WorldWideScience

Sample records for 16s-23s rrna internal

  1. Analysis of the 16S-23S rRNA gene internal transcribed spacer region in Klebsiella species.

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-11-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types-ITS(none) (without tRNA genes), ITS(glu) [with a tRNA(Glu (UUC)) gene], and ITS(ile+ala) [with tRNA(Ile (GAU)) and tRNA(Ala (UGC)) genes]-were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITS(glu) and ITS(ile+ala). The presence of ITS(none) in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITS(none), from 0.967 to 1.000 for ITS(glu), and from 0.968 to 1.000 for ITS(ile+ala). Interspecies sequence identities range from 0.775 to 0.989 for ITS(none), from 0.798 to 0.997 for ITS(glu), and from 0.712 to 0.985 for ITS(ile+ala). Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes.

  2. Differentiation of acetic acid bacteria based on sequence analysis of 16S-23S rRNA gene internal transcribed spacer sequences.

    Science.gov (United States)

    González, Angel; Mas, Albert

    2011-06-30

    The 16S-23S gene internal transcribed spacer sequence of sixty-four strains belonging to different acetic acid bacteria genera were analyzed, and phylogenetic trees were generated for each genera. The topologies of the different trees were in accordance with the 16S rRNA gene trees, although the similarity percentages obtained between the species was shown to be much lower. These values suggest the usefulness of including the 16S-23S gene internal transcribed spacer region as a part of the polyphasic approach required for the further classification of acetic acid bacteria. Furthermore, the region could be a good target for primer and probe design. It has also been validated for use in the identification of unknown samples of this bacterial group from wine vinegar and fruit condiments.

  3. Analysis of 16S-23S rRNA internal transcribed spacer regions in Pasteurellaceae isolated from laboratory rodents.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Christensen, Henrik; Sager, Martin

    2012-09-01

    The internal transcribed spacer (ITS) regions of members of Pasteurellaceae isolated from rodents, including the [Pasteurella] pneumotropica biotypes Jawetz and Heyl, [Actinobacillus] muris, "Hemophilus influenzaemurium" and Bisgaard taxon 17 were studied and their feasibility to discriminate these species was analyzed. The reference strains of all species analyzed showed unique species-specific ITS patterns which were further present in 49 clinical isolates of [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris allowing their identification by comparison to the reference strains pattern. Sequence analysis of the amplified fragments revealed in all species, with exception of "H. influenzaemurium", a larger ITS(ile+ala) which contained the genes for tRNA(Ile(GAU)) and tRNA(Ala(UGC)) and a smaller ITS(glu) with the tRNA(Glu(UUC)) gene. "H. influenzaemurium" revealed two each of the larger and respectively the smaller ITS fragments. Both the length and the sequence of each ITS type were highly conserved within the [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris strains tested. On the contrary, ITS sequences revealed significant interspecies variations with identity levels ranging from 61.2 to 89.5% for ITS(ile+ala) and 56.5 to 86.8% for ITS(glu). Sequences regions with significant interspecies variation but highly conserved within the species were identified and might be used to design probes for the identification of rodent Pasteurellaceae to the species level. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Development of a multiplex PCR assay based on the 16S-23S rRNA internal transcribed spacer for the detection and identification of rodent Pasteurellaceae.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Bleich, André; Gougoula, Christina; Sager, Martin

    2013-11-01

    The rodents Pasteurellaceae have to be excluded from the specified pathogen free experimental animal facilities. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals just a few molecular based methods are available for their detection and identification. The aim of the present investigation was to develop a multiplex PCR assay allowing detection of all rodent Pasteurellaceae and identification of [Pasteurella] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl and [Actinobacillus] muris, as the most prevalent members of the group. For this, a Pasteurellaceae common forward primer located on the 16S rRNA gene was used in conjunction with four different reverse primers specific for [P.] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl, [A.] muris and a common reverse primer for all rodent Pasteurellaceae, all targeting the 16S-23S rRNA internal transcribed spacer sequences. The performance characteristics of the assay were tested against 125 Pasteurellaceae isolates belonging to eleven different species and including 34 strains of [P.] pneumotropica biotype Jawetz, 44 strains of [P.] pneumotropica biotype Heyl and 37 strains of [A.] muris. Additionally, eight other mouse associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA gene sequencing. This multiplex PCR represents the first molecular tool able to detect and differentiate in a single assay among the Pasteurellaceae found in laboratory mouse and may become a reliable alternative to the present diagnostic methods. © 2013.

  5. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  6. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  7. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    Science.gov (United States)

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  8. Unusual features of the sequences of copies of the 16S-23S rRNA internal transcribed spacer regions of Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi arise from horizontal gene transfer events.

    Science.gov (United States)

    Maslunka, Christopher; Gürtler, Volker; Seviour, Robert

    2015-02-01

    The highly variable nature of the internal transcribed spacer region (ITS) has been claimed to represent an ideal target for designing species-specific probes/primers capable of differentiating between closely related Acinetobacter species. However, several Acinetobacter species contain multiple ITS copies of variable lengths, and these include Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi. This study shows these length variations result from inter-genomic insertion/deletion events (indels) involving horizontal transfer of ITS fragments of other Acinetobacter species and possibly unrelated bacteria, as shown previously by us. In some instances, indel incorporation results in the loss of probe target sites in the recipient cell ITS. In other cases, some indel sequences contain target sites for probes designed from a single ITS sequence to target other Acinetobacter species. Hence, these can generate false positives. The largest of the indels that remove probe sites is 683 bp (labelled bay/i1-0), and it derives from the horizontal transfer of a complete ITS between A. bereziniae BCRC15423(T) and A. baylyi strain ADP1. As a consequence, ITS sequencing or fingerprinting cannot be used to distinguish between the 683 bp ITS in these two strains.

  9. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    Science.gov (United States)

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  10. Improved identification of rapidly growing mycobacteria by a 16S-23S internal transcribed spacer region PCR and capillary gel electrophoresis.

    Directory of Open Access Journals (Sweden)

    Timothy J Gray

    Full Text Available The identification of rapidly growing mycobacteria (RGM remains problematic because of evolving taxonomy, limitations of current phenotypic methods and absence of a universal gene target for reliable speciation. This study evaluated a novel method of identification of RGM by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS followed by resolution of amplified fragments by capillary gel electrophoresis (CGE. Nineteen American Type Culture Collection (ATCC Mycobacterium strains and 178 clinical isolates of RGM (12 species were studied. All RGM ATCC strains generated unique electropherograms with no overlap with slowly growing mycobacteria species, including M. tuberculosis. A total of 47 electropherograms for the 178 clinical isolates were observed allowing the speciation of 175/178 (98.3% isolates, including the differentiation of the closely related species, M. massiliense (M. abscessus subspecies bolletii and M. abscessus (M. abscessus sensu stricto. ITS fragment size ranged from 332 to 534 bp and 33.7% of clinical isolates generated electropherograms with two distinct peaks, while the remainder where characterized with a single peak. Unique peaks (fragment lengths were identified for 11/12 (92% RGM species with only M. moriokaense having an indistinguishable electropherogram from a rarely encountered CGE subtype of M. fortuitum. We conclude that amplification of the 16S-23S ITS gene region followed by resolution of fragments by CGE is a simple, rapid, accurate and reproducible method for species identification and characterization of the RGM.

  11. Establishment and analysis of specific DNA patterns in 16S-23S rRNA gene spacer regions for differentiating different bacteria

    Institute of Scientific and Technical Information of China (English)

    尚世强; 付君芬; 董关萍; 洪文澜; 杜立中; 俞锡林

    2003-01-01

    Objective To establish the specific 16S-23S rRNA gene spacer regions in different bacteria using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), DNA cloning and sequences analysis. Methods A pair of primers were selected from highly conserved sequences adjacent to the 16S-23S rRNA spacer region. Bacterial DNA from sixty-one strains of standard bacteria and corresponding clinical isolates representative of 20 genera and 26 species was amplified by PCR, and further analyzed by RFLP, DNA cloning and sequences analysis. Furthermore, all specimens were examined by bacterial culturing and PCR-RFLP analysis. The evaluation of these assays in practical clinic practice was also discussed.Results Restriction enzyme analysis revealed one, two or three bands or more observed among the 26 different standard strains. The sensitivity of PCR reached 2.5 colony-forming unit (CFU), and there was no cross reaction with human genomic DNA, fungus or virus. Fourteen species could be distinguished immediately by PCR, while another 10 species were further identified by Hinf Ⅰ or Alu Ⅰ digestion. The only difference between K.pneumoniae and E.durans was located at the site of the 779th nucleotide according to the sequence analysis and only XmaⅢ digestion could distinguish one from another. Of 42 specimens from septicemic neonates, 15 were identified as positive by blood culture at a rate of 35.7%. However, 27 specimens identified as positive by PCR, with a rate of 64.2%, a method significantly more effective than blood culture (P<0.01). Of 6 cerebrospinal fluid (CSF) specimens, one tested positive for S.epidermidis was also positive by PCR, two culture negative were positive by PCR and diagnosed as S.epidermidis according to the DNA pattern. One positive for C.neoformans was negative by PCR. The other two specimens were negative by both PCR and culture.Conclusions The method of detecting bacterial 16S-23S rRNA spacer regions using PCR

  12. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  13. Analysis of the genotypes among different strains of common Mycobacteria based on 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer sequences%常见分枝杆菌种内不同株之间16S rRNA基因和16S-23SrRNA ITS序列分析结果的比较

    Institute of Scientific and Technical Information of China (English)

    黄至澄; 徐黔宁; 闫李侠; 陈保文; 王国治

    2011-01-01

    目的 针对常见分枝杆菌不同株对其基因序列进行分析,比较分析结果.方法 利用16S rRNA Gene和16S-23S rRNAITS(转录间隔区序列)分析法分别对97株共7种DSMZ/ATCC引进的常见分枝杆菌进行种内不同株之间基因差异性分析,对比两种分型结果的异同.结果 16S rRNA基因可将13株草分枝杆菌分为3个型别,18株偶发分枝杆菌分为6个型别,17株耻垢分枝杆菌分为4个型别,8株戈登分枝杆菌分为3个型别,9株龟分枝杆菌龟亚种分为3个型别,15株堪萨斯分枝杆菌分为2个型别,17株产鼻疽分枝杆菌分为1个型别;而16S-23S rRNA ITS可依次将上述分枝杆菌分为3个、15个、7个、3个、4个、3个、5个型别.结论 16S rRNA G ene分析和16S-23S rRNA ITS分析均是分枝杆菌基因型分析的可靠方法,此外,16S-23SrRNA ITS的种内多态性高于16S rRNA Gene.

  14. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    OpenAIRE

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A.

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 speci...

  15. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  16. Identification of Carnobacterium Species by Restriction Fragment Length Polymorphism of the 16S-23S rRNA Gene Intergenic Spacer Region and Species-Specific PCR

    OpenAIRE

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-01-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in ord...

  17. Genotyping of Salmonella spp.by 16S-23S rRNA assay%沙门菌PCR-dHPLC基因分型方法建立

    Institute of Scientific and Technical Information of China (English)

    张东方; 袁飞; 王娉; 杨海荣; 胡玥; 赵勇胜; 陈颖; 葛毅强

    2012-01-01

    Objective To develop a polymerase chain reaction-denaturing high performance liquid chromatography (PCR-dHPLC) genotyping method for genotyping of Salmonella spp. Methods Specific primers of 16S-23S rRNA in-tergenic spacer sequence (ITS) region were used to subtype Salmonella spp. The PCR amplification products of experimental strains were separated by dHPLC. The results of genotyping achieved through the differences between dHPLC peaks and were comparaed to the results obtained by serological typing and biochemical typing. Results Totally 89 Salmonella spp. strains were successfully genotyped into 12 dHPLC types(D type). All the Salmonella spp. strains had one same chromatographic peak,while other food-born pathogens showed no similar peak. DNA sequence analysis showed that the sequence was 600bp. The results indicate that the chromatographic peak is specific to Salmonella spp. Comparing the dHPLC genotyping results with those of serological typing and biochemical typing, we found dHPLC genotyping results were significantly differ from the serological typing results, while were consistent with that of the biochemical typing. Conclusion DHPLC is a novel, rapid, highly accurate, and cost-effective genotyping method for genotyping of Salmonella spp.%目的 建立沙门菌聚合酶链反应-变性高效液相色谱(PCR-dHPLC)基因分型方法.方法 采用16S ~23S rRNA内转录间隔(ITS)作为沙门菌分型目的基因,确定特异性扩增引物,进行PCR扩增,扩增产物经dHPLC分离,根据dHPLC图谱峰型差异进行分型,并与血清学和生化分型结果比较.结果 89株沙门菌共分为12个dHPLC型(D型);所有沙门菌均有1个相同色谱峰,克隆测序结果表明,其片断大小为600 bp,其他8种食源性致病菌对照株无此色谱峰,应为沙门菌16S~23S rRNA基因序列的特征性条带,分型结果与血清学差异较大,与生化分型结果有一定一致性.结论 所建立的沙门菌PCR-dHPLC基因分型方法具快速

  18. Molecular analysis of the 16S-23S rDNA internal spacer region (ISR) and truncated tRNA(Ala) gene segments in Campylobacter lari.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakanishi, S; Nakajima, T; Matsubara, K; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-06-01

    Following PCR amplification and sequencing, nucleotide sequence alignment analyses demonstrated the presence of two kinds of 16S-23S rDNA internal spacer regions (ISRs), namely, long length ISRs of 837-844 base pair (bp) [n = six for urease-negative (UN) Campylobacter lari isolates, UN C. lari JCM2530(T), RM2100, 176, 293, 299 and 448] and short length ISRs of 679-725 bp [n = six for UN C. lari: n = 14 for urease-positive thermophilic Campylobacter (UPTC) isolates]. The analyses also indicated that the short length ISRs mainly lacked the 156 bp sequence from the nucleotide positions 122-277 bp in long length ISRs for UN C. lari JCM2530(T). The 156 bp sequences shared 94.9-96.8 % sequence similarity among six isolates. Surprisingly, atypical tRNA(Ala) gene segment (5' end 35 bp), which was extremely truncated, occurred within the 156 bp sequences in the long length ISRs, as an unexpected tRNA(Ala) pseudogene. An order of the intercistronic tRNA genes within the short nucleotide spacer of 5'-16S rDNA-tRNA(Ala)-tRNA(Ile)-23S rDNA-3' occurred in all the C. lari isolates examined.

  19. Sequence Analysis and Comparison of 16S rRNA, 23S rRNA and 16S/23S Intergenic Spacer Region of Greening Bacterium Associated with Yellowing Disease (Huanglongbing) of Kinnow Mandarin.

    Science.gov (United States)

    Gupta, K N; Baranwal, V K; Haq, Q M R

    2012-03-01

    High incidence (up to 40%) of symptoms of yellowing and yellow mottling was observed in 5-8 years old orchards of kinnow mandarin {Citrus reticulate Balanco ('King' × 'Willow mandarin')} in the Punjab state of India during a survey in January 2007. These symptoms are often confused with nutrient deficiency and other stress related disorders. However, a greening bacterium has been attributed to cause the disease. The disease was graft transmissible and sequencing of 16S rRNA, 16S/23S intergenic spacer region and 23S rRNA of the greening bacterium associated with yellowing disease in kinnow mandarin confirmed it to be Candidatus Liberibacter asiaticus ('Ca L. asiaticus') showing maximum identity of 95.9% with 'Ca L. asiaticus' from USA and Brazil in 16S rRNA. The study indicates definite association of 'Ca L. asiaticus' with yellowing/chlorotic mottling symptoms of greening disease of kinnow mandarin in Punjab state of India.

  20. 16S rRNA、16S-23S rRNA基因测序分析检测主要血流感染病原菌比较%Comparison of the role of 16S rRNA and 16S-23S rRNA gene sequence-based identification of bacteria in bloodsteam infection

    Institute of Scientific and Technical Information of China (English)

    金中淦; 葛平; 徐蓉; 陈蓉; 宣瑛; 刘学杰; 王庆忠

    2012-01-01

    目的 比较细菌16S rRNA、16S-23S rRNA基因测序分析在血流感染病原菌检测中的作用.方法 提取临床上血流感染常见的金黄色葡萄菌、表皮葡萄球菌、大肠埃希菌、粪肠球菌、肺炎链球菌、铜绿假单胞菌、阴沟肠杆菌、鲍曼不动杆菌、洛菲不动杆菌、肺炎克雷伯杆菌、化脓性链球菌、奇异变形杆菌、潘尼变形杆菌、屎肠球菌、粘质沙雷菌、宋内志贺菌、产气肠杆菌、小肠结肠炎耶尔森菌、腐生葡萄球菌基因组DNA,运用16S rRNA、16S-23S rRNA基因进行PCR扩增.扩增产物经测序后在美国国家生物技术中心( NCBI)上进行比对分析,确定菌种.结果 在所分析的19种临床血流感染常见细菌中,16S rRNA基因测序分析可将除粘质沙雷菌外的细菌鉴定到种的水平,但无法完全区分近缘种属;16S-23SrRNA成功鉴定17种细菌,除大肠埃希菌、宋内志贺菌外所有细菌均成功鉴定到单一种的水平.结论 16S-23S rRNA基因可作为血流感染细菌检测较好的分子靶标.

  1. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    Science.gov (United States)

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  2. Quick identification of acetic acid bacteria based on nucleotide sequences of the 16S-23S rDNA internal transcribed spacer region and of the PQQ-dependent alcohol dehydrogenase gene.

    Science.gov (United States)

    Trcek, Janja

    2005-10-01

    Acetic acid bacteria (AAB) are well known for oxidizing different ethanol-containing substrates into various types of vinegar. They are also used for production of some biotechnologically important products, such as sorbose and gluconic acids. However, their presence is not always appreciated since certain species also spoil wine, juice, beer and fruits. To be able to follow AAB in all these processes, the species involved must be identified accurately and quickly. Because of inaccuracy and very time-consuming phenotypic analysis of AAB, the application of molecular methods is necessary. Since the pairwise comparison among the 16S rRNA gene sequences of AAB shows very high similarity (up to 99.9%) other DNA-targets should be used. Our previous studies showed that the restriction analysis of 16S-23S rDNA internal transcribed spacer region is a suitable approach for quick affiliation of an acetic acid bacterium to a distinct group of restriction types and also for quick identification of a potentially novel species of acetic acid bacterium (Trcek & Teuber 2002; Trcek 2002). However, with the exception of two conserved genes, encoding tRNAIle and tRNAAla, the sequences of 16S-23S rDNA are highly divergent among AAB species. For this reason we analyzed in this study a gene encoding PQQ-dependent ADH as a possible DNA-target. First we confirmed the expression of subunit I of PQQ-dependent ADH (AdhA) also in Asaia, the only genus of AAB which exhibits little or no ADH-activity. Further we analyzed the partial sequences of adhA among some representative species of the genera Acetobacter, Gluconobacter and Gluconacetobacter. The conserved and variable regions in these sequences made possible the construction of A. acetispecific oligonucleotide the specificity of which was confirmed in PCR-reaction using 45 well-defined strains of AAB as DNA-templates. The primer was also successfully used in direct identification of A. aceti from home made cider vinegar as well as for

  3. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  4. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  5. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria.

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I-V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC.

  6. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  7. Specific Detection of Yersinia enterocolitica by Loop-mediated Isothermal Amplification(LAMP)Targeting 16S-23S rDNA Internal Transcribed Spacer(ITS)%利用环介导恒温扩增方法特异性鉴定食品中小肠结肠炎耶尔森氏菌

    Institute of Scientific and Technical Information of China (English)

    赵玉龙; 张宏伟; 刘伟; 刘寅; 郑文杰; 魏亚东; 叶露萌; 黄熙泰

    2010-01-01

    介绍一种便捷、灵敏而又特异的用于检测治病细菌小肠结肠炎耶尔森氏菌(Yersinia enterocolitica)的 环介导恒温扩增基因检测技术(loop-mediated isothermal amplification,LAMP),该技术分别使用特异对应于16S-23S rDNA间区(16S-23S rDNA internal transcribed spacer,ITS)靶序列中6个基因区段的3对引物,在Bst 聚合酶的作用下对靶序列进行恒温扩增,整个检测反应只需1 h.利用这种技术检测小肠结肠炎耶尔森氏菌基因,阳性结果可通过直接观察反应液中有无焦磷酸镁白色沉淀,而无需经电泳检测.试验结果表明,LAMP对Y.enterocolitica的检测灵敏度可达到8 CFU/反应.

  8. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria.

  9. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  10. Sequence length variation of internal genic space of 16S rDNA-23S rDNA in biohydrogen-bacterium%产氢菌的16S -23S rDNA间隔区的长度变异性分析

    Institute of Scientific and Technical Information of China (English)

    李永峰; 郑国香; 张文启; 李建政; 胡立杰

    2005-01-01

    生物制氢细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区碱基序列被测定.利用PCR扩增间隔区DNA,间隔区碱基序列存在长度多态现象.用这一长度多态现象进行产氢发酵细菌的辨认和识别.产氢发酵细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区的PCR产品从1 270 到398 bp,共有5个序列.碱基数目分别为1 270、398、638、437 和 436 bp.%A method based on PCR amplification of the 16S rRNA gene (rDNA)-23S rDNA intergenic regions was developed for the identification of species for fermentative biohydrogen-producing bacterium. The sizes of the PCR products varied from 1 270 to 398 bp. Strain of Rennanqilyf3 were characterized as having products of 1 270,398,638, 437 and 436bp.

  11. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  12. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Science.gov (United States)

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes.

  13. Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism

    OpenAIRE

    Kabadjova, Petia; Dousset, Xavier; Le Cam, Virginie; Prevost, Hervé

    2002-01-01

    A novel strategy for identification of Carnobacterium food isolates based on restriction fragment length polymorphism (RFLP) of PCR-amplified 16S-23S ribosomal intergenic spacer regions (ISRs) was developed. PCR amplification from all Carnobacterium strains studied always yielded three ISR amplicons, which were designated the small ISR (S-ISR), the medium ISR (M-ISR), and the large ISR (L-ISR). The lengths of these ISRs varied from one species to another. Carnobacterium divergens NCDO 2763T a...

  14. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    Science.gov (United States)

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  15. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  16. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    Science.gov (United States)

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  17. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    Science.gov (United States)

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  18. Detection of two Bartonella tamiae-like sequences in Amblyomma americanum (Acari: Ixodidae) using 16S-23S intergenic spacer region-specific primers.

    Science.gov (United States)

    Billeter, Sarah A; Miller, Melissa K; Breitschwerdt, Edward B; Levy, Michael G

    2008-01-01

    Four hundred and sixty-six questing Amblyomma americanum (L.) (Acari: Ixodidae) from Carolina County, VA, and 98 questing A. americanum from Chatham County, NC, were screened by polymerase chain reaction (PCR) for the Bartonella 16S-23S intergenic spacer region. Two amplicons, approximately 270-280 bp, were detected in two ticks from Virginia. Based upon PCR and sequencing, an adult male and adult female tick harbored DNA sequences closely related to Bartonella tamiae (DQ395180). Bartonella DNA was not detected in A. americanum from North Carolina. Potential transmission of Bartonella spp. by A. americanum should be the focus of future experimental studies.

  19. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    Science.gov (United States)

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  20. Phylogenetic diversity based on rrs, atpD, recA genes and 16S-23S intergenic sequence analyses of rhizobial strains isolated from Vicia faba and Pisum sativum in Peru.

    Science.gov (United States)

    Santillana, Nery; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Velázquez, Encarna; Zúñiga, Doris

    2008-03-01

    In this study 17 isolates from effective nodules of Vicia faba and Pisum sativum var. macrocarpum growing in different soils from Peru were isolated and characterized. The isolates, presenting 11 different RAPD profiles, were distributed in three groups on the basis of their 16S-RFLP patterns. The 16S rRNA gene sequences of strains from 16S-RFLP groups I, II and III were closely related (identities higher than 99.5%) to Rhizobium leguminosarum bv. trifolii DSM 30141 (=ATCC 14480), R. leguminosarum bv. viciae DSM 30132(T) and Rhizobium etli CFN42(T) (=USDA 9032(T)), respectively. The analysis of the 16S-23S intergenic spacer (ITS) and two housekeeping genes, atpD and recA, confirmed the identification of strains from group I, however those from groups II and III were phylogenetically divergent to strains DSM 30132(T) and CFN42(T). These results support the fact that the 16S rRNA gene is not adequate for identification at species level within genus Rhizobium and suggest the existence of putative new species within the phylogenetic group of R. leguminosarum. They also confirm the need of a taxonomic revision of R. leguminosarum since the reference strains of the three biovars included in this study are phylogenetically divergent according to their ITS, atpD and recA gene sequences.

  1. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    DEFF Research Database (Denmark)

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas;

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient...... for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the partial gdh gene to identify clinical relevant NHS to the species level. Sequence analysis of the ITS region....... A phylogenetic algorithm based on the analysis of partial gdh gene sequences revealed three distinct clusters. We suggest that sequence analysis of the combination of the ITS region and the partial gdh gene can be used in the reference laboratory for the species-level identification of NHS....

  2. Cloning, Sequencing and Analysis of the 16S-23S rDNA Intergenic Spacers (IGSs) of Two Strains of Vibrio vulnificus%2株创伤弧菌的16S-23S rDNA间区的克隆、测序及分析

    Institute of Scientific and Technical Information of China (English)

    邓先余; 陈晓艳; 王智学; 欧普; 何建国

    2006-01-01

    根据细菌的16S rDNA 3'端和23S rDNA 5'端的高度保守区设计引物,PCR扩增了2株创伤弧菌(Vibrio vulnificus)的16S-23S rDNA间区(Intergenic spacer,IGS),克隆到pGEM-T载体上,测序.用BLAST和DNAstar软件对16S-23SrDNA间区序列及其内的tRNA基因进行比较分析.结果表明,2株创伤弧菌共测出9条16S-23S rDNA间区序列,其中ZSU006测出5条,间区类型分别为:IGSGLAV、IGSGLV、IGSIA、IGSA和IGSG.其中IGSGLAV最大,包含tRNAGlu、tRNALys、tRNAAla和tRNAVal基因;IGSGLV包含tRNAGlu、tRNALys和tRNAVal基因;IGSIn,则包含tRNAIle和tRNAAla基因;IGSG仅包含tRNAGlu基因;而IGSA仅包含tRNAAla基因.菌株CG021测出的16S-23S rDNAIGS序列有4条,除缺少IGSA外,其余的IGS类型均与ZSU006的相同.与GenBank内的创伤弧菌ATCC27562的IGS序列比较,发现创伤弧菌所有类型的IGS的tRNA基因两端的非编码区具有较高的种内同源性.16S-23S rDNA间区结构的差异为建立一种新的创伤弧菌检测方法奠定了基础.%According to the conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs, PCR primers were designed, and the 16S-23S rDNA intergenic spacers (IGSs) of two strains of Vibrio vulnificus were amplified by PCR and cloned into pGEM-T vector. Different clones were selected to be sequenced and the sequences were analyzed with BLAST and the software DNAstar. Analyses of the IGS sequences suggested that the strain ZSU006 contains five types of polymorphic16S-23S rDNA intergenic spacers, namely, IGSGLAV, IGSGLv, IGSIA, IGSG and IGSA; while the strain CG021 has the same types of IGSs except lacking IGSA. Among these five IGS types, IGSGLAV is the biggest type, including the gene cluster of tRNAGlu - tRNALys - tRNAAla - tRNAVal; IGSGLV includes that of tRNAGlu-tRNALys-tRNAVal; IGSAG, tRNAAla-tRNAGlu; IGSIA, tRNAIle -tRNAAla; IGSG, tRNAGlu and IGSA, tRNAAla. Intraspecies multiple alignment of all the IGS sequences of these two strains with those of V

  3. USE OF 16S-23S INTERGENIC TRANSCRIBED SPACER IN IDENTIFICATION AND COMMUNITY ANALYSIS OF BACTERIA%基因间隔序列(ITS)在细菌分类鉴定和种群分析中的应用

    Institute of Scientific and Technical Information of China (English)

    郑雪松; 杨虹; 李道棠; 韩文卿

    2003-01-01

    Use of 16S -23S intergenic transcribed spacer (ITS) variability, as a relatively new method, is becoming an important supplement to the molecular methods based on 16S rRNA for which has a fairly constant size and is not divergent enough to give good separation in close relationships. This paper summarizes the structures and characteristics of ITS regions that are extremely variable in copy number, length and sequence per genome. The ITS region can be amplified easily taking advantage of conserved nucleotide stretches at the 5′of the 16S and 3′of the 23S gene, and the amplicon can contain different amounts of the 16S rDNA by choosing primers at different conserved areas within this gene. These primers are listed and discussed for perfecting the methodology of ITS. Furthermore, some recent progresses on the taxonomy, identification and community analysis of bacteria by means of ITS in epidemiology, ecology and artificial environment are reviewed, as well, the virtues and limitations of that method are discussed. Fig 2, Tab 1, Ref 51

  4. Restrição do 16S-23S DNAr intergênico para avaliação da diversidade de Azospirillum amazonense isolado de Brachiaria spp. Restriction of 16S-23S intergenic rDNA for diversity evaluation of Azospirillum amazonense isolated from different Brachiaria spp.

    Directory of Open Access Journals (Sweden)

    Fábio Bueno dos Reis Junior

    2006-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a diversidade intra-específica de isolados de Azospirillum amazonense e estabelecer a possível influência de diferentes espécies de Brachiaria ssp. e diferentes condições edafoclimáticas. A caracterização da diversidade desses isolados foi conduzida, utilizando-se a análise de restrição da região intergênica 16S-23S DNAr. As estirpes estudadas separaram-se em dois grupos, definidos a 56% de similaridade. As espécies de Brachiaria ssp. influenciaram a diversidade de estirpes. A maioria dos isolados oriundos de B. decumbens e B. brizantha está inserida no primeiro grupo, enquanto os oriundos de B. humidicola concentram-se no segundo grupo.The aim of this work was to study the intra-specific diversity of Azospirillum amazonense isolates and to establish possible influences of different Brachiaria spp. and edaphoclimatic conditions. The characterization of the diversity among the isolates of A. amazonense studied was conducted using restriction analysis of the 16S-23S rDNA intergenic spacer region. The evaluated strains were separated in two groups, defined at 56% of similarity. Brachiaria spp. showed effects on strain diversity. Most part of the isolates from B. decumbens and B. brizantha are inserted in the first group, while B. humidicola isolates concentrate in the second group.

  5. Phylogenetic diversity of rhizobia associated with horsegram [Macrotyloma uniflorum (Lam.) Verdc.] grown in South India based on glnII, recA and 16S-23S intergenic sequence analyses.

    Science.gov (United States)

    Appunu, Chinnaswamy; Ganesan, Govindan; Kalita, Michał; Kaushik, Raghavan; Saranya, Balamurugan; Prabavathy, Vaiyapuri Ramalingam; Sudha, Nair

    2011-04-01

    Horsegram [Macrotyloma uniflorum (Lam.) Verdc.) is an important grain legume and fodder crop in India. Information on root nodule endosymbionts of this legume in India is limited. In the present study, 69 isolates from naturally occurring root nodules of horsegram collected from two agro-eco-climatic regions of South India was analyzed by generation rate, acid/alkali reaction on YMA medium, restriction fragment length polymorphism analysis of 16S-23S rDNA intergenic spacer region (IGS), and sequence analyses of IGS and housekeeping genes glnII and recA. Based on the rDNA IGS RFLP by means of three restriction enzymes rhizobia were grouped in five clusters (I-V). By sequence analysis of 16S-23S rDNA IGS identified genotypes of horsegram rhizobia were distributed into five divergent lineages of Bradyrhizobium genus which comprised (I) the IGS type IV rhizobia and valid species B. yuanmingense, (II) the strains of IGS type I and Bradyrhizobium sp. ORS 3257 isolated from Vigna sp., (III) the strains of the IGS type II and Bradyrhizobium sp. CIRADAc12 from Acacia sp., (IV) the IGS type V strains and Bradyrhizobium sp. genospecies IV, and (V) comprising genetically distinct IGS type III strains which probably represent an uncharacterized new genomic species. Nearly, 87% of indigenous horsegram isolates (IGS types I, II, III, and V) could not be related to any other species within the genus Bradyrhizobium. Phylogeny based on housekeeping glnII and recA genes confirmed those results found by the analysis of the IGS sequence. All the isolated rhizobia nodulated Macrotyloma sp. and Vigna spp., and only some of them formed nodules on Arachis hypogeae. The isolates within each IGS type varied in their ability to fix nitrogen. Selection for high symbiotic effective strains could reward horsegram production in poor soils of South India where this legume is largely cultivated.

  6. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences

    National Research Council Canada - National Science Library

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-01-01

    ...) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough...

  7. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    Science.gov (United States)

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  8. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  9. Use of PCR primers and probes based on the 23S rRNA and internal transcription spacer (ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements.

    Science.gov (United States)

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2010-06-01

    Novel polymerase chain reaction (PCR) primers designed from the 16S-23S internal transcription spacer (ITS) rRNA and 23S rRNA genes, respectively, were used for the specific detection of Lactobacillus acidophilus and Lactobacillus plantarum. Molecular weights of the PCR products were 221 and 599 bp, respectively. Strains of L. acidophilus and L. plantarum obtained from the culture center, dairy products, infant stool and other samples, could be identified with these PCR primers. DNAs from other lactic acid bacteria (LAB) species including strains of Lactobacillus pentosus which was closely related to L. plantarum, and bacteria species other than LAB, would not generate the false positive results. When this PCR primer set was used for the detection of L. acidophilus and L. plantarum in feed supplement or feed starter samples, reliable results were obtained. Furthermore, when these L. acidophilus or L. plantarum specific primers were used as DNA probes for the colony hybridization of L. acidophilus and L. plantarum, the viable cells of these LAB species in culture and feed supplements or starter products could be identified and enumerized. The method described here thus offers a rapid and economic way to inspect and assure the quality of the feed supplements or fermentation starters.

  10. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  11. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    Science.gov (United States)

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  12. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.

    Science.gov (United States)

    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas

    2015-09-01

    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (http://www.ncbi.nlm.nih.gov/sra/SRX889598).

  13. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  14. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    DEFF Research Database (Denmark)

    Lee, C H; Helweg-Larsen, J; Tang, X

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...

  15. Genotype analysis of the variable internal repeat region in the rRNA gene of Trichophyton tonsurans isolated from Japanese Judo practitioners.

    Science.gov (United States)

    Sugita, Takashi; Shiraki, Yumi; Hiruma, Masataro

    2006-01-01

    Tinea capitis due to Trichophyton tonsurans is currently epidemic among Japanese Judo practitioners. T. tonsurans has seven genotypes in a variable internal repeat (VIR) region of the rRNA gene. All 101 isolates obtained from Japanese Judo practitioners had the identical genotype. This suggests that a specific genotype strain occurs throughout Japan.

  16. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    Science.gov (United States)

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  17. Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting Tomato using 18S rRNA as an internal control.

    Science.gov (United States)

    Chen, Shaoning; Gu, Hao; Wang, Xiaoming; Chen, Jishuang; Zhu, Weimin

    2011-06-01

    A multiplex reverse-transcription polymerase chain reaction (RT-PCR) protocol was developed for simultaneous detection and discrimination of subgroups of Cucumber mosaic virus (CMV), including its satellite RNA, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV), using 18S rRNA as an internal control. Species- and subgroups-specific primers designed to differentiate CMV subgroups I and II, ToMV and TMV, were assessed using the cDNA clones of viral genomes, CMV satellite RNA and 18S rRNA gene from tomato (Solanum lycopersicum L.) or tobacco (Nicotiana tobacum). Using total RNA extracted from artificial mixture of tomato leaf tissues infected by each virus, the reaction components and cycling parameters were optimized and a multiplex RT-PCR procedure was established. Six fragments of 704, 593, 512, 421, 385, 255 bp, specific to CMV subgroup II, CMV subgroup I, ToMV, TMV, satellite RNA and 18S rRNA, respectively, were simultaneously amplified. The sensitivity of the multiplex RT-PCR method for detecting CMV was 100 times higher than that of double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA). This method was successfully used for field detection. Among 141 samples collected from East China through tomato growth seasons, 106 single infections with one of the above isolates were detected and 13 mixed infections were found. The results showed the potential use of this method for investigating the epidemiology of viral diseases infecting tomato.

  18. Clinical correlation of variations in the internal transcribed spacer regions of rRNA genes in Pneumocystis carinii f.sp. hominis

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Lee, C H; Jin, S

    2001-01-01

    OBJECTIVES: To analyse the importance of sequence variations in the internal transcribed spacer (ITS) regions 1 and 2 of the nuclear rRNA operon in AIDS patients with Pneumocystis carinii pneumonia (PCP). DESIGN AND METHODS: ITS 1 and 2 genotypes were determined in 162 bronchoalveolar lavage...... samples from 130 patients participating in a prospective cohort study of PCP. RESULTS: A total of 49 different ITS genotypes were detected. ITS genotype was not associated with the clinical severity or outcome of PCP. In 37 of 162 (23%) samples infection with two or more genotypes was observed. A genotype...... switch was detected in six of 10 patients (60%) with recurrent episodes of PCP. However, genotype changes were also seen in 10 of 19 patients (53%) who had repeated bronchoscopies within the same episode of PCP. The same ITS type was observed twice in 13 (46%) of the 28 patients with repeat...

  19. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Science.gov (United States)

    Siarkou, Victoria I; Stamatakis, Alexandros; Kappas, Ilias; Hadweh, Paul; Laroucau, Karine

    2011-01-01

    The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS), and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs), two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T) possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic) characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering) signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies) of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic inference reveal new

  20. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Directory of Open Access Journals (Sweden)

    Victoria I Siarkou

    Full Text Available The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS, and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs, two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic

  1. Comparative sequence analysis of 5.8S rRNA genes and internal transcribed spacer (ITS) regions of trichomonadid protozoa.

    Science.gov (United States)

    Felleisen, R S

    1997-08-01

    The taxonomic situation in the genus Tritrichomonas is the subject of controversial discussion: potentially T. foetus and T. suis, the tritrichomonads from cattle and swine, respectively, could belong to the same species. In order to shed some light on this question, a molecular biological analysis was performed. The 5.8S rRNA gene and the flanking internal transcribed spacer regions (ITS1 and ITS2) of 12 different isolates of 3 Tritrichomonas species T. foetus, T. suis and T. mobilensis were enzymatically amplified by PCR and subcloned. Also, the corresponding regions of the trichomonads Trichomonas vaginalis, T. tenax, T. gallinae and Pentatrichomonas hominis were included in this study. Sequence analysis of cloned fragments was used to compare the parasite isolates. The genus Tritrichomonas exhibited an extremely high degree of homogeneity. All T. foetus and T. suis isolates had identical sequences, and only 1 substitution was found in the ITS2 region of T. mobilensis. In contrast, the genus Trichomonas shared more diversity. The results obtained in this study support a possible future revision of the taxonomic classification of tritrichomonads.

  2. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, J. Gregory; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob; Bik, Holly

    2015-12-22

    ABSTRACT

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

    ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to

  3. Identifikacija ocetnokislinskih bakterij iz industrijske proizvodnje jabolčnega kisa na osnovi medgenske regije 16S-23S rDNA

    OpenAIRE

    2016-01-01

    Zavedanje ljudi o pomembnosti uživanja zdrave hrane postaja vedno močnejše, zato se v zadnjih letih povečuje trend uživanja živil, pridobljenih iz surovin, ki so čim manj izpostavljene kemikalijam, npr. s škropljenjem. Tudi kis, kot eden izmed pogosto uporabljenih dodatkov k hrani, se lahko pridobiva iz jabolk, ki so pridelana na konvencionalen način, s škropljenjem, ali pa brez škropljenja, s čimer pridobimo bio-jabolčni kis. V okviru te magistrske naloge smo primerjali mikrobioto iz industr...

  4. Serotyping, ribotyping, PCR-mediated ribosomal 16S-23S spacer analysis and arbitrarily primed PCR for epidemiological studies on Legionella pneumophila

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); H. Maas (Hugo); H.A. Verbrugh (Henri); N. van Leeuwen (N.)

    1996-01-01

    textabstractFifty clinical and environmental isolates of Legionella pneumophila were typed serologically and by DNA fingerprinting using arbitrarily primed polymerase chain reaction (AP-PCR). Furthermore, variability in and around ribosomal operons was assessed by conventional ribotyping and

  5. Serotyping, ribotyping, PCR-mediated ribosomal 16S-23S spacer analysis and arbitrarily primed PCR for epidemiological studies on Legionella pneumophila

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); H. Maas (Hugo); H.A. Verbrugh (Henri); N. van Leeuwen (N.)

    1996-01-01

    textabstractFifty clinical and environmental isolates of Legionella pneumophila were typed serologically and by DNA fingerprinting using arbitrarily primed polymerase chain reaction (AP-PCR). Furthermore, variability in and around ribosomal operons was assessed by conventional ribotyping and PCR-med

  6. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis.

    Science.gov (United States)

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej

    2014-04-01

    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing.

  7. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    Science.gov (United States)

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  8. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An

    2002-07-01

    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  9. Secondary structure analyses of the nuclear rRNA internal transcribed spacers and assessment of its phylogenetic utility across the Brassicaceae (mustards.

    Directory of Open Access Journals (Sweden)

    Patrick P Edger

    Full Text Available The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1. Ease of amplification due to high copy number of the gene clusters, 2. Available cost-effective methods and highly conserved primers, 3. Rapidly evolving markers (i.e. variable between closely related species, and 4. The assumption (and/or treatment that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships.

  10. Single-Cell DNA barcoding using sequences from the small subunit rRNA and internal transcribed spacer region identifies new species of Trichonympha and Trichomitopsis from the hindgut of the termite Zootermopsis angusticollis.

    Directory of Open Access Journals (Sweden)

    Vera Tai

    Full Text Available To aid in their digestion of wood, lower termites are known to harbour a diverse community of prokaryotes as well as parabasalid and oxymonad protist symbionts. One of the best-studied lower termite gut communities is that of Zootermopsis angusticollis which has been known for almost 100 years to possess 3 species of Trichonympha (T. campanula, T. collaris, and T. sphaerica, 1 species of Trichomitopsis (T. termopsidis, as well as smaller flagellates. We have re-assessed this community by sequencing the small subunit (SSU rRNA gene and the internal transcribed spacer (ITS region from a large number of single Trichonympha and Trichomitopsis cells for which morphology was also documented. Based on phylogenetic clustering and sequence divergence, we identify 3 new species: Trichonympha postcylindrica, Trichomitopsis minor, and Trichomitopsis parvus spp. nov. Once identified by sequencing, the morphology of the isolated cells for all 3 new species was re-examined and found to be distinct from the previously described species: Trichonympha postcylindrica can be morphologically distinguished from the other Trichonympha species by an extension on its posterior end, whereas Trichomitopsis minor and T. parvus are smaller than T. termopsidis but similar in size to each other and cannot be distinguished based on morphology using light microscopy. Given that Z. angusticollis has one of the best characterized hindgut communities, the near doubling of the number of the largest and most easily identifiable symbiont species suggests that the diversity of hindgut symbionts is substantially underestimated in other termites as well. Accurate descriptions of the diversity of these microbial communities are essential for understanding hindgut ecology and disentangling the interactions among the symbionts, and molecular barcoding should be a priority for these systems.

  11. Phylogenetic analysis based on 28S rRNA of Babesia spp. in ruminants in China.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-04-01

    Molecular phylogenetic analyses are mainly based on the small ribosomal RNA subunit (18S rRNA), internal transcribed spacer regions, and other molecular markers. We compared the phylogenetic relationships of Babesia spp. using large subunit ribosomal RNA, i.e., 28S rRNA, and the united 28S + 18S rRNA sequence fragments from 11 isolates of Babesia spp. collected in China. Due to sequence length and variability, the 28S rRNA gene contained more information than the 18S rRNA gene and could be used to elucidate the phlyogenetic relationships of B. motasi, B. major, and B. bovis. Thus, 28S rRNA is another candidate marker that can be used for the phylogenetic analysis of Babesia spp. However, the united fragment (28S + 18S) analysis provided better supported phylogenetic relationships than single genes for Babesia spp. in China.

  12. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Olivares-Fuster, Oscar; Shoemaker, Craig A; Klesius, Phillip H; Arias, Covadonga R

    2007-04-01

    Flavobacterium columnare intraspecies diversity was revealed by analyzing the 16S rRNA gene and the 16S-23S internal spacer region (ISR). Standard restriction fragment length polymorphism (RFLP) of these sequences was compared with single-strand conformation polymorphism (SSCP). Diversity indexes showed that both 16S-SSCP and ISR-SSCP improved resolution (D>or=0.9) when compared with standard RFLP. ISR-SSCP offered a simpler banding pattern than 16S-SSCP while providing high discrimination between isolates. SSCP analysis of rRNA genes proved to be a simple, rapid, and cost-effective method for routine fingerprinting of F. columnare.

  13. Chicken rRNA Gene Cluster Structure.

    Directory of Open Access Journals (Sweden)

    Alexander G Dyomin

    Full Text Available Ribosomal RNA (rRNA genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5'ETS (1836 bp, 18S rRNA gene (1823 bp, ITS1 (2530 bp, 5.8S rRNA gene (157 bp, ITS2 (733 bp, 28S rRNA gene (4441 bp and 3'ETS (343 bp. The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region. The results have confirmed the chicken rRNA gene cluster validity.

  14. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  15. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  16. rRNA Pseudogenes in Filamentous Ascomycetes as Revealed by Genome Data

    Directory of Open Access Journals (Sweden)

    Yi Li

    2017-08-01

    Full Text Available The nuclear ribosomal DNA (rDNA is considered as a paradigm of concerted evolution. Components of the rDNA tandem repeats (45S are widely used in phylogenetic studies of different organisms and the internal transcribed spacer (ITS region was recently selected as a fungal DNA bar code. However, rRNA pseudogenes, as one kind of escape from concerted evolution, were reported in a wide range of organisms, especially in plants and animals. Moreover, large numbers of 5S rRNA pseudogenes were identified in several filamentous ascomycetes. To study whether rDNA evolves in a strict concerted manner and test whether rRNA pseudogenes exist in more species of ascomycetes, intragenomic rDNA polymorphisms were analyzed using whole genome sequences. Divergent rDNA paralogs were found to coexist within a single genome in seven filamentous ascomycetes examined. A great number of paralogs were identified as pseudogenes according to the mutation and secondary structure analyses. Phylogenetic analyses of the three rRNA coding regions of the 45S rDNA repeats, i.e., 18S, 5.8S, and 28S, revealed an interspecies clustering pattern of those different rDNA paralogs. The identified rRNA pseudogenic sequences were validated using specific primers designed. Mutation analyses revealed that the repeat-induced point (RIP mutation was probably responsible for the formation of those rRNA pseudogenes.

  17. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  18. Eukaryotic 5S rRNA biogenesis.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2011-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. Copyright © 2011 John Wiley & Sons, Ltd.

  19. Potential use of molecular-typing methods for the identification and characterization of salmonella enterica serotypes isolated in the poultry production chain

    Directory of Open Access Journals (Sweden)

    CM Baratto

    2012-09-01

    Full Text Available Salmonella is widespread in nature and can be found in all links of the poultry production chain. Due to its high impact on meat processing, techniques for the rapid detection and reproducible characterization of Salmonella serotypes in foods are needed. The present study investigated the potential of molecular profiling to identify and differentiate 15 Salmonella serotypes isolated from the poultry production chain, based on 5 primers by random amplified polymorphic DNA (RAPD, enterobacterial repetitive intergenic consensus (ERIC-PCR, amplification of rDNA internal spacer analysis (RISA, and amplified ribosomal DNA restriction analysis (ARDRA of 16S-23S rRNA internal spacer region (ISR cleaved with Alu I and Hha I restriction enzymes. Three isolates of each serotype were analyzed for the identification of similar and different profiles. Dendrograms were constructed from molecular profiles using the UPGMA method (unweighted pair-group method for the arithmetic averages and the software program WinBoot. The present study indicates the usefulness of RISA and ARDRA of the 16S-23S rRNA intergenic spacer region (ISR for systematic, epidemiological, and diagnostic purposes. Since these techniques can be used for the differentiation of serotypes, they are highly promising for the characterization of Salmonella serotypes and intra-serotypes. Data indicate that these techniques may be used to produce more consistent, reliable, and reproducible results in the identification and epidemiological study (traceability of Salmonella in the poultry industry.

  20. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  1. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  2. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    Science.gov (United States)

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  3. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    Science.gov (United States)

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  4. First insight into the genome of an uncultivated crenarchaeote from soil

    DEFF Research Database (Denmark)

    Quaiser, Achim; Ochsenreiter, Torsten; Klenk, Hans-Peter;

    2002-01-01

    have constructed complex large-insert genomic libraries. Using archaea-specific 16S rRNA probes we have isolated a 34 kbp fragment from a 900 Mbp fosmid library of soil DNA. The clone contained a complete 16S/23S rRNA operon and 17 genes encoding putative proteins. Phylogenetic analyses of the r...

  5. Growth increase of Arabidopsis by forced expression of rice 45S rRNA gene.

    Science.gov (United States)

    Makabe, So; Motohashi, Reiko; Nakamura, Ikuo

    2017-02-01

    Forced expression of rice 45S rRNA gene conferred ca. 2-fold increase of above-ground growth in transgenic Arabidopsis . This growth increase was probably brought by cell proliferation, not by cell enlargement. Recent increase in carbon dioxide emissions is causing global climate change. The use of plant biomass as alternative energy source is one way to reduce these emissions. Therefore, reinforcement of plant biomass production is an urgent key issue to overcome both depletion of fossil energies and emission of carbon dioxide. Here, we created transgenic Arabidopsis with a 2-fold increase in above-ground growth by forced expression of the rice 45S rRNA gene using the maize ubiquitin promoter. Although the size of guard cells and ploidy of leaf-cells were similar between transgenic and control plants, numbers of stomata and pavement cells were much increased in the transgenic leaf. This data suggested that cell number, not cell expansion, was responsible for the growth increase, which might be brought by the forced expression of exogenous and full-length 45S rRNA gene. The expression level of rice 45S rRNA transcripts was very low, possibly triggering unknown machinery to enhance cell proliferation. Although microarray analysis showed enhanced expression of ethylene-responsive transcription factors, these factors might respond to ethylene induced by abiotic/biotic stresses or genomic incompatibility, which might be involved in the expression of species-specific internal transcribed spacer (ITS) sequences within rice 45S rRNA transcripts. Further analysis of the mechanism underlying the growth increase will contribute to understanding the regulation of the cell proliferation and the mechanism of hybrid vigor.

  6. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    Science.gov (United States)

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  7. Morphological characteristics and phylogenetic analyses of unusual morphospecies of Microcystis novacekii forming bloom in the Cheffia Dam (Algeria

    Directory of Open Access Journals (Sweden)

    Noureddine BOUAÏCHA

    2009-08-01

    Full Text Available The toxicological potential and morphological characteristics and phylogenetic analysis based on the 16S rDNA sequence and the 16S-23S rDNA internal transcribed spacer (ITS were investigated in unusual morphospecies of Microcystis (MCYS-CH01 isolated from the Cheffia Dam in Algeria. The presence of microcystin synthetase genes (mcyA, -B, and -C in isolated colonies of this morphospecies, and the fact that serine/threonine phosphatase (PP2A was inhibited by its crude extract indicated that this morphospecies was microcystin-producer. The morphological features of this unusual morphospecies were very different from any of those described in the literature of all known species of Microcystis. The phylogenic tree based on 16S rDNA sequences shows that this morphospecies is indistinguishable from the reference strain Microcystis aeruginosa PCC 7806 and from many other known Microcystis species and, therefore, this tree did not necessarily correlate to the distinctions between morphospecies. However, phylogenetic analysis based on the 16S-23S rRNA spacer region could be an effective way to assign this unusual morphospecies MCYS-CH01 to the Asian species Microcystis novacekii. Comparison of the ITS sequence of this morphospecies with sequences available in the GenBank database showed that some highly conserved genotypes are found throughout the world.

  8. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species wer...

  9. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    Science.gov (United States)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  10. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei.

  11. Analysis of the secondary structure of mitochondrial LSU rRNA of Peruvian land snails (Orthalicidae: Gastropoda

    Directory of Open Access Journals (Sweden)

    Jorge Ramirez Ramirez

    2011-05-01

    Full Text Available The alignment of ribosomal genes is difficult due to insertion and deletion events of nucleotides, making the alignment ambiguous. This can be overcome by using information from the secondary structure of ribosomal genes. The aim of this study was to evaluate the utility of the secondary structure in improving the alignment of the 16S rRNA gene in land snails of the family Orthalicidae. We assessed 10 Orthalicid species (five genera. Total DNA was isolated and the partial 16S rRNA gene was amplified and sequenced using internal primers. The sequences were aligned with ClustalX and manually corrected, in DCSE format, using the 16S rRNA secondary structure of Albinaria caerulea (Pulmonata: Clausiliidae. The sequences obtained ranged from 323 to 345 bp corresponding to parts of both domains IV and V of the 16S rRNA gene. The secondary structure was recovered by homology using RnaViz 2.0. Most stems are conserved, and in general the loops are more variable. The compensatory mutations in stems are related to maintenance of the structure. The absence of a bulge-stem-loop in domain V places the family Orthalicidae within the Heterobranchia.

  12. A case of feline leprosy caused by Mycobacterium lepraemurium originating from the island of Kythira (Greece): diagnosis and treatment.

    Science.gov (United States)

    Courtin, Francois; Huerre, Michel; Fyfe, Janet; Dumas, Paul; Boschiroli, Maria L

    2007-06-01

    A 2-year-old, 4 kg, healthy, domestic shorthair female cat presented with ulcerated subcutaneous nodules on the commissures of its mouth. The cat was negative for feline leukaemia virus and feline immunodeficiency virus. Skin mycobacteriosis was diagnosed after detection of numerous acid-fast bacilli in Ziehl Neelsen-stained smears from the ulcers. Feline leprosy was suspected following preliminary polymerase chain reaction results: positive for Mycobacterium genus but negative for Mycobacterium tuberculosis and Mycobacterium avium complexes. Mycobacterium lepraemurium was later identified following DNA sequence analysis of the 5' end of the 16S rRNA gene and the 16S-23S internal transcribed spacer region. Microscopic lesions consisted of pyogranulomas containing mainly large foamy macrophages with 10-100 intra-cellular acid-fast bacilli per field. The cat was cured after surgery and a 14-week course of clofazimine (30 mg daily) and clarithromycin (50 mg twice daily).

  13. Molecular identification of Mucorales in human tissues: contribution of PCR electrospray-ionization mass spectrometry.

    Science.gov (United States)

    Alanio, A; Garcia-Hermoso, D; Mercier-Delarue, S; Lanternier, F; Gits-Muselli, M; Menotti, J; Denis, B; Bergeron, A; Legrand, M; Lortholary, O; Bretagne, S

    2015-06-01

    Molecular methods are crucial for mucormycosis diagnosis because cultures are frequently negative, even if microscopy suggests the presence of hyphae in tissues. We assessed PCR/electrospray-ionization mass spectrometry (PCR/ESI-MS) for Mucorales identification in 19 unfixed tissue samples from 13 patients with proven or probable mucormycosis and compared the results with culture, quantitative real-time PCR, 16S-23S rRNA gene internal transcribed spacer region (ITS PCR) and 18S PCR sequencing. Concordance with culture identification to both genus and species levels was higher for PCR/ESI-MS than for the other techniques. Thus, PCR/ESI-MS is suitable for Mucorales identification, within 6 hours, for tissue samples for which microscopy results suggest the presence of hyphae.

  14. A polyphasic taxonomic approach in isolated strains of Cyanobacteria from thermal springs of Greece.

    Science.gov (United States)

    Bravakos, Panos; Kotoulas, Georgios; Skaraki, Katerina; Pantazidou, Adriani; Economou-Amilli, Athena

    2016-05-01

    Strains of Cyanobacteria isolated from mats of 9 thermal springs of Greece have been studied for their taxonomic evaluation. A polyphasic taxonomic approach was employed which included: morphological observations by light microscopy and scanning electron microscopy, maximum parsimony, maximum likelihood and Bayesian analysis of 16S rDNA sequences, secondary structural comparisons of 16S-23S rRNA Internal Transcribed Spacer sequences, and finally environmental data. The 17 cyanobacterial isolates formed a diverse group that contained filamentous, coccoid and heterocytous strains. These included representatives of the polyphyletic genera of Synechococcus and Phormidium, and the orders Oscillatoriales, Spirulinales, Chroococcales and Nostocales. After analysis, at least 6 new taxa at the genus level provide new evidence in the taxonomy of Cyanobacteria and highlight the abundant diversity of thermal spring environments with many potential endemic species or ecotypes.

  15. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  16. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Yih-Horng Shiao

    Full Text Available BACKGROUND: Ribosomal RNA (rRNA is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1 and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014. During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014. Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. CONCLUSIONS/SIGNIFICANCE: The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  17. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  18. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... to the presence of filamentous microorganisms was monitored weekly over 4 months. Microthrix was identified as a causative filament and suitable control measures were introduced. The level of Microthrix was reduced after 1-2 months but a number of other filamentous species were still present, with most of them...

  19. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  20. Higher-order structure of rRNA

    Science.gov (United States)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  1. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  2. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  3. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  4. Sequence variation of the 16S to 23S rRNA spacer region in Salmonella enterica.

    Science.gov (United States)

    Christensen, H; Møller, P L; Vogensen, F K; Olsen, J E

    2000-01-01

    The possibility for identification of Salmonella enterica serotypes by sequence analysis of the 16S to 23S rRNA internal transcribed spacer was investigated by direct sequencing of polymerase chain reaction-amplified DNA from all operons simultaneously in a collection of 25 strains of 18 different serotypes of S. enterica, and by sequencing individual cloned operons from a single strain. It was only possible to determine the first 117 bases upstream from the 23S rRNA gene by direct sequencing because of variation between the rrn operons. Comparison of sequences from this region allowed separation of only 15 out of the 18 serotypes investigated and was not specific even at the subspecies level of S. enterica. To determine the differences between internal transcribed spacers in more detail, the individual rrn operons of strain JEO 197, serotype IV 43:z4,z23:-, were cloned and sequenced. The strain contained four short internal transcribed spacer fragments of 382-384 bases in length, which were 98.4-99.7% similar to each other and three long fragments of 505 bases with 98.0-99.8% similarity. The study demonstrated a higher degree of interbacterial variation than intrabacterial variation between operons for serotypes of S. enterica.

  5. Genome sequencing and annotation of Morganella sp. SA36

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Morganella sp. Strain SA36, isolated from water spring in Aljouf region, Saudi Arabia. The draft genome size is 2,564,439 bp with a G + C content of 51.1% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDNQ00000000.

  6. Genome sequencing and annotation of Stenotrophomonas sp. SAM8

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Stenotrophomonas sp. strain SAM8, isolated from environmental water. The draft genome size is 3,665,538 bp with a G + C content of 67.2% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDAV00000000.

  7. Genome sequencing and annotation of Proteus sp. SAS71

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Proteus sp. strain SAS71, isolated from water spring in Aljouf region, Saudi Arabia. The draft genome size is 3,037,704 bp with a G + C content of 39.3% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDIU00000000.

  8. Rapid Identification of Pathogenic Bacteria by means of Two Conservative Gene Loci' Specific PCR-CE-RFLP

    Institute of Scientific and Technical Information of China (English)

    高鹏; 张卓然; 徐维家; 安万新; 张晓慧; 戴兵; 范艳萍; 王运锋; 李萍; 温杰; 于卫健; 高向仪; 谢凡迪; 王永海

    2003-01-01

    To establish a rapid identification method for common pathogenic bacteria on the basis of molecular biology and to construct a preliminary Polymerase Chain Reaction-Capillary Electrophoresis-Restriction Fragment Length Polymorphism (PCR-CE-RFLP) database of bacteria isolated from clinical specimens frequently, 183 strains collected from clinical samples belonging to 12 genera and 19 species whose biochemical characterizations corresponded to the typical ones were examined.The genomic DNAs were amplified by two pairs of fluorescence labeled primers aiming at 16S rRNA gene and 16S-23S rRNA spacer region gene respectively at the same time. PCR products were then digested by restriction endonuclease Hae Ⅲ in-completely before taking capillary electrophoresis. The results with the PCR-CE-RFLP patterns of 16S rRNA genes were just alike within some genera, but when it comes to 16S-23S rRNA spacer region genes, each bacterium showed a unique pattern, which can be distinguished from each other easily. It seems that PCR-CE-RFLP patterns of 16S rRNA gene could only be used to classify the bacteria into family level, whereas the data of 16S-23S rRNA spacer region gene could be utilized to identify the whole microorganisms as precisely as the species level. In spite of the data of the spacer region gene alone can be sufficiently to verify the whole bacteria, we insist that the 16S rRNA gene could be of some assistant in case that there should be lots of families of bacteria, in which some similar ones, with the same RFLP data of 16S-23S rRNA spacer region gene, may coexist. This study proves that the utility of PCR-CE-RFLP is a convenient, rapid method to identify pathogenic bacteria, and is also a quick diagnosis measure for application to clinical use.

  9. Development and evaluation of a novel multiplex probe array for rapid differential identification of Mycobacterium in clinical specimens

    Institute of Scientific and Technical Information of China (English)

    SHU LIN ZHANG; QUN SUN; DA XU LI; GUO LONG ZHANG; ZHAN QIANG SUN; CHANG MEI DU; GUO BIN WANG; ZHI RONG YANG

    2006-01-01

    Rapid differential identification of Mycobacterium species is essential for effective diagnosis and management of mycobacteriosis. The aim of this study was to develop a novel multiplex probe array based on the 16S-23S rRNA gene internal transcribed spacer sequence for the genotyping of mycobacteria to the species level. A pair of primers and a set of genus- and species-specific probes were designed from the conserved and polymorphic regions of the 16S rRNA gene, internal transcribed spacer, and 23S rRNA gene sequences of mycobacteria. We used a novel multiplex probe array for identification of 266 clinical specimens obtained from patients with mycobaterial infection. The results showed that the overall specificity and sensitivity of our novel probe array were both 100% for the genus-specific probe and Mycobacterium tuberculosis complex-specific probe. There were 79.3% (23/29) of nontuberculous mycobacteria which could be identified to the species level directly in the specimens from China. Some intraspecies heterogeneity in M. avium, M. intracellulare, M. chelonae and M. abscessus was observed. With the increase of sequences of internal transcribed spacer and numbers of whole microbial genomes, and further optimization of probes, the multiplex probe array will become a promising tool for the rapid and accurate identification of mycobacteria in ordinary clinical laboratories.

  10. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  11. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  12. Seasonal variation of Microcystis in Lake Taihu and its relationships with environmental factors

    Institute of Scientific and Technical Information of China (English)

    TAN Xiao; KONG Fanxiang; ZENG Qingfei; CAO Huansheng; QIAN Shanqin; ZHANG Min

    2009-01-01

    In order to monitor the changes of Microcystis along with temporal and spatial variations, seasonal variation of Microcystis in Lake Taihu was investigated by 16S-23S rRNA internal transcribed spacer denaturing gradient gel electrophoresis (16S-23S rRNA-ITS DGGE) and microscopic evaluation. Samples were collected quarterly at four sites (River Mouth, Meiliang Bay, Cross Area, and Lake Center) from August 2006 to April 2007. Results showed that Microcystis dominated total phytoplankton abundance at the four sites in all seasons except winter. The average annual abundance of Microcystis was relatively high at River Mouth and Meiliang Bay, reaching 81.22×106 and 61.32×106 cells/L, respectively. For temporal variations, Shannon-Wiener diversity index (H') according to DGGE profile revealed the richness of Microcystis in summer (H'=1.375±0.034) and winter (H'=1.650±0.032) was lower than that in spring (H'=2.078±0.031) and autumn (H'=2.365±0.032) (P0.05). Canonical correspondence analysis (CCA) was performed to elucidate the relationships between Microcystis operational taxonomic units (OTUs) composition and the environmental factors. Results of CCA revealed that temperature was strongly positively correlated with the first axis (r=0.963), while TSS was negative correlated with the second axis (r=-0.716). Phylogenetic tree based on the sequencing results of target bands on DGGE gel indicated that samples collected in summer and winter constituted two separated clusters.

  13. Characteristic archaebacterial 16S rRNA oligonucleotides

    Science.gov (United States)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  14. Defects in 18 S or 28 S rRNA processing activate the p53 pathway.

    Science.gov (United States)

    Hölzel, Michael; Orban, Mathias; Hochstatter, Julia; Rohrmoser, Michaela; Harasim, Thomas; Malamoussi, Anastassia; Kremmer, Elisabeth; Längst, Gernot; Eick, Dirk

    2010-02-26

    The p53 tumor suppressor pathway is activated by defective ribosome synthesis. Ribosomal proteins are released from the nucleolus and block human double minute-2 (Hdm2) that targets p53 for degradation. However, it remained elusive how abrogation of individual rRNA processing pathways contributes to p53 stabilization. Here, we show that selective inhibition of 18 S rRNA processing provokes accumulation of p53 as efficiently as abrogated 28 S rRNA maturation. We describe hUTP18 as a novel mammalian rRNA processing factor that is specifically involved in 18 S rRNA production. hUTP18 was essential for the cleavage of the 5'-external transcribed spacer leader sequence from the primary polymerase I transcript, but was dispensable for rRNA transcription. Because maturation of the 28 S rRNA was unaffected in hUTP18-depleted cells, our results suggest that the integrity of both the 18 S and 28 S rRNA synthesis pathways can be monitored independently by the p53 pathway. Interestingly, accumulation of p53 after hUTP18 knock down required the ribosomal protein L11. Therefore, cells survey the maturation of the small and large ribosomal subunits by separate molecular routes, which may merge in an L11-dependent signaling pathway for p53 stabilization.

  15. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  16. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kiparisov, Sergey; Petrov, Alexey; Meskauskas, Arturas; Sergiev, Petr V; Dontsova, Olga A; Dinman, Jonathan D

    2005-10-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semi-dominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression.

  17. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  18. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David

    2012-11-20

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  19. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    Directory of Open Access Journals (Sweden)

    David Kamanda Ngugi

    Full Text Available Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C and salinity (~41 psu from the mixed layer (~200 m to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS region of SAR11 in different depths of the Red Sea's water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen on the population dynamics of this ubiquitous marine bacterium.

  20. Resurrection of an ancestral 5S rRNA

    Directory of Open Access Journals (Sweden)

    Fox George E

    2011-07-01

    to resurrect additional meaningful 5S rRNA ancestors as well as ancestral sequences of many different types of RNA.

  1. Resurrection of an ancestral 5S rRNA.

    Science.gov (United States)

    Lu, Qing; Fox, George E

    2011-07-22

    In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible to resurrect additional meaningful 5S rRNA ancestors as well

  2. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  3. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  4. 18S rRNA degradation is not accompanied by altered rRNA transport at early times following irradiation of HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, P.; Krolak, J.M.; McClain, D.; Minton, K.W.

    1990-01-01

    In recent investigations on the effects of radiation on rRNA processing in HeLa S3 cells, the authors pulse-labeled the cells with uridine immediately prior to irradiation. The 45 S rRNA precursor, which undergoes nuclear processing to form one each of its major daughter species, 28S and 18S rRNA, was separated from the daughter species by gel electrophoresis and the radiolabel in each species determined at various times after irradiation. By pulse-labeling the cells prior to irradiation, superimposed effects caused by radiation-induced alterations of rRNA transcription and Refs. therein were minimized, permitting selective analysis of the processing of that fraction of 45S precursor that had been synthesized (radiolabeled) predominantly prior to irradiation. They now report more detailed studies on 45S rRNA processing within the first 2 h following irradiation in which they have found a maximum 28 S:18 S ratio of 2:1 that is observed about 1 h following irradiation of 5 or 10 Gy.

  5. Epigenetic Programming of the rRNA Promoter by MBD3

    OpenAIRE

    2008-01-01

    Within the human genome there are hundreds of copies of the rRNA gene, but only a fraction of these genes are active. Silencing through epigenetics has been extensively studied; however, it is essential to understand how active rRNA genes are maintained. Here, we propose a role for the methyl-CpG binding domain protein MBD3 in epigenetically maintaining active rRNA promoters. We show that MBD3 is localized to the nucleolus, colocalizes with upstream binding factor, and binds to unmethylated r...

  6. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Directory of Open Access Journals (Sweden)

    Nakajima Rafael T

    2012-10-01

    Full Text Available Abstract Background Among multigene families, ribosomal RNA (rRNA genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a

  7. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  8. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Science.gov (United States)

    2012-01-01

    Background Among multigene families, ribosomal RNA (rRNA) genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs) and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a more complete picture for

  9. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C.; Dennis, P. P.

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  10. Identification and chromosomal distribution of 5S rRNA genes in Neurospora crassa.

    OpenAIRE

    Metzenberg, R L; Stevens, J N; Selker, E U; Morzycka-Wroblewska, E

    1985-01-01

    The 5S rRNA genes of Neurospora crassa, unlike those of most organisms, are not tandemly arranged, and they are found imbedded in a variety of unique sequences. The 5S rRNA regions of most of the genes are of one type, alpha; however, several other "isotypes" (beta, gamma, delta, zeta, and eta) are also found. We asked whether Neurospora 5S rRNA genes are dispersed on a chromosomal scale and whether genes of different isotypes are spatially segregated. We identified, by DNA sequencing, 5S rRN...

  11. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  12. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    Energy Technology Data Exchange (ETDEWEB)

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  13. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    The rRNAs in Escherichia coli contain methylations at 24 nucleotides, which collectively are important for ribosome function. Three of these methylations are m5C modifications located at nucleotides C967 and C1407 in 16S rRNA and at nucleotide C1962 in 23S rRNA. Bacterial rRNA modifications gener...... methyltransferase gene rsmF, and that the nomenclature system be extended to include the rRNA methyltransferases that still await identification....

  14. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    Science.gov (United States)

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  16. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    Science.gov (United States)

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  17. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim;

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems...... growth. The amounts of 23S rRNA and pre-16S rRNA measured for E. coli growing in intestinal mucus corresponded to that expected for bacteria with the observed growth rate. In contrast, the slow-growing E. coli cells present in intestinal contents turned out to have an approximately ninefold higher...

  18. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    Science.gov (United States)

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  19. Detection of Babesia microti parasites by highly sensitive 18S rRNA reverse transcription PCR.

    Science.gov (United States)

    Hanron, Amelia E; Billman, Zachary P; Seilie, Annette M; Chang, Ming; Murphy, Sean C

    2017-03-01

    Babesia are increasingly appreciated as a cause of transfusion-transmitted infection. Sensitive methods are needed to screen blood products. We report herein that B. microti 18S rRNA is over 1,000-fold more abundant than its coding genes, making reverse transcription PCR (RT-PCR) much more sensitive than PCR. Babesia 18S rRNA may be useful for screening the blood supply.

  20. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    Science.gov (United States)

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  1. Low abundant spacer 5S rRNA transcripts are frequently polyadenylated in Nicotiana.

    Science.gov (United States)

    Fulnecek, Jaroslav; Kovarik, Ales

    2007-11-01

    In plants, 5S rRNA genes (5S rDNA) encoding 120-nt structural RNA molecules of ribosomes are organized in tandem arrays comprising thousands of units. Failure to correctly terminate transcription would generate longer inaccurately processed transcripts interfering with ribosome biogenesis. Hence multiple termination signals occur immediately after the 5S rRNA coding sequence. To obtain information about the efficiency of termination of 5S rDNA transcription in plants we analyzed 5S rRNA pools in three Nicotiana species, N. sylvestris, N. tomentosiformis and N. tabacum. In addition to highly abundant 120-nt 5S rRNA transcripts, we also detected RNA species composed of a genic region and variable lengths of intergenic sequences. These genic-intergenic RNA molecules occur at a frequency severalfold lower than the mature 120-nt transcripts, and are posttranscriptionally modified by polyadenylation at their 3' end in contrast to 120-nt transcripts. An absence of 5S small RNAs (smRNA) argue against a dominant role for the smRNA biosynthesis pathway in the degradation of aberrant 5S rRNA in Nicotiana. This work is the first description of polyadenylated 5S rRNA species in higher eukaryotes originating from a read-through transcription into the intergenic spacer. We propose that polyadenylation may function in a "quality control" pathway ensuring that only correctly processed molecules enter the ribosome biogenesis.

  2. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil.

    Science.gov (United States)

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo; Seldin, Lucy

    2016-05-26

    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs).

  3. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    Directory of Open Access Journals (Sweden)

    Marissa B Hirst

    Full Text Available Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of

  4. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  5. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Directory of Open Access Journals (Sweden)

    Huijing Hao

    Full Text Available API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  6. A nested-PCR with an Internal Amplification Control for the detection and differentiation of Bartonella henselae and B. clarridgeiae: An examination of cats in Trinidad

    Directory of Open Access Journals (Sweden)

    Ramsubeik Shalini

    2005-08-01

    Full Text Available Abstract Background Bartonella species are bacterial blood parasites of animals capable of causing disease in both animals and man. Cat-Scratch Disease (CSD in humans is caused mainly by Bartonella henselae and is acquired from the cat, which serves as a reservoir for the bacteria. A second species, B. clarridgeiae is also implicated in the disease. Diagnosis of Bartonellosis by culture requires a week or more of incubation on enriched media containing blood, and recovery is often complicated by faster growing contaminating bacteria and fungi. PCR has been explored as an alternative to culture for both the detection and species identification of Bartonella, however sensitivity problems have been reported and false negative reactions due to blood inhibitors have not generally been addressed in test design. Methods A novel, nested-PCR was designed for the detection of Bartonella henselae and B. clarridgeiae based on the strategy of targeting species-specific size differences in the 16S-23S rDNA intergenic regions. An Internal Amplification Control was used for detecting PCR inhibition. The nested-PCR was utilized in a study on 103 blood samples from pet and stray cats in Trinidad. Results None of the samples were positive by primary PCR, but the Nested-PCR detected Bartonella in 32/103 (31% cats where 16 were infected with only B. henselae, 13 with only B. clarridgeiae and 3 with both species. Of 22 stray cats housed at an animal shelter, 13 (59% were positive for either or both species, supporting the reported increased incidence of Bartonella among feral cats. Conclusion The usefulness of a single PCR for the detection of Bartonella henselae and B. clarridgeiae in the blood of cats is questionable. A nested-PCR offers increased sensitivity over a primary PCR and should be evaluated with currently used methods for the routine detection and speciation of Bartonella henselae and B. clarridgeiae. In Trinidad, B. henselae and B. clarridgeiae are the

  7. Defining 5S rRNA structure space: point mutation data can be used to predict the phenotype of multichange variants.

    Science.gov (United States)

    Nayar, Madhavi; Fox, George E

    2011-09-01

    A portion of the 5S ribosomal RNA (rRNA) structure space in the vicinity of the Vibrio proteolyticus 5S rRNA sequence is explored in detail with the intention of establishing principles that will allow a priori prediction of which sequences would be valid members of a particular RNA structure space. Four hundred and one sequence variants differing from the V. proteolyticus 5S rRNA wild-type sequence in 1-7 positions were characterized using an in vivo assay system. Most significantly, it was found that in general, the phenotypic effects of single changes were independent of the phenotypic effect of a second change. As a result, it was possible to use the new data in conjunction with results from prior studies of the same RNA to develop "truth tables" to predict which multiple change variants would be functional and which would be nonfunctional. The actual phenotype of 93.8% of the multichange variants studied was consistent with the predictions made using truth tables thereby providing for perhaps the first time an upper limit estimate of how frequent unexpected interactions are. It was also observed that single changes at positions involved in secondary structure were no more likely to be invalid than changes in other regions. In particular, internal changes in long standard stems were in fact almost always tolerated. Changes at positions that were hypervariable in the context of an alignment of related sequences were, as expected, usually found to be valid. However, the potential validity of changes that were idiosyncratic to a single lineage of related sequences when placed in the V. proteolyticus 5S rRNA context was unpredictable.

  8. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    Science.gov (United States)

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA.

  9. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Jia-Ming Ma; Yan Xin; Xiao-Yun Mao; Yu-Jie Zhao; Dong-Ying Wu; Su-Min Zhang; Yu-Kui Zhang

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma.METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (ASPCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE)were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA.RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues.There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05).DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations.The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not.CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis. During

  10. Rapid in vivo exploration of a 5S rRNA neutral network.

    Science.gov (United States)

    Zhang, Zhengdong D; Nayar, Madhavi; Ammons, David; Rampersad, Joanne; Fox, George E

    2009-02-01

    A partial knockout compensation method to screen 5S ribosomal RNA sequence variants in vivo is described. The system utilizes an Escherichia coli strain in which five of eight genomic 5S rRNA genes were deleted in conjunction with a plasmid which is compensatory when carrying a functionally active 5S rRNA. The partial knockout strain is transformed with a population of potentially compensatory plasmids each carrying a randomly generated 5S rRNA gene variant. a The ability to compensate the slow growth rate of the knockout strain is used in conjunction with sequencing to rapidly identify variant 5S rRNAs that are functional as well as those that likely are not. The assay is validated by showing that the growth rate of 15 variants separately expressed in the partial knockout strain can be accurately correlated with in vivo assessments of the potential validity of the same variants. A region of 5S rRNA was mutagenized with this approach and nine novel variants were recovered and characterized. Unlike a complete knockout system, the method allows recovery of both deleterious and functional variants.. The method can be used to study variants of any 5S rRNA in the E. coli context including those of E. coli.

  11. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA.

    Science.gov (United States)

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W Brad

    2009-05-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element.

  13. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    Science.gov (United States)

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  14. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  15. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  16. 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells

    Directory of Open Access Journals (Sweden)

    Kuchipudi Suresh V

    2012-10-01

    Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and

  17. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    Science.gov (United States)

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  18. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  19. Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions.

    Science.gov (United States)

    Smirnov, A V; Entelis, N S; Krasheninnikov, I A; Martin, R; Tarassov, I A

    2008-12-01

    Small non-coding RNAs are today a topic of great interest for molecular biologists because they can be regarded as relicts of a hypothetical "RNA world" which, apparently, preceded the modern stage of organic evolution on Earth. The small molecule of 5S rRNA (approximately 120 nucleotides) is a component of large ribosomal subunits of all living beings (5S rRNAs are not found only in mitoribosomes of fungi and metazoans). This molecule interacts with various protein factors and 23S (28S) rRNA. This review contains the accumulated data to date concerning 5S rRNA structure, interactions with other biological macromolecules, intracellular traffic, and functions in the cell.

  20. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    Science.gov (United States)

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  1. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  2. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  3. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Science.gov (United States)

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

  4. Identification of acetic acid bacteria in traditionally produced vinegar and mother of vinegar by using different molecular techniques.

    Science.gov (United States)

    Yetiman, Ahmet E; Kesmen, Zülal

    2015-07-02

    Culture-dependent and culture-independent methods were combined for the investigation of acetic acid bacteria (AAB) populations in traditionally produced vinegars and mother of vinegar samples obtained from apple and grape. The culture-independent denaturing gradient gel electrophoresis (DGGE) analysis, which targeted the V7-V8 regions of the 16S rRNA gene, showed that Komagataeibacter hansenii and Komagataeibacter europaeus/Komagataeibacter xylinus were the most dominant species in almost all of the samples analyzed directly. The culture-independent GTG5-rep PCR fingerprinting was used in the preliminary characterization of AAB isolates and species-level identification was carried out by sequencing of the 16S rRNA gene, 16S-23S rDNA internally transcribed to the spacer (ITS) region and tuf gene. Acetobacter okinawensis was frequently isolated from samples obtained from apple while K. europaeus was identified as the dominant species, followed by Acetobacter indonesiensis in the samples originating from grape. In addition to common molecular techniques, real-time PCR intercalating dye assays, including DNA melting temperature (Tm) and high resolution melting analysis (HRM), were applied to acetic acid bacterial isolates for the first time. The target sequence of ITS region generated species-specific HRM profiles and Tm values allowed discrimination at species level.

  5. Distribution and diversity of Prochlorococcus ecotypes in the Red Sea

    KAUST Repository

    Shibl, Ahmed A.

    2014-06-19

    Photosynthetic prokaryotes of the genus Prochlorococcus play a major role in global primary production in the world\\'s oligotrophic oceans. A recent study on pelagic bacterioplankton communities in the northern and central Red Sea indicated that the predominant cyanobacterial 16S rRNA gene sequence types were from Prochlorococcus cells belonging to a high-light-adapted ecotype (HL II). In this study, we analyzed microdiversity of Prochlorococcus sp. at multiple depths within and below the euphotic zone in the northern, central, and southern regions of the Red Sea, as well as in surface waters in the same locations, but in a different season. Prochlorococcus dominated the communities in clone libraries of the amplified 16S-23S rRNA internal transcribed spacer (ITS) region. Almost no differences were found between samples from coastal or open-water sites, but a high diversity of Prochlorococcus ecotypes was detected at 100-meter depth in the water column. In addition, an unusual dominance of HL II-related sequences was observed in deeper waters. Our results indicate that the Red Sea harbors diverse Prochlorococcus lineages, but no novel ecotypes, despite its unusual physicochemical properties. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  6. Cyanobacterial diversity and a new acaryochloris-like symbiont from Bahamian sea-squirts.

    Directory of Open Access Journals (Sweden)

    Susanna López-Legentil

    Full Text Available Symbiotic interactions between ascidians (sea-squirts and microbes are poorly understood. Here we characterized the cyanobacteria in the tissues of 8 distinct didemnid taxa from shallow-water marine habitats in the Bahamas Islands by sequencing a fragment of the cyanobacterial 16S rRNA gene and the entire 16S-23S rRNA internal transcribed spacer region (ITS and by examining symbiont morphology with transmission electron (TEM and confocal microscopy (CM. As described previously for other species, Trididemnum spp. mostly contained symbionts associated with the Prochloron-Synechocystis group. However, sequence analysis of the symbionts in Lissoclinum revealed two unique clades. The first contained a novel cyanobacterial clade, while the second clade was closely associated with Acaryochloris marina. CM revealed the presence of chlorophyll d (chl d and phycobiliproteins (PBPs within these symbiont cells, as is characteristic of Acaryochloris species. The presence of symbionts was also observed by TEM inside the tunic of both the adult and larvae of L. fragile, indicating vertical transmission to progeny. Based on molecular phylogenetic and microscopic analyses, Candidatus Acaryochloris bahamiensis nov. sp. is proposed for this symbiotic cyanobacterium. Our results support the hypothesis that photosymbiont communities in ascidians are structured by host phylogeny, but in some cases, also by sampling location.

  7. Lactobacillus curtus sp. nov., isolated from beer in Finland.

    Science.gov (United States)

    Asakawa, Yuki; Takesue, Nobuchika; Asano, Shizuka; Shimotsu, Satoshi; Iijima, Kazumaru; Suzuki, Koji; Motoyama, Yasuo; Aizawa, Masayuki

    2017-09-12

    A Gram-stain-positive, catalase-negative and short-rod-shaped organism, designated VTT E-94560, was isolated from beer in Finland and deposited in the VTT culture collection as a strain of Lactobacillus rossiae. However, the results of 16S rRNA gene sequence analysis showed that VTT E-94560 was only related to Lactobacillus rossiae JCM 16176T with 97.0 % sequence similarity, lower than the 98.7 % regarded as the boundary for the species differentiation. Additional phylogenetic studies on the pheS gene, rpoA gene and 16S-23S rRNA internally transcribed spacer region further reinforced the taxonomically independent status of VTT E-94560 and its related Lactobacillus species including L. rossiae and Lactobacillus siliginis. Strain VTT E-94560 also exhibited several differences in its carbohydrate fermentation profiles from those related Lactobacillus species. In addition, DNA-DNA relatedness between VTT E-94560 and these two type strains was 4 % (L. rossiae JCM 16176T) and 12 % (L. siliginins JCM 16155T), respectively, which were lower than the 70 % cut-off for general species delineation, indicating that these three strains are not taxonomically identical at the species level. These studies revealed that VTT E-94560 represents a novel species, for which the name Lactobacillus curtus sp. nov. is proposed. The type strain is VTT E-94560T (=JCM 31185T).

  8. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    Science.gov (United States)

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history.

  9. Geosmin-producing Species of Coelosphaerium (Synechococcales, Cyanobacteria) in Lake Shinji, Japan

    Science.gov (United States)

    Godo, T.; Saki, Y.; Nojiri, Y.; Tsujitani, M.; Sugahara, S.; Hayashi, S.; Kamiya, H.; Ohtani, S.; Seike, Y.

    2017-02-01

    In Lake Shinji, Japan, periodic outbreaks of musty odour have occurred since mid-May 2007. Although the substance responsible for the odour was identified as geosmin, the odour-producing organism was unknown. We cultivated an axenic unialgal strain and determined that a species of Coelosphaerium (Synechococcales) was responsible for the production of geosmin in Lake Shinji. Our analysis was conducted using gas chromatography/mass spectrometry to determine the odorous compound. To determine the algae species, it was observed by optical microscopy to describe its morphological characteristics and the polymerase chain reaction was used to characterise the nucleotide sequence of the 16S rRNA gene and the 16S-23S rRNA internal transcribed spacer region. In addition, we explored the relationship between the number of cells of the Coelosphaerium sp. and the concentration of geosmin. In conclusion, geosmin, the cause of the musty odour in Lake Shinji in autumn 2009, was produced by Coelosphaerium sp., and to our knowledge, this is the first report of a geosmin-producing species in the family Coelosphaeriaceae.

  10. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Directory of Open Access Journals (Sweden)

    Gbenga Adedeji Adewumi

    2013-01-01

    Full Text Available In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the sixteen iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, Staphylococcus saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and Uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA combined with 16S-23S rRNA gene internal transcribed spacer (ITS PCR amplification, restriction analysis (ITS-PCR-RFLP and randomly amplified polymorphic DNA (RAPD-PCR. This further discriminated Bacillus subtilis and its variants from food-borne pathogens such as Bacillus cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP for iru production to achieve product consistency, safety quality and improved shelf life.

  11. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  12. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Directory of Open Access Journals (Sweden)

    Shu Wu

    Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  13. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Science.gov (United States)

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  14. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    Science.gov (United States)

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  15. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Science.gov (United States)

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  16. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  17. Phylogeny of protostome worms derived from 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  18. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  19. Trypanosoma cruzi 5S rRNA arrays define five groups and indicate the geographic origins of an ancestor of the heterozygous hybrids.

    Science.gov (United States)

    Westenberger, Scott J; Sturm, Nancy R; Campbell, David A

    2006-03-01

    Isolates of the etiological agent of Chagas disease, Trypanosoma cruzi, have been subdivided into six subgroups referred to as discrete typing units. The subgroups are related through two distinct hybridisation events: representatives of homozygous discrete typing units I and IIb fused to form discrete typing units IIa and IIc, whose homozygous genotypes have features of both ancestral types; a second fusion between strains of homozygous discrete typing units IIb and IIc created the heterozygous hybrid strains discrete typing units IId and IIe. The intergenic region of the tandemly repeated 5S rRNA array displays four variant sequence classes, allowing the discrimination of five discrete typing units. The genome project reference strain, CL Brener, is a hybrid discrete typing unit IIe strain that contains both discrete typing unit IIb and IIc classes of 5S rRNA repeats in distinct arrays present on different chromosomes. The CL Brener discrete typing unit IIb-type array contains approximately 193 repeated units, of which about one-third contain a 129 bp sequence that replaces a majority of the 5S rRNA sequence. The 129 bp 'invader' sequence was detected within the arrays of all hybrid discrete typing unit IId and IIe strains and in a subset of discrete typing unit IIb strains. This array invader replaces the internal promoter elements conserved in 5S rRNA. The discrete typing unit IIb Esmeraldo strain contains approximately 135 repeats and shows a region of homology to the array invader in the 5' flank of the array, but no evidence of the invading sequence element within the array. A survey of additional discrete typing unit IIb strains revealed a split within the subgroup, in which some strains contained invaded arrays and others were homogeneous for the 5S rRNA. The putative discrete typing unit IIb ancestor of the hybrid discrete typing units IId and IIe more closely resembles the extant Bolivian/Chilean IIb isolates than the Brazilian IIb isolates based on the

  20. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  1. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gen

  2. Rapid identification of rumen protozoa by restriction analysis of amplified 18S rRNA gene

    NARCIS (Netherlands)

    Regensbogenova, M.; Kisidayova, S.; Michalowski, T.; Javorsky, P.; Moon-van der Staay, S.Y.; Hackstein, J.H.P.; McEwan, N.R.; Jouany, J.P.; Newbold, J.C.; Pristas, P.

    2004-01-01

    A rapid method has been developed for molecular identification of rumen ciliates without the need for cultivation. Total DNA was isolated from single protozoal cells by the Chelex method and nearly complete protozoal 18S rRNA genes were amplified and subjected to restriction fragment length polymorp

  3. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  4. NOF1 encodes an Arabidopsis protein involved in the control of rRNA expression.

    Directory of Open Access Journals (Sweden)

    Erwana Harscoët

    Full Text Available The control of ribosomal RNA biogenesis is essential for the regulation of protein synthesis in eukaryotic cells. Here, we report the characterization of NOF1 that encodes a putative nucleolar protein involved in the control of rRNA expression in Arabidopsis. The gene has been isolated by T-DNA tagging and its function verified by the characterization of a second allele and genetic complementation of the mutants. The nof1 mutants are affected in female gametogenesis and embryo development. This result is consistent with the detection of NOF1 mRNA in all tissues throughout plant life's cycle, and preferentially in differentiating cells. Interestingly, the closely related proteins from zebra fish and yeast are also necessary for cell division and differentiation. We showed that the nof1-1 mutant displays higher rRNA expression and hypomethylation of rRNA promoter. Taken together, the results presented here demonstrated that NOF1 is an Arabidopsis gene involved in the control of rRNA expression, and suggested that it encodes a putative nucleolar protein, the function of which may be conserved in eukaryotes.

  5. Direct regulation of rRNA transcription by fibroblast growth factor 2.

    Science.gov (United States)

    Sheng, Zhi; Liang, Yanping; Lin, Chih-Yin; Comai, Lucio; Chirico, William J

    2005-11-01

    Fibroblast growth factor 2 (FGF-2), which is highly expressed in developing tissues and malignant cells, regulates cell growth, differentiation, and migration. Five isoforms (18 to approximately 34 kDa) of FGF-2 are derived from alternative initiation codons of a single mRNA. The 18-kDa FGF-2 isoform is released from cells by a nonclassical secretory pathway and regulates gene expression by binding to cell surface receptors. This isoform also localizes to the nucleolus, raising the possibility that it may directly regulate ribosome biogenesis, a rate-limiting process in cell growth. Although several growth factors have been shown to accumulate in the nucleolus, their function and mechanism of action remain unclear. Here we show that 18-kDa FGF-2 interacts with upstream binding factor (UBF), an architectural transcription factor essential for rRNA transcription. The maximal activation of rRNA transcription in vitro by 18-kDa FGF-2 requires UBF. The 18-kDa FGF-2 localizes to rRNA genes and is necessary for the full activation of pre-rRNA synthesis in vivo. Our results demonstrate that 18-kDa FGF-2 directly regulates rRNA transcription.

  6. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    Science.gov (United States)

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  7. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten;

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  8. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...

  9. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S rRNA a...

  10. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  11. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  12. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  13. APPLICATION OF 26S RRNA GENE SEQUENCING AND RFLP OF ITS1-5.8S-ITS2 ANALYSIS FOR THE IDENTIFICATION OF KLUYVEROMYCES STRAIN BM9 PRODUCING BIOFUEL

    Directory of Open Access Journals (Sweden)

    Virginia Wambui

    2014-04-01

    Full Text Available Cheese whey is a dairy industry waste have high lactose concentration, which case environmental problem. Therefore biofuel production from cheese whey become an interest as renewable energy. In this study 28 yeasts were isolated from Kenyan cheese whey and characterized for lactose fermentation. Out of them one isolate, designated as BM9 had high efficiency for lactose fermentation was selected. For genetically identification PCR amplification of both internal transcribed spacer (ITS and 5.8 rDNA region (ITS1-5.8S-ITS2 and the variable D1/D2 domain of the 26S rRNA gene were used. RFLP of the PCR-amplified ITS1-5.8S-ITS2 region (750 bp using two restriction enzymes HaeIII and HinfI yielded fragments with 650 + 80 bp and 250 + 190 + 120 + 80 bp respectively witch identified the isolate as Kluyveromyces marxianus. 26S rRNA of the isolate was sequenced and compared with known 26S rRNA sequences in the GenBank database. Results of 26S rRNA gene confirmed that the isolate was highly related to K. marxianus with similarity 99%. Phylogenetic analysis show that BM9 shared a one cluster with K. marxianus. The fermentative performance of the strain BM9 on cheese whey to produce bio-ethanol at different parameters such as incubation temperature, initial pH, whey sugar concentrations, and yeast concentrations was evaluated.

  14. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  15. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  16. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    Science.gov (United States)

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  17. Characterization of ISR region and development of a PCR assay for rapid detection of the fish pathogen Tenacibaculum soleae.

    Science.gov (United States)

    López, Jose R; Hamman-Khalifa, Abdel M; Navas, José I; de la Herran, Roberto

    2011-11-01

    The aims of this work were to characterize the 16S-23S internal spacer region of the fish pathogen Tenacibaculum soleae and to develop a PCR assay for its identification and detection. All T. soleae strains tested displayed a single internal spacer region class, containing tRNA(I) (le) and tRNA(A) (la) genes; nevertheless, a considerable intraspecific heterogeneity was observed. However, this region proved to be useful for differentiation of T. soleae from related and non-related species. Species-specific primers were designed targeting the 16S rRNA gene and the internal spacer region region, yielding a 1555-bp fragment. Detection limit was of 1 pg DNA per reaction (< 30 bacterial cells) when using pure cultures. The detection level in the presence of DNA from fish or other bacteria was lower; however, 10 pg were detected at a target/background ratio of 1 : 10(5) . The PCR assay proved to be more sensitive than agar cultivation for the detection of T. soleae from naturally diseased fish, offering a useful tool for diagnosis and for understanding the epidemiology of this pathogen.

  18. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  19. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  20. Activity profiles for marine sponge-associated bacteria obtained by 16S rRNA vs 16S rRNA gene comparisons.

    Science.gov (United States)

    Kamke, Janine; Taylor, Michael W; Schmitt, Susanne

    2010-04-01

    The phylogenetic diversity of microorganisms in marine sponges is becoming increasingly well described, yet relatively little is known about the activities of these symbionts. Given the seemingly favourable environment provided to microbes by their sponge hosts, as indicated by the extraordinarily high abundance of sponge symbionts, we hypothesized that the majority of sponge-associated bacteria are active in situ. To test this hypothesis we compared, for the first time in sponges, 16S rRNA gene- vs 16S rRNA-derived bacterial community profiles to gain insights into symbiont composition and activity, respectively. Clone libraries revealed a highly diverse bacterial community in Ancorina alata, and a much lower diversity in Polymastia sp., which were identified by electron microscopy as a high- and a low-microbial abundance sponge, respectively. Substantial overlap between DNA and RNA libraries was evident at both phylum and phylotype levels, indicating in situ activity for a large fraction of sponge-associated bacteria. This active fraction included uncultivated, sponge-specific lineages within, for example, Actinobacteria, Chloroflexi and Gemmatimonadetes. This study shows the potential of RNA vs DNA comparisons based on the 16S rRNA gene to provide insights into the activity of sponge-associated microorganisms.

  1. Robertsonian rearrangements in the reef fish Chromis (Perciformes, Pomacentridae involving chromosomes bearing 5s rRNA genes

    Directory of Open Access Journals (Sweden)

    Wagner F. Molina

    2002-01-01

    Full Text Available Cytogenetic studies were done on three Pomacentridae species of the genus Chromis. The karyotype of C. multilineata consisted of 48 acrocentric chromosomes (FN = 48, C. insolata had 2n = 46-47 (3-4M+6SM+36-38A; FN = 56 and C. flavicauda had 2n = 39 (9M+6SM+24A; FN = 54. Robertsonian polymorphisms were detected in C. insolata and C. flavicauda. All three species had small heterochromatic blocks restricted to centromeric regions. Nucleolar organizer regions (NORs were detected in the telomeric position of a medium acrocentric chromosome pair in C. multilineata and in non-homologous chromosomes in both C. flavicauda and C. insolata. FISH with a telomeric probe detected no internal telomeric sequences in C. flavicauda and C. insolata. 5S rRNA genes were observed in a pericentromeric region of two large metacentric chromosome pairs in C. flavicauda and two large acrocentric pairs in C. insolata. The karyotype structure and the number and location of the 5S rDNA loci in these two species indicated that the 5S rRNA-bearing acrocentric chromosomes were directly involved in the origin of the polymorphisms observed. These data reinforce the idea that Robertsonian rearrangements have been involved in molding the karyotype in the subfamily Chrominae.

  2. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  3. 16S rRNA beacons for bacterial monitoring during human space missions.

    Science.gov (United States)

    Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

    2007-04-01

    Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

  4. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Directory of Open Access Journals (Sweden)

    Jolanta Kwasniewska

    Full Text Available In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley by maleic hydrazide (MH cells was performed. Simultaneously fluorescence in situ hybridization (FISH with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment.

  5. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  6. Improving oligonucleotide fingerprinting of rRNA genes by implementation of polony microarray technology

    Science.gov (United States)

    Ruegger, Paul M.; Bent, Elizabeth; Li, Wei; Jeske, Daniel R.; Cui, Xinping; Braun, Jonathan; Jiang, Tao; Borneman, James

    2012-01-01

    Improvements to oligonucleotide fingerprinting of rRNA genes (OFRG) were obtained by implementing polony microarray technology. OFRG is an array-based method for analyzing microbial community composition. Polonies are discrete clusters of DNA, produced by solid-phase PCR in hydrogels, and derived from individual, spatially isolated DNA molecules. The advantages of a polony-based OFRG method include higher throughput and reductions in the PCR-induced errors and compositional skew inherent in all other PCR-based community composition methods, including high throughput sequencing of rRNA genes. Given the similarities between polony microarrays and certain aspects of sequencing methods such as the Illumina platform, we suggest that if concepts presented in this study were implemented in high throughput sequencing protocols, a reduction of PCR-induced errors and compositional skew may be realized. PMID:22640891

  7. Phylogenetic analysis of freshwater mussel corbicula regularis by 18s rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Magare V N

    2015-04-01

    Full Text Available Corbicula regularis is a freshwater mussel found in the Indian sub-continent. In the present study, phylogenetic characterization of this important bivalve was attempted using 18S ribosomal RNA gene markers. Genomic DNA was extracted and 18S rRNA gene was amplified by universal primers. The amplification product was sequenced and compared with the nucleotide databases available online to evaluate phylogenetic relationship of the animal under study. Results indicated that 18S rRNA gene sequences of C. regularis showed high degree of similarity to another freshwater mussel, C. fluminea. This work constitutes the first ever sequence deposition of the C. regularis in the nucleotide databases highlighting the usefulness of 18S ribosomal gene markers for phylogenetic analysis.

  8. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  9. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Science.gov (United States)

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  10. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons.

    Science.gov (United States)

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function.

  11. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  12. PCR-based bioprospecting for homing endonucleases in fungal mitochondrial rRNA genes.

    Science.gov (United States)

    Hafez, Mohamed; Guha, Tuhin Kumar; Shen, Chen; Sethuraman, Jyothi; Hausner, Georg

    2014-01-01

    Fungal mitochondrial genomes act as "reservoirs" for homing endonucleases. These enzymes with their DNA site-specific cleavage activities are attractive tools for genome editing and gene therapy applications. Bioprospecting and characterization of naturally occurring homing endonucleases offers an alternative to synthesizing artificial endonucleases. Here, we describe methods for PCR-based screening of fungal mitochondrial rRNA genes for homing endonuclease encoding sequences, and we also provide protocols for the purification and biochemical characterization of putative native homing endonucleases.

  13. Stimulation of the mouse rRNA gene promoter by a distal spacer promoter.

    OpenAIRE

    Paalman, M H; Henderson, S L; Sollner-Webb, B

    1995-01-01

    We show that the mouse ribosomal DNA (rDNA) spacer promoter acts in vivo to stimulate transcription from a downstream rRNA gene promoter. This augmentation of mammalian RNA polymerase I transcription is observed in transient-transfection experiments with three different rodent cell lines, under noncompetitive as well as competitive transcription conditions, over a wide range of template concentrations, whether or not the enhancer repeats alone stimulate or repress expression from the downstre...

  14. Novel variants of the 5S rRNA genes in Eruca sativa.

    Science.gov (United States)

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Environmental rRNA inventories miss over half of protistan diversity

    Directory of Open Access Journals (Sweden)

    Hong Sunhee

    2008-12-01

    Full Text Available Abstract Background The main tool to discover novel microbial eukaryotes is the rRNA approach. This approach has important biases, including PCR discrimination against certain rRNA gene species, which makes molecular inventories skewed relative to the source communities. The degree of this bias has not been quantified, and it remains unclear whether species missed from clone libraries could be recovered by increasing sequencing efforts, or whether they cannot be detected in principle. Here we attempt to discriminate between these possibilities by statistically analysing four protistan inventories obtained using different general eukaryotic PCR primers. Results We show that each PCR primer set-specific clone library is not a sample from the community diversity but rather from a fraction of this diversity. Therefore, even sequencing such clone libraries to saturation would only recover that fraction, which, according to the parametric models, varies between 17 ± 4% to 49 ± 10%, depending on the set of primers. The pooled data is thus qualitatively richer than individual libraries, even if normalized to the same sequencing effort. Conclusion The use of a single pair of primers leads to significant underestimation of the true community richness at all levels of taxonomic hierarchy. The majority of available protistan rRNA gene surveys likely sampled less than half of the target diversity, and might have completely missed the rest. The use of multiple PCR primers reduces this bias but does not necessarily eliminate it.

  16. 4-thiouridine inhibits rRNA synthesis and causes a nucleolar stress response.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Kellner, Markus; Rohrmoser, Michaela; Gruber-Eber, Anita; Windhager, Lukas; Friedel, Caroline C; Dölken, Lars; Eick, Dirk

    2013-10-01

    High concentrations (> 100 µM) of the ribonucleoside analog 4-thiouridine (4sU) is widely used in methods for RNA analysis like photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) and nascent messenger (m)RNA labeling (4sU-tagging). Here, we show that 4sU-tagging at low concentrations ≤ 10 µM can be used to measure production and processing of ribosomal (r)RNA. However, elevated concentrations of 4sU (> 50 µM), which are usually used for mRNA labeling experiments, inhibit production and processing of 47S rRNA. The inhibition of rRNA synthesis is accompanied by nucleoplasmic translocation of nucleolar nucleophosmin (NPM1), induction of the tumor suppressor p53, and inhibition of proliferation. We conclude that metabolic labeling of RNA by 4sU triggers a nucleolar stress response, which might influence the interpretation of results. Therefore, functional ribosome biogenesis, nucleolar integrity, and cell cycle should be addressed in 4sU labeling experiments.

  17. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  18. Purine and pyrimidine composition in 5S rRNA and its mutational significance

    Directory of Open Access Journals (Sweden)

    Subacius Sandra Maria Rodrigues

    1998-01-01

    Full Text Available Variations observed in 5S rRNA base compositions are almost entirely due to fixation of point mutations. As a consequence, 5S rRNA size has remained relatively constant during evolution and, therefore, dependencies among the four bases can be predicted. In order to characterize the nature and to determine the degree of such dependencies, correlation analysis followed by principal component factorial analysis was conducted on a large sample of 5S rRNA sequences. The results show that the purine and pyrimidine contents tend to remain constant, so that A + G = Kpur and C + U = Kpyr. The composition of the four bases expressed now by Kpur/Kpyr relationships is also constant (Ks. These relationships imply that the behavior of the mutations in the variable sites of the molecule follows rules imposed by the chemical nature of the bases involved. Consequently, transition mutations would be more favored than substitutions in transversion sites and also than insertion-deletion (rare in 5S rRNAs, since transitions would not significantly alter the values of the Ks-index.

  19. Crystallization and X-ray diffraction data of Thermus flavus 5S rRNA helices

    Science.gov (United States)

    Vallazza, Marco; Senge, Andrea; Lippmann, Corinna; Perbandt, Markus; Betzel, Christian; Bald, Rolf; Erdmann, Volker A.

    2001-11-01

    5S rRNA is an essential component of the large ribosomal subunit in prokaryotes and eukaryotes. Its unknown function in the ribosome will eventually be revealed in part by structural studies. To promote crystallization and enhance resolution in X-ray diffraction the molecule was subdivided into five domains A-E. Several RNA oligonucleotides were chemically produced by solid-phase phosphoramidite synthesis in order to construct the domains of the 5S rRNA. An improved RNA-MPD-screen was applied in crystallization which covers a complete 2D matrix for the components used. Crystallization analysis resulted in preferred combinations of pH, polyamine, monovalent and divalent cations for short RNA molecules. Six types of crystals corresponding to the domains B, C and E of Thermus flavus 5S rRNA could be obtained which were suitable for X-ray diffraction. Four RNA helices consist of seven base pairs and two of eight base pairs. As special features, they contain two adenines in a bulge position or G : U wobble base pairs assumed to be involved in RNA-protein recognition. With an increase in crystal size an increase in resolution by X-ray analysis was observed. X-ray diffraction data were collected to 1.5 Å resolution using synchrotron radiation and cryogenic cooling techniques.

  20. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  1. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  2. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  3. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    Science.gov (United States)

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  5. Improved identification of Gordonia, Rhodococcus and Tsukamurella species by 5'-end 16S rRNA gene sequencing.

    Science.gov (United States)

    Wang, Tao; Kong, Fanrong; Chen, Sharon; Xiao, Meng; Sorrell, Tania; Wang, Xiaoyan; Wang, Shuo; Sintchenko, Vitali

    2011-01-01

    The identification of fastidious aerobic Actinomycetes such as Gordonia, Rhodococcus, and Tsukamurella has remained a challenge leading to clinically significant misclassifications. This study is intended to examine the feasibility of partial 5'-end 16S rRNA gene sequencing for the identification of Gordonia, Rhodococcus, and Tsukamurella, and defined potential reference sequences for species from each of these genera. The 16S rRNA gene sequence based identification algorithm for species identification was used and enhanced by aligning test sequences with reference sequences from the List of Prokaryotic Names with Standing in Nomenclature. Conventional PCR based 16S rRNA gene sequencing and the alignment of the isolate 16S rRNA gene sequence with reference sequences accurately identified 100% of clinical strains of aerobic Actinomycetes. While partial 16S rRNA gene sequences of reference type strains matched with the 16S rRNA gene sequences of 19 isolates in our data set, another 13 strains demonstrated a degree of polymorphism with a 1-4 bp difference in the regions of difference. 5'-end 606 bp 16S rRNA gene sequencing, coupled with the assignment of well defined reference sequences to clinically relevant species of bacteria, can be a useful strategy for improving the identification of clinically relevant aerobic Actinomycetes.

  6. [Phylogenetic comparison between Spirulina and Arthrospira based on 16S rRNA and rpoC1 gene].

    Science.gov (United States)

    Wu, Yuemei; Wang, Suying; Dong, Shirui

    2016-02-04

    Based on 16S rRNA and rpoC1 gene sequences, the phylogenetic relationship between Spirulina and Arthrospira were studied and compared. We amplified, sequenced and analyzed 16S rRNA and rpoC1 of 84 strains. Then the phylogenetic trees were constructed and compared. The conserved sites percentage, average G+C content and sequence identity of rpoC1 were 49.7%, 47.7%, 76%-100% respectively, significantly lower than 79.4%, 55.6% and 91%-100% of 16S rRNA, and the heterogeneity degree was higher. The trees generated with two different genes showed similar topologies and thus inferred consistent phylogenetic relationships. Eighty-four experimental strains were divided into 3 groups belonging to 2 genera: F-35 1, F-904-2, F-1070 and TJBC14 were Spirulina and the rest were Arthrospira. Although morphospecies and geographical species could not be distinguished based on 16S rRNA and rpoC1 gene sequences, the bootstrap value of rpoC1 (100%) was higher than that of 16S rRNA (99%). Moreover, clustering effect of rpoC1 for Spirulina and Arthrospirai was better than 16S rRNA. Spirulina and Arthrospira were different genera, rpoC1 gene has more advantage to distinguish the strains in the same genus than that of 16S rRNA gene.

  7. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    Science.gov (United States)

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  8. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    Science.gov (United States)

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-08-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology.

  9. The Final Step in 5.8S rRNA Processing Is Cytoplasmic in Saccharomyces cerevisiae▿ †

    OpenAIRE

    Thomson, Emma; TOLLERVEY, DAVID

    2009-01-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3' cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3'-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading t...

  10. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  11. Evolution of RNA editing sites in the mitochondrial small subunit rRNA of the Myxomycota.

    Science.gov (United States)

    Krishnan, Uma; Barsamian, Arpi; Miller, Dennis L

    2007-01-01

    Because of their unique and unprecedented character, it is often difficult to imagine how and why the different, diverse types of RNA editing have evolved. Information about the evolution of a particular RNA editing system can be obtained by comparing RNA editing characteristics in contemporary organisms whose phylogenetic relationships are known so that editing patterns in ancestral organisms can be inferred. This information can then be used to build models of the origins, constraints, variability, and mechanisms of RNA editing. As an example of the types of information that can be obtained from these analyses, we describe how we have used cDNA, covariation, and phylogenetic analyses to study the evolution of the variation in RNA editing site location in the core region of the small subunit rRNA gene in the mtDNA of seven myxomycetes, including Physarum polycephalum. We find that the unique type of insertional RNA editing present in mitochondria of P. polycephalum is also present in the mitochondrial small subunit (SSU) rRNA of the other six myxomycetes. As in Physarum, this editing predominantly consists of cytidine insertions, but also includes uridine insertions and certain dinucleotide insertions such that any of the four canonical ribonucleotides can be inserted. Although the characteristics of RNA editing in these organisms are the same as in Physarum, the location of the insertion sites varies among the seven organisms relative to the conserved primary sequence and secondary structure of the rRNA. Nucleotide insertions have been identified at 29 different sites within this core region of the rRNA, but no one organism has more than 10 of these insertion sites, suggesting that editing sites have been created and/or eliminated since the divergence of these organisms. To determine the order in which editing sites have been created or eliminated, the sequences of the mitochondrial SSU rRNA have been aligned and this alignment has been used to produce

  12. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  13. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    Science.gov (United States)

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  14. Hawaii Energy and Environmental Technologies (HEET) Initiative

    Science.gov (United States)

    2009-05-01

    TC U TC U TC Filter TC =*=*- TC Water Gas Shift :3=LJ TC 5s WGS Bypass Reformer and Insulation High pressure System...N2, CH4, H2. J. Geophys. Res. 97, 20335-20343. Lane, D. J. (1991). 16S/23S rRNA sequencing, in Nucleic Acid Techniques in Bacterial Systematics...evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA . Appl Environ Microbiol 64, 795-799. Masoudi

  15. Transcription of the 5S rRNA heterochromatic genes is epigenetically controlled in Arabidopsis thaliana and Xenopus laevis.

    Science.gov (United States)

    Douet, J; Tourmente, S

    2007-07-01

    5S ribosomal DNA is a highly conserved tandemly repeated multigenic family. As suggested for a long time, we have shown that only a fraction of the 5S rRNA genes are expressed in Arabidopsis thaliana. In Xenopus laevis, there is a developmental control of the expression of the 5S rRNA genes with only one of the two 5S rDNA families expressed during oogenesis. For both Arabidopsis and Xenopus, the strongest transcription of 5S rRNA, respectively in the seed and during oogenesis is correlated with heterogeneity in the transcribed 5S rRNAs. Epigenetic mechanisms such as modification of the chromatin structure are involved in the transcriptional regulation of the 5S rRNA genes in both organisms. In Arabidopsis, two silencing pathways, methylation-dependent (RNAi) and methylation-independent (MOM pathway), are involved in the silencing of a 5S rDNA fraction.

  16. Identification of Swertia mussotii and its adulterant Swertia species by 5S rRNA gene spacer.

    Science.gov (United States)

    Yu, Man-Tang; Wong, Ka-Lok; Zong, Yu-Ying; Shaw, Pang-Chui; Che, Chun-Tao

    2008-03-01

    This research focused on analyzing the differences of 5S rRNA gene spacer sequences on Swertia mussotii and its commonly used adulterants, including S. franchetiana, S. wolfangiana and S. chirayita. DNA was extracted from the collected Swertia samples. 5S rRNA intergenic spacers were amplified by PCR, sequenced and analyzed. 5S rRNA gene spacer sequences were different between S. mussotii and its other three adulterants. Sequence divergence among species ranged from 30.6% to 65.0%. 5S rRNA spacers may be used as molecular authentication markers to differentiate S. mussotii and other commonly used Swertia adulterants. This result provides reliable and simple reference for the authentication of Swertia genus species.

  17. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    National Research Council Canada - National Science Library

    Nossa, Carlos W; Oberdorf, William E; Yang, Liying; Aas, Jørn A; Paster, Bruce J; Desantis, Todd Z; Brodie, Eoin L; Malamud, Daniel; Poles, Michael A; Pei, Zhiheng

    2010-01-01

    .... A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral, esophageal, and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species...

  18. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    DEFF Research Database (Denmark)

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes...... that FISH and rRNA slot blot hybridization gave comparable results. Furthermore, a combination of the two methods allowed us to calculate specific cellular rRNA contents with respect to localization in the sediment profile. The rRNA contents of Desulfosarcina-Desulfococcus cells were highest in the first 5...... mm of the sediment (0.9 and 1.4 fg, respectively) and decreased steeply with depth, indicating that maximal metabolic activity occurred close to the surface, Based on SRB cell numbers, cellular sulfate reduction rates were calculated. The rates were highest in the surface layer (0.14 fmol cell(-1...

  19. Internal and International Corruption

    Directory of Open Access Journals (Sweden)

    Dr.Sc. Mario Antinucci

    2015-06-01

    Full Text Available This subject, whence the name of this paper originates from, must be addressed with courage and intellectual integrity by all of us, the different parts of the civil society, the public institutions, the entrepreneurs and the legal professionals, the youth and the new generations. All the public policies of the European governments share the belief of a direct correlation between the criminal density connected to corruption of States political and economic protagonists and the lack of availability of investments on young talents, new generations, both in the entrepreneurial and in the professional fields. In most Member States, anticorruption policies have gained an increased prominence in government agendas and the financial crisis has drawn attention to the integrity and accountability of policy-makers. Most Member States that are currently in serious financial difficulties have acknowledged the seriousness of issues related to corruption and have created (or are planning anticorruption programs in order to deal with the risks deriving from this issue and with the diversion of public funds. In some Member States, the economic adjustment programs provide for explicit obligations related to anti-corruption policies. Even when not formally connected to adjustment programs, anticorruption policies complement the adjustment measures, especially in those countries in which corruption is a serious issue.  During the European Semester of economic policy coordination, recommendations for efficiently fighting corruption have been laid out; Among the most vulnerable sectors, urban development and building projects are certainly very exposed to corruption risks and to infiltration of internal and transnational organized crime.

  20. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  1. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  2. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  3. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    . coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  4. Genetic diversity of root-nodulating bacteria isolated from pea (Pisum sativum) in subtropical regions of China

    Institute of Scientific and Technical Information of China (English)

    YANG ChengYun; YANG JiangKe; LI YouGuo; ZHOU JunOhu

    2008-01-01

    Diversity of 42 isolates from effective nodules of Pisum sativum in different geographical regions of China were studied using 16S rRNA gene RFLP patterns, 16S rRNA sequencing, 16S-23S rRNA inter-genic spacer (IGS) region RFLP patterns and G-C rich random amplified polymorphic DNA (RAPD). The isolates were distributed in two groups on the basis of their 16S rRNA gene RFLP patterns. The 16S rRNA gene sequences of strains from 16S rRNA gene RFLP patterns group Ⅰ were very closely related (identities higher than 99.5%) to Rhizobium leguminosarum USDA 2370. Group Ⅱ consisting of WzP3 and WzP15 was closely related to Rhizobium etli CFN42. The analysis of the 16S-23S IGS RFLP pat-terns divided the isolates into 18 genotypes and four groups. Group Ⅰ was clustered with R. legumino-sarum USDA2370. Group Ⅱ consisted of YcP2, YcP3 and CqP7. The strains of group Ⅲ were distributed abroad. Group Ⅳ consisted of WzP3, WzP15 and R. etli CFN42. RAPD divided the isolates into nine clusters in which group Ⅳ only consisted of YcP2 and the strains of group Ⅴ and Ⅸ were from Wenzhou and Xiantao, respectively. This assay demonstrated the geographical effect on genetic diversity of pea rhizobia.

  5. International arbejdsdeling

    DEFF Research Database (Denmark)

    Henten, Anders

    1998-01-01

    Article dealing with the implications of informátion and communication technologies on the international division of labour.......Article dealing with the implications of informátion and communication technologies on the international division of labour....

  6. Internal Bleeding

    Science.gov (United States)

    ... in Paralyzed Monkeys Additional Content Medical News Internal Bleeding By Amy H. Kaji, MD, PhD, Associate Professor, ... Emergency First Aid Priorities Cardiac Arrest Choking Internal Bleeding Wounds Soft-Tissue Injuries Severed or Constricted Limbs ...

  7. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    Science.gov (United States)

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  8. Diversity of Bartonella species detected in arthropod vectors from animals in Australia.

    Science.gov (United States)

    Kaewmongkol, Gunn; Kaewmongkol, Sarawan; Burmej, Halina; Bennett, Mark D; Fleming, Patricia A; Adams, Peter J; Wayne, Adrian F; Ryan, Una; Irwin, Peter J; Fenwick, Stanley G

    2011-09-01

    A variety of Bartonella species were detected in two species of ticks and three species of fleas collected from marsupial hosts; brush-tailed bettong or woylie (Bettongia penicillata) and western barred bandicoots (Perameles bougainville) and from a rodent host; Rattus fuscipes in Western Australia. Bartonella species were detected using nested-PCR of the gltA gene and the 16S-23S ribosomal internal transcribed spacer region (ITS), and species were characterized using DNA sequencing of the 16S rRNA, gltA, rpoB, ftsZ genes and the ITS region. Bartonella rattaustraliani and B. coopersplainsensis were detected in Ixodes spp. ticks and fleas (Stephanocircus pectinipes) respectively collected from rodents. Two novel Bartonella species were detected from marsupials; Candidatus Bartonella woyliei n. sp. was detected in both fleas (Pygiopsylla hilli) and ticks (Ixodes australiensis) collected from woylies and Candidatus Bartonella bandicootii n. sp. was detected in fleas (Pygiopsylla tunneyi) collected from western barred bandicoots. Concatenated phylogenetic analysis of all 5 loci clarified the marsupial cluster of Bartonella species in Australia and confirmed the species status of these two Bartonella species in ticks and fleas from woylies and western barred bandicoots, which are classified as threatened species and are vulnerable to extinction.

  9. Isolation and phylogenetic analysis of Bartonella species from wild carnivores of the suborder Caniformia in Japan.

    Science.gov (United States)

    Sato, Shingo; Kabeya, Hidenori; Miura, Tatsuya; Suzuki, Kazuo; Bai, Ying; Kosoy, Michael; Sentsui, Hiroshi; Kariwa, Hiroaki; Maruyama, Soichi

    2012-12-28

    The prevalence of Bartonella species was investigated among wild carnivores of the suborder Caniformia, including 15 Japanese badgers (Meles anakuma), 8 Japanese martens (Martes melampus), 2 Japanese weasels (Mustela itatsi), 1 Siberian weasel (Mustela sibirica), 171 raccoon dogs (Nyctereutes procyonoides), and 977 raccoons (Procyon lotor) in Japan. Bartonella bacteria were isolated from one Japanese badger (6.7%) and from one Japanese marten (12.5%); however, no Bartonella species was found in other representatives of Caniformia. Phylogenetic analysis was based on concatenated sequences of six housekeeping genes (16S rRNA, ftsZ, gltA, groEL, ribC, and rpoB) and sequence of the 16S-23S internal transcribed spacer region. The sequence analysis indicated that the isolate derived from the Japanese badger (strain JB-15) can represent a novel Bartonella species and the isolate from the Japanese marten (strain JM-1) was closely related to Bartonella washoensis. This is the first report on isolation of Bartonella from badger and marten.

  10. Diversity of Aphanizomenon flos-aquae (cyanobacterium) populations along a Baltic Sea salinity gradient.

    Science.gov (United States)

    Laamanen, Maria J; Forsström, Laura; Sivonen, Kaarina

    2002-11-01

    Colony-forming cyanobacteria of the genus Aphanizomenon form massive blooms in the brackish water of the Baltic Sea during the warmest summer months. There have been recent suggestions claiming that the Baltic Sea Aphanizomenon species may be different from Aphanizomenon flos-aquae found in lakes. In this study, we examined variability in the morphology and 16S-23S rRNA internal transcribed spacer (ITS) sequences of A. flos-aquae populations along a salinity gradient from a string of lakes to a fjord-like extension of the Baltic Sea to the open Baltic Sea. Morphological differences among the populations were negligible. We found that the Baltic Sea was dominated (25 out of 27 sequences) by one ITS1-S (shorter band of ITS 1 [ITS1]) genotype, which also was found in the lakes. The lake populations of A. flos-aquae tended to be genetically more diverse than the Baltic Sea populations. Since the lake ITS1-S genotypes of A. flos-aquae are continuously introduced to the Baltic Sea via inflowing waters, it seems that only one ITS1 genotype is able to persist in the Baltic Sea populations. The results suggest that one of the ITS1-S genotypes found in the lakes is better adapted to the conditions of the Baltic Sea and that natural selection removes most of the lake genotypes from the Baltic Sea A. flos-aquae populations.

  11. Nostoc thermotolerans sp. nov., a soil-dwelling species of Nostoc (Cyanobacteria).

    Science.gov (United States)

    Suradkar, Archana; Villanueva, Chelsea; Gaysina, Lira A; Casamatta, Dale A; Saraf, Aniket; Dighe, Gandhali; Mergu, Ratnaprabha; Singh, Prashant

    2017-05-01

    A filamentous, soil-dwelling cyanobacterial strain (9C-PST) was isolated from Mandsaur, Madhya Pradesh, India, and is described as a new species of the genus Nostoc. Extensive morphological and molecular characterization along with a thorough assessment of ecology was performed. The style of filament orientation, type and nature of the sheath (e.g. distribution and visibility across the trichome), and vegetative and heterocyte cell dimensions and shape were assessed for over one year using both the laboratory grown culture and the naturally occurring samples. Sequencing of the 16S rRNA gene showed 94 % similarity with Nostocpiscinale CENA21 while analyses of the secondary structures of the 16S-23S ITS region showed unique folding patterns that differentiated this strain from other species of Nostoc. The level of rbcl and rpoC1 gene sequence similarity was 91 and 94 % to Nostocsp. PCC 7524 and Nostocpiscinale CENA21, respectively, while the nifD gene sequence similarity was found to be 99 % with Nostocpiscinale CENA21. The phenotypic, ecological, genetic and phylogenetic observations indicate that the strain 9C-PST represents a novel species of the genus Nostoc with the name proposed being Nostoc thermotolerans sp. nov. according to the International Code of Nomenclature for Algae, Fungi, and Plants.

  12. Molecular survey of Bartonella henselae and Bartonella clarridgeiae in pet cats across Japan by species-specific nested-PCR.

    Science.gov (United States)

    Sato, S; Kabeya, H; Negishi, A; Tsujimoto, H; Nishigaki, K; Endo, Y; Maruyama, S

    2017-10-01

    Cats are known to be the main reservoir for Bartonella henselae and Bartonella clarridgeiae, which are the agents of 'cat-scratch disease' in humans. In the present study, we investigated the prevalence of the two Bartonella species on 1754 cat bloods collected from all prefectures in Japan during 2007-2008 by a nested-polymerase chain reaction (PCR) targeting the 16S-23S rRNA internal transcribed spacer region. Overall, Bartonella DNA was detected in 4·6% (80/1754) of the cats examined. The nested-PCR showed that 48·8% (39/80) of the positive cats were infected with B. henselae mono-infection, 33·8% (27/80) with B. clarridgeiae mono-infection and 17·5% (14/80) were infected with both species. The prevalence (5·9%; 65/1103) of Bartonella infection in the western part of Japan was significantly higher than that (2·3%; 15/651) of eastern Japan (P < 0·001). Statistical analysis of the cats examined suggested a significant association between Bartonella infection and FeLV infection (OR = 1·9; 95% CI = 1·1-3·4), but not with FIV infection (OR = 1·6; 95% CI = 1·0-2·6).

  13. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay.

    Science.gov (United States)

    Chen, Te-Li; Lee, Yi-Tzu; Kuo, Shu-Chen; Yang, Su-Pen; Fung, Chang-Phone; Lee, Shou-Dong

    2014-09-01

    Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii are clinically relevant members of the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and important nosocomial pathogens. These three species are genetically closely related and phenotypically similar; however, they differ in their epidemiology, antibiotic resistance and pathogenicity. In this study, we investigated the use of a multiplex PCR-based assay designed to detect internal fragments of the 16S-23S rRNA intergenic region and the gyrB and recA genes. The assay was capable of differentiating A. baumannii, A. nosocomialis and A. pittii in a reliable manner. In 23 different reference strains and 89 clinical isolates of Acinetobacter species, the assay accurately identified clinically relevant Acb complex species except those 'between 1 and 3' or 'close to 13TU'. None of the non-Acb complex species was misidentified. In an analysis of 1034 positive blood cultures, the assay had a sensitivity of 92.4 % and specificity of 98.2 % for Acb complex identification. Our results show that a single multiplex PCR assay can reliably differentiate clinically relevant Acb complex species. Thus, this method may be used to better understand the clinical differences between infections caused by these species.

  14. Reclassification of Bacillus isronensisShivaji et al. 2009 as Solibacillus isronensis comb. nov. and emended description of genus Solibacillus Krishnamurthi et al. 2009.

    Science.gov (United States)

    Mual, Poonam; Singh, Nitin Kumar; Verma, Ashish; Schumann, Peter; Krishnamurthi, Srinivasan; Dastager, Syed; Mayilraj, Shanmugam

    2016-05-01

    An investigation into the taxonomic position of Bacillus isronensis MTCC 7902T revealed that the strain shares a common phylogenetic lineage with Solibacillus silvestris MTCC 10789T. It displays considerable overlap in phenotypic properties with the genus Solibacillus, including endospore shape and position, oxidase and catalase activities, presence of iso-C15 : 0, C16 : 1ω7c alcohol and iso-C17 : 1ω7c as major cellular fatty acids, A4α-type cell-wall peptidoglycan, polar lipids and menaquinone pattern. These features reinforce the findings of molecular phylogenetic analyses based on 16S rRNA gene, gyrB gene and 16S-23S internal transcribed spacer (ITS) region sequences and, in line with the recommendations of Kämpfer et al. [Int J Syst Evol Microbiol 56 (2006), 781-786], provide justification for the transfer of Bacillus isronensis from the genus Bacillus to Solibacillus as Solibacillus isronensis comb. nov. The type strain is B3W22T ( = MTCC 7902T = DSM 21046T = JCM 13838T). An emended description of the genus Solibacillus is also provided.

  15. Hypomethylation and hypermethylation of the tandem repetitive 5S rRNA genes in Arabidopsis.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Jasencakova, Zuzana; Douet, Julien; Schubert, Ingo; Tourmente, Sylvette

    2008-04-01

    5S ribosomal DNA (5S rDNA) is organized in tandem repeats on chromosomes 3, 4 and 5 in Arabidopsis thaliana. One part of the 5S rDNA is located within the heterochromatic chromocenters, and the other fraction forms loops with euchromatic features that emanate from the chromocenters. We investigated whether the A. thaliana heterochromatin, and particularly the 5S rDNA, is modified when changing the culture conditions (cultivation in growth chamber versus greenhouse). Nuclei from challenged tissues displayed larger total, as well as 5S rDNA, heterochromatic fractions, and the DNA methyltransferase mutants met1 and cmt3 had different impacts in Arabidopsis. The enlarged fraction of heterochromatic 5S rDNA was observed, together with the reversal of the silencing of some 5S rRNA genes known as minor genes. We observed hypermethylation at CATG sites, and a concomitant DNA hypomethylation at CG/CXG sites in 5S rDNA. Our results show that the asymmetrical hypermethylation is correlated with the ageing of the plants, whereas hypomethylation results from the growth chamber/culture conditions. In spite of severely reduced DNA methylation, the met1 mutant revealed no increase in minor 5S rRNA transcripts in these conditions. The increasing proportion of cytosines in asymmetrical contexts during transition from the euchromatic to the heterochromatic state in the 5S rDNA array suggests that 5S rDNA units are differently affected by the (hypo and hyper)methylation patterns along the 5S rDNA locus. This might explain the different behaviour of 5S rDNA subpopulations inside a 5S array in terms of chromatin compaction and expression, i.e. some 5S rRNA genes would become derepressed, whereas others would join the heterochromatic fraction.

  16. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  17. Diversity and evolution of 5S rRNA gene family organization in Pythium.

    Science.gov (United States)

    Bedard, James E J; Schurko, Andrew M; de Cock, Arthur W A M; Klassen, Glen R

    2006-01-01

    The 5S rRNA gene family organization among 87 species and varieties of Pythium was investigated to assess evolutionary stability of the two patterns detected and to determine which pattern is likely the ancestral state in the genus. Species with filamentous sporangia (Groups A-C according to the ITS phylogenetic tree for Pythium) had 5S genes linked to the rDNA repeat that were predominantly coded for on the DNA strand opposite to the one with the other rRNA genes ('inverted' orientation). A small group of species with contiguous sporangia (Group D) is related to Groups A-C but had unlinked 5S genes. The main group of species with spherical zoosporangia (Groups E-J) generally had unlinked 5S genes in tandem arrays. The six species in Group K, although they also have spherical sporangia, had linked genes on the same strand as the other rRNA genes 'non-inverted' and most of them had pairs of tandem 5S genes. The evolutionary stability of 5S sequence organization was compared with the stability of morphological characters as interpreted from a phylogeny based on ITS sequence analysis. Features of 5S sequence organization were found to be just as consistent within groups as were the morphological characters. To determine the ancestral type of 5S family organization, a survey of Phytophthora strains was conducted to supply an outgroup reference. The most parsimonious interpretation of the data in this survey yielded the tentative conclusion that the linked condition of the 5S sequences was ancestral.

  18. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    Directory of Open Access Journals (Sweden)

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  19. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    communities, and in this study activated sludge sampled from 32 Wastewater Treatment Plants (WWTPs) around the world was described and compared. The top abundant bacteria in the global activated sludge ecosystem were found and the core population shared by multiple samples was investigated. The results......Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  20. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    Institute of Scientific and Technical Information of China (English)

    陶伟; 焦明大; 赫杰; 何孟元; 郝水

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electron microscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distribution and position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat liver cells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillar component (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore, by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcription sites of rRNA genes and testified that localization of transcription sites not only to DFC but also to the periphery of FC.

  1. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  2. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    Science.gov (United States)

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  3. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  4. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resis...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  5. Interaction of tRNA with domain II of 23S rRNA.

    Science.gov (United States)

    Hill, W E; Tassanakajohn, A; Tapprich, W E

    1990-08-27

    The interaction of tRNA with domain II of 23S rRNA in E. coli ribosomes has been probed using short, complementary DNA oligodeoxyribonucleotides. Specifically, cDNA oligomers to the region 801-811 of the 23S rRNA were used to ascertain the interaction of this region with tRNA. It was found that when tRNA was bound to the P site, considerable competition occurred between tRNA and the cDNA oligomers which base paired with the nucleotides 807-811. However, A-site bound tRNA neither displaced, nor was displaced, by cDNA oligomers to this region. Additionally, the binding of tRNA lacking the CACCA nucleotides on the 3' terminus was unaffected by the presence a cDNA oligomer complementary to nucleotides 803-811, indicating that the cDNA-tRNA competition was dependent on the 3' terminal nucleotides of tRNA.

  6. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Nan Cheng

    Full Text Available Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states, all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one, complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  7. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Science.gov (United States)

    Cheng, Nan; Mao, Yuanhui; Shi, Youyi; Tao, Shiheng

    2012-01-01

    Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states), all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one), complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  8. Midkine accumulated in nucleolus of HepG2 cells involved in rRNA transcription

    Institute of Scientific and Technical Information of China (English)

    Li-Cheng Dai; Jian-Zhong Shao; Li-Shan Min; Yong-Tao Xiao; Li-Xin Xiang; Zhi-Hong Ma

    2008-01-01

    AIM: To invesgate the ultrastructural location of midkine (MK) in nucleolus and function corresponding to its location. METHODS: To investigate the ultrastructural location of MK in nucleolus with immunoelectronic microscopy. To study the role that MK plays in ribosomal biogenesis by real-time PCR. The effect of MK on anti-apoptotic activity of HepG2 cells was studied with FITC-conjugated annexin V and propidium iodide PI double staining through FACS assay. RESULTS: MK mainly localized in the granular component (GC), dense fibrillar component (DFC) and the border between the DF-C and fibrillar center (FC). The production of 45S precursor rRNA level was decreased significantly in the presence of IK antisense oligonucleotide in the HepG2 cells. Furthermore, it was found that exogenous MK could protect HepG2 from apoptosis significantly. CONCLUSION: NK was constitutively translocated to the nucleolus of HepG2 cells, where it accumulated and mostly distributed at DFC, GC components and at the region between FC and DFC, MK played an important role in rRNA transcription, ribosome biogenesis, and cell proliferation in HepG2 cells. MK might serve as a molecular target for therapeutic intervention of human carcinomas.

  9. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  10. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    Science.gov (United States)

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  11. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... to be recognized by the RNA polymerase holoenzyme containing sigma hrdB, the principal sigma factor in S. coelicolor. P2 also shares homology with the consensus for vegetative promoters, but has a sequence overlapping the consensus -35 region that is also present in the -35 regions of P3 and P4. The -35 sequence...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  12. Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians

    Directory of Open Access Journals (Sweden)

    Chiari Ylenia

    2005-03-01

    Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.

  13. Control of rRNA Synthesis in Escherichia coli: a Systems Biology Approach†

    Science.gov (United States)

    Dennis, Patrick P.; Ehrenberg, Mans; Bremer, Hans

    2004-01-01

    The first part of this review contains an overview of the various contributions and models relating to the control of rRNA synthesis reported over the last 45 years. The second part describes a systems biology approach to identify the factors and effectors that control the interactions between RNA polymerase and rRNA (rrn) promoters of Escherichia coli bacteria during exponential growth in different media. This analysis is based on measurements of absolute rrn promoter activities as transcripts per minute per promoter in bacterial strains either deficient or proficient in the synthesis of the factor Fis and/or the effector ppGpp. These absolute promoter activities are evaluated in terms of rrn promoter strength (Vmax/Km) and free RNA polymerase concentrations. Three major conclusions emerge from this evaluation. First, the rrn promoters are not saturated with RNA polymerase. As a consequence, changes in the concentration of free RNA polymerase contribute to changes in rrn promoter activities. Second, rrn P2 promoter strength is not specifically regulated during exponential growth at different rates; its activity changes only when the concentration of free RNA polymerase changes. Third, the effector ppGpp reduces the strength of the rrn P1 promoter both directly and indirectly by reducing synthesis of the stimulating factor Fis. This control of rrn P1 promoter strength forms part of a larger feedback loop that adjusts the synthesis of ribosomes to the availability of amino acids via amino acid-dependent control of ppGpp accumulation. PMID:15590778

  14. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    Directory of Open Access Journals (Sweden)

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  15. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  16. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin.

  17. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates...... the relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell...... in the hrcA-grpE-dnaK operon was analyzed. The hybridization data suggested a complex heat shock regulation indicating that the mRNA levels continued to rise after 30 min, but after renormalization the calculated average cellular levels exhibited a much simpler induction pattern, eventually attaining...

  18. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    Science.gov (United States)

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  19. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  20. A critical role for the non-coding 5S rRNA in regulating Mdmx stability

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2013-01-01

    Summary Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most of cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2 whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal an critical role of noncoding 5S rRNA in modulating the p53-Mdmx axis. PMID:21925390

  1. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    Science.gov (United States)

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes.

  2. International skatteret

    DEFF Research Database (Denmark)

    Winther-Sørensen, Niels; Wittendorff, Jens

    1996-01-01

    De seneste 6 måneders udvikling indenfor international skatteret beskrives. NW-S har skrevet artiklens afsnit om udvalgte afgørelser og om EU-skatteret.......De seneste 6 måneders udvikling indenfor international skatteret beskrives. NW-S har skrevet artiklens afsnit om udvalgte afgørelser og om EU-skatteret....

  3. International indsats

    DEFF Research Database (Denmark)

    Sachs, Therese

    En analyse af Beredskabsstyrelsens internationale engagement og muligheder for international indsats fremover. Forslag til struktur logistisk og materielt samt til udvikling af personel-kompetencer......En analyse af Beredskabsstyrelsens internationale engagement og muligheder for international indsats fremover. Forslag til struktur logistisk og materielt samt til udvikling af personel-kompetencer...

  4. International Curriculums.

    Science.gov (United States)

    Neal, Larry L.

    This workshop presentation on international curriculums in the field of parks, recreation, leisure, cultural services, and travel/tourism comments that the literature is replete with articles addressing what the field is about, but not about curriculum issues, models, and structure. It reports an international survey of 12 college educators…

  5. International Specialization

    DEFF Research Database (Denmark)

    Kleindienst, Ingo; Geisler Asmussen, Christian; Hutzschenreuter, Thomas;

    2012-01-01

    Whether and how international diversification and cross-border arbitrage affects firm performance remains one of the major unresolved research questions in the strategy and international business literatures. We propose that knowing how much a firm has internationally diversified tells us very...... little about performance implications, if we do not know, and do not ask, how the firm has diversified. Therefore, building on the two broad arguments of operating flexibility and location-specific commitment, we develop a theoretical framework that focuses on the extent to which a firm's international...... arbitrage strategy is characterized by specialization versus replication and argue that these different strategies may have differential impact on profitability and risk reduction. Developing a sophisticated measure of international specialization and using a unique panel data set of 92 German MNEs to test...

  6. International Specialization

    DEFF Research Database (Denmark)

    Kleindienst, Ingo; Geisler Asmussen, Christian; Hutzschenreuter, Thomas

    2012-01-01

    Whether and how international diversification and cross-border arbitrage affects firm performance remains one of the major unresolved research questions in the strategy and international business literatures. We propose that knowing how much a firm has internationally diversified tells us very...... little about performance implications, if we do not know, and do not ask, how the firm has diversified. Therefore, building on the two broad arguments of operating flexibility and location-specific commitment, we develop a theoretical framework that focuses on the extent to which a firm's international...... arbitrage strategy is characterized by specialization versus replication and argue that these different strategies may have differential impact on profitability and risk reduction. Developing a sophisticated measure of international specialization and using a unique panel data set of 92 German MNEs to test...

  7. International Relations:

    DEFF Research Database (Denmark)

    This is the textbook for the Open University module International Relations: Continuity and Change in Global Politics. Instead of leading with a succession of theoretical 'isms', the module structures its presentation of the subject around six teaching ‘blocks’, each of which explores a dilemma......: Flat or uneven? Change and transformation in the international system • Block 3: Just or unjust? Intervention and inequality in the international system • Block 4: Top-down or bottom-up? Governance in the international system • Block 5: Secure or insecure? Pursuing security in the international system...... • Block 6: Continuity or change in global politics? Each block introduces new IR theories through discussions of the substantive dilemmas and adds in a layered way levels of analysis and conceptual complexity....

  8. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    Science.gov (United States)

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  9. Trends in evolution of 5S rRNA of deuterostomes: bases and homogeneous clusters

    Directory of Open Access Journals (Sweden)

    Sandra Maria Rodrigues Subacius

    2002-01-01

    Full Text Available Evolution of metazoan 5S rRNA sequences was analyzed through base composition and types, location and frequency of clustered bases. Characters from sequences of protostomes did not show regular trends as compared with paleontology dating or organism complexity. Trends of increasing G and C, stronger in G clusters, and decreasing A and U, were detected in deuterostomes, in parallel with evolution of complexity. The multifunctional domain 71-104 was highlighted among conserved stretches. Clusters of C were typical of helices. Those of G were longer, extending from helices into loops or related to bulges, which is suggestive of functional significance. Deuterostomian trends were installed early in the lineage and reached full development in aquatic organisms, not increasing further after reptiles. It can be suggested that ribosomal RNA structures participated in deuterostomian high regulatory complexity, either specifically or as part of the widespread processes of chromosomal regionalization.

  10. Genetic Diversity in Populations of Sepiella maindroni Using 16S rRNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Part of the 16S rRNA gene is amplified with PCR and sequenced for 5 populations of common Chinese cuttlefish Sepiella maindroni: three from the South China Sea, one from East China Sea and one from Japan. The result shows that a total of 5 nucleotide positions are found to have gaps or insertions of base pairs among these individuals, and 13 positions are examined to be variable in all the sequences, which range from 494 to 509 base pairs. All of the individuals are grouped into 7 haplotypes (h1-h7). No marked genetic difference is observed among those populations. All of the individuals from Nagasaki belong to h1 and the h3 haplotype is found only in the coastal waters of China. AG transition in Nucleotide 255 is suggested to be taken as a kind of genetic marker to identify the populations distributed in East-South China Sea and the Nagasaki waters of Japan.

  11. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K.bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  12. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... that also confer antibiotic resistance. Both the domain II deletion and the 2057A mutation relieve the hypersensitive effect of the 2032A mutation, producing an erythromycin-resistant phenotype; in addition, the combination of the 2032A and 2057A mutations confers a higher level of chloramphenicol...... and chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  13. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content......, the distal part from Meckels diverticulum to the ileo-caecal junction was removed. Fixation was performed in ethanol and phosphate buffered saline. After washing by centrifugation, the sample was resuspended in pre-heated hybridization buffer with oligonucleotide probe labelled with Cy3 (10ng/µl). The cells...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...

  14. PHYLOGENETIC STATUS OF BABYLONIA ZEYLANICA (FAMILY BABYLONIIDAE BASED ON 18S rRNA GENE FRAGMENT

    Directory of Open Access Journals (Sweden)

    Vaithilingam RAVITCHANDIRANE

    2013-12-01

    Full Text Available Neogastropoda, highly diversed group of predatory marine snails, often been confused by shell colour and design pattern for identification. Gastropod resources which became economically important in India during the last decade are the whelk. The species Babylonia zeylanica of the family Babyloniidae began to be fished and exported from the country to China, Singapore, Thailand and Europe. This paper reports the molecular study of the group published to date with eight families of neogastropod taxa. For this study the 18S rRNA gene of B. zeylanica and other published data were collected from the GenBank. Kimura-2-Parameter genetic distance, nucleotide composition and neighbour joining analyses were conducted in all the eight families. The result clearly shows that Babyloniidae is clustered closely with Columbellidae of super family of Buccinoidea. Further additional gene data and increased sampling is warranted to give new insights into the phylogenetic relationships of Neogastropoda.

  15. discussion on validity of rana maoershanensis based on partial sequence of 16s rrna gene

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    rana maoershanensis found in mt.maoershan in guangxi,china was reported as a new species in 2007,but there was no molecular data for this frog.the partial sequences (543 bp) of 16s rrna gene from 12 specimens of 3 brown frog species (rana hanluica,r.maoershanensis and r.chensinensis) were analyzed with 17 specimens of 9 species from genbank.the nucleotide sequence divergence between r.maoershanensis and the other brown frog species were 4.5%-6.5%,with 22-30 nucleotide substitutions at this locus.the phylogenetic relationships based on mp,ml,and bayesian inference indicate that the brown frogs from southern china were diverged into three groups (clades a,b and c).r.maoershanensis was clustered together a well-supported subclade (b-l).it is suggested that r.maoershanensis is a valid species.

  16. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  17. Comparative sequence analysis of 16S rRNA gene of Pasteurella multocida serogroup B isolates from different animal species.

    Science.gov (United States)

    Dey, S; Singh, V P; Kumar, A A; Sharma, B; Srivastava, S K; Singh, Nem

    2007-08-01

    The phylogenetic relationships of five isolates of Pasteurella multocida serotype B:2 belonging to buffalo, cattle, pig, sheep and goat were investigated by comparative sequence analysis of 16S rRNA gene. The 1468bp fragment of 16S rRNA gene sequence comparison showed that the isolates of cattle (PM75), pig (PM49) and sheep (PM82) shared 99.9% homology with the buffalo isolate (vaccine strain P52) whereas, the goat isolate (PM86) shared 99.8% homology with the vaccine strain. The 16S rRNA gene sequences of these isolates were also found monophyletic with type B reference strain NCTC 10323 of P. multocida subsp. multocida. The present study indicated the close relationships of haemorrhagic septicaemia causing P. multocida serotype B:2 isolates of buffalo and cattle with other uncommon hosts (pig, sheep and goat).

  18. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    Science.gov (United States)

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  19. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain

    2015-01-01

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study investigated microbial...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  20. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Martin Ciganda

    Full Text Available P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  1. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  2. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  3. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  4. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  5. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    Science.gov (United States)

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  6. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Science.gov (United States)

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  7. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  8. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    Science.gov (United States)

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  9. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  10. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  11. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D;

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  12. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  13. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR).

    Science.gov (United States)

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio

    2015-01-01

    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  14. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.;

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  15. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  16. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Science.gov (United States)

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  17. Assessing the fecal microbiota: an optimized ion torrent 16S rRNA gene-based analysis protocol.

    Directory of Open Access Journals (Sweden)

    Christian Milani

    Full Text Available Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota.

  18. Significant loss of sensitivity and specificity in the taxonomic classification occurs when short 16S rRNA gene sequences are used

    Directory of Open Access Journals (Sweden)

    Marcel Martínez-Porchas

    2016-09-01

    Full Text Available The classification performance of Kraken was evaluated in terms of sensitivity and specificity when using short and long 16S rRNA sequences. A total of 440,738 sequences from bacteria with complete taxonomic classifications were downloaded from the high quality ribosomal RNA database SILVA. Amplicons produced (86,371 sequences; 1450 bp by virtual PCR with primers covering the V1–V9 region of the 16S-rRNA gene were used as reference. Virtual PCŔs of internal fragments V3–V4, V4–V5 and V3–V5 were performed. A total of 81,523, 82,334 and 82,998 amplicons were obtained for regions V3–V4, V4–V5 and V3–V5 respectively. Differences in depth of taxonomic classification were detected among the internal fragments. For instance, sensitivity and specificity of sequences classified up to subspecies level were higher when the largest internal fraction (V3–V5 was used (54.0 and 74.6% respectively, compared to V3–V4 (45.1 and 66.7% and V4–V5 (41.8 and 64.6% fragments. Similar pattern was detected for sequences classified up to more superficial taxonomic categories (i.e. family, order, class…. Results also demonstrate that internal fragments lost specificity and some could be misclassified at the deepest taxonomic levels (i.e. species or subspecies. It is concluded that the larger V3–V5 fragment could be considered for massive high throughput sequencing reducing the loss of sensitivity and sensibility.

  19. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    DEFF Research Database (Denmark)

    Sahm, K.; MacGregor, BJ; Jørgensen, BB

    1999-01-01

    is a valuable tool for a more realistic assessment of SRB abundance in the natural environment. The distribution of SRB was investigated in a coastal marine sediment by hybridization of membrane-immobilized rRNA with oligonucleotide probes. As represented by general probe-target groups, SRB rRNA contributed...... between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...

  20. The participation of 5S rRNA in the co-translational formation of a eukaryotic 5S ribonucleoprotein complex

    OpenAIRE

    Lin, Elong; Lin, Sue-Wen; Lin, Alan

    2001-01-01

    The eukaryotic ribosomal 5S RNA–protein complex (5S rRNP) is formed by a co-translational event that requires 5S rRNA binding to the nascent peptide chain of eukaryotic ribosomal protein L5. Binding between 5S rRNA and the nascent chain is specific: neither the 5S rRNA nor the nascent chain of L5 protein can be substituted by other RNAs or other ribosomal proteins. The region responsible for binding 5S rRNA is located at positions 35–50 with amino acid sequence RLV...

  1. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2016-12-06

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development.

  2. International Health

    Science.gov (United States)

    ... create refugee populations with immediate and long-term health problems. Some of the major diseases currently affecting ... also an international problem which can affect people's health. Many countries and health organizations are working together ...

  3. International Reports.

    Science.gov (United States)

    Valauskas, Edward J.; Stowe, Jennifer L.; Haycock, Ken; Dodd, Frances

    1998-01-01

    Presents three reports: International Federation of Library Associations and Institutions; Special Libraries Association; and Canadian library trends, focusing on information technology and access to information and rights and examining provincial libraries and library education. (PEN)

  4. Juris International

    CERN Document Server

    A database on international trade law aimed at lawyers and legal counsel in developing and transition economies. Juris International is a multilingual collection (English, Spanish, and French) of legal information on international trade. Juris International aims to facilitate and reduce the work involved in research for business lawyers, advisers and in-house counsel, and state organizations in developing nd transition economies, by providing access to texts which have often been difficult to obtain. Its objective is to gather a large quantity of basic information at one site (favoring complete legal texts), without the need to send for the information, and consequently without excessive communication costs for users who d benefit from an efficient and cheap telecommunications network.

  5. Internal education

    OpenAIRE

    Anita Zagorc

    2016-01-01

    Research Question (RQ): The importance of internal trainings in an organization. Purpose: The purpose of research is to examine and present internal trainings in an organization and their contribution to greater success of an organization. The paper studies employee training in a company, how the organization itself looks after its employees during training, how trainings contribute to further development of organization and the advancement of knowledge for successful operation of organi...

  6. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    Institute of Scientific and Technical Information of China (English)

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    muscle. The signal intensities of 18S rRNA among tissues were consistent, which showed that the 18S rRNA gene expressed stably in different tissues and could be used as an internal standard for researches of specific gene expression in prawns.

  7. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Science.gov (United States)

    Flavobacterium columnare is the causative agent of columnaris disease which severely impacts channel catfish production in the USA and may be emerging as an important pathogen in the rainbow trout industry. The 16S rRNA gene is a housekeeping gene commonly used for bacterial taxonomy and genotyping...

  8. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment

    Science.gov (United States)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  9. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96.4...

  10. Campylobacter jejuni, an uncommon cause of splenic abscess diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Seng, Piseth; Quenard, Fanny; Menard, Amélie; Heyries, Laurent; Stein, Andreas

    2014-12-01

    Splenic abscess is a rare disease that primarily occurs in patients with splenic trauma, endocarditis, sickle cell anemia, or other diseases that compromise the immune system. This report describes a culture-negative splenic abscess in an immunocompetent patient caused by Campylobacter jejuni, as determined by 16S rRNA gene sequencing.

  11. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, Human Papilloma Virus infection and surgical treatment

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodriguez-Hilario, Arnold; Gonzalez, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David

    2016-01-01

    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropha

  12. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    Science.gov (United States)

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  13. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    Science.gov (United States)

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  14. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J;

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  15. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  16. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato (Solanum lycopersicum) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  17. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Science.gov (United States)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  18. Micelle PCR reduces chimera formation in 16S rRNA profiling of complex microbial DNA mixtures

    NARCIS (Netherlands)

    S.A. Boers (Stefan A.); J.P. Hays (John P.); R. Jansen (Ruud)

    2015-01-01

    textabstract16S rRNA gene profiling has revolutionized the field of microbial ecology. Many researchers in various fields have embraced this technology to investigate bacterial compositions of samples derived from many different ecosystems. However, it is important to acknowledge the current

  19. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database

    NARCIS (Netherlands)

    Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.

    2015-01-01

    Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to f

  20. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  1. First report of neonatal bacteremia caused by "Haemophilus quentini" diagnosed by 16S rRNA gene sequencing, Italy.

    Science.gov (United States)

    Giufrè, Maria; Cardines, Rita; Degl'Innocenti, Roberto; Cerquetti, Marina

    2015-10-01

    We report the first case of neonatal bacteremia caused by a "Haemophilus quentini" isolate in Italy. The isolate was differentiated from H. influenzae by 16S rRNA sequencing and was characterized by comparison with the wild-type "H. quentini" CCUG 36167. Both isolates carried substitutions in penicillin-binding protein 3 but were susceptible to aminopenicillins.

  2. Direct 16S rRNA gene sequencing of polymicrobial culture-negative samples with analysis of mixed chromatograms

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Justesen, Ulrik S

    2010-01-01

    Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...

  3. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment.

    Science.gov (United States)

    LaFrentz, B R; Waldbieser, G C; Welch, T J; Shoemaker, C A

    2014-07-01

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare, and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing of this important fish pathogen. Interpretation of restriction patterns can be difficult due to the lack of a formal description of the expected number and sizes of DNA fragments generated for each of the described genomovars. In this study, partial 16S rRNA gene sequences (ca. 1250-bp fragment) from isolates representing each described genomovar and isolates generating unique restriction patterns were cloned and sequenced. The results demonstrated that some isolates contained up to three different 16S rRNA genes whose sequences generate different RFLP patterns due to intragenomic heterogeneity within HaeIII restriction sites. The occurrence of HaeIII restriction sites within the portion of the 16S rRNA gene used for typing the F. columnare isolates and intragenomic heterogeneity within these sites explained the restriction patterns observed following RFLP analyses. This research provides a standard protocol for typing isolates of F. columnare by RFLP and a formal description of the expected restriction patterns for the previously described genomovars I, II, II-B and III. Additionally, we describe a new genomovar, I/II.

  4. Dynamics and persistence of Dead Sea microbial populations as shown by high-throughput sequencing of rRNA.

    Science.gov (United States)

    Rhodes, Matthew E; Oren, Aharon; House, Christopher H

    2012-04-01

    16S rRNA amplicon libraries from a haloarchaeal bloom in the hypersaline Dead Sea in 1992 were analyzed together with the 2007 residual population and simulated blooms in experimental mesocosms. Significant population shifts were observed during the bloom, and surprisingly a signature from the bloom was retained 15 years later.

  5. The final step in 5.8S rRNA processing is cytoplasmic in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thomson, Emma; Tollervey, David

    2010-02-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3' cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3'-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading to TRAMP-dependent pre-rRNA degradation. The 6S pre-rRNA was coprecipitated with the 60S export adapter Nmd3 and cytoplasmic 60S synthesis factor Lsg1. The longer 5.8S+30 pre-rRNA (a form of 5.8S rRNA 3' extended by approximately 30 nucleotides) is processed to 6S by the nuclear exonuclease Rrp6, and nuclear pre-rRNA accumulated in the absence of Rrp6. In contrast, 6S to 5.8S processing requires the cytoplasmic exonuclease Ngl2, and cytoplasmic pre-rRNA accumulated in strains lacking Ngl2. We conclude that nuclear pre-60S particles containing the 6S pre-rRNA bind Nmd3 and Crm1 and are exported to the cytoplasm prior to final maturation by Ngl2.

  6. The Final Step in 5.8S rRNA Processing Is Cytoplasmic in Saccharomyces cerevisiae▿ †

    Science.gov (United States)

    Thomson, Emma; Tollervey, David

    2010-01-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3′ cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3′-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading to TRAMP-dependent pre-rRNA degradation. The 6S pre-rRNA was coprecipitated with the 60S export adapter Nmd3 and cytoplasmic 60S synthesis factor Lsg1. The longer 5.8S+30 pre-rRNA (a form of 5.8S rRNA 3′ extended by ∼30 nucleotides) is processed to 6S by the nuclear exonuclease Rrp6, and nuclear pre-rRNA accumulated in the absence of Rrp6. In contrast, 6S to 5.8S processing requires the cytoplasmic exonuclease Ngl2, and cytoplasmic pre-rRNA accumulated in strains lacking Ngl2. We conclude that nuclear pre-60S particles containing the 6S pre-rRNA bind Nmd3 and Crm1 and are exported to the cytoplasm prior to final maturation by Ngl2. PMID:20008552

  7. Spatial Distribution of Escherichia coli in the Mouse Large Intestine Inferred from rRNA In Situ Hybridization

    DEFF Research Database (Denmark)

    Poulsen, Lars Kærgaard; Lan, Fusheng; Sternberg, Claus

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from th...

  8. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  9. Molecular diagnosis of Kingella kingae pericarditis by amplification and sequencing of the 16S rRNA gene.

    Science.gov (United States)

    Matta, Matta; Wermert, Delphine; Podglajen, Isabelle; Sanchez, Olivier; Buu-Hoï, Annie; Gutmann, Laurent; Meyer, Guy; Mainardi, Jean-Luc

    2007-09-01

    Kingella kingae is a fastidious gram-negative bacillus that is considered an emerging pathogen in pediatric settings but remains less common in adults. Here we describe a case of pericarditis in an immunocompetent adult host. The microorganism was identified directly from the clinical sample by molecular techniques, i.e., 16S rRNA gene amplification and sequencing.

  10. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  11. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A.

    Science.gov (United States)

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-06-05

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation.

  12. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  13. A comparison of rpoB and 16S rRNA as markers in pyrosequencing studies of bacterial diversity

    NARCIS (Netherlands)

    Vos, M.; Quince, C.; Pijl, A.S.; De Hollander, M.; Kowalchuk, G.A.

    2012-01-01

    Background The 16S rRNA gene is the gold standard in molecular surveys of bacterial and archaeal diversity, but it has the disadvantages that it is often multiple-copy, has little resolution below the species level and cannot be readily interpreted in an evolutionary framework. We compared the 16S r

  14. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    Science.gov (United States)

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  15. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  16. Micelle PCR reduces chimera formation in 16S rRNA profiling of complex microbial DNA mixtures

    NARCIS (Netherlands)

    S.A. Boers (Stefan A.); J.P. Hays (John P.); R. Jansen (Ruud)

    2015-01-01

    textabstract16S rRNA gene profiling has revolutionized the field of microbial ecology. Many researchers in various fields have embraced this technology to investigate bacterial compositions of samples derived from many different ecosystems. However, it is important to acknowledge the current limitat

  17. Improving the microbial community reconstruction at the genus level by multiple 16S rRNA regions.

    Science.gov (United States)

    Wang, Shengqin; Sun, Beili; Tu, Jing; Lu, Zuhong

    2016-06-07

    16S rRNA genes have been widely used for phylogenetic reconstruction and the quantification of microbial diversity through the application of next-generation sequencing technology. However, long-read sequencing is still costly, while short-read sequencing carries less information for complex microbial community profiling; therefore, the applications of high throughput sequencing platforms still remain challenging in microbial community reconstruction analysis. Here, we developed a method to investigate the profile of aligned 16S rRNA gene sequences and to measure the proper region for microbial community reconstruction, as a step in creating a more efficient way to detect microorganism at the genus level. Finally, we found that each genus has its own preferential genus-specific amplicons for a genus assignment, which are not always located in hyper variable regions (HVRs). It was also noted that the rare genera should contribute less than dominant ones to the common profile of the aligned 16S rRNA sequences and have lower affinity to the common universal primer. Therefore, using multiple 16S rRNA regions rather than one "universal" region can significantly improve the ability of microbial community reconstruction. In addition, we found that a short fragment is suitable for most genera identifications, and the proper conserved regions used for primer design are larger than before. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto

    2016-11-27

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  19. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, Human Papilloma Virus infection and surgical treatment

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodriguez-Hilario, Arnold; Gonzalez, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David

    2016-01-01

    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropha

  20. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    assigned to the donor substrate binding site and a possible base-pairing interaction between the 3'-terminal sequence of the peptidyl-tRNA and the sequence psi/U-G-G2582, that is conserved in all the non-mitochondrial 23 S-like rRNA sequences, is proposed. Three sites that have been implicated in aminoacyl-tRNA...

  1. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Science.gov (United States)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  2. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Directory of Open Access Journals (Sweden)

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  3. Bypassing rRNA methylation by RsmA/Dim1during ribosome maturation in the hyperthermophilic archaeon Nanoarchaeum equitans

    DEFF Research Database (Denmark)

    Seistrup, Kenneth H; Rose, Simon; Birkedal, Ulf

    2017-01-01

    In all free-living organisms a late-stage checkpoint in the biogenesis of the small ribosomal subunit involves rRNA modification by an RsmA/Dim1 methyltransferase. The hyperthermophilic archaeon Nanoarchaeum equitans, whose existence is confined to the surface of a second archaeon, Ignicoccus hos...

  4. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Science.gov (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  5. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    Directory of Open Access Journals (Sweden)

    Jiazhen Chen

    Full Text Available Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported.The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains.Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72% had intragenomic nucleotide polymorphisms (SNPs in multiple locations, and 13 strains (9.4% had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89 and 100% (19/19 of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed.Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities

  6. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    Science.gov (United States)

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

  7. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  9. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    Science.gov (United States)

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  10. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Directory of Open Access Journals (Sweden)

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  11. 16S rRNA terminal restriction fragment length polymorphism for the characterization of the nasopharyngeal microbiota.

    Directory of Open Access Journals (Sweden)

    Silvio D Brugger

    Full Text Available A novel non-culture based 16S rRNA Terminal Restriction Fragment Length Polymorphism (T-RFLP method using the restriction enzymes Tsp509I and Hpy166II was developed for the characterization of the nasopharyngeal microbiota and validated using recently published 454 pyrosequencing data. 16S rRNA gene T-RFLP for 153 clinical nasopharyngeal samples from infants with acute otitis media (AOM revealed 5 Tsp509I and 6 Hpy166II terminal fragments (TFs with a prevalence of >10%. Cloning and sequencing identified all TFs with a prevalence >6% allowing a sufficient description of bacterial community changes for the most important bacterial taxa. The conjugated 7-valent pneumococcal polysaccharide vaccine (PCV-7 and prior antibiotic exposure had significant effects on the bacterial composition in an additive main effects and multiplicative interaction model (AMMI in concordance with the 16S rRNA 454 pyrosequencing data. In addition, the presented T-RFLP method is able to discriminate S. pneumoniae from other members of the Mitis group of streptococci, which therefore allows the identification of one of the most important human respiratory tract pathogens. This is usually not achieved by current high throughput sequencing protocols. In conclusion, the presented 16S rRNA gene T-RFLP method is a highly robust, easy to handle and a cheap alternative to the computationally demanding next-generation sequencing analysis. In case a lot of nasopharyngeal samples have to be characterized, it is suggested to first perform 16S rRNA T-RFLP and only use next generation sequencing if the T-RFLP nasopharyngeal patterns differ or show unknown TFs.

  12. Comparative metagenomic and rRNA microbial diversity characterization using archaeal and bacterial synthetic communities.

    Science.gov (United States)

    Shakya, Migun; Quince, Christopher; Campbell, James H; Yang, Zamin K; Schadt, Christopher W; Podar, Mircea

    2013-06-01

    Next-generation sequencing has dramatically changed the landscape of microbial ecology, large-scale and in-depth diversity studies being now widely accessible. However, determining the accuracy of taxonomic and quantitative inferences and comparing results obtained with different approaches are complicated by incongruence of experimental and computational data types and also by lack of knowledge of the true ecological diversity. Here we used highly diverse bacterial and archaeal synthetic communities assembled from pure genomic DNAs to compare inferences from metagenomic and SSU rRNA amplicon sequencing. Both Illumina and 454 metagenomic data outperformed amplicon sequencing in quantifying the community composition, but the outcome was dependent on analysis parameters and platform. New approaches in processing and classifying amplicons can reconstruct the taxonomic composition of the community with high reproducibility within primer sets, but all tested primers sets lead to significant taxon-specific biases. Controlled synthetic communities assembled to broadly mimic the phylogenetic richness in target environments can provide important validation for fine-tuning experimental and computational parameters used to characterize natural communities.

  13. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available BACKGROUND: Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation. METHODOLOGY/PRINCIPAL FINDINGS: To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups. CONCLUSIONS/SIGNIFICANCE: In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  14. Molecular detection of adulteration in chicken products based on mitochondrial 12S rRNA gene.

    Science.gov (United States)

    Abuzinadah, Osama H A; Yacoub, Haitham Ahmed; El Ashmaoui, Hassan M; Ramadan, Hassan A I

    2015-06-01

    The aim of this study is to detect the fraudulent in chicken products constitutes in order to protect consumers in Saudi Arabia from illegal substitutions. Two different approaches were used in this study, direct sequencing of specific fragments of amplified mitochondrial 12S rRNA gene in addition to species-specific PCR primers for confirmation of the obtained Blast search results. The results showed that all processed chicken products were identified as chicken (Gallus gallus) by 90-98% homology depending on obtained sequence quality. Samples labeled with chicken luncheon (samples tested in this study) were identified as turkey meat (Meleagris gallopavo) by 98% homology, suggesting adulteration with inedible parts of turkey in chicken luncheon ingredients. The results showed also that not only chicken luncheon was mixed with inedible parts of turkey but also all chicken products tested in this study (chicken balls, chicken burger, chicken sausage and chicken mined meat) contained this turkey meat. Applying methods used in this study could be useful for accurate and rapid identification of commercial processed meat.

  15. Dinoflagellate nuclear SSU rRNA phylogeny suggests multiple plastid losses and replacements.

    Science.gov (United States)

    Saldarriaga, J F; Taylor, F J; Keeling, P J; Cavalier-Smith, T

    2001-09-01

    Dinoflagellates are a trophically diverse group of protists with photosynthetic and non-photosynthetic members that appears to incorporate and lose endosymbionts relatively easily. To trace the gain and loss of plastids in dinoflagellates, we have sequenced the nuclear small subunit rRNA gene of 28 photosynthetic and four non-photosynthetic species, and produced phylogenetic trees with a total of 81 dinoflagellate sequences. Patterns of plastid gain, loss, and replacement were plotted onto this phylogeny. With the exception of the apparently early-diverging Syndiniales and Noctilucales, all non-photosynthetic dinoflagellates are very likely to have had photosynthetic ancestors with peridinin-containing plastids. The same is true for all dinoflagellates with plastids other than the peridinin-containing plastid: their ancestors have replaced one type of plastid for another, in some cases most likely through a non-photosynthetic intermediate. Eight independent instances of plastid loss and three of replacement can be inferred from existing data, but as more non-photosynthetic lineages are characterized these numbers will surely grow.

  16. Mitochondrial 16S rRNA sequence variations and phylogeny of the Chinese sisorid catfishes

    Institute of Scientific and Technical Information of China (English)

    GUO Xianguang; ZHANG Yaoguang; HE Shunping; CHEN Yiyu

    2004-01-01

    Partial sequences of mitochondrial 16S rRNA gene were obtained by PCR amplification for comparisons among nine species of glyptosternoid fishes and six species of non-glyptosternoids representing 10 sisorid genera. There are compositional biases in the A-rich unpaired regions and G-rich paired regions. A-G transitions are primarily responsible for the Ts/Tv bias in unpaired regions. The overall substitution rate in unpaired regions is almost two times higher than that in the paired regions. Saturation plots at comparable levels of sequence divergence demonstrate no saturation effects. Phylogenetic analyses using both maximum likelihood and Bayesian methods support the monophyly of Sisoridae. Chinese sisorid catfishes are composed of two major lineages, one represented by (Gagata (Bagarius, Glyptothorax)) and the other by "glyptosternoids + Pseudecheneis".The glyptosternoids may not be a monophyletic group. A previous hypothesis referring to Pseudecheneis as the sister group of monophyletic glyptosternoids, based on morphological evidence, is not supported by the molecular data.Pseudecheneis is shown to be a sister taxon of Glaridoglanis.Pareuchiloglanis might be paraphyletic with Pseudexostoma and Euchiloglanis. Our results also support the hypothesis that Pareuchiloglanis anteanalis might be considered as the synonyms of Pareuchiloglanis sinensis, and genus Euchiloglanis might have only one valid species, Euchiloglanis davidi.

  17. Pentamidine inhibits Coxiella burnetii growth and 23S rRNA intron splicing in vitro.

    Science.gov (United States)

    Minnick, Michael F; Hicks, Linda D; Battisti, James M; Raghavan, Rahul

    2010-10-01

    Coxiella burnetii is the bacterial agent of Q fever in humans. Acute Q fever generally manifests as a flu-like illness and is typically self-resolving. In contrast, chronic Q fever usually presents with endocarditis and is often life-threatening without appropriate antimicrobial therapy. Unfortunately, available options for the successful treatment of chronic Q fever are both limited and protracted (>18 months). Pentamidine, an RNA splice inhibitor used to treat fungal and protozoal infections, was shown to reduce intracellular growth of Coxiella by ca. 73% at a concentration of 1 microM (ca. 0.6 microg/mL) compared with untreated controls, with no detectable toxic effects on host cells. Bacterial targets of pentamidine include Cbu.L1917 and Cbu.L1951, two group I introns that disrupt the 23S rRNA gene of Coxiella, as demonstrated by the drug's ability to inhibit intron RNA splicing in vitro. Since both introns are highly conserved amongst all eight genotypes of the pathogen, pentamidine is predicted to be efficacious against numerous strains of C. burnetii. To our knowledge, this is the first report describing antibacterial activity for this antifungal/antiprotozoal agent.

  18. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  19. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    Science.gov (United States)

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association.

  20. Identification of sulfate reducers and Syntrophobacter sp. in anaerobic granular sludge by fatty-acid biomarkers and 16S rRNA probing

    NARCIS (Netherlands)

    Oude Elferink, S.J.W.H.; Boschker, H.T.S.; Stams, A.J.M.

    1998-01-01

    The sulfate-reducing bacterial sludge population in anaerobic bioreactors, treating different types of wastewater in the presence or absence of sulfate, was evaluated by polar-lipid fatty acid (PLFA) analyses, and by 16S rRNA dot-blot hybridizations using specific 16S rRNA- targeted oligonucleotide

  1. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    DEFF Research Database (Denmark)

    Sahm, K.; MacGregor, BJ; Jørgensen, BB

    1999-01-01

    between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...

  2. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus

    Science.gov (United States)

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  3. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...

  4. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  5. Identification of sulfate reducers and Syntrophobacter sp. in anaerobic granular sludge by fatty-acid biomarkers and 16S rRNA probing

    NARCIS (Netherlands)

    Oude Elferink, S.J.W.H.; Boschker, H.T.S.; Stams, A.J.M.

    1998-01-01

    The sulfate-reducing bacterial sludge population in anaerobic bioreactors, treating different types of wastewater in the presence or absence of sulfate, was evaluated by polar-lipid fatty acid (PLFA) analyses, and by 16S rRNA dot-blot hybridizations using specific 16S rRNA- targeted oligonucleotide

  6. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.

    2005-01-01

    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  7. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    2005-01-01

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  8. The evaluation of an identification algorithm for Mycobacterium species using the 16S rRNA coding gene and rpoB

    Directory of Open Access Journals (Sweden)

    Yuko Kazumi

    2012-01-01

    Conclusions: The 16S rRNA gene identification is a rapid and prevalent method but still has some limitations. Therefore, the stepwise combination of rpoB with 16S rRNA gene analysis is an effective system for the identification of Mycobacterium species.

  9. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    DEFF Research Database (Denmark)

    Møller, Annette K.; Søborg, Ditte A.; Abu Al-Soud, Waleed;

    2013-01-01

    The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...

  10. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    2005-01-01

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  11. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.

    2005-01-01

    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  12. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    Science.gov (United States)

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  13. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    DEFF Research Database (Denmark)

    Møller, Annette; Søborg, Ditte Andreasen; Al-Soud, Waleed Abu

    2013-01-01

    The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...

  14. Genotypic and symbiotic diversity of Rhizobium populations associated with cultivated lentil and pea in sub-humid and semi-arid regions of Eastern Algeria

    OpenAIRE

    Riah, N.; Béna, Gilles; Djekoun, A.; Heulin, K.; De Lajudie, Philippe; Laguerre, G.

    2014-01-01

    The genetic structure of rhizobia nodulating pea and lentil in Algeria, Northern Africa was determined. A total of 237 isolates were obtained from root nodules collected on lentil (Lens culinaris), proteaginous and forage pea (Pisum sativum) growing in two eco-climatic zones, sub-humid and semi-arid, in Eastern Algeria. They were characterised by PCR-restriction fragment length polymorphism (RFLP) of the 16S-23S rRNA intergenic region (IGS), and the nodD-F symbiotic region. The combination of...

  15. Diversity of 18S rRNA Gene of 19 Wild Herbage Germplasms%19种野生牧草种质资源18S rRNA 基因的多态性

    Institute of Scientific and Technical Information of China (English)

    武玉祥; 田兵; 王啸; 陈彬; 冉雪琴; 王嘉福

    2014-01-01

    为了开发牧草资源,对贵州部分野生草本植物种质资源的遗传多样性进行研究。根据模式植物拟南芥18S rRNA 基因序列设计特异性引物,对贵州大学农场试验田自然生长的19种野生草本植物的18S rRNA 基因序列进行扩增、测序、构建进化树。结果表明:将获得的1000 bp 左右的 DNA 片段测序进行同源比对,共找到2280个碱基变异位点,分布在8个区段。据各样本18S rRNA 基因的遗传距离构建进化树推测,菊科、苋科和藜科之间存在较近的遗传相似性,豆科中三叶草属与豌豆属之间有较近的遗传距离。%In order to explore forage resource,the genetic diversity of 18 S rRNA gene in 19 kinds of wild herb germplasms were investigated,which were collected from the farm of Guizhou Unversity.The results showed that about 1000 bp fragments of 18 S rRNA genes were amplificated using specific primers based on the gene of Arabidopsis thaliana.After sequencing and homologous comparison,a total of 2 280 nucleotides were found out to be polymorphim sites.Phylogenetic tree of each family were constructed by similarity of 18S rRNA gene.The molecular classification of 19 kinds of wild herbs was consistent with its category based on morphological characteristics.Furthermore,the molecular classification could be useful to distinguish those similar species in morphology, and the genetic data suggested a close genetic relationship in three families,Compositae,Amaranthaceae and Chenopodiaceae.Trifolium and Pisum might share a high genetic similarty with each other.

  16. Interne evalueringer

    DEFF Research Database (Denmark)

    Hansson, Finn

    Det er en gennemgående tese i denne undersøgelse af interne evalueringer, at en af de vigtigste kendetegn ved den New Public Management -dominerede udvikling af den offentlige sektors reguleringspolitik, som Danmark såvel som en række andre OECD lande har gennemlevet, er en omfattende brug af alle...

  17. Transparency International

    NARCIS (Netherlands)

    Hulten, van M. (Michel)

    2009-01-01

    Established in 1993, Transparency International (TI) defines itself as “the global civil society organization leading the fight against corruption, that brings people together in a powerful worldwide coalition to end the devastating impact of corruption on men, women and children around the wo

  18. International Business

    NARCIS (Netherlands)

    Anne van Delft

    2011-01-01

    Internationalisation is the expansion of a firms operations to foreign markets and includes not only import and export but also foreign direct investments and international cooperation. Today’s globalising economy has resulted in a growing number of small and medium enterprises (SMEs) undertaking

  19. International Entomology

    Science.gov (United States)

    Pests and diseases of plants in agriculture are a shared international problem. Yet some of the very places that pest invaders come from often lack the institutional structure and organization necessary to help in understanding the biology of the pest or disease. Strengthening entomology by stimulat...

  20. International Reports.

    Science.gov (United States)

    Tabb, Winston; Bender, David R.; Haycock, Ken; Horodyski, John

    2001-01-01

    Includes three annual reports: one from the International Federation of Library Associations and Institutions, the Special Libraries Association, and a report on innovations in Canadian libraries that discusses electronic initiatives, partnerships, books and publishing, school libraries, national issues, local challenges, and funding. (LRW)

  1. Ascott International

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    "Heart-to-Heart" Charity Event for Hearing-Impaired Children in Beijing On June 12, Ascott International North China held a "heart-to-heart" charity event for hearing-impaired children in the Heritage Room at the Ascott Beijing.

  2. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes.

    Science.gov (United States)

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima

    2015-01-01

    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa.

  3. Identification and characterization of non-tuberculous mycobacteria isolated from tuberculosis suspects in Southern-central China.

    Science.gov (United States)

    Yu, Xiao-li; Lu, Lian; Chen, Gao-zhan; Liu, Zhi-Guo; Lei, Hang; Song, Yan-zheng; Zhang, Shu-lin

    2014-01-01

    The incidence of non-tuberculous mycobacteria (NTM)-related death has increased globally recently. To obtain information of the species and characterization of pathogens involved in NTM pulmonary infection in Southern-central China, we identified 160 non-tuberculous infection cases from 3995 acid-fast bacilli (AFB)-positive tuberculous suspects. We then randomly selected 101 non-tuberculous patients, isolated bacteria from their sputa and genotyped the pathogens using the 16S rRNA gene and 16S-23S rRNA internal transcribed spacer sequences. M. intracellulare (32.67%, 33/101), M. abscessus (32.67%, 33/101) and M. fortuitum (7.92%, 8/101) are identified in these isolates. Surprisingly, non-mycobacteria including Gordonia (8.91%, 9/101), Nocardia (5.94%, 6/101) and Tsukamurella (0.99%, 1/101) are also discovered, and the case of Tsukamurella pulmonis infection is first discovered in Southern-central China. Moreover, species of M. mucogenicum group, M. chubuense, M. kansasii, M. gastri, M. avium, M. porcinum and M. smegmatis are identified. In addition, nine immune compromised cases (8.91%, 9/101), including type two diabetes mellitus and HIV/AIDS are found to be infected with non-tuberculous bacteria. This study revealed the distribution and characteristics of non-tuberculous AFB pathogen infection occurred in Southern-central China, and suggested that physicians should be alert of the emerging of NTM and non-mycobacteria infection in AFB positive cases and take caution when choosing chemotherapy for tuberculosis-like pulmonary infections. Generally, this study may help with the development of new strategy for the diagnosis and treatment of mycobacterial infection.

  4. Identification and characterization of non-tuberculous mycobacteria isolated from tuberculosis suspects in Southern-central China.

    Directory of Open Access Journals (Sweden)

    Xiao-li Yu

    Full Text Available The incidence of non-tuberculous mycobacteria (NTM-related death has increased globally recently. To obtain information of the species and characterization of pathogens involved in NTM pulmonary infection in Southern-central China, we identified 160 non-tuberculous infection cases from 3995 acid-fast bacilli (AFB-positive tuberculous suspects. We then randomly selected 101 non-tuberculous patients, isolated bacteria from their sputa and genotyped the pathogens using the 16S rRNA gene and 16S-23S rRNA internal transcribed spacer sequences. M. intracellulare (32.67%, 33/101, M. abscessus (32.67%, 33/101 and M. fortuitum (7.92%, 8/101 are identified in these isolates. Surprisingly, non-mycobacteria including Gordonia (8.91%, 9/101, Nocardia (5.94%, 6/101 and Tsukamurella (0.99%, 1/101 are also discovered, and the case of Tsukamurella pulmonis infection is first discovered in Southern-central China. Moreover, species of M. mucogenicum group, M. chubuense, M. kansasii, M. gastri, M. avium, M. porcinum and M. smegmatis are identified. In addition, nine immune compromised cases (8.91%, 9/101, including type two diabetes mellitus and HIV/AIDS are found to be infected with non-tuberculous bacteria. This study revealed the distribution and characteristics of non-tuberculous AFB pathogen infection occurred in Southern-central China, and suggested that physicians should be alert of the emerging of NTM and non-mycobacteria infection in AFB positive cases and take caution when choosing chemotherapy for tuberculosis-like pulmonary infections. Generally, this study may help with the development of new strategy for the diagnosis and treatment of mycobacterial infection.

  5. Mycobacterium colombiense sp. nov., a novel member of the Mycobacterium avium complex and description of MAC-X as a new ITS genetic variant.

    Science.gov (United States)

    Murcia, Martha I; Tortoli, Enrico; Menendez, M Carmen; Palenque, Elia; Garcia, Maria J

    2006-09-01

    Forty-five mycobacterial strains isolated from 23 Colombian HIV-positive patients were identified as members of the Mycobacterium avium complex (MAC) and were characterized using different molecular approaches. Seven of the isolates showed characteristic features that allowed them to be differentiated from other members of the complex. The isolates had a novel 16S-23S rRNA internal transcribed spacer (ITS 1) gene sequence which is described as a new sequevar, MAC-X. All of the seven novel isolates gave a positive result with the MAC-specific AccuProbe (Gen-Probe), but tested negative for Mycobacterium avium and Mycobacterium intracellulare species-specific probes (64 and 100 % of the isolates, respectively). The novel isolates could be differentiated phenotypically from other members of the MAC on the basis of the production of urease and by a consistent mycolic acid pattern. The novel isolates shared some characteristics with M. avium, such as the avium variant I (av-I) pattern of the hsp65 gene as determined by PCR restriction analysis and a positive PCR result for the mig (macrophage-induced) gene. However, the novel isolates showed a unique 16S rRNA gene sequence. DNA-DNA relatedness values, from 24 to 44 %, confirmed the distinction of the novel isolates from other members of the MAC at the genetic level and their status as members of a separate species. The novel isolates are proposed as representatives of a novel species, Mycobacterium colombiense sp. nov., that is closely related to M. avium within the MAC. The type strain is 10B(T) (=CIP 108962(T)=CECT 3035(T)).

  6. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and high-resolution melt real-time PCR as diagnostic methods.

    Science.gov (United States)

    Gutiérrez, Ricardo; Morick, Danny; Gross, Ifat; Winkler, Ronen; Abdeen, Ziad; Harrus, Shimon

    2013-12-01

    To determine the occurrence of feline bartonellosis in Israel, blood samples were collected from 179 stray and 155 domestic cats from 18 cities or villages in central and northcentral Israel. Samples were screened for Bartonella infection by culture isolation and molecular detection using high-resolution melt (HRM) real-time PCR assay targeting the 16S-23S rRNA internal transcribed spacer (ITS). All positive samples were confirmed by two additional HRM real-time PCR assays targeting two fragments of the β-subunit of RNA polymerase (rpoB) and the 16S rRNA genes. The prevalence of Bartonella spp. infection in the general tested population was 25.1% (84/334). A higher prevalence was detected in the stray (30.7%; 55/179) than the domestic cats (18.7%; 29/155). Bartonella henselae, Bartonella clarridgeiae, and Bartonella koehlerae were highly prevalent in both cat populations, however their distribution among the two populations varied significantly (p=0.016). B. clarridgeiae and B. koehlerae were found to be more prevalent in stray than domestic cats, whereas B. henselae was evenly distributed. Co-infection with two or more different Bartonella spp. was determined in 2.1% (7) of the cats. The ITS HRM real-time PCR assay used in this study was shown to have a greater screening power than bacterial isolation, detecting 94.0% (79/84) compared to 35.7% (30/84), respectively, of all positive samples. The high prevalence of these zoonotic Bartonella species, coupled with the overpopulation of stray cats, and increased numbers of domestic cats in the major urban centers in Israel represent a significant threat for the public health in this country.

  7. Nearly complete rRNA genes from 371 Animalia: updated structure-based alignment and detailed phylogenetic analysis.

    Science.gov (United States)

    Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

    2012-09-01

    This study presents a manually constructed alignment of nearly complete rRNA genes from most animal clades (371 taxa from ~33 of the ~36 metazoan phyla), expanded from the 197 sequences in a previous study. This thorough, taxon-rich alignment, available at http://www.wsu.edu/~jmallatt/research/rRNAalignment.html and in the Dryad Repository (doi: http://dx.doi.org/10.5061/dryad.1v62kr3q), is based rigidly on the secondary structure of the SSU and LSU rRNA molecules, and is annotated in detail, including labeling of the erroneous sequences (contaminants). The alignment can be used for future studies of the molecular evolution of rRNA. Here, we use it to explore if the larger number of sequences produces an improved phylogenetic tree of animal relationships. Disappointingly, the resolution did not improve, neither when the standard maximum-likelihood method was used, nor with more sophisticated methods that partitioned the rRNA into paired and unpaired sites (stem, loop, bulge, junction), or accounted for the evolution of the paired sites. For example, no doublet model of paired-site substitutions (16-state, 16A and 16B, 7A-F, or 6A-C models) corrected the placement of any rogue taxa or increased resolution. The following findings are from the simplest, standard, ML analysis. The 371-taxon tree only imperfectly supported the bilaterian clades of Lophotrochozoa and Ecdysozoa, and this problem remained after 17 taxa with unstably positioned sequences were omitted from the analysis. The problem seems to stem from base-compositional heterogeneity across taxa and from an overrepresentation of highly divergent sequences among the newly added taxa (e.g., sequences from Cephalopoda, Rotifera, Acoela, and Myxozoa). The rogue taxa continue to concentrate in two locations in the rRNA tree: near the base of Arthropoda and of Bilateria. The approximately uncertain (AU) test refuted the monophyly of Mollusca and of Chordata, probably due to long-branch attraction of the highly

  8. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  9. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    Science.gov (United States)

    Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing 99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N. vectensis holobiont defined by both internal and external gradients of chemicals and

  10. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Directory of Open Access Journals (Sweden)

    Shenkar Noa

    2009-08-01

    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  11. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    OpenAIRE

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria gr...

  12. Phylogeny and classification of the Litostomatea (Protista, Ciliophora), with emphasis on free-living taxa and the 18S rRNA gene.

    Science.gov (United States)

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

    2011-05-01

    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of species ranging from aerobic, free-living predators to anaerobic endocommensals. This is traditionally reflected by classifying the Litostomatea into the subclasses Haptoria and Trichostomatia. The morphological classifications of the Haptoria conflict with the molecular phylogenies, which indicate polyphyly and numerous homoplasies. Thus, we analyzed the genealogy of 53 in-group species with morphological and molecular methods, including 12 new sequences from free-living taxa. The phylogenetic analyses and some strong morphological traits show: (i) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea and (ii) three distinct lineages (subclasses): the Rhynchostomatia comprising Tracheliida and Dileptida; the Haptoria comprising Lacrymariida, Haptorida, Didiniida, Pleurostomatida and Spathidiida; and the Trichostomatia. The curious Homalozoon cannot be assigned to any of the haptorian orders, but is basal to a clade containing the Didiniida and Pleurostomatida. The internal relationships of the Spathidiida remain obscure because many of them and some "traditional" haptorids form separate branches within the basal polytomy of the order, indicating one or several radiations and convergent evolution. Due to the high divergence in the 18S rRNA gene, the chaeneids and cyclotrichiids are classified incertae sedis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Genetic diversity of Helicobacter pylori indexed with respect to clinical symptomatology, using a 16S rRNA and a species-specific DNA probe.

    Science.gov (United States)

    Desai, M; Linton, D; Owen, R J; Cameron, H; Stanley, J

    1993-12-01

    DNA probes are described which identify group and fingerprint strains of the human gastric pathogen Helicobacter pylori, on the basis of well-defined band homologies. A 544 bp internal fragment of the 16S ribosomal RNA gene was generated by polymerase chain reaction (PCR) with primers derived from the Escherichia coli rRNA gene sequence. In genomic Southern blots this probe detected restriction site variation around these loci, generating simple but strain-specific molecular fingerprints. A small conserved chromosomal fragment of 1.2 kbp, Hps, species-specific for H. pylori, was obtained by cloning random HindIII fragments into pUC19. It was useful for dot-blot identification, and also separated isolates into one major and two minor groups. When results for these two probes were combined, a baseline characterization of genotype was obtained. A band-matching database of molecular fingerprints for the type strain and 63 clinical isolates of H. pylori from asymptomatic, ulcer and gastritis contexts is presented. No significant association between the genotypes at this level of definition and the associated clinical symptomatology of the isolates was detected.

  14. Liver International

    OpenAIRE

    Quarantini, Lucas de Castro [UNIFESP; Rodrigo A Bressan; Galvão, Amanda; Neves, Susana Batista; Raymundo PARANÁ

    2007-01-01

    p. 1098-1102 Objective: Evaluate the incidence of mental disorders using pegylated interferon plus ribavirin retreatment in nonresponder hepatitis C virus-infected patients. Method: The Mini-International Neuropsychiatric Interview (MINI) was used to evaluate 30 hepatitis C virus-infected interferon-nonresponder patients at baseline and following 4, 12 and 24 weeks of pegylated interferon retreatment. Results: During the pegylated interferon/ribavirin retreatment, 5(16.6%) patient...

  15. Teaching International Law: Concepts in International Relations

    Science.gov (United States)

    Starbird, Caroline; Pettit, Jenny; Singleton, Laurel

    2004-01-01

    This book is designed to introduce students to public international law. Topics covered include international public organizations, such as the United Nations and World Trade Organization, international courts, international human rights law, international trade law, and international environmental law. The goal of each study is to examine how…

  16. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota

    Science.gov (United States)

    Ellegaard, Kirsten M.; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities. PMID:27708630

  17. [Internal migration].

    Science.gov (United States)

    Borisovna, L

    1991-06-01

    Very few studies have been conducted that truly permit explanation of internal migration and it repercussions on social and economic structure. It is clear however that a profound knowledge of the determinants and consequences of internal migration will be required as a basis for economic policy decisions that advance the goal of improving the level of living of the population. the basic supposition of most studies of the relationship of population and development is that socioeconomic development conditions demographic dynamics. The process of development in Mexico, which can be characterized by great heterogeneity, consequently produces great regional disparities. At the national level various studies have estimated the volume of internal migration in Mexico, but they have usually been limited to interstate migration because the main source of data, the census, is classified by states. But given the great heterogeneity within states in all the elements related to internal migration, it is clear that studies of internal migration within states are also needed. Such studies are almost nonexistent because of their technical difficulty. National level studies show that interstate migration increased significantly between 1940-80. The proportion of Mexicans living outside their states of birth increased by 558% in those years, compared to the 342% increase in the total Mexican population. Although Puebla has a high rate of increase, migration has kept it below Mexico's national growth rate. Migration between Puebla and other states and within Puebla has led to an increasing unevenness of spatial distribution. Between 1970-80, 57 of Puebla's municipios had growth rates above the state average of 2.8%/year, 6 had growth rates equal to the average, and 129 had growth rates that were below the average but not negative. 25 states with negative growth rates that were considered strongly expulsive. In 1980, 51.7% of the population was concentrated in the 57 municipios

  18. Distribution of DNA and localization of rRNA transcription in G2 phase nucleolus of Physarum polycephalum

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Using electron microscopy, NAMA-Ur DNA selective staining and BrUTP incorporation, the nucleo lus ultrastructure, the distribution of DNA and the rRNA transcription sites in nucleolus of G2 phase Physarum poly cephalum were studied. The nucleolus was found to be different in structure from that of other plant cells. Fibrillar cen tern (FCs) were present in a large amount all over the nucleolus. DNA was distributed both in dense fibrillar components (DFC) and in FC. The DNA in the nucleolus was less condensed than that of the chromosome territory. These changes suggested that the transcription was active within the nucleolus. BrUTP incorporation localized the rRNA transcription in DFC and at the interface of FC and DFC, suggesting that the DNA in FC is in a storage form and only the rDNA in DFC is transcribed.

  19. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants.

  20. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    Science.gov (United States)

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis.

  1. Analysis of rRNA Gene Methylation in Arabidopsis thaliana by CHEF-Conventional 2D Gel Electrophoresis.

    Science.gov (United States)

    Mohannath, Gireesha; Pikaard, Craig S

    2016-01-01

    Contour-clamped homogenous electric field (CHEF) gel electrophoresis, a variant of Pulsed-field gel electrophoresis (PFGE), is a powerful technique for resolving large fragments of DNA (10 kb-9 Mb). CHEF has many applications including the physical mapping of chromosomes, artificial chromosomes, and sub-chromosomal DNA fragments, etc. Here, we describe the use of CHEF and two-dimensional gel electrophoresis to analyze rRNA gene methylation patterns within the two ~4 million base pair nucleolus organizer regions (NORs) of Arabidopsis thaliana. The method involves CHEF gel electrophoresis of agarose-embedded DNA following restriction endonuclease digestion to cut the NORs into large but resolvable segments, followed by digestion with methylation-sensitive restriction endonucleases and conventional (or CHEF) gel electrophoresis, in a second dimension. Resulting products are then detected by Southern blotting or PCR analyses capable of discriminating rRNA gene subtypes.

  2. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    Institute of Scientific and Technical Information of China (English)

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai

    2004-01-01

    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  3. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.; Ward, D.M. (Montana State Univ., Bozeman (United States)); Weller, J.W. (Univ. of Montana, Missoula (United States))

    1991-04-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  4. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    Science.gov (United States)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  5. Comparative analysis of mt LSU rRNA secondary structures of Odonates: structural variability and phylogenetic signal.

    Science.gov (United States)

    Misof, B; Fleck, G

    2003-12-01

    Secondary structures of the most conserved part of the mt 16S rRNA gene, domains IV and V, have been recently analysed in a comparative study. However, full secondary structures of the mt LSU rRNA molecule are published for only a few insect species. The present study presents full secondary structures of domains I, II, IV and V of Odonates and one representative of mayflies, Ephemera sp. The reconstructions are based on a comparative approach and minimal consensus structures derived from sequence alignments. The inferred structures exhibit remarkable similarities to the published Drosophila melanogaster model, which increases confidence in these structures. Structural variance within Odonates is homoplastic, and neighbour-joining trees based on tree edit distances do not correspond to any of the phylogenetically expected patterns. However, despite homoplastic quantitative structural variation, many similarities between Odonates and Ephemera sp. suggest promising character sets for higher order insect systematics that merit further investigations.

  6. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  7. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

    2004-01-01

      FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute...... for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  8. The ribosomal genes of Mycoplasma capricolum.

    Science.gov (United States)

    Muto, A; Hori, H; Sawada, M; Kawauchi, Y; Iwami, M; Yamao, F; Osawa, S

    1983-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the gene arrangement is in the order of 16S, 23S, and 5S rDNA. The ribosomes of M. capricolum contain about 30 species of proteins in 50S and 20 in 30S subunits. The number and size of the ribosomal proteins are not significantly different from those of other eubacterial ribosomes.

  9. Bioinformatics and molecular dynamics simulation study of L1 stalk non-canonical rRNA elements: kink-turns, loops, and tetraloops.

    Science.gov (United States)

    Krepl, Miroslav; Réblová, Kamila; Koča, Jaroslav; Sponer, Jiří

    2013-05-09

    The L1 stalk is a prominent mobile element of the large ribosomal subunit. We explore the structure and dynamics of its non-canonical rRNA elements, which include two kink-turns, an internal loop, and a tetraloop. We use bioinformatics to identify the L1 stalk RNA conservation patterns and carry out over 11.5 μs of MD simulations for a set of systems ranging from isolated RNA building blocks up to complexes of L1 stalk rRNA with the L1 protein and tRNA fragment. We show that the L1 stalk tetraloop has an unusual GNNA or UNNG conservation pattern deviating from major GNRA and YNMG RNA tetraloop families. We suggest that this deviation is related to a highly conserved tertiary contact within the L1 stalk. The available X-ray structures contain only UCCG tetraloops which in addition differ in orientation (anti vs syn) of the guanine. Our analysis suggests that the anti orientation might be a mis-refinement, although even the anti interaction would be compatible with the sequence pattern and observed tertiary interaction. Alternatively, the anti conformation may be a real substate whose population could be pH-dependent, since the guanine syn orientation requires protonation of cytosine in the tertiary contact. In absence of structural data, we use molecular modeling to explore the GCCA tetraloop that is dominant in bacteria and suggest that the GCCA tetraloop is structurally similar to the YNMG tetraloop. Kink-turn Kt-77 is unusual due to its 11-nucleotide bulge. The simulations indicate that the long bulge is a stalk-specific eight-nucleotide insertion into consensual kink-turn only subtly modifying its structural dynamics. We discuss a possible evolutionary role of helix H78 and a mechanism of L1 stalk interaction with tRNA. We also assess the simulation methodology. The simulations provide a good description of the studied systems with the latest bsc0χOL3 force field showing improved performance. Still, even bsc0χOL3 is unable to fully stabilize an essential

  10. rRNA and Poly-β-Hydroxybutyrate Dynamics in Bioreactors Subjected to Feast and Famine Cycles

    Science.gov (United States)

    Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

    2006-01-01

    Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-β-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

  11. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  12. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing

    OpenAIRE

    Jarvis, Karen G.; White, James R; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B.; Brown, Eric; Hanes, Darcy E.

    2015-01-01

    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  13. Detection and quantification of Dehalogenimonas and "Dehalococcoides" populations via PCR-based protocols targeting 16S rRNA genes.

    Science.gov (United States)

    Yan, Jun; Rash, Brian A; Rainey, Fred A; Moe, William M

    2009-12-01

    Members of the haloalkane dechlorinating genus Dehalogenimonas are distantly related to "Dehalococcoides" but share high homology in some variable regions of their 16S rRNA gene sequences. In this study, primers and PCR protocols intended to uniquely target Dehalococcoides were reevaluated, and primers and PCR protocols intended to uniquely target Dehalogenimonas were developed and tested. Use of the genus-specific primers revealed the presence of both bacterial groups in groundwater at a Louisiana Superfund site.

  14. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    Science.gov (United States)

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones.

  15. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    Science.gov (United States)

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification.

  16. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Science.gov (United States)

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

    2011-04-28

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  17. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.

    Science.gov (United States)

    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun

    2011-02-01

    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  18. Deep sequencing of 16S rRNA gene to efficiently assess bacterial richness and the rare biosphere in soils

    OpenAIRE

    Terrat, Sébastien; Dequiedt, Samuel; Bachar, Dipankar; Christen, Richard; Mougel, Christophe; Lelievre, Mélanie; Maron, Pierre-Alain; Plassart, Pierre; Wincker, Patrick; Cruaud, C; Jolivet, Claudy; Arrouays, Dominique; Bispo, Antonio; Lemanceau, Philippe; Ranjard, Lionel

    2012-01-01

    Soil is one of the most important reservoirs of microbiological diversity on our planet and, above all, one of the last bastions of such biodiversity. Since two decades, numerous molecular tools have been developed to assess accurately this huge diversity directly from soil DNA. In this context, 16S rRNA gene is widely used to study microbial community taxonomic diversity, as it can be easily amplified by PCR, and large databases are available relating obtained sequences to bacteria...

  19. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    Science.gov (United States)

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  20. 16s rRNA Identification of Pediococcus spp. from Broiler and Studies of Adherence Ability on Immobilized Mucus

    OpenAIRE

    Ema Damayanti; Lies Mira Yusiati; Achmad Dinoto

    2015-01-01

    The objectives of this research were to study taxonomical status of lactic acid bacteria (LAB) isolated from broiler and adherence ability on mucus in vitro. Molecular analysis was performed by analyzing 16S rRNA gene using universal primer. The adherence assay on mucus was carried out using microplate method with total plate count (TPC), absorbance (A550) and confirmed by scanning electron microscopy (SEM). The results of this studies revealed that three of LAB isolates have closed relation ...

  1. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    Science.gov (United States)

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał

    2014-08-01

    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity.

  2. Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.

    OpenAIRE

    de los Reyes, F L; Ritter, W; Raskin, L.

    1997-01-01

    Foaming in activated sludge systems is characterized by the formation of a thick, chocolate brown-colored scum that floats on the surface of aeration basins and secondary clarifiers. These viscous foams have been associated with the presence of filamentous mycolic acid-containing actinomycetes. To aid in evaluating the microbial representation in foam, we developed and characterized group-, genus-, and species-specific oligonucleotide probes targeting the small subunit rRNA of the Mycobacteri...

  3. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  4. Identification of bacteria directly from positive blood culture samples by DNA pyrosequencing of the 16S rRNA gene

    OpenAIRE

    2012-01-01

    Rapid identification of the causative bacteria of sepsis in patients can contribute to the selection of appropriate antibiotics and improvement of patients' prognosis. Genotypic identification is an emerging technology that may provide an alternative method to, or complement, established phenotypic identification procedures. We evaluated a rapid protocol for bacterial identification based on PCR and pyrosequencing of the V1 and V3 regions of the 16S rRNA gene using DNA extracted directly from...

  5. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  6. Diversity of Archaea in Icelandic hot springs based on 16S rRNA and chaperonin genes.

    Science.gov (United States)

    Mirete, Salvador; de Figueras, Carolina G; González-Pastor, Jose E

    2011-07-01

    The diversity of archaeal communities growing in four hot springs (65-90 °C, pH 6.5) was assessed with 16S rRNA gene primers specific for the domain Archaea. Overall, mainly uncultured members of the Desulfurococcales, the Thermoproteales and the Korarchaeota, were identified. Based on this diversity, a set of chaperonin heat-shock protein (Hsp60) gene sequences from different archaeal species were aligned to design two degenerate primer sets for the amplification of the chaperonin gene: Ths and Kor (which can also detect the korarchaeotal chaperonin gene from one of the samples). A phylogenetic tree was constructed using the chaperonin sequences retrieved and other sequences from cultured representatives. The Alpha and Beta paralogs of the chaperonin gene were observed within the main clades and orthologs among them. Cultivated representatives from these clades were assigned to either paralog in the chaperonin tree. Uncultured representatives observed in the 16S rRNA gene analysis were found to be related to the Desulfurococcales. The topologies of the 16S rRNA gene and chaperonin phylogenetic trees were compared, and similar phylogenetic relationships were observed. Our results suggest that the chaperonin Hsp60 gene may be used as a phylogenetic marker for the clades found in this extreme environment.

  7. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  8. A conserved alternative splicing event in plants reveals an ancient exonization of 5S rRNA that regulates TFIIIA.

    Science.gov (United States)

    Barbazuk, W Brad

    2010-01-01

    Uncovering conserved alternative splicing (AS) events can identify AS events that perform important functions. This is especially useful for identifying premature stop codon containing (PTC) AS isoforms that may regulate protein expression by being targets for nonsense mediated decay. This report discusses the identification of a PTC containing splice isoform of the TFIIIA gene that is highly conserved in land plants. TFIIIA is essential for RNA Polymerase III-based transcription of 5S rRNA in eukaryotes. Two independent groups have determined that the PTC containing alternative exon is ultraconserved and is coupled with nonsense-mediated mRNA decay. The alternative exon appears to have been derived by the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA. This provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized non-coding element.

  9. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Directory of Open Access Journals (Sweden)

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  10. Direct regulation of tRNA and 5S rRNA gene transcription by Polo-like kinase 1.

    Science.gov (United States)

    Fairley, Jennifer A; Mitchell, Louise E; Berg, Tracy; Kenneth, Niall S; von Schubert, Conrad; Silljé, Herman H W; Medema, René H; Nigg, Erich A; White, Robert J

    2012-02-24

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase III (pol III) through direct binding and phosphorylation of transcription factor Brf1. During interphase, Plk1 promotes tRNA and 5S rRNA expression by phosphorylating Brf1 directly on serine 450. However, this stimulatory modification is overridden at mitosis, when elevated Plk1 activity causes Brf1 phosphorylation on threonine 270 (T270), which prevents pol III recruitment. Thus, although Plk1 enhances net tRNA and 5S rRNA production, consistent with its proliferation-stimulating function, it also suppresses untimely transcription when cells divide. Genomic instability is apparent in cells with Brf1 T270 mutated to alanine to resist Plk1-directed inactivation, suggesting that chromosome segregation is vulnerable to inappropriate pol III activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    Science.gov (United States)

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  12. Clinical Fusobacterium mortiferum Isolates Cluster with Undifferentiated Clostridium rectum Species Based on 16S rRNA Gene Phylogenetic Analysis.

    Science.gov (United States)

    Lee, Yangsoon; Eun, Chang Soo; Han, Dong Soo

    2016-05-01

    The most commonly encountered clinical Fusobacterium species are F. nucleatum and F. necrophorum; other Fusobacteria, such as F. mortiferum and F. varium, have occasionally been isolated from human specimens. Clostridium rectum is a gram-positive species characterized as a straight bacillus with oval sub-terminal spores. The close 16S rRNA gene sequence relationship of C. rectum with the genus Fusobacterium is unexpected given their very different phenotypic characteristics. Between 2014 and 2015, a total of 19 Fusobacterium isolates were recovered from the colonic tissue of 10 patients at a university hospital. All isolates were identified based on 16S rRNA gene sequencing. The phylogenetic relationship among these isolates was estimated using the neighbor-joining method and the Molecular Evolutionary Genetic Analysis (MEGA) version 6. Based on phylogenetic analysis, the F. mortiferum isolates clustered into two groups - F. mortiferum DSM 19809 (group I) and F. mortiferum ATCC 25557 (group II) - even though they are of the same species. Furthermore, the F. mortiferum DSM 19809 (group I) showed a close phylogenetic relationship with C. rectum, even though C. rectum is classified as a gram-positive spore-producing bacillus. C. rectum is clearly unrelated to the genus Clostridium as it shows highest 16S rRNA gene sequence similarity with species from the genus Fusobacterium Therefore, additional methods such as Gram staining and other biochemical methods should be performed for Fusobacterium identification.

  13. Direct evidence for redundant segmental replacement between multiple 18S rRNA genes in a single Prototheca strain.

    Science.gov (United States)

    Ueno, Ryohei; Huss, Volker A R; Urano, Naoto; Watabe, Shugo

    2007-11-01

    Informational genes such as those encoding rRNAs are related to transcription and translation, and are thus considered to be rarely subject to lateral gene transfer (LGT) between different organisms, compared to operational genes having metabolic functions. However, several lines of evidence have suggested or confirmed the occurrence of LGT of DNA segments encoding evolutionarily variable regions of rRNA genes between different organisms. In the present paper, we show, for the first time to our knowledge, that variable regions of the 18S rRNA gene are segmentally replaced by multiple copies of different sequences in a single strain of the green microalga Prototheca wickerhamii, resulting in at least 17 genotypes, nine of which were actually transcribed. Recombination between different 18S rRNA genes occurred in seven out of eight variable regions (V1-V5 and V7-V9) of eukaryotic small subunit (SSU) rRNAs. While no recombination was observed in V1, one to three different recombination loci were demonstrated for the other regions. Such segmental replacement was also implicated for helix H37, which is defined as V6 of prokaryotic SSU rRNAs. Our observations provide direct evidence for redundant recombination of an informational gene, which encodes a component of mature ribosomes, in a single strain of one organism.

  14. IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

    Science.gov (United States)

    Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

    2016-09-23

    The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

  15. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  16. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    Institute of Scientific and Technical Information of China (English)

    ZHANG Junbin; LIU Xin

    2006-01-01

    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  17. A comparison of rpoB and 16S rRNA as markers in pyrosequencing studies of bacterial diversity.

    Directory of Open Access Journals (Sweden)

    Michiel Vos

    Full Text Available BACKGROUND: The 16S rRNA gene is the gold standard in molecular surveys of bacterial and archaeal diversity, but it has the disadvantages that it is often multiple-copy, has little resolution below the species level and cannot be readily interpreted in an evolutionary framework. We compared the 16S rRNA marker with the single-copy, protein-coding rpoB marker by amplifying and sequencing both from a single soil sample. Because the higher genetic resolution of the rpoB gene prohibits its use as a universal marker, we employed consensus-degenerate primers targeting the Proteobacteria. METHODOLOGY/PRINCIPAL FINDINGS: Pyrosequencing can be problematic because of the poor resolution of homopolymer runs. As these erroneous runs disrupt the reading frame of protein-coding sequences, removal of sequences containing nonsense mutations was found to be a valuable filter in addition to flowgram-based denoising. Although both markers gave similar estimates of total diversity, the rpoB marker revealed more species, requiring an order of magnitude fewer reads to obtain 90% of the true diversity. The application of population genetic methods was demonstrated on a particularly abundant sequence cluster. CONCLUSIONS/SIGNIFICANCE: The rpoB marker can be a complement to the 16S rRNA marker for high throughput microbial diversity studies focusing on specific taxonomic groups. Additional error filtering is possible and tests for recombination or selection can be employed.

  18. Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Harsi Dewantari Kusumaningrum

    2016-08-01

    Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

  19. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras.

    Science.gov (United States)

    Ashelford, Kevin E; Chuzhanova, Nadia A; Fry, John C; Jones, Antonia J; Weightman, Andrew J

    2006-09-01

    A new computer program, called Mallard, is presented for screening entire 16S rRNA gene libraries of up to 1,000 sequences for chimeras and other artifacts. Written in the Java computer language and capable of running on all major operating systems, the program provides a novel graphical approach for visualizing phylogenetic relationships among 16S rRNA gene sequences. To illustrate its use, we analyzed most of the large libraries of cloned bacterial 16S rRNA gene sequences submitted to the public repository during 2005. Defining a large library as one containing 100 or more sequences of 1,200 bases or greater, we screened 25 of the 28 libraries and found that all but three contained substantial anomalies. Overall, 543 anomalous sequences were found. The average anomaly content per clone library was 9.0%, 4% higher than that previously estimated for the public repository overall. In addition, 90.8% of anomalies had characteristic chimeric patterns, a rise of 25.4% over that found previously. One library alone was found to contain 54 chimeras, representing 45.8% of its content. These figures far exceed previous estimates of artifacts within public repositories and further highlight the urgent need for all researchers to adequately screen their libraries prior to submission. Mallard is freely available from our website at http://www.cardiff.ac.uk/biosi/research/biosoft/.

  20. RAP, the Sole Octotricopeptide Repeat Protein in Arabidopsis, Is Required for Chloroplast 16S rRNA Maturation[W

    Science.gov (United States)

    Kleinknecht, Laura; Wang, Fei; Stübe, Roland; Philippar, Katrin; Nickelsen, Jörg; Bohne, Alexandra-Viola

    2014-01-01

    The biogenesis and activity of chloroplasts in both vascular plants and algae depends on an intracellular network of nucleus-encoded, trans-acting factors that control almost all aspects of organellar gene expression. Most of these regulatory factors belong to the helical repeat protein superfamily, which includes tetratricopeptide repeat, pentatricopeptide repeat, and the recently identified octotricopeptide repeat (OPR) proteins. Whereas green algae express many different OPR proteins, only a single orthologous OPR protein is encoded in the genomes of most land plants. Here, we report the characterization of the only OPR protein in Arabidopsis thaliana, RAP, which has previously been implicated in plant pathogen defense. Loss of RAP led to a severe defect in processing of chloroplast 16S rRNA resulting in impaired chloroplast translation and photosynthesis. In vitro RNA binding and RNase protection assays revealed that RAP has an intrinsic and specific RNA binding capacity, and the RAP binding site was mapped to the 5′ region of the 16S rRNA precursor. Nucleoid localization of RAP was shown by transient green fluorescent protein import assays, implicating the nucleoid as the site of chloroplast rRNA processing. Taken together, our data indicate that the single OPR protein in Arabidopsis is important for a basic process of chloroplast biogenesis. PMID:24585838

  1. RAP, the sole octotricopeptide repeat protein in Arabidopsis, is required for chloroplast 16S rRNA maturation.

    Science.gov (United States)

    Kleinknecht, Laura; Wang, Fei; Stübe, Roland; Philippar, Katrin; Nickelsen, Jörg; Bohne, Alexandra-Viola

    2014-02-01

    The biogenesis and activity of chloroplasts in both vascular plants and algae depends on an intracellular network of nucleus-encoded, trans-acting factors that control almost all aspects of organellar gene expression. Most of these regulatory factors belong to the helical repeat protein superfamily, which includes tetratricopeptide repeat, pentatricopeptide repeat, and the recently identified octotricopeptide repeat (OPR) proteins. Whereas green algae express many different OPR proteins, only a single orthologous OPR protein is encoded in the genomes of most land plants. Here, we report the characterization of the only OPR protein in Arabidopsis thaliana, RAP, which has previously been implicated in plant pathogen defense. Loss of RAP led to a severe defect in processing of chloroplast 16S rRNA resulting in impaired chloroplast translation and photosynthesis. In vitro RNA binding and RNase protection assays revealed that RAP has an intrinsic and specific RNA binding capacity, and the RAP binding site was mapped to the 5' region of the 16S rRNA precursor. Nucleoid localization of RAP was shown by transient green fluorescent protein import assays, implicating the nucleoid as the site of chloroplast rRNA processing. Taken together, our data indicate that the single OPR protein in Arabidopsis is important for a basic process of chloroplast biogenesis.

  2. Selective expression of two types of 28S rRNA paralogous genes in the chaetognath Spadella cephaloptera.

    Science.gov (United States)

    Barthélémy, R-M; Casanova, J-P; Grino, M; Faure, E

    2007-09-13

    Significant intra-individual variation in the sequences of the ribosomal RNA (rRNA) genes is highly unusual in animal genomes; however, two classes of both 18S and 28S rRNA gene sequences have been detected in chaetognaths, a small phylum of marine invertebrates. One species, Spadella cephaloptera Busch, 1851, is well-suited to the methods of in situ analysis of gene expression, since it is totally transparent. To test our hypothesis of a possible functional division of the two classes of genes, we carried out in situ hybridization. Our results indicated that 28S class II genes are expressed intensively in the oocytes of chaetognaths. In contrast, hybridization using an heterologous probe of 28S class I genes revealed only a single and relatively weak signal in a distinct area of intestinal cells. Our results suggest that the S. cephaloptera genome contains at least three different types of rRNA 28S genes; however, those which are expressed during housekeeping conditions could not be detected in our experiments.

  3. VITCOMIC: visualization tool for taxonomic compositions of microbial communities based on 16S rRNA gene sequences

    Directory of Open Access Journals (Sweden)

    Kurokawa Ken

    2010-06-01

    Full Text Available Abstract Background Understanding the community structure of microbes is typically accomplished by sequencing 16S ribosomal RNA (16S rRNA genes. These community data can be represented by constructing a phylogenetic tree and comparing it with other samples using statistical methods. However, owing to high computational complexity, these methods are insufficient to effectively analyze the millions of sequences produced by new sequencing technologies such as pyrosequencing. Results We introduce a web tool named VITCOMIC (VIsualization tool for Taxonomic COmpositions of MIcrobial Community that can analyze millions of bacterial 16S rRNA gene sequences and calculate the overall taxonomic composition for a microbial community. The 16S rRNA gene sequences of genome-sequenced strains are used as references to identify the nearest relative of each sample sequence. With this information, VITCOMIC plots all sequences in a single figure and indicates relative evolutionary distances. Conclusions VITCOMIC yields a clear representation of the overall taxonomic composition of each sample and facilitates an intuitive understanding of differences in community structure between samples. VITCOMIC is freely available at http://mg.bio.titech.ac.jp/vitcomic/.

  4. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  5. Description of an unusual Neisseria meningitidis isolate containing and expressing Neisseria gonorrhoeae-Specific 16S rRNA gene sequences.

    Science.gov (United States)

    Walcher, Marion; Skvoretz, Rhonda; Montgomery-Fullerton, Megan; Jonas, Vivian; Brentano, Steve

    2013-10-01

    An apparently rare Neisseria meningitidis isolate containing one copy of a Neisseria gonorrhoeae 16S rRNA gene is described herein. This isolate was identified as N. meningitidis by biochemical identification methods but generated a positive signal with Gen-Probe Aptima assays for the detection of Neisseria gonorrhoeae. Direct 16S rRNA gene sequencing of the purified isolate revealed mixed bases in signature regions that allow for discrimination between N. meningitidis and N. gonorrhoeae. The mixed bases were resolved by sequencing individually PCR-amplified single copies of the genomic 16S rRNA gene. A total of 121 discrete sequences were obtained; 92 (76%) were N. meningitidis sequences, and 29 (24%) were N. gonorrhoeae sequences. Based on the ratio of species-specific sequences, the N. meningitidis strain seems to have replaced one of its four intrinsic 16S rRNA genes with the gonococcal gene. Fluorescence in situ hybridization (FISH) probes specific for meningococcal and gonococcal rRNA were used to demonstrate the expression of the rRNA genes. Interestingly, the clinical isolate described here expresses both N. meningitidis and N. gonorrhoeae 16S rRNA genes, as shown by positive FISH signals with both probes. This explains why the probes for N. gonorrhoeae in the Gen-Probe Aptima assays cross-react with this N. meningitidis isolate. The N. meningitidis isolate described must have obtained N. gonorrhoeae-specific DNA through interspecies recombination.

  6. International Exchanges

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    On October 12,2015,Mr.Zhu Rui,CPAPD Secretary General,chaired informal discussions with U.S.young experts and scholars on arms control and non-proliferation.The two sides exchanged views on international arms control,disarmament,non-proliferation and nuclear security,etc.During October 12 to 16,2015,at the invitation of the CPAPD,a four-member delegation from the Vietnam Peace Committee headed by its Vice-President Ms.Nguyen Thi Hoang Van

  7. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements.

    Science.gov (United States)

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-10-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  8. The tumor suppressive role of eIF3f and its function in translation inhibition and rRNA degradation.

    Directory of Open Access Journals (Sweden)

    Fushi Wen

    Full Text Available Deregulated translation plays an important role in human cancer. We previously reported decreased eukaryotic initiation factor 3 subunit f (eIF3f expression in pancreatic cancer. Whether decreased eIF3f expression can transform normal epithelial cells is not known. In our current study, we found evidence that stable knockdown of eIF3f in normal human pancreatic ductal epithelial cells increased cell size, nuclear pleomorphism, cytokinesis defects, cell proliferation, clonogenicity, apoptotic resistance, migration, and formation of 3-dimensional irregular masses. Our findings support the tumor suppressive role of eIF3f in pancreatic cancer. Mechanistically, we found that eIF3f inhibited both cap-dependent and cap-independent translation. An increase in the ribosomal RNA (rRNA level was suggested to promote the generation of cancer. The regulatory mechanism of rRNA degradation in mammals is not well understood. We demonstrated here that eIF3f promotes rRNA degradation through direct interaction with heterogeneous nuclear ribonucleoprotein (hnRNP K. We showed that hnRNP K is required for maintaining rRNA stability: under stress conditions, eIF3f dissociates hnRNP K from rRNA, thereby preventing it from protecting rRNA from degradation. We also demonstrated that rRNA degradation occurred in non-P body, non-stress granule cytoplasmic foci that contain eIF3f. Our findings established a new mechanism of rRNA decay regulation mediated by hnRNP K/eIF3f and suggest that the tumor suppressive function of eIF3f may link to impaired rRNA degradation and translation.

  9. [Detection of bacterial signal of 16S rRNA gene in prostate tissues obtained by perineal approach from patient with chronic pelvic pain syndrome].

    Science.gov (United States)

    Zhu, Qing-Feng; Xie, Hui; Weng, Zhi-Liang; Yang, Yi-Rong; Chen, Bi-Cheng

    2009-03-31

    To explore the role of bacteria in etiology of chronic pelvic pain syndrome (CPPS), i.e., chronic prostatitis and the correlation between presence of bacterial signal of 16S ribosomal RNA (16S rRNA) gene and the response to antibiotics. Samples of prostatic and subcutaneous tissues were obtained by biopsy via perineal approach from 112 CPPS patients, aged 20 - 48. Polymerase chain reaction was conducted to detect the 16S rRNA gene of bacteria. The patients were treated with gatifloxacin 0.4 g once a day for 4 weeks and then 4 weeks later the effects of treatment were assessed by the National Institutes of Health Chronic Prostatitis Symptom Index (NIH-CPSI). PCR was completed in 94 of the 112 patients, and 18 were excluded because their subcutaneous biopsies were positive for 16S rRNA, showing the possible contamination of their prostatic tissues. The total positive rate of bacterial 16S rRNA gene was 63.8% (60/94). The positive rate of bacterial 16S rRNA gene in the patients with IIIa CPPS and IIIb CPPS were 68.3% and 60.3% respectively. The total gatifloxacin effective rate of positive bacterial signal group after the was 55.0%, significantly higher than that of the negative bacterial signal group (14.7%, P 6S rRNA positive IIIa CPPS patients was 75%, significantly higher than that of the 6S rRNA negative IIIa CPPS patients (23.1%, P 6S rRNA positive IIIb CPPS patients was 37.5%, significantly higher than that of the 6S rRNA negative IIIb CPPS patients (9.5%, P < 0.05). Bacterial infection is related to CPPS in part of the patients. Bacterial signal detection helps predict the effect of antimicrobial therapy.

  10. Internal education

    Directory of Open Access Journals (Sweden)

    Anita Zagorc

    2016-09-01

    Full Text Available Research Question (RQ: The importance of internal trainings in an organization. Purpose: The purpose of research is to examine and present internal trainings in an organization and their contribution to greater success of an organization. The paper studies employee training in a company, how the organization itself looks after its employees during training, how trainings contribute to further development of organization and the advancement of knowledge for successful operation of organization. Method: How to achieve the purpose of research, used methods and theoretical approach. Results: Specific examples and opinions of employees. Results show the importance of trainings for an organization. We can see that all employees are fairly motivated and ready to participate in trainings and can adapt to changing business environment very well. The results demonstrate that all trainings in the organization are very important and welcome. Only with continuous learning, the organization can be successful and survive in the market despite strong competition. Organization: Trainings are designed for all employees inside an organization. Different employees participate in trainings in a different way as all trainings are divided into certain work and fields that are important for each individual or department in an organization. Society: Trainings have an impact on the whole organization by contributing to its development. Originality: The originality of study is what was new in the research, what is the value and originality of research. Limitations/Future Research: Research was limited to a small number of sources.

  11. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification...

  12. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    Science.gov (United States)

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings.

  13. Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis

    Science.gov (United States)

    Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne

    2017-01-01

    Background Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. Results The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). Conclusions The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal

  14. Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis.

    Science.gov (United States)

    Virtanen, Seppo; Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne

    2017-01-01

    Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal microbiota studies employing different

  15. Use of 1 6S rRNA and rpoB Genes as Molecular Markers for Microbial Ecology Studies[white triangle down

    National Research Council Canada - National Science Library

    Rebecca J Case; Yan Boucher; Ingela Dahllöf; Carola Holmström

    2007-01-01

      Several characteristics of the 16S rRNA gene, such as its essential function, ubiquity, and evolutionary properties, have allowed it to become the most commonly used molecular marker in microbial ecology...

  16. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  17. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.

    Science.gov (United States)

    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D

    2006-03-01

    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis.

  18. Molecular characterization of gap region in 28S rRNA molecules in brine shrimp Artemia parthenogenetica and planarian Dugesia japonica.

    Science.gov (United States)

    Sun, Shuhong; Xie, Hui; Sun, Yan; Song, Jing; Li, Zhi

    2012-04-01

    In most insects and some other protostomes, a small stretch of nucleotides can be removed from mature 28S rRNA molecules, which could create two 28S rRNA subunits (28Sα and 28Sβ). Thus, during electrophoresis, the rRNA profiles of these organisms may differ significantly from the standard benchmark since the two subunits co-migrate with the 18S rRNA. To understand the structure and mechanism of the atypical 28S rRNA molecule, partial fragments of 28Sα and 28Sβ in brine shrimp Artemia parthenogenetica and planarian Dugesia japonica were cloned using a modified technology based on terminal transferase. Alignment with the corresponding sequences of 28S rDNAs indicates that there are 41 nucleotides in A. parthenogenetica and 42 nucleotides in D. japonica absent from the mature rRNAs. The AU content of the gap sequences of D. japonica and A. parthenogenetica is high. Both the gaps may form stem-loop structure. In D. japonica a UAAU cleavage signal is identified in the loop, but it is absent in A. parthenogenetica. Thus, it is proposed that the gap processing of 28S rRNA was a late enzyme-dependent cleavage event in the rRNA maturational process based on the AU rich gap sequence and the formation of the stem-loop structure to expose the processing segment, while the deletion of the gap region would not affect the structure and function of the 28S rRNA molecule.

  19. Mild Glucose Starvation Induces KDM2A-Mediated H3K36me2 Demethylation through AMPK To Reduce rRNA Transcription and Cell Proliferation.

    Science.gov (United States)

    Tanaka, Yuji; Yano, Hirohisa; Ogasawara, Sachiko; Yoshioka, Sho-Ichi; Imamura, Hiromi; Okamoto, Kengo; Tsuneoka, Makoto

    2015-12-01

    Environmental conditions control rRNA transcription. Previously, we found that serum and glucose deprivation induces KDM2A-mediated H3K36me2 demethylation in the rRNA gene (rDNA) promoter and reduces rRNA transcription in the human breast cancer cell line MCF-7. However, the molecular mechanism and biological significance are still unclear. In the present study, we found that glucose starvation alone induced the KDM2A-dependent reduction of rRNA transcription. The treatment of cells with 2-deoxy-d-glucose, an inhibitor of glycolysis, reduced rRNA transcription and H3K36me2 in the rDNA promoter, both of which were completely dependent on KDM2A in low concentrations of 2-deoxy-d-glucose, that is, mild starvation conditions. The mild starvation induced these KDM2A activities through AMP-activated kinase (AMPK) but did not affect another AMPK effector of rRNA transcription, TIF-IA. In the triple-negative breast cancer cell line MDA-MB-231, the mild starvation also reduced rRNA transcription in a KDM2A-dependent manner. We detected KDM2A in breast cancer tissues irrespective of their estrogen receptor, progesterone receptor, and HER2 status, including triple-negative cancer tissues. In both MCF-7 and MDA-MB-231 cells, mild starvation reduced cell proliferation, and KDM2A knockdown suppressed the reduction of cell proliferation. These results suggest that under mild glucose starvation AMPK induces KDM2A-dependent reduction of rRNA transcription to control cell proliferation.

  20. Phylogenetic relationships of chemoautotrophic bacterial symbionts of Solemya velum say (Mollusca: Bivalvia) determined by 16S rRNA gene sequence analysis.

    OpenAIRE

    Eisen, J. A.; Smith, S W; Cavanaugh, Colleen Marie

    1992-01-01

    The protobranch bivalve Solemya velum Say (Mollusca: Bivalvia) houses chemoautotrophic symbionts intracellularly within its gills. These symbionts were characterized through sequencing of polymerase chain reaction-amplified 16S rRNA coding regions and hybridization of an Escherichia coli gene probe to S. velum genomic DNA restriction fragments. The symbionts appeared to have only one copy of the 16S rRNA gene. The lack of variability in the 16S sequence and hybridization patterns within and b...

  1. Maturation of the 5S rRNA 5' end is catalyzed in vitro by the endonuclease tRNase Z in the archaeon H. volcanii.

    Science.gov (United States)

    Hölzle, Annette; Fischer, Susan; Heyer, Ruth; Schütz, Stefanie; Zacharias, Martin; Walther, Paul; Allers, Thorsten; Marchfelder, Anita

    2008-05-01

    Ribosomal RNA molecules are synthesized as precursors that have to undergo several processing steps to generate the functional rRNA. The 5S rRNA in the archaeon Haloferax volcanii is transcribed as part of a multicistronic transcript containing both large rRNAs and one or two tRNAs. Release of the 5S rRNA from the precursor requires two endonucleolytic cleavages by enzymes as yet not identified. Here we report the first identification of an archaeal 5S rRNA processing endonuclease. The enzyme tRNase Z, which was initially identified as tRNA processing enzyme, generates not only tRNA 3' ends but also mature 5S rRNA 5' ends in vitro. Interestingly, the sequence upstream of the 5S rRNA can be folded into a mini-tRNA, which might explain the processing of this RNA by tRNase Z. The endonuclease is active only at low salt concentrations in vitro, which is in contrast to the 2-4 M KCl concentration present inside the cell in vivo. Electron microscopy studies show that there are no compartments inside the Haloferax cell that could provide lower salt environments. Processing of the 5S rRNA 5' end is not restricted to the haloarchaeal tRNase Z since tRNase Z enzymes from a thermophilic archaeon, a lower and a higher eukaryote, are as well able to cleave the tRNA-like structure 5' of the 5S rRNA. Knock out of the tRNase Z gene in Haloferax volcanii is lethal, showing that the protein is essential for the cell.

  2. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    Science.gov (United States)

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  3. Phylogeny of intestinal ciliates, including Charonina ventriculi, and comparison of microscopy and 18S rRNA gene pyrosequencing for rumen ciliate community structure analysis.

    Science.gov (United States)

    Kittelmann, Sandra; Devente, Savannah R; Kirk, Michelle R; Seedorf, Henning; Dehority, Burk A; Janssen, Peter H

    2015-04-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups.

  4. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Directory of Open Access Journals (Sweden)

    Jenny Chirinos

    2011-05-01

    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  5. A minor class of 5S rRNA genes in Saccharomyces cerevisiae X2180-1B, one member of which lies adjacent to a Ty transposable element.

    OpenAIRE

    Piper, P W; Lockheart, A; Patel, N.

    1984-01-01

    In Saccharomyces cerevisiae the majority of the genes for 5S rRNA lie within a 9kb rDNA sequence that is present as 100-200 tandemly-repeated copies on Chromosome XII. Following our observations that about 10% of yeast 5S rRNA exists as minor variant sequences, we screened a collection of yeast DNA fragments cloned in lambda gt for 5S rRNA genes whose flanking sequences differed from those adjacent to 5S rRNA genes of the rDNA repeat. Three variant 5S rRNA genes were isolated on the basis of ...

  6. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  7. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing.

    Science.gov (United States)

    Jarvis, Karen G; White, James R; Grim, Christopher J; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E

    2015-08-12

    Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective pre-enrichment culture step commonly used by laboratory analysts to resuscitate microorganisms in foods suspected of contamination with pathogens. Cilantro samples were processed for Salmonella detection according to the method in the United States Food and Drug Administration Bacteriological Analytical Manual. Genomic DNA was extracted from culture supernatants prior to and after a 24-hour nonselective pre-enrichment step and 454 pyrosequencing was performed on 16S rRNA amplicon libraries. A database of Enterobacteriaceae 16S rRNA sequences was created, and used to screen the libraries for Salmonella, as some samples were known to be culture positive. Additionally, culture positive cilantro samples were examined for the presence of Salmonella using shotgun metagenomics on the Illumina MiSeq. Time zero uncultured samples had an abundance of Proteobacteria while the 24-hour enriched samples were composed mostly of Gram-positive Firmicutes. Shotgun metagenomic sequencing of Salmonella culture positive cilantro samples revealed variable degrees of Salmonella contamination among the sequenced samples. Our cilantro study demonstrates the use of high-throughput sequencing to reveal the microbiome of cilantro, and how the microbiome changes during the culture-based protocols employed by food safety laboratories to detect foodborne pathogens. Finding that culturing the cilantro shifts the microbiome to a predominance of Firmicutes suggests that changing our culture-based methods will improve

  8. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    Directory of Open Access Journals (Sweden)

    Chia Sing eChan

    2015-03-01

    Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

  9. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  10. The structure of the archaebacterial ribosomal protein S7 and its possible interaction with 16S rRNA.

    Science.gov (United States)

    Hosaka, H; Yao, M; Kimura, M; Tanaka, I

    2001-11-01

    Ribosomal protein S7 is one of the ubiquitous components of the small subunit of the ribosome. It is a 16S rRNA-binding protein positioned close to the exit of the tRNA, and it plays a role in initiating assembly of the head of the 30S subunit. Previous structural analyses of eubacterial S7 have shown that it has a stable alpha-helix core and a flexible beta-arm. Unlike these eubacterial proteins, archaebacterial or eukaryotic S7 has an N-terminal extension of approximately 60 residues. The crystal structure of S7 from archaebacterium Pyrococcus horikoshii (PhoS7) has been determined at 2.1 A resolution. The final model of PhoS7 consists of six major alpha-helices, a short 3(10)-helix and two beta-stands. The major part (residues 18-45) of the N-terminal extension of PhoS7 reinforces the alpha-helical core by well-extended hydrophobic interactions, while the other part (residues 46-63) is not visible in the crystal and is possibly fixed only by interacting with 16S rRNA. These differences in the N-terminal extension as well as in the insertion (between alpha1 and alpha2) of the archaebacterial S7 structure from eubacterial S7 are such that they do not necessitate a major change in the structure of the currently available eubacterial 16S rRNA. Some of the inserted chains might pass through gaps formed by helices of the 16S rRNA.

  11. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    Science.gov (United States)

    Tang, Xianghai; Yu, Rencheng; Zhou, Mingjiang; Yu, Zhigang

    2012-03-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs). This species consists of many strains that differ in their ability to produce toxins but have similar morphology, making identification difficult. In this study, species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A. minutum from two phylogenetic clades. We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes. Three ribotype-specific probes, M-GC-1, M-PC-2, and M-PC-3, were designed. The former is specific for the GC clade ("Global clade") of A. minutum, the majority of which have been found non-toxic, and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade ("Pacific clade"). The specificity of these three probes was confirmed by FISH. All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions. However, the accessibility of rRNA molecules in ribosomes varied among the probe binding positions. Thus, there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1, M-PC-3), or just nucleolus (M-PC-2). Our results provide a methodological basis for studying the biogeography and population dynamics of A. minutum, and providing an early warning of toxic HABs.

  12. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    Science.gov (United States)

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  13. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    Science.gov (United States)

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  14. Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.

    Science.gov (United States)

    de los Reyes, F L; Ritter, W; Raskin, L

    1997-03-01

    Foaming in activated sludge systems is characterized by the formation of a thick, chocolate brown-colored scum that floats on the surface of aeration basins and secondary clarifiers. These viscous foams have been associated with the presence of filamentous mycolic acid-containing actinomycetes. To aid in evaluating the microbial representation in foam, we developed and characterized group-, genus-, and species-specific oligonucleotide probes targeting the small subunit rRNA of the Mycobacterium complex, Gordona spp., and Gordona (Nocardia) amarae, respectively. The use of a universal base analog, 5-nitroindole, in oligonucleotide probe design was evaluated by comparing the characteristics of two different versions of the Mycobacterium complex probe. The temperature of dissociation of each probe was determined. Probe specificity studies with a diverse collection of 67 target and nontarget rRNAs demonstrated the specificity of the probes to the target groups. Whole-cell hybridizations with fluorescein- and rhodamine-labeled probes were performed with pure cultures of various members of the Mycobacterium complex as well as with environmental samples from a full-scale activated sludge plant which experienced foaming. Quantitative membrane hybridizations with activated sludge and anaerobic digester foam showed that 15.0 to 18.3% of the total small-subunit rRNAs could be attributed to members of the Mycobacterium complex, of which a vast majority consisted of Gordona rRNA. Several G. amarae strains made up only a very small percentage of the Gordona strains present. We demonstrated that group-specific rRNA probes are useful tools for the in situ monitoring and identification of filamentous bacteria in activated sludge systems.

  15. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    Directory of Open Access Journals (Sweden)

    Patrick D. Schloss

    2016-03-01

    Full Text Available Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  16. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    Institute of Scientific and Technical Information of China (English)

    TANG Xianghai; YU Rencheng; ZHOU Mingjiang; YU Zhigang

    2012-01-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs).This species consists of many strains that differ in their ability to produce toxins but have similar morphology,making identification difficult.In this study,species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A.minutum from two phylogenetic clades.We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes.Three ribotype-specific probes,M-GC-1,M-PC-2,and M-PC-3,were designed.The former is specific for the GC clade (“Global clade”) of A.minutum,the majority of which have been found non-toxic,and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade (“Pacific clade”).The specificity of these three probes was confirmed by FISH.All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions.However,the accessibility of rRNA molecules in ribosomes varied among the probe binding positions.Thus,there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1,M-PC-3),or just nucleolus (M-PC-2).Our results provide a methodological basis for studying the biogeography and population dynamics of A.minutum,and providing an early warning of toxic HABs.

  17. Applied genomics: data mining reveals species-specific malaria diagnostic targets more sensitive than 18S rRNA.

    Science.gov (United States)

    Demas, Allison; Oberstaller, Jenna; DeBarry, Jeremy; Lucchi, Naomi W; Srinivasamoorthy, Ganesh; Sumari, Deborah; Kabanywanyi, Abdunoor M; Villegas, Leopoldo; Escalante, Ananias A; Kachur, S Patrick; Barnwell, John W; Peterson, David S; Udhayakumar, Venkatachalam; Kissinger, Jessica C

    2011-07-01

    Accurate and rapid diagnosis of malaria infections is crucial for implementing species-appropriate treatment and saving lives. Molecular diagnostic tools are the most accurate and sensitive method of detecting Plasmodium, differentiating between Plasmodium species, and detecting subclinical infections. Despite available whole-genome sequence data for Plasmodium falciparum and P. vivax, the majority of PCR-based methods still rely on the 18S rRNA gene targets. Historically, this gene has served as the best target for diagnostic assays. However, it is limited in its ability to detect mixed infections in multiplex assay platforms without the use of nested PCR. New diagnostic targets are needed. Ideal targets will be species specific, highly sensitive, and amenable to both single-step and multiplex PCRs. We have mined the genomes of P. falciparum and P. vivax to identify species-specific, repetitive sequences that serve as new PCR targets for the detection of malaria. We show that these targets (Pvr47 and Pfr364) exist in 14 to 41 copies and are more sensitive than 18S rRNA when utilized in a single-step PCR. Parasites are routinely detected at levels of 1 to 10 parasites/μl. The reaction can be multiplexed to detect both species in a single reaction. We have examined 7 P. falciparum strains and 91 P. falciparum clinical isolates from Tanzania and 10 P. vivax strains and 96 P. vivax clinical isolates from Venezuela, and we have verified a sensitivity and specificity of ∼100% for both targets compared with a nested 18S rRNA approach. We show that bioinformatics approaches can be successfully applied to identify novel diagnostic targets and improve molecular methods for pathogen detection. These novel targets provide a powerful alternative molecular diagnostic method for the detection of P. falciparum and P. vivax in conventional or multiplex PCR platforms.

  18. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    DEFF Research Database (Denmark)

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin...... drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind...

  19. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Directory of Open Access Journals (Sweden)

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  20. Terminal restriction fragment length polymorphism (T-RFLP) profiling of bacterial 16S rRNA genes.

    Science.gov (United States)

    Osborne, Catherine A

    2014-01-01

    T-RFLP profiling is a very effective method for comparing many samples in an environmental microbiology study, because fingerprints of microbial diversity can be generated in a sensitive, reproducible, and cost-effective manner. This protocol describes the steps required to generate T-RFLP profiles of the dominant members of a bacterial community, by PCR amplification of the bacterial 16S rRNA genes and three restriction endonuclease digests to generate three different profiles for each sample. The generation of multiple profiles per sample provides enough information to confidently differentiate rich environmental bacterial communities.