
Sample records for 16s-23s rrna internal

  1. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  2. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;


    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  3. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)



    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  4. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling


    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C


    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  5. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources


    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.


    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  6. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平


    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  7. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    Institute of Scientific and Technical Information of China (English)

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良


    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  8. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    Institute of Scientific and Technical Information of China (English)

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静


    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  9. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Directory of Open Access Journals (Sweden)

    Neumann Elisabeth


    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  10. Applicability of the 16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in field soil


    Baudoin, Ezékiel; Couillerot, O.; Spaepen, S.; Moenne-Loccoz, Y.; Nazaret, S.


    Aims: To assess the applicability of the 16S-23S rDNA internal spacer regions (ISR) as targets for PCR detection of Azospirillum ssp. and the phytostimulatory plant growth-promoting rhizobacteria seed inoculant Azospirillum lipoferum CRT1 in soil. Methods and Results: Primer sets were designed after sequence analysis of the ISR of A. lipoferum CRT1 and Azospirillum brasilense Sp245. The primers fAZO/rAZO targeting the Azospirillum genus successfully yielded PCR amplicons (400-550 bp) from Azo...

  11. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies. (United States)

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H


    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  12. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh


    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  13. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains. (United States)

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H


    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here. PMID:24238667

  14. Application of the Sequences Analysis of the 16S rRNA Gene and ITS of 16S-23S rRNA to the Systematic Study of the Genus Arthrospira and Spirulina%16S rRNA基因与16S-23S rRNA转录单元内间隔区序列分析及其在节旋藻和螺旋藻分类鉴定中的应用

    Institute of Scientific and Technical Information of China (English)

    茅云翔; 杨官品; 张宝红; 张学成


    测定了节旋藻属3个品系和螺旋藻属1个品系的全长16S rRNA基因和16S-23S rRNA转录单元内间隔区序列(ITS),分析了已知的节旋藻、螺旋藻和相关品系的相应序列的同源性,构建了系统发生树,并评价了这两段DNA序列在节旋藻、螺旋藻种属分类和种质鉴定中的意义.结果表明:(1)16S rRNA基因序列和ITS序列均可用于节旋藻属和螺旋藻属的属间分类,以两序列为基础的系统学分析结果一致;(2)ITS序列变异程度高于16S rDNA序列,适用于节旋藻和螺旋藻属内品系或种质鉴定;(3)节旋藻属可明确界定,16S rRNA基因序列相似性大于98%,ITS序列相似性大于88%;(4)螺旋藻属某些品系间16S rDNA序列和ITS序列相似性较低,与不同属间的序列相似性程度为同一水平.

  15. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing


    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  16. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization. (United States)

    Dingman, Douglas W


    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  17. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses


    Toth, I. K.; Avrova, A. O.; Hyman, L. J.


    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated al...

  18. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes. (United States)

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M


    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes. PMID:11166101

  19. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿


    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu


    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  20. Designing PCR Primers from 16S-23S rDNA Intergenic Spacer Region for the Identification of Pasteurella multocida%以 16S-23S rDNA 间区序列为目的基因设计 PCR 引物鉴定多杀巴斯德氏菌

    Institute of Scientific and Technical Information of China (English)

    周浩; 刘寅; 陈一军; 郑泽军; 黄熙泰


    多杀巴斯德氏菌是养殖动物(鸡,猪,牛等)的重要致病菌.本研究以16S-23S rDNA间区序列为目的基因设计PCR引物鉴定多杀巴斯德氏菌.通过对多杀巴斯德氏菌ITS-IA(含有tDNA-Ile和tDNA-Ala的16S-23S rDNA间区序列)的测序和与GenBank中序列的BLAST,设计筛选了一对特异引物PS-F/PS-R.对引物的特异性和有效性,用PCR方法进行了验证.结果表明:所有的多杀巴斯德氏菌标准菌株和分离菌株都能被检出,而全部39株非多杀巴斯德氏菌都没有扩增出特异性条带.其检测灵敏度能达到102CFU/mL.研究结果表明,发展了的PCR鉴定方法是省时的和可靠的,整个过程只需要20 h,而传统的鉴定方法需要至少5 d的时间.%Pasteurella multocida is an important pathogen that infects many kinds of animals. In present study, a polymerase chain reaction (PCR) assay using primers derived from the 16S-23S rRNA intergenic spacer (ITS) of P. multocida was developed. One pairs of specific PCR primers were designed by sequencing the ITS-IA (ITS containing tDNA-Ile and tDNA-Ala) of P. multocida and BLAST of GenBank. The specificity and efficiency of the PCR methods were tested against a panel of numerous strains from 39 different bacterial strains. All of the P. multocida strains generated positive signal, and no cross-reaction was observed with non-P, multocida strains in the PCR detection. Sensitivity of the detection is 102 CFU/mL cultures. The newly developed PCR array procedures take only 20 hours for each time, whereas the conventional methods required at least five days. This study demonstrated that the PCR detection for P. multocida is time-saved and reliable.

  1. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)


    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  2. Identification of Clinically Relevant Nonhemolytic Streptococci on the Basis of Sequence Analysis of 16S-23S Intergenic Spacer Region and Partial gdh Gene▿


    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas; Kemp, Michael; Christensen, Jens Jørgen


    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the part...

  3. 16s-23S rDNA: polymorphisms and their use for detection and identification of Xylella fastidiosa strains 16S-23S rDNA: polimorfismos e sua aplicação na detecção e identificação de linhagens de Xylella fastidiosa

    Directory of Open Access Journals (Sweden)

    Juliana Camargo Martinati


    Full Text Available Strains of Xylella fastidiosa from several hosts (coffee, citrus, grape, almond, oleander, peach, plum, etc. were characterized by analyzing the content of the nucleotide sequences of 16S-23S rDNA (coding for a small subunit ribosomal RNA spacer region (ITS. Current methods for sequencing the ITS region yields partial sequences that do not contribute with significant information. According to this fact, new primers have been designed in order to obtain a complete sequence and facilitate the sequencing. The complete 16S-23S sequences from 08 strains were amplified through PCR using the primers designed in our lab. The 16S-23S sequences obtained were compared with 52 others sequences entries in GenBank database. The results revealed a higher level of variation than that found in 16S gene sequences, with similarity values ranging from 0.79-1.00. The dendogram based on similarity data revealed 5 main groups. This spacer sequence contains two genes for tRNA (tRNAala and tRNAile. The sequence analysis of the tRNA content showed a conserved region with a few differences in the nucleotide composition.Linhagens de Xylella fastidiosa de diferentes hospedeiros (café, uva, amêndoa, ameixa, etc. foram caracterizados analisando as sequências de nucleotídeos do espaço intergênico 16S-23S (ITS. Os métodos atuais para o sequenciamento da região ITS produzem fragmentos parciais das sequências que não contribuem com informações significantes. Em vista disso, novos primers foram desenhados a fim de obter uma sequência completa e facilitar o sequenciamento. A sequencia completa da região ITS de 08 linhagens de X. Fastidiosa foram amplificadas via PCR, sequenciadas e comparadas com outras 52 sequencias depositadas no GenBank. Os resultados revelaram um alto nível de variação sendo maior que os níveis encontrados quando se utiliza o gene 16S para este tipo de análise, com valores variando entre 0.79 a 1.00. O dendograma baseado em dados de

  4. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)


    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  5. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian


    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  6. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon . (United States)

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L


    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson


    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  8. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus


    Verma Mansi; Lal Devi; Lal Rup


    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  9. Multiplex RT-PCR detection of Cucumber mosaic virus subgroups and Tobamoviruses infecting Tomato using 18S rRNA as an internal control

    Institute of Scientific and Technical Information of China (English)

    Shaoning Chen; Hao Gu; Xiaoming Wang; Jishuang Chen; Weimin Zhu


    A multiplex reverse-transcription polymerase chain reaction (RT-PCR) protocol was developed for simultaneous detection and discrimination of subgroups of Cucumber mosaic virus (CMV), including its satellite RNA, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV),using 18S rRNA as an internal control.Species- and subgroups-specific primers designed to differentiate CMV subgroups Ⅰ and Ⅱ, ToMV and TMV, were assessed using the cDNA clones of viral genomes, CMV satellite RNA and 18S rRNA gene from tomato (Solanum lycopersicum L.) or tobacco (Nicotiana tobacum).Using total RNA extracted from artificial mixture of tomato leaf tissues infected by each virus, the reaction components and cycling parmeters were optimized and a multiplex RT-PCR procedure was established.Six fragments of 704, 593, 512, 421,385, 255 bp, specific to CMV subgroup ll, CMV subgroup I, ToMV, TMV, satellite RNA and 18S rRNA, respectively, were sinultaneously amplified.The sensitivity of the multiplex RT-PCR method for detecting CMV was 100 times higher than that of double-antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA).This method was successfully used for field detection.Among 141 samples collected from East China through tomato growth seasons, 106 single infections with one of the above isolates were detected and 13 mixed infections were found.The results showed the potential use of this method for investigating the epidemiology of viral diseases infecting tomato.

  10. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    DEFF Research Database (Denmark)

    Lee, C H; Helweg-Larsen, J; Tang, X; Jin, S; Li, B; Bartlett, M S; Lu, Jingquan; Lundgren, B; Lundgren, J D; Olsson, M; Lucas, Sandra; Roux, P; Cargnel, A; Atzori, C; Matos, O; Smith, J W


    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...... previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are...... named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  11. Analysis of the 5.8S rRNA gene and the internal transcribed spacers in Naegleria spp. and in N. fowleri. (United States)

    Pélandakis, M; Serre, S; Pernin, P


    Internal transcribed spacers (ITS) and the 5.8S ribosomal gene of 21 Naegleria fowleri strains and eight other species including Naegleria gruberi were sequenced. The results showed that this region can help differentiate between and within species. The phylogeny of Naegleria spp. deduced from the ITS and the 5.8S gene produced four major lineages, fowleri-lovaniensis, galeacystis-italica-clarki-gruberi-australiensis, andersoni-jamiesoni, and pussardi, that fit perfectly with those inferred from the 18S rRNA gene analysis. The N. gruberi isolate, NG260, was closely related to Naegleria pussardi. The other N. gruberi isolates branched together with Naegleria australiensis in another lineage. The ITS and 5.8S results for N. fowleri were congruent with those previously deduced by RAPD analysis. The phylogenetic analysis inferred from ITS and RAPD data revealed two major groups. The French Cattenom and Chooz and South Pacific strains constituted the first group. The second group encompassed the strains corresponding to the Euro-American and Widespread RAPD variants and shared the same substitution in the 5.8S gene. In addition, it was possible to define species specific primers in ITS regions to rapidly identify N. fowleri. PMID:10750838

  12. .i.Aulosira bohemensis./i. sp. nov.: further phylogenetic uncertainty at the base of the Nostocales (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Lukešová, Alena; Johansen, J. R.; Martin, M.P.; Casamatta, D.A.


    Roč. 48, č. 2 (2009), s. 118-129. ISSN 0031-8884 Institutional research plan: CEZ:AV0Z60660521 Keywords : Cyanobacteria * 16S rRNA gene * 16S-23S Internal transcribed spacer (ITS) Subject RIV: EH - Ecology, Behaviour Impact factor: 1.218, year: 2009

  13. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    DEFF Research Database (Denmark)

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas;


    was performed with 57 NHS reference or clinical strains. Satisfactory identification to the species level was achieved for 14/19 NHS species included in this study on the basis of sequence analysis of the ITS region. Streptococcus salivarius and Streptococcus vestibularis obtained the expected taxon as the best...... taxon match, but there was a short maximum score distance to the next best match (distance, Streptococcus mitis, Streptococcus oralis, and Streptococcus pneumoniae could not be unambiguously discriminated by sequence analysis of the ITS region, as was also proven by phylogenetic analysis...

  14. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis. (United States)

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej


    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing. PMID:24607713

  15. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob


    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  16. Cyanobacterial Diversity and a New Acaryochloris-Like Symbiont from Bahamian Sea-Squirts


    Susanna López-Legentil; Bongkeun Song; Manel Bosch; Joseph R Pawlik; Xavier Turon


    Symbiotic interactions between ascidians (sea-squirts) and microbes are poorly understood. Here we characterized the cyanobacteria in the tissues of 8 distinct didemnid taxa from shallow-water marine habitats in the Bahamas Islands by sequencing a fragment of the cyanobacterial 16S rRNA gene and the entire 16S-23S rRNA internal transcribed spacer region (ITS) and by examining symbiont morphology with transmission electron (TEM) and confocal microscopy (CM). As described previously for other s...

  17. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An


    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  18. Secondary structure analyses of the nuclear rRNA internal transcribed spacers and assessment of its phylogenetic utility across the Brassicaceae (mustards). (United States)

    Edger, Patrick P; Tang, Michelle; Bird, Kevin A; Mayfield, Dustin R; Conant, Gavin; Mummenhoff, Klaus; Koch, Marcus A; Pires, J Chris


    The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1.) Ease of amplification due to high copy number of the gene clusters, 2.) Available cost-effective methods and highly conserved primers, 3.) Rapidly evolving markers (i.e. variable between closely related species), and 4.) The assumption (and/or treatment) that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC) content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships. PMID:24984034

  19. Secondary structure analyses of the nuclear rRNA internal transcribed spacers and assessment of its phylogenetic utility across the Brassicaceae (mustards.

    Directory of Open Access Journals (Sweden)

    Patrick P Edger

    Full Text Available The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1. Ease of amplification due to high copy number of the gene clusters, 2. Available cost-effective methods and highly conserved primers, 3. Rapidly evolving markers (i.e. variable between closely related species, and 4. The assumption (and/or treatment that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships.

  20. Diversity of Aphanizomenon flos-aquae (Cyanobacterium) Populations along a Baltic Sea Salinity Gradient


    Laamanen, Maria J.; Forsström, Laura; Sivonen, Kaarina


    Colony-forming cyanobacteria of the genus Aphanizomenon form massive blooms in the brackish water of the Baltic Sea during the warmest summer months. There have been recent suggestions claiming that the Baltic Sea Aphanizomenon species may be different from Aphanizomenon flos-aquae found in lakes. In this study, we examined variability in the morphology and 16S-23S rRNA internal transcribed spacer (ITS) sequences of A. flos-aquae populations along a salinity gradient from a string of lakes to...

  1. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.


    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  2. Potential use of molecular-typing methods for the identification and characterization of salmonella enterica serotypes isolated in the poultry production chain

    Directory of Open Access Journals (Sweden)

    CM Baratto


    Full Text Available Salmonella is widespread in nature and can be found in all links of the poultry production chain. Due to its high impact on meat processing, techniques for the rapid detection and reproducible characterization of Salmonella serotypes in foods are needed. The present study investigated the potential of molecular profiling to identify and differentiate 15 Salmonella serotypes isolated from the poultry production chain, based on 5 primers by random amplified polymorphic DNA (RAPD, enterobacterial repetitive intergenic consensus (ERIC-PCR, amplification of rDNA internal spacer analysis (RISA, and amplified ribosomal DNA restriction analysis (ARDRA of 16S-23S rRNA internal spacer region (ISR cleaved with Alu I and Hha I restriction enzymes. Three isolates of each serotype were analyzed for the identification of similar and different profiles. Dendrograms were constructed from molecular profiles using the UPGMA method (unweighted pair-group method for the arithmetic averages and the software program WinBoot. The present study indicates the usefulness of RISA and ARDRA of the 16S-23S rRNA intergenic spacer region (ISR for systematic, epidemiological, and diagnostic purposes. Since these techniques can be used for the differentiation of serotypes, they are highly promising for the characterization of Salmonella serotypes and intra-serotypes. Data indicate that these techniques may be used to produce more consistent, reliable, and reproducible results in the identification and epidemiological study (traceability of Salmonella in the poultry industry.

  3. Novel Species Including Mycobacterium fukienense sp. Is Found from Tuberc-ulosis Patients in Fujian Province, China, Using Phylogenetic Analysis of Mycobacterium chelonae/abscessus Complex

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yuan Yuan; LI Yan Bing; HUANG Ming Xiang; ZHAO Xiu Qin; ZHANG Li Shui; LIU Wen En; WAN Kang Lin


    Objective To identify the novel species ‘Mycobacterium fukienense’ sp. nov of Mycobacterium chelonae/abscessus complex from tuberculosis patients in Fujian Province, China. Methods Five of 27 clinical Mycobacterium isolates (Cls) were previously identified as M. chelonae/abscessus complex by sequencing the hsp65, rpoB, 16S-23S rRNA internal transcribed spacer region (its), recA and sodA house-keeping genes commonly used to describe the molecular characteristics of Mycobacterium. Clinical Mycobacterium isolates were classified according to the gene sequence using a clustering analysis program. Sequence similarity within clusters and diversity between clusters were analyzed. Results The 5 isolates were identified with distinct sequences exhibiting 99.8% homology in the hsp65 gene. However, a complete lack of homology was observed among the sequences of the rpoB, 16S-23S rRNA internal transcribed spacer region (its), sodA, and recA genes as compared with the M. abscessus. Furthermore, no match for rpoB, sodA, and recA genes was identified among the published sequences. Conclusion The novel species, Mycobacterium fukienense, is identified from tuberculosis patients in Fujian Province, China, which does not belong to any existing subspecies of M. chelonea/abscessus complex.

  4. Downregulation of rRNA Transcription Triggers Cell Differentiation


    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura


    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  5. Downregulation of rRNA transcription triggers cell differentiation.

    Directory of Open Access Journals (Sweden)

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  6. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Czech Academy of Sciences Publication Activity Database

    Caisová, Lenka


    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  7. International

    International Nuclear Information System (INIS)

    This rubric reports on 10 short notes about international economical facts about nuclear power: Electricite de France (EdF) and its assistance and management contracts with Eastern Europe countries (Poland, Hungary, Bulgaria); Transnuclear Inc. company (a 100% Cogema daughter company) acquired the US Vectra Technologies company; the construction of the Khumo nuclear power plant in Northern Korea plays in favour of the reconciliation between Northern and Southern Korea; the delivery of two VVER 1000 Russian reactors to China; the enforcement of the cooperation agreement between Euratom and Argentina; Japan requested for the financing of a Russian fast breeder reactor; Russia has planned to sell a floating barge-type nuclear power plant to Indonesia; the control of the Swedish reactor vessels of Sydkraft AB company committed to Tractebel (Belgium); the renewal of the nuclear cooperation agreement between Swiss and USA; the call for bids from the Turkish TEAS electric power company for the building of the Akkuyu nuclear power plant answered by three candidates: Atomic Energy of Canada Limited (AECL), Westinghouse (US) and the French-German NPI company. (J.S.)

  8. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer


    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard


    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  9. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.


    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  10. Morphological characteristics and phylogenetic analyses of unusual morphospecies of Microcystis novacekii forming bloom in the Cheffia Dam (Algeria

    Directory of Open Access Journals (Sweden)

    Noureddine BOUAÏCHA


    Full Text Available The toxicological potential and morphological characteristics and phylogenetic analysis based on the 16S rDNA sequence and the 16S-23S rDNA internal transcribed spacer (ITS were investigated in unusual morphospecies of Microcystis (MCYS-CH01 isolated from the Cheffia Dam in Algeria. The presence of microcystin synthetase genes (mcyA, -B, and -C in isolated colonies of this morphospecies, and the fact that serine/threonine phosphatase (PP2A was inhibited by its crude extract indicated that this morphospecies was microcystin-producer. The morphological features of this unusual morphospecies were very different from any of those described in the literature of all known species of Microcystis. The phylogenic tree based on 16S rDNA sequences shows that this morphospecies is indistinguishable from the reference strain Microcystis aeruginosa PCC 7806 and from many other known Microcystis species and, therefore, this tree did not necessarily correlate to the distinctions between morphospecies. However, phylogenetic analysis based on the 16S-23S rRNA spacer region could be an effective way to assign this unusual morphospecies MCYS-CH01 to the Asian species Microcystis novacekii. Comparison of the ITS sequence of this morphospecies with sequences available in the GenBank database showed that some highly conserved genotypes are found throughout the world.

  11. rRNA fragmentation induced by a yeast killer toxin. (United States)

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm


    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  12. Regulation of Arabidopsis thaliana 5S rRNA Genes. (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette


    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  13. Morphological and molecular characterization within 26 strains of the genus Cylindrospermum (Nostocaceae, Cyanobacteria), with description of three new species

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Bohunická, Markéta; Lukešová, Alena; Hrčková, Kristýna; Vaccarino, M. A.; Chesarino, N. M.


    Roč. 50, č. 1 (2014), s. 187-202. ISSN 0022-3646 Institutional support: RVO:67985939 ; RVO:60077344 Keywords : 16S rRNA gene * 16S-23S ITS * Nostocaceae * polyphasic approach Subject RIV: EF - Botanics; EE - Microbiology , Virology (BC-A) Impact factor: 2.844, year: 2014

  14. A polyphasic taxonomic approach in isolated strains of Cyanobacteria from thermal springs of Greece. (United States)

    Bravakos, Panos; Kotoulas, Georgios; Skaraki, Katerina; Pantazidou, Adriani; Economou-Amilli, Athena


    Strains of Cyanobacteria isolated from mats of 9 thermal springs of Greece have been studied for their taxonomic evaluation. A polyphasic taxonomic approach was employed which included: morphological observations by light microscopy and scanning electron microscopy, maximum parsimony, maximum likelihood and Bayesian analysis of 16S rDNA sequences, secondary structural comparisons of 16S-23S rRNA Internal Transcribed Spacer sequences, and finally environmental data. The 17 cyanobacterial isolates formed a diverse group that contained filamentous, coccoid and heterocytous strains. These included representatives of the polyphyletic genera of Synechococcus and Phormidium, and the orders Oscillatoriales, Spirulinales, Chroococcales and Nostocales. After analysis, at least 6 new taxa at the genus level provide new evidence in the taxonomy of Cyanobacteria and highlight the abundant diversity of thermal spring environments with many potential endemic species or ecotypes. PMID:26899923

  15. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;


    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  16. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification. (United States)

    Sharma, Sunny; Lafontaine, Denis L J


    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  17. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules. (United States)

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E


    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  18. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  19. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang


    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  20. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes


    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.


    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  1. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable


    Page, R.D.M.; Cruickshank, R.; Johnson, K P


    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  2. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.


    Selenska-Pobell, S; Evguenieva-Hackenberg, E


    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  3. Rapid Identification of Pathogenic Bacteria by means of Two Conservative Gene Loci' Specific PCR-CE-RFLP

    Institute of Scientific and Technical Information of China (English)

    高鹏; 张卓然; 徐维家; 安万新; 张晓慧; 戴兵; 范艳萍; 王运锋; 李萍; 温杰; 于卫健; 高向仪; 谢凡迪; 王永海


    To establish a rapid identification method for common pathogenic bacteria on the basis of molecular biology and to construct a preliminary Polymerase Chain Reaction-Capillary Electrophoresis-Restriction Fragment Length Polymorphism (PCR-CE-RFLP) database of bacteria isolated from clinical specimens frequently, 183 strains collected from clinical samples belonging to 12 genera and 19 species whose biochemical characterizations corresponded to the typical ones were examined.The genomic DNAs were amplified by two pairs of fluorescence labeled primers aiming at 16S rRNA gene and 16S-23S rRNA spacer region gene respectively at the same time. PCR products were then digested by restriction endonuclease Hae Ⅲ in-completely before taking capillary electrophoresis. The results with the PCR-CE-RFLP patterns of 16S rRNA genes were just alike within some genera, but when it comes to 16S-23S rRNA spacer region genes, each bacterium showed a unique pattern, which can be distinguished from each other easily. It seems that PCR-CE-RFLP patterns of 16S rRNA gene could only be used to classify the bacteria into family level, whereas the data of 16S-23S rRNA spacer region gene could be utilized to identify the whole microorganisms as precisely as the species level. In spite of the data of the spacer region gene alone can be sufficiently to verify the whole bacteria, we insist that the 16S rRNA gene could be of some assistant in case that there should be lots of families of bacteria, in which some similar ones, with the same RFLP data of 16S-23S rRNA spacer region gene, may coexist. This study proves that the utility of PCR-CE-RFLP is a convenient, rapid method to identify pathogenic bacteria, and is also a quick diagnosis measure for application to clinical use.

  4. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae


    Deguo Wang; Yanhong Liu


    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactia...

  5. Stable morphospecies within the 16S rRNA monophyletic genus .i.Microcystis./i. (KÜTZING) KÜTZING

    Czech Academy of Sciences Publication Activity Database

    Komárková, Jaroslava; Mugnai, M. A.; Sili, C.; Komárek, Ondřej; Turicchia, S.

    -, č. 117 (2005), s. 279-295. ISSN 0342-1120. [Symposium of the International Association for Cyanophyte Research /16./. Luxembourg, 30.08.2004–03.09.2004] R&D Projects: GA AV ČR(CZ) IBS6017004 Grant ostatní: EU(XE) MIDI-CHIP EVK2-CT-1999-00026 Institutional research plan: CEZ:AV0Z60170517 Keywords : Microcystis * morhpospecies * 16S rRNA Subject RIV: EE - Microbiology, Virology

  6. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.


    Honoré, N; Marchal, G.; Cole, S T


    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  7. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    International Nuclear Information System (INIS)

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  8. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states (United States)

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.


    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  9. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    Directory of Open Access Journals (Sweden)

    David Kamanda Ngugi

    Full Text Available Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C and salinity (~41 psu from the mixed layer (~200 m to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS region of SAR11 in different depths of the Red Sea's water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen on the population dynamics of this ubiquitous marine bacterium.

  10. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David Kamanda


    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  11. Depletion of pre-16S rRNA in starved Escherichia coli cells. (United States)

    Cangelosi, G A; Brabant, W H


    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  12. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis


    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja


    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  13. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;


    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  14. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences. (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R


    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  15. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.


    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  16. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren


    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  17. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline


    Trieber, Catharine A.; Taylor, Diane E.


    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  18. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium


    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.


    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  19. Functional interactions within 23S rRNA involving the peptidyltransferase center.


    Douthwaite, S


    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  20. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing. (United States)

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui


    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  1. Mycoplasmas hyorhinis in different regions of cuba: diagnosis

    Directory of Open Access Journals (Sweden)

    Evelyn Lobo


    Full Text Available M. hyorhinis is considered one of the etiological agents of arthritis in sucking pigs, but recently as seen, some strains can produce pneumonia that could not be distinguished from the mycoplasmosis caused by M. hyopneumoniae. The study was conducted to research the presence of Mycoplasma hyorhinis (M. hyorhinis in different regions of the country from exudates of pig lungs with typical EP lesions. Exudates from 280 pig lungs with typical EP lesions were studied using molecular techniques such as PCR, real time PCR and amplification of the 16S-23S rRNA. It was detected that the 66% of the samples studied resulted positive to M. hyorhinis, and the presence of this species was detected in all the provinces. Amplification and studies on the intergenic region 16S-23S of M. hyorhinis rRNA demonstrated the existing variability among strains of a same species. This study is the first report on M. hyorhinis detection in Cuba.

  2. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence. (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  3. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species. (United States)

    Park, Y K; Park, K C; Park, C H; Kim, N S


    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  4. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  5. Diversity and Antimicrobial Properties of Lactic Acid Bacteria Isolated from Rhizosphere of Olive Trees and Desert Truffles of Tunisia


    Imene Fhoula; Afef Najjari; Yousra Turki; Sana Jaballah; Abdelatif Boudabous; Hadda Ouzari


    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while onl...

  6. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil (United States)

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo


    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs). PMID:27231360

  7. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B;


    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  8. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.


    Fujiwara, H.; H. Ishikawa


    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  9. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Directory of Open Access Journals (Sweden)

    Susan M Huse


    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  10. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  11. A yeast transcription system for the 5S rRNA gene.


    Keulen, H.; Thomas, D. Y.


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  12. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition


    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James


    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  13. Depletion of pre-16S rRNA in starved Escherichia coli cells.


    Cangelosi, G A; Brabant, W H


    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  14. Strength and Regulation of Seven rRNA Promoters in Escherichia coli (United States)

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira


    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  15. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage


    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.


    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  16. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination


    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.


    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  17. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.


    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  18. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Czech Academy of Sciences Publication Activity Database

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.


    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  19. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik


    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  20. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Czech Academy of Sciences Publication Activity Database

    Krásný, Libor; Gourse, Richard. L.


    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  1. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S


    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  2. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L


    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  3. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA


    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing


    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  4. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    DEFF Research Database (Denmark)

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.


    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  5. Distribution and diversity of Prochlorococcus ecotypes in the Red Sea

    KAUST Repository

    Shibl, Ahmed A.


    Photosynthetic prokaryotes of the genus Prochlorococcus play a major role in global primary production in the world\\'s oligotrophic oceans. A recent study on pelagic bacterioplankton communities in the northern and central Red Sea indicated that the predominant cyanobacterial 16S rRNA gene sequence types were from Prochlorococcus cells belonging to a high-light-adapted ecotype (HL II). In this study, we analyzed microdiversity of Prochlorococcus sp. at multiple depths within and below the euphotic zone in the northern, central, and southern regions of the Red Sea, as well as in surface waters in the same locations, but in a different season. Prochlorococcus dominated the communities in clone libraries of the amplified 16S-23S rRNA internal transcribed spacer (ITS) region. Almost no differences were found between samples from coastal or open-water sites, but a high diversity of Prochlorococcus ecotypes was detected at 100-meter depth in the water column. In addition, an unusual dominance of HL II-related sequences was observed in deeper waters. Our results indicate that the Red Sea harbors diverse Prochlorococcus lineages, but no novel ecotypes, despite its unusual physicochemical properties. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  6. Cyanobacterial diversity and a new acaryochloris-like symbiont from Bahamian sea-squirts.

    Directory of Open Access Journals (Sweden)

    Susanna López-Legentil

    Full Text Available Symbiotic interactions between ascidians (sea-squirts and microbes are poorly understood. Here we characterized the cyanobacteria in the tissues of 8 distinct didemnid taxa from shallow-water marine habitats in the Bahamas Islands by sequencing a fragment of the cyanobacterial 16S rRNA gene and the entire 16S-23S rRNA internal transcribed spacer region (ITS and by examining symbiont morphology with transmission electron (TEM and confocal microscopy (CM. As described previously for other species, Trididemnum spp. mostly contained symbionts associated with the Prochloron-Synechocystis group. However, sequence analysis of the symbionts in Lissoclinum revealed two unique clades. The first contained a novel cyanobacterial clade, while the second clade was closely associated with Acaryochloris marina. CM revealed the presence of chlorophyll d (chl d and phycobiliproteins (PBPs within these symbiont cells, as is characteristic of Acaryochloris species. The presence of symbionts was also observed by TEM inside the tunic of both the adult and larvae of L. fragile, indicating vertical transmission to progeny. Based on molecular phylogenetic and microscopic analyses, Candidatus Acaryochloris bahamiensis nov. sp. is proposed for this symbiotic cyanobacterium. Our results support the hypothesis that photosymbiont communities in ascidians are structured by host phylogeny, but in some cases, also by sampling location.

  7. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds. (United States)

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy


    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life. PMID:23316189

  8. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Directory of Open Access Journals (Sweden)

    Gbenga Adedeji Adewumi


    Full Text Available In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the sixteen iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, Staphylococcus saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and Uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA combined with 16S-23S rRNA gene internal transcribed spacer (ITS PCR amplification, restriction analysis (ITS-PCR-RFLP and randomly amplified polymorphic DNA (RAPD-PCR. This further discriminated Bacillus subtilis and its variants from food-borne pathogens such as Bacillus cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP for iru production to achieve product consistency, safety quality and improved shelf life.

  9. Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR


    Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo


    A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs desig...

  10. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  11. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Frédéric Pontvianne


    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  12. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment. (United States)

    Kwasniewska, Jolanta; Jaskowiak, Joanna


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  13. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip


    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  14. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA. (United States)

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E


    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  15. Characterization of ISR region and development of a PCR assay for rapid detection of the fish pathogen Tenacibaculum soleae. (United States)

    López, Jose R; Hamman-Khalifa, Abdel M; Navas, José I; de la Herran, Roberto


    The aims of this work were to characterize the 16S-23S internal spacer region of the fish pathogen Tenacibaculum soleae and to develop a PCR assay for its identification and detection. All T. soleae strains tested displayed a single internal spacer region class, containing tRNA(I) (le) and tRNA(A) (la) genes; nevertheless, a considerable intraspecific heterogeneity was observed. However, this region proved to be useful for differentiation of T. soleae from related and non-related species. Species-specific primers were designed targeting the 16S rRNA gene and the internal spacer region region, yielding a 1555-bp fragment. Detection limit was of 1 pg DNA per reaction (< 30 bacterial cells) when using pure cultures. The detection level in the presence of DNA from fish or other bacteria was lower; however, 10 pg were detected at a target/background ratio of 1 : 10(5) . The PCR assay proved to be more sensitive than agar cultivation for the detection of T. soleae from naturally diseased fish, offering a useful tool for diagnosis and for understanding the epidemiology of this pathogen. PMID:22092820

  16. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.


    Escalante, A A; Ayala, F. J.


    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  17. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.


    Felske, A; B. Engelen; Nübel, U; Backhaus, H


    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  18. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA


    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.


    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  19. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.


    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F


    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  20. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.


    Haltiner, M M; Smale, S T; Tjian, R


    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  1. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta


    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.


    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  2. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes


    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun


    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  3. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk


    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  4. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.


    A 16S rRNA gene database ( addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  5. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness. (United States)

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan


    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  6. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines. (United States)

    Chukwudi, Chinwe U


    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  7. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam


    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  8. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses. (United States)

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi


    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  9. Details of gastropod phylogeny inferred from 18S rRNA sequences. (United States)

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R


    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  10. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. (United States)

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  11. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials. (United States)

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H


    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment. PMID:23661261

  12. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles


    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  13. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.


    Fujiwara, H.; Kawata, Y.; H. Ishikawa


    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  14. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Directory of Open Access Journals (Sweden)

    Peano Clelia


    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  15. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.


    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.


    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  16. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae


    Pronk, Loes M; Sanderson, Kenneth E.


    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  17. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  18. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    Directory of Open Access Journals (Sweden)

    A Azazy Ahmed


    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  19. The role of human ribosomal proteins in the maturation of rRNA and ribosome production


    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica


    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  20. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    Institute of Scientific and Technical Information of China (English)


    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  1. Altered features in the secondary structure of Vicia faba 5.8s rRNA.


    Nazar, R N; Wildeman, A G


    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  2. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S


    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  3. Evolution of green plants as deduced from 5S rRNA sequences


    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  4. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B


    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...


    Directory of Open Access Journals (Sweden)

    G. S. Andriiash


    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  6. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes (United States)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.


    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  7. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard† (United States)

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús


    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  8. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens


    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  9. Isolation and phylogenetic analysis of Bartonella species from wild carnivores of the suborder Caniformia in Japan. (United States)

    Sato, Shingo; Kabeya, Hidenori; Miura, Tatsuya; Suzuki, Kazuo; Bai, Ying; Kosoy, Michael; Sentsui, Hiroshi; Kariwa, Hiroaki; Maruyama, Soichi


    The prevalence of Bartonella species was investigated among wild carnivores of the suborder Caniformia, including 15 Japanese badgers (Meles anakuma), 8 Japanese martens (Martes melampus), 2 Japanese weasels (Mustela itatsi), 1 Siberian weasel (Mustela sibirica), 171 raccoon dogs (Nyctereutes procyonoides), and 977 raccoons (Procyon lotor) in Japan. Bartonella bacteria were isolated from one Japanese badger (6.7%) and from one Japanese marten (12.5%); however, no Bartonella species was found in other representatives of Caniformia. Phylogenetic analysis was based on concatenated sequences of six housekeeping genes (16S rRNA, ftsZ, gltA, groEL, ribC, and rpoB) and sequence of the 16S-23S internal transcribed spacer region. The sequence analysis indicated that the isolate derived from the Japanese badger (strain JB-15) can represent a novel Bartonella species and the isolate from the Japanese marten (strain JM-1) was closely related to Bartonella washoensis. This is the first report on isolation of Bartonella from badger and marten. PMID:22841404


    Hynes, Annette M; Webb, Eric A; Doney, Scott C; Waterbury, John B


    The filamentous, colonial cyanobacterium Trichodesmium has six well-described species, but many more names. Traditional classification was based on field samples using morphological characteristics such as cell width and length, gas vesicle distribution, and colony morphology. We used the Woods Hole Trichodesmium culture collection to identify 21 cultured strains to species using cell morphology; phycobiliprotein absorption spectra; and sequences of the 16S rRNA gene, the 16S-23S internal transcribed spacer (ITS), and the heterocyst differentiation gene hetR. We compared our results to previous studies of field specimens and found similar clades, though not all phylogenetic groups were represented in culture. Our culture collection represented two of the four major clades of Trichodesmium: clade I, made up of Trichodesmium thiebautii Gomont, Trichodesmium tenue Wille, Katagnymene spiralis Lemmerm., and Trichodesmium hildebrandtii Gomont; and clade III, consisting of Trichodesmium erythraeum Ehrenb. and Trichodesmium contortum Wille. These clades were genetically coherent with similar phycobiliprotein composition, but morphologically diverse. In the continual revision of cyanobacterial taxonomy, genetic and biochemical information is useful and informative complements to morphology for the development of a functional classification scheme. PMID:27009664

  11. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics. (United States)

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G


    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  12. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes (United States)

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing


    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  13. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes. (United States)

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing


    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  14. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D;


    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  15. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A


    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  16. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  17. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae. (United States)

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C


    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  18. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    DEFF Research Database (Denmark)

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;


    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  19. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  20. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Directory of Open Access Journals (Sweden)

    Chi-Yong Ahn


    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  1. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis. (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio


    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  2. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah


    Fread Anderios; Daw Khin Saw Naing; Zaw Lin


    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  3. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.


    Dron, M; Rahire, M; Rochaix, J D


    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  4. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming


    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  5. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis


    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M


    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website ( RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  6. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.


    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  7. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol (United States)

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco


    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  8. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis


    El Saied, H.E.


    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  9. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  10. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4


    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  11. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    DEFF Research Database (Denmark)

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;


    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  12. Automated identification of medically important bacteria by 16S rRNA gene sequencing using a novel comprehensive database, 16SpathDB


    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung


    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB ( based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiol...

  13. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Douthwaite, S


    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  14. Estimation of 16S rRNA gene copy number in several probiotic Lactobacillus strains isolated from the gastrointestinal tract of chicken


    Lee, Chin Mei; Sieo, Chin Chin; Abdullah, Norhani; Ho, Yin Wan


    The copy numbers of 16S rRNA genes in 12 probiotic Lactobacillus strains of poultry origin were analyzed. Genomic DNA of the strains was digested with restriction endonucleases that do not cut within the 16S rRNA gene of the strains. This was followed by Southern hybridization with a biotinylated probe complementary to the 16S rRNA gene. The copy number of the 16S rRNA gene within a Lactobacillus species was found to be conserved. From the hybridization results, Lactobacillus salivarius I 24 ...

  15. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    Institute of Scientific and Technical Information of China (English)

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁


    muscle. The signal intensities of 18S rRNA among tissues were consistent, which showed that the 18S rRNA gene expressed stably in different tissues and could be used as an internal standard for researches of specific gene expression in prawns.

  16. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J;


    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure is...

  17. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Czech Academy of Sciences Publication Activity Database

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.


    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  18. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    DEFF Research Database (Denmark)

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.; Schwarz, S.; Vester, B.


    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and...

  19. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei. (United States)

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit


    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  20. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    Digital Repository Service at National Institute of Oceanography (India)

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  1. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp. (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  2. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Directory of Open Access Journals (Sweden)

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  3. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;


    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times for...... identification were 1.5 days and 2.8 days, respectively....

  4. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Czech Academy of Sciences Publication Activity Database

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.


    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  5. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli. (United States)

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L


    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  6. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Directory of Open Access Journals (Sweden)

    Kumar Nikhil


    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  7. International arbejdsdeling

    DEFF Research Database (Denmark)

    Henten, Anders


    Article dealing with the implications of informátion and communication technologies on the international division of labour.......Article dealing with the implications of informátion and communication technologies on the international division of labour....

  8. International safeguards

    International Nuclear Information System (INIS)

    The following topics are covered in this chapter: basis for international safeguards; basis for applying international safeguards in US facilities; application of international safeguards at the facility level; and example of application of international safeguards at a low-enriched uranium fuel fabrication facility including material balance area structure and key measurement points, inspection activities, auditing operator's measurement system, verifying nuclear material, containment and surveillance measures, and inspector's conclusions

  9. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A


    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  10. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus (United States)

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  11. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.


    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  12. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J


    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  13. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P;


    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  14. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR. (United States)

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B


    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  15. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene. (United States)

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao


    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  16. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S


    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  17. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Directory of Open Access Journals (Sweden)

    Shenkar Noa


    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  18. 16S rRNA gene survey of microbial communities in Winogradsky columns.

    Directory of Open Access Journals (Sweden)

    Ethan A Rundell

    Full Text Available A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities.

  19. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes. (United States)

    Groben, René; Medlin, Linda


    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  20. Molecular confirmation of Trichomonas gallinae and other parabasalids from Brazil using the 5.8S and ITS-1 rRNA regions. (United States)

    Ecco, Roselene; Preis, Ingred S; Vilela, Daniel A R; Luppi, Marcela M; Malta, Marcelo C C; Beckstead, Robert B; Stimmelmayr, Raphaela; Stimmelmayer, Raphaela; Gerhold, Richard W


    Clinical, gross, and histopathology lesions and molecular characterization of Trichomonas spp. infection were described in two striped owls (Asio (Rhinoptynx) clamator), one American kestrel (Falco sparverius), two green-winged saltators (Saltator similis), and in a toco toucan (Ramphastos toco) from Brazil. These birds presented clinical signs including emaciation, ruffled feathers, abundant salivation and open mouth breathing presumably due to abundant caseous material. Gross lesions were characterized by multifocal yellow friable plaques on the surface of the tongue, pharynx and/or caseous masses partially occluding the laryngeal entrance. In the owls, the caseous material extended into the mandibular muscles and invaded the sinuses of the skull. Histopathologically, marked necrotic and inflammatory lesions were associated with numerous round to oval, pale eosinophilic structures (6-10μm) with basophilic nuclei, consistent with trichomonads. Organisms similar to those described above also were found in the liver of the two green-winged saltators. To the authors' knowledge, this is the first report of trichomonosis in a striped owl and a toco toucan. Sequence analysis of the Trichomonas spp. internal transcribed spacer 1 (ITS-1) region and partial 5.8S of the ribosomal RNA (rRNA) disclosed significant genetic diversity. Two sequences had 100% identity to Trichomonas gallinae, whereas two sequences had a 99% and 92% identity to a Trichomonas vaginalis-like sequence, respectively. One sequence (green-winged saltator 502-08) had a 100% identity to a newly recognized genus Simplicomonas. PMID:22749289

  1. Phylogeny and classification of the Litostomatea (Protista, Ciliophora), with emphasis on free-living taxa and the 18S rRNA gene. (United States)

    Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm


    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of species ranging from aerobic, free-living predators to anaerobic endocommensals. This is traditionally reflected by classifying the Litostomatea into the subclasses Haptoria and Trichostomatia. The morphological classifications of the Haptoria conflict with the molecular phylogenies, which indicate polyphyly and numerous homoplasies. Thus, we analyzed the genealogy of 53 in-group species with morphological and molecular methods, including 12 new sequences from free-living taxa. The phylogenetic analyses and some strong morphological traits show: (i) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea and (ii) three distinct lineages (subclasses): the Rhynchostomatia comprising Tracheliida and Dileptida; the Haptoria comprising Lacrymariida, Haptorida, Didiniida, Pleurostomatida and Spathidiida; and the Trichostomatia. The curious Homalozoon cannot be assigned to any of the haptorian orders, but is basal to a clade containing the Didiniida and Pleurostomatida. The internal relationships of the Spathidiida remain obscure because many of them and some "traditional" haptorids form separate branches within the basal polytomy of the order, indicating one or several radiations and convergent evolution. Due to the high divergence in the 18S rRNA gene, the chaeneids and cyclotrichiids are classified incertae sedis. PMID:21333743

  2. Detection of Renibacterium salmoninarum in tissue samples by sequence capture and fluorescent PCR based on the 16S rRNA gene. (United States)

    Königsson, Malin Heldtander; Ballagi, Andras; Jansson, Eva; Johansson, Karl-Erik


    The 16S rRNA genes from eight isolates of Renibacterium salmoninarum with different origins and dates of isolation were sequenced to evaluate the possibility to construct a diagnostic PCR system with target sites within this gene. The sequences were found to be identical but for one single position in one of the isolates, and two regions with an adequate number of nucleotide differences as compared to closely related species were identified. Species-specific fluorescent PCR primers complementary to these regions were constructed as well as oligonucleotides for DNA preparation by sequence capture. A mimic molecule was constructed to be used as an internal control. The PCR was specific and allowed the detection of DNA equivalent to 1-10 R. salmoninarum genomes per reaction. The DNA preparation with sequence capture and analysis by PCR with a mimic was found to be a reliable method for analysis of kidneys from fish with BKD. The amount of PCR inhibiting substances present in the tissue was reduced, and the relevant DNA was concentrated in the capture step. Furthermore, the use of the mimic molecule in the system assured that false negative results could be identified. PMID:15708821

  3. Complete genome sequence of Microbacterium sp. CGR1, bacterium tolerant to wide abiotic conditions isolated from the Atacama Desert. (United States)

    Mandakovic, Dinka; Cabrera, Pablo; Pulgar, Rodrigo; Maldonado, Jonathan; Aravena, Pamela; Latorre, Mauricio; Cambiazo, Verónica; González, Mauricio


    Microbacterium sp. CGR1 (RGM2230) is an isolate from the Atacama Desert that displays a wide pH, salinity and temperature tolerance. This strain exhibits riboflavin overproducer features and traits for developing an environmental arsenic biosensor. Here, we report the complete genome sequence of this strain, which represents the first genome of the genus Microbacterium sequenced and assembled in a single contig. The genome contains 3,634,864bp, 3299 protein-coding genes, 45 tRNAs, six copies of 5S-16S-23S rRNA and a high genome average GC-content of 68.04%. PMID:26521698

  4. Taxonomic resolution, ecotypes and the biogeography of Prochlorococcus


    Martiny, AC; Tai, APK; D. Veneziano; F. Primeau; Chisholm, SW


    Summary In order to expand our understanding of the diversity and biogeography of Prochlorococcus ribotypes, we PCR-amplified, cloned and sequenced the 16S/23S rRNA ITS region from sites in the Atlantic and Pacific oceans. Ninety-three per cent of the ITS sequences could be assigned to existing Prochlorococcus clades, although many novel subclades were detected. We assigned the sequences to operational taxonomic units using a graduated scale of sequence identity from 80% to 99.5% and correlat...

  5. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.


    Six Sarcocystis species from reindeer (S. grueneri, S. rangi, S. tarandivulpes, S. hardangeri, S. rangiferi and S. tarandi) have previously been genetically characterised. The aim of this study was to identify possible definitive hosts for S. hardangeri, S. rangiferi and S. tarandi by including the...... six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have...... any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  6. Distribution of DNA and localization of rRNA transcription in G2 phase nucleolus of Physarum polycephalum

    Institute of Scientific and Technical Information of China (English)


    Using electron microscopy, NAMA-Ur DNA selective staining and BrUTP incorporation, the nucleo lus ultrastructure, the distribution of DNA and the rRNA transcription sites in nucleolus of G2 phase Physarum poly cephalum were studied. The nucleolus was found to be different in structure from that of other plant cells. Fibrillar cen tern (FCs) were present in a large amount all over the nucleolus. DNA was distributed both in dense fibrillar components (DFC) and in FC. The DNA in the nucleolus was less condensed than that of the chromosome territory. These changes suggested that the transcription was active within the nucleolus. BrUTP incorporation localized the rRNA transcription in DFC and at the interface of FC and DFC, suggesting that the DNA in FC is in a storage form and only the rDNA in DFC is transcribed.

  7. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    Institute of Scientific and Technical Information of China (English)

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai


    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  8. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;


    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  9. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias


    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  10. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach. (United States)

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti


    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  11. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    DEFF Research Database (Denmark)

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;


    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes......, The SRB community was dominated by members of the Desulfosarcina-Desulfococcus group. This group accounted for up to 73% of the SRB detected and up to 70% of the SRB rRNA detected. The predominance was shown to be a common feature for different stations along the coast of Svalbard, In a top......-Desulfococcus group. A group of clone sequences (group SVAL1) most closely related to Desulfosarcina variabilis (91.2% sequence similarity) was dominant and was shown to be most abundant in situ, accounting for up to 54.8% of the total SRB detected. A comparison of the two methods used for quantification showed...

  12. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal. (United States)

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E


    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  13. Internal branding


    Rai, Anu; omanga, josphat


    The project report provides an insight into internal branding of two different leading firms – Coca-Cola and Google. The aim of this project report is to study how these two companies use internal branding to promote or build brand performance of the company. This report follows a qualitative research method. The report is deductive in nature and hence, it is guided by the literatures of internal branding. The project report conducted research on brand identity, brand commitment and brand...

  14. International marketing


    Cateora, Philip R.


    The international marketplace has been transformed in recent years by shifts in trading patterns and practices. These changes have been reinforced by new technologies and evolving economic relationships. This paper is an attempt to integrate these developments into the burgeoning literature on international marketing as well as recent research findings. The research emphasis within the subject has evolved alongside changes in the stress given to key aspects of international trade. The preoccu...

  15. Internal audit


    Topor, Peter


    Master's thesis is referring the importance and requirement of internal audit in middle sized enterprises. It summarizes theoretical basis for the implementation of internal audit's profession and its legislative environment. Thesis is focused on the analysis of the processes of administration and record keeping of leasing agreements in corporation. Based on the analysis, solutions and measures concerning internal controls are proposed. Goal of the Master's thesis is to refer the importance o...

  16. CNN International


    Swann, David


    Dr David Swann interviewed by CNN International for a special programme series profiling international designers- 90 seconds vignette showcased innovative solutions from around the world. A theme week on CNN International and concluded with a half hour program special in September. The campaign was played to CNN’s television and online audiences with a global reach of 2 billion in 200 countries and 271 million households around the world.

  17. International Perspectives. (United States)

    Allen, Kenn; Habermann, Ulla; Chowdhury, Omar Faruque; Guerra, Iraida Manzanilla


    Includes "Introduction to International Perspectives" (Allen); "Volunteerism in the Welfare State: The Case of Denmark" (Habermann); "Grassroots Organizing in Bangladesh" (Chowdhury); and "Volunteerism in Latin America" (Guerra). (SK)

  18. Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates


    Patel, Robin; Piper, Kerryl E.; Rouse, Mark S; Steckelberg, James M.; Uhl, Jim R.; Kohner, Peggy; Hopkins, Marlene K.; Cockerill, Franklin R.; Kline, Bruce C.


    The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faec...

  19. Unique 16S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain


    Elva Escobar-Briones; Eduardo Nájera-Hillman; Fernando Álvarez


    Amphipods of the species Eurythenes gryllus were collected at 2 locations on the abyssal plain (~3 400 m) of the Gulf of Mexico in order to test whether or not these scavenger amphipods are isolated in this peripheral sea or show connectivity by their predominant swimming behavior, moving horizontally along the abyssal water masses in the region. Partial sequences of the mitochondrial 16S rRNA gene from 2 individuals of E. gryllus were determined and showed small differences when compared to ...

  20. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis. (United States)

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał


    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  1. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing


    Diaz, Patricia I.; Abusleme, Loreto; Hong, Bo-Young; Amanda K. Dupuy; Linda D Strausbaugh


    Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction proced...

  2. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample


    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.


    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  3. Analysis of Mixed Sequencing Chromatograms and Its Application in Direct 16S rRNA Gene Sequencing of Polymicrobial Samples▿


    Kommedal, Øyvind; Karlsen, Bjarte; Sæbø, Øystein


    Investigation of clinical samples by direct 16S rRNA gene sequencing provides the possibility to detect nonviable bacteria and bacteria with special growth requirements. This approach has been particularly valuable for the diagnosis of patients who have received antibiotics prior to sample collection. In specimens containing more than one bacterium, direct sequencing gives mixed chromatograms that complicate further interpretation. We designed an algorithm able to analyze these ambiguous chro...

  4. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus. (United States)

    More, Ravi P; Purohit, Hemant J


    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  5. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing


    Jarvis, Karen G.; White, James R.; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E.


    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  6. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  7. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila.


    Butler, D. K.; Yasuda, L E; Yao, M C


    Large palindromic DNAs are found in a wide variety of eukaryotic cells. In Tetrahymena thermophila, a large palindrome is formed from a single rRNA gene (rDNA) during nuclear differentiation. We present evidence that a key step in the formation of the rDNA palindrome of T. thermophila involves homologous intramolecular recombination. Heteroduplex micronuclear rDNA molecules were constructed in vitro and microinjected into developing macronuclei, where they formed palindromes. Analysis of the ...

  8. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  9. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.


    Pettersson, B; Johansson, K. E.; Uhlén, M


    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing wa...

  10. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes


    Mu Peng; Xiaoxue Zi; Qiuyu Wang


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  11. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes. (United States)

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima


    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa. PMID:25351877

  12. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Directory of Open Access Journals (Sweden)

    Martins Cesar


    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  13. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    Institute of Scientific and Technical Information of China (English)

    ZHANG Junbin; LIU Xin


    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  14. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing. (United States)

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  15. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett


    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on and on

  16. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization. (United States)

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W


    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  17. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S


    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  18. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    Directory of Open Access Journals (Sweden)

    J.P. Casanova


    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  19. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4 (United States)

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  20. International Curriculums. (United States)

    Neal, Larry L.

    This workshop presentation on international curriculums in the field of parks, recreation, leisure, cultural services, and travel/tourism comments that the literature is replete with articles addressing what the field is about, but not about curriculum issues, models, and structure. It reports an international survey of 12 college educators…

  1. International indsats

    DEFF Research Database (Denmark)

    Sachs, Therese

    En analyse af Beredskabsstyrelsens internationale engagement og muligheder for international indsats fremover. Forslag til struktur logistisk og materielt samt til udvikling af personel-kompetencer......En analyse af Beredskabsstyrelsens internationale engagement og muligheder for international indsats fremover. Forslag til struktur logistisk og materielt samt til udvikling af personel-kompetencer...

  2. International skatteret

    DEFF Research Database (Denmark)

    Winther-Sørensen, Niels; Wittendorff, Jens


    De seneste 6 måneders udvikling indenfor international skatteret beskrives. NW-S har skrevet artiklens afsnit om udvalgte afgørelser og om EU-skatteret.......De seneste 6 måneders udvikling indenfor international skatteret beskrives. NW-S har skrevet artiklens afsnit om udvalgte afgørelser og om EU-skatteret....

  3. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion


    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel


    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  4. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis


    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.


    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  5. International Specialization

    DEFF Research Database (Denmark)

    Kleindienst, Ingo; Geisler Asmussen, Christian; Hutzschenreuter, Thomas;


    Whether and how international diversification and cross-border arbitrage affects firm performance remains one of the major unresolved research questions in the strategy and international business literatures. We propose that knowing how much a firm has internationally diversified tells us very...... little about performance implications, if we do not know, and do not ask, how the firm has diversified. Therefore, building on the two broad arguments of operating flexibility and location-specific commitment, we develop a theoretical framework that focuses on the extent to which a firm's international...... arbitrage strategy is characterized by specialization versus replication and argue that these different strategies may have differential impact on profitability and risk reduction. Developing a sophisticated measure of international specialization and using a unique panel data set of 92 German MNEs to test...

  6. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    DEFF Research Database (Denmark)

    Sahm, K.; MacGregor, BJ; Jørgensen, BB; Stahl, DA


    In the past, enumeration of sulphate-reducing bacteria (SRB) by cultivation-based methods generally contradicted measurements of sulphate reduction, suggesting unrealistically high respiration rates per cell. Here, we report evidence that quantification of SRB rRNA by slot-blot hybridization is a...... between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...... (SRR) measured with (SO42-)-S-35 tracer in whole-core incubations. While SRB abundance was highest near the surface, peaking at around 1.5cm, measured sulphate reduction rates were lowest in this region. A second peak of SRB rRNA was observed at the transition zone from oxidized to reduced sediment...

  7. Transport of rRNA into cytoplasm required for initiation of S phase in root meristem cells in Helianthus annuus L

    International Nuclear Information System (INIS)

    Cold treatment (10degC) of root meristems during a period longer than duration of the cell cycle in 20degC causes a blocking of most cells in G1. One of the causes of cell cycle blockade is the decrease of rRNA synthesis and inhibition of rRNA transport into cytoplasm. Transfer of seedlings to 20degC results in increase of rRNA synthesis and its transport to cytoplasm as well as transition of almost all cells from G1 to S during 3 hours. Synchronization of DNA replication, comprising cells within rows of cells, is preceded by similar transport patter of rRNA to cytoplasm. (Author)

  8. Juris International

    CERN Document Server

    A database on international trade law aimed at lawyers and legal counsel in developing and transition economies. Juris International is a multilingual collection (English, Spanish, and French) of legal information on international trade. Juris International aims to facilitate and reduce the work involved in research for business lawyers, advisers and in-house counsel, and state organizations in developing nd transition economies, by providing access to texts which have often been difficult to obtain. Its objective is to gather a large quantity of basic information at one site (favoring complete legal texts), without the need to send for the information, and consequently without excessive communication costs for users who d benefit from an efficient and cheap telecommunications network.

  9. Internal Bleeding (United States)

    ... 2 Diabetes, Heart Disease a Dangerous Combo Are 'Workaholics' Prone to OCD, Anxiety? ALL NEWS > Resources First ... pelvis, that are broken. Initially, internal bleeding may cause no symptoms, although an injured organ that is ...

  10. International Health (United States)

    ... create refugee populations with immediate and long-term health problems. Some of the major diseases currently affecting ... also an international problem which can affect people's health. Many countries and health organizations are working together ...

  11. Internal marketing


    Potter, Ned


    This chapter from The Library Marketing Toolkit focuses on Internal stakeholders. They often hold the purse-strings to our libraries, so marketing successfully to them is absolutely essential. The first part of this chapter covers language, telling stories, using statistics, marketing upwards and communicating your message well. The second part covers marketing with internal stakeholders, such as a parent company within whose branding guidelines you must promote the library, or marketing as p...

  12. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera


    Wörheide Gert; Erpenbeck Dirk; Voigt Oliver


    Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by...

  13. Update and evaluation of 16SpathDB, an automated comprehensive database for identification of medically important bacteria by 16S rRNA gene sequencing


    Yeung, Shiu-yan; 楊兆恩


    Identification of pathogens is one of the important duties of clinical microbiology laboratory. Traditionally, phenotypic tests are used to identify the bacteria. However, due to some limitations of the phenotypic tests, the bacteria may not be identified sometimes and cannot be identified promptly. 16S rRNA gene sequencing is a rapid and accurate method to achieve this target. It is especially useful for identify rare or slow growing bacteria. However, the interpretation of the 16S rRNA gene...

  14. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes


    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Janaína F. Araújo; Alinne P. de Castro; Barreto, Cristine C.; Mercedes M.C. Bustamante; Betania F. Quirino; Krüger, Ricardo H.


    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial ...

  15. Identificación de Yarrowia lipolytica (Ascomycota: Hemiascomycetes como contaminante en la obtención de amplificados del gen 28S rRNA de moluscos

    Directory of Open Access Journals (Sweden)

    Jenny Chirinos


    Full Text Available En el presente trabajo se identifica una secuencia de DNA no esperada proveniente de los amplificados del gen 28S rRNA de moluscos terrestres. Las extracciones de DNA se realizaron del tejido del pie de caracoles terrestres por el método del CTAB modificado. Las PCRs fueron llevadas a cabo con primers universales para el gen COI e iniciadores diseñados para moluscos, para el marcador 16S rRNA, 28S rRNA y la región ITS-2. Los tamaños aproximados de las bandas de los amplificados de moluscos fueron de 706 pb para el COI, 330 pb para el 16S rRNA, 900 pb para el ITS-2 y 583 pb para el 28S rRNA; un amplificado del último marcador fue de una longitud inesperada, ~340 pb. Las secuencias de DNA fueron comparadas con la base de datos del GenBank mediante el programa BLASTn y la muestra con la banda de tamaño inesperado resultó en un 100% de identidad y cobertura del 99% con el gen 26S rRNA de la levadura Yarrowia lipolytica. El análisis filogenético con Neighbour-Joining y los valores de divergencia confirmaron la identificación, proporcionando resultados que apoyan la ubicación taxonómica de la especie dentro del clado de los Hemiascomycetes.

  16. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja


    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  17. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Directory of Open Access Journals (Sweden)

    Maiväli Ülo


    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  18. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    Institute of Scientific and Technical Information of China (English)

    TANG Xianghai; YU Rencheng; ZHOU Mingjiang; YU Zhigang


    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs).This species consists of many strains that differ in their ability to produce toxins but have similar morphology,making identification difficult.In this study,species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A.minutum from two phylogenetic clades.We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes.Three ribotype-specific probes,M-GC-1,M-PC-2,and M-PC-3,were designed.The former is specific for the GC clade (“Global clade”) of A.minutum,the majority of which have been found non-toxic,and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade (“Pacific clade”).The specificity of these three probes was confirmed by FISH.All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions.However,the accessibility of rRNA molecules in ribosomes varied among the probe binding positions.Thus,there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1,M-PC-3),or just nucleolus (M-PC-2).Our results provide a methodological basis for studying the biogeography and population dynamics of A.minutum,and providing an early warning of toxic HABs.

  19. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH


    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  20. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    Directory of Open Access Journals (Sweden)

    Chia Sing eChan


    Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

  1. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4. (United States)

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A


    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  2. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Directory of Open Access Journals (Sweden)

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  3. Molecular identification of Trichinella spiralis and Trichinella britovi by diagnostic multiprimer large mitochondrial rRNA amplification. (United States)

    Borsuk, P; Moskwa, B; Pastusiak, K; Cabaj, W


    Trichinella parasites with different epidemiological features still occur in Europe and four species of genus Trichinella have been identified: T. spiralis, T. britovi, T. nativa and T. pseudospiralis. Until now, two of them, T. spiralis and T. britovi, have been identified in Poland. In our studies we selected sequence coding for large mitochondrial rRNA (mt LrDNA) as a genetic marker and developed a sensitive LrDNA multiprimer PCR assay allowing for rapid identification of T. spiralis and T. britovi, parasites present in wild and domestic animals in Poland. PMID:14505042

  4. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1


    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.


    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequen...

  5. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    Directory of Open Access Journals (Sweden)

    Wörheide Gert


    Full Text Available Abstract Background The cytoplasmic ribosomal small subunit (SSU, 18S ribosomal RNA (rRNA is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836, a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges and Calcarea (calcareous sponges. We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early

  6. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera (United States)


    Background The cytoplasmic ribosomal small subunit (SSU, 18S) ribosomal RNA (rRNA) is the most frequently-used gene for molecular phylogenetic studies. However, information regarding its secondary structure is neglected in most phylogenetic analyses. Incorporation of this information is essential in order to apply specific rRNA evolutionary models to overcome the problem of co-evolution of paired sites, which violates the basic assumption of the independent evolution of sites made by most phylogenetic methods. Information about secondary structure also supports the process of aligning rRNA sequences across taxa. Both aspects have been shown to increase the accuracy of phylogenetic reconstructions within various taxa. Here, we explore SSU rRNA secondary structures from the three extant classes of Phylum Porifera (Grant, 1836), a pivotal, but largely unresolved taxon of early branching Metazoa. This is the first phylogenetic study of poriferan SSU rRNA data to date that includes detailed comparative secondary structure information for all three sponge classes. Results We found base compositional and structural differences in SSU rRNA among Demospongiae, Hexactinellida (glass sponges) and Calcarea (calcareous sponges). We showed that analyses of primary rRNA sequences, including secondary structure-specific evolutionary models, in combination with reconstruction of the evolution of unusual structural features, reveal a substantial amount of additional information. Of special note was the finding that the gene tree topologies of marine haplosclerid demosponges, which are inconsistent with the current morphology-based classification, are supported by our reconstructed evolution of secondary structure features. Therefore, these features can provide alternative support for sequence-based topologies and give insights into the evolution of the molecule itself. To encourage and facilitate the application of rRNA models in phylogenetics of early metazoans, we present 52 SSU rRNA

  7. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.


    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L....... monocytogenes EGD in BHI. Filamentation was not induced by anaerobiosis only. Fluorescent in situ rRNA hybridization (FISH) of cells grown in BHI showed that the L. monocytogenes EGD filaments consisted of chains of individual slightly elongated cells. The rods formed by L. monocytogenes LO28 had the same size...... in air and CO2.. Septation and cell division were induced in the filaments after a CO2 downshift (i.e., exposure to air). In BHI, the number of colony forming units increased rapidly when L. monocytogenes EGD grown in CO2 was exposed to air whereas the number of L. monocytogenes LO28 remained almost...

  8. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata) (United States)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin


    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  9. 16s rRNA Identification of Pediococcus spp. from Broiler and Studies of Adherence Ability on Immobilized Mucus

    Directory of Open Access Journals (Sweden)

    Ema Damayanti


    Full Text Available The objectives of this research were to study taxonomical status of lactic acid bacteria (LAB isolated from broiler and adherence ability on mucus in vitro. Molecular analysis was performed by analyzing 16S rRNA gene using universal primer. The adherence assay on mucus was carried out using microplate method with total plate count (TPC, absorbance (A550 and confirmed by scanning electron microscopy (SEM. The results of this studies revealed that three of LAB isolates have closed relation to Pediococcus acidilactici (99.9% species.Three isolates of P. acidilactici have adherence ability on broiler mucus higher than that on porcine mucin with an adherence percentage of 55.5% versus 50.8% and absorbance A550 of 0.061 versus 0.051, respectively. The highest adherence ability showed by P. acidilactici R02 with adherence percentage was 59.3% and absorbance A550 = 0.068. Adherence on mucus were affected by the addition of 3 g/l of gastric juice and 0.3% (b/v of bile salt. Adherence analysis using SEM also showed that the adherence on broiler mucus was higher than the adherence on porcine mucin. Altogether this adherence studies, suggest that three isolates of P. acidilactici LAB were capable of colonizing host intestinal mucus in vitro as important property to be promising probiotic bacteria for broiler.Key words : adherence, broiler, Pediococcus, mucus, 16S rRNA

  10. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    Directory of Open Access Journals (Sweden)

    Heather Maughan

    Full Text Available The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq: a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients.

  11. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Institute of Scientific and Technical Information of China (English)

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao


    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  12. 16S rRNA Gene Phylogenesis of Culturable Predominant Bacteria from Diseased Apostichopus japonicus(Holothuroidea, Echinodermata)

    Institute of Scientific and Technical Information of China (English)

    MA Haiyan; JIANG Guoliang; WU Zhiqiang; WANG Xin


    Cultured Apostichopusjaponicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopusjaponicus individuals.

  13. Genetic relationship between Neobenedenia girellae and N.melleni inferred from 28S rRNA sequences

    Institute of Scientific and Technical Information of China (English)

    WANG Jun; ZHANG Wen; SU Yongquan; DING Shaoxiong


    The fragments of 350 bp in 28S rRNA from the closely related monogenea of trematoda, Neobenedenia girellae and N. melleni are obtained by polymerase chain reaction (PCR) amplified using a couple of special primers and then sequenced. The results show that the comparison of 28S rRNA sequences, with only a base varying in 337bp accounting for 0.3% genetic difference, from the relative species N. girellae and N. melleni parasitized on the different fishes in different farms displays that they possess a very high genetic similarity of 99.7%, higher than that of 99.41% for the single species N. melleni sampled in different areas, and the intraspecific divergence of N.melleni is 0.59%. Meanwhile, the interspecific differences between the two Neobenedenia and three Benedenia (i.e., B. lutjani, B. rohdei and B. seriolae) range from 2.08% to11.73%. In addition, UPGMA and MP molecular phylogenetic trees are constructed and proved to be consistent with each other. Though the morphological characteristics and the results of genetic diversity for the two Neobenedenia show a high similarity, whether they belong to a single species or not are still undefined, and the more genes of them should be further investigated, in combination with the systematical and detailed morphological study.

  14. Formation of nucleolar polymorphisms in trisomic chickens and subsequent microevolution of rRNA gene clusters in diploids. (United States)

    Delany, M E; Muscarella, D E; Bloom, S E


    Variations in nucleolar size are common in animals and man, yet the basis and significance of this variation are not well understood. In this report, we describe the generation de novo of individuals that express nucleolar size variations (polymorphisms) and the underlying basis for this phenotype in a vertebrate animal system (Gallus domesticus). Individuals that express nucleolar size polymorphisms were produced from mating chickens trisomic for the nucleolar organizer (NO) chromosome; 10%-18% of progeny demonstrated nucleolar polymorphisms. These progeny were incorporated into a diploid genetic line in which the polymorphic trait was observed to segregate in Mendelian fashion. An even more dramatic nucleolar size polymorphism (one macro- plus one micronucleolus) evolved in one diploid family over the course of only two generations. These individuals were used to ascertain that the polymorphic-nucleoli phenotype was expressed in tissues derived from the three primary embryonic cell layers in embryos and neonates. Image analysis was conducted on cells of these birds to quantitate the size differences between macro- and micronucleoli (5 mu2 versus 1 mu2, respectively). Finally, these birds were studied with the technique of in situ hybridization, which showed that gene number differences between homologous NO chromosomes (i.e., heterozygosity for rRNA gene copy number), underlies the polymorphic-nucleoli phenotype. Thus, the chicken emerges as an experimental system through which heterozygosity for the rRNA gene copy number can be induced, easily identified, transmitted, and expressed in all somatic tissues.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2061593

  15. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling. (United States)

    Ferrocino, Ilario; Di Cagno, Raffaella; De Angelis, Maria; Turroni, Silvia; Vannini, Lucia; Bancalari, Elena; Rantsiou, Kalliopi; Cardinali, Gianluigi; Neviani, Erasmo; Cocolin, Luca


    In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE). The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples. PMID:26035837

  16. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling.

    Directory of Open Access Journals (Sweden)

    Ilario Ferrocino

    Full Text Available In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE. The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples.

  17. Bacterial community analysis of a gas-phase biotrickling filter for biogas mimics desulfurization through the rRNA approach. (United States)

    Maestre, Juan P; Rovira, R; Alvarez-Hornos, F J; Fortuny, M; Lafuente, J; Gamisans, X; Gabriel, D


    The bacterial composition of a lab-scale biotrickling filter (BTF) treating high loads of H(2)S was investigated by the rRNA approach. Two 16S rRNA gene clone libraries were established 42 and 189 d after reactor startup, while fluorescent in-situ hybridization (FISH) with DNA probes was performed throughout 260d of reactor operation. Diversity, community structure and metamorphosis were studied from reactor startup to fully-established pseudo-steady state operation at near neutral pH and at an inlet H(2)S concentration of 2000 ppmv (load of 55.6g H(2)S m(-3)h(-1)). In addition, FISH was used for assessing the spatial distribution of sulfur-oxidizing bacteria (SOB) along the length of the reactor under pseudo-steady state operation. A major shift in the diversity of the community was observed with the operating time, from a well-diverse community at startup to pseudo-steady state operation with a majority of retrieved sequences affiliated to SOB of the sulfur cycle including Thiothrix spp., Thiobacillus spp., and Sulfurimonas denitrificans. Although aerobic species were predominant along the BTF, a vertical stratification was encountered, in which facultative anaerobes had a major relative abundance in the inlet part of the BTF, where the sulfide to oxygen ratio was higher. The observed changes were related to the trophic properties of the community, the DO concentration, the accumulation of elemental sulfur and the operation at neutral pH. PMID:20554311


    Directory of Open Access Journals (Sweden)

    Sri Darmawati


    Full Text Available The purpose of this study is to identify 8 strains of Staphylococcus genus members isolated from positive Widal blood (4 strains of Staphylococcus saprophyticus, 1 strain of Staphylococcus warneri, 2 strains of Staphylococcus hominis, 1 strain of Staphylococcus xylosus and 1 strain of Staphylococcus capitis based on 16S rRNA gene sequences. The methods used in this study are conducting PCR of 16S rRNA gene, cloning genes using T-Vector pMD20 which is transformed to E. coli DH5α, sequencing. The results show that four strains (BA 47.4, BA 19.2, KD 29.5 and TG 09.1 are identified as Stap. Saprophyticus strains of Stap. saprophyticus members of ATCC 15305T (99.01-100% similarity. The strain of TG 01.3 is identified as Stap. Warneri strain of TG 01.3 of Stap. Warneri members of ATCC 27836T (99.74-99.93% similarity, 2strains (KT 29.2 and KD 35.1 are identified as of Stap. hominis members of DSM 20328T (99.4-99.67% similarity. The strain of KT 30.5 is not identified

  19. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Directory of Open Access Journals (Sweden)

    Zhongliang Zhao


    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  20. Transparency International

    NARCIS (Netherlands)

    Hulten, van M. (Michel)


    Established in 1993, Transparency International (TI) defines itself as “the global civil society organization leading the fight against corruption, that brings people together in a powerful worldwide coalition to end the devastating impact of corruption on men, women and children around the wo

  1. International safeguards

    International Nuclear Information System (INIS)

    Since the start of the post-war era, international safeguards were considered essential to ensure that nuclear materials should not be diverted to unauthorised uses. In parallel, it was proposed to set up an international atomic energy agency within the United Nations through which international cooperation in nuclear matters would be channelled and controlled. Created in 1957, the IAEA was authorized to administer safeguards in connection with any assistance it provided as well as at the request of Member State and of any party to bilateral or multilateral arrangements in its ambit. Today, there are two international treaties requiring that its parties should accept Agency safeguards unilaterally, the Latin America Tlatelolco Treaty of 1967, and the Treaty on the Non-Proliferation of Nuclear Weapons (NPT), operative since 1970, which requires in particular that non-nuclear weapon states should accept Agency safeguards on its peaceful nuclear activities. Thus while NPT covers peaceful nuclear activities indiscriminately in a country, the Agency's original safeguards system is applied according to specific agreements and to given facilities. A basic conflict has now emerged between commercial interests and the increasing wish that transfer of nuclear equipment and know-how should not result in proliferation of military nuclear capacity; however, serious efforts are currently in progress to ensure universal application of IAEA safeguards and to develop them in step with the uses of nuclear energy. (N.E.A.)

  2. International Standards. (United States)

    Havard-Williams, Peter


    Discussion of standardization on an international scale for resource sharing--cooperation, coordination, interlibrary loans, cooperative acquisition and cataloging--focuses on a definition of standards; the development of standards for cataloging; public, school, and university libraries; and library education. A 60-item bibliography is included.…

  3. Ascott International

    Institute of Scientific and Technical Information of China (English)


    "Heart-to-Heart" Charity Event for Hearing-Impaired Children in Beijing On June 12, Ascott International North China held a "heart-to-heart" charity event for hearing-impaired children in the Heritage Room at the Ascott Beijing.

  4. International librarianship


    Hopkinson, Alan


    Librarianship is international and librarians can go to other countries promoting what we do in Europe with funding from ERASMUS or TEMPUS, EU programmes, and with that and other funds such as Commonwealth fellowships, librarians can be invited from overseas to learn from us in the UK

  5. Q-PCR based bioburden assessment of drinking water throughout treatment and delivery to the International Space Station (United States)

    Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri


    Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.

  6. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos


    Pedro Braga Arcuri; Michael Larry Thonney; Peter Schofield; Alice Nelson Pell


    In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/...

  7. Teaching International Law: Concepts in International Relations (United States)

    Starbird, Caroline; Pettit, Jenny; Singleton, Laurel


    This book is designed to introduce students to public international law. Topics covered include international public organizations, such as the United Nations and World Trade Organization, international courts, international human rights law, international trade law, and international environmental law. The goal of each study is to examine how…

  8. International Trade


    Bonfiglioli, Alessandra


    International trade has been one of the most dynamic sub-fields of economics in recent years, with exciting new work on trade under imperfect competition as well as important extensions of existing models. This two volume set of readings synthesizes these contributions, including some rare classic articles as well as a representative selection of the best modern work. The editor’s introductions to the volumes, which contain extensive bibliographies, put the readings in perspective and in the ...


    CERN Multimedia

    Mail Office


    Internal mail envelopes often finish up in large piles in certain offices, thus creating a shortage for other users of the mail service, who would be grateful if everyone with an unused stock could deposit them in their mail box, after attaching them together with an elastic band or piece of string. The messengers will then collect them so that the Mail Office can put them back in circulation. Thank you for your understanding and collaboration.

  10. Fostering internalization

    DEFF Research Database (Denmark)

    Baernholdt, Marianne; Drake, Emily; Maron, Frederic;


    Aim: This paper describes the development, implementation and evaluation of a semester-long exchange program between two Bachelor of Science in Nursing programs in the USA and Denmark. Background: Nurses globally need to provide culturally sensitive care for an ethnically diverse population. Comp......, flexibility and open communication are key components when setting up a 360 degrees exchange program. Keywords: Cultural Competence, Exchanges, International Collaboration, Undergraduate Education...

  11. Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA. (United States)

    Wachi, M; Umitsuki, G; Shimizu, M; Takada, A; Nagai, K


    We found that the Escherichia coli cafA::cat mutant accumulated a precursor of 16S rRNA. This precursor migrated to the same position with 16.3S precursor found in the BUMMER strain that is known to be deficient in the 5' end processing of 16S rRNA. Accumulation of 16. 3S rRNA in the BUMMER mutant was complemented by introduction of a plasmid carrying the cafA gene. The mutant type cafA gene cloned from the BUMMER strain had a 11-bp deletion in its coding region. A small amount of the mature 16S rRNA was still formed in the cafA::cat mutant. This residual activity was found to be due to RNase E encoded by the rne/ams gene by rifampicin-chase experiments of the cafA::cat ams1 double mutant. These results indicated that the cafA gene encodes a novel RNase responsible for processing of the 5' end of 16S rRNA. PMID:10362534

  12. Sequence Characterization of Mitochondrial 12S rRNA Gene in Mouse Deer (Moschiola indica for PCR-RFLP Based Species Identification

    Directory of Open Access Journals (Sweden)

    Chandra Mohan Siddappa


    Full Text Available Mitochondrial 12S rRNA has proven to be a useful molecular marker for better conservation and management of the endangered species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP of the mitochondrial 12S rRNA gene has proven to be a reliable and efficient tool for the identification of different Indian deer species of family cervidae. In the present study, mitochondrial 12S rRNA gene sequence of mouse deer (Moschiola indica belonging to the family Tragulidae was characterized and analysed in silico for its use in species identification. Genomic DNA was isolated from the hair follicles and mitochondrial 12S rRNA gene was amplified using universal primers. PCR product was cloned and sequenced for the first time. The sequence of mouse deer showed 90.04, 90.08, 90.04, 91.2, 90.04, and 90.08% identities with sika deer, sambar, hog deer, musk deer, chital, and barking deer, respectively. Restriction mapping in Lasergene (DNAstar Inc., Madison, WI, USA revealed that mouse deer mitochondrial 12S rRNA gene sequence can be differentiated from the other deer species in PCR-RFLP using RsaI, DdeI, BsrI, and BstSFI. With the help of predicted pattern, mouse deer can be identified using genomic DNA from a variety of biomaterials, thereby providing molecular aid in wildlife forensics and conservation of the species.

  13. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance. (United States)

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo


    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  14. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    International Nuclear Information System (INIS)

    We explored the mitochondrial 12S rRNA and the tRNASer(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNASer(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNASer(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNASer(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  15. Evaluation of 5.8S rRNA to identify Penaeus semisulcatus and its subspecies, Penaeus semisulcatus persicus (Penaeidae and some Decapoda species

    Directory of Open Access Journals (Sweden)

    Zahra Noroozi


    Full Text Available The green tiger prawn, Penaeus semisulcatus is one of the most important members of the family Penaeidae in the Persian Gulf. Based on the morphological characteristics, two groups, including P. semisulcatus and its subspecies viz. P. s. persicus are recognized. This study was conducted to investigate the genetic distance between P. semisulcatus and P. s. persicus by analyzing partial sequence of 5.8S rRNA. Another objective of this study is to evaluate the ability of 5.8S rRNA to identify the species of Decapoda. The results indicated that the 5.8S rRNA gene of both P. semisulcatus and P. s. persicus were exactly identical, and sequence variation was not observed. The results also indicated that 5.8S rRNA sequences between species of the same genus of analysed species of Decapoda are conserved, and no genetic distance was observed in species level. The low evolutionary rate and efficient conservation of the 5.8S rRNA can be attributed to its role in the translation process.

  16. International cooperation

    International Nuclear Information System (INIS)

    Europe is certainly the part of the world where the largest number of international arrangements have been established for dealing with international cooperation in cases of major oil spills at sea. Let me list the most important of these multilateral arrangements: Bonn Agreement: covers the North Sea Contracting Parties: riparian states and the EEC Barcelona Convention: (protocol for emergency situations) covers the Mediterranean Sea Contracting Parties: riparian states and the EEC; Helsinki Convention: covers the Baltic Sea Contracting Parties: riparian states and (soon) the EEC; Lisbon Agreement: covers the NE Atlantic Contracting Parties: France, Spain, Portugal, Morocco and the EEC; Community Action Plan: covers the whole community waters; EEC; Members States participate in this plan. It should be underlined that, in addition to these large multilateral agreements a number of bilateral or trilateral arrangements have been set up, such as the Copenhagen Agreement, Denger Plan, Manche Plan, etc. The Commission involvement in these international frameworks is very important: as an example, it is presently chairing the Bonn Agreement Contracting Parties meeting. In addition, being the only contracting party to all these agreements, it is able to play a unique role of coordination and information to avoid duplications and contradictions. Having given this overview, I would now focus on the Community Action Plan

  17. Internal corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Joosten, M. [ConocoPhillips, Bartlesville, OK (United States); Anderson, W. [Spectra Energy Transmission, Vancouver, BC (Canada)


    Working Group 11 identified internal corrosion issues in both upstream and downstream oil and gas pipelines and suggested ways to address them through integrity management, modeling, and monitoring. Three sessions were held in an effort to provided a better understanding between integrity professionals engaged in different aspects of pipeline management. Opportunities for reducing cost or improving integrity performance of the whole system were also identified. It was determined that management support is needed in order to monitor and mitigate internal corrosion of pipelines. The role of regulations in ensuring pipeline integrity was also discussed along with rules for pigging and batching of inhibitors. In-line inspections have identified under-deposit corrosion and solids/water deposition as two key problems facing pipeline operators. It was noted that an internal corrosion course offered by the National Association of Corrosion Engineers (NACE) is being well attended and is providing worthwhile training. Other issues discussed by this working group were: bacteria with upstream problems; effects of carbon dioxide, hydrogen sulphide and partial pressures on corrosion; and, procedures and guidelines to maintain clean pipelines. tabs., figs.

  18. Genotypic and phenotypic diversity of Ralstonia pickettii and Ralstonia insidiosa isolates from clinical and environmental sources including High-purity Water.

    LENUS (Irish Health Repository)

    Ryan, Michael P


    Abstract Background Ralstonia pickettii is a nosocomial infectious agent and a significant industrial contaminant. It has been found in many different environments including clinical situations, soil and industrial High Purity Water. This study compares the phenotypic and genotypic diversity of a selection of strains of Ralstonia collected from a variety of sources. Results Ralstonia isolates (fifty-nine) from clinical, industrial and environmental origins were compared genotypically using i) Species-specific-PCR, ii) PCR and sequencing of the 16S-23S rRNA Interspatial region (ISR) iii) the fliC gene genes, iv) RAPD and BOX-PCR and v) phenotypically using biochemical testing. The species specific-PCR identified fifteen out of fifty-nine designated R. pickettii isolates as actually being the closely related species R. insidiosa. PCR-ribotyping of the 16S-23S rRNA ISR indicated few major differences between the isolates. Analysis of all isolates demonstrated different banding patterns for both the RAPD and BOX primers however these were found not to vary significantly. Conclusions R. pickettii species isolated from wide geographic and environmental sources appear to be reasonably homogenous based on genotypic and phenotypic characteristics. R. insidiosa can at present only be distinguished from R. pickettii using species specific PCR. R. pickettii and R. insidiosa isolates do not differ significantly phenotypically or genotypically based on environmental or geographical origin.

  19. Interordinal mammalian relationships: evidence for paenungulate monophyly is provided by complete mitochondrial 12S rRNA sequences. (United States)

    Lavergne, A; Douzery, E; Stichler, T; Catzeflis, F M; Springer, M S


    The complete mitochondrial 12S rRNA sequences of 5 placental mammals belonging to the 3 orders Sirenia, Proboscidea, and Hyracoidea are reported together with phylogenetic analyses (distance and parsimony) of a total of 51 mammalian orthologues. This 12S rRNA database now includes the 2 extant proboscideans (the African and Asiatic elephants Loxodonta africana and Elephas maximus), 2 of the 3 extant sirenian genera (the sea cow Dugong dugon and the West Indian manatee Trichechus manatus), and 2 of the 3 extant hyracoid genera (the rock and tree hyraxes Procavia capensis and Dendrohyrax dorsalis). The monophyly of the 3 orders Sirenia, Proboscidea, and Hyracoidea is supported by all kinds of analysis. There are 23 and 3 diagnostic subsitutions shared by the 2 proboscideans and the 2 hyracoids, respectively, but none by the 2 sirenians. The 2 proboscideans exhibit the fastest rates of 12S rRNA evolution among the 11 placental orders studied. Based on various taxonomic sampling methods among eutherian orders and marsupial outgroups, the most strongly supported clade in our comparisons clusters together the 3 orders Sirenia, Proboscidea, and Hyracoidea in the superorder Paenungulata. Within paenungulates, the grouping of sirenians and proboscideans within the mirorder Tethytheria is observed. This branching pattern is supported by all analyses by high bootstrap percentages (BPs) and decay indices. When only one species is selected per order or suborder, the taxonomic sampling leads to a relative variation in bootstrap support of 53% for Tethytheria (BPs ranging from 44 to 93%) and 7% for Paernungulata (92-99%). When each order or suborder is represented by two species, this relative variation decreased to 10% for Tethytheria (78-87%) and 3% for Paenungulata (96-99%). Two nearly exclusive synapomorphies for paenungulates are identified in the form of one transitional compensatory change, but none were detected for tethytherians. Such a robust and reliable resolution of

  20. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Directory of Open Access Journals (Sweden)

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  1. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing

    Directory of Open Access Journals (Sweden)

    Samara Nawal A


    Full Text Available Abstract Background Cronobacter spp. (formerly Enterobacter sakazakii, are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%. The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (α-MUG, DFI and EsPM and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences, 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Conclusion Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable

  2. ITS-2 and 18S rRNA gene phylogeny of Aplysinidae (Verongida, Demospongiae). (United States)

    Schmitt, Susanne; Hentschel, Ute; Zea, Sven; Dandekar, Thomas; Wolf, Matthias


    18S ribosomal DNA and internal transcribed spacer 2 (ITS-2) full-length sequences, each of which was sequenced three times, were used to construct phylogenetic trees with alignments based on secondary structures, in order to elucidate genealogical relationships within the Aplysinidae (Verongida). The first poriferan ITS-2 secondary structures are reported. Altogether 11 Aplysina sponges and 3 additional sponges (Verongula gigantea, Aiolochroia crassa, Smenospongia aurea) from tropical and subtropical oceans were analyzed. Based on these molecular studies, S. aurea, which is currently affiliated with the Dictyoceratida, should be reclassified to the Verongida. Aplysina appears as monophyletic. A soft form of Aplysina lacunosa was separated from other Aplysina and stands at a basal position in both 18S and ITS-2 trees. Based on ITS-2 sequence information, the Aplysina sponges could be distinguished into a single Caribbean-Eastern Pacific cluster and a Mediterranean cluster. The species concept for Aplysina sponges as well as a phylogenetic history with a possibly Tethyan origin is discussed. PMID:15871043

  3. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences. (United States)

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan


    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids. PMID:23847285

  4. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;


    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  5. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    DEFF Research Database (Denmark)

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;


    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  6. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J;


    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  7. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Directory of Open Access Journals (Sweden)

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  8. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Ž. Radulović


    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  9. The crystal structure of Mtr4 reveals a novel arch domain required for rRNA processing

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, R.N.; Robinson, H.; Klauer, A. A.; Hintze, B. J.; van Hoof, A.; Johnson, S. J.


    The essential RNA helicase, Mtr4, performs a critical role in RNA processing and degradation as an activator of the nuclear exosome. The molecular basis for this vital function is not understood and detailed analysis is significantly limited by the lack of structural data. In this study, we present the crystal structure of Mtr4. The structure reveals a new arch-like domain that is specific to Mtr4 and Ski2 (the cytosolic homologue of Mtr4). In vivo and in vitro analyses demonstrate that the Mtr4 arch domain is required for proper 5.8S rRNA processing, and suggest that the arch functions independently of canonical helicase activity. In addition, extensive conservation along the face of the putative RNA exit site highlights a potential interface with the exosome. These studies provide a molecular framework for understanding fundamental aspects of helicase function in exosome activation, and more broadly define the molecular architecture of Ski2-like helicases.

  10. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;


    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  11. Phylogenetic relationship of 16 Oedipodidae species (Insecta: Orthoptera) based on the 16S rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)



    The sequences of the mitochondrial 16S rRNA gene of 16 Oedipodidae species were amplified and sequenced. All sequences were aligned and analyzed and the phyloge netic relationships were inferred. The properties of 16S gene in Oedipodidae showed typical patterns of many insects such as a high A+T content and variable distance-dependent transition/transversion ratios. The 0.2 weight for sites of loops may be advisable for phylogeny reconstruction using the maximum parsimony method. The phylogenetic analysis results do not support the current subfamily classification systems of Oedipodidae. Bryodemellinae and Bryodeminae are closely related and should be merged as one subfamily. The status of Oedipodinae and Locustinae is also problematic.

  12. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA. (United States)

    Williams, A M; Rodrigues, U M; Collins, M D


    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  13. Avian malaria in captive psittacine birds: detection by microscopy and 18S rRNA gene amplification. (United States)

    Belo, N O; Passos, L F; Júnior, L M C; Goulart, C E; Sherlock, T M; Braga, E M


    A cross-sectional survey was conducted to estimate the occurrence of malaria infection among captive psittacine birds (n=127) from three zoological gardens in Brazil. Malaria infection was evaluated by the association of direct examination of blood smears with amplification of the 18SSU rRNA gene of the Plasmodium genus, demonstrating an overall occurrence of 36%. Most infected bird species were Amazona aestiva (28/73), Ara ararauna (6/10), and Amazona amazonica (3/10). The low parasitemias observed among the infected birds suggest a chronic infection. The sequence analyses of 10 isolates indicate a potential occurrence of four distinct Plasmodium lineages. These findings provide new data on malarial infection in captive psittacine birds, and emphasize the need for better control of importation and exportation of these birds. PMID:18937986

  14. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    DEFF Research Database (Denmark)

    Douthwaite, S; Aagaard, C


    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  15. Conceptualizing international education: From international student to international study


    Madge, C.; P Raghuram; Noxolo, P.


    In a rapidly changing transnational eduscape, it is timely to consider how best to conceptualize international education. Here we argue for a conceptual relocation from international student to international study as a means to bridge the diverse literatures on international education. International study also enables recognition of the multiple contributions (and resistances) of international students as agents of knowledge formation; it facilitates consideration of the mobility of students ...

  16. Microbial community dynamics based on 16S rRNA gene profiles in a Pacific Northwest estuary and its tributaries. (United States)

    Bernhard, Anne E; Colbert, Debbie; McManus, James; Field, Katharine G


    We analyzed bacterioplankton community structure in Tillamook Bay, Oregon and its tributaries to evaluate phylogenetic variability and its relation to changes in environmental conditions along an estuarine gradient. Using eubacterial primers, we amplified 16S rRNA genes from environmental DNA and analyzed the PCR products by length heterogeneity polymerase chain reaction (LH-PCR), which discriminates products based on naturally occurring length differences. Analysis of LH-PCR profiles by multivariate ordination methods revealed differences in community composition along the estuarine gradient that were correlated with changes in environmental variables. Microbial community differences were also detected among different rivers. Using partial 16S rRNA sequences, we identified members of dominant or unique gene fragment size classes distributed along the estuarine gradient. Gammaproteobacteria and Betaproteobacteria and members of the Bacteroidetes dominated in freshwater samples, while Alphaproteobacteria, Cyanobacteria and chloroplast genes dominated in marine samples. Changes in the microbial communities correlated most strongly with salinity and dissolved silicon, but were also strongly correlated with precipitation. We also identified specific gene fragments that were correlated with inorganic nutrients. Our data suggest that there is a significant and predictable change in microbial species composition along an estuarine gradient, shifting from a more complex community structure in freshwater habitats to a community more typical of open ocean samples in the marine-influenced sites. We also demonstrate the resolution and power of LH-PCR and multivariate analyses to provide a rapid assessment of major community shifts, and show how these shifts correlate with environmental variables. PMID:16329898

  17. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report. (United States)

    Lee, Sin Hang


    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  18. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences. (United States)

    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M


    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  19. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report (United States)

    Lee, Sin Hang


    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  20. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland. (United States)

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina


    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  1. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Loreto Abusleme


    Full Text Available Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction procedures is important when comparing studies that use different methods. Identifying the method that best portrays communities is also desirable. Accordingly, the aim of this study was to evaluate bias introduced by different DNA extraction procedures on oral microbiome profiles. Design: Four DNA extraction methods were tested on mock communities consisting of seven representative oral bacteria. Additionally, supragingival plaque samples were collected from seven individuals and divided equally to test two commonly used DNA extraction procedures. Amplicon libraries of the 16S rRNA gene were generated and sequenced via 454-pyrosequencing. Results: Evaluation of mock communities revealed that DNA yield and bacterial species representation varied with DNA extraction methods. Despite producing the lowest yield of DNA, a method that included bead beating was the only protocol capable of detecting all seven species in the mock community. Comparison of the performance of two commonly used methods (crude lysis and a chemical/enzymatic lysis+column-based DNA isolation on plaque samples showed no effect of extraction protocols on taxa prevalence but global community structure and relative abundance of individual taxa were affected. At the phylum level, the latter method improved the recovery of Actinobacteria, Bacteroidetes, and Spirochaetes over crude lysis. Conclusion: DNA extraction distorts microbial profiles in simulated and clinical oral samples, reinforcing the

  2. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea (United States)

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.


    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  3. Diversity, Dynamics and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis


    Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de, R.; Vaughan, E E


    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  4. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan


    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.


    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  5. Direct 16S rRNA Gene Sequencing from Clinical Specimens, with Special Focus on Polybacterial Samples and Interpretation of Mixed DNA Chromatograms ▿


    Kommedal, Øyvind; Kvello, Kristine; Skjåstad, Rune; Langeland, Nina; Wiker, Harald G.


    RipSeq (iSentio, Bergen, Norway) is a web-based application for the analysis of mixed DNA chromatograms. It opens the possibility to analyze chromatograms obtained by direct 16S rRNA gene sequencing from polybacterial human clinical samples. In this study, we used direct 16S rRNA gene sequencing to investigate 264 samples from a wide range of suspected human bacterial infections. The sequence-based identification was compared with the results from routine culture-based identification. A total...

  6. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA


    Yueh, Andrew; Schneider, Robert J.


    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  7. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    DEFF Research Database (Denmark)

    Moazed, D; Van Stolk, B J; Douthwaite, S;


    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  8. Composition of fecal microbiota of laboratory mice derived from Japanese commercial breeders using 16S rRNA gene clone libraries (United States)

    NOZU, Ryoko; UENO, Masami; HAYASHIMOTO, Nobuhito


    The fecal microbiota of six mice derived from three Japanese commercial breeders was analyzed by using 16S rRNA gene clone libraries to construct a database for analyzing the gut microbiota of laboratory mice. The 566 clones were obtained from the clone libraries generated from the fecal DNA samples derived from BALB/c, C57BL/6N, DBA/2 and ICR mice. Among these 566 clones, there were 446 unique 16S rRNA gene sequences. When grouped at the 98% similarity level, the 446 unique sequences consisted of 103 Clostridiales, 43 Bacteroidales, 5 Lactobacillus and 3 Erysipelotricaceae, as well as sequences from 11 other phyla. PMID:26902692

  9. Comparative Analysis of 16S rRNA and amoA Genes from Archaea Selected with Organic and Inorganic Amendments in Enrichment Culture


    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Holly M Simon


    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the “root” clade, we detected no corresponding amoA gene. The amoA-contai...

  10. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Directory of Open Access Journals (Sweden)

    Zhou Jianjin


    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  11. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil


    de Oliveira, L. P.; Cardozo, G.P.; E.V. Santos; Mansur, M.A.B.; I.A.N. Donini; Zissou, V.G.; P.G. Roberto; M. Marins


    The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto.As sequências parciais dos genes RNAr 18S de Babesia...

  12. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon


    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  13. Phylogenetic analysis of ten species of five genera of Buccinidae from the Chinese coast based on 28S rRNA gene


    DONG Chang-Yong; Hou, Lin; Sui, Na; Zhang, Yun; WANG Ming-Chang; Li, Yan


    It has been reported that there are 31 species in 13 genera of the family Buccinidae, distributed along the Chinese coast, but their taxonomic status is still controversial. In the present paper, phylogenetic relationships among ten species in five genera of Buccinidae from the Liaoning, Shandong and Fujian coast and ten species in five genus from the Chinese coast were examined using partial large ribosome subunit 28S rRNA sequences. An approximate 1400 bp fragment of the 28 rRNA gene was o...

  14. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites


    Anping Peng; Juan Liu; Wanting Ling; Zeyou Chen; Yanzheng Gao


    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg−1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollu...

  15. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history


    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun


    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  16. Estimation of Pig Fecal Contamination in a River Catchment by Real-Time PCR Using Two Pig-Specific Bacteroidales 16S rRNA Genetic Markers▿


    Mieszkin, Sophie; Furet, Jean-Pierre; Corthier, Gérard; Gourmelon, Michèle


    The microbiological quality of coastal or river water can be affected by fecal contamination from human or animal sources. To discriminate pig fecal pollution from other pollution, a library-independent microbial source tracking method targeting Bacteroidales host-specific 16S rRNA gene markers by real-time PCR was designed. Two pig-specific Bacteroidales markers (Pig-1-Bac and Pig-2-Bac) were designed using 16S rRNA gene Bacteroidales clone libraries from pig feces and slurry. For these two ...

  17. Richness and diversity of bacterioplankton species along an estuarine gradient in Moreton Bay, Australia. (United States)

    Hewson, Ian; Fuhrman, Jed A


    Bacterioplankton community diversity was investigated in the subtropical Brisbane River-Moreton Bay estuary, Australia (27 degrees 25 minutes S, 153 degrees 5 minutes E). Bacterial communities were studied using automated rRNA intergenic spacer analysis (ARISA), which amplifies 16S-23S ribosomal DNA internally transcribed spacer regions from mixed-community DNA and detects the separated products on a fragment analyzer. Samples were collected from eight sites throughout the estuary and east to the East Australian Current (Coral Sea). Bacterioplankton communities had the highest operational taxonomic unit (OTU) richness, as measured by ARISA at eastern bay stations (S [total richness] = 84 to 85 OTU) and the lowest richness in the Coral Sea (S = 39 to 59 OTU). Richness correlated positively with bacterial abundance; however, there were no strong correlations between diversity and salinity, NO(3)(-) and PO(4)(3-) concentrations, or chlorophyll a concentration. Bacterioplankton communities at the riverine stations were different from communities in the bay or Coral Sea. The main differences in OTU richness between stations were in taxa that each represented 0.1% (the detection limit) to 0.5% of the total amplified DNA, i.e., the "tail" of the distribution. We found that some bacterioplankton taxa are specific to distinct environments while others have a ubiquitous distribution from river to sea. Bacterioplankton richness and diversity patterns in the estuary are potentially a consequence of greater niche availability, mixing of local and adjacent environment communities, or intermediate disturbance. Furthermore, these results contrast with previous reports of spatially homogeneous bacterioplankton communities in other coastal waters. PMID:15184140

  18. Ultrastructure, molecular phylogenetics, and chlorophyll a content of novel cyanobacterial symbionts in temperate sponges. (United States)

    Erwin, Patrick M; López-Legentil, Susanna; Turon, Xavier


    Marine sponges often harbor photosynthetic symbionts that may enhance host metabolism and ecological success, yet little is known about the factors that structure the diversity, specificity, and nature of these relationships. Here, we characterized the cyanobacterial symbionts in two congeneric and sympatric host sponges that exhibit distinct habitat preferences correlated with irradiance: Ircinia fasciculata (higher irradiance) and Ircinia variabilis (lower irradiance). Symbiont composition was similar among hosts and dominated by the sponge-specific cyanobacterium Synechococcus spongiarum. Phylogenetic analyses of 16S-23S rRNA internal transcribed spacer (ITS) gene sequences revealed that Mediterranean Ircinia spp. host a specific, novel symbiont clade ("M") within the S. spongiarum species complex. A second, rare cyanobacterium related to the ascidian symbiont Synechocystis trididemni was observed in low abundance in I. fasciculata and likewise corresponded to a new symbiont clade. Symbiont communities in I. fasciculata exhibited nearly twice the chlorophyll a concentrations of I. variabilis. Further, S. spongiarum clade M symbionts in I. fasciculata exhibited dense intracellular aggregations of glycogen granules, a storage product of photosynthetic carbon assimilation rarely observed in I. variabilis symbionts. In both host sponges, S. spongiarum cells were observed interacting with host archeocytes, although the lower photosynthetic activity of Cyanobacteria in I. variabilis suggests less symbiont-derived nutritional benefit. The observed differences in clade M symbionts among sponge hosts suggest that ambient irradiance conditions dictate symbiont photosynthetic activity and consequently may mediate the nature of host-symbiont relationships. In addition, the plasticity exhibited by clade M symbionts may be an adaptive attribute that allows for flexibility in host-symbiont interactions across the seasonal fluctuations in light and temperature characteristic of

  19. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Directory of Open Access Journals (Sweden)

    Boyang Cao

    Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  20. Metagenomic data of fungal internal transcribed spacer from serofluid dish, a traditional Chinese fermented food


    Peng Chen; Yang Zhao; Zhengrong Wu; Ronghui Liu; Ruixiang Xu; Lei Yan; Hongyu Li


    Serofluid dish (or Jiangshui, in Chinese), a traditional food in the Chinese culture for thousands of years, is made from vegetables by fermentation. In this work, microorganism community of the fermented serofluid dish was investigated by the culture-independent method. The metagenomic data in this article contains the sequences of fungal internal transcribed spacer (ITS) regions of rRNA genes from 12 different serofluid dish samples. The metagenome comprised of 50,865 average raw reads with...

  1. International recommendations

    International Nuclear Information System (INIS)

    Full text: This short presentation will indicate the general radiation protection background to protective measures against foodstuffs contaminated with radioactive substances. A number of international organizations are involved in various aspects of radiation protection, for example, the International Atomic Energy Agency (IAEA), the United Nations Food and Agriculture Organization (FAO), the United Nations Environment Programme (UNEP), and the World Health Organization (WHO). Two international organizations, however, provide the basic background. These are the International Commission on Radiological Protection (ICRP) and the United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR). UNSCEAR provides the scientific information on radiation levels and effects. It consists of 21 member countries, with truly international coverage. It issues reports to the UN General Assembly, including comprehensive scientific annexes. Its latest comprehensive report was issued in 1982, the next is expected to be published in 1988. That report will include an assessment of the radiological consequences of the Chernobyl accident. The ICRP is a non-governmental organization. It has issued recommendations on radiation protection since 1928. The postulated biological basis for radiation protection recommendations involves two types of biological effects. The so-called non-stochastic effects, mainly due to cell death, appear only when the radiation doses exceed a certain threshold value. These effects, therefore, can only appear after high accidental exposures. After the Chernobyl accident, they only affected about 200 individuals involved in fire extinction and rescue work at the damaged nuclear power plant. Stochastic effects, with some simplification, may be seen as the result of initial changes in the genetic code of some surviving cells. If these cells are germ cells, this may lead to hereditary harm. If they are somatic cells, the result could be cancer

  2. International relations

    International Nuclear Information System (INIS)

    The French nuclear safety authority (A.S.N.) has participated at different meeting in European Union as nuclear decommissioning assistance programme(N.D.A.P.), Regulatory assistance management group (R.A.M.G.) and Instrument for nuclear safety cooperation (I.N.S.C.). The members of Western European nuclear regulator association (W.E.N.R.A.) met and discussed about the future of W.E.N.R.A. and its representativeness and its cooperation with European nuclear safety regulator group (E.N.S.R.E.G.) and head of European radiation control authorities (H.E.R.C.A.). About International relations it is to noticed a meeting at the invitation of IAEA to discuss about the possibility to resort to the Ines scale for medical events. An audit mission under the IAEA aegis stood at Fessenheim, O.S.A.R.T. for operational safety review team. Two years and a half passed by between the audit mission Integrated regulatory review service (I.R.S.S.) welcome by A.S.N. in november 2006 and the audit mission follow up in 2009, 12 experts from 11 different countries and coordinated by three representatives of IAEA worked, the conclusions were that 90% of recommendations made to A.S.N. in 2006 were treated in a satisfying way; the evaluation gives three new recommendations, 7 new suggestions and 11 new correct practices. A meeting of the commission on safety standards (C.S.S.) stood in april 2009. Some others meeting are to be noticed: nuclear safety and security group (N.S.S.G.), expert group on nuclear and radiation safety (E.G.N.R.S.) instituted by the council of the Baltic sea states (C.B.S.S.) treats data exchange on the national networks of dose rates and surveillance of radioactivity in air. International nuclear regulator association (I.N.R.A.) held its first meeting in april 2009 at Seoul (Korea). Bilateral relations with Poland, Italy, Ukraine and Germany planed cooperation or information exchange in the field of nuclear safety. Participation to conference in Usa, meetings with United

  3. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth;


    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...

  4. True microbiota involved in chronic lung infection of cystic fibrosis patients found by culturing and 16S rRNA gene analysis

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine R; Alhede, Morten; Kragh, Kasper N; Nielsen, Per H; Johansen, Ulla; Givskov, Michael; Høiby, Niels; Bjarnsholt, Thomas


    Patients suffering from cystic fibrosis (CF) develop chronic lung infection. In this study, we investigated the microorganisms present in transplanted CF lungs (n = 5) by standard culturing and 16S rRNA gene analysis. A correspondence between culturing and the molecular methods was observed. In c...

  5. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P


    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  6. [Transport of newly synthesized rRNA from the nucleus to the cytoplasm in freely suspended cells of parsley (Petroselinum sativum)]. (United States)

    Seitz, U; Seitz, U


    A rapidly labelled rRNA precursor can be detected in callus cells of Petroselinum sativum grown on a liquid synthetic medium. Its molecular weight has been calculated to be 2.3×10(6). This value agrees with that of the rRNA precursor from other plant material. In order to follow the synthesis and processing of rRNA in time and to correlate single steps in this process with cell organelles it was necessary to obtain pure fractions of nuclei and ribosomes. The isolation method for nuclei is given in detail. The nucleic acids are separated on polyacrylamide gels of low acrylamide concentration. Pulse-chase experiments show that the rRNA precursor is split into two fragments within the nucleus: an 18S and a 25S component. The 18S RNA leaves the nucleus rapidly. It is already found quantitatively in the ribosomal fraction after 30-60 min chase. At that time the 25S RNA is still within the nucleus; it appears much later in the ribosomes. Since the increase in ribosomal label occurs simultaneously with the decrease in nuclear label, it is concluded that there is no degradation of 18S RNA within the nucleus. Apparently there are two distinct transport mechanisms with different kinetics for the two RNA components. PMID:24477955

  7. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T;


    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  8. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  9. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    DEFF Research Database (Denmark)

    Holmsgaard, Peter N.; Sørensen, Søren J.; Hansen, Lars Hestbjerg


    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity of...

  10. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri


    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  11. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    International Nuclear Information System (INIS)

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA1/sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA1/sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA1/sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  12. High Prevalence of Metallo-β-Lactamase and 16S rRNA Methylase Coproduction among Imipenem-Resistant Pseudomonas aeruginosa Isolates in Brazil▿


    Doi, Yohei; Ghilardi, Angela C. R.; Adams, Jennifer; de Oliveira Garcia, Doroti; Paterson, David L.


    Rates of metallo-β-lactamase and 16S rRNA methylase production were investigated in 51 imipenem-resistant Pseudomonas aeruginosa clinical isolates collected from hospitals in São Paulo, Brazil. Of them, 57% and 75% produced SPM-1 and RmtD, respectively. Of note, 51% produced both enzymes, suggesting that their coproduction is already common in this geographic area.

  13. Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA


    Hogg, J.C.; Lehane, M. J.


    This was the first molecular study of the bacterial flora of the sheep scab mite (Psoroptes ovis). A sequence analysis of genes coding for 16S rRNA revealed that Serratia marcescens and bacteria closely related to Staphylococcus intermedius or Staphylococcus chromogens and Alloiococcus otitidis were present. These bacteria were associated with skin lesions, dermatitis, and otitis media caused by P. ovis.

  14. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp. (United States)

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  15. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine


    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  16. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes


    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar


    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  17. Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rRNA gene sequences

    Czech Academy of Sciences Publication Activity Database

    Wijová, Martina; Moravec, František; Horák, Aleš; Lukeš, Julius


    Roč. 36, č. 9 (2006), s. 1067-1075. ISSN 0020-7519 R&D Projects: GA ČR(CZ) GA524/06/0170 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA gene sequences Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.337, year: 2006

  18. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing


    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.; Dharne, Mahesh S.


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  19. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    DEFF Research Database (Denmark)

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J; Tehler, Disa; Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Lund, Anders H; Nielsen, Henrik


    the level of RNA modifications. A comparison to HCT116 cells reveals similar 2'-O-Me profiles with distinct differences at several sites. This study constitutes the first comprehensive mapping of 2'-O-Me sites in human rRNA using a high throughput sequencing approach. It establishes the existence of a...

  20. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates. (United States)

    Liu, Zhenru; Ling, Baodong; Zhou, Liming


    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  1. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)


    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  2. Internal audit


    Švandrlíková, Monika


    Diplomová práce se zabývá interním auditem procesu nákupu ve společnosti Slovácké strojírny, a.s. Uherský Brod. Cílem je zhodnotit stávající situaci a nabídnout doporučení přinášející přidanou hodnotu organizaci. Analýza současného stavu nákupu byla podkladem pro identifikaci rizik pomocí metody „What can go wrongs“. Na základě těchto poznatků jsou navrženy kontroly a nápravná opatření vedoucí ke snížení rizik. Následná implementace zajistí zlepšení fungování nákupního oddělení a zefektivnění...

  3. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.


    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  4. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling. (United States)

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  5. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene. (United States)

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying


    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China. PMID:26196543

  6. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Directory of Open Access Journals (Sweden)

    Youhua Yuan

    Full Text Available Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  7. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Directory of Open Access Journals (Sweden)

    Stern David B


    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  8. Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides. (United States)

    Zhou, Y; Yu, H; Guo, Q; Xu, X; Ye, X; Wu, S; Guo, Y; Wang, M


    16S rRNA methylases confer high-level resistance to most aminoglycosides in Gram-negative bacteria. Seven 16S rRNA methylase genes, armA, rmtA, rmtB, rmtC, rmtD, rmtE and npmA, have been identified since 2003. We studied the distribution of methylase genes in more than 200 aminoglycoside-resistant Gram-negative clinical isolates collected in 2007 at our hospital in Shanghai, China. 16S rRNA methylase genes were amplified by polymerase chain reaction (PCR) among 217 consecutive clinical isolates of Gram-negative bacilli resistant to gentamicin and amikacin by a disk diffusion method. 16S rRNA methylase genes were present in 97.5% (193/198) of clinical isolates highly resistant to amikacin (≥512 μg/ml), with armA and rmtB detected in 67.2 and 30.3% of strains, respectively, while no 16S rRNA methylase genes were detected in 19 strains with amikacin minimum inhibitory concentration (MIC) ≤256 μg/ml. armA or rmtB genes were detected in 100% of 104 strains of Enterobacteriaceae, and these two genes were equally represented (49 vs. 55 strains). Genes for armA or rmtB were detected in 94.7% (89/94) of Acinetobacter baumannii and Pseudomonas aeruginosa strains, and armA was predominant (84 vs. 5 strains with rmtB). No rmtA, rmtC, rmtD or npmA genes were found. Enterobacterial repetitive intergenic consensus sequence (ERIC-PCR) indicated that armA and rmtB genes were spread by both horizontal transfer and clonal dissemination. PMID:20614151

  9. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Directory of Open Access Journals (Sweden)

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  10. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1. (United States)

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  11. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene

    Directory of Open Access Journals (Sweden)

    Kobayashi S.


    Full Text Available We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil using a modified Balamuth’s egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli; moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla. We determined the small subunit rRNA (SSU-rRNA gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli.

  12. Seabird and louse coevolution: complex histories revealed by 12S rRNA sequences and reconciliation analyses. (United States)

    Paterson, A M; Wallis, G P; Wallis, L J; Gray, R D


    We investigated the coevolutionary history of seabirds (orders Procellariiformes and Sphenisciformes) and their lice (order Phthiraptera). Independent trees were produced for the seabirds (tree derived from 12S ribosomal RNA, isoenzyme, and behavioral data) and their lice (trees derived from 12S rRNA data). Brook's parsimony analysis (BPA) supported a general history of cospeciation (consistency index = 0.84, retention index = 0.81). We inferred that the homoplasy in the BPA was caused by one intrahost speciation, one potential host-switching, and eight or nine sorting events. Using reconciliation analysis, we quantified the cost of fitting the louse tree onto the seabird tree. The reconciled trees postulated one host-switching, nine cospeciation, three or four intrahost speciation, and 11 to 14 sorting events. The number of cospeciation events was significantly more than would be expected from chance alone (P seabirds and lice. Neither data set displayed significant rate heterogeneity. An examination of the codivergent nodes revealed that seabirds and lice have cospeciated synchronously and that lice have evolved at approximately 5.5 times the rate of seabirds. The degree of sequence divergence supported some of the postulated intrahost speciation events (e.g., Halipeurus predated the evolution of their present hosts). The sequence data also supported some of the postulated host-switching events. These results demonstrate the value of sequence data and reconciliation analyses in unraveling complex histories between hosts and their parasites. PMID:12116418

  13. First microbiota assessments of children's paddling pool waters evaluated using 16S rRNA gene-based metagenome analysis. (United States)

    Sawabe, Toko; Suda, Wataru; Ohshima, Kenshiro; Hattori, Masahira; Sawabe, Tomoo


    Insufficient chloric sterilization of children's paddling pool waters increases the risk of diarrheal illness. Therefore, we investigated the microbiota changes after children use pools. First, we applied 16S rRNA gene-based metagenome analysis to understand the dynamics of microbiota in pool water, especially with respect to the bio-contamination by potential pathogens. Proteobacteria were major taxa detected in every pool water sample after children spent time in the pool. In more detail, Gammaproteobacteria comprised the dominant class, which was followed by Betaproteobacteria. Five phyla, Bacteroidetes, Firmicutes, Actinobacteria and Deinococcus-Thermus phyla were minor groups. The pool water microbiota are likely to be a consortium of intestinal and skin microbiota from humans. Interestingly, the ratio of Gammaproteobacteria and Betaproteobacteria differed according to the age of the children who used the pool, which means the pool water was additionally contaminated by soil microbiota as a result of the children's behavior. Furthermore, potential pathogens, such as Campylobacter spp., Comamonas testosteroni and Burkholderia pseudomallei, were also found. Considering the standard plate counts, the abundances of these human pathogens are unlikely to be a sufficiently infectious dose. We suggest the importance of sanitary measures in paddling pool waters to reduce bio-contamination from both humans and the environment. PMID:26671497

  14. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization. (United States)

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A


    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses. PMID:8727903

  15. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease. (United States)

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H


    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  16. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species (United States)

    Fogarty, L.R.; Voytek, M.A.


    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  17. Microbial succession in the traditional Chinese Luzhou-flavor liquor fermentation process as evaluated by SSU rRNA profiles. (United States)

    Xiang, Wenliang; Li, Ke; Liu, Seng; Xing, Yage; Li, Mingyuan; Che, Zhenming


    The community succession of microbes inhabited in the fermenting lees of Luzhou-flavor liquor was investigated based on small-subunit rRNA culture independent method. All sequences recovered from fermenting lees respectively fell into the genera of Lactobacillus, Streptococcus, Bacillus, Staphylococcus, Clostridium, Pelobacter, Actobacter, Serratia, Burkholderia, Rhodoccous, Corynebacterium, Arthrobacter, Microbacterium, Curtobacterium, Leptotrichia, Methanocuuleus, Saccharomyces, Zygosaccharomyces, Saccharomycopsis, Pichia, Talaromyces, Aspergillus, Eurotium, Fomitopsis and Trichosporon. The fungal Pichia, Saccharomycopsis and Talaromyces were most abundant in the lees fermented for 1 day, the fungal Eurotium and the bacteria Burkholderia, Streptococcus and Lactobacillus were dominant in the lees fermented for 7 days, only the bacteria Lactobacillus, Burkholderia were prevalent in the lees fermented for 60 days. Most genera almost existed in the fermenting lees, while their distributions were significantly different in 1, 7 and 60 days fermented lees. The prokaryotic community similarity coefficient was from 0.5000 to 0.5455 and followed to 0.1523, and that of eukaryotic community was from 0.5466 to 0.5259 and to 0.3750 when compared at species level. These results suggested that many microbes in lees have community successions associated with fermenting and that such successions maybe contribute the fermentation process of Luzhou-flavor liquor and is main reasons that the characteristic flavor factors are produced. PMID:23180546

  18. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mu Peng


    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  19. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes. (United States)

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  20. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing. (United States)

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  1. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Directory of Open Access Journals (Sweden)

    Ma Junling


    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  2. Detection of Chlamydophila psittaci from pigeons by polymerase chain reaction in Ahvaz

    Directory of Open Access Journals (Sweden)

    Masoud Ghorbanpoor


    Full Text Available Background and Objective: Chlamydophila psittaci is a lethal bacterium that causes endemic avian chlamydiosis, and respiratory psittacosis. Laboratory diagnosis of Chlamydophila psittaci is difficult by culture. This study was design to investigate the presence of Chlamydophila psittaci in collected pharyngeal swabs from asyptomatic pigeons by PCR.Materials and Methods: Pharyngeal samples from pigeons with no symptoms of disease (n=280 were collected during hot and cold seasons in different parts of Ahvaz. DNA was extracted from specimens and subjected to PCR targeting pmp genes and 16s-23s rRNA intergenic spacer of Cp. psittaci and chlamydiales specific primers.Results: Of 280 samples 2 (0.7% harbor were positive for chlamydiales (16s-23s intergenic spacer and Cp. psittaci specific genes (pmp gene.Conclusions: In this research the pigeons were asymptomatic carriers for Cp. psittaci in their respiratory discharges. These results suggest that Cp. psittaci infection of human can occur in very close and continuous contact with pigeons.

  3. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction. (United States)

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles


    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  4. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    KAUST Repository

    Prest, Emmanuelle I E C


    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  5. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)? (United States)

    Baum, B R; Edwards, T; Johnson, D A


    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  6. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Alikunhi, Nabeel M.


    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  7. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing. (United States)

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  8. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    DEFF Research Database (Denmark)

    Møller, Annette; Søborg, Ditte Andreasen; Al-Soud, Waleed Abu;


    controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input......The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...... of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers...

  9. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species. (United States)

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H


    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  10. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips (United States)

    Bavykin, Sergei G.; Mirzabekov, Andrei D.


    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  11. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Guanghong Zuo


    Full Text Available A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1 the whole-genome-based and alignment-free CVTree using 179 genomes; (2 the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3 the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation.

  12. The mitochondrial 16 s rRNA reveals high anthropogenic influence on land snail diversity in a preliminary island survey. (United States)

    Abu-Bakar, Siti-Balkhis; Razali, Norhanis M; Naggs, Fred; Wade, Christopher; Mohd-Nor, Siti-Azizah; Aileen-Tan, Shau-Hwai


    A total of 30 specimens belonging to five species, namely; Cryptozona siamensis, Sarika resplendens and Sarika sp. from the family Ariophantidae as well as Quantula striata and Quantula sp. from the family Dyakiidae were collected from the Langkawi Island in Northern Peninsular Malaysia. All specimens were identified through comparisons of shell morphology and amplification of a 500 bp segment of the 16S rRNA mtDNA gene. To assess phylogenetic insights, the sequences were aligned using ClustalW and phylogenetic trees were constructed. The analyses showed two major lineages in both Maximum Parsimony and Neighbour Joining phylogenetic trees. Each putative taxonomic group formed a monophyletic cluster. Our study revealed low species and intraspecies genetic diversities based on the 16S rRNA gene sequences. Thus, this study has provided an insight of land snail diversity in populations of an island highly influenced by anthropogenic activities through complementary use of shell morphological and molecular data. PMID:24443224

  13. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences

    Czech Academy of Sciences Publication Activity Database

    Černotíková, Eva; Horák, Aleš; Moravec, František


    Roč. 58, č. 2 (2011), s. 135-148. ISSN 0015-5683 R&D Projects: GA ČR(CZ) GA524/06/0170; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA * phylogeny * taxonomy Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.812, year: 2011

  14. Identification of coagulase-negative staphylococci by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and rRNA restriction patterns.


    Pennington, T H; Harker, C.; Thomson-Carter, F


    A total of 1,417 staphylococcal and micrococcal strains were collected from the beards and scalps of 10 subjects over a period of 8 months. Sixteen strains identified as Staphylococcus epidermidis with an API system had distinctive yellow colonies on nutrient agar plates and sodium dodecyl sulfate-polyacrylamide gel electrophoresis whole-cell polypeptide profiles similar to those of Staphylococcus capitis; this identification was confirmed by analysis of rRNA gene restriction patterns.

  15. Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers▿


    Dar, Shabir A.; Yao, Li; van Dongen, Udo; Kuenen, J. Gijs; Muyzer, Gerard


    Here we describe the diversity and activity of sulfate-reducing bacteria (SRB) in sulfidogenic bioreactors by using the simultaneous analysis of PCR products obtained from DNA and RNA of the 16S rRNA and dissimilatory sulfite reductase (dsrAB) genes. We subsequently analyzed the amplified gene fragments by using denaturing gradient gel electrophoresis (DGGE). We observed fewer bands in the RNA-based DGGE profiles than in the DNA-based profiles, indicating marked differences in the populations...

  16. Sensitive PCR diagnosis of Infections by Enterocytozoon bieneusi (microsporidia) using primers based on the region coding for small-subunit rRNA.


    DA SILVA, A. J.; Schwartz, D A; Visvesvara, G S; De Moura, H; Slemenda, S B; Pieniazek, N J


    Enterocytozoon bieneusi is the most common microsporidian infecting patients with AIDS. We have developed a PCR primer pair, named EBIEF1/EBIER1, based on the small-subunit rRNA sequence of this microsporidian. Compared with other PCR-based methods, this primer pair shows a higher efficiency of detection in diagnostic applications than does another previously described primer pair, V1/EB450.

  17. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa.

    Directory of Open Access Journals (Sweden)

    Hagen Frickmann

    Full Text Available The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation.Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture.Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture.Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required.

  18. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data


    Redmond, Niamh E.; Jean Raleigh; Van Soest, Rob W.M.; Michelle Kelly; Travers, Simon A A; Brian Bradshaw; Salla Vartia; Kelly M Stephens; McCormack, Grace P.


    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, ...

  19. 16S rRNA sequences of Bartonella bacilliformis and cat scratch disease bacillus reveal phylogenetic relationships with the alpha-2 subgroup of the class Proteobacteria.


    O'Connor, S P; Dorsch, M; Steigerwalt, A G; Brenner, D J; Stackebrandt, E


    The primary structures of 16S rRNAs of Bartonella bacilliformis, an isolate of the cat scratch disease (CSD) bacillus, and a strain phenotypically similar to the CSD bacillus were determined by reverse transcriptase sequencing. These microorganisms were found to be members of the alpha-2 subgroup of the class Proteobacteria. The sequence from B. bacilliformis was most closely related to the rRNA of Rochalimaea quintana (91.7% homology), the etiologic agent of trench fever. The sequence from t...

  20. 16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles


    Hang, Jun; Desai, Valmik; Zavaljevski, Nela; Yang, Yu; Lin, Xiaoxu; Satya, Ravi Vijaya; Martinez, Luis J.; Blaylock, Jason M.; Jarman, Richard G.; Thomas, Stephen J.; Kuschner, Robert A.


    Background Sample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. Most published studies were limited to the comparison of only one or two types of these factors. Systematic multi-factor explorations are needed to evaluate the conditions that may impact validity of a microbiome analysis. This study was aimed to improve methodological options to facilitate the best technical app...

  1. Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens


    Kommedal, Øyvind; Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.


    Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or ne...

  2. An effect of 16S rRNA intercistronic variability on coevolutionary analysis in symbiotic bacteria: Molecular phylogeny of Arsenophonus triatominarum

    Czech Academy of Sciences Publication Activity Database

    Šorfová, Pavlína; Škeříková, Andrea; Hypša, Václav


    Roč. 31, č. 2 (2008), s. 88-100. ISSN 0723-2020 R&D Projects: GA ČR GA206/04/0520; GA AV ČR IAA601410708 Institutional research plan: CEZ:AV0Z60220518 Keywords : intragenomic heterogeneity * 16S rRNA * coevolution * insect symbionts * molecular phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 2.582, year: 2008

  3. The chromatin remodeling factor CSB recruits histone acetyltransferase PCAF to rRNA gene promoters in active state for transcription initiation.

    Directory of Open Access Journals (Sweden)

    Meili Shen

    Full Text Available The promoters of poised rRNA genes (rDNA are marked by both euchromatic and heterochromatic histone modifications and are associated with two transcription factors, UBF and SL1 that nucleate transcription complex formation. Active rRNA genes contain only euchromatic histone modifications and are loaded with all components of transcriptional initiation complex including RNA polymerase I. Coupled with histone acetylation and RNA polymerase I targeting, poised promoters can be converted to active ones by ATP-dependent chromatin remodeling factor CSB for initiation of rDNA transcription. However, it is not clear how dynamic histone modifications induce the assembly of polymerase I transcription initiation complex to active promoters during such conversion. Here we show that a complex consisting of CSB, RNA polymerase I and histone acetyltransferase PCAF is present at the rDNA promoters in active state. CSB is required for the association of PCAF with rDNA, which induces acetylation of histone H4 and histone H3K9. Overexpression of CSB promotes the association of PCAF with rDNA. Knockdown of PCAF leads to decreased levels of H4ac and H3K9ac at rDNA promoters, prevents the association of RNA polymerase I and inhibits pre-rRNA synthesis. The results demonstrate that CSB recruits PCAF to rDNA, which allows histone acetylation that is required for the assembly of polymerase I transcription initiation complex during the transition from poised to active state of rRNA genes, suggesting that CSB and PCAF play cooperative roles to establish the active state of rRNA genes by histone acetylation.

  4. Congruent Phylogenies of Most Common Small-Subunit rRNA and Dissimilatory Sulfite Reductase Gene Sequences Retrieved from Estuarine Sediments


    Joulian, Catherine; Ramsing, Niels B.; Ingvorsen, Kjeld


    The diversity of sulfate-reducing bacteria (SRB) in brackish sediment was investigated using small-subunit rRNA and dissimilatory sulfite reductase (DSR) gene clone libraries and cultivation. The phylogenetic affiliation of the most commonly retrieved clones for both genes was strikingly similar and produced Desulfosarcina variabilis-like sequences from the inoculum but Desulfomicrobium baculatum-like sequences from a high dilution in natural media. Related organisms were subsequently cultiva...

  5. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene


    Pasupuleti Sreenivasa Rao


    Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Seq...

  6. Characterization by 16S rRNA gene analysis and in situ hybridization of bacteria living in the hindgut of a deposit-feeding echinoid (Echinodermata)


    da Silva, S.G.; Gillan, D. C.; Dubilier, N.; De Ridder, C.


    The hindgut caecum of the deposit-feeding echinoid Echinocardium cordatum harbours a symbiotic bacterial microflora, organized into layered mats around detrital particles owing to the proliferation of filamentous bacteria. The bacterial community was analysed using 16S rRNA gene analysis and fluorescence in situ hybridization. The purpose was to characterize its biodiversity and to identify its predominant members. The majority of the 16S sequences belong to the delta -Proteobacteria (61.5%),...

  7. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling


    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recov...

  8. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    Directory of Open Access Journals (Sweden)

    Stephan Roger


    Full Text Available Abstract Background E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a preliminary evaluation of this system to a number of target and non-target strains showed significant specificity problems of this system. In this study full-length 16S rRNA genes of thirteen E. sakazakii strains from food, environment and human origin as well as the type strain ATCC 51329 were sequenced. Based on this sequence data a new specific PCR system for E. sakazakii was developed and evaluated. Results By phylogenetic analysis of the new full-length 16S rRNA gene sequence data obtained we could show the presence of a second phylogenetic distinct lineage within the E. sakazakii species. The newly developed 16S rRNA gene targeting PCR system allows identification of E. sakazakii strains from both lineages. The assay's ability to correctly identify different E. sakazakii isolates as well as to differentiate E. sakazakii from other closely related Enterobacteriaceae species and other microorganisms was shown on 75 target and non-target strains. Conclusion By this study we are presenting a specific and reliable PCR identification system, which is able to correctly identify E. sakazakii isolates from both phylogenetic distinct lines within the E. sakazakii species. The impact of this second newly described phylogenetic line within the E. sakazakii species in view of clinical and food safety aspects need further investigation.

  9. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification


    Lehner, A J; Tasara, T.; Stephan, R


    BACKGROUND: E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a prelimin...

  10. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene


    Neumann, K.; Michaux, Johan,; Lebedev, V.; N Yigit; Colak, E.; Ivanova, N.; Poltoraus, A.; Surov, A.; Markov, G.; Maak, S.; Neumann, S.; Gattermann, R.


    Despite some popularity of hamsters as pets and laboratory animals there is no reliable phylogeny of the subfamily Cricetinae available so far. Contradicting views exist not only about the actual number of species but also concerning the validity of several genera. We used partial DNA sequences of two mitochondrial (cytochrome b, 12S rRNA) and one partial nuclear gene (von Willebrand Factor exon 28) to provide a first gene tree of the Cricetinae based on 15 taxa comprising six genera: Accordi...

  11. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites (United States)

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng


    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  12. 16S rRNA gene-based metagenomic analysis identifies a novel bacterial co-prevalence pattern in dental caries


    Jagathrakshakan, Sri Nisha; Sethumadhava, Raghavendra Jayesh; Mehta, Dhaval Tushar; Ramanathan, Arvind


    Objective: To identify the prevalence of acidogenic and nonacidogenic bacteria in patients with polycaries lesions, and to ascertain caries specific bacterial prevalence in relation to noncaries controls. Materials and Methods: Total genomic DNA extracted from saliva of three adults and four children from the same family were subjected to 16S rRNA gene sequencing analysis on a next generation sequencer, the PGS-Ion Torrent. Those bacterial genera with read counts > 1000 were considered as sig...

  13. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    International Nuclear Information System (INIS)

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

  14. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water


    Ahmed, W.; Staley, C.; Sadowsky, M J; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.


    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial...

  15. Polynucleotide Probes That Target a Hypervariable Region of 16S rRNA Genes To Identify Bacterial Isolates Corresponding to Bands of Community Fingerprints


    Heuer, Holger; Hartung, Kathrin; Wieland, Gabriele; Kramer, Ina; Smalla, Kornelia


    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in ...

  16. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis


    Steelman Samantha M; Chowdhary Bhanu P; Dowd Scot; Suchodolski Jan; Janečka Jan E


    Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to character...

  17. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing. (United States)

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  18. Complementarity of the 16S rRNA penultimate stem with sequences downstream of the AUG destabilizes the plastid mRNAs


    Kuroda, Hiroshi; Maliga, Pal


    Escherichia coli mRNA translation is facilitated by sequences upstream and downstream of the initiation codon, called Shine–Dalgarno (SD) and downstream box (DB) sequences, respectively. In E.coli enhancing the complementarity between the DB sequences and the 16S rRNA penultimate stem resulted in increased protein accumulation without a significant affect on mRNA stability. The objective of this study was to test whether enhancing the complementarity of plastid mRN...

  19. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene


    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.


    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic...

  20. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba. (United States)

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia


    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  1. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa. (United States)

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli


    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  2. Community College Internal Auditors: Internal Audit Guidebook. (United States)

    Jones, Ronna; And Others

    This guidebook includes information compiled by the "Audit Manual" committee of Community College Internal Auditors (CCIA) from several California community college districts regarding their internal auditing practices. The first section of the guidebook discusses the purpose of internal audits, indicating that audits assist members of the…

  3. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Sarah M. Boomer


    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  4. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Bryan E. Dutton


    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  5. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Directory of Open Access Journals (Sweden)

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  6. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    Institute of Scientific and Technical Information of China (English)

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan


    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  7. Population genetic structure of Cheyletus malaccensis (Acari: Cheyletidae) in China based on mitochondrial COI and 12S rRNA genes. (United States)

    Yang, Xiaoqiang; Ye, Qingtian; Xin, Tianrong; Zou, Zhiwen; Xia, Bin


    Cheyletus malaccensis is a predatory mite widely distributed in grain storages. It has been regarded as an important biological control agent for pest mites. In this study, we investigated the population genetic structure of C. malaccensis distributed in China based on the partial regions of mitochondrial COI and 12S rRNA genes. We collected 256 individuals of C. malaccensis from stored grain in 34 sites of China. We detected 50 COI gene haplotypes and nine 12S rRNA gene haplotypes. There were three clades in the haplotype network and Bayesian and maximum parsimony phylogenetic trees based on COI sequences, and two based on 12S rRNA sequences. The clustering of haplotypes was not correlated with their geographical distributions. The analysis of molecular variance, AMOVA, indicated that the genetic differentiation between populations was relatively weak. The major genetic differentiation was found within populations. We suggest that the genetic structure of C. malaccensis observed in this study may be the result of long-term climate fluctuations and recent human disturbances. PMID:26947027

  8. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage. [uv radiation, Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Morgan, E.A.; Nomura, M.


    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA/sub 1//sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA/sub 1//sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA/sub 1//sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage.

  9. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan. (United States)

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R


    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  10. Genetic variation and identification of cultivated Fallopia multiflora and its wild relatives by using chloroplast matK and 18S rRNA gene sequences. (United States)

    Yan, Ping; Pang, Qi-Hua; Jiao, Xu-Wen; Zhao, Xuan; Shen, Yan-Jing; Zhao, Shu-Jin


    FALLOPIA MULTIFLORA (Thunb.) Harald . has been widely and discriminatingly used in China for the study and treatment of anemia, swirl, deobstruent, pyrosis, insomnia, amnesia, atheroma and also for regulating immune functions. However, there is still confusion about the herbal drug's botanical origins and the phylogenetic relationship between the cultivars and the wild relatives. In order to develop an efficient method for identification, a molecular analysis was performed based on 18 S rRNA gene and partial MATK gene sequences. The 18 S rRNA gene sequences of F. MULTIFLORA were 1809 bp in length and were highly conserved, indicating that the cultivars and the wild F. MULTIFLORA have the same botanical origin. Based on our 18 S rRNA gene sequences analysis, F. MULTIFLORA could be easily distinguished at the DNA level from adulterants and some herbs with similar components. The MATK gene partial sequences were found to span 1271 bp. The phylogenetic relation of F. MULTIFLORA based on the MATK gene showed that all samples in this paper were divided into four clades. The sequences of the partial MATK gene had many permutations, which were related to the geographical distributions of the samples. MATK gene sequences provided valuable information for the identification of F. MULTIFLORA. New taxonomic information could be obtained to authenticate the botanical origin of the F. MULTIFLORA, the species and the medicines made of it. PMID:18759218

  11. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr (United States)

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie


    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  12. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae. (United States)

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping


    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae. PMID:27147066

  13. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops. (United States)

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A


    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants. PMID:26345903

  14. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species. (United States)

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi


    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  15. Identification of Internal Transcribed Spacer Sequence Motifs in Truffles: a First Step toward Their DNA Bar Coding▿ †


    El Karkouri, Khalid; Murat, Claude; Zampieri, Elisa; Bonfante, Paola


    This work presents DNA sequence motifs from the internal transcribed spacer (ITS) of the nuclear rRNA repeat unit which are useful for the identification of five European and Asiatic truffles (Tuber magnatum, T. melanosporum, T. indicum, T. aestivum, and T. mesentericum). Truffles are edible mycorrhizal ascomycetes that show similar morphological characteristics but that have distinct organoleptic and economic values. A total of 36 out of 46 ITS1 or ITS2 sequence motifs have allowed an accura...

  16. Isolation and Identification of a New Tetrodotoxin-Producing Bacterial Species, Raoultella terrigena, from Hong Kong Marine Puffer Fish Takifugu niphobles


    Fred Wang-Fat Lee; Peter Hoi-Fu Yu; Vincent Chung-Him Yu; Kin-Chung Ho


    Puffer fish, Takifugu niphobles, collected from the Hong Kong coastal waters were screened for tetrodotoxin-producing bacteria. A Gram-negative, non-acid-fast, non-sporing and rod shaped bacterial strain (designated as gutB01) was isolated from the intestine of the puffer fish and was shown to produce tetrodotoxin (TTX). Based on the Microbial Identification (MIDI) and 16S-23S rDNA internal transcribed spacer (ITS) phylogenetic analysis, the strain was identified as Raoultella terrigena. The ...

  17. Internal Control System


    Pavésková, Ivana


    This thesis is focused on internal control system. The aim of this thesis is to analyse the development and elements of internal control system, and then demonstrate the possible form of the internal control system in practice. The thesis is divided into two parts -- theoretical and practical. The beginning of the theoretical part is devoted to characteristics of internal controls and their relation to internal control, attention is also paid to economic crimes which the internal control syst...

  18. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S


    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  19. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Directory of Open Access Journals (Sweden)

    Ghosh Sujit K


    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  20. Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

    International Nuclear Information System (INIS)

    A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

  1. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Directory of Open Access Journals (Sweden)

    Pedro Braga Arcuri


    Full Text Available In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG and polyvinylpirrolidone (PVP on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp. skin, Desmodium ovalifolium, red grape (Vitis vinifera skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (PA recuperação de RNA ribossômico (rRNA intacto é necessária para a detecção de flutuações na população microbiana ruminal decorrentes dos taninos de forrageiras, utilizando-se sondas para 16S rRNA. O objetivo deste trabalho foi avaliar o efeito de polietilenoglicol (PEG e polivinilpirrolidona (PVP na extração de rRNA bacteriano, em presença de taninos de leguminosas forrageiras tropicais e de outras fontes, que possa ser hibridizado com sondas de oligonucleotídeos. Culturas de Ruminococcus albus 8 foram expostas ou não a 8 g/L de ácido tânico ou a 1 g/L de taninos condensados, extraídos de Acacia angustissima, casca de banana (Musa sp., Desmodium ovalifolium, cascas de uvas vermelhas (Vitis vinifera e Inga edulis. As culturas foram lavadas com tampão Tris pH 7 contendo 8% PEG ou 6% PVP antes do rompimento das c

  2. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations. (United States)

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao


    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1



    Tomas Hrebik


    This article deals with the significance of internal audit and explains that implementation of an internal audit unit into a company organisational structures is going to significantly influence the company business success in the future. Further, it focuses on the strategies, procedures and all organisational processes but also on the methods for reaching the intention on the individual operational levels. Nevertheless the internal audit position depends mainly on the utilisation of the unit...

  4. Penerapan Pengendalian Intern Pada Heifer International Indonesia


    Harianja, Hertauli R


    The aim of this research is to find out how Heifer International Indonesia applicate the Internal Control as a International Non Government Organization (INGO) The type of this research is descriptive research using primary data i.e : result of interviews with a related organization staff. Secondary data i.e organization structure, audited financial report, implementing partner list. Data collecting technic is done using interview, observation, documentation techniques. This research is...

  5. Pattern of antibiotic resistant mastitis in dairy cows

    Directory of Open Access Journals (Sweden)

    D. Chandrasekaran


    Full Text Available Aim: To study the prevalence of drug resistant mastitis and their pattern of antibiotic resistance in dairy cows from Tamil Nadu. Materials and Methods: Isolation and identification of resistant pathogens were performed from acute clinical mastitis samples. Based on culture, isolation and sensitivity tests, cows with resistant mastitis were grouped as; Group I: Escherichia coli (n=119, Group II: Staphylococcus aureus (n=104 and Group III: Methicillin-resistant Staphylococcal aureus (MRSA (n=12. The isolates were tested using agar disc diffusion method for their antimicrobial susceptibility and modified resazurin assay microdilution technique for minimum inhibitory concentration (MIC to 8 antimicrobial drugs. The organisms were also confirmed for their identity by performing PCR on the bacterial pellet targeting the specific genes such as 16s-23s rRNA, mecA and blaZ respectively for the resistant pathogens and also confirmed by sequencing. Results: Antibiotic resistant mastitis was detected in 235 out of 401 cows accounting to 56.1%. The predominant resistant causative pathogen was E. coli (50.64% followed by S. aureus (44.25% and MRSA (5.11%. In vitro antibiotic sensitivity test and MIC breakpoints, E. coli, S. aureus and MRSA organisms showed more sensitivity to enrofloxacin, amoxicillin + sulbactam, gentamicin and ceftriaxone and had highest resistant to penicillin followed by amoxicillin, oxytetracycline and methicillin. E. coli and S. aureus isolates were found to be resistant to 1 or 2 antimicrobials, whereas most of the MRSA isolates were found to be multi-drug resistant i.e resistance to 3 or more of antimicrobials. Out of 235 milk samples, the specific target gene 16s-23s rRNA (E. coli , 16s-23s rRNA (S. aureus and MRSA (mecA and blaZ could be amplified from 119, 104 and 12 isolates with a percentage positivity of 50.64 (119/235, 89.64 (104/116 and 10.34 (12/116 respectively. Conclusion: Prevalence of antimicrobial resistance (AMR in

  6. Application of 12S rRNA in the identification of Muntiacus crinifons and Muntiacus reevesi%12S rRNA在黑麂和黄麂物种鉴定中的应用

    Institute of Scientific and Technical Information of China (English)

    贺培建; 阮向东; 方盛国


    The gene of 12S rRNA exhibits a high degree of conservation during animal evolution. Its sequence shows partial difference among species but little variation among individuals of the same species. Therefore, the 12S rRNA could be used to perform intra-and inter-specific identification studies. All the deer of genus Muntiacus become endangered due to excessive poaching and thus protected by Chinas Wildlife Protection Law at the national and provincial level. In this study, we employed the sequencing of 12S rRNA to identify two confiscated samples and found out that the two samples were Mwttiacus crinifons and Mwttiacus reevesi,respectively. The sequence of the 12S rRNA adopted in this study proved to be a suitable genetic marker for species identification of conservation animals.

  7. The Internal Audit Outsourcing


    Grzegorz Gołębiowski


    The article explores an issue of the internal audit outsourcing. It indicates the differences between internal audit, outsourcing and cosourcing of this service as well as their advantages and disadvantages. Drawing from the research on internal audit outsourcing the recent market trends were identified as well as motivations for choosing different forms of internal auditing.

  8. The Internal Audit Outsourcing

    Directory of Open Access Journals (Sweden)

    Grzegorz Gołębiowski


    Full Text Available The article explores an issue of the internal audit outsourcing. It indicates the differences between internal audit, outsourcing and cosourcing of this service as well as their advantages and disadvantages. Drawing from the research on internal audit outsourcing the recent market trends were identified as well as motivations for choosing different forms of internal auditing.

  9. Models og International Entrepreneurship

    DEFF Research Database (Denmark)

    Rask, Morten; Servais, Per


    International Entrepreneurship, and specifically but not exclusively, International New Ventures (INVs). The three resulting ‘meta-models’ depict the activities and loci of such firms, the motivating factors that give rise to such firms and their growth modalities and strategies. These models reflect the merger...... of entrepreneurship and international business into the field of international entrepreneurship....

  10. Neurology and international organizations


    Mateen, Farrah J.


    A growing number of international stakeholders are engaged with neurologic diseases. This article provides a brief overview of important international stakeholders in the practice of neurology, including global disease-specific programs, United Nations agencies, governmental agencies with international influence, nongovernmental organizations, international professional organizations, large private donors, private–public partnerships, commercial interests, armed forces, and universities and c...

  11. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis


    Meyer, Birte; Kuever, Jan


    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  12. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.



    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  13. Theorising international environmental law


    Humphreys, Stephen; Otomo, Yoriko


    From The Oxford Handbook of International Legal Theory (Florian Hoffmann and Anne Orford, eds, Oxford UP, forthcoming 2014). --- This paper, part of a larger work on international law theory, sketches some early lines of inquiry towards a theoretical understanding of international environmental law. As the body of international law regulating human interaction with the natural world, one might expect this branch of law to be a cornerstone of the international system. Yet in practice,...

  14. Interní audit


    Samuelová, Barbora


    The diploma thesis deals with the internal audit, its function and status in a particular organization. The passages look into the development of the profession, relation to the external audit and their comparison, demands on the internal auditor, internal audit structure and the procedure itself. A part of the thesis deals thoroughly with the internal audit in connection with a risk, fraudulent conduct and the importance of the internal control. At the end of the thesis, there are some pract...

  15. Quantitative identification of fecal water pollution sources by TaqMan real-time PCR assays using Bacteroidales 16S rRNA genetic markers. (United States)

    Lee, Dae-Young; Weir, Susan C; Lee, Hung; Trevors, Jack T


    PCR-based analysis of Bacteroidales 16S rRNA genes has emerged as a promising tool to identify sources of fecal water pollution. In this study, three TaqMan real-time PCR assays (BacGeneral, BacHuman, and BacBovine) were developed and evaluated for their ability to quantitatively detect general (total), human-specific, and bovine-specific Bacteroidales 16S rRNA genetic markers. The detection sensitivity was determined to be 6.5 copies of 16S rRNA gene for the BacGeneral and BacHuman assays and 10 copies for the BacBovine assay. The assays were capable of detecting approximately one to two cells per PCR. When tested with 70 fecal samples from various sources (human, cattle, pig, deer, dog, cat, goose, gull, horse, and raccoon), the three assays positively identified the target markers in all samples without any false-negative results. The BacHuman and BacBovine assays exhibited false-positive reactions with non-target samples in a few cases. However, the level of the false-positive reactions was about 50 times smaller than that of the true-positive ones, and therefore, these cross-reactions were unlikely to cause misidentifications of the fecal pollution sources. Microbial source-tracking capability was tested at two freshwater streams of which water quality was influenced by human and cattle feces, respectively. The assays accurately detected the presence of the corresponding host-specific markers upon fecal pollution and the persistence of the markers in downstream areas. The assays are expected to reliably determine human and bovine fecal pollution sources in environmental water samples. PMID:20871990

  16. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China. (United States)

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong


    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination. PMID:27139028

  17. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)


    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  18. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    International Nuclear Information System (INIS)

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities

  19. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)



    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  20. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate. (United States)

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M


    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  1. The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    Directory of Open Access Journals (Sweden)

    Arzu Coleri Cihan


    Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

  2. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Xiangyu He

    Full Text Available The phenotypic manifestations of mitochondrial DNA (mtDNA mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R or P(R 454 mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R, the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S, mto2(P(S and MTO2(P(R. The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  3. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Pasupuleti Sreenivasa Rao


    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  4. 16S rRNA gene pyrosequencing reveals shift in patient faecal microbiota during high-dose chemotherapy as conditioning regimen for bone marrow transplantation. (United States)

    Montassier, Emmanuel; Batard, Eric; Massart, Sébastien; Gastinne, Thomas; Carton, Thomas; Caillon, Jocelyne; Le Fresne, Sophie; Caroff, Nathalie; Hardouin, Jean Benoit; Moreau, Philippe; Potel, Gilles; Le Vacon, Françoise; de La Cochetière, Marie France


    Gastrointestinal disturbances are a side-effect frequently associated with haematological malignancies due to the intensive cytotoxic treatment given in connection with bone marrow transplantation (BMT). However, intestinal microbiota changes during chemotherapy remain poorly described, probably due to the use of culture-based and low-resolution molecular methods in previous studies. The objective of our study was to apply a next generation DNA sequencing technology to analyse chemotherapy-induced changes in faecal microbiota. We included eight patients with non-Hodgkin's lymphoma undergoing one course of BMT conditioning chemotherapy. We collected a prechemotherapy faecal sample, the day before chemotherapy was initiated, and a postchemotherapy sample, collected 1 week after the initiation of chemotherapy. Total DNA was extracted from faecal samples, denaturing high-performance liquid chromatography based on amplification of the V6 to V8 region of the 16S ribosomal RNA (rRNA) gene, and 454-pyrosequencing of the 16 S rRNA gene, using PCR primers targeting the V5 and V6 hypervariable 16S rRNA gene regions were performed. Raw sequence data were screened, trimmed, and filtered using the QIIME pipeline. We observed a steep reduction in alpha diversity and significant differences in the composition of the intestinal microbiota in response to chemotherapy. Chemotherapy was associated with a drastic drop in Faecalibacterium and accompanied by an increase of Escherichia. The chemotherapy-induced shift in the intestinal microbiota could induce severe side effects in immunocompromised cancer patients. Our study is a first step in identifying patients at risk for gastrointestinal disturbances and to promote strategies to prevent this drastic shift in intestinal microbiota. PMID:24402367

  5. Models of international entrepreneurship

    DEFF Research Database (Denmark)

    Rask, Morten; Servais, Per


    ). These models reflect the merger of entrepreneurship and international business into the field of international entrepreneurship. Managers in international entrepreneurial firms and students in international business and entrepreneurship can use the models as framework for understanding international......The purpose with this article is to review models used to describe and explain the establishment and development of international new ventures in order to investigate how and why international new ventures are established and developed. This article attempts an integration of extant theory on...... International Entrepreneurship, and specifically but not exclusively, International New Ventures (INVs). The three resulting ‘meta-models’ depict the activities and loci of such firms (Figure 1), the motivating factors that give rise to such firms (Figure 2) and their growth modalities and strategies (Figure 3...

  6. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA


    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.


    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is a...

  7. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing


    Fei Gao; Fenghui Li; Jie Tan; Jingping Yan; Huiling Sun


    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±...

  8. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment. (United States)

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  9. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    Directory of Open Access Journals (Sweden)

    Jeongsu Oh

    Full Text Available High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs. The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM

  10. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S


    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  11. Cultivation-independent analysis reveals a shift in ciliate 18S rRNA gene diversity in a polycyclic aromatic hydrocarbon-polluted soil


    Lara, Enrique; Berney, Cédric; Harms, Hauke; Chatzinotas, Antonis


    Using cultivation-independent methods the ciliate communities of a clay-rich soil with a 90-year record of pollution by polycyclic aromatic hydrocarbons (PAH) (4.5 g kg−1 PAH) were compared with that of a nonpolluted soil collected in its vicinity and with similar properties. A ciliate-specific set of 18S rRNA gene targeting primers was designed and used to amplify DNA extracted from both soils (surface and 20 cm depth). Four clone libraries were generated with PCR products that covered an 18...

  12. hRRN3 is essential in the SL1-mediated recruitment of RNA Polymerase I to rRNA gene promoters


    Miller, Gail; Panov, Kostya I.; Friedrich, J. Karsten; TRINKLE-MULCAHY, LAURA; Lamond, Angus I; Zomerdijk, Joost C. B. M.


    A crucial step in transcription is the recruitment of RNA polymerase to promoters. In the transcription of human rRNA genes by RNA Polymerase I (Pol I), transcription factor SL1 has a role as the essential core promoter binding factor. Little is known about the mechanism by which Pol I is recruited. We provide evidence for an essential role for hRRN3, the human homologue of a yeast Pol I transcription factor, in this process. We find that whereas the bulk of human Pol I complexes (Iα) are tra...

  13. High-density universal 16S rRNA microarray analysis reveals broader diversity than typical clone library when sampling the environment. (United States)

    DeSantis, Todd Z; Brodie, Eoin L; Moberg, Jordan P; Zubieta, Ingrid X; Piceno, Yvette M; Andersen, Gary L


    Molecular approaches aimed at detection of a broad-range of prokaryotes in the environment routinely rely on classifying heterogeneous 16S rRNA genes amplified by polymerase chain reaction (PCR) using primers with broad specificity. The general method of sampling and categorizing DNA has been to clone then sequence the PCR products. However, the number of clones required to adequately catalog the majority of taxa in a sample is unwieldy. Alternatively, hybridizing target sequences to a universal 16S rRNA gene microarray may provide a more rapid and comprehensive view of prokaryotic community composition. This study investigated the breadth and accuracy of a microarray in detecting diverse 16S rRNA gene sequence types compared to clone-and-sequencing using three environmental samples: urban aerosol, subsurface soil, and subsurface water. PCR products generated from universal 16S rRNA gene-targeted primers were classified by using either the clone-and-sequence method or by hybridization to a novel high-density microarray of 297,851 probes complementary to 842 prokaryotic subfamilies. The three clone libraries comprised 1391 high-quality sequences. Approximately 8% of the clones could not be placed into a known subfamily and were considered novel. The microarray results confirmed the majority of clone-detected subfamilies and additionally demonstrated greater amplicon diversity extending into phyla not observed by the cloning method. Sequences matching operational taxonomic units within the phyla Nitrospira, Planctomycetes, and TM7, which were uniquely detected by the array, were verified with specific primers and subsequent amplicon sequencing. Subfamily richness detected by the array corresponded well with nonparametric richness predictions extrapolated from clone libraries except in the water community where clone-based richness predictions were greatly exceeded. It was concluded that although the microarray is unreliable in identifying novel prokaryotic taxa, it

  14. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding


    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson


    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  15. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment (United States)

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  16. Genetic Diversity of Pasteurella dagmatis as Assessed by Analysis of the 16S rRNA and rpoB Gene Sequences


    Król, Jarosław; Bania, Jacek; Florek, Magdalena; Podkowik, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzisław


    A total of 16 Pasteurella dagmatis strains, including 11 feline and 4 canine isolates as well as one strain isolated from a tiger, were analyzed using partial 16S rRNA and rpoB gene sequence comparison. Phylogenetic studies based on both genes revealed that the population of P. dagmatis recovered from cats in Poland differs markedly from canine strains, constituting a well-separated cluster within Pasteurella sensu stricto species group. The isolate from a tiger seems to represent yet another...

  17. Phylogenetic positions of two marine ciliates, Metanophrys similis and Pseudocohnilembus hargisi (Protozoa, Ciliophora, Scuticociliatia), inferred from complete small subunit rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)


    The small subunit rRNA (SSrRNA) gene was sequenced for two marine scuticociliates Metanophrys similis and Pseudocohnilembus hargisi. The results show that this gene comprises 1763 and 1753 nucleotides in the two marine ciliates respectively.Metanophrys similis is phylogenetically closely related to the clade containing Mesanophrys carcini and Anophyroides haemophila, which branches basally to other species within the order Philasterida. Pseudocohnilembus hargisi groups with its congener, P. marinus, with strong bootstrap support. Paranophrys magna groups with the clade including Cohnilembus and Uronema, representing a sister clade to that containing the two Pseudocohnilembus species.

  18. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Directory of Open Access Journals (Sweden)

    Mariza M. Coêlho


    Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

  19. Molecular identification of bacteria by fluorescence-based PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene.


    Widjojoatmodjo, M N; Fluit, A.C.; Verhoef, J


    PCR-single-strand conformation polymorphism (PCR-SSCP) analysis is a rapid and convenient technique for the detection of mutations and allelic variants. We have adapted this technique for the identification of bacteria by PCR with fluorescein-labeled primers chosen from the conserved regions of the 16S rRNA gene flanking a variable region. The PCR product was denatured, separated on a nondenaturing gel, and detected by an automated DNA sequencer. The mobility of the single-stranded DNA is seq...

  20. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat


    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad


    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that ...

  1. Genetic Analysis of the Invariant Residue G791 in Escherichia coli 16S rRNA Implicates RelA in Ribosome Function▿


    Kim, Hong-Man; Ryou, Sang-Mi; Song, Woo-Seok; Sim, Se-Hoon; Cha, Chang-Jun; Han, Seung Hyun; Ha, Nam-Chul; Kim, Jae-Hong; BAE, Jeehyeon; Cunningham, Philip R.; Lee, Kangseok


    Previous studies identified G791 in Escherichia coli 16S rRNA as an invariant residue for ribosome function. In order to establish the functional role of this residue in protein synthesis, we searched for multicopy suppressors of the mutant ribosomes that bear a G-to-U substitution at position 791. We identified relA, a gene whose product has been known to interact with ribosomes and trigger a stringent response. Overexpression of RelA resulted in the synthesis of approximately 1.5 times more...

  2. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences. (United States)

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V


    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  3. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria. (United States)

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S


    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  4. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene. (United States)

    Coêlho, Mariza M; Ferreira-Nozawa, Monica S; Nozawa, Sérgio R; Santos, André L W


    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  5. Relatedness of chromosomal and plasmid DNAs of Erwinia pyrifoliae and Erwinia amylovora. (United States)

    McGhee, Gayle C; Schnabel, Elise L; Maxson-Stein, Kimberly; Jones, Beatrix; Stromberg, Verlyn K; Lacy, George H; Jones, Alan L


    The plant pathogen Erwinia pyrifoliae has been classified as a separate species from Erwinia amylovora based in part on differences in molecular properties. In this study, these and other molecular properties were examined for E. pyrifoliae and for additional strains of E. amylovora, including strains from brambles (Rubus spp.). The nucleotide composition of the internal transcribed spacer (ITS) region was determined for six of the seven 16S-23S rRNA operons detected in these species with a 16S rRNA gene probe. Each species contained four operons with a tRNA(Glu) gene and two with tRNA(Ile) and tRNA(Ala) genes, and analysis of the operons from five strains of E. amylovora indicated a high degree of ITS variability among them. One tRNA(Glu)-containing operon from E. pyrifoliae Ep1/96 was identical to one in E. amylovora Ea110, but three tRNA(Glu) operons and two tRNA(Ile) and tRNA(Ala) operons from E. pyrifoliae contained unique nucleotide changes. When groEL sequences were used for species-specific identification, E. pyrifoliae and E. amylovora were the closest phylogenetic relatives among a set of 12 bacterial species. The placement of E. pyrifoliae distinct from E. amylovora corroborated molecular hybridization data indicating low DNA-DNA similarity between them. Determination of the nucleotide sequence of plasmid pEP36 from E. pyrifoliae Ep1/96 revealed a number of presumptive genes that matched genes previously found in pEA29 from E. amylovora and similar organization for the genes and origins of replication. Also, pEP36 and pEA29 were incompatible with clones containing the reciprocal origin regions. Finally, the ColE1-like plasmid pEP2.6 from strain Ep1/96 contained sequences found in small plasmids in E. amylovora strains IL-5 and IH3-1. PMID:12450843

  6. Isolation and identification by 16s rrna sequence analysis of achromobacter, azospirillum and rhodococcus strains from the rhizosphere of maize and screening for the beneficial effect on plant growth

    International Nuclear Information System (INIS)

    The aim of the present study was to isolate and characterize plant growth promoting rhizobacteria from the rhizosphere of field-grown maize. Among the five bacterial isolates obtained in the present study, the isolates M1, M7 and ZN1 showed typical Azospirillum-like cell morphology, motility and high sequence similarity of 16S rDNA to the genus Azospirillum. The isolates M25 and M28 were identified on the bases of 16S rRNA sequence analysis as Achromobacter and Rhodococcus, respectively. All the five isolates obtained in the present study produced phytohormone IAA in pure culture but phosphate-solubilization activity was detected only in pure cultures of Achromobacter strain M25 and Rhodococcus strain M28. The isolates were tested as inoculants for maize seedlings grown in sterilized sand from which cotyledons were removed at an early growth stage to deprive the seedlings of internal nutrient source and harvested after 5 weeks. For comparison, seedlings with intact cotyledons were used as control. In addition inoculated plants were grown in non-sterilized soil in earthen pots and harvested at maturity. In both the short-term inoculation experiments carried out in sterilized sand as well as in long-term inoculation experiment in earthen pots all the inoculated strains improved plant growth compared to respective non-inoculated controls. However, unlike the seedlings with intact cotyledons, the pattern regarding the efficiency of growth promotion by inoculated strains (Azospirillum strains ZN1>M7>M1>Achromobacter strain M25>Rhodococcus strain M28) was the same in plants with detached cotyledons and the plants grown to maturity in non-sterilized soil. It can be concluded from the short-term experiments under controlled conditions that removal of cotyledons helps effective screening of bacterial inocula compared to seedlings with intact cotyledons. (author)

  7. International Transplant Nurses Society (United States)

    ... 25th Annual ITNS Symposium The International Transplant Nurses Society (ITNS) cordially invites transplant nurses and other transplant ... pocket guide, developed by the International Transplant Nurses Society (ITNS), provides an overview of the interventions used ...

  8. Hepatitis Foundation International (United States)

    ... partner – it's your best friend. Welcome. The Hepatitis Foundation International (HFI) is a 501 (c) 3 non- ... and cures is your participation in the Hepatitis Foundation International Registry. Whether you are affected, a caregiver, ...

  9. International diversification and Microfinance

    NARCIS (Netherlands)

    Galema, Rients; Lensink, Robert; Spierdijk, Laura


    International commercial banks, institutional investors, and private investors have become increasingly interested in financing microfinance institutions (MFIs). This paper investigates whether adding microfinance funds to a portfolio of risky international assets yields diversification gains. By us

  10. Generalized internal multiple imaging

    KAUST Repository

    Zuberi, Mohammad Akbar Hosain


    Various examples are provided for generalized internal multiple imaging (GIMI). In one example, among others, a method includes generating a higher order internal multiple image using a background Green\\'s function and rendering the higher order internal multiple image for presentation. In another example, a system includes a computing device and a generalized internal multiple imaging (GIMI) application executable in the computing device. The GIMI application includes logic that generates a higher order internal multiple image using a background Green\\'s function and logic that renders the higher order internal multiple image for display on a display device. In another example, a non-transitory computer readable medium has a program executable by processing circuitry that generates a higher order internal multiple image using a background Green\\'s function and renders the higher order internal multiple image for display on a display device.

  11. International OCD Foundation (United States)

    ... and productive lives. Join Donate Volunteer Events International OCD Foundation Our mission is to help all individuals ... to the IOCDF. Learn More Order a Bouquet OCD Awareness Week #OCDweek International OCD Awareness Week is ...

  12. International trade in uranium

    International Nuclear Information System (INIS)

    The subject is discussed under the following headings: need for security of uranium supply; pressures on international trade; mechanism of international trade; non-proliferation and uranium trade; means of increasing security of supply. (U.K.)

  13. International Map Year 2015


    Miljenko Lapaine; Dražen Tutić


    The International Cartographic Association (ICA) decided to establish the International Map Year (IMY) during the year 2015. The working group was formed and terms of reference accepted by the ICA Executive Committee.

  14. conflicts in international teams


    Kurdovanidze, Salome


    This thesis aims to define international team and conflicts and identify the essential competencies for a manager and employee of international teams. It is argued that everyone in an international team should possess more skills and competencies than those who belong to homogeneous teams. As a result, representatives of international team must be able to understand culturally diverse backgrounds manage conflicts constructively, and comprehend different strategies to handle sensitive cases. T...

  15. Essays on international economics


    Özer, Seda Köymen


    In these essays, I examine quantitatively some of the classic questions in the field of International Economics: What is the impact of international trade on consumption and productivity? How does international trade affect income inequality? How do exchange rates movements affect real output and productivity? This dissertation is composed of three chapters, each covering one of these topics.The first chapter, based on my paper "Measured Gains from International Trade" with Ariel Burstein, r...

  16. External and internal audit


    Froňková, Hana


    Dissertation includes problems of internal and external audit. The goal of this work is on the basis teoretical knowledge and information got from experience, to do internal and external audit of fulfilment by drawings of financial subvence. The result of both made audits is final report.Work is composed from three parts, first part- theoretical-describes progress of internal audit, its essence and definitions, regulation frame, which characteristics ought to fulfil an internal auditor, then ...

  17. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Directory of Open Access Journals (Sweden)

    Annette K. Møller


    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  18. Footprints of a trypanosomatid RNA world: pre-small subunit rRNA processing by spliced leader addition trans-splicing

    Directory of Open Access Journals (Sweden)

    Mario Gustavo Mayer


    Full Text Available The addition of a capped mini-exon [spliced leader (SL] through trans-splicing is essential for the maturation of RNA polymerase (pol II-transcribed polycistronic pre-mRNAs in all members of the Trypanosomatidae family. This process is an inter-molecular splicing reaction that follows the same basic rules of cis-splicing reactions. In this study, we demonstrated that mini-exons were added to precursor ribosomal RNA (pre-rRNA are transcribed by RNA pol I, including the 5' external transcribed spacer (ETS region. Additionally, we detected the SL-5'ETS molecule using three distinct methods and located the acceptor site between two known 5'ETS rRNA processing sites (A' and A1 in four different trypanosomatids. Moreover, we detected a polyadenylated 5'ETS upstream of the trans-splicing acceptor site, which also occurs in pre-mRNA trans-splicing. After treatment with an indirect trans-splicing inhibitor (sinefungin, we observed SL-5'ETS decay. However, treatment with 5-fluorouracil (a precursor of RNA synthesis that inhibits the degradation of pre-rRNA led to the accumulation of SL-5'ETS, suggesting that the molecule may play a role in rRNA degradation. The detection of trans-splicing in these molecules may indicate broad RNA-joining properties, regardless of the polymerase used for transcription.

  19. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae). (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A


    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  20. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    International Nuclear Information System (INIS)

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1