WorldWideScience

Sample records for 23s ribosomal rna

  1. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  2. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  3. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  4. Helix 69 of Escherichia coli 23S ribosomal RNA as a peptide nucleic acid target.

    Science.gov (United States)

    Kulik, Marta; Markowska-Zagrajek, Agnieszka; Wojciechowska, Monika; Grzela, Renata; Wituła, Tomasz; Trylska, Joanna

    2017-07-01

    A fragment of 23S ribosomal RNA (nucleotides 1906-1924 in E. coli), termed Helix 69, forms a hairpin that is essential for ribosome function. Helix 69 forms a conformationally flexible inter-subunit connection with helix 44 of 16S ribosomal RNA, and the nucleotide A1913 of Helix 69 influences decoding accuracy. Nucleotides U1911 and U1917 are post-transcriptionally modified with pseudouridines (Ψ) and U1915 with 3-methyl-Ψ. We investigated Helix 69 as a target for a complementary synthetic oligonucleotide - peptide nucleic acid (PNA). We determined thermodynamic properties of Helix 69 and its complexes with PNA and tested the performance of PNA targeted at Helix 69 in inhibiting translation in cell-free extracts and growth of E. coli cells. First, we examined the interactions of a PNA oligomer complementary to the G1907-A1919 fragment of Helix 69 with the sequences corresponding to human and bacterial species (with or without pseudouridine modifications). PNA invades the Helix 69 hairpin creating stable complexes and PNA binding to the pseudouridylated bacterial sequence is stronger than to Helix 69 without any modifications. Second, we confirmed the binding of PNA to 23S rRNA and 70S ribosomes. Third, we verified the efficiency of translation inhibition of these PNA oligomers in the cell-free translation/transcription E. coli system, which were in a similar range as tetracycline. Next, we confirmed that PNA conjugated to the (KFF)3K transporter peptide inhibited E. coli growth in micromolar concentrations. Overall, targeting Helix 69 with PNA or other sequence-specific oligomers could be a promising way to inhibit bacterial translation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  5. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  6. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  7. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    Science.gov (United States)

    Zweib, C; Dahlberg, A E

    1984-09-25

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33.

  8. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  9. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function...

  10. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  11. Macrolides and lincomycin susceptibility of Mycoplasma hyorhinis and variable mutation of domain II and V in 23S ribosomal RNA.

    Science.gov (United States)

    Kobayashi, Hideki; Nakajima, Hiromi; Shimizu, Yuka; Eguchi, Masashi; Hata, Eiji; Yamamoto, Koshi

    2005-08-01

    A total of 151 strains of Mycoplasma hyorhinis isolated from porcine lung lesions (weaned pigs, n=71, and finishers, n=80) were investigated for their in vitro susceptibility to 10 antimicrobial agents. Thirty-one strains (28 from weaned pigs and 3 from finishers) showed resistance to 16-membered macrolide antibiotics and lincomycin. The prevalence of the 16-membered macrolide-resistant M. hyorhinis strain in weaned pigs from Japanese herds has approximately quadrupled in the past 10 years. Several of the 31 strains were examined for mutations in the 23S ribosomal RNA (rRNA). All field strains tested showed a transition of A to G at position 2059 of 23S rRNA-rendered Escherichia coli. On the other hand, individual tylosin- and lincomycin-resistant mutants of M. hyorhinis were selected in vitro from the susceptible type strain BTS7 by 3 to 9 serial passages in subinhibitory concentrations of each antibiotic. The 23S rRNA sequences of both tylosin and lincomycin-resistant mutants were compared with that of the radical BTS7 strain. The BTS7 mutant strain selected by tylosin showed the same transition as the field-isolated strains of A2059G. However, the transition selected in lincomycin showed mutations in domains II and V of 23S rRNA, G2597U, C2611U in domain V, and the addition of an adenine at the pentameric adenine loop in domain II. The strain selected by lincomycin showed an additional point mutation of A2062G selected by tylosin.

  12. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  13. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed......The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally...... in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...

  14. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.

    Science.gov (United States)

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-10-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  15. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  16. Mutations at three sites in the Escherichia coli 23S ribosomal RNA binding region for protein L11 cause UGA-specific suppression and conditional lethality.

    Science.gov (United States)

    Murgola, E J; Xu, W; Arkov, A L

    1995-01-01

    A single nucleotide change, G to A, at nucleotide position 1093 of E. coli 23S ribosomal RNA was found to cause UGA-specific suppression (D.K. Jemiolo, F.T. Pagel and E.J. Murgola, Proc. Natl. Acad. Sci. USA, in press). To obtain new kinds of UGA-specific suppressors in 23S rRNA, we used segment-directed mutagenic PCR, and targeted first the 1405 nucleotide SnaBI/I-CeuI segment, which includes position 1093, of the rrnB operon cloned into a multicopy plasmid. The mutagenized fragments were subcloned into the plasmid vector and used to transform to ampicillin resistance (Ampr) a recipient strain containing a UGA mutation in trpA. The Ampr transformants were then screened for suppression of UGA. After purification, Trp+ transformants were tested for association of the suppressor phenotype first with the plasmid and then specifically with the SnaBI/I-CeuI fragment. In one screening, four different kinds of mutational change were found, all at three sites within a highly conserved hexanucleotide loop in domain II of 23S rRNA. This region is part of the site for binding of the large subunit protein L11, which has been shown to be involved in peptide chain termination in a specific way. All of the mutants (G1093A, G1093 delta, A1095 delta, and U1097 delta) suppress UGA mutations, but not UAA or UAG mutations, and all four types exhibit high-temperature conditional lethality when highly expressed. Several mechanisms can be suggested for the UGA-specific suppression exhibited by these mutants, including altered interaction with protein L11, Second-site mutations that overcome the conditional lethality of G1093A indicate that intramolecular interactions within 23S rRNA may play a role in peptide chain termination at the UGA stop codon.

  17. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-Ac-Phe-tRNA were derivatized at the 2 position with an azido group and the tRNAs were cross-linked to the ribosome on irradiation with ultraviolet light at 365 nm. The cross-links were localized on the rRNA within extended versions of three previously characterized 23S rRNA fragments F1', F2', and F4......' at nucleotides C2601/A2602, U2584/U2585 (F1'), U2506 (F2'), and A2062/C2063 (F4'). Each of these nucleotides lies within the peptidyl transferase loop region of the 23S rRNA. Cross-links were also formed with ribosomal proteins L27 (strong) and L33 (weak), as shown earlier. The antibiotics sparsomycin...

  18. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  19. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...... within the peptidyl transferase loop region of 23S-like rRNA by using a combination of a primer extension approach, RNase H fragment analysis, and crosslinking with radioactive [(125)I]phenol-alanine-sparsomycin. Crosslinking of several sparsomycin derivatives, modified near the sulfoxy group, implicated...

  20. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S R; Liljas, A

    1990-01-01

    Ribonuclease and chemical probes were used to investigate the binding sites of ribosomal protein L11 and the pentameric complex L10.(L12)4 on Escherichia coli 23 S RNA. Protein complexes were formed with an RNA fragment constituting most of domains I and II or with 23 S RNA and they were...... investigated by an end-labelling method and a reverse transcriptase procedure, respectively. The results demonstrate that the two protein moieties bind at adjacent sites within a small RNA region. The L11 binding region overlaps with those of the modified peptide antibiotics thiostrepton and micrococcin...... data, were used in a computer graphics approach to build a partial RNA tertiary structural model. The model provides insight into the topography of the L11 binding site. It also provides a structural rationale for the mutually co-operative binding of protein L11 with the antibiotics thiostrepton...

  1. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1995-01-01

    The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and nume......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions...

  2. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...

  3. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...

  4. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  5. Interaction of tRNA with domain II of 23S rRNA.

    Science.gov (United States)

    Hill, W E; Tassanakajohn, A; Tapprich, W E

    1990-08-27

    The interaction of tRNA with domain II of 23S rRNA in E. coli ribosomes has been probed using short, complementary DNA oligodeoxyribonucleotides. Specifically, cDNA oligomers to the region 801-811 of the 23S rRNA were used to ascertain the interaction of this region with tRNA. It was found that when tRNA was bound to the P site, considerable competition occurred between tRNA and the cDNA oligomers which base paired with the nucleotides 807-811. However, A-site bound tRNA neither displaced, nor was displaced, by cDNA oligomers to this region. Additionally, the binding of tRNA lacking the CACCA nucleotides on the 3' terminus was unaffected by the presence a cDNA oligomer complementary to nucleotides 803-811, indicating that the cDNA-tRNA competition was dependent on the 3' terminal nucleotides of tRNA.

  6. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  7. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  8. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  9. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  10. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.

    Science.gov (United States)

    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J

    2001-07-01

    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  11. Sites of interaction of the CCA end of peptidyl-tRNA with 23S rRNA.

    Science.gov (United States)

    Moazed, D; Noller, H F

    1991-05-01

    Oligonucleotide fragments derived from the 3' CCA terminus of acylated tRNA, such as CACCA-(AcPhe), UACCA-(AcLeu), and CAACCA-(fMet), bind specifically to ribosomes in the presence of sparsomycin and methanol [Monro, R. E., Celma, M. L. & Vazquez, D. (1969) Nature (London) 222, 356-358]. All three oligonucleotides protect a characteristic set of bases in 23S rRNA from chemical probes: G2252, G2253, A2439, A2451, U2506, and U2585. A2602 shows enhanced reactivity. These account for most of the same bases that are protected when peptidyl-tRNA analogues such as AcPhe-tRNA are bound to the ribosomal P site, and correspond precisely to those bases whose protection is abolished by removal of the 3'-CA end of tRNA. We conclude that most of the observed interactions between tRNA and 23S rRNA in the 50S ribosomal P site involve the conserved CCA terminus of tRNA. Sparsomycin may inhibit protein synthesis by stabilizing interaction between the peptidyl-CCA and the 23S P site, preventing formation of the intermediate A/P hybrid state.

  12. Pseudouridylation of helix 69 of 23S rRNA is necessary for an effective translation termination

    DEFF Research Database (Denmark)

    Ejby, Morten; Sørensen, Michael A; Pedersen, Steen

    2007-01-01

    Escherichia coli strains with inactivated rluD genes were previously found to lack the conserved pseudouridines in helix 69 of 23S ribosomal RNA and to grow slowly. A suppressor mutant was isolated with a near normal growth rate that had changed the conserved Glu-172 codon to a Lys codon in prfB,...

  13. [Ribosomal RNA Evolution

    Science.gov (United States)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  14. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    Science.gov (United States)

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  15. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  16. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...

  17. Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism

    OpenAIRE

    Kabadjova, Petia; Dousset, Xavier; Le Cam, Virginie; Prevost, Hervé

    2002-01-01

    A novel strategy for identification of Carnobacterium food isolates based on restriction fragment length polymorphism (RFLP) of PCR-amplified 16S-23S ribosomal intergenic spacer regions (ISRs) was developed. PCR amplification from all Carnobacterium strains studied always yielded three ISR amplicons, which were designated the small ISR (S-ISR), the medium ISR (M-ISR), and the large ISR (L-ISR). The lengths of these ISRs varied from one species to another. Carnobacterium divergens NCDO 2763T a...

  18. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  19. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    Science.gov (United States)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  20. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA.

    Science.gov (United States)

    Huang, L; Ku, J; Pookanjanatavip, M; Gu, X; Wang, D; Greene, P J; Santi, D V

    1998-11-10

    Several putative Escherichia coli pseudouridine (Psi) synthases have been identified by iterative searching of genomic databases for ORFs homologous to known Psi synthases [Gustafsson et al. (1996) Nucleic Acids Res. 24, 3756-3762]. Of these, yceC and yfiI were proposed to encode Psi synthases which modify 23S rRNA. In the present work, yceC and yfiI were cloned and overexpressed in E. coli, and the encoded enzymes, YceC and YfiI, were purified to homogeneity. Both proteins converted Urd residues of rRNA to Psi, thus confirming their identities as Psi synthases. However, in in vitro experiments both enzymes extensively modified Urd residues of both 23S rRNA and 16S rRNA. Gene-disruption of yceCresulted in the absence of Psi modification at positions U955, 2504, and 2580 of 23S RNA, thus identifying these sites as in vivo targets for YceC. Likewise, yfiI disruption resulted in the absence of Psi modification at positions U1911, 1917, and possibly 1915 of 23S RNA. Disruption of yceC did not affect the growth under the conditions tested, whereas yfiI-disrupted cells showed a dramatic decrease in growth rate. Since YceC and YfiI hypermodify RNA in vitro, factors in addition to ribonucleotide sequence must contribute to the in vivo specificity of these enzymes.

  1. Methylation of 23S rRNA caused by tlrA (ermSF), a tylosin resistance determinant from Streptomyces fradiae.

    Science.gov (United States)

    Zalacain, M; Cundliffe, E

    1989-01-01

    Ribosomes from Streptomyces griseofuscus expressing tlrA, a resistance gene isolated from the tylosin producer Streptomyces fradiae, are resistant to macrolide and lincosamide antibiotics in vitro. The tlrA product was found to be a methylase that introduces two methyl groups into a single base within 23S rRNA, generating N6,N6-dimethyladenine at position 2058. This activity is therefore similar to the ermE resistance mechanism in Saccharopolyspora erythraea (formerly Streptomyces erythraeus). Images PMID:2753855

  2. Precursors of ribosomal RNA in yeast nucleus : Biosynthesis and relation to cytoplasmic ribosomal RNA

    NARCIS (Netherlands)

    Sillevis Smitt, W.W.; Vlak, J.M.; Schiphof, R.; Rozijn, Th.H.

    In vivo methylated precursors of ribosomal RNA in yeast have been characterized on acrylamide gels. The initial ribosomal precursor in the yeast nucleus is a 37S RNA component, which is processed to a nuclear 28S RNA. Both the 37S and the 28S RNA components are important constituents of the yeast

  3. Mutational robustness of 16S ribosomal RNA, shown by experimental horizontal gene transfer in Escherichia coli

    OpenAIRE

    Kitahara, Kei; Yasutake, Yoshiaki; Miyazaki, Kentaro

    2012-01-01

    The bacterial ribosome consists of three rRNA molecules and 57 proteins and plays a crucial role in translating mRNA-encoded information into proteins. Because of the ribosome’s structural and mechanistic complexity, it is believed that each ribosomal component coevolves to maintain its function. Unlike 5S rRNA, 16S and 23S rRNAs appear to lack mutational robustness, because they form the structural core of the ribosome. However, using Escherichia coli Δ7 (null mutant of operons) as a host, w...

  4. Reconstitution of functional eukaryotic ribosomes from Dictyostelium discoideum ribosomal proteins and RNA.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S

    1997-08-08

    40 and 60 S ribosomal subunits have been reconstituted in vitro from purified ribosomal RNA and ribosomal proteins of Dictyostelium discoideum. The functionality of the reconstituted ribosomes was demonstrated in in vitro mRNA-directed protein synthesis. The reassembly proceeded well with immature precursors of ribosomal RNA but poorly if at all with mature cytoplasmic RNA species. Reassembly also required a preparation of small nuclear RNA(s), acting as morphopoietic factor(s).

  5. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... that also confer antibiotic resistance. Both the domain II deletion and the 2057A mutation relieve the hypersensitive effect of the 2032A mutation, producing an erythromycin-resistant phenotype; in addition, the combination of the 2032A and 2057A mutations confers a higher level of chloramphenicol...... and chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  6. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...

  7. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resis...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  8. Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

    Science.gov (United States)

    Lebars, Isabelle; Yoshizawa, Satoko; Stenholm, Anne R.; Guittet, Eric; Douthwaite, Stephen; Fourmy, Dominique

    2003-01-01

    The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem–loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G–A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase–RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly. PMID:12514124

  9. Ribosomal RNA pseudouridines and pseudouridine synthases.

    Science.gov (United States)

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  10. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  11. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  12. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    2016-05-01

    Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.

  13. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    Directory of Open Access Journals (Sweden)

    Schwartz Ira

    2011-01-01

    Full Text Available Abstract Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla; tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (pppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate.

  14. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    assigned to the donor substrate binding site and a possible base-pairing interaction between the 3'-terminal sequence of the peptidyl-tRNA and the sequence psi/U-G-G2582, that is conserved in all the non-mitochondrial 23 S-like rRNA sequences, is proposed. Three sites that have been implicated in aminoacyl-tRNA...

  15. Pentamidine inhibits Coxiella burnetii growth and 23S rRNA intron splicing in vitro.

    Science.gov (United States)

    Minnick, Michael F; Hicks, Linda D; Battisti, James M; Raghavan, Rahul

    2010-10-01

    Coxiella burnetii is the bacterial agent of Q fever in humans. Acute Q fever generally manifests as a flu-like illness and is typically self-resolving. In contrast, chronic Q fever usually presents with endocarditis and is often life-threatening without appropriate antimicrobial therapy. Unfortunately, available options for the successful treatment of chronic Q fever are both limited and protracted (>18 months). Pentamidine, an RNA splice inhibitor used to treat fungal and protozoal infections, was shown to reduce intracellular growth of Coxiella by ca. 73% at a concentration of 1 microM (ca. 0.6 microg/mL) compared with untreated controls, with no detectable toxic effects on host cells. Bacterial targets of pentamidine include Cbu.L1917 and Cbu.L1951, two group I introns that disrupt the 23S rRNA gene of Coxiella, as demonstrated by the drug's ability to inhibit intron RNA splicing in vitro. Since both introns are highly conserved amongst all eight genotypes of the pathogen, pentamidine is predicted to be efficacious against numerous strains of C. burnetii. To our knowledge, this is the first report describing antibacterial activity for this antifungal/antiprotozoal agent.

  16. Identification of a novel G2073A mutation in 23S rRNA in amphenicol-selected mutants of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Licai Ma

    Full Text Available OBJECTIVES: This study was conducted to examine the development and molecular mechanisms of amphenicol resistance in Campylobacter jejuni by using in vitro selection with chloramphenicol and florfenicol. The impact of the resistance development on growth rates was also determined using in vitro culture. METHODS: Chloramphenicol and florfenicol were used as selection agents to perform in vitro stepwise selection. Mutants resistant to the selective agents were obtained from the selection process. The mutant strains were compared with the parent strain for changes in MICs and growth rates. The 23S rRNA gene and the L4 and L22 ribosomal protein genes in the mutant strains and the parent strain were amplified and sequenced to identify potential resistance-associated mutations. RESULTS: C. jejuni strains that were highly resistant to chloramphenicol and florfenicol were obtained from in vitro selection. A novel G2073A mutation in all three copies of the 23S rRNA gene was identified in all the resistant mutants examined, which showed resistance to both chloramphenicol and florfenicol. In addition, all the mutants selected by chloramphenicol also exhibited the G74D modification in ribosomal protein L4, which was previously shown to confer a low-level erythromycin resistance in Campylobacter species. The mutants selected by florfenicol did not have the G74D mutation in L4. Notably, the amphenicol-resistant mutants also exhibited reduced susceptibility to erythromycin, suggesting that the selection resulted in cross resistance to macrolides. CONCLUSIONS: This study identifies a novel point mutation (G2073A in 23S rRNA in amphenicol-selected mutants of C. jejuni. Development of amphenicol resistance in Campylobacter likely incurs a fitness cost as the mutant strains showed slower growth rates in antibiotic-free media.

  17. Intrinsic and selected resistance to antibiotics binding the ribosome: analyses of Brucella 23S rrn, L4, L22, EF-Tu1, EF-Tu2, efflux and phylogenetic implications

    Directory of Open Access Journals (Sweden)

    Jensen Allen E

    2006-10-01

    Full Text Available Abstract Background Brucella spp. are highly similar, having identical 16S RNA. However, they have important phenotypic differences such as differential susceptibility to antibiotics binding the ribosome. Neither the differential susceptibility nor its basis has been rigorously studied. Differences found among other conserved ribosomal loci could further define the relationships among the classical Brucella spp. Results Minimum inhibitory concentration (MIC values of Brucella reference strains and three marine isolates to antibiotics binding the ribosome ranged from 0.032 to >256 μg/ml for the macrolides erythromycin, clarithromycin, and azithromycin and 2 to >256 μg/ml for the lincosamide, clindamycin. Though sequence polymorphisms were identified among ribosome associated loci 23S rrn, rplV, tuf-1 and tuf-2 but not rplD, they did not correlate with antibiotic resistance phenotypes. When spontaneous erythromycin resistant (eryR mutants were examined, mutation of the peptidyl transferase center (A2058G Ec correlated with increased resistance to both erythromycin and clindamycin. Brucella efflux was examined as an alternative antibiotic resistance mechanism by use of the inhibitor L-phenylalanine-L-arginine β-naphthylamide (PAβN. Erythromycin MIC values of reference and all eryR strains, except the B. suis eryR mutants, were lowered variably by PAβN. A phylogenetic tree based on concatenated ribosomal associated loci supported separate evolutionary paths for B. abortus, B. melitensis, and B. suis/B. canis, clustering marine Brucella and B. neotomae with B. melitensis. Though Brucella ovis was clustered with B. abortus, the bootstrap value was low. Conclusion Polymorphisms among ribosomal loci from the reference Brucella do not correlate with their highly differential susceptibility to erythromycin. Efflux plays an important role in Brucella sensitivity to erythromycin. Polymorphisms identified among ribosome associated loci construct a

  18. Reverse Translocation of tRNA in the Ribosome

    OpenAIRE

    2006-01-01

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes ...

  19. A detailed view of a ribosomal active site: the structure of the L11-RNA complex.

    Science.gov (United States)

    Wimberly, B T; Guymon, R; McCutcheon, J P; White, S W; Ramakrishnan, V

    1999-05-14

    We report the crystal structure of a 58 nucleotide fragment of 23S ribosomal RNA bound to ribosomal protein L11. This highly conserved ribonucleoprotein domain is the target for the thiostrepton family of antibiotics that disrupt elongation factor function. The highly compact RNA has both familiar and novel structural motifs. While the C-terminal domain of L11 binds RNA tightly, the N-terminal domain makes only limited contacts with RNA and is proposed to function as a switch that reversibly associates with an adjacent region of RNA. The sites of mutations conferring resistance to thiostrepton and micrococcin line a narrow cleft between the RNA and the N-terminal domain. These antibiotics are proposed to bind in this cleft, locking the putative switch and interfering with the function of elongation factors.

  20. Elucidation of pathways of ribosomal RNA degradation: an essential role for RNase E

    Science.gov (United States)

    Sulthana, Shaheen; Basturea, Georgeta N.; Deutscher, Murray P.

    2016-01-01

    Although normally stable in growing cells, ribosomal RNAs are degraded under conditions of stress, such as starvation, and in response to misassembled or otherwise defective ribosomes in a process termed RNA quality control. Previously, our laboratory found that large fragments of 16S and 23S rRNA accumulate in strains lacking the processive exoribonucleases RNase II, RNase R, and PNPase, implicating these enzymes in the later steps of rRNA breakdown. Here, we define the pathways of rRNA degradation in the quality control process and during starvation, and show that the essential endoribonuclease, RNase E, is required to make the initial cleavages in both degradative processes. We also present evidence that explains why the exoribonuclease, RNase PH, is required to initiate the degradation of rRNA during starvation. The data presented here provide the first detailed description of rRNA degradation in bacterial cells. PMID:27298395

  1. A plasmid-coded and site-directed mutation in Escherichia coli 23S RNA that confers resistance to erythromycin

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1987-01-01

    Primer-directed mutagenesis was employed to introduce an A2058----G transition in plasmid-encoded Escherichia coli 23S RNA at a site that has been implicated, indirectly, in erythromycin binding. The mutation raises the growth tolerance of cells from 30 to 300 micrograms/ml of erythromycin, and c...

  2. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Science.gov (United States)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  3. Higher order structure in ribosomal RNA.

    Science.gov (United States)

    Gutell, R R; Noller, H F; Woese, C R

    1986-05-01

    The only reliable general method currently available for determining precise higher order structure in the large ribosomal RNAs is comparative sequence analysis. The method is here applied to reveal 'tertiary' structure in the 16S-like rRNAs, i.e. structure more complex than simple double-helical, secondary structure. From a list of computer-generated potential higher order interactions within 16S rRNA one such interaction considered likely was selected for experimental test. The putative interaction involves a Watson-Crick one to one correspondence between positions 570 and 866 in the molecule (E. coli numbering). Using existing oligonucleotide catalog information several organisms were selected whose 16S rRNA sequences might test the proposed co-variation. In all of the (phylogenetically independent) cases selected, full sequence evidence confirms the predicted one to one (Watson-Crick) correspondence. An interaction between positions 570 and 866 is, therefore, considered proven phylogenetically.

  4. Structural features of the tmRNA-ribosome interaction.

    Science.gov (United States)

    Bugaeva, Elizaveta Y; Surkov, Serhiy; Golovin, Andrey V; Ofverstedt, Lars-Göran; Skoglund, Ulf; Isaksson, Leif A; Bogdanov, Alexey A; Shpanchenko, Olga V; Dontsova, Olga A

    2009-12-01

    Trans-translation is a process which switches the synthesis of a polypeptide chain encoded by a nonstop messenger RNA to the mRNA-like domain of a transfer-messenger RNA (tmRNA). It is used in bacterial cells for rescuing the ribosomes arrested during translation of damaged mRNA and directing this mRNA and the product polypeptide for degradation. The molecular basis of this process is not well understood. Earlier, we developed an approach that allowed isolation of tmRNA-ribosomal complexes arrested at a desired step of tmRNA passage through the ribosome. We have here exploited it to examine the tmRNA structure using chemical probing and cryo-electron microscopy tomography. Computer modeling has been used to develop a model for spatial organization of the tmRNA inside the ribosome at different stages of trans-translation.

  5. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    Science.gov (United States)

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  6. Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA

    Science.gov (United States)

    Ivanova, Natalia; Pavlov, Michael Y.; Bouakaz, Elli; Ehrenberg, Måns; Schiavone, Lovisa Holmberg

    2005-01-01

    In trans-translation transfer messenger RNA (tmRNA) and small protein B (SmpB) rescue ribosomes stalled on truncated or in other ways problematic mRNAs. SmpB promotes the binding of tmRNA to the ribosome but there is uncertainty about the number of participating SmpB molecules as well as their ribosomal location. Here, the interaction of SmpB with ribosomal subunits and ribosomes was studied by isolation of SmpB containing complexes followed by chemical modification of ribosomal RNA with dimethyl sulfate, kethoxal and hydroxyl radicals. The results show that SmpB binds 30S and 50S subunits with 1:1 molar ratios and the 70S ribosome with 2:1 molar ratio. SmpB-footprints are similar on subunits and the ribosome. In the 30S subunit, SmpB footprints nucleotides that are in the vicinity of the P-site facing the E-site, and in the 50S subunit SmpB footprints nucleotides that are located below the L7/L12 stalk in the 3D structure of the ribosome. Based on these results, we suggest a mechanism where two molecules of SmpB interact with tmRNA and the ribosome during trans-translation. The first SmpB molecule binds near the factor-binding site on the 50S subunit helping tmRNA accommodation on the ribosome, whereas the second SmpB molecule may functionally substitute for a missing anticodon stem–loop in tmRNA during later steps of trans-translation. PMID:15972795

  7. The Expression of Antibiotic Resistance Methyltransferase Correlates with mRNA Stability Independently of Ribosome Stalling.

    Science.gov (United States)

    Dzyubak, Ekaterina; Yap, M N

    2016-12-01

    Members of the Erm methyltransferase family modify 23S rRNA of the bacterial ribosome and render cross-resistance to macrolides and multiple distantly related antibiotics. Previous studies have shown that the expression of erm is activated when a macrolide-bound ribosome stalls the translation of the leader peptide preceding the cotranscribed erm Ribosome stalling is thought to destabilize the inhibitory stem-loop mRNA structure and exposes the erm Shine-Dalgarno (SD) sequence for translational initiation. Paradoxically, mutations that abolish ribosome stalling are routinely found in hyper-resistant clinical isolates; however, the significance of the stalling-dead leader sequence is largely unknown. Here, we show that nonsense mutations in the Staphylococcus aureus ErmB leader peptide (ErmBL) lead to high basal and induced expression of downstream ErmB in the absence or presence of macrolide concomitantly with elevated ribosome methylation and resistance. The overexpression of ErmB is associated with the reduced turnover of the ermBL-ermB transcript, and the macrolide appears to mitigate mRNA cleavage at a site immediately downstream of the ermBL SD sequence. The stabilizing effect of antibiotics on mRNA is not limited to ermBL-ermB; cationic antibiotics representing a ribosome-stalling inducer and a noninducer increase the half-life of specific transcripts. These data unveil a new layer of ermB regulation and imply that ErmBL translation or ribosome stalling serves as a "tuner" to suppress aberrant production of ErmB because methylated ribosome may impose a fitness cost on the bacterium as a result of misregulated translation.

  8. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  9. Identification of Carnobacterium Species by Restriction Fragment Length Polymorphism of the 16S-23S rRNA Gene Intergenic Spacer Region and Species-Specific PCR

    OpenAIRE

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-01-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in ord...

  10. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  11. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  12. Sequence Analysis and Comparison of 16S rRNA, 23S rRNA and 16S/23S Intergenic Spacer Region of Greening Bacterium Associated with Yellowing Disease (Huanglongbing) of Kinnow Mandarin.

    Science.gov (United States)

    Gupta, K N; Baranwal, V K; Haq, Q M R

    2012-03-01

    High incidence (up to 40%) of symptoms of yellowing and yellow mottling was observed in 5-8 years old orchards of kinnow mandarin {Citrus reticulate Balanco ('King' × 'Willow mandarin')} in the Punjab state of India during a survey in January 2007. These symptoms are often confused with nutrient deficiency and other stress related disorders. However, a greening bacterium has been attributed to cause the disease. The disease was graft transmissible and sequencing of 16S rRNA, 16S/23S intergenic spacer region and 23S rRNA of the greening bacterium associated with yellowing disease in kinnow mandarin confirmed it to be Candidatus Liberibacter asiaticus ('Ca L. asiaticus') showing maximum identity of 95.9% with 'Ca L. asiaticus' from USA and Brazil in 16S rRNA. The study indicates definite association of 'Ca L. asiaticus' with yellowing/chlorotic mottling symptoms of greening disease of kinnow mandarin in Punjab state of India.

  13. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  14. RNA tertiary interactions in the large ribosomal subunit: The A-minor motif

    Energy Technology Data Exchange (ETDEWEB)

    Nissen, Poul; Ippolito, Joseph A.; Ban, Nenad; Moore, Peter B.; Steitz, Thomas A. (Yale University); (Yale University); (Yale Unversity)

    2009-10-07

    Analysis of the 2.4-{angstrom} resolution crystal structure of the large ribosomal subunit from Haloarcula marismortui reveals the existence of an abundant and ubiquitous structural motif that stabilizes RNA tertiary and quaternary structures. This motif is termed the A-minor motif, because it involves the insertion of the smooth, minor groove edges of adenines into the minor groove of neighboring helices, preferentially at C-G base pairs, where they form hydrogen bonds with one or both of the 2' OHs of those pairs. A-minor motifs stabilize contacts between RNA helices, interactions between loops and helices, and the conformations of junctions and tight turns. The interactions between the 3' terminal adenine of tRNAs bound in either the A site or the P site with 23S rRNA are examples of functionally significant A-minor interactions. The A-minor motif is by far the most abundant tertiary structure interaction in the large ribosomal subunit; 186 adenines in 23S and 5S rRNA participate, 68 of which are conserved. It may prove to be the universally most important long-range interaction in large RNA structures.

  15. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  16. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Institute of Scientific and Technical Information of China (English)

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  17. Sequence variation of the 16S to 23S rRNA spacer region in Salmonella enterica.

    Science.gov (United States)

    Christensen, H; Møller, P L; Vogensen, F K; Olsen, J E

    2000-01-01

    The possibility for identification of Salmonella enterica serotypes by sequence analysis of the 16S to 23S rRNA internal transcribed spacer was investigated by direct sequencing of polymerase chain reaction-amplified DNA from all operons simultaneously in a collection of 25 strains of 18 different serotypes of S. enterica, and by sequencing individual cloned operons from a single strain. It was only possible to determine the first 117 bases upstream from the 23S rRNA gene by direct sequencing because of variation between the rrn operons. Comparison of sequences from this region allowed separation of only 15 out of the 18 serotypes investigated and was not specific even at the subspecies level of S. enterica. To determine the differences between internal transcribed spacers in more detail, the individual rrn operons of strain JEO 197, serotype IV 43:z4,z23:-, were cloned and sequenced. The strain contained four short internal transcribed spacer fragments of 382-384 bases in length, which were 98.4-99.7% similar to each other and three long fragments of 505 bases with 98.0-99.8% similarity. The study demonstrated a higher degree of interbacterial variation than intrabacterial variation between operons for serotypes of S. enterica.

  18. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  19. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly

    Directory of Open Access Journals (Sweden)

    Oliver Rackham

    2016-08-01

    Full Text Available The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE and RNA-seq enabled us to identify that in vivo 5′ tRNA cleavage precedes 3′ tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome.

  20. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  1. Resistance to the macrolide antibiotic tylosin is conferred by single methylations at 23S rRNA nucleotides G748 and A2058 acting in synergy

    Science.gov (United States)

    Liu, Mingfu; Douthwaite, Stephen

    2002-01-01

    The macrolide antibiotic tylosin has been used extensively in veterinary medicine and exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin-synthesizing strains of the Gram-positive bacterium Streptomyces fradiae protect themselves from their own product by differential expression of four resistance determinants, tlrA, tlrB, tlrC, and tlrD. The tlrB and tlrD genes encode methyltransferases that add single methyl groups at 23S rRNA nucleotides G748 and A2058, respectively. Here we show that methylation by neither TlrB nor TlrD is sufficient on its own to give tylosin resistance, and resistance is conferred by the G748 and A2058 methylations acting together in synergy. This synergistic mechanism of resistance is specific for the macrolides tylosin and mycinamycin that possess sugars extending from the 5- and 14-positions of the macrolactone ring and is not observed for macrolides, such as carbomycin, spiramycin, and erythromycin, that have different constellations of sugars. The manner in which the G748 and A2058 methylations coincide with the glycosylation patterns of tylosin and mycinamycin reflects unambiguously how these macrolides fit into their binding site within the bacterial 50S ribosomal subunit. PMID:12417742

  2. Analysis of the 16S-23S rRNA gene internal transcribed spacer region in Klebsiella species.

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-11-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types-ITS(none) (without tRNA genes), ITS(glu) [with a tRNA(Glu (UUC)) gene], and ITS(ile+ala) [with tRNA(Ile (GAU)) and tRNA(Ala (UGC)) genes]-were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITS(glu) and ITS(ile+ala). The presence of ITS(none) in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITS(none), from 0.967 to 1.000 for ITS(glu), and from 0.968 to 1.000 for ITS(ile+ala). Interspecies sequence identities range from 0.775 to 0.989 for ITS(none), from 0.798 to 0.997 for ITS(glu), and from 0.712 to 0.985 for ITS(ile+ala). Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes.

  3. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...... of this region to the chemical reagents. The data indicate that a less-exposed conformation at A2058 leads to reduction in methylation by ErmE. Nucleotide G2057 and its interaction with C2611 maintain the conformation at A2058, and are thus important in forming the structural motif that is recognized by the Erm...

  4. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    Directory of Open Access Journals (Sweden)

    Trebesius Karlheinz

    2010-03-01

    Full Text Available Abstract Background Francisella (F. tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples.

  5. mRNA pseudoknot structures can act as ribosomal roadblocks

    DEFF Research Database (Denmark)

    Hansen, Jesper Tholstrup; Oddershede, Lene Broeng; Sørensen, Michael Askvad

    2012-01-01

    Several viruses utilize programmed ribosomal frameshifting mediated by mRNA pseudoknots in combination with a slippery sequence to produce a well defined stochiometric ratio of the upstream encoded to the downstream-encoded protein. A correlation between the mechanical strength of mRNA pseudoknot...

  6. A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

    Science.gov (United States)

    Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

    2016-11-17

    Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification...

  8. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  9. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  10. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  11. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  12. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  13. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  14. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  15. Polyadenylation of ribosomal RNA in human cells

    OpenAIRE

    Slomovic, Shimyn; Laufer, David; Geiger, Dan; Schuster, Gadi

    2006-01-01

    The addition of poly(A)-tails to RNA is a process common to almost all organisms. In eukaryotes, stable poly(A)-tails, important for mRNA stability and translation initiation, are added to the 3′ ends of most nuclear-encoded mRNAs, but not to rRNAs. Contrarily, in prokaryotes and organelles, polyadenylation stimulates RNA degradation. Recently, polyadenylation of nuclear-encoded transcripts in yeast was reported to promote RNA degradation, demonstrating that polyadenylation can play a double-...

  16. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    Science.gov (United States)

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species.

  17. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  18. Clinical and Microbiological Aspects of Linezolid Resistance Mediated by the cfr Gene Encoding a 23S rRNA Methyltransferase▿

    Science.gov (United States)

    Arias, Cesar A.; Vallejo, Martha; Reyes, Jinnethe; Panesso, Diana; Moreno, Jaime; Castañeda, Elizabeth; Villegas, Maria V.; Murray, Barbara E.; Quinn, John P.

    2008-01-01

    The cfr (chloramphenicol-florfenicol resistance) gene encodes a 23S rRNA methyltransferase that confers resistance to linezolid. Detection of linezolid resistance was evaluated in the first cfr-carrying human hospital isolate of linezolid and methicillin-resistant Staphylococcus aureus (designated MRSA CM-05) by dilution and diffusion methods (including Etest). The presence of cfr was investigated in isolates of staphylococci colonizing the patient's household contacts and clinical isolates recovered from patients in the same unit where MRSA CM-05 was isolated. Additionally, 68 chloramphenicol-resistant Colombian MRSA isolates recovered from hospitals between 2001 and 2004 were screened for the presence of the cfr gene. In addition to erm(B), the erm(A) gene was also detected in CM-05. The isolate belonged to sequence type 5 and carried staphylococcal chromosomal cassette mec type I. We were unable to detect the cfr gene in any of the human staphylococci screened (either clinical or colonizing isolates). Agar and broth dilution methods detected linezolid resistance in CM-05. However, the Etest and disk diffusion methods failed to detect resistance after 24 h of incubation. Oxazolidinone resistance mediated by the cfr gene is rare, and acquisition by a human isolate appears to be a recent event in Colombia. The detection of cfr-mediated linezolid resistance might be compromised by the use of the disk diffusion or Etest method. PMID:18174304

  19. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    Energy Technology Data Exchange (ETDEWEB)

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  20. The European database on small subunit ribosomal RNA

    OpenAIRE

    Wuyts, Jan; Van de Peer, Yves; Winkelmans, Tina; De Wachter, Rupert

    2002-01-01

    The European database on SSU rRNA can be consulted via the World WideWeb at http://rrna.uia.ac.be/ssu/ and compiles all complete or nearly complete small subunit ribosomal RNA sequences. Sequences are provided in aligned format. The alignment takes into account the secondary structure information derived by comparative sequence analysis of thousands of sequences. Additional information such as literature references, taxonomy, secondary structure models and nucleotide variability maps, is also...

  1. RNA polymerase and the ribosome: the close relationship.

    Science.gov (United States)

    McGary, Katelyn; Nudler, Evgeny

    2013-04-01

    In bacteria transcription and translation are linked in time and space. When coupled to RNA polymerase (RNAP), the translating ribosome ensures transcriptional processivity by preventing RNAP backtracking. Recent advances in the field have characterized important linker proteins that bridge the gap between transcription and translation: In particular, the NusE(S10):NusG complex and the NusG homolog, RfaH. The direct link between the moving ribosome and RNAP provides a basis for maintaining genomic integrity while enabling efficient transcription and timely translation of various genes within the bacterial cell. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Serotyping, ribotyping, PCR-mediated ribosomal 16S-23S spacer analysis and arbitrarily primed PCR for epidemiological studies on Legionella pneumophila

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); H. Maas (Hugo); H.A. Verbrugh (Henri); N. van Leeuwen (N.)

    1996-01-01

    textabstractFifty clinical and environmental isolates of Legionella pneumophila were typed serologically and by DNA fingerprinting using arbitrarily primed polymerase chain reaction (AP-PCR). Furthermore, variability in and around ribosomal operons was assessed by conventional ribotyping and

  3. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    DEFF Research Database (Denmark)

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen

    2008-01-01

    of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...

  4. Differentiation of non-pylori Helicobacter species based on PCR-restriction fragment length polymorphism of the 23S rRNA gene.

    Science.gov (United States)

    Yadegar, Abbas; Alebouyeh, Masoud; Lawson, Andy J; Mirzaei, Tabassom; Nazemalhosseini Mojarad, Ehsan; Zali, Mohammad Reza

    2014-06-01

    Phenotypic identification of non-pylori Helicobacter species has always been problematic and time-consuming in comparison with many other bacteria. We developed a rapid two-step identification assay based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 23S rRNA gene for differentiating between non-pylori Helicobacter species. A new genus-specific primer pair based on all available complete and partial 23S rRNA sequences of Helicobacter species was designed. In silico restriction analysis of variable regions of the 23S rRNA gene suggested SmaI and HindIII endonucleases would provide a good level of differentiation. Analysis of the obtained 23S rRNA RFLP patterns divided all Helicobacter study strains into three species groups (groups A-C) and 12 unique restriction patterns. Wolinella succinogenes also gave a unique pattern. Our proposed PCR-RFLP method was found to be as a valuable tool for routine identification of non-pylori Helicobacter species from human or animal samples.

  5. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Douthwaite, S

    1994-01-01

    The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  6. Antibiotic resistance evolved via inactivation of a ribosomal RNA methylating enzyme

    Science.gov (United States)

    Stojković, Vanja; Noda-Garcia, Lianet; Tawfik, Dan S.; Fujimori, Danica Galonić

    2016-01-01

    Modifications of the bacterial ribosome regulate the function of the ribosome and modulate its susceptibility to antibiotics. By modifying a highly conserved adenosine A2503 in 23S rRNA, methylating enzyme Cfr confers resistance to a range of ribosome-targeting antibiotics. The same adenosine is also methylated by RlmN, an enzyme widely distributed among bacteria. While RlmN modifies C2, Cfr modifies the C8 position of A2503. Shared nucleotide substrate and phylogenetic relationship between RlmN and Cfr prompted us to investigate evolutionary origin of antibiotic resistance in this enzyme family. Using directed evolution of RlmN under antibiotic selection, we obtained RlmN variants that mediate low-level resistance. Surprisingly, these variants confer resistance not through the Cfr-like C8 methylation, but via inhibition of the endogenous RlmN C2 methylation of A2503. Detection of RlmN inactivating mutations in clinical resistance isolates suggests that the mechanism used by the in vitro evolved variants is also relevant in a clinical setting. Additionally, as indicated by a phylogenetic analysis, it appears that Cfr did not diverge from the RlmN family but from another distinct family of predicted radical SAM methylating enzymes whose function remains unknown. PMID:27496281

  7. c-Myc co-ordinates mRNA cap methylation and ribosomal RNA production.

    Science.gov (United States)

    Dunn, Sianadh; Lombardi, Olivia; Cowling, Victoria H

    2017-02-01

    The mRNA cap is a structure added to RNA pol II transcripts in eukaryotes, which recruits factors involved in RNA processing, nuclear export and translation initiation. RNA guanine-7 methyltransferase (RNMT)-RNA-activating miniprotein (RAM), the mRNA cap methyltransferase complex, completes the basic functional mRNA cap structure, cap 0, by methylating the cap guanosine. Here, we report that RNMT-RAM co-ordinates mRNA processing with ribosome production. Suppression of RNMT-RAM reduces synthesis of the 45S ribosomal RNA (rRNA) precursor. RNMT-RAM is required for c-Myc expression, a major regulator of RNA pol I, which synthesises 45S rRNA. Constitutive expression of c-Myc restores rRNA synthesis when RNMT-RAM is suppressed, indicating that RNMT-RAM controls rRNA production predominantly by controlling c-Myc expression. We report that RNMT-RAM is recruited to the ribosomal DNA locus, which may contribute to rRNA synthesis in certain contexts. © 2017 The Author(s).

  8. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    Science.gov (United States)

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  9. Serotyping, ribotyping, PCR-mediated ribosomal 16S-23S spacer analysis and arbitrarily primed PCR for epidemiological studies on Legionella pneumophila

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); H. Maas (Hugo); H.A. Verbrugh (Henri); N. van Leeuwen (N.)

    1996-01-01

    textabstractFifty clinical and environmental isolates of Legionella pneumophila were typed serologically and by DNA fingerprinting using arbitrarily primed polymerase chain reaction (AP-PCR). Furthermore, variability in and around ribosomal operons was assessed by conventional ribotyping and PCR-med

  10. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    Science.gov (United States)

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  11. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    Science.gov (United States)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.

    1991-01-01

    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  12. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    in the latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop...... the functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift...... that was excised from the mature rRNA using RNAse H. In contrast, no antibiotic-induced effects were observed on in vitro T7 transcripts of full-length 23S rRNA, domain V, or on a fragment extending from positions approximately 2496-2566, which indicates that one or more posttranscriptional modifications within...

  13. Depletion of Ribosomal RNA Sequences from Single-Cell RNA-Sequencing Library.

    Science.gov (United States)

    Fang, Nan; Akinci-Tolun, Rumeysa

    2016-07-01

    Recent advances in single-cell RNA sequencing technologies have revealed high heterogeneity of gene expression profiles in individual cells. However, most current single-cell RNA-seq methods use oligo-dT priming in the reverse transcription steps and detect only polyA-positive for more accuracy, since there are also polyA-positive non-coding RNAs transcripts, not other important RNA species, such as polyA-negative noncoding RNA. Reverse transcription using random oligos enables detection of not only the noncoding RNA species without polyA tails, but also ribosomal RNA (rRNA). rRNA comprises more than 90% of the total RNA and should be depleted from the RNA-seq library to ensure efficient usage of the sequencing capacity. Commonly used hybridization-based rRNA depletion methods can preserve noncoding RNA in the standard RNA-seq library. However, such rRNA depletion methods require high input amounts of total RNA and do not work at the single-cell level or with limited input DNA. This unit describes a novel procedure for RNA-seq library construction from single cells or a minimal amount of RNA. A thermostable duplex-specific nuclease is used in this method to effectively remove ribosomal RNA sequences following whole-transcriptome amplification and sequencing library construction. © 2016 by John Wiley & Sons, Inc.

  14. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  15. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S

    2000-01-01

    Oxazolidinone antibiotics inhibit bacterial protein synthesis by interacting with the large ribosomal subunit. The structure and exact location of the oxazolidinone binding site remain obscure, as does the manner in which these drugs inhibit translation. To investigate the drug-ribosome interaction...... in the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized resistance...

  16. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan - Iran.

    Science.gov (United States)

    Khademi, Farzad; Faghri, Jamshid; Moghim, Sharareh; Esfahani, Bahram Nasr; Fazeli, Hossein; Poursina, Farkhondeh; Adibi, Peyman; Madhi, Masoumeh; Safaei, Hajieh Ghasemian

    2014-01-01

    Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C).

  17. Traffic of interacting ribosomes on mRNA during protein synthesis: effects of chemo-mechanics of individual ribosomes

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many {\\it ribosomes} simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. In contrast to the earlier models, here {\\it we develope a ``unified'' theoretical model} that not only incorporates the {\\it mutual exclusions} of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze the rates of protein synthesis and the spatio-temporal oraganization of the ribosomes in this model. We also predict how these properties would change with the changes in the rates of the various chemo-mechanical processes in each ribosome. Finally, we illustrate the power of this model by making experimentally testable predictions on the rates of protein synthesis and the density profiles of the ribosomes on some mRNAs in {\\it E-coli}.

  18. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  19. Rapid assay of A2058T-mutated 23S rRNA allelic profiles associated with high-level macrolide resistance in Moraxella catarrhalis.

    Science.gov (United States)

    Saito, Ryoichi; Kasai, Ayako; Ogihara, Shinji; Yamada, Kageto; Tao, Kazuyuki

    2015-09-01

    We report on a restriction fragment-length polymorphism (HpyCH4III) assay for profile analysis of 23S rRNA gene A2058T-mutated alleles associated with high-level macrolide resistance in Moraxella catarrhalis. Our assay results were supported by DNA sequencing analysis, allowed for simultaneous testing of many strains, and produced results from pure-cultured colonies within 4 h.

  20. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  1. The conserved endoribonuclease YbeY is required for chloroplast ribosomal RNA processing in Arabidopsis.

    Science.gov (United States)

    Liu, Jinwen; Zhou, Wenbin; Liu, Guifeng; Yang, Chuanping; Sun, Yi; Wu, Wenjuan; Cao, Shenquan; Wang, Chong; Hai, Guanghui; Wang, Zhifeng; Bock, Ralph; Huang, Jirong; Cheng, Yuxiang

    2015-05-01

    Maturation of chloroplast ribosomal RNAs (rRNAs) comprises several endoribonucleolytic and exoribonucleolytic processing steps. However, little is known about the specific enzymes involved and the cleavage steps they catalyze. Here, we report the functional characterization of the single Arabidopsis (Arabidopsis thaliana) gene encoding a putative YbeY endoribonuclease. AtYbeY null mutants are seedling lethal, indicating that AtYbeY function is essential for plant growth. Knockdown plants display slow growth and show pale-green leaves. Physiological and ultrastructural analyses of atybeY mutants revealed impaired photosynthesis and defective chloroplast development. Fluorescent microcopy analysis showed that, when fused with the green fluorescence protein, AtYbeY is localized in chloroplasts. Immunoblot and RNA gel-blot assays revealed that the levels of chloroplast-encoded subunits of photosynthetic complexes are reduced in atybeY mutants, but the corresponding transcripts accumulate normally. In addition, atybeY mutants display defective maturation of both the 5' and 3' ends of 16S, 23S, and 4.5S rRNAs as well as decreased accumulation of mature transcripts from the transfer RNA genes contained in the chloroplast rRNA operon. Consequently, mutant plants show a severe deficiency in ribosome biogenesis, which, in turn, results in impaired plastid translational activity. Furthermore, biochemical assays show that recombinant AtYbeY is able to cleave chloroplast rRNAs as well as messenger RNAs and transfer RNAs in vitro. Taken together, our findings indicate that AtYbeY is a chloroplast-localized endoribonuclease that is required for chloroplast rRNA processing and thus for normal growth and development.

  2. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  3. Molecular analysis of the 16S-23S rDNA internal spacer region (ISR) and truncated tRNA(Ala) gene segments in Campylobacter lari.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakanishi, S; Nakajima, T; Matsubara, K; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-06-01

    Following PCR amplification and sequencing, nucleotide sequence alignment analyses demonstrated the presence of two kinds of 16S-23S rDNA internal spacer regions (ISRs), namely, long length ISRs of 837-844 base pair (bp) [n = six for urease-negative (UN) Campylobacter lari isolates, UN C. lari JCM2530(T), RM2100, 176, 293, 299 and 448] and short length ISRs of 679-725 bp [n = six for UN C. lari: n = 14 for urease-positive thermophilic Campylobacter (UPTC) isolates]. The analyses also indicated that the short length ISRs mainly lacked the 156 bp sequence from the nucleotide positions 122-277 bp in long length ISRs for UN C. lari JCM2530(T). The 156 bp sequences shared 94.9-96.8 % sequence similarity among six isolates. Surprisingly, atypical tRNA(Ala) gene segment (5' end 35 bp), which was extremely truncated, occurred within the 156 bp sequences in the long length ISRs, as an unexpected tRNA(Ala) pseudogene. An order of the intercistronic tRNA genes within the short nucleotide spacer of 5'-16S rDNA-tRNA(Ala)-tRNA(Ile)-23S rDNA-3' occurred in all the C. lari isolates examined.

  4. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  5. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R; Kim, Kelly H; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-29

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes-UtpA and UtpB-interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  6. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    . coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  7. Cyclin-dependent kinase 9 links RNA polymerase II transcription to processing of ribosomal RNA.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

    2013-07-19

    Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3' extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3' processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3' rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing.

  8. Differentiation of acetic acid bacteria based on sequence analysis of 16S-23S rRNA gene internal transcribed spacer sequences.

    Science.gov (United States)

    González, Angel; Mas, Albert

    2011-06-30

    The 16S-23S gene internal transcribed spacer sequence of sixty-four strains belonging to different acetic acid bacteria genera were analyzed, and phylogenetic trees were generated for each genera. The topologies of the different trees were in accordance with the 16S rRNA gene trees, although the similarity percentages obtained between the species was shown to be much lower. These values suggest the usefulness of including the 16S-23S gene internal transcribed spacer region as a part of the polyphasic approach required for the further classification of acetic acid bacteria. Furthermore, the region could be a good target for primer and probe design. It has also been validated for use in the identification of unknown samples of this bacterial group from wine vinegar and fruit condiments.

  9. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  10. Crystal structure of the RluD pseudouridine synthase catalytic module, an enzyme that modifies 23S rRNA and is essential for normal cell growth of Escherichia coli.

    Science.gov (United States)

    Sivaraman, J; Iannuzzi, Pietro; Cygler, Miroslaw; Matte, Allan

    2004-01-01

    Pseudouridine (5-beta-D-ribofuranosyluracil, Psi) is the most commonly found modified base in RNA. Conversion of uridine to Psi is performed enzymatically in both prokaryotes and eukaryotes by pseudouridine synthases (EC 4.2.1.70). The Escherichia coli Psi-synthase RluD modifies uridine to Psi at positions 1911, 1915 and 1917 within 23S rRNA. RluD also possesses a second function related to proper assembly of the 50S ribosomal subunit that is independent of Psi-synthesis. Here, we report the crystal structure of the catalytic module of RluD (residues 68-326; DeltaRluD) refined at 1.8A to a final R-factor of 21.8% (R(free)=24.3%). DeltaRluD is a monomeric enzyme having an overall mixed alpha/beta fold. The DeltaRluD molecule consists of two subdomains, a catalytic subdomain and C-terminal subdomain with the RNA-binding cleft formed by loops extending from the catalytic sub-domain. The catalytic sub-domain of DeltaRluD has a similar fold as in TruA, TruB and RsuA, with the location of the RNA-binding cleft, active-site and conserved, catalytic Asp residue superposing in all four structures. Superposition of the crystal structure of TruB bound to a T-stem loop with RluD reveals that similar RNA-protein interactions for the flipped-out uridine base would exist in both structures, implying that base-flipping is necessary for catalysis. This observation also implies that the specificity determinants for site-specific RNA-binding and recognition likely reside in parts of RluD beyond the active site.

  11. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  12. Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region.

    Science.gov (United States)

    Yang, G; Benson, R; Pelish, T; Brown, E; Winchell, J M; Fields, B

    2010-03-01

    Although the majority of cases of Legionnaires' disease (LD) are caused by Legionella pneumophila, an increasing number of other Legionella species have been reported to cause human disease. There are no clinical presentations unique to LD and hence accurate laboratory tests are required for early diagnosis. Therefore, we designed a real-time PCR assay that targets the 23S-5S rRNA intergenic spacer region (23S-5S PCR) and allows for detection of all Legionella species and discrimination of L. pneumophila from other Legionella species. In total, 271 isolates representing 50 Legionella species were tested and the assay was validated using 39 culture-positive and 110 culture-negative patient specimens collected between 1989 and 2006. PCR-positive results were obtained with all 39 culture-positive samples (100% sensitivity). Specimens that tested positive according to 23S-5S PCR, but were culture-negative, were further analysed by DNA sequencing of the amplicon or the macrophage infectivity potentiator (mip) gene. In addition to L. pneumophila, Legionella longbeachae, Legionella cincinnatiensis and Legionella micdadei were identified in the specimens. The assay showed a 7-log dynamic range displaying a sensitivity of 7.5 CFU/mL or three genome equivalents per reaction. Sixty-one specimens containing viruses or bacteria other than Legionellae were negative according to 23S-5S PCR, demonstrating its specificity. Use of this assay should contribute to the earlier detection of respiratory disease caused by Legionella species, as well as to increased rates of detection.

  13. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    OpenAIRE

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-01-01

    International audience; Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. He...

  14. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller

    2011-01-01

    rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...

  15. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  16. Evidence for several higher order structural elements in ribosomal RNA.

    Science.gov (United States)

    Woese, C R; Gutell, R R

    1989-05-01

    Comparative analysis of small subunit ribosomal RNA sequences suggests the existence of two new higher order interactions: (i) a double-helical structure involving positions 505-507 and 524-526 (Escherichia coli numbering) and (ii) an interaction between the region of position 130 and the helix located approximately between positions 180 and 195. In the first of these, one of the strands of the helix exists in the bulge loop, and the other strand exists in the terminal loop of a previously recognized compound helix involving positions 500-545. Therefore, the new structure formally represents a pseudoknot. In the second, the insertion/deletion of a nucleotide in the vicinity of position 130 correlates with the length of the helix in the 180-195 region, the latter having a 3-base-pair stalk when the base in question is deleted and a stalk of approximately 10 pairs when it is inserted.

  17. Analysis of 16S-23S rRNA internal transcribed spacer regions in Pasteurellaceae isolated from laboratory rodents.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Christensen, Henrik; Sager, Martin

    2012-09-01

    The internal transcribed spacer (ITS) regions of members of Pasteurellaceae isolated from rodents, including the [Pasteurella] pneumotropica biotypes Jawetz and Heyl, [Actinobacillus] muris, "Hemophilus influenzaemurium" and Bisgaard taxon 17 were studied and their feasibility to discriminate these species was analyzed. The reference strains of all species analyzed showed unique species-specific ITS patterns which were further present in 49 clinical isolates of [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris allowing their identification by comparison to the reference strains pattern. Sequence analysis of the amplified fragments revealed in all species, with exception of "H. influenzaemurium", a larger ITS(ile+ala) which contained the genes for tRNA(Ile(GAU)) and tRNA(Ala(UGC)) and a smaller ITS(glu) with the tRNA(Glu(UUC)) gene. "H. influenzaemurium" revealed two each of the larger and respectively the smaller ITS fragments. Both the length and the sequence of each ITS type were highly conserved within the [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris strains tested. On the contrary, ITS sequences revealed significant interspecies variations with identity levels ranging from 61.2 to 89.5% for ITS(ile+ala) and 56.5 to 86.8% for ITS(glu). Sequences regions with significant interspecies variation but highly conserved within the species were identified and might be used to design probes for the identification of rodent Pasteurellaceae to the species level. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    Science.gov (United States)

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  19. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan — Iran

    Science.gov (United States)

    Khademi, Farzad; Faghri, Jamshid; Moghim, Sharareh; Esfahani, Bahram Nasr; Fazeli, Hossein; Poursina, Farkhondeh; Adibi, Peyman; Madhi, Masoumeh; Safaei, Hajieh Ghasemian

    2014-01-01

    Background: Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Materials and Methods: Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. Conclusions: In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C). PMID:24800187

  20. The study of mutation in 23S rRNA resistance gene of Helicobacter pylori to clarithromycin in patients with gastrointestinal disorders in Isfahan - Iran

    Directory of Open Access Journals (Sweden)

    Farzad Khademi

    2014-01-01

    Full Text Available Background: Helicobacter pylori antimicrobial resistance is an important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori in Isfahan city of Iran. Materials and Methods: Thirty isolates of H. pylori from 130 biopsy specimens were isolated by culture and confirmed by biochemical and PCR tests. The MIC of clarithromycin antibiotic for 30 clinical isolates of H. pylori was determined by E-test method. The point mutations in the 288 bp of 23S rRNA gene of H. Pylori were investigated in four clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. One point mutation was found at position T2243C in the 23S rRNA gene in all resistance isolates. Conclusions: In our study, H. pylori resistance to clarithromycin associated with point mutation at position 2243 (T2243C.

  1. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Science.gov (United States)

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  2. Turnover of ribosomal RNA in mouse fibroblasts (3T3) in culture

    Energy Technology Data Exchange (ETDEWEB)

    Kolodny, G.M.

    1975-01-01

    Growing and confluent cultures of mouse fibroblasts were labeled with /sup 3/H-uridine and chased with an excess of nonradioactive uridine to investigate the turnover of ribosomal RNA. Growing cultures did not turn over their 18S and 28S ribosomal RNA; however, confluent cultures did show ribosomal RNA (rRNA) turnover. If the cells were labeled while growing and chased when confluent, 18S RNA displayed a two-component decay curve, while 28S RNA showed only single-component decay, similar in lifetime to the first component of the 18S RNA decay curve. If the cells were labeled while confluent, both the 18S and 28S RNA showed single-component decay curves with a lifetime possibly only slightly longer than the lifetime of the first component of the 18S RNA and the single component of the 28S RNA of the cultures labeled while growing.

  3. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    Science.gov (United States)

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-11-17

    Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. Here, we present the cryo-electron microscopy structures of tmRNA-SmpB accommodated or translocated into stalled ribosomes. Two atomic models for each state are proposed. This study reveals how tmRNA-SmpB crosses the ribosome and how, as the problematic mRNA is ejected, the tmRNA resume codon is placed onto the ribosomal decoding site by new contacts between SmpB and the nucleotides upstream of the tag-encoding sequence. This provides a structural basis for the transit of the large tmRNA-SmpB complex through the ribosome and for the means by which the tmRNA internal frame is set for translation to resume.

  4. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  5. Dynamics of translation by single ribosomes through mRNA secondary structures

    OpenAIRE

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L.; Reiche, Michael; Farrell, Ian; Cooperman, Barry S.; Goldman, Yale E.

    2013-01-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary (2°) structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we employ single molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem loop or pseudoknot mRNA 2° structures. Downstream ...

  6. Establishment and analysis of specific DNA patterns in 16S-23S rRNA gene spacer regions for differentiating different bacteria

    Institute of Scientific and Technical Information of China (English)

    尚世强; 付君芬; 董关萍; 洪文澜; 杜立中; 俞锡林

    2003-01-01

    Objective To establish the specific 16S-23S rRNA gene spacer regions in different bacteria using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), DNA cloning and sequences analysis. Methods A pair of primers were selected from highly conserved sequences adjacent to the 16S-23S rRNA spacer region. Bacterial DNA from sixty-one strains of standard bacteria and corresponding clinical isolates representative of 20 genera and 26 species was amplified by PCR, and further analyzed by RFLP, DNA cloning and sequences analysis. Furthermore, all specimens were examined by bacterial culturing and PCR-RFLP analysis. The evaluation of these assays in practical clinic practice was also discussed.Results Restriction enzyme analysis revealed one, two or three bands or more observed among the 26 different standard strains. The sensitivity of PCR reached 2.5 colony-forming unit (CFU), and there was no cross reaction with human genomic DNA, fungus or virus. Fourteen species could be distinguished immediately by PCR, while another 10 species were further identified by Hinf Ⅰ or Alu Ⅰ digestion. The only difference between K.pneumoniae and E.durans was located at the site of the 779th nucleotide according to the sequence analysis and only XmaⅢ digestion could distinguish one from another. Of 42 specimens from septicemic neonates, 15 were identified as positive by blood culture at a rate of 35.7%. However, 27 specimens identified as positive by PCR, with a rate of 64.2%, a method significantly more effective than blood culture (P<0.01). Of 6 cerebrospinal fluid (CSF) specimens, one tested positive for S.epidermidis was also positive by PCR, two culture negative were positive by PCR and diagnosed as S.epidermidis according to the DNA pattern. One positive for C.neoformans was negative by PCR. The other two specimens were negative by both PCR and culture.Conclusions The method of detecting bacterial 16S-23S rRNA spacer regions using PCR

  7. Specialized yeast ribosomes: a customized tool for selective mRNA translation.

    Directory of Open Access Journals (Sweden)

    Johann W Bauer

    Full Text Available Evidence is now accumulating that sub-populations of ribosomes - so-called specialized ribosomes - can favour the translation of subsets of mRNAs. Here we use a large collection of diploid yeast strains, each deficient in one or other copy of the set of ribosomal protein (RP genes, to generate eukaryotic cells carrying distinct populations of altered 'specialized' ribosomes. We show by comparative protein synthesis assays that different heterologous mRNA reporters based on luciferase are preferentially translated by distinct populations of specialized ribosomes. These mRNAs include reporters carrying premature termination codons (PTC thus allowing us to identify specialized ribosomes that alter the efficiency of translation termination leading to enhanced synthesis of the wild-type protein. This finding suggests that these strains can be used to identify novel therapeutic targets in the ribosome. To explore this further we examined the translation of the mRNA encoding the extracellular matrix protein laminin β3 (LAMB3 since a LAMB3-PTC mutant is implicated in the blistering skin disease Epidermolysis bullosa (EB. This screen identified specialized ribosomes with reduced levels of RP L35B as showing enhanced synthesis of full-length LAMB3 in cells expressing the LAMB3-PTC mutant. Importantly, the RP L35B sub-population of specialized ribosomes leave both translation of a reporter luciferase carrying a different PTC and bulk mRNA translation largely unaltered.

  8. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  9. Choreography of molecular movements during ribosome progression along mRNA.

    Science.gov (United States)

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines.

  10. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  11. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA.

    Science.gov (United States)

    Ganapathi, Karthik A; Austin, Karyn M; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M; Reed, Robin; Shimamura, Akiko

    2007-09-01

    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome.

  12. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    DEFF Research Database (Denmark)

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I...... that the evolutionary paths of RNA and DNA 5-methyluridine and 5-methylcytosine MTases have been closely intertwined....

  13. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA.

    Science.gov (United States)

    Sunita, S; Zhenxing, H; Swaathi, J; Cygler, Miroslaw; Matte, Allan; Sivaraman, J

    2006-06-16

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine (Psi) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E.coli RluF at 2.6A resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of Psi-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  14. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Sunita,S.; Zhenxing, H.; Swaathi, J.; Cygler, M.; Matte, A.; Sivaraman, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  15. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Science.gov (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  16. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  17. What do we know about ribosomal RNA methylation in Escherichia coli?

    Science.gov (United States)

    Sergeeva, O V; Bogdanov, A A; Sergiev, P V

    2015-10-01

    A ribosome is a ribonucleoprotein that performs the synthesis of proteins. Ribosomal RNA of all organisms includes a number of modified nucleotides, such as base or ribose methylated and pseudouridines. Methylated nucleotides are highly conserved in bacteria and some even universally. In this review we discuss available data on a set of modification sites in the most studied bacteria, Escherichia coli. While most rRNA modification enzymes are known for this organism, the function of the modified nucleotides is rarely identified.

  18. Potential key bases of ribosomal RNA to kingdom-specific spectra of antibiotic susceptibility and the possible archaeal origin of eukaryotes.

    Directory of Open Access Journals (Sweden)

    Qiang Xie

    Full Text Available In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.

  19. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...... collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m...

  20. Development of a multiplex PCR assay based on the 16S-23S rRNA internal transcribed spacer for the detection and identification of rodent Pasteurellaceae.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Bleich, André; Gougoula, Christina; Sager, Martin

    2013-11-01

    The rodents Pasteurellaceae have to be excluded from the specified pathogen free experimental animal facilities. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals just a few molecular based methods are available for their detection and identification. The aim of the present investigation was to develop a multiplex PCR assay allowing detection of all rodent Pasteurellaceae and identification of [Pasteurella] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl and [Actinobacillus] muris, as the most prevalent members of the group. For this, a Pasteurellaceae common forward primer located on the 16S rRNA gene was used in conjunction with four different reverse primers specific for [P.] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl, [A.] muris and a common reverse primer for all rodent Pasteurellaceae, all targeting the 16S-23S rRNA internal transcribed spacer sequences. The performance characteristics of the assay were tested against 125 Pasteurellaceae isolates belonging to eleven different species and including 34 strains of [P.] pneumotropica biotype Jawetz, 44 strains of [P.] pneumotropica biotype Heyl and 37 strains of [A.] muris. Additionally, eight other mouse associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA gene sequencing. This multiplex PCR represents the first molecular tool able to detect and differentiate in a single assay among the Pasteurellaceae found in laboratory mouse and may become a reliable alternative to the present diagnostic methods. © 2013.

  1. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  2. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    Science.gov (United States)

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  3. Dynamics of translation by single ribosomes through mRNA secondary structures.

    Science.gov (United States)

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L; Reiche, Michael; Farrell, Ian; Cooperman, Barry S; Goldman, Yale E

    2013-05-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we used single-molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem-loop or pseudoknot mRNA secondary structures. Downstream stem-loops containing 100% GC base pairs decrease the rates of both tRNA translocation within the ribosome and deacylated tRNA dissociation from the ribosomal exit site (E site). Downstream stem-loops or pseudoknots containing both GC and AU pairs also decrease the rate of tRNA dissociation, but they have little effect on tRNA translocation rate. Thus, somewhat unexpectedly, unfolding of mRNA secondary structures is more closely coupled to E-site tRNA dissociation than to tRNA translocation.

  4. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.

    Science.gov (United States)

    Robert, F; Brakier-Gingras, L

    2001-02-01

    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  5. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  6. Genotyping of Salmonella spp.by 16S-23S rRNA assay%沙门菌PCR-dHPLC基因分型方法建立

    Institute of Scientific and Technical Information of China (English)

    张东方; 袁飞; 王娉; 杨海荣; 胡玥; 赵勇胜; 陈颖; 葛毅强

    2012-01-01

    Objective To develop a polymerase chain reaction-denaturing high performance liquid chromatography (PCR-dHPLC) genotyping method for genotyping of Salmonella spp. Methods Specific primers of 16S-23S rRNA in-tergenic spacer sequence (ITS) region were used to subtype Salmonella spp. The PCR amplification products of experimental strains were separated by dHPLC. The results of genotyping achieved through the differences between dHPLC peaks and were comparaed to the results obtained by serological typing and biochemical typing. Results Totally 89 Salmonella spp. strains were successfully genotyped into 12 dHPLC types(D type). All the Salmonella spp. strains had one same chromatographic peak,while other food-born pathogens showed no similar peak. DNA sequence analysis showed that the sequence was 600bp. The results indicate that the chromatographic peak is specific to Salmonella spp. Comparing the dHPLC genotyping results with those of serological typing and biochemical typing, we found dHPLC genotyping results were significantly differ from the serological typing results, while were consistent with that of the biochemical typing. Conclusion DHPLC is a novel, rapid, highly accurate, and cost-effective genotyping method for genotyping of Salmonella spp.%目的 建立沙门菌聚合酶链反应-变性高效液相色谱(PCR-dHPLC)基因分型方法.方法 采用16S ~23S rRNA内转录间隔(ITS)作为沙门菌分型目的基因,确定特异性扩增引物,进行PCR扩增,扩增产物经dHPLC分离,根据dHPLC图谱峰型差异进行分型,并与血清学和生化分型结果比较.结果 89株沙门菌共分为12个dHPLC型(D型);所有沙门菌均有1个相同色谱峰,克隆测序结果表明,其片断大小为600 bp,其他8种食源性致病菌对照株无此色谱峰,应为沙门菌16S~23S rRNA基因序列的特征性条带,分型结果与血清学差异较大,与生化分型结果有一定一致性.结论 所建立的沙门菌PCR-dHPLC基因分型方法具快速

  7. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...

  8. Classification of methanogenic bacteria by 16S ribosomal RNA characterization

    Energy Technology Data Exchange (ETDEWEB)

    Fox, G.E.; Magrum, L.J.; Balch, W.E.; Wolfe, R.S.; Woese, C.R.

    1977-10-01

    The 16S ribosomal RNAs from 10 species of methanogenic bacteria have been characterized in terms of the oligonucleotides produced by T/sub 1/ RNase digestion. Comparative analysis of these data reveals the methanogens to constitute a distinct phylogenetic group containing two major divisions. These organisms appear to be only distantly related to typical bacteria.

  9. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  10. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  11. Flipping of the ribosomal A-site adenines provides a basis for tRNA selection

    Science.gov (United States)

    Zeng, Xiancheng; Chugh, Jeetender; Casiano-Negroni, Anette; Al-Hashimi, Hashim M.; Brooks, Charles L.

    2014-01-01

    Ribosomes control the missense error rate of ~10−4 during translation though quantitative contributions of individual mechanistic steps of the conformational changes yet to be fully determined. Biochemical and biophysical studies led to a qualitative tRNA selection model in which ribosomal A-site residues A1492 and A1493 (A1492/3) flip out in response to cognate tRNA binding, promoting the subsequent reactions, but not in the case of near cognate or non-cognate tRNA. However, this model was recently questioned by X-ray structures revealing conformations of extrahelical A1492/3 and domain closure of the decoding center in both cognate and near-cognate tRNA bound ribosome complexes, suggesting that the non-specific flipping of A1492/3 has no active role in tRNA selection. We explore this question by carrying out molecular dynamics (MD) simulations, aided with fluorescence and NMR experiments, to probe the free energy cost of extrahelical flipping of 1492/3 and the strain energy associated with domain conformational change. Our rigorous calculations demonstrate that the A1492/3 flipping is indeed a specific response to the binding of cognate tRNA, contributing 3 kcal/mol to the specificity of tRNA selection. Furthermore, the different A-minor interactions in cognate and near-cognate complexes propagate into the conformational strain and contribute another 4 kcal/mol in domain closure. The recent structure of ribosome with features of extrahelical A1492/3 and closed domain in near-cognate complex is reconciled by possible tautomerization of the wobble base pair in mRNA-tRNA. These results quantitatively rationalize other independent experimental observations and explain the ribosomal discrimination mechanism of selecting cognate versus near-cognate tRNA. PMID:24813122

  12. Assembly factors Rpf2 and Rrs1 recruit 5S rRNA and ribosomal proteins rpL5 and rpL11 into nascent ribosomes.

    Science.gov (United States)

    Zhang, Jingyu; Harnpicharnchai, Piyanun; Jakovljevic, Jelena; Tang, Lan; Guo, Yurong; Oeffinger, Marlene; Rout, Michael P; Hiley, Shawna L; Hughes, Timothy; Woolford, John L

    2007-10-15

    More than 170 proteins are necessary for assembly of ribosomes in eukaryotes. However, cofactors that function with each of these proteins, substrates on which they act, and the precise functions of assembly factors--e.g., recruiting other molecules into preribosomes or triggering structural rearrangements of pre-rRNPs--remain mostly unknown. Here we investigated the recruitment of two ribosomal proteins and 5S ribosomal RNA (rRNA) into nascent ribosomes. We identified a ribonucleoprotein neighborhood in preribosomes that contains two yeast ribosome assembly factors, Rpf2 and Rrs1, two ribosomal proteins, rpL5 and rpL11, and 5S rRNA. Interactions between each of these four proteins have been confirmed by binding assays in vitro. These molecules assemble into 90S preribosomal particles containing 35S rRNA precursor (pre-rRNA). Rpf2 and Rrs1 are required for recruiting rpL5, rpL11, and 5S rRNA into preribosomes. In the absence of association of these molecules with pre-rRNPs, processing of 27SB pre-rRNA is blocked. Consequently, the abortive 66S pre-rRNPs are prematurely released from the nucleolus to the nucleoplasm, and cannot be exported to the cytoplasm.

  13. Counterselection of prokaryotic ribosomal RNA during reverse transcription using non-random hexameric oligonucleotides.

    Science.gov (United States)

    Gonzalez, J M; Robb, F T

    2007-12-01

    Ribosomal RNA (rRNA) is the major component in total RNA extracts, interfering with the synthesis of cDNA corresponding to messenger RNA (mRNA). In this study, we present a novel strategy for selectively discriminating against rRNA and favoring mRNA from prokaryotes during synthesis of cDNA by reverse transcriptase. Our technique is based on the fact that rRNA sequences, in many species, are G+C rich relative to the genome at large, and highly conserved among prokaryotes. The sequence TTTT is therefore rarely found in rRNA sequences. However, TTTT priming sites are found at a much higher frequency in protein-encoding gene sequences. We designed specific hexamers (HD/DHTTTT) to prime reverse transcription reactions resulting in a selective synthesis of cDNA corresponding to mRNA from prokaryotic total RNA extractions.

  14. Ribosomal RNA and protein transcripts persist in the cysts of Entamoeba invadens.

    Science.gov (United States)

    Ojha, Sandeep; Ahamad, Jamaluddin; Bhattacharya, Alok; Bhattacharya, Sudha

    2014-06-01

    In most organisms rDNA transcription ceases under conditions of growth stress. However, we have earlier shown that pre-rRNA accumulates during encystation in Entamoeba invadens. We labeled newly-synthesized rRNA during encystation, with [methyl-(3)H] methionine in the presence of chitinase to enable uptake of isotope. Incorporation rate reduced after 24h, and then increased to reach levels comparable with normal cells. The label was rapidly chased to the ribosomal pellet in dividing cells, while at late stages of encystation the ratio of counts going to the pellet dropped 3-fold. The transcript levels of selected ribosomal protein genes also went down initially but went up again at later stages of encystation. This suggested that rRNA and ribosomal protein transcription may be coordinately regulated. Our data shows that encysting E. invadens cells accumulate transcripts of both the RNA and protein components of the ribosome, which may ensure rapid synthesis of new ribosomes when growth resumes.

  15. Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes

    Science.gov (United States)

    Goodfellow, Sarah J.; Zomerdijk, Joost C. B. M.

    2013-01-01

    RNA Polymerase (Pol) I produces ribosomal (r)RNA, an essential component of the cellular protein synthetic machinery that drives cell growth, underlying many fundamental cellular processes. Extensive research into the mechanisms governing transcription by Pol I has revealed an intricate set of control mechanisms impinging upon rRNA production. Pol I-specific transcription factors guide Pol I to the rDNA promoter and contribute to multiple rounds of transcription initiation, promoter escape, elongation and termination. In addition, many accessory factors are now known to assist at each stage of this transcription cycle, some of which allow the integration of transcriptional activity with metabolic demands. The organisation and accessibility of rDNA chromatin also impinge upon Pol I output, and complex mechanisms ensure the appropriate maintenance of the epigenetic state of the nucleolar genome and its effective transcription by Pol I. The following review presents our current understanding of the components of the Pol I transcription machinery, their functions and regulation by associated factors, and the mechanisms operating to ensure the proper transcription of rDNA chromatin. The importance of such stringent control is demonstrated by the fact that deregulated Pol I transcription is a feature of cancer and other disorders characterised by abnormal translational capacity. PMID:23150253

  16. Comment on "Length-dependent translation of messenger RNA by ribosomes"

    CERN Document Server

    Zhang, Yunxin

    2011-01-01

    In recent paper [Phys. Rev. E {\\bf 83}, 042903 (2011)], a simple model for the translation of messenger RNA by ribosomes is provided, and the expression of translational ratio of protein is given. In this comments, varied methods to get this ratio are addressed. Depending on a different method, we find that, roughly speaking, this translational ratio decays exponentially with mRNA length in prokaryotic cell, and reciprocally with mRNA length in eukaryotic cells.

  17. [Affinity modification of Escherichia coli ribosomes with photoactivated analogs of mRNA].

    Science.gov (United States)

    Gimautdinova, O I; Zenkova, M A; Karpova, G G; Podust, L M

    1984-01-01

    Oligoribonucleotide derivatives containing the photoactivated arylazidogroup at 5'-end of the oligonucleotide fragment [2-(N-2,4-dinitro-5-azidophenyl) aminoethyl] phosphamides of the oligoribonucleotides, azido-NH (CH2)2NHpN (pN) n-1, were prepared. It was demonstrated that azido-NH(CH2)2NHpA(pA)4 and azido-NH (CH2)2NHpU (pU)3 stimulate the binding of the codonspecific aminoacyl-tRNA with ribosome. After irradiation of the ternary complex ribosome-azido-NH (CH2)2NHpU (pU) n-1 X tRNA with UV-light (lambda greater than 350 nm) covalent binding of the reagent to ribosome occurs. Up to 10% of the reagent, bound in the ternary complex with ribosome, is cross-linked with the ribosomal proteins of 30S and 50S subunits. The ribosomal RNA are not modified by azido-NH (CH2)2NHpU (pU) n-1. The proteins of 30S and 50S subunits, modified with azido-NH (CH2)2NHpU (pU) n-1 with n = 4,7 and 8, were identified. It is shown that proteins of 30S subunits S3, S4, S9, S11, S12, S14, S17, S19, S20 undergo modification. The proteins of 50S subunits L2, L13, L16, L27, L32, L33 are modified. The set of the modified proteins essentially depends on the length of the oligonucleotide part of the reagent and on occupancy of ribosome A-site by a molecule of tRNA.

  18. Ribosomal protein L16 binds to the 3'-end of transfer RNA.

    Science.gov (United States)

    Maimets, T; Remme, J; Villems, R

    1984-01-23

    Escherichia coli 50 S ribosomal subunits were reconstituted with and without protein L16 present. The latter particles, although active in puromycin reaction, were unable to use CACCA-Phe as an acceptor substrate. We also found that L16 interacts directly with this oligonucleotide and, in the complex with tRNA, protects its 3'-end from pancreatic ribonuclease digestion. We suggest that the role of L16 is in the fixation of the aminoacyl stem of tRNA to the ribosome at its A-site.

  19. Ribosomal RNA in Alzheimer disease is oxidized by bound redox-active iron.

    Science.gov (United States)

    Honda, Kazuhiro; Smith, Mark A; Zhu, Xiongwei; Baus, Diane; Merrick, William C; Tartakoff, Alan M; Hattier, Thomas; Harris, Peggy L; Siedlak, Sandra L; Fujioka, Hisashi; Liu, Quan; Moreira, Paula I; Miller, Frank P; Nunomura, Akihiko; Shimohama, Shun; Perry, George

    2005-06-03

    Oxidative modification of cytoplasmic RNA in vulnerable neurons is an important, well documented feature of the pathophysiology of Alzheimer disease. Here we report that RNA-bound iron plays a pivotal role for RNA oxidation in vulnerable neurons in Alzheimer disease brain. The cytoplasm of hippocampal neurons showed significantly higher redox activity and iron(II) staining than age-matched controls. Notably, both were susceptible to RNase, suggesting a physical association of iron(II) with RNA. Ultrastructural analysis further suggested an endoplasmic reticulum association. Both rRNA and mRNA showed twice the iron binding as tRNA. rRNA, extremely abundant in neurons, was considered to provide the greatest number of iron binding sites among cytoplasmic RNA species. Interestingly, the difference of iron binding capacity disappeared after denaturation of RNA, suggesting that the higher order structure may contribute to the greater iron binding of rRNA. Reflecting the difference of iron binding capacity, oxidation of rRNA by the Fenton reaction formed 13 times more 8-hydroxyguanosine than tRNA. Consistent with in situ findings, ribosomes purified from Alzheimer hippocampus contained significantly higher levels of RNase-sensitive iron(II) and redox activity than control. Furthermore, only Alzheimer rRNA contains 8-hydroxyguanosine in reverse transcriptase-PCR. Addressing the biological significance of ribosome oxidation by redox-active iron, in vitro translation with oxidized ribosomes from rabbit reticulocyte showed a significant reduction of protein synthesis. In conclusion these results suggest that rRNA provides a binding site for redox-active iron and serves as a redox center within the cytoplasm of vulnerable neurons in Alzheimer disease in advance of the appearance of morphological change indicating neurodegeneration.

  20. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  1. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    Science.gov (United States)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  2. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  3. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  4. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  5. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  6. Structural diversity in bacterial ribosomes: mycobacterial 70S ribosome structure reveals novel features.

    Directory of Open Access Journals (Sweden)

    Manidip Shasmal

    Full Text Available Here we present analysis of a 3D cryo-EM map of the 70S ribosome from Mycobacterium smegmatis, a saprophytic cousin of the etiological agent of tuberculosis in humans, Mycobacterium tuberculosis. In comparison with the 3D structures of other prokaryotic ribosomes, the density map of the M. smegmatis 70S ribosome reveals unique structural features and their relative orientations in the ribosome. Dramatic changes in the periphery due to additional rRNA segments and extra domains of some of the peripheral ribosomal proteins like S3, S5, S16, L17, L25, are evident. One of the most notable features appears in the large subunit near L1 stalk as a long helical structure next to helix 54 of the 23S rRNA. The sharp upper end of this structure is located in the vicinity of the mRNA exit channel. Although the M. smegmatis 70S ribosome possesses conserved core structure of bacterial ribosome, the new structural features, unveiled in this study, demonstrates diversity in the 3D architecture of bacterial ribosomes. We postulate that the prominent helical structure related to the 23S rRNA actively participates in the mechanisms of translation in mycobacteria.

  7. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  8. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  9. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  10. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  11. Preparation of Biologically Active Arabidopsis Ribosomes and Comparison with Yeast Ribosomes for Binding to a tRNA-Mimic that Enhances Translation of Plant Plus-Strand RNA Viruses

    Directory of Open Access Journals (Sweden)

    Vera Aleksey Stupina

    2013-07-01

    Full Text Available Isolation of biologically active cell components from multicellular eukaryotic organisms often poses difficult challenges such as low yields and inability to retain the integrity and functionality of the purified compound. We previously identified a cap-independent translation enhancer (3’CITE in the 3’UTR of Turnip crinkle virus (TCV that structurally mimics a tRNA and binds to yeast 80S ribosomes and 60S subunits in the P-site. Yeast ribosomes were used for these studies due to the lack of methods for isolation of plant ribosomes with high yields and integrity. To carry out studies with more natural components, a simple and efficient procedure has been developed for the isolation of large quantities of high quality ribosomes and ribosomal subunits from Arabidopsis thaliana protoplasts prepared from seed-derived callus tissue. Attempts to isolate high quality ribosomes from wheat germ, bean sprouts and evacuolated protoplasts were unsuccessful. Addition of purified Arabidopsis 80S plant ribosomes to ribosome-depleted wheat germ lysates resulted in a greater than 1200-fold enhancement in in vitro translation of a luciferase reporter construct. The TCV 3’CITE bound to ribosomes with a 3 to 7-fold higher efficiency when using plant 80S ribosomes compared with yeast ribosomes, indicating that this viral translational enhancer is adapted to interact more efficiently with host plant ribosomes.

  12. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.

    Science.gov (United States)

    Verrier, S B; Jean-Jean, O

    2000-04-01

    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  13. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    -rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...... translates the genetic message encoded in mRNAs to synthesize proteins. Initiation of translation requires localization and recognition of the start codon at the P-site of the 40S small ribosomal subunit. On most eukaryotic mRNAs, the start codon is identified by a scanning mechanism, whereby a small subunit...

  14. CED-4 is an mRNA-binding protein that delivers ced-3 mRNA to ribosomes.

    Science.gov (United States)

    Wang, Miao-xing; Itoh, Masanori; Li, Shimo; Hida, Yoko; Ohta, Kazunori; Hayakawa, Miki; Nishida, Emika; Ueda, Masashi; Islam, Saiful; Tana; Nakagawa, Toshiyuki

    2016-01-29

    Cell death abnormal (ced)-3 and ced-4 genes regulate apoptosis to maintain tissue homeostasis in Caenorhabditis elegans. Apoptosome formation and CED-4 translocation drive CED-3 activation. However, the precise role of CED-4 translocation is not yet fully understood. In this study, using a combination of immunoprecipitation and reverse transcription-polymerase chain reaction methods in cells and a glutathione-S-transferase pull down assay in a cell-free system, we show that CED-4 binds ced-3 mRNA. In the presence of ced-3 mRNA, CED-4 protein is enriched in the microsomal fraction and interacts with ribosomal protein L10a in mammalian cells, increasing the levels of CED-3. These results suggest that CED-4 forms a complex with ced-3 mRNA and delivers it to ribosomes for translation.

  15. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  16. Chromosomal localization of the major ribosomal RNA genes in scallop Chlamys farreri

    Institute of Scientific and Technical Information of China (English)

    HUANG Xiaoting; BAO Zhenmin; BI Ke; HU Jingjie; ZHANG Can; ZHANG Quanqi; HU Xiaoli

    2006-01-01

    The chromosomes of Chlamys farreri were analyzed by means of silver staining and fluorescence in situ hybridization ( FISH ) with 18S-28S rDNA probe. Probe was made by PCR amplification of a DNA fragment containing internal transcribed spacers ITS1 between 18S and 5.8S ribosomal RNA gene, ITS2 between 5.8S and 28S ribosomal RNA gene and 5.8S rRNA gene, and labeled by PCR incorporation of bio-16-dUTP. FISH signals were located on the short arm of subtelocentric chromosome 10. After silverstaining, nucleolus organizer regions (NORs) could be observed on the telomere of the short arm of chromosome 10. However,one metaphase spread displayed an additional silver spot on the short arm of subtelocentric chromosome 12.

  17. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  18. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  19. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    Science.gov (United States)

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3.

  20. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063.

    Science.gov (United States)

    Suzuki, Yu; Seto, Junji; Shimotai, Yoshitaka; Ikeda, Tatsuya; Yahagi, Kazue; Mizuta, Katsumi; Matsuzaki, Yoko; Hongo, Seiji

    2016-12-01

    The prevalence of macrolide-resistant Mycoplasma pneumoniae harboring a mutation in the 23S rRNA gene is increasing, and rapid detection assays are needed for clinical management. We developed an endpoint genotyping assay to detect the M. pneumoniae 23S rRNA gene and determine the existence of macrolide resistance-associated mutations at position 2063 (A2063G, A2063T and A2063C mutations). This A2063B genotyping assay detected more than 50 copies/reaction of the M. pneumoniae gene in every nucleotide mutation at position 2063. Of 42 clinical specimens, 3 were positive without mutation, 6 were positive with the A2063G mutation, and 33 were negative. The results were confirmed using nested PCR with the sequencing of the M. pneumoniae 23S rRNA gene, and a high sensitivity (90%), specificity (100%), and coincidence ratio (kappa coefficient=0.93) were obtained. Therefore, the A2063B genotyping assay is useful for the rapid discrimination of macrolide resistance mutations at position 2063.

  1. Regulation of ribosomal rna synthesis in escherichia coli

    OpenAIRE

    Oostra, Bernard Anne

    1981-01-01

    Bacterien kunnen met verschillende snelheden groeien. De groeisnelheid hangt af van het milieu waarin de bakterien zich bevinden. De expressie van genen wordt aangepast aan de groeiomstandigheden. Omdat op een bepaald moment slechts een beperkt deel van de genen tot expressie komt, moet er sprake zijn van regulering. Daarbij is het ook van belang te weten dat prokaryoten één enzym hebben, het RNA polymerase, dat zorgt voor de transcriptie van alle genen. ... Samenvatting

  2. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  3. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading.

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Lohoff, Tim; Jia, Qidong; Satterlee, James; Ke, Kenneth; von Arnim, Albrecht G

    2015-09-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock.

  4. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  5. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2015-10-01

    Full Text Available Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA. It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  6. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  7. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  8. Recognition of Cognate Transfer RNA by the 30S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.; Tarry, Michael J.; Carter, Andrew P.; Ramakrishnan, V. (MRC Laboratory of Molecular Biology)

    2009-10-07

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognate tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.

  9. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  10. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  11. DksA Guards Elongating RNA Polymerase Against Ribosome-Stalling-Induced Arrest

    Science.gov (United States)

    Zhang, Yan; Mooney, Rachel A.; Grass, Jeffrey A.; Sivaramakrishnan, Priya; Herman, Christophe; Landick, Robert; Wang, Jue D.

    2014-01-01

    Summary In bacteria, translation-transcription coupling inhibits RNA polymerase (RNAP) stalling. We present evidence suggesting that, upon amino acid starvation, inactive ribosomes promote rather than inhibit RNAP stalling. We developed an algorithm to evaluate genome-wide polymerase progression independently of local noise, and used it to reveal that the transcription factor DksA inhibits promoter-proximal pausing and increases RNAP elongation when uncoupled from translation by depletion of charged tRNAs. DksA has minimal effect on RNAP elongation in vitro and on untranslated RNAs in vivo. In these cases, transcripts can form RNA structures that prevent backtracking. Thus, the effect of DksA on transcript elongation may occur primarily upon ribosome slowing/stalling or at promoter-proximal locations that limit the potential for RNA structure. We propose that inactive ribosomes prevent formation of backtrack-blocking mRNA structures and that, in this circumstance, DksA acts as a transcription elongation factor in vivo. PMID:24606919

  12. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  13. The structure of a ribosomal protein S8/spc operon mRNA complex.

    Science.gov (United States)

    Merianos, Helen J; Wang, Jimin; Moore, Peter B

    2004-06-01

    In bacteria, translation of all the ribosomal protein cistrons in the spc operon mRNA is repressed by the binding of the product of one of them, S8, to an internal sequence at the 5' end of the L5 cistron. The way in which the first two genes of the spc operon are regulated, retroregulation, is mechanistically distinct from translational repression by S8 of the genes from L5 onward. A 2.8 A resolution crystal structure has been obtained of Escherichia coli S8 bound to this site. Despite sequence differences, the structure of this complex is almost identical to that of the S8/helix 21 complex seen in the small ribosomal subunit, consistent with the hypothesis that autogenous regulation of ribosomal protein synthesis results from conformational similarities between mRNAs and rRNAs. S8 binding must repress the translation of its own mRNA by inhibiting the formation of a ribosomal initiation complex at the start of the L5 cistron.

  14. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  15. Comparative analyses among the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S ribosomal RNA genes.

    Science.gov (United States)

    Torres-Machorro, Ana Lilia; Hernández, Roberto; Alderete, John F; López-Villaseñor, Imelda

    2009-04-01

    The 5S ribosomal RNA (5S rRNA) is an essential component of ribosomes. Throughout evolution, variation is found among 5S rRNA genes regarding their chromosomal localization, copy number, and intergenic regions. In this report, we describe and compare the gene sequences, motifs, genomic copy number, and chromosomal localization of the Trichomonas vaginalis, Trichomonas tenax, and Tritrichomonas foetus 5S rRNA genes. T. vaginalis and T. foetus have a single type of 5S rRNA-coding region, whereas two types were found in T. tenax. The sequence identities among the three organisms are between 94 and 97%. The intergenic regions are more divergent in sequence and size with characteristic species-specific motifs. The T. foetus 5S rRNA gene has larger and more complex intergenic regions, which contain either an ubiquitin gene or repeated sequences. The 5S rRNA genes were located in Trichomonads chromosomes by fluorescent in situ hybridization.

  16. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Directory of Open Access Journals (Sweden)

    Khan Umaer

    Full Text Available RNA binding proteins (RBP play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD. Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  17. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  18. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components. PMID:26121669

  19. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    Science.gov (United States)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  20. Structure-Activity Relationships of Diverse Oxazolidinones for Linezolid-Resistant Staphylococcus aureus Strains Possessing the cfr Methyltransferase Gene or Ribosomal Mutations▿

    OpenAIRE

    Locke, Jeffrey B.; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; Kedar, G. C.; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L.

    2010-01-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZDr) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-ring...

  1. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    Science.gov (United States)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  2. Sequence of the 16S Ribosomal RNA from Halobacterium volcanii, an Archaebacterium.

    Science.gov (United States)

    Gupta, R; Lanter, J M; Woese, C R

    1983-08-12

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  3. Probing the structure of 16 S ribosomal RNA from Bacillus brevis.

    Science.gov (United States)

    Kop, J; Kopylov, A M; Magrum, L; Siegel, R; Gupta, R; Woese, C R; Noller, H F

    1984-12-25

    A majority (approximately 89%) of the nucleotide sequence of Bacillus brevis 16 S rRNA has been determined by a combination of RNA sequencing methods. Several experimental approaches have been used to probe its structure, including (a) partial RNase digestion of 30 S ribosomal subunits, followed by two-dimensional native/denatured gel electrophoresis, in which base-paired fragments were directly identified; (b) identification of positions susceptible to cleavage by RNase A and RNase T1 in 30 S subunits; (c) sites of attack by cobra venom RNase on naked 16 S rRNA; and (d) nucleotides susceptible to attack by bisulfite in 16 S rRNA. These data are discussed with respect to a secondary structure model for B. brevis 16 S rRNA derived by comparative sequence analysis.

  4. Detection of bacterial 16S ribosomal RNA genes for forensic identification of vaginal fluid.

    Science.gov (United States)

    Akutsu, Tomoko; Motani, Hisako; Watanabe, Ken; Iwase, Hirotaro; Sakurada, Koichi

    2012-05-01

    To preliminarily evaluate the applicability of bacterial DNA as a marker for the forensic identification of vaginal fluid, we developed and performed PCR-based detection of 16S ribosomal RNA genes of Lactobacillus spp. dominating the vagina and of bacterial vaginosis-related bacteria from DNA extracted from body fluids and stains. As a result, 16S ribosomal RNA genes of Lactobacillus crispatus, Lactobacillus jensenii and Atopobium vaginae were specifically detected in vaginal fluid and female urine samples. Bacterial genes detected in female urine might have originated from contaminated vaginal fluid. In addition, those of Lactobacillus iners, Lactobacillus gasseri and Gardnerella vaginalis were also detected in non-vaginal body fluids such as semen. Because bacterial genes were successfully amplified in DNA samples extracted by using the general procedure for animal tissues without any optional treatments, DNA samples prepared for the identification of vaginal fluid can also be used for personal identification. In conclusion, 16S ribosomal RNA genes of L. crispatus, L. jensenii and A. vaginae could be effective markers for forensic identification of vaginal fluid.

  5. Detection of Enterobacter sakazakii in neonatal sepsis by PCR on 16S ribosomal RNA

    Directory of Open Access Journals (Sweden)

    Khadijeh Ahmadi

    2014-08-01

    Full Text Available Background: Enterobacter sakazakii is a gram negative, facultative anaerobic, straight rod-shaped bacterium that belongs to the family Enterobacteriaceae. It is also considered an emerging opportunistic pathogen, responsible of cases of neonatal infections including sepsis, meningitis, necrotizing enterocolitis ad bacteremia. The goal of this study was detection of Enterobacter salazakii in neonates with sepsis by PCR on 16S ribosomal RNA gene. Material and Methods: This cross-sectional study was conducted on 405 blood specimens that were taken from hospitalized neonates suspected to sepsis in Ahvaz Abuzar Hospital in 2011. From each neonate 0.5 ml blood sample was taken and placed in CBC tubes containing EDTA at -200C for polymerase chain reaction. For detection of Enterobacter sakazakii, PCR was performed on DNA for amplification of 16S ribosomal RNA gene. Results: In all 405 neonates blood samples’ PCR reactions for Enterobacter sakazakii 16S ribosomal RNA gene were negative. Blood cultures were positive for Streptococcus agalactiae in 8 (1.4 % patients. Conclusion: Because Enterobacter sakazakii is an opportunistic pathogen with high pathogenicity power, more investigation on high risk groups is required. For detection of infection caused by this organism using of different diagnostic methods with high specificity and sensitivity is necessary.

  6. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  7. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    Science.gov (United States)

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  8. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations.

    Science.gov (United States)

    Kuhlmann, Micki M; Chattopadhyay, Maitreyi; Stupina, Vera A; Gao, Feng; Simon, Anne E

    2016-10-01

    Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3' end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide

  9. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  10. Efficient hammerhead ribozyme and antisense RNA targeting in a slow ribosome Escherichia coli mutant.

    Science.gov (United States)

    Chen, H; Ferbeyre, G; Cedergren, R

    1997-05-01

    We have evaluated inhibition of the plasmid-born chloramphenicol acetyl transferase gene (CAT) by the hammerhead ribozyme and antisense RNA in Escherichia coli where the translation and transcription rates have been modified. Whereas neither antisense nor the hammerhead had an inhibitory effect on CAT activity in wild-type E. coli, both reduced the level of the messenger RNA and the activity of the CAT gene by almost 60% in a slow ribosome mutant. Streptomycin, which increases the speed of translation in this mutant strain, restored full CAT activity. The level of CAT activity expressed from a T7 RNA polymerase promoter was not affected by the presence of either antisense RNA or the hammerhead ribozyme. When the target gene was expressed from a chromosomal locus in wild-type E. coli, both antisense RNA and the hammerhead ribozyme showed some inhibitory activity, but the level of inhibition was significantly increased in the slow ribosome strain. This bacterial system offers a unique entry to the study of cellular factors which mediate the activity of ribozymes in vivo.

  11. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  12. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  13. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Functional ribosome biogenesis is a prerequisite for p53 destabilization: impact of chemotherapy on nucleolar functions and RNA metabolism.

    Science.gov (United States)

    Burger, Kaspar; Eick, Dirk

    2013-09-01

    The production and processing of ribosomal RNA is a complex and well-coordinated nucleolar process for ribosome biogenesis. Progress in understanding nucleolar structure and function has lead to the unexpected discovery of the nucleolus as a highly sensitive sensor of cellular stress and an important regulator of the tumor suppressor p53. Inhibition of ribosomal RNA metabolism has been shown to activate a signaling pathway for p53 induction. This review elucidates the potential of classical and recently developed chemotherapeutic drugs to stabilize p53 by inhibiting nucleolar functions.

  15. A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

    Science.gov (United States)

    Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

    1990-09-01

    Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

  16. Decrease in Ribosomal RNA in Candida albicans Induced by Serum Exposure.

    Science.gov (United States)

    Fleischmann, Jacob; Rocha, Miguel A

    2015-01-01

    Candida albicans is an important polymorphic human pathogen. It can switch from a unicellular yeast form to germinating hypha, which may play a role in making it the successful pathogen it is. This hyphal transformation can be triggered by various extracellular stimuli, the most potent one being serum from any source. We have previously reported that Candida albicans transiently polyadenylates portions of both the large and small subunits of ribosomal RNA, shortly after serum exposure. Northern blots at the same time suggested that serum might induce a decrease in total ribosomal RNA. We have carried out a number of experiments to carefully assess this possibility and now report that serum significantly reduces ribosomal RNA in Candida albicans. Fluorometric measurements, Northern blotting and quantitative RT-PCR, have all confirmed this decrease. Timed experiments show that serum induces this decrease rapidly, as it was seen in as early as five minutes. Cell mass is not decreased as total cellular protein content remains the same and metabolic activity does not appear to slow, as assessed by XTT assay, and by the observation that cells form hyphal structures robustly. Another hyphal inducer, N-acetylglucosamine, also caused RNA decrease, but to a lesser extent. We also observed it in non-germinating yeast, such as Candida glabrata. The reason for this decrease is unknown and overall our data suggests that decrease in rRNA does not play a causal role in hyphal transformation. Rapid and significant decrease in a molecule so central to the yeast's biology is of some importance, and further studies, such as its effect on protein metabolism, will be required to better understand its purpose.

  17. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    to A752 via alkyl-aryl groups linked to a carbamate at the drug 11/12 position (in the ketolide antibiotics HMR 3647 and HMR 3004). The data indicate that simultaneous drug interactions with domains II and V strengthen binding and that the domain II contact is of particular importance to achieve...

  18. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  19. The Comparative RNA Web (CRW Site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs

    Directory of Open Access Journals (Sweden)

    Müller Kirsten M

    2002-01-01

    Full Text Available Abstract Background Comparative analysis of RNA sequences is the basis for the detailed and accurate predictions of RNA structure and the determination of phylogenetic relationships for organisms that span the entire phylogenetic tree. Underlying these accomplishments are very large, well-organized, and processed collections of RNA sequences. This data, starting with the sequences organized into a database management system and aligned to reveal their higher-order structure, and patterns of conservation and variation for organisms that span the phylogenetic tree, has been collected and analyzed. This type of information can be fundamental for and have an influence on the study of phylogenetic relationships, RNA structure, and the melding of these two fields. Results We have prepared a large web site that disseminates our comparative sequence and structure models and data. The four major types of comparative information and systems available for the three ribosomal RNAs (5S, 16S, and 23S rRNA, transfer RNA (tRNA, and two of the catalytic intron RNAs (group I and group II are: (1 Current Comparative Structure Models; (2 Nucleotide Frequency and Conservation Information; (3 Sequence and Structure Data; and (4 Data Access Systems. Conclusions This online RNA sequence and structure information, the result of extensive analysis, interpretation, data collection, and computer program and web development, is accessible at our Comparative RNA Web (CRW Site http://www.rna.icmb.utexas.edu. In the future, more data and information will be added to these existing categories, new categories will be developed, and additional RNAs will be studied and presented at the CRW Site.

  20. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    Science.gov (United States)

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame.

  1. Dataset of the transcribed 45S ribosomal RNA sequence of the tree crop “yerba mate”

    Directory of Open Access Journals (Sweden)

    Patricia M. Aguilera

    2017-06-01

    Full Text Available This contribution contains data related to the research article entitled “The 18S-25S ribosomal RNA unit of yerba mate (Ilex paraguariensis A. St.-Hil.” (Aguilera et al., 2016 [1]. Through a bioinformatic approach involving NGS data, we provide information of the transcribed 45S ribosomal RNA (rRNA sequence of yerba mate, the first reference for the Ilex L. genus. This dataset (Supplementary file 1 comprises information regarding the assembly and annotation of this rRNA unit. The generated data is applicable for comparative analysis and evolutionary studies among Ilex and related taxa. The raw sequencing data used here is available at DDBJ/EMBL/GenBank (NCBI Resource Coordinators, 2016 [2] Sequence Read Archive (SRA under the accession SRP043293 and the consensus 45S ribosomal RNA sequence has been deposited there under the accession GFHV00000000.

  2. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    Science.gov (United States)

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  3. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    of the embryonic genome. In the present study, ribosomal RNA (rRNA) transcription was investigated by visualization of the rRNA by fluorescent in situ hybridization, and subsequent visualization of the argyrophilic nucleolar proteins by silver staining. A total of 145 in vivo developed and 200 in vitro produced...... bovine embryos were investigated to allow comparison of transcription initiation. Signs of active transcription of rRNA were observed in the third cell cycle in 29% of the in vitro produced embryos (n=35) and in 58% of the in vivo developed embryos (n=11). Signs of active transcription of rRNA were...... not apparent in the early phase of the fourth cell cycle but restarted later on. All embryos in the fifth or later cell cycles were all transcribing rRNA. The signs of rRNA synthesis during the third and fourth embryonic cell cycles could be blocked by actinomycin D, which is a strong inhibitor of RNA...

  4. Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction

    Science.gov (United States)

    Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard

    2017-01-01

    Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666

  5. Polynucleotide phosphorylase hinders mRNA degradation upon ribosomal protein S1 overexpression in Escherichia coli.

    Science.gov (United States)

    Briani, Federica; Curti, Serena; Rossi, Francesca; Carzaniga, Thomas; Mauri, Pierluigi; Dehò, Gianni

    2008-11-01

    The exoribonuclease polynucleotide phosphorylase (PNPase, encoded by pnp) is a major player in bacterial RNA decay. In Escherichia coli, PNPase expression is post-transcriptionally regulated at the level of mRNA stability. The primary transcript is very efficiently processed by the endonuclease RNase III at a specific site and the processed pnp mRNA is rapidly degraded in a PNPase-dependent manner. While investigating the PNPase autoregulation mechanism we found, by UV-cross-linking experiments, that the ribosomal protein S1 in crude extracts binds to the pnp-mRNA leader region. We assayed the potential role of S1 protein in pnp gene regulation by modulating S1 expression from depletion to overexpression. We found that S1 depletion led to a sharp decrease of the amount of pnp and other tested mRNAs, as detected by Northern blotting, whereas S1 overexpression caused a strong stabilization of pnp and the other transcripts. Surprisingly, mRNA stabilization depended on PNPase, as it was not observed in a pnp deletion strain. PNPase-dependent stabilization, however, was not detected by chemical decay assay of bulk mRNA. Overall, our data suggest that PNPase exonucleolytic activity may be modulated by the translation potential of the target mRNAs and that, upon ribosomal protein S1 overexpression, PNPase protects from degradation a set of full-length mRNAs. It thus appears that a single mRNA species may be differentially targeted to either decay or PNPase-dependent stabilization, thus preventing its depletion in conditions of fast turnover.

  6. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...

  7. Highly purified spermatozoal RNA obtained by a novel method indicates an unusual 28S/18S rRNA ratio and suggests impaired ribosome assembly.

    Science.gov (United States)

    Cappallo-Obermann, Heike; Schulze, Wolfgang; Jastrow, Holger; Baukloh, Vera; Spiess, Andrej-Nikolai

    2011-11-01

    Human spermatozoal RNA features special characteristics such as a significantly reduced quantity within spermatozoa compared with somatic cells is described as being devoid of ribosomal RNAs and is difficult to isolate due to a massive excess of genomic DNA in the lysates. Using a novel two-round column-based protocol for human ejaculates delivering highly purified spermatozoal RNA, we uncovered a heterogeneous, but specific banding pattern in microelectrophoresis with 28S ribosomal RNA being indicative for the amount of round cell contamination. Ejaculates with different round cell quantities and density-purified spermatozoa revealed that 18S rRNA but not 28S rRNA is inherent to a pure spermatozoal fraction. Transmission electron microscopy showed monoribosomes and polyribosomes in spermatozoal cytoplasm, while immunohistochemical results suggest the presence of proteins from small and large ribosomal subunits in retained spermatozoal cytoplasm irrespective of 28S rRNA absence.

  8. The ribosomal genes of Mycoplasma capricolum.

    Science.gov (United States)

    Muto, A; Hori, H; Sawada, M; Kawauchi, Y; Iwami, M; Yamao, F; Osawa, S

    1983-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the gene arrangement is in the order of 16S, 23S, and 5S rDNA. The ribosomes of M. capricolum contain about 30 species of proteins in 50S and 20 in 30S subunits. The number and size of the ribosomal proteins are not significantly different from those of other eubacterial ribosomes.

  9. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  10. Streptomycin binds to the decoding center of 16 S ribosomal RNA.

    Science.gov (United States)

    Spickler, C; Brunelle, M N; Brakier-Gingras, L

    1997-10-31

    Streptomycin, an error-inducing aminoglycoside antibiotic, binds to a single site on the small ribosomal subunit of bacteria, but this site has not yet been defined precisely. Here, we demonstrate that streptomycin binds to E. coli 16 S rRNA in the absence of ribosomal proteins, and protects a set of bases in the decoding region against dimethyl sulfate attack. The binding studies were performed in a high ionic strength buffer containing 20 mM Mg2+. The pattern of protection in the decoding region was similar to that observed when streptomycin binds to the 30 S subunit. However, streptomycin also protects the 915 region of 16 S rRNA within the 30 S subunit, whereas it did not protect the 915 region of the naked 16 S rRNA. The interaction of streptomycin with 16 S rRNA was further defined by using two fragments that correspond to the 3' minor domain of 16 S rRNA and to the decoding analog, a portion of this domain encompassing the decoding center. In the presence of streptomycin, the pattern of protection against dimethyl sulfate attack for the two fragments was similar to that seen with the full-length 16 S rRNA. This indicates that the 3' minor domain as well as the decoding analog contain the recognition signals for the binding of streptomycin. However, streptomycin could not bind to the decoding analog in the absence of Mg2+. This contrasts with neomycin, another error-inducing aminoglycoside antibiotic, that binds to the decoding analog in the absence of Mg2+, but not at 20 mM Mg2+. Our results suggest that both neomycin and streptomycin interact with the decoding center, but recognize alternative conformations of this region.

  11. Use of PCR primers and probes based on the 23S rRNA and internal transcription spacer (ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements.

    Science.gov (United States)

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2010-06-01

    Novel polymerase chain reaction (PCR) primers designed from the 16S-23S internal transcription spacer (ITS) rRNA and 23S rRNA genes, respectively, were used for the specific detection of Lactobacillus acidophilus and Lactobacillus plantarum. Molecular weights of the PCR products were 221 and 599 bp, respectively. Strains of L. acidophilus and L. plantarum obtained from the culture center, dairy products, infant stool and other samples, could be identified with these PCR primers. DNAs from other lactic acid bacteria (LAB) species including strains of Lactobacillus pentosus which was closely related to L. plantarum, and bacteria species other than LAB, would not generate the false positive results. When this PCR primer set was used for the detection of L. acidophilus and L. plantarum in feed supplement or feed starter samples, reliable results were obtained. Furthermore, when these L. acidophilus or L. plantarum specific primers were used as DNA probes for the colony hybridization of L. acidophilus and L. plantarum, the viable cells of these LAB species in culture and feed supplements or starter products could be identified and enumerized. The method described here thus offers a rapid and economic way to inspect and assure the quality of the feed supplements or fermentation starters.

  12. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  13. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion.

  14. Mutation of the mitochondrial large ribosomal RNA can provide pentamidine resistance to Saccharomyces cerevisiae.

    Science.gov (United States)

    Örs, Ş Tomris; Akdoğan, Emel; Dunn, Cory D

    2014-09-01

    Pentamidine is used to treat several trypanosomal diseases, as well as opportunistic infection by pathogenic fungi. However, the relevant targets of this drug are unknown. We isolated dominant mutations providing pentamidine resistance to Saccharomyces cerevisiae, one of which was localized to mitochondrial DNA. Next-generation sequencing revealed alteration of a widely conserved base at the peptidyl transferase center of the mitochondrial 21S ribosomal RNA. Our results provide a potential rationale for the toxicity of this drug to patients, and we discuss whether blockade of mitochondrial translation is the mechanism by which pathogenic fungi or protists are killed by pentamidine.

  15. Nonstop mRNA Decay: a Special Attribute of Trans-Translation Mediated Ribosome Rescue

    Directory of Open Access Journals (Sweden)

    Krithika eVenkataraman

    2014-03-01

    Full Text Available Decoding of aberrant mRNAs leads to unproductive ribosome stalling and sequestration of components of the translation machinery. Bacteria have evolved three seemingly independent pathways to resolve stalled translation complexes. The trans-translation process, orchestrated by the hybrid transfer-messenger RNA (tmRNA and its essential protein co-factor, SmpB, is the principal translation quality control system for rescuing unproductively stalled ribosomes. Two specialized alternative rescue pathways, coordinated by ArfA and ArfB, have been recently discovered. The SmpB-tmRNA mediated trans-translation pathway, in addition to re-mobilizing stalled translation complexes, co-translationally appends a degradation tag to the associated nascent polypeptides, marking them for proteolysis by various cellular proteases. Another unique feature of trans-translation, not shared by the alternative rescue pathways, is the facility to recruit RNase R for targeted degradation of nonstop mRNAs, thus preventing further futile cycles of translation. The distinct C-terminal lysine-rich (K-rich domain of RNase R is essential for its recruitment to stalled ribosomes. To gain new insights into the structure and function of RNase R, we investigated its global architecture, the spatial arrangement of its distinct domains, and the identities of key functional residues in its unique K-rich domain. Small-angle X-ray scattering (SAXS models of RNase R reveal a tri-lobed structure with flexible N- and C-terminal domains, and suggest intimate contacts between the K-rich domain and the catalytic core of the enzyme. Alanine-scanning mutagenesis of the K-rich domain, in the region spanning residues 735 and 750, has uncovered the precise amino acid determinants required for the productive engagement of RNase R on tmRNA-rescued ribosomes. Theses analyses demonstrate that alanine substitution of conserved residues E740 and K741 result in profound defects, not only in the recruitment

  16. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1999-01-01

    Streptogramin antibiotics contain two active A and B components that inhibit peptide elongation synergistically. Mutants resistant to the A component (virginiamycin M1 and pristinamycin IIA) were selected for the archaeon Halobacterium halobium. The mutations mapped to the universally conserved...... and within the bacterial cells. It is inferred that position 2058 and the sites of mutation, A2059 and A2503, are involved in the synergistic inhibition by the two antibiotics. A structural model is presented which links A2059 and A2503 and provides a structural rationale for the rRNA footprints....

  17. Structural arrangement of tRNA binding sites on Escherichia coli ribosomes, as revealed from data on affinity labelling with photoactivatable tRNA derivatives.

    Science.gov (United States)

    Graifer, D M; Babkina, G T; Matasova, N B; Vladimirov, S N; Karpova, G G; Vlassov, V V

    1989-07-01

    A systematic study of protein environment of tRNA in ribosomes in model complexes representing different translation steps was carried out using the affinity labelling of the ribosomes with tRNA derivatives bearing aryl azide groups scattered statistically over tRNA guanine residues. Analysis of the proteins crosslinked to tRNA derivatives showed that the location of the derivatives in the aminoacyl (A) site led to the labelling of the proteins S5 and S7 in all complexes studied, whereas the labelling of the proteins S2, S8, S9, S11, S14, S16, S17, S18, S19, S21 as well as L9, L11, L14, L15, L21, L23, L24, L29 depended on the state of tRNA in A site. Similarly, the location of tRNA derivatives in the peptidyl (P) site resulted in the labelling of the proteins L27, S11, S13 and S19 in all states, whereas the labelling of the proteins S5, S7, S9, S12, S14, S20, S21 as well as L2, L13, L14, L17, L24, L27, L31, L32, L33 depended on the type of complex. The derivatives of tRNA(fMet) were found to crosslink to S1, S3, S5, S7, S9, S14 and L1, L2, L7/L12, L27. Based on the data obtained, a general principle of the dynamic functioning of ribosomes has been proposed: (i) the formation of each type of ribosomal complex is accompanied by changes in mutual arrangement of proteins - 'conformational adjustment' of the ribosome - and (ii) a ribosome can dynamically change its internal structure at each step of initiation and elongation; on the 70 S ribosome there are no rigidly fixed structures forming tRNA-binding sites (primarily A and P sites).

  18. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.

    Science.gov (United States)

    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L

    2000-11-01

    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain.

  19. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  20. Studies on the control of ribosomal RNA synthesis in HeLa cells.

    Science.gov (United States)

    Chesterton, C J; Coupar, B E; Butterworth, P H; Green, M H

    1975-09-01

    In many eucaryotic systems protein synthesis is coupled to ribosomal RNA synthesis such that shut-down of the former causes inhibition of the latter. We have investigated this stringency phenomenon in HeLa cells. The protein synthesis inhibitors cycloheximide and puromycin cause inactivation of both processes but valine starvation totally inhibits only the processing of 45-S RNA. DNA-dependent RNA polymerases from A, B and C (or I, II and III respectively) were extracted, separated partially by DEAE-cellulose chromatography and their activity levels determined. These do not decrease significantly during inhibition of protein synthesis. To find out whether or not form A is bound to its template under these conditions, proteins were removed from chromatin with the detergent sarkosyl. This does not affect bound RNA polymerase. Inhibition of protein synthesis caused up to 50% reduction in endogenous alpha-amanitin-insensitive chromatin-RNA-synthesising activity. This reduced level of activity was not affected by sarkosyl treatment. Levels in normal cells were stimulated. This result indicates that the form A RNA polymerase is not bound to its template when protein synthesis is inhibited.

  1. Molecular and cytological characterization of ribosomal RNA genes in Chenopodium quinoa and Chenopodium berlandieri.

    Science.gov (United States)

    Maughan, P J; Kolano, B A; Maluszynska, J; Coles, N D; Bonifacio, A; Rojas, J; Coleman, C E; Stevens, M R; Fairbanks, D J; Parkinson, S E; Jellen, E N

    2006-07-01

    The nucleolus organizer region (NOR) and 5S ribosomal RNA (rRNA) genes are valuable as chromosome landmarks and in evolutionary studies. The NOR intergenic spacers (IGS) and 5S rRNA nontranscribed spacers (NTS) were PCR-amplified and sequenced from 5 cultivars of the Andean grain crop quinoa (Chenopodium quinoa Willd., 2n = 4x = 36) and a related wild ancestor (C. berlandieri Moq. subsp. zschackei (Murr) A. Zobel, 2n = 4x = 36). Length heterogeneity observed in the IGS resulted from copy number difference in subrepeat elements, small re arrangements, and species-specific indels, though the general sequence composition of the 2 species was highly similar. Fifteen of the 41 sequence polymorphisms identified among the C. quinoa lines were synapomorphic and clearly differentiated the highland and lowland ecotypes. Analysis of the NTS sequences revealed 2 basic NTS sequence classes that likely originated from the 2 allopolyploid subgenomes of C. quinoa. Fluorescence in situ hybridization (FISH) analysis showed that C. quinoa possesses an interstitial and a terminal pair of 5S rRNA loci and only 1 pair of NOR, suggesting a reduction in the number of rRNA loci during the evolution of this species. C. berlandieri exhibited variation in both NOR and 5S rRNA loci without changes in ploidy.

  2. Effects of ethidium bromide on the production of ribosomal RNA in cultured mouse cells.

    Science.gov (United States)

    Lange, M; May, P

    1979-06-25

    A treatment of primary mouse kidney cell cultures with 5 microM Ethidium Bromide (Eth Br) reduces the transcription of nuclear-coded genes and especially of ribosomal RNA genes. This effect was consistently observed when comparing drug-treated and control cells for (i), the incorporation of 3H uridine into total nuclear and B RNA polymerases as determined in isolated nuclei. It became more pronounced with exposure time; however, after removal of the drug, there was a progressive recovery of RNA synthesis culminating in the complete reversal of the drug effect. That this effect is probably not due only to the suppression of mitochondrial protein synthesis by the drug, is shown by a comparative study of the effects of chloramphenicol treatment. In addition, in the cytoplasm Eth Br depresses the labeling of 28 S rRNA more than that of 18 S whereas no abnormal accumulation of 28 S rRNA is observed in the nucleus. It is suggested that Eth Br may affect either the stability of the 28 S rRNA or its rate of formation from the 32 S precursor.

  3. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction...... codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  4. [Study of the photoaffinity modification of Escherichia coli ribosomes near the donor tRNA-binding center].

    Science.gov (United States)

    Bausk, E V; Graĭfer, D M; Karpova, G G

    1985-01-01

    Affinity labelling of E. coli ribosomes near the donor tRNA-binding (P) site was studied with the use of photoreactive derivatives of tRNAPhe bearing arylazidogroups on N7 atoms of guanine residues (azido-tRNA). UV-irradiation of complexes 70S ribosome.poly(U).azido- tRNA(P-site) and 70S ribosome.poly(U).azido-tRNA(P-site).Phe- tRNAPhe(A-site) resulted in covalent attachment of azido-tRNA to ribosomes, both subunits being labelled. In both cases modification extent of 30S subunit was two-fold than that of the 50S one. It was shown that when the A-site was free the azido-tRNA located in P-site labelled proteins S9, S11, S12, S13, S21 and L14, L27, L31. Azido-tRNA located in P-site when the A-site was occupied with Phe-tRNAPhe labelled proteins S11, S12, S13, S14, S19, L32/L33 and possibly L23, L25. From the comparison of the sets of proteins labelled when A-site was free or occupied a conclusion was drawn that aminoacyl-tRNA located in ribosomal A-site affects the arrangement of deacylated tRNA in P-site. Data obtained allow to propose that proteins S5, S19, S20 and L24, L33 interact with guanine residues important for the tRNA tertiary structure formation.

  5. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-09-06

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  6. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S rRNA a...

  7. Cell-Type-Specific mRNA Purification by Translating Ribosome Affinity Purification (TRAP)

    Science.gov (United States)

    Heiman, Myriam; Kulicke, Ruth; Fenster, Robert J.; Greengard, Paul; Heintz, Nathaniel

    2014-01-01

    Cellular diversity and architectural complexity create barriers to understanding the function of the mammalian central nervous system (CNS) at a molecular level. To address this problem, we recently developed a methodology that provides the ability to profile the entire translated mRNA complement of any genetically defined cell population. This methodology, which we termed translating ribosome affinity purification, or TRAP, combines cell-type-specific transgene expression with affinity purification of translating ribosomes. TRAP can be used to study the cell-type-specific mRNA profiles of any genetically defined cell type, and has been successfully used to date in organisms ranging from D. melanogaster to mice and human cultured cells. Unlike other methodologies that rely upon micro-dissection, cell panning, or cell sorting, the TRAP methodology bypasses the need for tissue fixation or single-cell suspensions (and potential artifacts these treatments introduce), and reports on mRNAs in the entire cell body. This protocol provides a step-by-step guide to implementing the TRAP methodology, which takes two days to complete once all materials are in hand. PMID:24810037

  8. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  9. Translational regulation via L11: Molecular switches on the ribosome turned on and off by thiostrepton and micrococcin

    OpenAIRE

    M Harms, J.; Wilson, D. N.; Schluenzen, F.; Connell, S. R.; Stachelhaus, T.; Zaborowska, Z.; Spahn, C. M. T.; Fucini, P.

    2008-01-01

    The thiopeptide class of antibiotics targets the GTPase-associated center (GAC) of the ribosome to inhibit translation factor function. Using X-ray crystallography, we have determined the binding sites of thiostrepton (Thio), nosiheptide (Nosi), and micrococcin (Micro), on the Deinococcus radiodurans large ribosomal subunit. The thiopeptides, by binding within a cleft located between the ribosomal protein L11 and helices 43 and 44 of the 23S rRNA, overlap with the position of domain V of EF-G...

  10. [Study of the mRNA-binding region of ribosomes at different steps of translation. II. Affinity modification of Escherichia coli ribosomes by benzylidene derivative of AUGU6 in the 70S initiation complex].

    Science.gov (United States)

    Babkina, G T; Karpova, G G; Matasova, N B; Berzin', V M; Gren, E Ia

    1985-01-01

    2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.

  11. Ribosomal RNA gene diversity, effective population size, and evolutionary longevity in asexual glomeromycota.

    Science.gov (United States)

    Vankuren, Nicholas W; den Bakker, Henk C; Morton, Joseph B; Pawlowska, Teresa E

    2013-01-01

    Arbuscular mycorrhizal fungi (phylum Glomeromycota) are among the oldest and most successful symbionts of land plants. With no evidence of sexual reproduction, their evolutionary success is inconsistent with the prediction that asexual taxa are vulnerable to extinction due to accumulation of deleterious mutations. To explore why Glomeromycota defy this prediction, we studied ribosomal RNA (rRNA) gene evolution in the Claroideoglomus lineage and estimated effective population size, N(e) , in C. etunicatum. We found that rRNA genes of these fungi exhibit unusual and complex patterns of molecular evolution. In C. etunicatum, these patterns can be collectively explained by an unexpectedly large N(e) combined with imperfect genome-wide and population-level rRNA gene repeat homogenization. The mutations accumulated in rRNA gene sequences indicate that natural selection is effective at purging deleterious mutations in the Claroideoglomus lineage, which is also consistent with the large N(e) of C. etunicatum. We propose that in the near absence of recombination, asexual reproduction involving massively multinucleate spores typical for Glomeromycota is responsible for the improved efficacy of selection relative to drift. We postulate that large effective population sizes contribute to the evolutionary longevity of Glomeromycota.

  12. The putative RNA helicase HELZ promotes cell proliferation, translation initiation and ribosomal protein S6 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Philippe A Hasgall

    Full Text Available The hypoxia-inducible transcription factor (HIF is a key component of the cellular adaptation mechanisms to hypoxic conditions. HIFα subunits are degraded by prolyl-4-hydroxylase domain (PHD enzyme-dependent prolyl-4-hydroxylation of LxxLAP motifs that confer oxygen-dependent proteolytic degradation. Interestingly, only three non-HIFα proteins contain two conserved LxxLAP motifs, including the putative RNA helicase with a zinc finger domain HELZ. However, HELZ proteolytic regulation was found to be oxygen-independent, supporting the notion that a LxxLAP sequence motif alone is not sufficient for oxygen-dependent protein destruction. Since biochemical pathways involving RNA often require RNA helicases to modulate RNA structure and activity, we used luciferase reporter gene constructs and metabolic labeling to demonstrate that HELZ overexpression activates global protein translation whereas RNA-interference mediated HELZ suppression had the opposite effect. Although HELZ interacted with the poly(A-binding protein (PABP via its PAM2 motif, PABP was dispensable for HELZ function in protein translation. Importantly, downregulation of HELZ reduced translational initiation, resulting in the disassembly of polysomes, in a reduction of cell proliferation and hypophosphorylation of ribosomal protein S6.

  13. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Science.gov (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps.

  14. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  15. Recognizing RNA structural motifs in HT-SELEX data for ribosomal protein S15.

    Science.gov (United States)

    Pei, Shermin; Slinger, Betty L; Meyer, Michelle M

    2017-06-06

    Proteins recognize many different aspects of RNA ranging from single stranded regions to discrete secondary or tertiary structures. High-throughput sequencing (HTS) of in vitro selected populations offers a large scale method to study RNA-proteins interactions. However, most existing analysis methods require that the binding motifs are enriched in the population relative to earlier rounds, and that motifs are found in a loop or single stranded region of the potential RNA secondary structure. Such methods do not generalize to all RNA-protein interaction as some RNA binding proteins specifically recognize more complex structures such as double stranded RNA. In this study, we use HT-SELEX derived populations to study the landscape of RNAs that interact with Geobacillus kaustophilus ribosomal protein S15. Our data show high sequence and structure diversity and proved intractable to existing methods. Conventional programs identified some sequence motifs, but these are found in less than 5-10% of the total sequence pool. Therefore, we developed a novel framework to analyze HT-SELEX data. Our process accounts for both sequence and structure components by abstracting the overall secondary structure into smaller substructures composed of a single base-pair stack, which allows us to leverage existing approaches already used in k-mer analysis to identify enriched motifs. By focusing on secondary structure motifs composed of specific two base-pair stacks, we identified significantly enriched or depleted structure motifs relative to earlier rounds. Discrete substructures are likely to be important to RNA-protein interactions, but they are difficult to elucidate. Substructures can help make highly diverse sequence data more tractable. The structure motifs provide limited accuracy in predicting enrichment suggesting that G. kaustophilus S15 can either recognize many different secondary structure motifs or some aspects of the interaction are not captured by the analysis. This

  16. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    Science.gov (United States)

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species.

  17. The bacterial toxin RelE induces specific mRNA cleavage in the A site of the eukaryote ribosome

    Science.gov (United States)

    Andreev, Dmitri; Hauryliuk, Vasili; Terenin, Ilya; Dmitriev, Sergey; Ehrenberg, Måns; Shatsky, Ivan

    2008-01-01

    RelE/RelB is a well-characterized toxin–anti-toxin pair involved in nutritional stress responses in Bacteria and Archae. RelE lacks any eukaryote homolog, but we demonstrate here that it efficiently and specifically cleaves mRNA in the A site of the eukaryote ribosome. The cleavage mechanism is similar to that in bacteria, showing the feasibility of A-site cleavage of mRNA for regulatory purposes also in eukaryotes. RelE cleavage in the A-site codon of a stalled eukaryote ribosome is precise and easily monitored, making “RelE printing” a useful complement to toeprinting to determine the exact mRNA location on the eukaryote ribosome and to probe the occupancy of its A site. PMID:18083838

  18. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  19. Removal of ribosomal subunits (and rRNA) from cytoplasmic extracts before solubilization with SDS and deproteinization.

    Science.gov (United States)

    Rio, Donald C; Ares, Manuel; Hannon, Gregory J; Nilsen, Timothy W

    2010-06-01

    More than 95% of total RNA is composed of ribosomal RNAs (rRNAs) (28S, 18S, 5.8S, and 5S). Here, we present a method that is effective in removing rRNA before extraction and purification of total RNA. If you choose to prepare cytoplasmic RNA and wish to analyze any RNA other than rRNA, it is desirable to eliminate the rRNAs by taking advantage of the fact that the ribosomal subunits are very large (40S and 60S). Few, if any, other cellular RNAs are present in such large macromolecular complexes. The vast majority of rRNAs can be removed by sedimentation. Of course, steps must be taken to avoid co-sedimentation of desired RNAs. Co-sedimentation can be greatly reduced by first dissociating ribosomes into their respective subunits by EDTA treatment. The subunits are then "cleaned" by treatment with high salt and nonionic detergent. Ribosomal subunits remain intact under these conditions and can be sedimented free of other RNAs. Subsequently, the remaining RNAs (messenger RNAs [mRNAs] and all other RNAs) can be purified and analyzed by a variety of methods.

  20. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    Science.gov (United States)

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  1. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  2. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  3. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  4. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Science.gov (United States)

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis.

  5. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Science.gov (United States)

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  6. 16S rRNA、16S-23S rRNA基因测序分析检测主要血流感染病原菌比较%Comparison of the role of 16S rRNA and 16S-23S rRNA gene sequence-based identification of bacteria in bloodsteam infection

    Institute of Scientific and Technical Information of China (English)

    金中淦; 葛平; 徐蓉; 陈蓉; 宣瑛; 刘学杰; 王庆忠

    2012-01-01

    目的 比较细菌16S rRNA、16S-23S rRNA基因测序分析在血流感染病原菌检测中的作用.方法 提取临床上血流感染常见的金黄色葡萄菌、表皮葡萄球菌、大肠埃希菌、粪肠球菌、肺炎链球菌、铜绿假单胞菌、阴沟肠杆菌、鲍曼不动杆菌、洛菲不动杆菌、肺炎克雷伯杆菌、化脓性链球菌、奇异变形杆菌、潘尼变形杆菌、屎肠球菌、粘质沙雷菌、宋内志贺菌、产气肠杆菌、小肠结肠炎耶尔森菌、腐生葡萄球菌基因组DNA,运用16S rRNA、16S-23S rRNA基因进行PCR扩增.扩增产物经测序后在美国国家生物技术中心( NCBI)上进行比对分析,确定菌种.结果 在所分析的19种临床血流感染常见细菌中,16S rRNA基因测序分析可将除粘质沙雷菌外的细菌鉴定到种的水平,但无法完全区分近缘种属;16S-23SrRNA成功鉴定17种细菌,除大肠埃希菌、宋内志贺菌外所有细菌均成功鉴定到单一种的水平.结论 16S-23S rRNA基因可作为血流感染细菌检测较好的分子靶标.

  7. Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli.

    Science.gov (United States)

    Knutsson Jenvert, Rose-Marie; Holmberg Schiavone, Lovisa

    2005-02-01

    Stringent factor is a ribosome-dependent ATP:GTP pyrophosphoryl transferase that synthesizes (p)ppGpp upon nutrient deprivation. It is activated by unacylated tRNA in the ribosomal amino-acyl site (A-site) but it is unclear how activation occurs. A His-tagged stringent factor was isolated by affinity-chromatography and precipitation. This procedure yielded a protein of high purity that displayed (a) a low endogenous pyrophosphoryl transferase activity that was inhibited by the antibiotic tetracycline; (b) a low ribosome-dependent activity that was inhibited by the A-site specific antibiotics thiostrepton, micrococcin, tetracycline and viomycin; (c) a tRNA- and ribosome-dependent activity amounting to 4500 pmol pppGpp per pmol stringent factor per minute. Footprinting analysis showed that stringent factor interacted with ribosomes that contained tRNAs bound in classical states. Maximal activity was seen when the ribosomal A-site was presaturated with unacylated tRNA. Less tRNA was required to reach maximal activity when stringent factor and unacylated tRNA were added simultaneously to ribosomes, suggesting that stringent factor formed a complex with tRNA in solution that had higher affinity for the ribosomal A-site. However, tRNA-saturation curves, performed at two different ribosome/stringent factor ratios and filter-binding assays, did not support this hypothesis.

  8. Model of EF4-induced ribosomal state transitions and mRNA translocation

    Science.gov (United States)

    Xie, Ping

    2014-08-01

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region.

  9. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    DEFF Research Database (Denmark)

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J

    2016-01-01

    Ribose methylation is one of the two most abundant modifications in human ribosomal RNA and is believed to be important for ribosome biogenesis, mRNA selectivity and translational fidelity. We have applied RiboMeth-seq to rRNA from HeLa cells for ribosome-wide, quantitative mapping of 2'-O-Me sites...... and obtained a comprehensive set of 106 sites, including two novel sites, and with plausible box C/D guide RNAs assigned to all but three sites. We find approximately two-thirds of the sites to be fully methylated and the remainder to be fractionally modified in support of ribosome heterogeneity at the level...

  10. RACK1 is a ribosome scaffold protein for β-actin mRNA/ZBP1 complex.

    Directory of Open Access Journals (Sweden)

    Marcello Ceci

    Full Text Available In neurons, specific mRNAs are transported in a translationally repressed manner along dendrites or axons by transport ribonucleic-protein complexes called RNA granules. ZBP1 is one RNA binding protein present in transport RNPs, where it transports and represses the translation of cotransported mRNAs, including β-actin mRNA. The release of β-actin mRNA from ZBP1 and its subsequent translation depends on the phosphorylation of ZBP1 by Src kinase, but little is known about how this process is regulated. Here we demonstrate that the ribosomal-associated protein RACK1, another substrate of Src, binds the β-actin mRNA/ZBP1 complex on ribosomes and contributes to the release of β-actin mRNA from ZBP1 and to its translation. We identify the Src binding and phosphorylation site Y246 on RACK1 as the critical site for the binding to the β-actin mRNA/ZBP1 complex. Based on these results we propose RACK1 as a ribosomal scaffold protein for specific mRNA-RBP complexes to tightly regulate the translation of specific mRNAs.

  11. The effect of aminoacyl- or peptidyl-tRNA at the A-site on the arrangement of deacylated tRNA at the ribosomal P-site.

    Science.gov (United States)

    Babkina, G T; Bausk, E V; Graifer, D M; Karpova, G G; Matasova, N B

    1984-05-21

    Photoreactive derivatives of E. coli tRNAPhe bearing arylazido groups on guanine residues (azido-tRNA) were used for affinity labelling of E. coli ribosomes in the region of the P-site when the A-site was either free or occupied by aminoacyl- or peptidyl-tRNA. Corresponding complexes of azido-tRNA with ribosomes and poly(U) were obtained both nonenzymatically and with the use of elongation factors. UV-irradiation of the complexes resulted in labelling of ribosomal proteins (preferentially of 30 S subunit). Proteins S9 and S21 were labelled only when the A-site was free; S14 - only when it was occupied; S11, S13, S19 - in both cases; S5, S7, S12, S20 - in some states.

  12. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Science.gov (United States)

    Whitford, Paul C; Blanchard, Scott C; Cate, Jamie H D; Sanbonmatsu, Karissa Y

    2013-01-01

    Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds) to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  13. Basonuclin regulates a subset of ribosomal RNA genes in HaCaT cells.

    Directory of Open Access Journals (Sweden)

    Shengliang Zhang

    Full Text Available Basonuclin (Bnc1, a cell-type-specific ribosomal RNA (rRNA gene regulator, is expressed mainly in keratinocytes of stratified epithelium and gametogenic cells of testis and ovary. Previously, basonuclin was shown in vitro to interact with rRNA gene (rDNA promoter at three highly conserved sites. Basonuclin's high affinity binding site overlaps with the binding site of a dedicated and ubiquitous Pol I transcription regulator, UBF, suggesting that their binding might interfere with each other if they bind to the same promoter. Knocking-down basonuclin in mouse oocytes eliminated approximately one quarter of RNA polymerase I (Pol I transcription foci, without affecting the BrU incorporation of the remaining ones, suggesting that basonuclin might regulate a subset of rDNA. Here we show, via chromatin immunoprecipitation (ChIP, that basonuclin is associated with rDNA promoters in HaCaT cells, a spontaneously established human keratinocyte line. Immunoprecipitation data suggest that basonuclin is in a complex that also contains the subunits of Pol I (RPA194, RPA116, but not UBF. Knocking-down basonuclin in HaCaT cells partially impairs the association of RPA194 to rDNA promoter, but not that of UBF. Basonuclin-deficiency also reduces the amount of 47S pre-rRNA, but this effect can be seen only after cell-proliferation related rRNA synthesis has subsided at a higher cell density. DNA sequence of basonuclin-bound rDNA promoters shows single nucleotide polymorphisms (SNPs that differ from those associated with UBF-bound promoters, suggesting that basonuclin and UBF interact with different subsets of promoters. In conclusion, our results demonstrate basonuclin's functional association with rDNA promoters and its interaction with Pol I in vivo. Our data also suggest that basonuclin-Pol I complex transcribes a subset of rDNA.

  14. Genetic characterization of clinical acanthamoeba isolates from Japan using nuclear and mitochondrial small subunit ribosomal RNA.

    Science.gov (United States)

    Rahman, Md Moshiur; Yagita, Kenji; Kobayashi, Akira; Oikawa, Yosaburo; Hussein, Amjad I A; Matsumura, Takahiro; Tokoro, Masaharu

    2013-08-01

    Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear sub-conformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.

  15. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  16. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  17. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of Haeckel's Radiolaria.

    Science.gov (United States)

    Polet, Stephane; Berney, Cédric; Fahrni, José; Pawlowski, Jan

    2004-03-01

    In his grand monograph of Radiolaria, Ernst Haeckel originally included Phaeodarea together with Acantharea and Polycystinea, all three taxa characterized by the presence of a central capsule and the possession of axopodia. Cytological and ultrastructural studies, however, questioned the monophyly of Radiolaria, suggesting an independent evolutionary origin of the three taxa, and the first molecular data on Acantharea and Polycystinea brought controversial results. To test further the monophyly of Radiolaria, we sequenced the complete small subunit ribosomal RNA gene of three phaeodarians and three polycystines. Our analyses reveal that phaeodarians clearly branch among the recently described phylum Cercozoa, separately from Acantharea and Polycystinea. This result enhances the morphological variability within the phylum Cercozoa, which already contains very heterogeneous groups of protists. Our study also confirms the common origin of Acantharea and Polycystinea, which form a sister-group to the Cercozoa, and allows a phylogenetic reinterpretation of the morphological features of the three radiolarian groups.

  18. Ribosome-associated GTPases: the role of RNA for GTPase activation.

    Science.gov (United States)

    Clementi, Nina; Polacek, Norbert

    2010-01-01

    The GTPase super-family comprises a variety of G proteins found in all three domains of life. Although they are participating in completely different processes like signal transduction, protein biosynthesis and regulation of cell proliferation, they all share a highly conserved G domain and use a common mechanism for GTP hydrolysis. Exact timing in hydrolyzing the bound GTP serves as a molecular switch to initiate diverse cellular reactions. Classical GTPases depend on external proteins to fire GTP hydrolysis (GAPs), and following the GTPase reaction to exchange GDP for GTP (GEFs), converting the GTPase into the active state again. In recent years it became clear that there are many GTPases that do not follow this classical switch mode scheme. Certain ribosome-associated GTPases are not reliant on other GEF proteins to exchange GDP for GTP. Furthermore many of these G proteins are not activated by external GAPs, but by evolutionarily ancient molecules, namely by RNA.

  19. Routine forensic use of the mitochondrial 12S ribosomal RNA gene for species identification.

    Science.gov (United States)

    Melton, Terry; Holland, Charity

    2007-11-01

    Since July 2004, Mitotyping Technologies has been amplifying and sequencing a approximately 150 base pair fragment of mitochondrial DNA (mtDNA) that codes for 12S ribosomal RNA, to identify the species origin of nonhuman casework samples. The approximately 100 base pair sequence product is searched at http://www.ncbi.nlm.nih.gov/BLAST and the species match is reported. The use of this assay has halved the number of samples for which no mtDNA results are obtained and is especially useful on hairs and degraded samples. The availability of species determination may aid forensic investigators in opening or closing off lines of inquiry where a highly probative but challenging sample has been collected.

  20. 微孢子虫核糖体小亚单位RNA(ssUrRNA)基因%Small Subunit Ribosomal RNA Genes of Microsporidia

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威; 毛西成; 赵 昀; 陆长德

    2001-01-01

    微孢子虫是广泛分布于自然界的细胞内原虫类寄生物。它们可寄生于整个生物界。微孢子虫是真核生物,但其核糖体及核糖体RNA(rRNA)为原核生物型。为探讨9种家蚕病原性微孢子虫的种属地位及亲缘关系,对已广泛用于生物进化分类的核糖体小亚单位RNA(asurRNA)基因进行了研究。由微孢子虫ssurRNA基因序列同源性分析所构建的系统进化发育树及Southam杂交分析表明,这9种微孢子虫同为Nosema属,为同属不同种。%Microsporidia are ubiquitous intracellular parasitic protozoa infecting all types of animals. Their ribosomes and rRNAs are of prokaryotic size. In order to better understand their phylogenetic relationship and identify the uncertain species, the sequences of the small subunit ribosomal RNA (ssurRNA, 16 S rRNA) genesof nine microsporidia infectious to the silkworm, Bombyx mori, were determined. The results of phylogenetic trees and Southern blotting suggest all the nine strains of icrosporidia are various species of the genus Nosema.

  1. Terminal-sequence studies of high-molecular-weight ribonucleic acid. The 3'-termini of rabbit reticulocyte ribosomal RNA.

    Science.gov (United States)

    Hunt, J A

    1970-11-01

    Sequences of the polynucleotide chains of RNA found in the large and small ribosomal subunits of rabbit reticulocytes have been determined from the 3'-end by use of periodate oxidation and condensation with [(3)H]isoniazid and by stepwise degradation. By these methods the hexanucleotide sequences have been found as -pGpUpUpUpGpU for the 28S RNA and -pGpUpCpGpCpU for the 6S RNA of the large ribosomal subunit and the octanucleotide sequence -pGpApUpCpApUpUpA for the 18S rRNA of the small ribosomal subunit. These sequences are present in at least 70% of all the RNA molecules and are discussed in relation to the specific cleavage of rRNA from its precursors and the role of multiple cistrons for rRNA in the DNA of higher organisms. The feasibility of using the method for longer sequence determinations is discussed.

  2. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  3. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  4. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  5. Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids.

    Science.gov (United States)

    Shalchian-Tabrizi, Kamran; Minge, Marianne A; Cavalier-Smith, Tom; Nedreklepp, Joachim M; Klaveness, Dag; Jakobsen, Kjetill S

    2006-01-01

    Dinoflagellates harbour diverse plastids obtained from several algal groups, including haptophytes, diatoms, cryptophytes, and prasinophytes. Their major plastid type with the accessory pigment peridinin is found in the vast majority of photosynthetic species. Some species of dinoflagellates have other aberrantly pigmented plastids. We sequenced the nuclear small subunit (SSU) ribosomal RNA (rRNA) gene of the "green" dinoflagellate Gymnodinium chlorophorum and show that it is sister to Lepidodinium viride, indicating that their common ancestor obtained the prasinophyte (or other green alga) plastid in one event. As the placement of dinoflagellate species that acquired green algal or haptophyte plastids is unclear from small and large subunit (LSU) rRNA trees, we tested the usefulness of the heat shock protein (Hsp) 90 gene for dinoflagellate phylogeny by sequencing it from four species with aberrant plastids (G. chlorophorum, Karlodinium micrum, Karenia brevis, and Karenia mikimotoi) plus Alexandrium tamarense, and constructing phylogenetic trees for Hsp90 and rRNAs, separately and together. Analyses of the Hsp90 and concatenated data suggest an ancestral origin of the peridinin-containing plastid, and two independent replacements of the peridinin plastid soon after the early radiation of the dinoflagellates. Thus, the Hsp90 gene seems to be a promising phylogenetic marker for dinoflagellate phylogeny.

  6. Analysis of the interaction between bovine mitochondrial 28 S ribosomal subunits and mRNA.

    Science.gov (United States)

    Farwell, M A; Schirawski, J; Hager, P W; Spremulli, L L

    1996-11-11

    The small subunit of the bovine mitochondrial ribosome forms a tight complex with mRNAs. This [28 S:mRNA] complex forms as readily on circular mRNAs as on linear mRNAs indicating that a free 5' end on the mRNA is not required for the interaction observed. The effects of monovalent cations on the equilibrium association constant and on the forward and reverse rate constants governing this interaction have been determined. Monovalent cations have a strong effect on the forward rate constant. Increasing the KCl concentration from 1 mM to 100 mM reduces kon by nearly 100-fold. Monovalent cations have only a small effect on the reverse rate constant, koff'. Analysis of these data indicates that the rate laws governing the formation and dissociation of the [28 S:mRNA] complex cannot be deduced from the chemical equation. This observation suggests that there are "hidden intermediates' in the formation and dissociation of this complex. The implications of these observations are discussed in terms of a model for the interaction between the mitochondrial 28 S subunit and mRNAs.

  7. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  8. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  9. Bypassing rRNA methylation by RsmA/Dim1during ribosome maturation in the hyperthermophilic archaeon Nanoarchaeum equitans

    DEFF Research Database (Denmark)

    Seistrup, Kenneth H; Rose, Simon; Birkedal, Ulf

    2017-01-01

    In all free-living organisms a late-stage checkpoint in the biogenesis of the small ribosomal subunit involves rRNA modification by an RsmA/Dim1 methyltransferase. The hyperthermophilic archaeon Nanoarchaeum equitans, whose existence is confined to the surface of a second archaeon, Ignicoccus hos...

  10. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    . Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...... of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all...

  11. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  12. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    OpenAIRE

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  13. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation.

  14. Photoinduced cross-linkage, in situ, of Escherichia coli 30S ribosomal proteins to 16S rRNA: identification of cross-linked proteins and relationships between reactivity and ribosome structure.

    Science.gov (United States)

    Gorelic, L

    1976-08-10

    The kinetics of photoinduced cross-linkage of Escherichia coli 30S ribosomal proteins to the 16S-rRNA molecule in the intact Escherichia coli 30S ribosomal subunit was studied in this report. All of the 30S ribosomal proteins become cross-linked to the 16S rRNA before changes in the sedimentation characteristics of the 30S ribosomal subunit can be detected. The proteins exhibit different reactivities in the cross-linkage reaction. One group of proteins-S3, S7-S9, S11, S12, and S15-S19-is cross-linked to the 16S rRNA by single-hit kinetics, or by photoprocesses of nonunity but low multiplicities. A second group of proteins--S1, S2, S4-S6, S10, S13, S14, and S21--is cross-linked to the 16S rRNA by photoprocesses of a complex nature. A comparison of these data with other properties of the individual 30S ribosomal proteins related to ribosome structure indicated that most of the 30S ribosomal proteins cross-linked to the 16S rRNA by photoprocesses of low multiplicities had been classified rRNA-binding proteins by nonphotochemical methods, and most of the proteins cross-linked to the 16S rRNA by photoprocesses of large multiplicities had been classified as nonbinding proteins. There were certain exceptions to these correlations. Proteins S4 and S20, both RNA-binding proteins, become cross-linked to the 16S rRNA by photoprocessses of large multiplicities, and proteins S3, S11, S12, and S18, none of which have been classified RNA-binding proteins, exhibited low multiplicities in the cross-linkage reaction. All of these exceptions could be explained in terms of limitations inherent in the photochemical methods used in this study and in other types of methods that have been used to study RNA-protein interactions in the 30S ribosomal subunit. The data presented here also suggest that labile RNA-protein cross-links are present in the uv-irradiated 30S ribosomal subunits, and that neither peptide-bond cleavage nor photoinduced modification of the charged side-chain groups in

  15. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    OpenAIRE

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  16. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  17. 18S ribosomal RNA gene sequences of Cochliopodium (Himatismenida) and the phylogeny of Amoebozoa.

    Science.gov (United States)

    Kudryavtsev, Alexander; Bernhard, Detlef; Schlegel, Martin; Chao, Ema E Y; Cavalier-Smith, Thomas

    2005-08-01

    Cochliopodium is a very distinctive genus of discoid amoebae covered by a dorsal tectum of carbohydrate microscales. Its phylogenetic position is unclear, since although sharing many features with naked "gymnamoebae", the tectum sets it apart. We sequenced 18S ribosomal RNA genes from three Cochliopodium species (minus, spiniferum and Cochliopodium sp., a new species resembling C. minutum). Phylogenetic analysis shows Cochliopodium as robustly holophyletic and within Amoebozoa, in full accord with morphological data. Cochliopodium is always one of the basal branches within Amoebozoa but its precise position is unstable. In Bayesian analysis it is sister to holophyletic Glycostylida, but distance trees mostly place it between Dermamoeba and a possibly artifactual long-branch cluster including Thecamoeba. These positions are poorly supported and basal amoebozoan branching ill-resolved, making it unclear whether Discosea (Glycostylida, Himatismenida, Dermamoebida) is holophyletic; however, Thecamoeba seems not specifically related to Dermamoeba. We also sequenced the small-subunit rRNA gene of Vannella persistens, which constantly grouped with other Vannella species, and two Hartmannella strains. Our trees suggest that Vexilliferidae, Variosea and Hartmannella are polyphyletic, confirming the existence of two very distinct Hartmannella clades: that comprising H. cantabrigiensis and another divergent species is sister to Glaeseria, whilst Hartmannella vermiformis branches more deeply.

  18. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants.

  19. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  20. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  1. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  2. Evidence for compensatory evolution of ribosomal proteins in response to rapid divergence of mitochondrial rRNA.

    Science.gov (United States)

    Barreto, Felipe S; Burton, Ronald S

    2013-02-01

    Rapid evolution of mitochondrial DNA (mtDNA) places intrinsic selective pressures on many nuclear genes involved in mitochondrial functions. Mitochondrial ribosomes, for example, are composed of mtDNA-encoded ribosomal RNAs (rRNAs) and a set of more than 60 nuclear-encoded ribosomal proteins (mRP) distinct from the cytosolic RPs (cRP). We hypothesized that the rapid divergence of mt-rRNA would result in rapid evolution of mRPs relative to cRPs, which respond to slowly evolving nuclear-encoded rRNA. In comparisons of rates of nonsynonymous and synonymous substitutions between a pair of divergent populations of the copepod Tigriopus californicus, we found that mRPs showed elevated levels of amino acid changes relative to cRPs. This pattern was equally strong at the interspecific level, between three pairs of sister species (Nasonia vitripennis vs. N. longicornis, Drosophila melanogaster vs. D. simulans, and Saccharomyces cerevisae vs. S. paradoxus). This high rate of mRP evolution may result in intergenomic incompatibilities between taxonomic lineages, and such incompatibilities could lead to dysfunction of mitochondrial ribosomes and the loss of fitness observed among interpopulation hybrids in T. californicus and interspecific hybrids in other species.

  3. Covalent crosslinking of tRNA1Val to 16S RNA at the ribosomal P site: identification of crosslinked residues.

    Science.gov (United States)

    Prince, J B; Taylor, B H; Thurlow, D L; Ofengand, J; Zimmermann, R A

    1982-09-01

    N-Acetylvalyl-tRNA1Val (AcVal-tRNA1Val) was bound to the P site of uniformly 32P-labeled 70S ribosomes from Escherichia coli and crosslinked to 16S RNA in the 30S ribosomal subunit by irradiation with light of 300-400 nm. To identify the crosslinked nucleotide in 16S RNA. AcVal-tRNA1Val-16S [32P]RNA was digested completely with RNase T1 and the band containing the covalently attached oligonucleotides from tRNA and rRNA was isolated by polyacrylamide gel electrophoresis. The crosslinked oligonucleotide, and the 32P-labeled rRNA moiety released from it by photoreversal of the crosslink at 254 nm, were then analyzed by secondary hydrolysis with pancreatic RNase A and RNase U2. The oligonucleotide derived from 16S RNA was found to be the evolutionarily conserved sequence, U-A-C-A-C-A-C-C-G1401, and the nucleotide crosslinked to tRNA1Val, C1400. The identity of the covalently attached residue in the tRNA was established by using AcVal-tRNA1Val-16S RNA prepared from unlabeled ribosomes. This complex was digested to completion with RNase T1 and the resulting RNA fragments were labeled at the 3' end with [5'-32P]pCp. The crosslinked T1 oligonucleotide isolated from the mixture yielded one major end-labeled component upon photoreversal. Chemical sequence analysis demonstrated that this product was derived from the anticodon-containing pentadecanucleotide of tRNA1Val, C-A-C-C-U-C-C-C-U-cmo5U-A-C-m6A-A-G39(cmo5U, 5-carboxymethoxyuridine). A similar study of the crosslinked oligonucleotide revealed that the residue covalently bound to 16S was cmo5U34, the 5' or wobble base of the anticodon. The adduct is believed to result from formation of a cyclobutane dimer between cmo5U34 of tRNA1Val and C1400 of the 16S RNA.

  4. Combined large and small subunit ribosomal RNA phylogenies support a basal position of the acoelomorph flatworms.

    Science.gov (United States)

    Telford, Maximilian J; Lockyer, Anne E; Cartwright-Finch, Chloë; Littlewood, D Timothy J

    2003-05-22

    The phylogenetic position of the phylum Platyhelminthes has been re-evaluated in the past decade by analysis of diverse molecular datasets. The consensus is that the Rhabditophora + Catenulida, which includes most of the flatworm taxa, are not primitively simple basal bilaterians but are related to coelomate phyla such as molluscs. The status of two other groups of acoelomate worms, Acoela and Nemertodermatida, is less clear. Although many characteristics unite these two groups, initial molecular phylogenetic studies placed the Nemertodermatida within the Rhabditophora, but placed the Acoela at the base of the Bilateria, distant from other flatworms. This contradiction resulted in scepticism about the basal position of acoels and led to calls for further data. We have sequenced large subunit ribosomal RNA genes from 13 rhabditophorans + catenulids, three acoels and one nemertodermatid, tripling the available data. Our analyses strongly support a basal position of both acoels and nemertodermatids. Alternative hypotheses are significantly less well supported by the data. We conclude that the Nemertodermatida and Acoela are basal bilaterians and, owing to their unique body plan and embryogenesis, should be recognized as a separate phylum, the Acoelomorpha.

  5. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  6. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  7. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Science.gov (United States)

    Wu, Jianguo; Zhang, Ying; Wang, Yingshuang; Kong, Ruirui; Hu, Lelin; Schuele, Roland; Du, Xiaojuan; Ke, Yang

    2012-01-01

    NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA) is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA) directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs) were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  8. Transcriptional repressor NIR functions in the ribosome RNA processing of both 40S and 60S subunits.

    Directory of Open Access Journals (Sweden)

    Jianguo Wu

    Full Text Available BACKGROUND: NIR was identified as an inhibitor of histone acetyltransferase and it represses transcriptional activation of p53. NIR is predominantly localized in the nucleolus and known as Noc2p, which is involved in the maturation of the 60S ribosomal subunit. However, how NIR functions in the nucleolus remains undetermined. In the nucleolus, a 47S ribosomal RNA precursor (pre-rRNA is transcribed and processed to produce 18S, 5.8S and 28S rRNAs. The 18S rRNA is incorporated into the 40S ribosomal subunit, whereas the 28S and 5.8S rRNAs are incorporated into the 60S subunit. U3 small nucleolar RNA (snoRNA directs 18S rRNA processing and U8 snoRNA mediates processing of 28S and 5.8 S rRNAs. Functional disruption of nucleolus often causes p53 activation to inhibit cell proliferation. METHODOLOGY/PRINCIPAL FINDINGS: Western blotting showed that NIR is ubiquitously expressed in different human cell lines. Knock-down of NIR by siRNA led to inhibition of the 18S, 28S and 5.8S rRNAs evaluated by pulse-chase experiment. Pre-rRNA particles (pre-rRNPs were fractionated from the nucleus by sucrose gradient centrifugation and analysis of the pre-RNPs components showed that NIR existed in the pre-RNPs of both the 60S and 40S subunits and co-fractionated with 32S and 12S pre-rRNAs in the 60S pre-rRNP. Protein-RNA binding experiments demonstrated that NIR is associated with the 32S pre-rRNA and U8 snoRNA. In addition, NIR bound U3 snoRNA. It is a novel finding that depletion of NIR did not affect p53 protein level but de-repressed acetylation of p53 and activated p21. CONCLUSIONS: We provide the first evidence for a transcriptional repressor to function in the rRNA biogenesis of both the 40S and 60S subunits. Our findings also suggested that a nucleolar protein may alternatively signal to p53 by affecting the p53 modification rather than affecting p53 protein level.

  9. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    Energy Technology Data Exchange (ETDEWEB)

    Liu, X (Washington State University); Mann, David B.(ASSOC WESTERN UNIVERSITY); Suquet, C (Washington State University); Springer, David L.(BATTELLE (PACIFIC NW LAB)); Smerdon, Michael J.(VISITORS)

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  10. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  11. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences.

    Science.gov (United States)

    Allsopp, M; Visser, E S; du Plessis, J L; Vogel, S W; Allsopp, B A

    1997-08-01

    Cowdria ruminantium is a rickettsial parasite which causes heartwater, a economically important disease of domestic and wild ruminants in tropical and subtropical Africa and parts of the Caribbean. Because existing diagnostic methods are unreliable, we investigated the small-subunit ribosomal RNA (srRNA) gene from heartwater-infected material to characterise the organisms present and to develop specific oligonucleotide probes for polymerase chain reaction (PCR) based diagnosis. DNA was obtained from ticks and ruminants from heartwater-free and heartwater-endemic areas from Cowdria in tissue culture. PCR was carried out using primers designed to amplify only rickettsial srRNA genes, the target region being the highly variable V1 loop. Amplicons were cloned and sequenced; 51% were C. ruminantium sequences corresponding to four genotypes, two of which were identical to previously reported C. ruminantium sequences while the other two were new. The four different Cowdria genotypes can be correlated with different phenotypes. Tissue-culture samples yielded only Cowdria genotype sequences, but an extraordinary heterogeneity of 16S sequences was obtained from field samples. In addition to Cowdria genotypes we found sequences from previously unknown Ehrlichia spp., sequences showing homology to other Rickettsiales and a variety of Pseudomonadaceae. One Ehrlichia sequence was phylogenetically closely related to Ehrlichia platys (Group II Ehrlichia) and one to Ehrlichia canis (Group III Ehrlichia). This latter sequence was from an isolate (Germishuys) made from a naturally infected sheep which, from brain smear examination and pathology, appeared to be suffering from heartwater; nevertheless no Cowdria genotype sequences were found in this isolate. In addition no Cowdria sequences were obtained from uninfected ticks. Complete 16S rRNA gene sequences were determined for two C. ruminantium genotypes and for two previously uncharacterised heartwater-associated Ehrlichia spp

  12. A new model for the three-dimensional folding of Escherichia coli 16 S ribosomal RNA. II. The RNA-protein interaction data.

    Science.gov (United States)

    Mueller, F; Brimacombe, R

    1997-08-29

    The map of the mass centres of the 21 proteins from the Escherichia coli 30 S ribosomal subunit, as determined by neutron scattering, was fitted to a cryoelectron microscopic (cryo-EM) model at a resolution of 20 A of 70 S ribosomes in the pre-translocational state, carrying tRNA molecules at the A and P sites. The fit to the 30 S moiety of the 70 S particles was accomplished with the help of the well-known distribution of the ribosomal proteins in the head, body and side lobe regions of the 30 S subunit, as determined by immuno electron microscopy (IEM). Most of the protein mass centres were found to lie close to the surface (or even outside) of the cryo-EM contour of the 30 S subunit, supporting the idea that the ribosomal proteins are arranged peripherally around the rRNA. The ribosomal protein distribution was then compared with the corresponding model for the 16 S rRNA, fitted to the same EM contour (described in an accompanying paper), in order to analyse the mutual compatibility of the arrangement of proteins and rRNA in terms of the available RNA-protein interaction data. The information taken into account included the hydroxyl radical and base foot-printing data from Noller's laboratory, and our own in situ cross-linking results. Proteins S1 and S14 were not considered, due to the lack of RNA-protein data. Among the 19 proteins analysed, 12 (namely S2, S4, S5, S7, S8, S9, S10, S11, S12, S15, S17 and S21) showed a fit to the rRNA model that varied from being excellent to at least acceptable. Of the remaining 7, S3 and S13 showed a rather poor fit, as did S18 (which is considered in combination with S6 in the foot-printing experiments). S16 was difficult to evaluate, as the foot-print data for this protein cover a large area of the rRNA. S19 and S20 showed a bad fit in terms of the neutron map, but their foot-print and cross-link sites were clustered into compact groups in the rRNA model in those regions of the 30 S subunit where these proteins have

  13. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    NARCIS (Netherlands)

    Essers, Paul B.; Nonnekens, Julie; Goos, Yvonne J.; Betist, Marco C.|info:eu-repo/dai/nl/304073202; Viester, Marjon D.; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C.; Jelier, Rob; Brenkman, Arjan B.; MacInnes, Alyson W.|info:eu-repo/dai/nl/338681388

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  14. Asaia bogorensis peritonitis identified by 16S ribosomal RNA sequence analysis in a patient receiving peritoneal dialysis.

    Science.gov (United States)

    Snyder, Richard W; Ruhe, Jorg; Kobrin, Sidney; Wasserstein, Alan; Doline, Christa; Nachamkin, Irving; Lipschutz, Joshua H

    2004-08-01

    Here the authors report a case of refractory peritonitis leading to multiple hospitalizations and the loss of peritoneal dialysis access in a patient on automated peritoneal dialysis, caused by Asaia bogorensis, a bacterium not previously described as a human pathogen. This organism was identified by sequence analysis of the 16S ribosomal RNA gene. Unusual microbial agents may cause peritonitis, and molecular microbiological techniques are important tools for identifying these agents.

  15. A ribonucleoprotein fragment of the 30 S ribosome of E. coli containing two contiguous domains of the 16 S RNA.

    Science.gov (United States)

    Spitnik-Elson, P; Elson, D; Avital, S; Abramowitz, R

    1982-08-11

    Ribonucleoprotein fragments of the 30 S ribosome of E. coli have been prepared by limited ribonuclease digestion and mild heating of the ribosome in a constant ionic environment. One such fragment has been described previously. A second electrophoretically homogeneous fragment has now been isolated and its RNA and protein moieties have been characterized. It contains the 5' half of the 16 S RNA, encompassing domains I and II except for the extreme 5' terminus and several small gaps. Seven proteins are present: S4, S5, S6, S8, S12, S15 and S20. The RNA binding sites of five of these proteins are known, and all are RNA sequences that are present in the fragment. Published neutron scattering and immuno-electron microscopic data indicate that six of the proteins are clustered together in a cross sectional slice through the center of the subunit. After deproteinization, the RNA moiety gives two bands in gel electrophoresis, one containing domains I and II and the other, essentially only domain II. The former, although larger, migrates faster in gel electrophoresis, indicating that RNA domains I and II interact with each other in such a way as to become more compact than domain II by itself.

  16. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  17. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    Science.gov (United States)

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  18. Selection of random RNA fragments as method for searching for a site of regulation of translation of E. coli streptomycin mRNA by ribosomal protein S7.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kraal, B; Kopylov, A M

    2008-06-01

    In E. coli cells ribosomal small subunit biogenesis is regulated by RNA-protein interactions involving protein S7. S7 initiates the subunit assembly interacting with 16S rRNA. During shift-down of rRNA synthesis level, free S7 inhibits self-translation by interacting with 96 nucleotides long specific region of streptomycin (str) mRNA between cistrons S12 and S7 (intercistron). Many bacteria do not have the extended intercistron challenging development of specific approaches for searching putative mRNA regulatory regions, which are able to interact with proteins. The paper describes application of SERF approach (Selection of Random RNA Fragments) to reveal regulatory regions of str mRNA. Set of random DNA fragments has been generated from str operon by random hydrolysis and then transcribed into RNA; the fragments being able to bind protein S7 (serfamers) have been selected by iterative rounds. S7 binds to single serfamer, 109 nucleotide long (RNA109), derived from the intercistron. After multiple copying and selection, the intercistronic mutant (RNA109) has been isolated; it has enhanced affinity to S7. RNA109 binds to the protein better than authentic intercistronic str mRNA; apparent dissociation constants are 26 +/- 5 and 60 +/- 8 nM, respectively. Location of S7 binding site on the mRNA, as well as putative mode of regulation of coupled translation of S12 and S7 cistrons have been hypothesized.

  19. Characterisation of RNA fragments obtained by mild nuclease digestion of 30-S ribosomal subunits from Escherichia coli.

    Science.gov (United States)

    Rinke, J; Ross, A; Brimacombe, R

    1977-06-01

    When Escherichia coli 30-S ribosomal subunits are hydrolysed under mild conditions, two ribonucleoprotein fragments of unequal size are produced. Knowledge of the RNA sequences contained in these hydrolysis products was required for the experiments described in the preceding paper, and the RNA sub-fragments have therefore been examined by oligonucleotide analysis. Two well-defined small fragments of free RNA, produced concomitantly with the ribonucleoprotein fragments, were also analysed. The larger ribonucleoprotein fragment, containing predominantly proteins S4, S5, S8, S15, S16 (17) and S20, contains a complex mixture of RNA sub-fragments varying from about 100 to 800 nucleotides in length. All these fragments arose from the 5'-terminal 900 nucleotides of 16-S RNA, corresponding to the well-known 12-S fragment. No long-range interactions could be detected within this RNA region in these experiments. The RNA from the smaller ribonucleoprotein fragment (containing proteins S7, S9 S10, S14 and S19) has been described in detail previously, and consists of about 450 nucleotides near the 3' end of the 16-S RNA, but lacking the 3'-terminal 150 nucleotides. The two small free RNA fragments (above) partly account for these missing 150 nucleotides; both fragments arose from section A of the 16-S RNA, but section J (the 3'-terminal 50 nucleotides) was not found. This result suggests that the 3' region of 16-S RNA is not involved in stable interactions with protein.

  20. Detection of the A2058G and A2059G 23S rRNA gene point mutations associated with azithromycin resistance in Treponema pallidum by use of a TaqMan real-time multiplex PCR assay.

    Science.gov (United States)

    Chen, Cheng-Yen; Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R; Ballard, Ronald C

    2013-03-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum.

  1. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Directory of Open Access Journals (Sweden)

    Vincent J Denef

    2016-04-01

    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  2. WDR55 is a nucleolar modulator of ribosomal RNA synthesis, cell cycle progression, and teleost organ development.

    Directory of Open Access Journals (Sweden)

    Norimasa Iwanami

    2008-08-01

    Full Text Available The thymus is a vertebrate-specific organ where T lymphocytes are generated. Genetic programs that lead to thymus development are incompletely understood. We previously screened ethylnitrosourea-induced medaka mutants for recessive defects in thymus development. Here we report that one of those mutants is caused by a missense mutation in a gene encoding the previously uncharacterized protein WDR55 carrying the tryptophan-aspartate-repeat motif. We find that WDR55 is a novel nucleolar protein involved in the production of ribosomal RNA (rRNA. Defects in WDR55 cause aberrant accumulation of rRNA intermediates and cell cycle arrest. A mutation in WDR55 in zebrafish also leads to analogous defects in thymus development, whereas WDR55-null mice are lethal before implantation. These results indicate that WDR55 is a nuclear modulator of rRNA synthesis, cell cycle progression, and embryonic organogenesis including teleost thymus development.

  3. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... nuclear transfer (SCNT) using fluorescence in situ hybridization (FISH) with an rDNA probe and subsequent visualization of the nucleolar proteins by silver staining. In the 205 IVP embryos investigated, all two-cell embryos (n = 34) were categorized as transcriptionally inactive. At the late four......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  4. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    Energy Technology Data Exchange (ETDEWEB)

    Ayaki, Hitoshi; Hara, Ryujiro; Ikenaga, Mituo [Kyoto Univ. (Japan). Radiation Biology Center

    1996-06-01

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of {sup 3}H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  5. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production. PMID:28091612

  6. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

  7. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...

  8. A novel mutation 3090 G>A of the mitochondrial 16S ribosomal RNA associated with myopathy.

    Science.gov (United States)

    Coulbault, L; Deslandes, B; Herlicoviez, D; Read, M H; Leporrier, N; Schaeffer, S; Mouadil, A; Lombès, A; Chapon, F; Jauzac, P; Allouche, S

    2007-10-26

    We describe a young woman who presented with a progressive myopathy since the age of 9. Spectrophotometric analysis of the respiratory chain in muscle tissue revealed combined and profound complex I, III, II+III, and IV deficiency ranging from 60% to 95% associated with morphological and histochemical abnormalities of the muscle. An exhaustive screening of mitochondrial transfer and ribosomal RNAs showed a novel G>A substitution at nucleotide position 3090 which was detected only in urine sediment and muscle of the patient and was not found in her mother's blood cells and urine sample. We suggest that this novel de novo mutation in the 16S ribosomal RNA, a nucleotide which is highly conserved in different species, would impair mitochondrial protein synthesis and would cause a severe myopathy.

  9. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Science.gov (United States)

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-10-25

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting related aminoglycoside antibiotics such as neomycin, kanamycin or gentamicin, which do not compete for the streptomycin binding site. The 530 loop where the mutation in the 16S rRNA is located has been mapped at the external surface of the 30S subunit, and is therefore distal from the streptomycin binding site at the subunit interface. Our results support the conclusion that the mutation at position 523 in the 16S rRNA does not interfere with the binding of streptomycin, but prevents the drug from inducing conformational changes in the 530 loop which account for its miscoding effect. Since this effect primarily results from a perturbation of the translational proofreading control, our results also provide evidence that the 530 loop of the 16S rRNA is involved in this accuracy control.

  10. Crosstalk in gene expression: coupling and co-regulation of rDNA transcription, pre-ribosome assembly and pre-rRNA processing.

    Science.gov (United States)

    Granneman, Sander; Baserga, Susan J

    2005-06-01

    Ribosomes, the large RNPs that translate mRNA into protein in the cytoplasm of eukaryotic cells, are synthesized in a subcompartment of the nucleus, the nucleolus. There, transcription by Pol I yields a pre-rRNA which is modified, cleaved and assembled with ribosomal proteins to make functional ribosomes. Previously, rRNA transcription and pre-rRNA cleavage in eukaryotes were considered to be separable steps in gene expression. However, recent findings suggest that these two steps in gene expression can be concurrent and are co-regulated. Unexpectedly, optimal rDNA transcription requires the presence of a defined subset of components of the pre-rRNA processing machinery.

  11. Studies on the ability of partially iodinated 16S RNA to participate in 30S ribosome assembly.

    Science.gov (United States)

    Schendel, P L; Craven, G R

    1976-11-01

    Deproteinated 16S RNA was iodinated at pH 5.0 in an aqueous solution containing TlCl3 plus KI for 1-5 hours at 42 degrees C. Under these conditions 33 moles of iodine are incorporated per mole of RNA. As judged by sucrose gradient sedimentation, the iodinated RNA does not exhibit any large alteration in conformation as compared to unmodified 16S. The iodinated RNA was examined for its ability to reconstitute with total 30S proteins. Sedimentation velocity analysis reveals that the reconstituted subunit has a sedimentation constant of approximately 20S. In addition, protein analysis of particles reconstituted with 16S RNA iodinated for 5 hours indicates that proteins S2, S10, S13, S14, S15, S17, S18, S19, and S21 are no longer able to participate in the 30S assembly process and that proteins S6, S16 and S20 are present in reduced amounts. The ramifications of these results concerning protein-RNA and RNA-RNA interactions occurring in ribosome assembly are discussed.

  12. First structural evidence of sequestration of mRNA cap structures by type 1 ribosome inactivating protein from Momordica balsamina.

    Science.gov (United States)

    Kushwaha, Gajraj Singh; Yamini, Shavait; Kumar, Mukesh; Sinha, Mau; Kaur, Punit; Sharma, Sujata; Singh, Tej P

    2013-05-01

    This is the first structural evidence of recognition of mRNA cap structures by a ribosome inactivating protein. It is well known that a unique cap structure is formed at the 5' end of mRNA for carrying out various processes including mRNA maturation, translation initiation, and RNA turnover. The binding studies and crystal structure determinations of type 1 ribosome inactivating protein (RIP-1) from Momordica balsamina (MbRIP-1) were carried out with mRNA cap structures including (i) N7-methyl guanine (m7G), (ii) N7-methyl guanosine diphosphate (m7GDP), and (iii) N7-methyl guanosine triphosphate (m7GTP). These compounds showed affinities to MbRIP-1 at nanomolar concentrations. The structure determinations of the complexes of MbRIP-1 with m7G, m7GDP, and m7GTP at 2.65, 1.77, and 1.75 Å resolutions revealed that all the three compounds bound to MbRIP-1 in the substrate binding site at the positions which are slightly shifted towards Glu85 as compared to those of rRNA substrates. In this position, Glu85 forms several hydrogen bonds with guanine moiety while N-7 methyl group forms van der Waals contacts. However, the guanine rings are poorly stacked in these complexes. Thus, the mode of binding by MbRIP-1 to mRNA cap structures is different which results in the inhibition of depurination. Since some viruses are known to exploit the capping property of the host, this action of MbRIP-1 may have implications for the antiviral activity of this protein in vivo. The understanding of the mode of binding of MbRIP-1 to cap structures may also assist in the design of anti-viral agents. Copyright © 2013 Wiley Periodicals, Inc.

  13. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Directory of Open Access Journals (Sweden)

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  14. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  15. 动物性食品源弓形菌23S rRNA基因PCR检测方法的建立%Establishment of PCR Method for Detecting Animal Food-Borne Arcobacter Based on the 23S rRNA Gene

    Institute of Scientific and Technical Information of China (English)

    毕水莲

    2014-01-01

    建立了一种快速、准确检测弓形菌(Arcobacter)的PCR方法.根据弓形菌23S rRNA基因序列设计引物,对弓形菌标准菌株、弓形菌食品分离株及非弓形菌属菌株进行PCR扩增.结果表明,弓形菌标准菌株和35株弓形菌食品分离株扩增后均可得到688 bp的目的条带,11株非弓形菌属菌株均未见任何扩增条带,对弓形菌的最低检测限为1.12× 103 CFU/mL.该方法操作简单、检测周期短、灵敏度高、特异性好,可用于食品中弓形菌的快速检测.

  16. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    Science.gov (United States)

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  17. [Mutual effect of human ribosomal proteins S5 and S16 on their binding with 18S rRNA fragment 1203-1236/1521-1698].

    Science.gov (United States)

    Ian'shina, D D; Malygin, A A; Karpova, G G

    2009-01-01

    Human ribosomal proteins S5 and S16 are homologues of prokaryotic ribosomal proteins S7p and S9p, respectively, that according to X-ray crystallography data on the Thermus thermophilus 30S ribosomal subunit contact the 3'-terminal 16S rRNA region formed by helices H28-H30 and H38-H43. In the present work we report studying mutual effect of human ribosomal proteins S5 and S16 on their binding with RNA transcript corresponding to the region 1203-1236/1521-1698 of the 18S rRNA (helices H28-30 and H41-43), which is homologous to thel6S rRNA region known to contain binding site of S7p and part of binding site of S9p. It was shown that simultaneous binding of ribosomal proteins S5 and S16 with this RNA transcript causes conformational changes in it stabilizing the complex by involvement of new parts of the RNA that interact with neither S5 nor S16 in the respective binary complexes.

  18. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  19. Molecular inventory control in ribosome biosynthesis.

    Science.gov (United States)

    Warner, J R; Johnson, S P

    1986-11-01

    The eukaryotic cell coordinates the accumulation of each ribosomal protein with every other ribosomal protein, with ribosomal RNA and with the needs of the cell. To do so it regulates the transcription, processing, translation and lifetime of the mRNA for ribosomal proteins. When all else fails, it rapidly degrades any excess ribosomal protein which is synthesized.

  20. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH)

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; De Boer, W.; Van Veen, J.A.

    2004-01-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia

  1. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    Directory of Open Access Journals (Sweden)

    Hui-Ren Zhou

    2014-12-01

    Full Text Available Double-stranded RNA (dsRNA-activated protein kinase (PKR is a critical upstream mediator of the ribotoxic stress response (RSR to the trichothecene deoxynivalenol (DON and other translational inhibitors. Here, we employed HeLa cell lysates to: (1 characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA; (2 demonstrate cell-free activation of ribosomal-associated PKR and (3 integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  2. Direct activation of ribosome-associated double-stranded RNA-dependent protein kinase (PKR) by deoxynivalenol, anisomycin and ricin: a new model for ribotoxic stress response induction.

    Science.gov (United States)

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J

    2014-12-16

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR's interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR.

  3. Translation complex profile sequencing to study the in vivo dynamics of mRNA-ribosome interactions during translation initiation, elongation and termination.

    Science.gov (United States)

    Shirokikh, Nikolay E; Archer, Stuart K; Beilharz, Traude H; Powell, David; Preiss, Thomas

    2017-04-01

    Messenger RNA (mRNA) translation is a tightly controlled process that is integral to gene expression. It features intricate and dynamic interactions of the small and large subunits of the ribosome with mRNAs, aided by multiple auxiliary factors during distinct initiation, elongation and termination phases. The recently developed ribosome profiling method can generate transcriptome-wide surveys of translation and its regulation. Ribosome profiling records the footprints of fully assembled ribosomes along mRNAs and thus primarily interrogates the elongation phase of translation. Importantly, it does not monitor multiple substeps of initiation and termination that involve complexes between the small ribosomal subunit (SSU) and mRNA. Here we describe a related method, termed 'translation complex profile sequencing' (TCP-seq), that is uniquely capable of recording positions of any type of ribosome-mRNA complex transcriptome-wide. It uses fast covalent fixation of translation complexes in live cells, followed by RNase footprinting of translation intermediates and their separation into complexes involving either the full ribosome or the SSU. The footprints derived from each type of complex are then deep-sequenced separately, generating native distribution profiles during the elongation, as well as the initiation and termination stages of translation. We provide the full TCP-seq protocol for Saccharomyces cerevisiae liquid suspension culture, including a data analysis pipeline. The protocol takes ∼3 weeks to complete by a researcher who is well acquainted with standard molecular biology techniques and who has some experience in ultracentrifugation and the preparation of RNA sequencing (RNA-seq) libraries. Basic Bash and UNIX/Linux command skills are required to use the bioinformatics tools provided.

  4. The structure of the archaebacterial ribosomal protein S7 and its possible interaction with 16S rRNA.

    Science.gov (United States)

    Hosaka, H; Yao, M; Kimura, M; Tanaka, I

    2001-11-01

    Ribosomal protein S7 is one of the ubiquitous components of the small subunit of the ribosome. It is a 16S rRNA-binding protein positioned close to the exit of the tRNA, and it plays a role in initiating assembly of the head of the 30S subunit. Previous structural analyses of eubacterial S7 have shown that it has a stable alpha-helix core and a flexible beta-arm. Unlike these eubacterial proteins, archaebacterial or eukaryotic S7 has an N-terminal extension of approximately 60 residues. The crystal structure of S7 from archaebacterium Pyrococcus horikoshii (PhoS7) has been determined at 2.1 A resolution. The final model of PhoS7 consists of six major alpha-helices, a short 3(10)-helix and two beta-stands. The major part (residues 18-45) of the N-terminal extension of PhoS7 reinforces the alpha-helical core by well-extended hydrophobic interactions, while the other part (residues 46-63) is not visible in the crystal and is possibly fixed only by interacting with 16S rRNA. These differences in the N-terminal extension as well as in the insertion (between alpha1 and alpha2) of the archaebacterial S7 structure from eubacterial S7 are such that they do not necessitate a major change in the structure of the currently available eubacterial 16S rRNA. Some of the inserted chains might pass through gaps formed by helices of the 16S rRNA.

  5. Inhibition of the protein kinase PKR by the internal ribosome entry site of hepatitis C virus genomic RNA.

    Science.gov (United States)

    Vyas, Jashmin; Elia, Androulla; Clemens, Michael J

    2003-07-01

    Translation of the hepatitis C genome is mediated by internal ribosome entry on the structurally complex 5' untranslated region of the large viral RNA. Initiation of protein synthesis by this mechanism is independent of the cap-binding factor eIF4E, but activity of the initiator Met-tRNA(f)-binding factor eIF2 is still required. HCV protein synthesis is thus potentially sensitive to the inhibition of eIF2 activity that can result from the phosphorylation of the latter by the interferon-inducible, double-stranded RNA-activated protein kinase PKR. Two virally encoded proteins, NS5A and E2, have been shown to reduce this inhibitory effect of PKR by impairing the activation of the kinase. Here we present evidence for a third viral strategy for PKR inhibition. A region of the viral RNA comprising part of the internal ribosome entry site (IRES) is able to bind to PKR in competition with double-stranded RNA and can prevent autophosphorylation and activation of the kinase in vitro. The HCV IRES itself has no PKR-activating ability. Consistent with these findings, cotransfection experiments employing a bicistronic reporter construct and wild-type PKR indicate that expression of the protein kinase is less inhibitory towards HCV IRES-driven protein synthesis than towards cap-dependent protein synthesis. These data suggest a dual function for the viral IRES, with both a structural role in promoting initiation complex formation and a regulatory role in preventing inhibition of initiation by PKR.

  6. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Science.gov (United States)

    Mishra, Bhavya; Schütz, Gunter M.; Chowdhury, Debashish

    2016-06-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special “slippery” sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obtained from a mean-field analysis of the stochastic dynamics.

  7. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    CERN Document Server

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  8. A tRNA body with high affinity for EF-Tu hastens ribosomal incorporation of unnatural amino acids.

    Science.gov (United States)

    Ieong, Ka-Weng; Pavlov, Michael Y; Kwiatkowski, Marek; Ehrenberg, Måns; Forster, Anthony C

    2014-05-01

    There is evidence that tRNA bodies have evolved to reduce differences between aminoacyl-tRNAs in their affinity to EF-Tu. Here, we study the kinetics of incorporation of L-amino acids (AAs) Phe, Ala allyl-glycine (aG), methyl-serine (mS), and biotinyl-lysine (bK) using a tRNA(Ala)-based body (tRNA(AlaB)) with a high affinity for EF-Tu. Results are compared with previous data on the kinetics of incorporation of the same AAs using a tRNA(PheB) body with a comparatively low affinity for EF-Tu. All incorporations exhibited fast and slow phases, reflecting the equilibrium fraction of AA-tRNA in active ternary complex with EF-Tu:GTP before the incorporation reaction. Increasing the concentration of EF-Tu increased the amplitude of the fast phase and left its rate unaltered. This allowed estimation of the affinity of each AA-tRNA to EF-Tu:GTP during translation, showing about a 10-fold higher EF-Tu affinity for AA-tRNAs formed from the tRNA(AlaB) body than from the tRNA(PheB) body. At ∼1 µM EF-Tu, tRNA(AlaB) conferred considerably faster incorporation kinetics than tRNA(PheB), especially in the case of the bulky bK. In contrast, the swap to the tRNA(AlaB) body did not increase the fast phase fraction of N-methyl-Phe incorporation, suggesting that the slow incorporation of N-methyl-Phe had a different cause than low EF-Tu:GTP affinity. The total time for AA-tRNA release from EF-Tu:GDP, accommodation, and peptidyl transfer on the ribosome was similar for the tRNA(AlaB) and tRNA(PheB) bodies. We conclude that a tRNA body with high EF-Tu affinity can greatly improve incorporation of unnatural AAs in a potentially generalizable manner.

  9. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    Directory of Open Access Journals (Sweden)

    Xiaolan Huang

    2013-01-01

    Full Text Available Programmed −1 ribosomal frameshifting (PRF and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event.

  10. Delimitation of the Thoracosphaeraceae (Dinophyceae), including the calcareous dinoflagellates, based on large amounts of ribosomal RNA sequence data.

    Science.gov (United States)

    Gottschling, Marc; Soehner, Sylvia; Zinssmeister, Carmen; John, Uwe; Plötner, Jörg; Schweikert, Michael; Aligizaki, Katerina; Elbrächter, Malte

    2012-01-01

    The phylogenetic relationships of the Dinophyceae (Alveolata) are not sufficiently resolved at present. The Thoracosphaeraceae (Peridiniales) are the only group of the Alveolata that include members with calcareous coccoid stages; this trait is considered apomorphic. Although the coccoid stage apparently is not calcareous, Bysmatrum has been assigned to the Thoracosphaeraceae based on thecal morphology. We tested the monophyly of the Thoracosphaeraceae using large sets of ribosomal RNA sequence data of the Alveolata including the Dinophyceae. Phylogenetic analyses were performed using Maximum Likelihood and Bayesian approaches. The Thoracosphaeraceae were monophyletic, but included also a number of non-calcareous dinophytes (such as Pentapharsodinium and Pfiesteria) and even parasites (such as Duboscquodinium and Tintinnophagus). Bysmatrum had an isolated and uncertain phylogenetic position outside the Thoracosphaeraceae. The phylogenetic relationships among calcareous dinophytes appear complex, and the assumption of the single origin of the potential to produce calcareous structures is challenged. The application of concatenated ribosomal RNA sequence data may prove promising for phylogenetic reconstructions of the Dinophyceae in future.

  11. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  12. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  13. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    Science.gov (United States)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  14. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells......UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate....... Mechanistically this will couple the ribosomes translating a leader peptide gene more tightly to the elongating RNA polymerase. The ribosomes will then be more prone to prevent the folding of the mRNA chains into terminating hairpin structures when RNA polymerase is at the attenuator and has to decide whether...

  15. Ribosome maturation in E. coli.

    Science.gov (United States)

    Silengo, L; Altruda, F; Dotto, G P; Lacquaniti, F; Perlo, C; Turco, E; Mangiarotti, G

    1977-01-01

    In vivo and in vitro experiments have shown that processing of ribosomal RNA is a late event in ribosome biogenesis. The precursor form of RNA is probably necessary to speed up the assembly of ribomal proteins. Newly formed ribosomal particles which have already entered polyribosomes differ from mature ribosomes not only in their RNA content but also in their susceptibility to unfolding in low Mg concentration and to RNase attack. Final maturation of new ribosomes is probably dependent on their functioning in protein synthesis. Thus only those ribosomes which have proven to be functional may be converted into stable cellular structures.

  16. An automated procedure for covariation-based detection of RNA structure

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

  17. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Directory of Open Access Journals (Sweden)

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long

  18. Insects' RNA Profiling Reveals Absence of "Hidden Break" in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci.

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a "hidden break" which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the "hidden break" is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of "hidden break" was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  19. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  20. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology.

  1. Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome.

    Science.gov (United States)

    Zhang, Jingji; Ieong, Ka-Weng; Johansson, Magnus; Ehrenberg, Måns

    2015-08-04

    We used a cell-free system with pure Escherichia coli components to study initial codon selection of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP on messenger RNA-programmed ribosomes. We took advantage of the universal rate-accuracy trade-off for all enzymatic selections to determine how the efficiency of initial codon readings decreased linearly toward zero as the accuracy of discrimination against near-cognate and wobble codon readings increased toward the maximal asymptote, the d value. We report data on the rate-accuracy variation for 7 cognate, 7 wobble, and 56 near-cognate codon readings comprising about 15% of the genetic code. Their d values varied about 400-fold in the 200-80,000 range depending on type of mismatch, mismatch position in the codon, and tRNA isoacceptor type. We identified error hot spots (d = 200) for U:G misreading in second and U:U or G:A misreading in third codon position by His-tRNA(His) and, as also seen in vivo, Glu-tRNA(Glu). We suggest that the proofreading mechanism has evolved to attenuate error hot spots in initial selection such as those found here.

  2. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    Science.gov (United States)

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  3. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2010-08-01

    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  4. Neonatal Meningitis by Multidrug Resistant Elizabethkingia meningosepticum Identified by 16S Ribosomal RNA Gene Sequencing

    Directory of Open Access Journals (Sweden)

    V. V. Shailaja

    2014-01-01

    Full Text Available Clinical and microbiological profile of 9 neonates with meningitis by Elizabethkingia meningosepticum identified by 16S ribosomal gene sequencing was studied. All the clinical isolates were resistant to cephalosporins, aminoglycosides, trimethoprim-sulfamethoxazole, β-lactam combinations, carbapenems and only one isolate was susceptible to ciprofloxacin. All the isolates were susceptible to vancomycin. Six of nine neonates died even after using vancomycin, based on susceptibility results. E. meningosepticum meningitis in neonates results in high mortality rate. Though the organism is susceptible to vancomycin in vitro, its efficacy in vivo is questionable and it is difficult to determine the most appropriate antibiotic for treating E. meningosepticum meningitis in neonates.

  5. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    Science.gov (United States)

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  6. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  7. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  8. Intra-genomic ribosomal RNA polymorphism and morphological variation in Elphidium macellum suggests inter-specific hybridization in foraminifera.

    Directory of Open Access Journals (Sweden)

    Loïc Pillet

    Full Text Available Elphidium macellum is a benthic foraminifer commonly found in the Patagonian fjords. To test whether its highly variable morphotypes are ecophenotypes or different genotypes, we analysed 70 sequences of the SSU rRNA gene from 25 specimens. Unexpectedly, we identified 11 distinct ribotypes, with up to 5 ribotypes co-occurring within the same specimen. The ribotypes differ by varying blocks of sequence located at the end of stem-loop motifs in the three expansion segments specific to foraminifera. These changes, distinct from typical SNPs and indels, directly affect the structure of the expansion segments. Their mosaic distribution suggests that ribotypes originated by recombination of two or more clusters of ribosomal genes. We propose that this expansion segment polymorphism (ESP could originate from hybridization of morphologically different populations of Patagonian Elphidium. We speculate that the complex geological history of Patagonia enhanced divergence of coastal foraminiferal species and contributed to increasing genetic and morphological variation.

  9. RNA:protein ratio of the unicellular organism as a characteristic of phosphorous and nitrogen stoichiometry and of the cellular requirement of ribosomes for protein synthesis

    Directory of Open Access Journals (Sweden)

    Sams Carl E

    2006-09-01

    Full Text Available Abstract Background Mean phosphorous:nitrogen (P:N ratios and relationships of P:N ratios with the growth rate of organisms indicate a surprising similarity among and within microbial species, plants, and insect herbivores. To reveal the cellular mechanisms underling this similarity, the macromolecular composition of seven microorganisms and the effect of specific growth rate (SGR on RNA:protein ratio, the number of ribosomes, and peptide elongation rate (PER were analyzed under different conditions of exponential growth. Results It was found that P:N ratios calculated from RNA and protein contents in these particular organisms were in the same range as the mean ratios reported for diverse organisms and had similar positive relationships with growth rate, consistent with the growth-rate hypothesis. The efficiency of protein synthesis in microorganisms is estimated as the number of active ribosomes required for the incorporation of one amino acid into the synthesized protein. This parameter is calculated as the SGR:PER ratio. Experimental and theoretical evidence indicated that the requirement of ribosomes for protein synthesis is proportional to the RNA:protein ratio. The constant of proportionality had the same values for all organisms, and was derived mechanistically from the characteristics of the protein-synthesis machinery of the cell (the number of nucleotides per ribosome, the average masses of nucleotides and amino acids, the fraction of ribosomal RNA in the total RNA, and the fraction of active ribosomes. Impairment of the growth conditions decreased the RNA:protein ratio and increased the overall efficiency of protein synthesis in the microorganisms. Conclusion Our results suggest that the decrease in RNA:protein and estimated P:N ratios with decrease in the growth rate of the microorganism is a consequence of an increased overall efficiency of protein synthesis in the cell resulting from activation of the general stress response and

  10. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  11. Structural and functional evaluation of interaction between mammalian ribosomal RNA with platinum-containing antineoplastic drugs.

    Science.gov (United States)

    Theile, Dirk; Kos, Martin

    2016-02-03

    Cisplatin, oxaliplatin, and carboplatin primarily target DNA, but also alter RNA functionality, albeit to different extent. This study determined the in vitro cytotoxicity (IC50 values) of platinum drugs in LS180 cells and compared the rRNA platination patterns following IC50 exposure. Relevance of particular secondary RNA structures for platination susceptibility was evaluated by primer extension methodology using 18S rRNA as a model RNA. Consequences of rRNA platination for translation efficiency were evaluated by monitoring fluorescence of a destabilised green fluorescent protein variant through flow cytometry. Oxaliplatin and cisplatin were most cytotoxic with IC50 values of 1.7 μM±0.8 and 4.1 μM±0.1, respectively. Carboplatin was significantly less efficient (IC50 147.1 μM±19.4). When exposed to equitoxic concentrations (respective IC50), all three compounds caused similar stop signal incidence or intensity. Moreover, the same rRNA sites were targeted without selectivity for particular secondary structures but with a slight preference for guanine-rich regions. Compared to cycloheximide, none of the drugs diminished translation efficiency at typical in vivo concentrations. In conclusion, equitoxic concentrations of platinum drugs target the same sites in cellular rRNA and cause similar platination intensities. At pharmacokinetically relevant concentrations, cisplatin, oxaliplatin or carboplatin do not inhibit translation efficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  13. The major transcripts of the kinetoplast Trypanosoma brucei are very small ribosomal RNA's.

    NARCIS (Netherlands)

    I.C. Eperon; J.W.G. Janssen; J.H.J. Hoeijmakers (Jan); P. Borst (Piet)

    1983-01-01

    textabstractThe nucleotide sequence has been determined of a 2.2 kb segment of kinetoplast DNA, which encodes the major mitochondrial transcripts (12S and 9S) of Trypanosoma brucei. The sequence shows that the 12S RNA is a large subunit rRNA, although sufficiently unusual for resistance to chloramph

  14. Synergistic Internal Ribosome Entry Site/MicroRNA-Based Approach for Flavivirus Attenuation and Live Vaccine Development

    Directory of Open Access Journals (Sweden)

    Konstantin A. Tsetsarkin

    2017-04-01

    Full Text Available The recent emergence of Zika virus underscores the need for new strategies for a rapid development of safe flavivirus vaccines. Using another flavivirus (Langat virus [LGTV] that belongs to the group of tick-borne flaviviruses as a model, we describe a dual strategy for virus attenuation which synergistically accesses the specificity of microRNA (miRNA genome targeting and the effectiveness of internal ribosome entry site (IRES insertion. To increase the stability and immunogenicity of bicistronic LGTVs, we developed a novel approach in which the capsid (C protein gene was relocated into the 3′ noncoding region (NCR and expressed under translational control from an IRES. Engineered bicistronic LGTVs carrying multiple target sequences for brain-specific miRNAs were stable in Vero cells and induced adaptive immunity in mice. Importantly, miRNA-targeted bicistronic LGTVs were not pathogenic for either newborn mice after intracranial inoculation or adult immunocompromised mice (SCID or type I interferon receptor knockout after intraperitoneal injection. Moreover, bicistronic LGTVs were restricted for replication in tick-derived cells, suggesting an interruption of viral transmission in nature by arthropod vectors. This approach is suitable for reliable attenuation of many flaviviruses and may enable development of live attenuated flavivirus vaccines.

  15. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    In porcine embryos, nucleoli are first observed during the third postfertilization cell cycle, i.e., at the 4-cell stage. However, direct studies of the initiation of rRNA transcription have not been reported. This transcription was investigated in the present study by simultaneous visualization...... of the rRNA genes and the rRNA by fluorescent in situ hybridization using a porcine 28S rDNA probe and subsequent visualization of argyrophilic nucleolar proteins by silver staining of extracted and fixed nuclei from in vivo-derived porcine embryos (n = 229). Nucleologenesis was observed by transmission...... electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  16. Massive-scale RNA-Seq analysis of non ribosomal transcriptome in human trisomy 21.

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    Full Text Available Hybridization- and tag-based technologies have been successfully used in Down syndrome to identify genes involved in various aspects of the pathogenesis. However, these technologies suffer from several limits and drawbacks and, to date, information about rare, even though relevant, RNA species such as long and small non-coding RNAs, is completely missing. Indeed, none of published works has still described the whole transcriptional landscape of Down syndrome. Although the recent advances in high-throughput RNA sequencing have revealed the complexity of transcriptomes, most of them rely on polyA enrichment protocols, able to detect only a small fraction of total RNA content. On the opposite end, massive-scale RNA sequencing on rRNA-depleted samples allows the survey of the complete set of coding and non-coding RNA species, now emerging as novel contributors to pathogenic mechanisms. Hence, in this work we analysed for the first time the complete transcriptome of human trisomic endothelial progenitor cells to an unprecedented level of resolution and sensitivity by RNA-sequencing. Our analysis allowed us to detect differential expression of even low expressed genes crucial for the pathogenesis, to disclose novel regions of active transcription outside yet annotated loci, and to investigate a plethora of non-polyadenylated long as well as short non coding RNAs. Novel splice isoforms for a large subset of crucial genes, and novel extended untranslated regions for known genes--possibly novel miRNA targets or regulatory sites for gene transcription--were also identified in this study. Coupling the rRNA depletion of samples, followed by high-throughput RNA-sequencing, to the easy availability of these cells renders this approach very feasible for transcriptome studies, offering the possibility of investigating in-depth blood-related pathological features of Down syndrome, as well as other genetic disorders.

  17. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes...

  18. A mutant RNA pseudoknot that promotes ribosomal frameshifting in mouse mammary tumor virus.

    Science.gov (United States)

    Kang, H; Tinoco, I

    1997-05-15

    A single A-->G mutation that changes a potential A.U base pair to a G.U pair at the junction of the stems and loops of a non-frameshifting pseudoknot dramatically increases its frameshifting efficiency in mouse mammary tumor virus. The structure of the non-frameshifting pseudoknot APK has been found to be very different from that of pseudoknots that cause efficient frameshifting [Kang,H., Hines,J.V. and Tinoco,I. (1995) J. Mol. Biol. , 259, 135-147]. The 3-dimensional structure of the mutant pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distance and torsion angle constraints. One striking feature of the mutant pseudoknot compared with the parent pseudoknot is that a G.U base pair forms at the top of stem 2, thus leaving only 1 nt at the junction of the two stems. The conformation is very different from that of the previously determined non-frameshifting parent pseudoknot, which lacks the A.U base pair at the top of the stem and has 2 nt between the stems. However, the conformation is quite similar to that of efficient frameshifting pseudoknots whose structures were previously determined by NMR. A single adenylate residue intervenes between the two stems and interrupts their coaxial stacking. This unpaired nucleotide produces a bent structure. The structural similarity among the efficient frameshifting pseudoknots indicates that a specific conformation is required for ribosomal frameshifting, further implying a specific interaction of the pseudoknot with the ribosome.

  19. Analysis of the genotypes among different strains of common Mycobacteria based on 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer sequences%常见分枝杆菌种内不同株之间16S rRNA基因和16S-23SrRNA ITS序列分析结果的比较

    Institute of Scientific and Technical Information of China (English)

    黄至澄; 徐黔宁; 闫李侠; 陈保文; 王国治

    2011-01-01

    目的 针对常见分枝杆菌不同株对其基因序列进行分析,比较分析结果.方法 利用16S rRNA Gene和16S-23S rRNAITS(转录间隔区序列)分析法分别对97株共7种DSMZ/ATCC引进的常见分枝杆菌进行种内不同株之间基因差异性分析,对比两种分型结果的异同.结果 16S rRNA基因可将13株草分枝杆菌分为3个型别,18株偶发分枝杆菌分为6个型别,17株耻垢分枝杆菌分为4个型别,8株戈登分枝杆菌分为3个型别,9株龟分枝杆菌龟亚种分为3个型别,15株堪萨斯分枝杆菌分为2个型别,17株产鼻疽分枝杆菌分为1个型别;而16S-23S rRNA ITS可依次将上述分枝杆菌分为3个、15个、7个、3个、4个、3个、5个型别.结论 16S rRNA G ene分析和16S-23S rRNA ITS分析均是分枝杆菌基因型分析的可靠方法,此外,16S-23SrRNA ITS的种内多态性高于16S rRNA Gene.

  20. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X.; Zhang, Quanwei; Ermolenko, Dmitri N.; Zhang, Zhengdong D.; Gorbunova, Vera; Seluanov, Andrei

    2013-01-01

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity. PMID:24082110

  1. Binding of helix-threading peptides to E. coli 16S ribosomal RNA and inhibition of the S15-16S complex.

    Science.gov (United States)

    Gooch, Barry D; Krishnamurthy, Malathy; Shadid, Mohammad; Beal, Peter A

    2005-12-01

    Helix-threading peptides (HTPs) constitute a new class of small molecules that bind selectively to duplex RNA structures adjacent to helix defects and project peptide functionality into the dissimilar duplex grooves. To further explore and develop the capabilities of the HTP design for binding RNA selectively, we identified helix 22 of the prokaryotic ribosomal RNA 16S as a target. This helix is a component of the binding site for the ribosomal protein S15. In addition, the S15-16S RNA interaction is important for the ordered assembly of the bacterial ribosome. Here we present the synthesis and characterization of helix-threading peptides that bind selectively to helix 22 of E. coli 16S RNA. These compounds bind helix 22 by threading intercalation placing the N termini in the minor groove and the C termini in the major groove. Binding is dependent on the presence of a highly conserved purine-rich internal loop in the RNA, whereas removal of the loop minimally affects binding of the classical intercalators ethidium bromide and methidiumpropyl-EDTAFe (MPEFe). Moreover, binding selectivity translates into selective inhibition of formation of the S15-16S complex.

  2. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    Science.gov (United States)

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  3. Comment on ``Length-dependent translation of messenger RNA by ribosomes''

    Science.gov (United States)

    Zhang, Yunxin

    2012-02-01

    In a recent paper by Valleriani [Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.83.042903 83, 042903 (2011)], a simple model for the translation of messenger RNA (mRNA) is presented. Using this model, the protein translational ratio r, defined as the ratio of protein translation rate ωtl from mRNA to protein degradation rate ωp, is obtained. The key point in obtaining the translational ratio r is to get the protein translation rate ωtl. In Valleriani 's paper, ωtl is obtained as the mean value of the measured translation rate, which is the ratio of the synthesized protein number to the mRNA lifetime. However, in experiments, different methods might be used to obtain the value of ωtl. Therefore, to apply Valleriani 's model to more general experiments, in this Comment three methods to obtain the translation rate ωtl, and consequently the translational ratio r, are presented. Based on one of the methods which might be employed in most of the experiments, we find that the translational ratio r decays exponentially with mRNA length in prokaryotic cells, and decays reciprocally with mRNA length in eukaryotic cells. This result is slight different from that which was obtained in Valleriani 's paper.

  4. A comparison of the unfolding and dissociation of the large ribosome subunits from Rhodopseudomonas spheroides N.C.I.B. 8253 and Escherichia coli M.R.E. 600.

    Science.gov (United States)

    Robinson, A; Sykes, J

    1973-08-01

    1. The behaviour of the large ribosomal subunit from Rhodopseudomonas spheroides (45S) has been compared with the 50S ribosome from Escherichia coli M.R.E. 600 (and E. coli M.R.E. 162) during unfolding by removal of Mg(2+) and detachment of ribosomal proteins by high univalent cation concentrations. The extent to which these processes are reversible with these ribosomes has also been examined. 2. The R. spheroides 45S ribosome unfolds relatively slowly but then gives rise directly to two ribonucleoprotein particles (16.6S and 13.7S); the former contains the intact primary structure of the 16.25S rRNA species and the latter the 15.00S rRNA species of the original ribosome. No detectable protein loss occurs during unfolding. The E. coli ribosome unfolds via a series of discrete intermediates to a single, unfolded ribonucleoprotein unit (19.1S) containing the 23S rRNA and all the protein of the original ribosome. 3. The two unfolded R. spheroides ribonucleoproteins did not recombine when the original conditions were restored but each simply assumed a more compact configuration. Similar treatments reversed the unfolding of the E. coli 50S ribosomes; replacement of Mg(2+) caused the refolding of the initial products of unfolding and in the presence of Ni(2+) the completely unfolded species (19.1S) again sedimented at the same rate as the original ribosomes (44S). 4. Ribosomal proteins (25%) were dissociated from R. spheroides 45S ribosomes by dialysis against a solution with a Na(+)/Mg(2+) ratio of 250:1. During this process two core particles were formed (21.2S and 14.2S) and the primary structures of the two original rRNA species were conserved. This dissociation was not reversed. With E. coli 50S approximately 15% of the original ribosomal protein was dissociated, a single 37.6S core particle was formed, the 23S rRNA remained intact and the ribosomal proteins would reassociate with the core particle to give a 50S ribosome. 5. The ribonuclease activities in R

  5. Site-specific reverse splicing of a HEG-containing group I intron in ribosomal RNA

    Science.gov (United States)

    Birgisdottir, Åsa B.; Johansen, Steinar

    2005-01-01

    The wide, but scattered distribution of group I introns in nature is a result of two processes; the vertical inheritance of introns with or without losses, and the occasional transfer of introns across species barriers. Reversal of the group I intron self-splicing reaction, termed reverse splicing, coupled with reverse transcription and genomic integration potentially mediate an RNA-based intron mobility pathway. Compared to the well characterized endonuclease-mediated intron homing, reverse splicing is less specific and represents a likely explanation for many intron transpositions into new genomic sites. However, the frequency and general role of an RNA-based mobility pathway in the spread of natural group I introns is still unclear. We have used the twin-ribozyme intron (Dir.S956-1) from the myxomycete Didymium iridis to test how a mobile group I intron containing a homing endonuclease gene (HEG) selects between potential insertion sites in the small subunit (SSU) rRNA in vitro, in Escherichia coli and in yeast. Surprisingly, the results show a site-specific RNA-based targeting of Dir.S956-1 into its natural (S956) SSU rRNA site. Our results suggest that reverse splicing, in addition to the established endonuclease-mediated homing mechanism, potentially accounts for group I intron spread into the homologous sites of different strains and species. PMID:15817568

  6. Native Valve Endocarditis due to Corynebacterium striatum confirmed by 16S Ribosomal RNA Sequencing: A Case Report and Literature Review

    Science.gov (United States)

    2016-01-01

    Corynebacterium species are non-fermentous Gram-positive bacilli that are normal flora of human skin and mucous membranes and are commonly isolated in clinical specimens. Non-diphtheriae Corynebacterium are regarded as contaminants when found in blood culture. Currently, Corynebacterium striatum is considered one of the emerging nosocomial agents implicated in endocarditis and serious infections. We report a case of native-valve infective endocarditis caused by C. striatum, which was misidentified by automated identification system but identified accurately by 16S ribosomal RNA sequencing, in a 55-year-old male patient. The patient had two mobile vegetations on his mitral valve, both of which had high embolic risk. Through surgical valve replacement and an antibiotic regimen, the patient recovered completely. In unusual clinical scenarios, C. striatum should not be simply dismissed as a contaminant when isolated from clinical specimens. The possibility of C. striatum infection should be considered even in an immunocompetent patient, and we suggest a genotypic assay, such as 16S rRNA sequencing, to confirm species identity. PMID:27659439

  7. The phylogenetic position of Allocreadiidae (Trematoda: Digenea) from partial sequences of the 18S and 28S ribosomal RNA genes.

    Science.gov (United States)

    Choudhury, Anindo; Rosas Valdez, Rogelio; Johnson, Ryan C; Hoffmann, Brian; Pérez-Ponce de León, Gerardo

    2007-02-01

    Species of Allocreadiidae are an important component of the parasite fauna of freshwater vertebrates, particularly fishes, and yet their systematic relationships with other trematodes have not been clarified. Partial sequences of the 18S and 28S ribosomal RNA genes from 3 representative species of Allocreadiidae, i.e., Crepidostomum cooperi, Bunodera mediovitellata, and Polylekithum ictaluri, and from 79 other taxa representing 78 families of trematodes obtained from GenBank, were used in a phylogenetic analysis to address the relationships of Allocreadiidae with other plagiorchiiforms/plagiorchiidans. Maximum parsimony and Bayesian analyses of combined 18S and 28S rRNA gene sequence data place 2 of the allocreadiids, Crepidostomum cooperi and Bunodera mediovitellata, in a clade with species of Callodistomidae and Gorgoderidae, which, in turn is sister to a clade containing Polylekithum ictaluri and representatives of Encyclometridae, Dicrocoelidae, and Orchipedidae, a grouping supported by high bootstrap values. These results suggest that Polylekithum ictaluri is not an allocreadiid, a conclusion that is supported by reported differences between its cercaria and that of other allocreadiids. Although details of the life cycle of callodistomids, the sister taxon to Allocreadiidae, remain unknown, the relationship of Allocreadiidae and Gorgoderidae is consistent with their larval development in bivalve, rather than gastropod, molluscs, and with their host relationships (predominantly freshwater vertebrates). The results also indicate that, whereas Allocreadiidae is not a basal taxon, it is not included within the suborder Plagiorchiata. No support was found for a direct relationship between allocreadiids and opecoelids either.

  8. Study of several factors in RNA-protein cross-link formation induced by ionizing radiations within 70S ribosomes of E. coli MRE 600.

    Science.gov (United States)

    Ekert, B; Giocanti, N; Sabattier, R

    1986-09-01

    The induction of RNA-protein crosslinks in E. coli 70S ribosomes by gamma-irradiation was studied by measuring the dependence of cross-link formation on ribosome concentration. The inverse dependence of cross-link percentage upon concentration up to at least 20 A260 nm units ml-1 indicate that indirect effects seem to play a more major part than direct effects for these ribosome concentrations. The effect of various gases and free radical scavengers was used to determine the roles of the radicals H., CO2-., OH. and e-aq and to estimate their relative efficiencies for cross-links. They were found to be: 7.2(H.), 6(CO2-.), 2(OH.) and 1(e-aq). The extent of RNA-protein cross-link production in 70S ribosomes induced by gamma-rays and neutrons in the presence and absence of oxygen was also investigated. Cross-link formation was estimated by separation of linked and unlinked material on nitrocellulose filters or after separation by SDS-sucrose gradient centrifugation under dissociating conditions. Oxygen inhibited cross-link formation by both neutrons and gamma-rays. However, very few cross-links were formed in de-aerated solutions by exposure to neutrons, compared to those produced by gamma-rays under the same conditions. This suggests that molecular oxygen generated along the secondary particle track can reduce the formation of RNA-protein cross-links.

  9. Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene.

    Science.gov (United States)

    Zardoya, R; Meyer, A

    1996-05-28

    The origin of land vertebrates was one of the major transitions in the history of vertebrates. Yet, despite many studies that are based on either morphology or molecules, the phylogenetic relationships among tetrapods and the other two living groups of lobe-finned fishes, the coelacanth and the lungfishes, are still unresolved and debated. Knowledge of the relationships among these lineages, which originated back in the Devonian, has profound implications for the reconstruction of the evolutionary scenario of the conquest of land. We collected the largest molecular data set on this issue so far, about 3,500 base pairs from seven species of the large 28S nuclear ribosomal gene. All phylogenetic analyses (maximum parsimony, neighbor-joining, and maximum likelihood) point toward the hypothesis that lungfishes and coelacanths form a monophyletic group and are equally closely related to land vertebrates. This evolutionary hypothesis complicates the identification of morphological or physiological preadaptations that might have permitted the common ancestor of tetrapods to colonize land. This is because the reconstruction of its ancestral conditions would be hindered by the difficulty to separate uniquely derived characters from shared derived characters in the coelacanth/lungfish and tetrapod lineages. This molecular phylogeny aids in the reconstruction of morphological evolutionary steps by providing a framework; however, only paleontological evidence can determine the sequence of morphological acquisitions that allowed lobe-finned fishes to colonize land.

  10. Insulin receptor substrate-1 (IRS-1 associates with small nucleolar RNA which contributes to ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    Atsufumi eOzoe

    2014-03-01

    Full Text Available Insulin receptor substrates (IRSs are well known to play crucial roles in mediating intracellular signals of insulin-like growth factors (IGFs/insulin. Previously we showed that IRS-1 forms high molecular mass complexes containing RNAs. To identify RNAs in IRS-1 complexes, we performed UV cross-linking and immunoprecipitation (CLIP analysis using HEK293 cells expressing FLAG-IRS-1 and FLAG-IRS-2. We detected the radioactive signals in the immunoprecipitates of FLAG-IRS-1 proportional to the UV irradiation, but not in the immunoprecipitates of FLAG-IRS-2, suggesting the direct contact of RNAs with IRS-1. RNAs cross-linked to IRS-1 were then amplified by RT-PCR, followed by sequence analysis. We isolated sequence tags attributed to 25 messenger RNAs and 8 non-coding RNAs, including small nucleolar RNAs (snoRNAs. We focused on the interaction of IRS-1 with U96A snoRNA (U96A and its host Rack1 (receptor for activated C kinase 1 pre-mRNA. We confirmed the interaction of IRS-1 with U96A, and with RACK1 pre-mRNA by immunoprecipitation with IRS-1 followed by Northern blotting or RT-PCR analyses. Mature U96A in IRS-1-/- mouse embryonic fibroblasts was quantitatively less than WT. We also found that a part of nuclear IRS-1 is localized in the Cajal body, a nuclear subcompartment where snoRNA mature. The unanticipated function of IRS-1 in snoRNA biogenesis highlights the potential of RNA-associated IRS-1 complex to open a new line of investigation to dissect the novel mechanisms regulating IGFs/insulin-mediated biological events.

  11. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  12. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region...

  13. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Yingang, E-mail: fengyg@qibebt.ac.cn [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  14. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...... of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms....

  15. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming

    2008-01-01

    To date only five partial and two complete SSU rRNA gene sequences are available for the lobose testate amoebae (Arcellinida). Consequently, the phylogenetic relationships among taxa and the definition of species are still largely dependant on morphological characters of uncertain value, which...

  16. Nematode Diversity of Qingdao Coast Inferred from the 18S Ribosomal RNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    SHEN Xiquan; YANG Guanpin; LIU Yongjian

    2007-01-01

    The 18S ribosomal DNA gene (18S rDNA) sequences (approximately 1300 bp in length) were amplified from the DNA extracted from the free-living marine nematodes collected from the inter-tidal sediment of Qingdao coast in bulk with nematode specific primers. The PCR products were cloned, re-amplified, digested with Rsa I and Hin6Ⅰ restriction endonucleases and separated in agarose gel. Among 17 restriction fragment length types, types 1, 2 and 6 covered 61.2%, 14.4% and 9.3% of the clones analyzed, respectively, while the remaining 14 only covered 21 clones, which accounted for 15.1% of the total. Twenty-four representative clones were sequenced and phylogenetically analyzed by referring to those currently available in RDP and GenBank databases. Although it was hard to assign these sequences to known species or genera due to the lack of the 18S rDNA sequence data of known marine free-living nematodes, the obtained sequences were assigned to the nematodes of Adenophorea. Among them, twelve sequences were close to Pontonema vulgare and Adoncholaimus sp., four to Daptonemaprocerus and two (identical) to Enoplus brevis. Our results showed that free-living marine nematode diversities could be determined by PCR retrieving and analysis of the 18S rDNA sequences and an 18S rDNA sequence could be assigned to a species or a genus only if the 18S rDNA sequences of the free-living marine nematodes were accumulated to some extent.

  17. Ribosomal RNA gene silencing in interpopulation hybrids of Tigriopus californicus: nucleolar dominance in the absence of intergenic spacer subrepeats.

    Science.gov (United States)

    Flowers, Jonathan M; Burton, Ronald S

    2006-07-01

    A common feature of interspecific animal and plant hybrids is the uniparental silencing of ribosomal RNA gene transcription, or nucleolar dominance. A leading explanation for the genetic basis of nucleolar dominance in animal hybrids is the enhancer-imbalance model. The model proposes that limiting transcription factors are titrated by a greater number of enhancer-bearing subrepeat elements in the intergenic spacer (IGS) of the dominant cluster of genes. The importance of subrepeats for nucleolar dominance has repeatedly been supported in competition assays between Xenopus laevis and X. borealis minigene constructs injected into oocytes. However, a more general test of the importance of IGS subrepeats for nuclear dominance in vivo has not been conducted. In this report, rRNA gene expression was examined in interpopulation hybrids of the marine copepod Tigriopus californicus. This species offers a rare opportunity to test the role of IGS subrepeats in nucleolar dominance because the internal subrepeat structure, found in the IGS of virtually all animal and plant species, is absent in T. californicus. Our results clearly establish that nucleolar dominance occurs in F1 and F2 interpopulation hybrids of this species. In the F2 generation, nucleolar dominance appears to break down in some hybrids in a fashion that is inconsistent with a transcription factor titration model. These results are significant because they indicate that nucleolar dominance can be established and maintained without enhancer-bearing repeat elements in the IGS. This challenges the generality of the enhancer-imbalance model for nucleolar dominance and suggests that dominance of rRNA transcription in animals may be determined by epigenetic factors as has been established in plants.

  18. Evaluation of Borrelia real time PCR DNA targeting OspA, FlaB and 5S-23S IGS and Borrelia 16S rRNA RT-qPCR.

    Science.gov (United States)

    de Leeuw, Bertie H C G M; Maraha, Boulos; Hollemans, Leonie; Sprong, Hein; Brandenburg, Afke H; Westenend, Pieter J; Kusters, Johannes G

    2014-12-01

    Borrelia burgdorferi non-sensu lato (s.l.) strains occurred in the Netherlands. A multiplex OspA, FlaB, IGS real time PCR was compared to 16S rRNA/rDNA RT-qPCR with lower average Cycle threshold (Ct) and LOD on strain dilutions. Multiplexing increased sensitivity on CSF samples (n=74), distinguishing B. burgdorferi s.l. from non-s.l. strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    DEFF Research Database (Denmark)

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;

    2011-01-01

    . However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...

  20. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    Institute of Scientific and Technical Information of China (English)

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  1. Architecture of ribosomal RNA: Constraints on the sequence of tetra-loops

    Energy Technology Data Exchange (ETDEWEB)

    Woese, C.R. (Univ. of Illinois, Urbana (United States)); Winker, S. (Argonne National Lab., IL (United States)); Gutell, R.R. (Univ. of Illinois, Urbana (United States) Cangene Corp., Mississauga, Ontario (Canada))

    1990-11-01

    The four-base loops that cap many double-helical structures in rRNA (the so-called tetra-loops) exhibit highly invariant to highly variable sequences depending upon their location in the molecule. However, in the vast majority of these cases the sequence of a tetra-loop is independent of its location and conforms to one of three general motifs, GNRA, UNCG, and (more rarely) CUUG. For the most frequently varying of the 16S rRNA tetra-loops, that at position 83 (Escherichia coli numbering), the three sequences CUUG, UUCG, and GCAA account for almost all examples encountered, and each of them has independently arisen at least a dozen times. The closing base pair of tetra-loop hairpins reflects the loop sequence, tending to be C{center dot}G for CUUG loops.

  2. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    Directory of Open Access Journals (Sweden)

    Kris Genelyn B. Dimasuay

    2013-01-01

    Full Text Available Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation.

  3. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  4. Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

    Science.gov (United States)

    Li, X; De Boer, S H

    1995-10-01

    Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

  5. Two trypanosome-specific proteins are essential factors for 5S rRNA abundance and ribosomal assembly in Trypanosoma brucei.

    Science.gov (United States)

    Hellman, Kristina M; Ciganda, Martin; Brown, Silvia V; Li, Jinlei; Ruyechan, William; Williams, Noreen

    2007-10-01

    We have previously identified and characterized two novel nuclear RNA binding proteins, p34 and p37, which have been shown to bind 5S rRNA in Trypanosoma brucei. These two proteins are nearly identical, with one major difference, an 18-amino-acid insert in the N-terminal region of p37, as well as three minor single-amino-acid differences. Homologues to p34 and p37 have been found only in other trypanosomatids, suggesting that these proteins are unique to this ancient family. We have employed RNA interference (RNAi) studies in order to gain further insight into the interaction between p34 and p37 with 5S rRNA in T. brucei. In our p34/p37 RNAi cells, decreased expression of the p34 and p37 proteins led to morphological alterations, including loss of cell shape and vacuolation, as well as to growth arrest and ultimately to cell death. Disruption of a higher-molecular-weight complex containing 5S rRNA occurs as well as a dramatic decrease in 5S rRNA levels, suggesting that p34 and p37 serve to stabilize 5S rRNA. In addition, an accumulation of 60S ribosomal subunits was observed, accompanied by a significant decrease in overall protein synthesis within p34/p37 RNAi cells. Thus, the loss of the trypanosomatid-specific proteins p34 and p37 correlates with a diminution in 5S rRNA levels as well as a decrease in ribosome activity and an alteration in ribosome biogenesis.

  6. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3’-Terminal Fragment of 16S rRNA in E. coli

    Science.gov (United States)

    Golovin, A.V.; Khayrullina, G.A.; Kraal, B.; Kopylov, А.М.

    2012-01-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA–protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA–protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV–induced RNA–protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA– protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA – protein cross–link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA–protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit. PMID:23346381

  7. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    Science.gov (United States)

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

  8. Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

    Science.gov (United States)

    Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

    1993-11-01

    In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

  9. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  10. The differential expression of ribosomal 18S RNA paralog genes from the chaetognath Spadella cephaloptera.

    Science.gov (United States)

    Barthélémy, Roxane-Marie; Grino, Michel; Pontarotti, Pierre; Casanova, Jean-Paul; Faure, Eric

    2007-01-01

    Chaetognaths constitute a small marine phylum of approximately 120 species. Two classes of both 18S and 28S rRNA gene sequences have been evidenced in this phylum, even though significant intraindividual variation in the sequences of rRNA genes is unusual in animal genomes. These observations led to the hypothesis that this unusual genetic characteristic could play one or more physiological role(s). Using in situ hybridization on the frontal sections of the chaetognath Spadella cephaloptera, we found that the 18S Class I genes are expressed in the whole body, with a strong expression throughout the gut epithelium, whereas the expression of the 18S Class II genes is restricted to the oocytes. Our results could suggest that the paralog products of the 18S Class I genes are probably the "housekeeping" 18S rRNAs, whereas those of class II would only be essential in specific tissues. These results provide support for the idea that each type of 18S paralog is important for specific cellular functions and is under the control of selective factors.

  11. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    Science.gov (United States)

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  12. Phylogenetics of the brachyuran crabs (Crustacea: Decapoda): the status of Podotremata based on small subunit nuclear ribosomal RNA.

    Science.gov (United States)

    Ahyong, Shane T; Lai, Joelle C Y; Sharkey, Deirdre; Colgan, Donald J; Ng, Peter K L

    2007-11-01

    The true crabs, the Brachyura, are generally divided into two major groups: Eubrachyura or 'advanced' crabs, and Podotremata or 'primitive' crabs. The status of Podotremata is one of the most controversial issues in brachyuran systematics. The podotreme crabs, best recognised by the possession of gonopores on the coxae of the pereopods, have variously been regarded as mono-, para- or polyphyletic, or even as non-brachyuran. For the first time, the phylogenetic positions of the podotreme crabs were studied by cladistic analysis of small subunit nuclear ribosomal RNA sequences. Eight of 10 podotreme families were represented along with representatives of 17 eubrachyuran families. Under both maximum parsimony and Bayesian Inference, Podotremata was found to be significantly paraphyletic, comprising three major clades: Dromiacea, Raninoida, and Cyclodorippoida. The most 'basal' is Dromiacea, followed by Raninoida and Cylodorippoida. Notably, Cyclodorippoida was identified as the sister group of the Eubrachyura. Previous hypotheses that the dromiid crab, Hypoconcha, is an anomuran were unsupported, though Dromiidae as presently composed could be paraphyletic. Topologies constrained for podotreme monophyly were found to be significantly worse (P < 0.04) than unconstrained topologies under Templeton and S-H tests. The clear pattern of podotreme paraphyly and robustness of topologies recovered indicates that Podotremata as a formal concept is untenable. Relationships among the eubrachyurans were generally equivocal, though results indicate the majoids or dorippoids were the least derived of the Eubrachyura. A new high level classification of the Brachyura is proposed.

  13. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  14. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  15. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Science.gov (United States)

    Guo, Zhiling; Liu, Sheng; Hu, Simin; Li, Tao; Huang, Yousong; Liu, Guangxing; Zhang, Huan; Lin, Senjie

    2012-01-01

    Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  16. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Zhiling Guo

    Full Text Available Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups, six (containing 99% of all the sequences belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus, and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  17. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  18. A phylogeny of the Passerida(Aves: Passeriformes)based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina; Wu; Yanfeng; Sun; Juyong; Li; Yaqing; Li; Yuefeng; Wu; Dongming; Li

    2015-01-01

    Background: Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations; however, the phylogenetic relationships within this assemblage have been the subject of many debates.Methods: We analyzed the 12 S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group.Results: Our results identified the monophyly of the three superfamilies in Passerida: Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida.Conclusion: Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  19. The ribosome as a missing link in the evolution of life.

    Science.gov (United States)

    Root-Bernstein, Meredith; Root-Bernstein, Robert

    2015-02-21

    Many steps in the evolution of cellular life are still mysterious. We suggest that the ribosome may represent one important missing link between compositional (or metabolism-first), RNA-world (or genes-first) and cellular (last universal common ancestor) approaches to the evolution of cells. We present evidence that the entire set of transfer RNAs for all twenty amino acids are encoded in both the 16S and 23S rRNAs of Escherichia coli K12; that nucleotide sequences that could encode key fragments of ribosomal proteins, polymerases, ligases, synthetases, and phosphatases are to be found in each of the six possible reading frames of the 16S and 23S rRNAs; and that every sequence of bases in rRNA has information encoding more than one of these functions in addition to acting as a structural component of the ribosome. Ribosomal RNA, in short, is not just a structural scaffold for proteins, but the vestigial remnant of a primordial genome that may have encoded a self-organizing, self-replicating, auto-catalytic intermediary between macromolecules and cellular life. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Effect of acidic ribosomal phosphoprotein mRNA 5'-untranslated region on gene expression and protein accumulation.

    Science.gov (United States)

    Bermejo, B; Remacha, M; Ortiz-Reyes, B; Santos, C; Ballesta, J P

    1994-02-11

    Constructions were made from genes encoding ribosomal acidic phosphoproteins YP1 beta (L44') and YP2 beta (L45) from Saccharomyces cerevisiae in which different parts of the 5'-untranslated regions were included. The constructs were inserted into centromeric plasmids under the control of the GAL1 promoter and expressed in yeast strains in which the genes coding for each acidic protein family, P1 and P2, had been disrupted. Deletions in the 5' region of the two genes have been found to oppositely affect their expression. Deletion of most of this region strongly stimulates the expression of YP2 beta (L45), increasing the translation efficiency of the mRNA, and generating a 6-fold excess of protein in the cell. A similar deletion in the rpYP1 beta gene represses the expression of the protein, reducing drastically the amount of the mRNA in the cell. The overexpression of rpYP2 beta affects the cell growth by inhibiting protein synthesis at the level of initiation. Reduction of the YP2 beta(L45) overproduction by growing in controlled concentrations of glucose abolishes the inhibitory effect. The excess protein, probably as a high molecular weight complex, apparently interferes with the joining of the 60 S subunit to the initiation complex generating the accumulation of polysome half-mers. In addition, the results indicate the existence of a regulatory mechanism by which each one of the two acidic proteins controls the expression of the other polypeptide. YP1 beta(L44') represses the expression of YP2 beta(L45), while this protein stimulates the expression of YP1 beta(L44').

  1. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida.

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A

    2015-12-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved.

  2. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A.

    2015-01-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved. PMID:26941463

  3. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  4. Ribosomal RNA phylogeny of bodonid and diplonemid flagellates and the evolution of euglenozoa.

    Science.gov (United States)

    von der Heyden, Sophie; Chao, Ema E; Vickerman, Keith; Cavalier-Smith, Thomas

    2004-01-01

    Euglenozoa is a major phylum of excavate protozoa (comprising euglenoids, kinetoplastids, and diplonemids) with highly unusual nuclear, mitochondrial, and chloroplast genomes. To improve understanding of euglenozoan evolution, we sequenced nuclear small-subunit rRNA genes from 34 bodonids (Bodo, Neobodo, Parabodo, Dimastigella-like, Rhynchobodo, Rhynchomonas, and unidentified strains), nine diplonemids (Diplonema, Rhynchopus), and a euglenoid (Entosiphon). Phylogenetic analysis reveals that diplonemids and bodonids are more diverse than previously recognised, but does not clearly establish the branching order of kinetoplastids, euglenoids, and diplonemids. Rhynchopus is holophyletic; parasitic species arose from within free-living species. Kinetoplastea (bodonids and trypanosomatids) are robustly holophyletic and comprise a major clade including all trypanosomatids and most bodonids ('core bodonids') and a very divergent minor one including Ichthyobodo. The root of the major kinetoplastid clade is probably between trypanosomatids and core bodonids. Core bodonids have three distinct subclades. Clade 1 has two distinct Rhynchobodo-like lineages; a lineage comprising Dimastigella and Rhynchomonas; and another including Cruzella and Neobodo. Clade 2 comprises Cryptobia/ Trypanoplasma, Procryptobia, and Parabodo. Clade 3 is an extensive Bodo saltans species complex. Neobodo designis is a vast genetically divergent species complex with mutually exclusive marine and freshwater subclades. Our analysis supports three phagotrophic euglenoid orders: Petalomonadida (holophyletic), Ploeotiida (probably holophyletic), Peranemida (paraphyletic).

  5. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    The rRNAs in Escherichia coli contain methylations at 24 nucleotides, which collectively are important for ribosome function. Three of these methylations are m5C modifications located at nucleotides C967 and C1407 in 16S rRNA and at nucleotide C1962 in 23S rRNA. Bacterial rRNA modifications gener...... methyltransferase gene rsmF, and that the nomenclature system be extended to include the rRNA methyltransferases that still await identification....

  6. Molecular phylogenetic inference of the woolly mammoth Mammuthus primigenius, based on complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes.

    Science.gov (United States)

    Noro, M; Masuda, R; Dubrovo, I A; Yoshida, M C; Kato, M

    1998-03-01

    Complete sequences of cytochrome b (1,137 bases) and 12S ribosomal RNA (961 bases) genes in mitochondrial DNA were successfully determined from the woolly mammoth (Mammuthus primigenius), African elephant (Loxodonta africana), and Asian elephant (Elephas maximus). From these sequence data, phylogenetic relationships among three genera were examined. Molecular phylogenetic trees reconstructed by the neighbor-joining and the maximum parsimony methods provided an identical topology both for cytochrome b and 12S rRNA genes. These results support the "Mammuthus-Loxodonta" clade, which is contrary to some previous morphological reports that Mammuthus is more closely related to Elephas than to Loxodonta.

  7. Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch: RNA-DEPENDENT CODON SELECTION OUTSIDE THE RIBOSOME.

    Science.gov (United States)

    Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J; Henkin, Tina M

    2015-09-18

    Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the "Specifier Sequence," in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNA(Gly) anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3' of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system.

  8. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Science.gov (United States)

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA.

  9. Inhibitor RNA blocks the protein translation mediated by hepatitis C virus internal ribosome entry site in vivo

    Institute of Scientific and Technical Information of China (English)

    Xue-Song Liang; Jian-Qi Lian; Yong-Xing Zhou; Mo-Bin Wan

    2004-01-01

    AIM: To investigate the inhibitory effect of hepatitis C virus internal ribosome entry site (HCV IRES) specific inhibitor RNA (IRNA) on gene expression mediated by HCV IRES in vivo.METHODS: By using G418 screening system, hepatoma cells constitutively expressing IRNA or mutant IRNA (mIRNA) were established and characterized, and HCV replicons containing the 5' untranslated region (5'UTR) were constructed by using the same method. Cotransfection of pCMVNCRluc containing HCV 5'UTR-luc fusion genes and eukaryotic vector of IRNA into human hepatic carcinoma cells (HepG2) was performed and the eukaryotic expression plasmid of IRNA was transfected transiently into HCV replicons, pCMVNCRluc or pCDNA-luc was cotransfected with pSV40-β Gal into IRNA expressing hepatoma cells by using lipofectamine 2000 in vitro. Then the reporting gene expression level was examined at 48 h after transfection by using a luminometer and the expressing level of HCV C antigen was analysed with a confocal microscope.RESULTS: Transient expression of IRES specific IRNA could significantly inhibit the expression of reporter gene and viral antigen mediated by HCV IRES by 50% to 90% in vivo, but mIRNA lost its inhibitory activity completely. The luciferase gene expression mediated by HCV IRES was blocked in the HHCC constitutively expressing IRNA. At 48 h after transfection, the expression level of reportor gene descreased by 20%, but cap-dependent luciferase gene expression was not affected. IRNA could inhibit the HCV replicon expression 24 h after transfection and the highest inhibitory activity was 80% by 72 h, and the inhibitory activity was not increased until 7d after transfection.CONCLUSION: IRNA can inhibit HCV IRES mediated gene expression in vivo.

  10. Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

    Directory of Open Access Journals (Sweden)

    Meier Harald

    2006-05-01

    Full Text Available Abstract Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating

  11. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  12. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for ‑1 ribosomal frameshifting stimulation

    Science.gov (United States)

    Zhong, Zhensheng; Yang, Lixia; Zhang, Haiping; Shi, Jiahao; Vandana, J. Jeya; Lam, Do Thuy Uyen Ha; Olsthoorn, René C. L.; Lu, Lanyuan; Chen, Gang

    2016-12-01

    Minus-one ribosomal frameshifting is a translational recoding mechanism widely utilized by many RNA viruses to generate accurate ratios of structural and catalytic proteins. An RNA pseudoknot structure located in the overlapping region of the gag and pro genes of Simian Retrovirus type 1 (SRV-1) stimulates frameshifting. However, the experimental characterization of SRV-1 pseudoknot (un)folding dynamics and the effect of the base triple formation is lacking. Here, we report the results of our single-molecule nanomanipulation using optical tweezers and theoretical simulation by steered molecular dynamics. Our results directly reveal that the energetic coupling between loop 2 and stem 1 via minor-groove base triple formation enhances the mechanical stability. The terminal base pair in stem 1 (directly in contact with a translating ribosome at the slippery site) also affects the mechanical stability of the pseudoknot. The ‑1 frameshifting efficiency is positively correlated with the cooperative one-step unfolding force and inversely correlated with the one-step mechanical unfolding rate at zero force. A significantly improved correlation was observed between ‑1 frameshifting efficiency and unfolding rate at forces of 15–35 pN, consistent with the fact that the ribosome is a force-generating molecular motor with helicase activity. No correlation was observed between thermal stability and ‑1 frameshifting efficiency.

  13. Effect of thiostrepton and 3'-terminal fragments of aminoacyl-tRNA on EF-Tu and ribosome-dependent GTP hydrolysis.

    Science.gov (United States)

    Bhuta, P; Chládek, S

    1982-08-30

    The effect of the antibiotics thiostrepton and micrococcin on EF-Tu-catalyzed (ribosome-dependent) GTP hydrolysis in the presence of A-Phe, C-A-Phe, or C-C-A-Phe (related to the sequence of the 3'-terminus of aminoacyl-tRNA)(System I) or by methanol ('uncoupled GTPase', System II) was investigated. In System I, thiostrepton increases the binding affinities of the effectors to the EF-Tu.GTP.70 S ribosome complex, as well as the extent of the GTP hydrolysis, while the KmGTP is virtually unchanged. Similarly, in the uncoupled system (System II) and in the absence of effectors, thiostrepton significantly increases VmaxGTP, whereas KmGTP remains unaffected. Micrococcin is without any effect in both systems. The 'uncoupled GTPase' (in System II) is also strongly inhibited by C-A-Phe. The results indicate the crucial role of the EF-Tu site which binds the aminoacylated C-C-A terminus of aminoacyl-tRNA in promoting GTP hydrolysis. It follows that the binding of the model effectors (such as C-C-A-Phe) to that site is favorably influenced by the interaction of thiostrepton with the 50 S ribosomal subunit, whereas thiostrepton, per se, does not influence the affinity of EF-Tu for GTP.

  14. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    Science.gov (United States)

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  15. Limited portability of G-patch domains in regulators of the Prp43 RNA helicase required for pre-mRNA splicing and ribosomal RNA maturation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Banerjee, Daipayan; McDaniel, Peter M; Rymond, Brian C

    2015-05-01

    The Prp43 DExD/H-box protein is required for progression of the biochemically distinct pre-messenger RNA and ribosomal RNA (rRNA) maturation pathways. In Saccharomyces cerevisiae, the Spp382/Ntr1, Sqs1/Pfa1, and Pxr1/Gno1 proteins are implicated as cofactors necessary for Prp43 helicase activation during spliceosome dissociation (Spp382) and rRNA processing (Sqs1 and Pxr1). While otherwise dissimilar in primary sequence, these Prp43-binding proteins each contain a short glycine-rich G-patch motif required for function and thought to act in protein or nucleic acid recognition. Here yeast two-hybrid, domain-swap, and site-directed mutagenesis approaches are used to investigate G-patch domain activity and portability. Our results reveal that the Spp382, Sqs1, and Pxr1 G-patches differ in Prp43 two-hybrid response and in the ability to reconstitute the Spp382 and Pxr1 RNA processing factors. G-patch protein reconstitution did not correlate with the apparent strength of the Prp43 two-hybrid response, suggesting that this domain has function beyond that of a Prp43 tether. Indeed, while critical for Pxr1 activity, the Pxr1 G-patch appears to contribute little to the yeast two-hybrid interaction. Conversely, deletion of the primary Prp43 binding site within Pxr1 (amino acids 102-149) does not impede rRNA processing but affects small nucleolar RNA (snoRNA) biogenesis, resulting in the accumulation of slightly extended forms of select snoRNAs, a phenotype unexpectedly shared by the prp43 loss-of-function mutant. These and related observations reveal differences in how the Spp382, Sqs1, and Pxr1 proteins interact with Prp43 and provide evidence linking G-patch identity with pathway-specific DExD/H-box helicase activity.

  16. [Mg2+ ions affect the structure of the central domain of the 18S rRNA in the vicinity of the ribosomal protein S13 binding site].

    Science.gov (United States)

    Ivanov, A V; Malygin, A A; Karpova, G G

    2013-01-01

    It is known that Mg2+ ions at high concentrations stabilize the structure of the 16S rRNA in a conformation favorable for binding to the ribosomal proteins in the course of the eubacterial 30S ribosomal subunits assembly in vitro. Effect of Mg2+ on the formation of the 18S rRNA structure at the 40S subunit assembly remains poorly explored. In this paper, we show that the sequentional increase of the Mg2+ concentration from 0.5 mM to 20 mM leads to a significant decrease of the affinity of recombinant human ribosomal protein S13 (rpS13e) to a RNA transcript corresponding to the central domain fragment of the 18S rRNA (18SCD). The regions near the rpS13e binding site in 18SCD (including the nucleotides of helices H20 and H22), whose availabilities to hydroxyl radicals were dependent on the Mg2+ concentration, were determined. It was found that increase of the concentrations of Mg2+ results in the enhanced accessibilities of nucleotides G933-C937 and C1006-A1009 in helix H22 and reduces those of nucleotides A1023, A1024, and A1028-S1026 in the helix H20. Comparison of the results obtained with the crystallographic data on the structure of the central domain of 18S rRNA in the 40S ribosomal subunit led to conclusion that increase of Mg2+ concentrations results in the reorientation of helices H20 and H24 relatively helices H22 and H23 to form a structure, in which these helices are positioned the same way as in 40S subunits. Hence, saturation of the central domain of 18S rRNA with coordinated Mg2+ ions causes the same changes in its structure as rpS13e binding does, and leads to decreasing of this domain affinity to the protein.

  17. RNA-protein complexes identified by crosslinking of polysomes.

    Science.gov (United States)

    Sköld, S E

    1981-01-01

    The bifunctional cleavable reagent diepoxybutane was used to investigate the crosslinking of proteins to the 16S and 23S RNA in Escherichia coli ribosomes. The crosslinking patterns from polysomes, accumulated in the absence and presence of oxytetracycline, as well as reassociated 70S ribosomes were compared. The 30S proteins: S3, S4, S5, S7, S8, S9, S12, S13, S14 and S18 were recovered crosslinked to the 16S RNA and the 50S: proteins L1, L2, L4, L13, L14-L21, L15, L16, L17, L18-L23, L19-22-24, L27 and L28 were recovered crosslinked to the 23S RNA, in all three associated states. Proteins crosslinked to the RNA of the heterologous subunit and therefore considered to be at or near the ribosomal subunit interface were, for all three states, proteins S1, S4, S6, S9, S12, S13, S14 and S18 from the small subunit and proteins L16, L17, L20 and L27 from the large subunit. Finally, the recovery of intrasubunit crosslinks was measured for the isolated subunits. Additional crosslinked complexes were observed between 16S RNA and S1, S2 as well as S6 from the 30S subunit; and between 23S RNA and L10, L11, L7/12 from the 50S subunit.

  18. Nanometer scale pores similar in size to the entrance of the ribosomal exit cavity are a common feature of large RNAs

    Science.gov (United States)

    Rivas, Mario; Tran, Quyen; Fox, George E.

    2013-01-01

    The highly conserved peptidyl transferase center (PTC) of the ribosome contains an RNA pore that serves as the entrance to the exit tunnel. Analysis of available ribosome crystal structures has revealed the presence of multiple additional well-defined pores of comparable size in the ribosomal (rRNA) RNAs. These typically have dimensions of 1–2 nm, with a total area of ∼100 Å2 or more, and most are associated with one or more ribosomal proteins. The PTC example and the other rRNA pores result from the packing of helices. However, in the non-PTC cases the nitrogenous bases do not protrude into the pore, thereby limiting the potential for hydrogen bonding within the pore. Instead, it is the RNA backbone that largely defines the pore likely resulting in a negatively charged environment. In many but not all cases, ribosomal proteins are associated with the pores to a greater or lesser extent. With the exception of the PTC case, the large subunit pores are not found in what are thought to be the evolutionarily oldest regions of the 23S rRNA. The unusual nature of the PTC pore may reflect a history of being created by hybridization between two or more RNAs early in evolution rather than simple folding of a single RNA. An initial survey of nonribosomal RNA crystal structures revealed additional pores, thereby showing that they are likely a general feature of RNA tertiary structure. PMID:23940386

  19. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria.

  20. Evidence that E. coli ribosomal protein S13 has two separable functional domains involved in 16S RNA recognition and protein S19 binding.

    Science.gov (United States)

    Schwarzbauer, J; Craven, G R

    1985-09-25

    We have found that E. coli ribosomal protein S13 recognizes multiple sites on 16S RNA. However, when protein S19 is included with a mixture of proteins S4, S7, S8, S16/S17 and S20, the S13 binds to the complex with measurably greater strength and with a stoichiometry of 1.5 copies per particle. This suggests that the protein may have two functional domains. We have tested this idea by cleaving the protein into two polypeptides. It was found that one of the fragments, composed of amino acid residues 84-117, retained the capacity to bind 16S RNA at multiple sites. Protein S19 had no affect on the strength or stoichiometry of the binding of this fragment. These data suggest that S13 has a C-terminal domain primarily responsible for RNA recognition and possibly that the N-terminal region is important for association with protein S19.

  1. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc.

  2. Expression of gyrB and 16S ribosomal RNA genes as indicators of growth and physiological activities of Legionella pneumophila.

    Science.gov (United States)

    Okuno, Toshihiro; Tani, Katsuji; Yamaguchi, Nobuyasu; Nasu, Masao

    2015-01-01

    To determine whether the DNA gyrase (gyrB) and 16S ribosomal RNA (16S rRNA) genes can be used as indicators of the biological activities of Legionella pneumophila, the expression levels were estimated. The ratio of mRNA/DNA in gyrB was 0.7 in mid log phase and decreased drastically after the log phase. For 16S rRNA, the ratio was highest in mid log phase (7.0×10(3)), and the value that was about 10% of that in the log phase was maintained for six days. The rRNA may be vital in the resting or active but nonculturable cells that are not growing but physiologically active. The expression levels of gyrB mRNA and 16S rRNA can be used as indicators of the growth activity and the physiological activity of L. pneumophila, respectively. Therefore, by measurement of these indicators, we can evaluate the activities of Legionella cells in various environments.

  3. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome.

    Science.gov (United States)

    Mouzakis, Kathryn D; Lang, Andrew L; Vander Meulen, Kirk A; Easterday, Preston D; Butcher, Samuel E

    2013-02-01

    The human immunodeficiency virus (HIV) requires a programmed -1 ribosomal frameshift for Pol gene expression. The HIV frameshift site consists of a heptanucleotide slippery sequence (UUUUUUA) followed by a spacer region and a downstream RNA stem-loop structure. Here we investigate the role of the RNA structure in promoting the -1 frameshift. The stem-loop was systematically altered to decouple the contributions of local and overall thermodynamic stability towards frameshift efficiency. No correlation between overall stability and frameshift efficiency is observed. In contrast, there is a strong correlation between frameshift efficiency and the local thermodynamic stability of the first 3-4 bp in the stem-loop, which are predicted to reside at the opening of the mRNA entrance channel when the ribosome is paused at the slippery site. Insertion or deletions in the spacer region appear to correspondingly change the identity of the base pairs encountered 8 nt downstream of the slippery site. Finally, the role of the surrounding genomic secondary structure was investigated and found to have a modest impact on frameshift efficiency, consistent with the hypothesis that the genomic secondary structure attenuates frameshifting by affecting the overall rate of translation.

  4. The Role of Disordered Ribosomal Protein Extensions in the Early Steps of Eubacterial 50 S Ribosomal Subunit Assembly

    Directory of Open Access Journals (Sweden)

    Youri Timsit

    2009-03-01

    Full Text Available Although during the past decade research has shown the functional importance of disorder in proteins, many of the structural and dynamics properties of intrinsically unstructured proteins (IUPs remain to be elucidated. This review is focused on the role of the extensions of the ribosomal proteins in the early steps of the assembly of the eubacterial 50 S subunit. The recent crystallographic structures of the ribosomal particles have revealed the picture of a complex assembly pathway that condenses the rRNA and the ribosomal proteins into active ribosomes. However, little is know about the molecular mechanisms of this process. It is thought that the long basic r-protein extensions that penetrate deeply into the subunit cores play a key role through disorder-order transitions and/or co-folding mechanisms. A current view is that such structural transitions may facilitate the proper rRNA folding. In this paper, the structures of the proteins L3, L4, L13, L20, L22 and L24 that have been experimentally found to be essential for the first steps of ribosome assembly have been compared. On the basis of their structural and dynamics properties, three categories of extensions have been identified. Each of them seems to play a distinct function. Among them, only the coil-helix transition that occurs in a phylogenetically conserved cluster of basic residues of the L20 extension appears to be strictly required for the large subunit assembly in eubacteria. The role of a helix-coil transitions in 23 S RNA folding is discussed in the light of the calcium binding protein calmodulin that shares many structural and dynamics properties with L20.

  5. Identification of Bacteria Synthesizing Ribosomal RNA in Response to Uranium Addition During Biostimulation at the Rifle, CO Integrated Field Research Site.

    Directory of Open Access Journals (Sweden)

    Lora R McGuinness

    Full Text Available Understanding which organisms are capable of reducing uranium at historically contaminated sites provides crucial information needed to evaluate treatment options and outcomes. One approach is determination of the bacteria which directly respond to uranium addition. In this study, uranium amendments were made to groundwater samples from a site of ongoing biostimulation with acetate. The active microbes in the planktonic phase were deduced by monitoring ribosomes production via RT-PCR. The results indicated several microorganisms were synthesizing ribosomes in proportion with uranium amendment up to 2 μM. Concentrations of U (VI >2 μM were generally found to inhibit ribosome synthesis. Two active bacteria responding to uranium addition in the field were close relatives of Desulfobacter postgateii and Geobacter bemidjiensis. Since RNA content often increases with growth rate, our findings suggest it is possible to rapidly elucidate active bacteria responding to the addition of uranium in field samples and provides a more targeted approach to stimulate specific populations to enhance radionuclide reduction in contaminated sites.

  6. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    DEFF Research Database (Denmark)

    Moazed, D; Van Stolk, B J; Douthwaite, S

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed...... by end-labeling followed by analine-induced strand scission (in some cases preceded by hybrid selection), or by primer extension using synthetic DNA oligomers. These studies show the following: The transition from the active to the inactive state cannot be described as a simple loosening or unfolding...

  7. Stepwise binding of tylosin and erythromycin to Escherichia coli ribosomes, characterized by kinetic and footprinting analysis.

    Science.gov (United States)

    Petropoulos, Alexandros D; Kouvela, Ekaterini C; Dinos, George P; Kalpaxis, Dimitrios L

    2008-02-22

    Erythromycin and tylosin are 14- and 16-membered lactone ring macrolides, respectively. The current work shows by means of kinetic and chemical footprinting analysis that both antibiotics bind to Escherichia coli ribosomes in a two-step process. The first step established rapidly, involves a low-affinity binding site placed at the entrance of the exit tunnel in the large ribosomal subunit, where macrolides bind primarily through their hydrophobic portions. Subsequently, slow conformational changes mediated by the antibiotic hydrophilic portion push the drugs deeper into the tunnel, in a high-affinity site. Compared with erythromycin, tylosin shifts to the high-affinity site more rapidly, due to the interaction of the mycinose sugar of the drug with the loop of H35 in domain II of 23 S rRNA. Consistently, mutations of nucleosides U2609 and U754 implicated in the high-affinity site reduce the shift of tylosin to this site and destabilize, respectively, the final drug-ribosome complex. The weak interaction between tylosin and the ribosome is Mg2+ independent, unlike the tight binding. In contrast, both interactions between erythromycin and the ribosome are reduced by increasing concentrations of Mg2+ ions. Polyamines attenuate erythromycin affinity for the ribosome at both sequential steps of binding. In contrast, polyamines facilitate the initial binding of tylosin, but exert a detrimental, more pronounced, effect on the drug accommodation at its final position. Our results emphasize the role of the particular interactions that side chains of tylosin and erythromycin establish with 23 S rRNA, which govern the exact binding process of each drug and its response to the ionic environment.

  8. An indigenous posttranscriptional modification in the ribosomal peptidyl transferase center confers resistance to an array of protein synthesis inhibitors

    Science.gov (United States)

    Toh, Seok-Ming; Mankin, Alexander S.

    2017-01-01

    A number of nucleotide residues in ribosomal RNA undergo specific posttranscriptional modification. The roles of most modifications are unclear, but their clustering in the functionally-important regions of rRNA suggest that they might either directly affect the activity or assembly of the ribosome or modulate its interactions with ligands. Of the 25 modified nucleotides in E. coli 23S rRNA, 14 are located in the peptidyl transferase center, the main antibiotic target in the large ribosomal subunit. Since nucleotide modifications have been closely associated with both antibiotic sensitivity and antibiotic resistance, the loss of some of these posttranscriptional modifications may affect the susceptibility of bacteria to antibiotics. We investigated the antibiotic sensitivity of E. coli cells in which the genes of eight rRNA modifying enzymes targeting the PTC were individually inactivated. The lack of pseudouridine at position 2504 of 23S rRNA was found to significantly increase the susceptibility of bacteria to peptidyl transferase inhibitors. Therefore, this indigenous posttranscriptional modification may have evolved as an intrinsic resistance mechanism protecting bacteria against natural antibiotics. PMID:18554609

  9. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.

    Science.gov (United States)

    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F

    2000-05-01

    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics.

  10. Chromosomal localization and copy number of 18S + 28S ribosomal RNA genes in evolutionarily diverse mosquitoes (Diptera, Culicidae)

    National Research Council Canada - National Science Library

    Kumar, A; Rai, K S

    1990-01-01

    In situ hybridization using 3H-labeled 18S and 28S ribosomal DNA (rDNA) probes from Aedes albopictus was performed on the mitotic chromosomes of 20 species of mosquitoes belonging to 8 genera of subfamilies Culicinae and Anophelinae...

  11. Molecular signatures of ribosomal evolution.

    Science.gov (United States)

    Roberts, Elijah; Sethi, Anurag; Montoya, Jonathan; Woese, Carl R; Luthey-Schulten, Zaida

    2008-09-16

    Ribosomal signatures, idiosyncrasies in the ribosomal RNA (rRNA) and/or proteins, are characteristic of the individual domains of life. As such, insight into the early evolution of the domains can be gained from a comparative analysis of their respective signatures in the translational apparatus. In this work, we identify signatures in both the sequence and structure of the rRNA and analyze their contributions to the universal phylogenetic tree using both sequence- and structure-based methods. Domain-specific ribosomal proteins can be considered signatures in their own right. Although it is commonly assumed that they developed after the universal ribosomal proteins, we present evidence that at least one may have been present before the divergence of the organismal lineages. We find correlations between the rRNA signatures and signatures in the ribosomal proteins showing that the rRNA signatures coevolved with both domain-specific and universal ribosomal proteins. Finally, we show that the genomic organization of the universal ribosomal components contains these signatures as well. From these studies, we propose the ribosomal signatures are remnants of an evolutionary-phase transition that occurred as the cell lineages began to coalesce and so should be reflected in corresponding signatures throughout the fabric of the cell and its genome.

  12. Crystal structure of the eukaryotic ribosome.

    Science.gov (United States)

    Ben-Shem, Adam; Jenner, Lasse; Yusupova, Gulnara; Yusupov, Marat

    2010-11-26

    Crystal structures of prokaryotic ribosomes have described in detail the universally conserved core of the translation mechanism. However, many facets of the translation process in eukaryotes are not shared with prokaryotes. The crystal structure of the yeast 80S ribosome determined at 4.15 angstrom resolution reveals the higher complexity of eukaryotic ribosomes, which are 40% larger than their bacterial counterparts. Our model shows how eukaryote-specific elements considerably expand the network of interactions within the ribosome and provides insights into eukaryote-specific features of protein synthesis. Our crystals capture the ribosome in the ratcheted state, which is essential for translocation of mRNA and transfer RNA (tRNA), and in which the small ribosomal subunit has rotated with respect to the large subunit. We describe the conformational changes in both ribosomal subunits that are involved in ratcheting and their implications in coordination between the two associated subunits and in mRNA and tRNA translocation.

  13. Alternative patterns of transcription and translation of the ribosomal protein L32 mRNA in somatic and spermatogenic cells in mice.

    Science.gov (United States)

    Kleene, Kenneth C; Cataldo, Leah; Mastrangelo, Mary-Ann; Tagne, Jean-Bosco

    2003-11-15

    The patterns of transcription and translation of the ribosomal protein L32 (Rpl32) mRNA differ greatly in adult testis and somatic tissues. Northern blots reveal that the levels of Rpl32 mRNA are four- to five-fold higher in prepubertal and adult testes, and purified pachytene spermatocytes and round spermatids than in a variety of nongrowing adult somatic tissues. 5' RACE demonstrates that transcription in 8-day prepubertal testis, which lacks meiotic and haploid cells, strongly prefers the same start site in the 5' terminal oligopyrimidine tract (5' TOP) that is used is somatic cells. The 5' TOP is a cis element that inhibits translation of many mRNAs in nongrowing somatic cells. Although the sizes of deadenylated Rpl32 mRNAs are indistinguishable in somatic and spermatogenic cells, transcription initiates at 11 sites over a 31-nt segment in adult testis and approximately 62% of Rpl32 mRNAs lack a 5' TOP. In agreement with previous studies, low levels of cycloheximide increase the proportions and sizes of polysomes in absorbance profiles, and increase the proportions and sizes of polysomes translating four 5' TOP mRNA species including the Rpl32 mRNA in 8-day seminiferous tubules. In contrast, cycloheximide has little or no effect on the absorbance profiles and distribution of Rpl32 mRNA and 5' TOP mRNAs in adult seminiferous tubules. The failure of cycloheximide to increase the size of polysomes in adult seminiferous tubules implies a block in the pathway by which ribosomes are recruited onto translationally active mRNAs.

  14. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Science.gov (United States)

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  15. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Eukaryotic 18S ribosomal RNA (rRNA gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  16. Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen cing and Characterization of Sailonggu(Whole Bone of Myospalax baileyi Thomas)cing%塞隆骨原动物高原鼢鼠核基因18S rRNA序列测定与分析

    Institute of Scientific and Technical Information of China (English)

    曹晖; 刘玉萍; 张绍来; 周开亚

    2001-01-01

    目的:测定仓鼠科动物高原鼢鼠Myospalax b aileyi的核rDNA基因序列,为塞隆骨正品基原检定提供分子依据。方法:采用PCR直接测序技术测定高原鼢鼠18S rRNA基因核苷酸序列并作序列特征分析。[ HT5”H〗结果:高原鼢鼠的18S rRNA序列长度为1 851 bp。根据排序比较,高原鼢鼠与2种鼠科动物间的DNA序列同源性 为72.04%~72.18%。结论:通过基因序列分析,DNA测序技术可成为 塞隆骨正品基原检定的准确有效手段。%Objective: Sequencing the nuclear ribosomal RNA small subunit (18S r RNA) gene of Myospalax baileyi (Cricetidae) to develop an ultimate and defi nitive means for origin identification of genuine Sailonggu. Methods: The total DNA wa s prepared from dried tail tissues. The nuclear 18S rRNA gene region was amplifi ed by PCR using a consensus primer set and its nucleotide sequence was determine d by PCR direct sequencing. The characteristic analysis of 18S rRNA sequences wa s generated usin software program Genetyx-SV/R Version 10.1. Results: The entire 18S rRNA gene region of M. baileyi spanned 1851 bp in length. Althou gh m ultiple alignment of sequence indicates that there are only lower homology (72.0 4%~72.18%)comparing with its two alias Mus musculus (GenBank Accession numb er X 00686)and Rattus norvegicus (M11188)(Muridae), their highly conservative dom ain i s located in 1020~1509 nt. There are many variable sites from upstream of 5'-e nd , which coud provide a novel information for molecular recognition of Sailonggu. Conclusion:DNA sequencing could be a useful and reliable tool in the origin identification of genuine Sailonggu.

  17. Structural Dynamics of the Ribosome

    OpenAIRE

    Korostelev, Andrei; Ermolenko, Dmitri N.; Noller, Harry F.

    2008-01-01

    Protein synthesis is inherently a dynamic process, requiring both small- and large-scale movements of tRNA and mRNA. It has long been suspected that these movements might be coupled to conformational changes in the ribosome, and in its RNA moieties in particular. Recently, the nature of ribosome structural dynamics has begun to emerge from a combination of approaches, most notably cryo-EM, X-ray crystallography and FRET. Ribosome movement occurs both on a grand scale, as in the intersubunit r...

  18. Epistasis analysis of 16S rRNA ram mutations helps define the conformational dynamics of the ribosome that influence decoding.

    Science.gov (United States)

    Ying, Lanqing; Fredrick, Kurt

    2016-04-01

    The ribosome actively participates in decoding, with a tRNA-dependent rearrangement of the 30S A site playing a key role. Ribosomal ambiguity (ram) mutations have mapped not only to the A site but also to the h12/S4/S5 region and intersubunit bridge B8, implicating other conformational changes such as 30S shoulder rotation and B8 disruption in the mechanism of decoding. Recent crystallographic data have revealed that mutation G299A in helix h12 allosterically promotes B8 disruption, raising the question of whether G299A and/or other ram mutations act mainly via B8. Here, we compared the effects of each of several ram mutations in the absence and presence of mutation h8Δ2, which effectively takes out bridge B8. The data obtained suggest that a subset of mutations including G299A act in part via B8 but predominantly through another mechanism. We also found that G299A in h12 and G347U in h14 each stabilize tRNA in the A site. Collectively, these data support a model in which rearrangement of the 30S A site, inward shoulder rotation, and bridge B8 disruption are loosely coupled events, all of which promote progression along the productive pathway toward peptide bond formation.

  19. Mapping contacts of the S12-S7 intercistronic region of str operon mRNA with ribosomal protein S7 of E. coli.

    Science.gov (United States)

    Golovin, Andrey; Spiridonova, Vera; Kopylov, Alexei

    2006-10-30

    In E. coli, S7 initiates 30S ribosome assembly by binding to 16S rRNA. It also regulates translation of the S12 and S7 cistrons of the 'streptomycin' operon transcript by binding to the S12-S7 intercistronic region. Here, we describe the contacts of N-terminally His(6)-tagged S7 with this region as mapped by UV-induced cross-linking. The cross-links are located at U(-34), U(-35), quite distant from the start codons of the two cistrons. In order to explain the mechanism of translational repression of S12-S7, we consider a possible conformational rearrangement of the intercistronic RNA structure induced by S7 binding.

  20. Molecular typing of sand fly species (Diptera, Psychodidae, Phlebotominae) from areas endemic for Leishmaniasis in Ecuador by PCR-RFLP of 18S ribosomal RNA gene.

    Science.gov (United States)

    Terayama, Yoshimi; Kato, Hirotomo; Gomez, Eduardo A; Uezato, Hiroshi; Calvopiña, Manuel; Iwata, Hiroyuki; Hashiguchi, Yoshihisa

    2008-09-01

    Surveillance of the distribution of sand fly species is important for prediction of the risk and expansion of Leishmania infection in endemic and surrounding areas. In the present study, a simple and reliable method of typing New World Lutzomyia species circulating in endemic areas in Ecuador was established by using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) technique. PCR-RFLP of 18S ribosomal RNA (rRNA) genes with the restriction enzyme AfaI and subsequently HinfI successfully identified seven sand fly species in nine endemic areas in Ecuador. Although intraspecific genetic-diversity affecting the RFLP-patterns was detected in a species, the patterns were species specific. The method promises to be a powerful tool for the classification of New World Lutzomyia species.

  1. The vhs1 mutant form of herpes simplex virus virion host shutoff protein retains significant internal ribosome entry site-directed RNA cleavage activity.

    Science.gov (United States)

    Lu, P; Saffran, H A; Smiley, J R

    2001-01-01

    The virion host shutoff (vhs) protein of herpes simplex virus (HSV) triggers global shutoff of host protein synthesis and accelerated turnover of host and viral mRNAs during HSV infection. As well, it induces endoribonucleolytic cleavage of RNA substrates when produced in a rabbit reticulocyte lysate (RRL) in vitro translation system. The vhs1 point mutation (Thr 214-->Ile) eliminates vhs function during virus infection and in transiently transfected mammalian cells and was therefore previously considered to abolish vhs activity. Here we demonstrate that the vhs1 mutant protein induces readily detectable endoribonuclease activity on RNA substrates bearing the internal ribosome entry site of encephalomyocarditis virus in the RRL assay system. These data document that the vhs1 mutation does not eliminate catalytic activity and raise the possibility that the vhs-dependent endoribonuclease employs more than one mode of substrate recognition.

  2. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH).

    Science.gov (United States)

    Leveau, Johan H J; Gerards, Saskia; de Boer, Wietse; van Veen, Johannes A

    2004-09-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia coli of large-sized genomic DNA fragments of the mycophagous soil bacterium Collimonas fungivorans, and hybridized 768 library clones with the Collimonas-specific fluorescent probe CTE998-1015. Critical to the success of this approach (which we refer to as large-insert library FISH or LIL-FISH) was the ability to induce fosmid copy number, the exponential growth status of library clones in the FISH assay and the use of a simple pooling strategy to reduce the number of hybridizations. Twelve out of 768 E. coli clones were suspected to harbour and express Collimonas 16S rRNA genes based on their hybridization to CTE998-1015. This was confirmed by the finding that all 12 clones were also identified in an independent polymerase chain reaction-based screening of the same 768 clones using a primer set for the specific detection of Collimonas 16S ribosomal DNA (rDNA). Fosmids isolated from these clones were grouped by restriction analysis into two distinct contigs, confirming that C. fungivorans harbours at least two 16S rRNA genes. For one contig, representing 1-2% of the genome, the nucleotide sequence was determined, providing us with a narrow but informative view of Collimonas genome structure and content.

  3. Nucleolar Dominance and Repression of 45S Ribosomal RNA Genes in Hybrids between Xenopus borealis and X. muelleri (2n = 36).

    Science.gov (United States)

    Maciak, Sebastian; Michalak, Katarzyna; Kale, Shiv D; Michalak, Pawel

    2016-01-01

    Nucleolar dominance is a dramatic disruption in the formation of nucleoli and the expression of ribosomal RNA (rRNA) genes, characteristic of some plant and animal hybrids. Here, we report that F1 hybrids produced from reciprocal crosses between 2 sister species of Xenopus clawed frogs, X. muelleri and X. borealis, undergo nucleolar dominance somewhat distinct from a pattern previously reported in hybrids between phylogenetically more distant Xenopus species. Patterns of nucleolar development, 45S rRNA expression, and gene copy inheritance were investigated using a combination of immunostaining, pyrosequencing, droplet digital PCR, flow cytometry, and epigenetic inhibition. In X. muelleri × X. borealis hybrids, typically only 1 nucleolus is formed, and 45S rRNA genes are predominantly expressed from 1 progenitor's alleles, X. muelleri, regardless of the cross-direction. These changes are accompanied by an extensive (∼80%) loss of rRNA gene copies in the hybrids relative to their parents, with the transcriptionally underdominant variant (X. borealis) being preferentially lost. Chemical treatment of hybrid larvae with a histone deacetylase inhibitor resulted in a partial derepression of the underdominant variant. Together, these observations shed light on the genetic and epigenetic basis of nucleolar dominance as an underappreciated manifestation of genetic conflicts within a hybrid genome.

  4. Transcriptional Regulation of Mouse Ribosomal RNA Synthesis by Pathways Involving Protein Kinase C, Calcium, Insulin and Serum

    Science.gov (United States)

    1992-05-08

    Arnheim , 1983). These enhancer regions share many of the same characteristics of polymerase II enhancers (Khoury and Grussl,1983). They enhance 6...1979) were kind gifts of Dr. Norman Arnheim . Plasmids pUC9, pUC19, and pUC18, T4 DNA ligase, all restriction enzymes and molecular weight markers were...H.E. Morgan, 1991. Phorbol Ester Stimulation of Protein Kinase C Activity and Ribosomal DNA Transcription, j. ;iol. Chem. 266:22003-22009. Arnheim , N

  5. Affinity of ribosomal protein S8 from mesophilic and (hyper)thermophilic archaea and bacteria for 16S rRNA correlates with the growth temperatures of the organisms.

    Science.gov (United States)

    Gruber, Thomas; Köhrer, Caroline; Lung, Birgit; Shcherbakov, Dmitri; Piendl, Wolfgang

    2003-08-14

    The ribosomal protein S8 plays a pivotal role in the assembly of the 30S ribosomal subunit. Using filter binding assays, S8 proteins from mesophilic, and (hyper)thermophilic species of the archaeal genus Methanococcus and from the bacteria Escherichia coli and Thermus thermophilus were tested for their affinity to their specific 16S rRNA target site. S8 proteins from hyperthermophiles exhibit a 100-fold and S8 from thermophiles exhibit a 10-fold higher affinity than their mesophilic counterparts. Thus, there is a striking correlation of affinity of S8 proteins for their specific RNA binding site and the optimal growth temperatures of the respective organisms. The stability of individual rRNA-protein complexes might modulate the stability of the ribosome, providing a maximum of thermostability and flexibility at the growth temperature of the organism.

  6. Ribosomal targets for antibiotic drug discovery

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  7. Macrolide-peptide conjugates as probes of the path of travel of the nascent peptides through the ribosome.

    Science.gov (United States)

    Washington, Arren Z; Benicewicz, Derek B; Canzoneri, Joshua C; Fagan, Crystal E; Mwakwari, Sandra C; Maehigashi, Tatsuya; Dunham, Christine M; Oyelere, Adegboyega K

    2014-11-21

    Despite decades of research on the bacterial ribosome, the ribosomal exit tunnel is still poorly understood. Although it has been suggested that the exit tunnel is simply a convenient route of egress for the nascent chain, specific protein sequences serve to slow the rate of translation, suggesting some degree of interaction between the nascent peptide chain and the exit tunnel. To understand how the ribosome interacts with nascent peptide sequences, we synthesized and characterized a novel class of probe molecules. These peptide-macrolide (or "peptolide") conjugates were designed to present unique peptide sequences to the exit tunnel. Biochemical and X-ray structural analyses of the interactions between these probes and the ribosome reveal interesting insights about the exit tunnel. Using translation inhibition and RNA structure probing assays, we find the exit tunnel has a relaxed preference for the directionality (N → C or C → N orientation) of the nascent peptides. Moreover, the X-ray crystal structure of one peptolide derived from a positively charged, reverse Nuclear Localization Sequence peptide, bound to the 70S bacterial ribosome, reveals that the macrolide ring of the peptolide binds in the same position as other macrolides. However, the peptide tail folds over the macrolide ring, oriented toward the peptidyl transferase center and interacting in a novel manner with 23S rRNA residue C2442 and His69 of ribosomal protein L4. These data suggest that these peptolides are viable probes for interrogating nascent peptide-exit tunnel interaction.

  8. Chemical and structural characterization of a model Post-Termination Complex (PoTC) for the ribosome recycling reaction: Evidence for the release of the mRNA by RRF and EF-G

    Science.gov (United States)

    Iwakura, Nobuhiro; Yokoyama, Takeshi; Quaglia, Fabio; Mitsuoka, Kaoru; Mio, Kazuhiro; Shigematsu, Hideki; Shirouzu, Mikako; Kaji, Akira; Kaji, Hideko

    2017-01-01

    A model Post-Termination Complex (PoTC) used for the discovery of Ribosome Recycling Factor (RRF) was purified and characterized by cryo-electron microscopic analysis and biochemical methods. We established that the model PoTC has mostly one tRNA, at the P/E or P/P position, together with one mRNA. The structural studies were supported by the biochemical measurement of bound tRNA and mRNA. Using this substrate, we establish that the release of tRNA, release of mRNA and splitting of ribosomal subunits occur during the recycling reaction. Order of these events is tRNA release first followed by mRNA release and splitting almost simultaneously. Moreover, we demonstrate that IF3 is not involved in any of the recycling reactions but simply prevents the re-association of split ribosomal subunits. Our finding demonstrates that the important function of RRF includes the release of mRNA, which is often missed by the use of a short ORF with the Shine-Dalgarno sequence near the termination site. PMID:28542628

  9. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA