WorldWideScience

Sample records for 16s-23s rrna intergenic

  1. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    Science.gov (United States)

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  2. Identification of Carnobacterium Species by Restriction Fragment Length Polymorphism of the 16S-23S rRNA Gene Intergenic Spacer Region and Species-Specific PCR

    OpenAIRE

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-01-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in ord...

  3. Sequence Analysis and Comparison of 16S rRNA, 23S rRNA and 16S/23S Intergenic Spacer Region of Greening Bacterium Associated with Yellowing Disease (Huanglongbing) of Kinnow Mandarin.

    Science.gov (United States)

    Gupta, K N; Baranwal, V K; Haq, Q M R

    2012-03-01

    High incidence (up to 40%) of symptoms of yellowing and yellow mottling was observed in 5-8 years old orchards of kinnow mandarin {Citrus reticulate Balanco ('King' × 'Willow mandarin')} in the Punjab state of India during a survey in January 2007. These symptoms are often confused with nutrient deficiency and other stress related disorders. However, a greening bacterium has been attributed to cause the disease. The disease was graft transmissible and sequencing of 16S rRNA, 16S/23S intergenic spacer region and 23S rRNA of the greening bacterium associated with yellowing disease in kinnow mandarin confirmed it to be Candidatus Liberibacter asiaticus ('Ca L. asiaticus') showing maximum identity of 95.9% with 'Ca L. asiaticus' from USA and Brazil in 16S rRNA. The study indicates definite association of 'Ca L. asiaticus' with yellowing/chlorotic mottling symptoms of greening disease of kinnow mandarin in Punjab state of India.

  4. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    Science.gov (United States)

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  5. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  6. Differentiation of Closely Related Carnobacterium Food Isolates Based on 16S-23S Ribosomal DNA Intergenic Spacer Region Polymorphism

    OpenAIRE

    Kabadjova, Petia; Dousset, Xavier; Le Cam, Virginie; Prevost, Hervé

    2002-01-01

    A novel strategy for identification of Carnobacterium food isolates based on restriction fragment length polymorphism (RFLP) of PCR-amplified 16S-23S ribosomal intergenic spacer regions (ISRs) was developed. PCR amplification from all Carnobacterium strains studied always yielded three ISR amplicons, which were designated the small ISR (S-ISR), the medium ISR (M-ISR), and the large ISR (L-ISR). The lengths of these ISRs varied from one species to another. Carnobacterium divergens NCDO 2763T a...

  7. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  8. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms.

    Science.gov (United States)

    Hill, K E; Davies, C E; Wilson, M J; Stephens, P; Lewis, M A O; Hall, V; Brazier, J; Thomas, D W

    2002-11-01

    Peptostreptococci are gram-positive, strictly anaerobic bacteria which, although regarded as members of the commensal human microflora, are also frequently isolated from sites of clinical infection. The study of this diverse group of opportunist pathogens has been hindered by an inadequate taxonomy and the lack of a valid identification scheme. Recent re-classification of the Peptostreptococcus family into five distinct genus groups has helped to clarify the situation. However, this has been on the basis of 16S rRNA sequence determinations, which are both time-consuming and expensive. The aim of the present study was to evaluate the use of PCR-amplified ribosomal DNA spacer polymorphisms for the rapid differentiation of the currently recognised taxa within the group of anaerobic gram-positive cocci. A collection comprising 19 reference strains with representatives of each of the 15 species, two close relatives and two of the well-characterised groups, together with 38 test strains was studied. All strains were identified to species group level by phenotypic means. Amplification of the 16S-23S intergenic spacer region (ISR) with universal primers produced distinct banding patterns for all the 19 reference strains and the patterns could be differentiated easily visually. However, of the 38 test strains, less than half could be speciated from ISR analysis alone. Only five groups produced correlating banding patterns for all members tested (Peptoniphilus lacrimalis, P. ivorii, Anaerococcus octavius, Peptostreptococcus anaerobius and Micromonas micros). For other species, either the type strain differed significantly from other species members (e.g., A. hydrogenalis) or there appeared to be considerable intra-species variation (e.g., A. vaginalis). Partial 16S rRNA gene sequences for the 'trisimilis' and 'betaGAL' groups showed that both are most closely related to the Anaerococcus group. This work highlights the heterogeneous nature of a number of Peptostreptococcus

  9. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    Science.gov (United States)

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  10. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  11. Analysis of the 16S-23S rRNA gene internal transcribed spacer region in Klebsiella species.

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-11-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types-ITS(none) (without tRNA genes), ITS(glu) [with a tRNA(Glu (UUC)) gene], and ITS(ile+ala) [with tRNA(Ile (GAU)) and tRNA(Ala (UGC)) genes]-were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITS(glu) and ITS(ile+ala). The presence of ITS(none) in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITS(none), from 0.967 to 1.000 for ITS(glu), and from 0.968 to 1.000 for ITS(ile+ala). Interspecies sequence identities range from 0.775 to 0.989 for ITS(none), from 0.798 to 0.997 for ITS(glu), and from 0.712 to 0.985 for ITS(ile+ala). Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes.

  12. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    Science.gov (United States)

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  13. Detection of two Bartonella tamiae-like sequences in Amblyomma americanum (Acari: Ixodidae) using 16S-23S intergenic spacer region-specific primers.

    Science.gov (United States)

    Billeter, Sarah A; Miller, Melissa K; Breitschwerdt, Edward B; Levy, Michael G

    2008-01-01

    Four hundred and sixty-six questing Amblyomma americanum (L.) (Acari: Ixodidae) from Carolina County, VA, and 98 questing A. americanum from Chatham County, NC, were screened by polymerase chain reaction (PCR) for the Bartonella 16S-23S intergenic spacer region. Two amplicons, approximately 270-280 bp, were detected in two ticks from Virginia. Based upon PCR and sequencing, an adult male and adult female tick harbored DNA sequences closely related to Bartonella tamiae (DQ395180). Bartonella DNA was not detected in A. americanum from North Carolina. Potential transmission of Bartonella spp. by A. americanum should be the focus of future experimental studies.

  14. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    Science.gov (United States)

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  15. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    DEFF Research Database (Denmark)

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas;

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient...... for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the partial gdh gene to identify clinical relevant NHS to the species level. Sequence analysis of the ITS region....... A phylogenetic algorithm based on the analysis of partial gdh gene sequences revealed three distinct clusters. We suggest that sequence analysis of the combination of the ITS region and the partial gdh gene can be used in the reference laboratory for the species-level identification of NHS....

  16. Differentiation of acetic acid bacteria based on sequence analysis of 16S-23S rRNA gene internal transcribed spacer sequences.

    Science.gov (United States)

    González, Angel; Mas, Albert

    2011-06-30

    The 16S-23S gene internal transcribed spacer sequence of sixty-four strains belonging to different acetic acid bacteria genera were analyzed, and phylogenetic trees were generated for each genera. The topologies of the different trees were in accordance with the 16S rRNA gene trees, although the similarity percentages obtained between the species was shown to be much lower. These values suggest the usefulness of including the 16S-23S gene internal transcribed spacer region as a part of the polyphasic approach required for the further classification of acetic acid bacteria. Furthermore, the region could be a good target for primer and probe design. It has also been validated for use in the identification of unknown samples of this bacterial group from wine vinegar and fruit condiments.

  17. Cloning, Sequencing and Analysis of the 16S-23S rDNA Intergenic Spacers (IGSs) of Two Strains of Vibrio vulnificus%2株创伤弧菌的16S-23S rDNA间区的克隆、测序及分析

    Institute of Scientific and Technical Information of China (English)

    邓先余; 陈晓艳; 王智学; 欧普; 何建国

    2006-01-01

    根据细菌的16S rDNA 3'端和23S rDNA 5'端的高度保守区设计引物,PCR扩增了2株创伤弧菌(Vibrio vulnificus)的16S-23S rDNA间区(Intergenic spacer,IGS),克隆到pGEM-T载体上,测序.用BLAST和DNAstar软件对16S-23SrDNA间区序列及其内的tRNA基因进行比较分析.结果表明,2株创伤弧菌共测出9条16S-23S rDNA间区序列,其中ZSU006测出5条,间区类型分别为:IGSGLAV、IGSGLV、IGSIA、IGSA和IGSG.其中IGSGLAV最大,包含tRNAGlu、tRNALys、tRNAAla和tRNAVal基因;IGSGLV包含tRNAGlu、tRNALys和tRNAVal基因;IGSIn,则包含tRNAIle和tRNAAla基因;IGSG仅包含tRNAGlu基因;而IGSA仅包含tRNAAla基因.菌株CG021测出的16S-23S rDNAIGS序列有4条,除缺少IGSA外,其余的IGS类型均与ZSU006的相同.与GenBank内的创伤弧菌ATCC27562的IGS序列比较,发现创伤弧菌所有类型的IGS的tRNA基因两端的非编码区具有较高的种内同源性.16S-23S rDNA间区结构的差异为建立一种新的创伤弧菌检测方法奠定了基础.%According to the conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs, PCR primers were designed, and the 16S-23S rDNA intergenic spacers (IGSs) of two strains of Vibrio vulnificus were amplified by PCR and cloned into pGEM-T vector. Different clones were selected to be sequenced and the sequences were analyzed with BLAST and the software DNAstar. Analyses of the IGS sequences suggested that the strain ZSU006 contains five types of polymorphic16S-23S rDNA intergenic spacers, namely, IGSGLAV, IGSGLv, IGSIA, IGSG and IGSA; while the strain CG021 has the same types of IGSs except lacking IGSA. Among these five IGS types, IGSGLAV is the biggest type, including the gene cluster of tRNAGlu - tRNALys - tRNAAla - tRNAVal; IGSGLV includes that of tRNAGlu-tRNALys-tRNAVal; IGSAG, tRNAAla-tRNAGlu; IGSIA, tRNAIle -tRNAAla; IGSG, tRNAGlu and IGSA, tRNAAla. Intraspecies multiple alignment of all the IGS sequences of these two strains with those of V

  18. Establishment and analysis of specific DNA patterns in 16S-23S rRNA gene spacer regions for differentiating different bacteria

    Institute of Scientific and Technical Information of China (English)

    尚世强; 付君芬; 董关萍; 洪文澜; 杜立中; 俞锡林

    2003-01-01

    Objective To establish the specific 16S-23S rRNA gene spacer regions in different bacteria using polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), DNA cloning and sequences analysis. Methods A pair of primers were selected from highly conserved sequences adjacent to the 16S-23S rRNA spacer region. Bacterial DNA from sixty-one strains of standard bacteria and corresponding clinical isolates representative of 20 genera and 26 species was amplified by PCR, and further analyzed by RFLP, DNA cloning and sequences analysis. Furthermore, all specimens were examined by bacterial culturing and PCR-RFLP analysis. The evaluation of these assays in practical clinic practice was also discussed.Results Restriction enzyme analysis revealed one, two or three bands or more observed among the 26 different standard strains. The sensitivity of PCR reached 2.5 colony-forming unit (CFU), and there was no cross reaction with human genomic DNA, fungus or virus. Fourteen species could be distinguished immediately by PCR, while another 10 species were further identified by Hinf Ⅰ or Alu Ⅰ digestion. The only difference between K.pneumoniae and E.durans was located at the site of the 779th nucleotide according to the sequence analysis and only XmaⅢ digestion could distinguish one from another. Of 42 specimens from septicemic neonates, 15 were identified as positive by blood culture at a rate of 35.7%. However, 27 specimens identified as positive by PCR, with a rate of 64.2%, a method significantly more effective than blood culture (P<0.01). Of 6 cerebrospinal fluid (CSF) specimens, one tested positive for S.epidermidis was also positive by PCR, two culture negative were positive by PCR and diagnosed as S.epidermidis according to the DNA pattern. One positive for C.neoformans was negative by PCR. The other two specimens were negative by both PCR and culture.Conclusions The method of detecting bacterial 16S-23S rRNA spacer regions using PCR

  19. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  20. Genotyping of Salmonella spp.by 16S-23S rRNA assay%沙门菌PCR-dHPLC基因分型方法建立

    Institute of Scientific and Technical Information of China (English)

    张东方; 袁飞; 王娉; 杨海荣; 胡玥; 赵勇胜; 陈颖; 葛毅强

    2012-01-01

    Objective To develop a polymerase chain reaction-denaturing high performance liquid chromatography (PCR-dHPLC) genotyping method for genotyping of Salmonella spp. Methods Specific primers of 16S-23S rRNA in-tergenic spacer sequence (ITS) region were used to subtype Salmonella spp. The PCR amplification products of experimental strains were separated by dHPLC. The results of genotyping achieved through the differences between dHPLC peaks and were comparaed to the results obtained by serological typing and biochemical typing. Results Totally 89 Salmonella spp. strains were successfully genotyped into 12 dHPLC types(D type). All the Salmonella spp. strains had one same chromatographic peak,while other food-born pathogens showed no similar peak. DNA sequence analysis showed that the sequence was 600bp. The results indicate that the chromatographic peak is specific to Salmonella spp. Comparing the dHPLC genotyping results with those of serological typing and biochemical typing, we found dHPLC genotyping results were significantly differ from the serological typing results, while were consistent with that of the biochemical typing. Conclusion DHPLC is a novel, rapid, highly accurate, and cost-effective genotyping method for genotyping of Salmonella spp.%目的 建立沙门菌聚合酶链反应-变性高效液相色谱(PCR-dHPLC)基因分型方法.方法 采用16S ~23S rRNA内转录间隔(ITS)作为沙门菌分型目的基因,确定特异性扩增引物,进行PCR扩增,扩增产物经dHPLC分离,根据dHPLC图谱峰型差异进行分型,并与血清学和生化分型结果比较.结果 89株沙门菌共分为12个dHPLC型(D型);所有沙门菌均有1个相同色谱峰,克隆测序结果表明,其片断大小为600 bp,其他8种食源性致病菌对照株无此色谱峰,应为沙门菌16S~23S rRNA基因序列的特征性条带,分型结果与血清学差异较大,与生化分型结果有一定一致性.结论 所建立的沙门菌PCR-dHPLC基因分型方法具快速

  1. Phylogenetic diversity based on rrs, atpD, recA genes and 16S-23S intergenic sequence analyses of rhizobial strains isolated from Vicia faba and Pisum sativum in Peru.

    Science.gov (United States)

    Santillana, Nery; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Velázquez, Encarna; Zúñiga, Doris

    2008-03-01

    In this study 17 isolates from effective nodules of Vicia faba and Pisum sativum var. macrocarpum growing in different soils from Peru were isolated and characterized. The isolates, presenting 11 different RAPD profiles, were distributed in three groups on the basis of their 16S-RFLP patterns. The 16S rRNA gene sequences of strains from 16S-RFLP groups I, II and III were closely related (identities higher than 99.5%) to Rhizobium leguminosarum bv. trifolii DSM 30141 (=ATCC 14480), R. leguminosarum bv. viciae DSM 30132(T) and Rhizobium etli CFN42(T) (=USDA 9032(T)), respectively. The analysis of the 16S-23S intergenic spacer (ITS) and two housekeeping genes, atpD and recA, confirmed the identification of strains from group I, however those from groups II and III were phylogenetically divergent to strains DSM 30132(T) and CFN42(T). These results support the fact that the 16S rRNA gene is not adequate for identification at species level within genus Rhizobium and suggest the existence of putative new species within the phylogenetic group of R. leguminosarum. They also confirm the need of a taxonomic revision of R. leguminosarum since the reference strains of the three biovars included in this study are phylogenetically divergent according to their ITS, atpD and recA gene sequences.

  2. USE OF 16S-23S INTERGENIC TRANSCRIBED SPACER IN IDENTIFICATION AND COMMUNITY ANALYSIS OF BACTERIA%基因间隔序列(ITS)在细菌分类鉴定和种群分析中的应用

    Institute of Scientific and Technical Information of China (English)

    郑雪松; 杨虹; 李道棠; 韩文卿

    2003-01-01

    Use of 16S -23S intergenic transcribed spacer (ITS) variability, as a relatively new method, is becoming an important supplement to the molecular methods based on 16S rRNA for which has a fairly constant size and is not divergent enough to give good separation in close relationships. This paper summarizes the structures and characteristics of ITS regions that are extremely variable in copy number, length and sequence per genome. The ITS region can be amplified easily taking advantage of conserved nucleotide stretches at the 5′of the 16S and 3′of the 23S gene, and the amplicon can contain different amounts of the 16S rDNA by choosing primers at different conserved areas within this gene. These primers are listed and discussed for perfecting the methodology of ITS. Furthermore, some recent progresses on the taxonomy, identification and community analysis of bacteria by means of ITS in epidemiology, ecology and artificial environment are reviewed, as well, the virtues and limitations of that method are discussed. Fig 2, Tab 1, Ref 51

  3. Restrição do 16S-23S DNAr intergênico para avaliação da diversidade de Azospirillum amazonense isolado de Brachiaria spp. Restriction of 16S-23S intergenic rDNA for diversity evaluation of Azospirillum amazonense isolated from different Brachiaria spp.

    Directory of Open Access Journals (Sweden)

    Fábio Bueno dos Reis Junior

    2006-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a diversidade intra-específica de isolados de Azospirillum amazonense e estabelecer a possível influência de diferentes espécies de Brachiaria ssp. e diferentes condições edafoclimáticas. A caracterização da diversidade desses isolados foi conduzida, utilizando-se a análise de restrição da região intergênica 16S-23S DNAr. As estirpes estudadas separaram-se em dois grupos, definidos a 56% de similaridade. As espécies de Brachiaria ssp. influenciaram a diversidade de estirpes. A maioria dos isolados oriundos de B. decumbens e B. brizantha está inserida no primeiro grupo, enquanto os oriundos de B. humidicola concentram-se no segundo grupo.The aim of this work was to study the intra-specific diversity of Azospirillum amazonense isolates and to establish possible influences of different Brachiaria spp. and edaphoclimatic conditions. The characterization of the diversity among the isolates of A. amazonense studied was conducted using restriction analysis of the 16S-23S rDNA intergenic spacer region. The evaluated strains were separated in two groups, defined at 56% of similarity. Brachiaria spp. showed effects on strain diversity. Most part of the isolates from B. decumbens and B. brizantha are inserted in the first group, while B. humidicola isolates concentrate in the second group.

  4. Development of a multiplex PCR assay based on the 16S-23S rRNA internal transcribed spacer for the detection and identification of rodent Pasteurellaceae.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Bleich, André; Gougoula, Christina; Sager, Martin

    2013-11-01

    The rodents Pasteurellaceae have to be excluded from the specified pathogen free experimental animal facilities. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals just a few molecular based methods are available for their detection and identification. The aim of the present investigation was to develop a multiplex PCR assay allowing detection of all rodent Pasteurellaceae and identification of [Pasteurella] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl and [Actinobacillus] muris, as the most prevalent members of the group. For this, a Pasteurellaceae common forward primer located on the 16S rRNA gene was used in conjunction with four different reverse primers specific for [P.] pneumotropica biotype Jawetz, [P.] pneumotropica biotype Heyl, [A.] muris and a common reverse primer for all rodent Pasteurellaceae, all targeting the 16S-23S rRNA internal transcribed spacer sequences. The performance characteristics of the assay were tested against 125 Pasteurellaceae isolates belonging to eleven different species and including 34 strains of [P.] pneumotropica biotype Jawetz, 44 strains of [P.] pneumotropica biotype Heyl and 37 strains of [A.] muris. Additionally, eight other mouse associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA gene sequencing. This multiplex PCR represents the first molecular tool able to detect and differentiate in a single assay among the Pasteurellaceae found in laboratory mouse and may become a reliable alternative to the present diagnostic methods. © 2013.

  5. Phylogenetic diversity of rhizobia associated with horsegram [Macrotyloma uniflorum (Lam.) Verdc.] grown in South India based on glnII, recA and 16S-23S intergenic sequence analyses.

    Science.gov (United States)

    Appunu, Chinnaswamy; Ganesan, Govindan; Kalita, Michał; Kaushik, Raghavan; Saranya, Balamurugan; Prabavathy, Vaiyapuri Ramalingam; Sudha, Nair

    2011-04-01

    Horsegram [Macrotyloma uniflorum (Lam.) Verdc.) is an important grain legume and fodder crop in India. Information on root nodule endosymbionts of this legume in India is limited. In the present study, 69 isolates from naturally occurring root nodules of horsegram collected from two agro-eco-climatic regions of South India was analyzed by generation rate, acid/alkali reaction on YMA medium, restriction fragment length polymorphism analysis of 16S-23S rDNA intergenic spacer region (IGS), and sequence analyses of IGS and housekeeping genes glnII and recA. Based on the rDNA IGS RFLP by means of three restriction enzymes rhizobia were grouped in five clusters (I-V). By sequence analysis of 16S-23S rDNA IGS identified genotypes of horsegram rhizobia were distributed into five divergent lineages of Bradyrhizobium genus which comprised (I) the IGS type IV rhizobia and valid species B. yuanmingense, (II) the strains of IGS type I and Bradyrhizobium sp. ORS 3257 isolated from Vigna sp., (III) the strains of the IGS type II and Bradyrhizobium sp. CIRADAc12 from Acacia sp., (IV) the IGS type V strains and Bradyrhizobium sp. genospecies IV, and (V) comprising genetically distinct IGS type III strains which probably represent an uncharacterized new genomic species. Nearly, 87% of indigenous horsegram isolates (IGS types I, II, III, and V) could not be related to any other species within the genus Bradyrhizobium. Phylogeny based on housekeeping glnII and recA genes confirmed those results found by the analysis of the IGS sequence. All the isolated rhizobia nodulated Macrotyloma sp. and Vigna spp., and only some of them formed nodules on Arachis hypogeae. The isolates within each IGS type varied in their ability to fix nitrogen. Selection for high symbiotic effective strains could reward horsegram production in poor soils of South India where this legume is largely cultivated.

  6. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  7. 16S rRNA、16S-23S rRNA基因测序分析检测主要血流感染病原菌比较%Comparison of the role of 16S rRNA and 16S-23S rRNA gene sequence-based identification of bacteria in bloodsteam infection

    Institute of Scientific and Technical Information of China (English)

    金中淦; 葛平; 徐蓉; 陈蓉; 宣瑛; 刘学杰; 王庆忠

    2012-01-01

    目的 比较细菌16S rRNA、16S-23S rRNA基因测序分析在血流感染病原菌检测中的作用.方法 提取临床上血流感染常见的金黄色葡萄菌、表皮葡萄球菌、大肠埃希菌、粪肠球菌、肺炎链球菌、铜绿假单胞菌、阴沟肠杆菌、鲍曼不动杆菌、洛菲不动杆菌、肺炎克雷伯杆菌、化脓性链球菌、奇异变形杆菌、潘尼变形杆菌、屎肠球菌、粘质沙雷菌、宋内志贺菌、产气肠杆菌、小肠结肠炎耶尔森菌、腐生葡萄球菌基因组DNA,运用16S rRNA、16S-23S rRNA基因进行PCR扩增.扩增产物经测序后在美国国家生物技术中心( NCBI)上进行比对分析,确定菌种.结果 在所分析的19种临床血流感染常见细菌中,16S rRNA基因测序分析可将除粘质沙雷菌外的细菌鉴定到种的水平,但无法完全区分近缘种属;16S-23SrRNA成功鉴定17种细菌,除大肠埃希菌、宋内志贺菌外所有细菌均成功鉴定到单一种的水平.结论 16S-23S rRNA基因可作为血流感染细菌检测较好的分子靶标.

  8. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  9. Analysis of the genotypes among different strains of common Mycobacteria based on 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer sequences%常见分枝杆菌种内不同株之间16S rRNA基因和16S-23SrRNA ITS序列分析结果的比较

    Institute of Scientific and Technical Information of China (English)

    黄至澄; 徐黔宁; 闫李侠; 陈保文; 王国治

    2011-01-01

    目的 针对常见分枝杆菌不同株对其基因序列进行分析,比较分析结果.方法 利用16S rRNA Gene和16S-23S rRNAITS(转录间隔区序列)分析法分别对97株共7种DSMZ/ATCC引进的常见分枝杆菌进行种内不同株之间基因差异性分析,对比两种分型结果的异同.结果 16S rRNA基因可将13株草分枝杆菌分为3个型别,18株偶发分枝杆菌分为6个型别,17株耻垢分枝杆菌分为4个型别,8株戈登分枝杆菌分为3个型别,9株龟分枝杆菌龟亚种分为3个型别,15株堪萨斯分枝杆菌分为2个型别,17株产鼻疽分枝杆菌分为1个型别;而16S-23S rRNA ITS可依次将上述分枝杆菌分为3个、15个、7个、3个、4个、3个、5个型别.结论 16S rRNA G ene分析和16S-23S rRNA ITS分析均是分枝杆菌基因型分析的可靠方法,此外,16S-23SrRNA ITS的种内多态性高于16S rRNA Gene.

  10. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  11. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Science.gov (United States)

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes.

  12. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences

    National Research Council Canada - National Science Library

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-01-01

    ...) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough...

  13. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria.

  14. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  15. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    Science.gov (United States)

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  16. Improved identification of rapidly growing mycobacteria by a 16S-23S internal transcribed spacer region PCR and capillary gel electrophoresis.

    Directory of Open Access Journals (Sweden)

    Timothy J Gray

    Full Text Available The identification of rapidly growing mycobacteria (RGM remains problematic because of evolving taxonomy, limitations of current phenotypic methods and absence of a universal gene target for reliable speciation. This study evaluated a novel method of identification of RGM by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS followed by resolution of amplified fragments by capillary gel electrophoresis (CGE. Nineteen American Type Culture Collection (ATCC Mycobacterium strains and 178 clinical isolates of RGM (12 species were studied. All RGM ATCC strains generated unique electropherograms with no overlap with slowly growing mycobacteria species, including M. tuberculosis. A total of 47 electropherograms for the 178 clinical isolates were observed allowing the speciation of 175/178 (98.3% isolates, including the differentiation of the closely related species, M. massiliense (M. abscessus subspecies bolletii and M. abscessus (M. abscessus sensu stricto. ITS fragment size ranged from 332 to 534 bp and 33.7% of clinical isolates generated electropherograms with two distinct peaks, while the remainder where characterized with a single peak. Unique peaks (fragment lengths were identified for 11/12 (92% RGM species with only M. moriokaense having an indistinguishable electropherogram from a rarely encountered CGE subtype of M. fortuitum. We conclude that amplification of the 16S-23S ITS gene region followed by resolution of fragments by CGE is a simple, rapid, accurate and reproducible method for species identification and characterization of the RGM.

  17. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    OpenAIRE

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A.

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 speci...

  18. Analysis of 16S-23S rRNA internal transcribed spacer regions in Pasteurellaceae isolated from laboratory rodents.

    Science.gov (United States)

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Christensen, Henrik; Sager, Martin

    2012-09-01

    The internal transcribed spacer (ITS) regions of members of Pasteurellaceae isolated from rodents, including the [Pasteurella] pneumotropica biotypes Jawetz and Heyl, [Actinobacillus] muris, "Hemophilus influenzaemurium" and Bisgaard taxon 17 were studied and their feasibility to discriminate these species was analyzed. The reference strains of all species analyzed showed unique species-specific ITS patterns which were further present in 49 clinical isolates of [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris allowing their identification by comparison to the reference strains pattern. Sequence analysis of the amplified fragments revealed in all species, with exception of "H. influenzaemurium", a larger ITS(ile+ala) which contained the genes for tRNA(Ile(GAU)) and tRNA(Ala(UGC)) and a smaller ITS(glu) with the tRNA(Glu(UUC)) gene. "H. influenzaemurium" revealed two each of the larger and respectively the smaller ITS fragments. Both the length and the sequence of each ITS type were highly conserved within the [P.] pneumotropica biotypes Jawetz and Heyl and [A.] muris strains tested. On the contrary, ITS sequences revealed significant interspecies variations with identity levels ranging from 61.2 to 89.5% for ITS(ile+ala) and 56.5 to 86.8% for ITS(glu). Sequences regions with significant interspecies variation but highly conserved within the species were identified and might be used to design probes for the identification of rodent Pasteurellaceae to the species level. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  20. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis.

    Science.gov (United States)

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej

    2014-04-01

    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing.

  1. Quick identification of acetic acid bacteria based on nucleotide sequences of the 16S-23S rDNA internal transcribed spacer region and of the PQQ-dependent alcohol dehydrogenase gene.

    Science.gov (United States)

    Trcek, Janja

    2005-10-01

    Acetic acid bacteria (AAB) are well known for oxidizing different ethanol-containing substrates into various types of vinegar. They are also used for production of some biotechnologically important products, such as sorbose and gluconic acids. However, their presence is not always appreciated since certain species also spoil wine, juice, beer and fruits. To be able to follow AAB in all these processes, the species involved must be identified accurately and quickly. Because of inaccuracy and very time-consuming phenotypic analysis of AAB, the application of molecular methods is necessary. Since the pairwise comparison among the 16S rRNA gene sequences of AAB shows very high similarity (up to 99.9%) other DNA-targets should be used. Our previous studies showed that the restriction analysis of 16S-23S rDNA internal transcribed spacer region is a suitable approach for quick affiliation of an acetic acid bacterium to a distinct group of restriction types and also for quick identification of a potentially novel species of acetic acid bacterium (Trcek & Teuber 2002; Trcek 2002). However, with the exception of two conserved genes, encoding tRNAIle and tRNAAla, the sequences of 16S-23S rDNA are highly divergent among AAB species. For this reason we analyzed in this study a gene encoding PQQ-dependent ADH as a possible DNA-target. First we confirmed the expression of subunit I of PQQ-dependent ADH (AdhA) also in Asaia, the only genus of AAB which exhibits little or no ADH-activity. Further we analyzed the partial sequences of adhA among some representative species of the genera Acetobacter, Gluconobacter and Gluconacetobacter. The conserved and variable regions in these sequences made possible the construction of A. acetispecific oligonucleotide the specificity of which was confirmed in PCR-reaction using 45 well-defined strains of AAB as DNA-templates. The primer was also successfully used in direct identification of A. aceti from home made cider vinegar as well as for

  2. Molecular analysis of the 16S-23S rDNA internal spacer region (ISR) and truncated tRNA(Ala) gene segments in Campylobacter lari.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakanishi, S; Nakajima, T; Matsubara, K; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-06-01

    Following PCR amplification and sequencing, nucleotide sequence alignment analyses demonstrated the presence of two kinds of 16S-23S rDNA internal spacer regions (ISRs), namely, long length ISRs of 837-844 base pair (bp) [n = six for urease-negative (UN) Campylobacter lari isolates, UN C. lari JCM2530(T), RM2100, 176, 293, 299 and 448] and short length ISRs of 679-725 bp [n = six for UN C. lari: n = 14 for urease-positive thermophilic Campylobacter (UPTC) isolates]. The analyses also indicated that the short length ISRs mainly lacked the 156 bp sequence from the nucleotide positions 122-277 bp in long length ISRs for UN C. lari JCM2530(T). The 156 bp sequences shared 94.9-96.8 % sequence similarity among six isolates. Surprisingly, atypical tRNA(Ala) gene segment (5' end 35 bp), which was extremely truncated, occurred within the 156 bp sequences in the long length ISRs, as an unexpected tRNA(Ala) pseudogene. An order of the intercistronic tRNA genes within the short nucleotide spacer of 5'-16S rDNA-tRNA(Ala)-tRNA(Ile)-23S rDNA-3' occurred in all the C. lari isolates examined.

  3. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  4. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria.

    Science.gov (United States)

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I-V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC.

  5. Comparison of DNA Extraction Methods for Microbial Community Analysis in Indonesian Tempe Employing Amplified Ribosomal Intergenic Spacer Analysis

    Directory of Open Access Journals (Sweden)

    CECILIA ANNA SEUMAHU

    2012-06-01

    Full Text Available Tempe fermentation involved complex microbial communities which are only revealed partially through culture dependent methods. Culture-independent methods would be potential to unravel this complex microbial fermentation. Appropriate DNA extraction is an essential tool to obtain reliable data from culture independent method. In this study, we employed two commercial DNA extraction methods to find the best one for microbial community characterization employing amplified ribosomal intergenic spacer analysis (ARISA. Our result showed that PowerFood Microbial DNA Isolation Kit-MOBIO (PFMDIK is an excellent method for microbial DNA extraction from tempe. It gave high quantity and quality of DNA suitable for PCR amplification of 16S-23S rRNA intergenic spacer to yield a diverse and reproducible ARISA profile.

  6. Structure of rrn operons in pathogenic non-cultivable treponemes: sequence but not genomic position of intergenic spacers correlates with classification of Treponema pallidum and Treponema paraluiscuniculi strains.

    Science.gov (United States)

    Cejková, Darina; Zobaníková, Marie; Pospísilová, Petra; Strouhal, Michal; Mikalová, Lenka; Weinstock, George M; Smajs, David

    2013-02-01

    This study examined the sequences of the two rRNA (rrn) operons of pathogenic non-cultivable treponemes, comprising 11 strains of T. pallidum ssp. pallidum (TPA), five strains of T. pallidum ssp. pertenue (TPE), two strains of T. pallidum ssp. endemicum (TEN), a simian Fribourg-Blanc strain and a rabbit T. paraluiscuniculi (TPc) strain. PCR was used to determine the type of 16S-23S ribosomal intergenic spacers in the rrn operons from 30 clinical samples belonging to five different genotypes. When compared with the TPA strains, TPc Cuniculi A strain had a 17 bp deletion, and the TPE, TEN and Fribourg-Blanc isolates had a deletion of 33 bp. Other than these deletions, only 17 heterogeneous sites were found within the entire region (excluding the 16S-23S intergenic spacer region encoding tRNA-Ile or tRNA-Ala). The pattern of nucleotide changes in the rrn operons corresponded to the classification of treponemal strains, whilst two different rrn spacer patterns (Ile/Ala and Ala/Ile) appeared to be distributed randomly across species/subspecies classification, time and geographical source of the treponemal strains. It is suggested that the random distribution of tRNA genes is caused by reciprocal translocation between repetitive sequences mediated by a recBCD-like system.

  7. Unusual features of the sequences of copies of the 16S-23S rRNA internal transcribed spacer regions of Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi arise from horizontal gene transfer events.

    Science.gov (United States)

    Maslunka, Christopher; Gürtler, Volker; Seviour, Robert

    2015-02-01

    The highly variable nature of the internal transcribed spacer region (ITS) has been claimed to represent an ideal target for designing species-specific probes/primers capable of differentiating between closely related Acinetobacter species. However, several Acinetobacter species contain multiple ITS copies of variable lengths, and these include Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi. This study shows these length variations result from inter-genomic insertion/deletion events (indels) involving horizontal transfer of ITS fragments of other Acinetobacter species and possibly unrelated bacteria, as shown previously by us. In some instances, indel incorporation results in the loss of probe target sites in the recipient cell ITS. In other cases, some indel sequences contain target sites for probes designed from a single ITS sequence to target other Acinetobacter species. Hence, these can generate false positives. The largest of the indels that remove probe sites is 683 bp (labelled bay/i1-0), and it derives from the horizontal transfer of a complete ITS between A. bereziniae BCRC15423(T) and A. baylyi strain ADP1. As a consequence, ITS sequencing or fingerprinting cannot be used to distinguish between the 683 bp ITS in these two strains.

  8. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    Science.gov (United States)

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  9. Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

    Energy Technology Data Exchange (ETDEWEB)

    Li, W.M.; Sylvester, J.E. [Hahnemann Univ., Philadelphia, PA (United States)

    1994-09-01

    In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcription run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.

  10. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  11. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Yih-Horng Shiao

    Full Text Available BACKGROUND: Ribosomal RNA (rRNA is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1 and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014. During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014. Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. CONCLUSIONS/SIGNIFICANCE: The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  12. Sequence length variation of internal genic space of 16S rDNA-23S rDNA in biohydrogen-bacterium%产氢菌的16S -23S rDNA间隔区的长度变异性分析

    Institute of Scientific and Technical Information of China (English)

    李永峰; 郑国香; 张文启; 李建政; 胡立杰

    2005-01-01

    生物制氢细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区碱基序列被测定.利用PCR扩增间隔区DNA,间隔区碱基序列存在长度多态现象.用这一长度多态现象进行产氢发酵细菌的辨认和识别.产氢发酵细菌Rennanqilyf3的16S rRNA gene (rDNA)-23S rDNA间隔区的PCR产品从1 270 到398 bp,共有5个序列.碱基数目分别为1 270、398、638、437 和 436 bp.%A method based on PCR amplification of the 16S rRNA gene (rDNA)-23S rDNA intergenic regions was developed for the identification of species for fermentative biohydrogen-producing bacterium. The sizes of the PCR products varied from 1 270 to 398 bp. Strain of Rennanqilyf3 were characterized as having products of 1 270,398,638, 437 and 436bp.

  13. Specific Detection of Yersinia enterocolitica by Loop-mediated Isothermal Amplification(LAMP)Targeting 16S-23S rDNA Internal Transcribed Spacer(ITS)%利用环介导恒温扩增方法特异性鉴定食品中小肠结肠炎耶尔森氏菌

    Institute of Scientific and Technical Information of China (English)

    赵玉龙; 张宏伟; 刘伟; 刘寅; 郑文杰; 魏亚东; 叶露萌; 黄熙泰

    2010-01-01

    介绍一种便捷、灵敏而又特异的用于检测治病细菌小肠结肠炎耶尔森氏菌(Yersinia enterocolitica)的 环介导恒温扩增基因检测技术(loop-mediated isothermal amplification,LAMP),该技术分别使用特异对应于16S-23S rDNA间区(16S-23S rDNA internal transcribed spacer,ITS)靶序列中6个基因区段的3对引物,在Bst 聚合酶的作用下对靶序列进行恒温扩增,整个检测反应只需1 h.利用这种技术检测小肠结肠炎耶尔森氏菌基因,阳性结果可通过直接观察反应液中有无焦磷酸镁白色沉淀,而无需经电泳检测.试验结果表明,LAMP对Y.enterocolitica的检测灵敏度可达到8 CFU/反应.

  14. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Science.gov (United States)

    Siarkou, Victoria I; Stamatakis, Alexandros; Kappas, Ilias; Hadweh, Paul; Laroucau, Karine

    2011-01-01

    The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS), and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs), two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T) possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic) characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering) signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies) of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic inference reveal new

  15. Evolutionary relationships among Chlamydophila abortus variant strains inferred by rRNA secondary structure-based phylogeny.

    Directory of Open Access Journals (Sweden)

    Victoria I Siarkou

    Full Text Available The evolutionary relationships among known Chlamydophila abortus variant strains including the LLG and POS, previously identified as being highly distinct, were investigated based on rRNA secondary structure information. PCR-amplified overlapping fragments of the 16S, 16S-23S intergenic spacer (IS, and 23S domain I rRNAs were subjected to cloning and sequencing. Secondary structure analysis revealed the presence of transitional single nucleotide variations (SNVs, two of which occurred in loops, while seven in stem regions that did not result in compensatory substitutions. Notably, only two SNVs, in 16S and 23S, occurred within evolutionary variable regions. Maximum likelihood and Bayesian phylogeny reconstructions revealed that C. abortus strains could be regarded as representing two distinct lineages, one including the "classical" C. abortus strains and the other the "LLG/POS variant", with the type strain B577(T possibly representing an intermediate of the two lineages. The two C. abortus lineages shared three unique (apomorphic characters in the 23S domain I and 16S-23S IS, but interestingly lacked synapomorphies in the 16S rRNA. The two lineages could be distinguished on the basis of eight positions; four of these comprised residues that appeared to be signature or unique for the "classical" lineage, while three were unique for the "LLG/POS variant". The U277 (E. coli numbering signature character, corresponding to a highly conserved residue of the 16S molecule, and the unique G681 residue, conserved in a functionally strategic region also of 16S, are the most pronounced attributes (autapomorphies of the "classical" and the "LLG/POS variant" lineages, respectively. Both lineages were found to be descendants of a common ancestor with the Prk/Daruma C. psittaci variant. Compared with the "classical", the "LLG/POS variant" lineage has retained more ancestral features. The current rRNA secondary structure-based analysis and phylogenetic

  16. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    Science.gov (United States)

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  17. Molecular phylogeny of several common Gracilaria species in-ferred from 18S rRNA, cox2-3 intergenic spacer and RUBISCO spacer sequence comparisons%几种江蓠属海藻3个分子序列的系统学分析

    Institute of Scientific and Technical Information of China (English)

    赵小波; 逄少军; 刘峰

    2013-01-01

      分析了我国沿海几种常见的江蓠属(Gracilaria)海藻的18S rRNA 基因、cox2-3间隔区以及RUBISCO间隔区的分子序列,并结合GenBank现有的相关数据进行了分子系统学关系分析,为江蓠属的系统进化和分类地位提供了新的佐证。结果表明,基于cox2-3间隔区、以及 RUBISCO间隔区序列构建的MP (Maximum parsimony)进化树较为相似,而与基于18S rRNA构建的进化树略有不同。这主要是由于18S rRNA更为保守的原因;扁江蓠与脆江蓠在3个系统树中均聚合成支,显示了它们之间具有较近的亲缘关系;龙须菜与江蓠属海藻具有较远的遗传距离,在3个进化树中,龙须菜也均位于进化树的基部,单独成支,证实龙须菜并不隶属于江蓠属,且分化相对较早。%Sequences of three molecular markers (18S rRNA, cox2-3 intergenic spacer and RUBISCO spacer), in combination with data from GenBank, were used to analyze the phylogentic relations of Gracilaria species col-lected from the coast of China. Phylogenetic trees that were constructed using cox2-3 and RUBISCO spacer se-quences exhibited the same pattern but differed slightly from that of the 18S rRNA-based phylogenetic tree due to a higher degree of conservation of the latter. Gracilaria textorii was sister to G. chouae in all three trees showing the close relationship between the two species. The results further confirm that the Gracilariopsis lemaneiformis does not belong to the genus Gracilaria. Results also indicate an earlier evolution status of G.lemaneiformis based on these three sequence comparisons.

  18. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    Science.gov (United States)

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  19. Ribosomal operon intergenic sequence region (ISR) heterogeneity in Campylobacter coli and Campylobacter jejuni

    Science.gov (United States)

    Campylobacter jejuni and Campylobacter coli are closely related species that can not be distinguished by their 16S or 23S rRNA gene sequences. However, the intergenic sequence region (ISR) that is between the 16S and 23S genes is markedly different and characteristic for each species. A peculiarit...

  20. Functionality of intergenic transcription: an evolutionary comparison.

    Directory of Open Access Journals (Sweden)

    Philipp Khaitovich

    2006-10-01

    Full Text Available Although a large proportion of human transcription occurs outside the boundaries of known genes, the functional significance of this transcription remains unknown. We have compared the expression patterns of known genes as well as intergenic transcripts within the ENCODE regions between humans and chimpanzees in brain, heart, testis, and lymphoblastoid cell lines. We find that intergenic transcripts show patterns of tissue-specific conservation of their expression, which are comparable to exonic transcripts of known genes. This suggests that intergenic transcripts are subject to functional constraints that restrict their rate of evolutionary change as well as putative positive selection to an extent comparable to that of classical protein-coding genes. In brain and testis, we find that part of this intergenic transcription is caused by widespread use of alternative promoters. Further, we find that about half of the expression differences between humans and chimpanzees are due to intergenic transcripts.

  1. Functionality of Intergenic Transcription: An Evolutionary Comparison

    Science.gov (United States)

    Visagie, Johann; Giger, Thomas; Joerchel, Sabrina; Petzold, Ekkehard; Green, Richard E; Lachmann, Michael; Pääbo, Svante

    2006-01-01

    Although a large proportion of human transcription occurs outside the boundaries of known genes, the functional significance of this transcription remains unknown. We have compared the expression patterns of known genes as well as intergenic transcripts within the ENCODE regions between humans and chimpanzees in brain, heart, testis, and lymphoblastoid cell lines. We find that intergenic transcripts show patterns of tissue-specific conservation of their expression, which are comparable to exonic transcripts of known genes. This suggests that intergenic transcripts are subject to functional constraints that restrict their rate of evolutionary change as well as putative positive selection to an extent comparable to that of classical protein-coding genes. In brain and testis, we find that part of this intergenic transcription is caused by widespread use of alternative promoters. Further, we find that about half of the expression differences between humans and chimpanzees are due to intergenic transcripts. PMID:17040132

  2. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  3. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  4. Identifikacija ocetnokislinskih bakterij iz industrijske proizvodnje jabolčnega kisa na osnovi medgenske regije 16S-23S rDNA

    OpenAIRE

    2016-01-01

    Zavedanje ljudi o pomembnosti uživanja zdrave hrane postaja vedno močnejše, zato se v zadnjih letih povečuje trend uživanja živil, pridobljenih iz surovin, ki so čim manj izpostavljene kemikalijam, npr. s škropljenjem. Tudi kis, kot eden izmed pogosto uporabljenih dodatkov k hrani, se lahko pridobiva iz jabolk, ki so pridelana na konvencionalen način, s škropljenjem, ali pa brez škropljenja, s čimer pridobimo bio-jabolčni kis. V okviru te magistrske naloge smo primerjali mikrobioto iz industr...

  5. Serotyping, ribotyping, PCR-mediated ribosomal 16S-23S spacer analysis and arbitrarily primed PCR for epidemiological studies on Legionella pneumophila

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); H. Maas (Hugo); H.A. Verbrugh (Henri); N. van Leeuwen (N.)

    1996-01-01

    textabstractFifty clinical and environmental isolates of Legionella pneumophila were typed serologically and by DNA fingerprinting using arbitrarily primed polymerase chain reaction (AP-PCR). Furthermore, variability in and around ribosomal operons was assessed by conventional ribotyping and

  6. Serotyping, ribotyping, PCR-mediated ribosomal 16S-23S spacer analysis and arbitrarily primed PCR for epidemiological studies on Legionella pneumophila

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); H. Maas (Hugo); H.A. Verbrugh (Henri); N. van Leeuwen (N.)

    1996-01-01

    textabstractFifty clinical and environmental isolates of Legionella pneumophila were typed serologically and by DNA fingerprinting using arbitrarily primed polymerase chain reaction (AP-PCR). Furthermore, variability in and around ribosomal operons was assessed by conventional ribotyping and PCR-med

  7. Low abundant spacer 5S rRNA transcripts are frequently polyadenylated in Nicotiana.

    Science.gov (United States)

    Fulnecek, Jaroslav; Kovarik, Ales

    2007-11-01

    In plants, 5S rRNA genes (5S rDNA) encoding 120-nt structural RNA molecules of ribosomes are organized in tandem arrays comprising thousands of units. Failure to correctly terminate transcription would generate longer inaccurately processed transcripts interfering with ribosome biogenesis. Hence multiple termination signals occur immediately after the 5S rRNA coding sequence. To obtain information about the efficiency of termination of 5S rDNA transcription in plants we analyzed 5S rRNA pools in three Nicotiana species, N. sylvestris, N. tomentosiformis and N. tabacum. In addition to highly abundant 120-nt 5S rRNA transcripts, we also detected RNA species composed of a genic region and variable lengths of intergenic sequences. These genic-intergenic RNA molecules occur at a frequency severalfold lower than the mature 120-nt transcripts, and are posttranscriptionally modified by polyadenylation at their 3' end in contrast to 120-nt transcripts. An absence of 5S small RNAs (smRNA) argue against a dominant role for the smRNA biosynthesis pathway in the degradation of aberrant 5S rRNA in Nicotiana. This work is the first description of polyadenylated 5S rRNA species in higher eukaryotes originating from a read-through transcription into the intergenic spacer. We propose that polyadenylation may function in a "quality control" pathway ensuring that only correctly processed molecules enter the ribosome biogenesis.

  8. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

    Science.gov (United States)

    Lakshmikumaran, M; Negi, M S

    1994-03-01

    Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

  9. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    Science.gov (United States)

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  10. Use of PCR primers and probes based on the 23S rRNA and internal transcription spacer (ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements.

    Science.gov (United States)

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2010-06-01

    Novel polymerase chain reaction (PCR) primers designed from the 16S-23S internal transcription spacer (ITS) rRNA and 23S rRNA genes, respectively, were used for the specific detection of Lactobacillus acidophilus and Lactobacillus plantarum. Molecular weights of the PCR products were 221 and 599 bp, respectively. Strains of L. acidophilus and L. plantarum obtained from the culture center, dairy products, infant stool and other samples, could be identified with these PCR primers. DNAs from other lactic acid bacteria (LAB) species including strains of Lactobacillus pentosus which was closely related to L. plantarum, and bacteria species other than LAB, would not generate the false positive results. When this PCR primer set was used for the detection of L. acidophilus and L. plantarum in feed supplement or feed starter samples, reliable results were obtained. Furthermore, when these L. acidophilus or L. plantarum specific primers were used as DNA probes for the colony hybridization of L. acidophilus and L. plantarum, the viable cells of these LAB species in culture and feed supplements or starter products could be identified and enumerized. The method described here thus offers a rapid and economic way to inspect and assure the quality of the feed supplements or fermentation starters.

  11. Genotypic and symbiotic diversity of Rhizobium populations associated with cultivated lentil and pea in sub-humid and semi-arid regions of Eastern Algeria

    OpenAIRE

    Riah, N.; Béna, Gilles; Djekoun, A.; Heulin, K.; De Lajudie, Philippe; Laguerre, G.

    2014-01-01

    The genetic structure of rhizobia nodulating pea and lentil in Algeria, Northern Africa was determined. A total of 237 isolates were obtained from root nodules collected on lentil (Lens culinaris), proteaginous and forage pea (Pisum sativum) growing in two eco-climatic zones, sub-humid and semi-arid, in Eastern Algeria. They were characterised by PCR-restriction fragment length polymorphism (RFLP) of the 16S-23S rRNA intergenic region (IGS), and the nodD-F symbiotic region. The combination of...

  12. Intergenic spacer length variants in Old Portuguese bread wheat cultivars

    Indian Academy of Sciences (India)

    Ana Carvalho; Henrique Guedes-Pinto; José Lima-Brito

    2011-08-01

    The intergenic spacer of the ribosomal DNA is highly variable, but is location specific in the nucleolar organizer region of the chromosomes. This study provides an event of high level of polymorphism / size variation and occurrence of 14 unique phenotypes in 48 landraces of Portuguese bread wheat cultivars for IGS-amplified products obtained by PCR-RFLP technique performed with TaqI. The attendant IGS polymorphism has been used to deduce affinities between landraces. Some of the high molecular weight IGS allelic variants were also probed for their chromosomal localization by sequential silver nitrate staining and fluorescence in situ hybridization. However, only the intergenic spacer allelic variant of 3.1 kb could be successfully hybridized, and was observed to be physically located on the chromosome pair 1B in the NOR loci of the cultivar ‘Magueija’.

  13. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    Science.gov (United States)

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  14. Genetic diversity of root-nodulating bacteria isolated from pea (Pisum sativum) in subtropical regions of China

    Institute of Scientific and Technical Information of China (English)

    YANG ChengYun; YANG JiangKe; LI YouGuo; ZHOU JunOhu

    2008-01-01

    Diversity of 42 isolates from effective nodules of Pisum sativum in different geographical regions of China were studied using 16S rRNA gene RFLP patterns, 16S rRNA sequencing, 16S-23S rRNA inter-genic spacer (IGS) region RFLP patterns and G-C rich random amplified polymorphic DNA (RAPD). The isolates were distributed in two groups on the basis of their 16S rRNA gene RFLP patterns. The 16S rRNA gene sequences of strains from 16S rRNA gene RFLP patterns group Ⅰ were very closely related (identities higher than 99.5%) to Rhizobium leguminosarum USDA 2370. Group Ⅱ consisting of WzP3 and WzP15 was closely related to Rhizobium etli CFN42. The analysis of the 16S-23S IGS RFLP pat-terns divided the isolates into 18 genotypes and four groups. Group Ⅰ was clustered with R. legumino-sarum USDA2370. Group Ⅱ consisted of YcP2, YcP3 and CqP7. The strains of group Ⅲ were distributed abroad. Group Ⅳ consisted of WzP3, WzP15 and R. etli CFN42. RAPD divided the isolates into nine clusters in which group Ⅳ only consisted of YcP2 and the strains of group Ⅴ and Ⅸ were from Wenzhou and Xiantao, respectively. This assay demonstrated the geographical effect on genetic diversity of pea rhizobia.

  15. Identification of Swertia mussotii and its adulterant Swertia species by 5S rRNA gene spacer.

    Science.gov (United States)

    Yu, Man-Tang; Wong, Ka-Lok; Zong, Yu-Ying; Shaw, Pang-Chui; Che, Chun-Tao

    2008-03-01

    This research focused on analyzing the differences of 5S rRNA gene spacer sequences on Swertia mussotii and its commonly used adulterants, including S. franchetiana, S. wolfangiana and S. chirayita. DNA was extracted from the collected Swertia samples. 5S rRNA intergenic spacers were amplified by PCR, sequenced and analyzed. 5S rRNA gene spacer sequences were different between S. mussotii and its other three adulterants. Sequence divergence among species ranged from 30.6% to 65.0%. 5S rRNA spacers may be used as molecular authentication markers to differentiate S. mussotii and other commonly used Swertia adulterants. This result provides reliable and simple reference for the authentication of Swertia genus species.

  16. Potential use of molecular-typing methods for the identification and characterization of salmonella enterica serotypes isolated in the poultry production chain

    Directory of Open Access Journals (Sweden)

    CM Baratto

    2012-09-01

    Full Text Available Salmonella is widespread in nature and can be found in all links of the poultry production chain. Due to its high impact on meat processing, techniques for the rapid detection and reproducible characterization of Salmonella serotypes in foods are needed. The present study investigated the potential of molecular profiling to identify and differentiate 15 Salmonella serotypes isolated from the poultry production chain, based on 5 primers by random amplified polymorphic DNA (RAPD, enterobacterial repetitive intergenic consensus (ERIC-PCR, amplification of rDNA internal spacer analysis (RISA, and amplified ribosomal DNA restriction analysis (ARDRA of 16S-23S rRNA internal spacer region (ISR cleaved with Alu I and Hha I restriction enzymes. Three isolates of each serotype were analyzed for the identification of similar and different profiles. Dendrograms were constructed from molecular profiles using the UPGMA method (unweighted pair-group method for the arithmetic averages and the software program WinBoot. The present study indicates the usefulness of RISA and ARDRA of the 16S-23S rRNA intergenic spacer region (ISR for systematic, epidemiological, and diagnostic purposes. Since these techniques can be used for the differentiation of serotypes, they are highly promising for the characterization of Salmonella serotypes and intra-serotypes. Data indicate that these techniques may be used to produce more consistent, reliable, and reproducible results in the identification and epidemiological study (traceability of Salmonella in the poultry industry.

  17. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    Science.gov (United States)

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  18. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    Science.gov (United States)

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  19. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  20. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  1. Detection of Chlamydophila psittaci from pigeons by polymerase chain reaction in Ahvaz

    Directory of Open Access Journals (Sweden)

    Masoud Ghorbanpoor

    2015-10-01

    Full Text Available Background and Objective: Chlamydophila psittaci is a lethal bacterium that causes endemic avian chlamydiosis, and respiratory psittacosis. Laboratory diagnosis of Chlamydophila psittaci is difficult by culture. This study was design to investigate the presence of Chlamydophila psittaci in collected pharyngeal swabs from asyptomatic pigeons by PCR.Materials and Methods: Pharyngeal samples from pigeons with no symptoms of disease (n=280 were collected during hot and cold seasons in different parts of Ahvaz. DNA was extracted from specimens and subjected to PCR targeting pmp genes and 16s-23s rRNA intergenic spacer of Cp. psittaci and chlamydiales specific primers.Results: Of 280 samples 2 (0.7% harbor were positive for chlamydiales (16s-23s intergenic spacer and Cp. psittaci specific genes (pmp gene.Conclusions: In this research the pigeons were asymptomatic carriers for Cp. psittaci in their respiratory discharges. These results suggest that Cp. psittaci infection of human can occur in very close and continuous contact with pigeons.

  2. The structure of a single unit of ribosomal RNA gene (rDNA) including intergenic subrepeats in the Australian bulldog ant Myrmecia croslandi (Hymenoptera: Formicidae).

    Science.gov (United States)

    Ohnishi, Hitoshi; Yamamoto, Masa-Toshi

    2004-02-01

    A complete single unit of a ribosomal RNA gene (rDNA) of M. croslandi was sequenced. The ends of the 18S, 5.8S and 28S rRNA genes were determined by using the sequences of D. melanogaster rDNAs as references. Each of the tandemly repeated rDNA units consists of coding and non-coding regions whose arrangement is the same as that of D. melanogaster rDNA. The intergenic spacer (IGS) contains, as in other species, a region with subrepeats, of which the sequences are different from those previously reported in other insect species. The length of IGSs was estimated to be 7-12 kb by genomic Southern hybridization, showing that an rDNA repeating unit of M. croslandi is 14-19 kb-long. The sequences of the coding regions are highly conserved, whereas IGS and ITS (internal transcribed spacer) sequences are not. We obtained clones with insertions of various sizes of R2 elements, the target sequence of which was found in the 28S rRNA coding region. A short segment in the IGS that follows the 3' end of the 28S rRNA gene was predicted to form a secondary structure with long stems.

  3. Quantitative modeling of a gene's expression from its intergenic sequence.

    Directory of Open Access Journals (Sweden)

    Md Abul Hassan Samee

    2014-03-01

    Full Text Available Modeling a gene's expression from its intergenic locus and trans-regulatory context is a fundamental goal in computational biology. Owing to the distributed nature of cis-regulatory information and the poorly understood mechanisms that integrate such information, gene locus modeling is a more challenging task than modeling individual enhancers. Here we report the first quantitative model of a gene's expression pattern as a function of its locus. We model the expression readout of a locus in two tiers: 1 combinatorial regulation by transcription factors bound to each enhancer is predicted by a thermodynamics-based model and 2 independent contributions from multiple enhancers are linearly combined to fit the gene expression pattern. The model does not require any prior knowledge about enhancers contributing toward a gene's expression. We demonstrate that the model captures the complex multi-domain expression patterns of anterior-posterior patterning genes in the early Drosophila embryo. Altogether, we model the expression patterns of 27 genes; these include several gap genes, pair-rule genes, and anterior, posterior, trunk, and terminal genes. We find that the model-selected enhancers for each gene overlap strongly with its experimentally characterized enhancers. Our findings also suggest the presence of sequence-segments in the locus that would contribute ectopic expression patterns and hence were "shut down" by the model. We applied our model to identify the transcription factors responsible for forming the stripe boundaries of the studied genes. The resulting network of regulatory interactions exhibits a high level of agreement with known regulatory influences on the target genes. Finally, we analyzed whether and why our assumption of enhancer independence was necessary for the genes we studied. We found a deterioration of expression when binding sites in one enhancer were allowed to influence the readout of another enhancer. Thus, interference

  4. Ribosomal RNA gene silencing in interpopulation hybrids of Tigriopus californicus: nucleolar dominance in the absence of intergenic spacer subrepeats.

    Science.gov (United States)

    Flowers, Jonathan M; Burton, Ronald S

    2006-07-01

    A common feature of interspecific animal and plant hybrids is the uniparental silencing of ribosomal RNA gene transcription, or nucleolar dominance. A leading explanation for the genetic basis of nucleolar dominance in animal hybrids is the enhancer-imbalance model. The model proposes that limiting transcription factors are titrated by a greater number of enhancer-bearing subrepeat elements in the intergenic spacer (IGS) of the dominant cluster of genes. The importance of subrepeats for nucleolar dominance has repeatedly been supported in competition assays between Xenopus laevis and X. borealis minigene constructs injected into oocytes. However, a more general test of the importance of IGS subrepeats for nuclear dominance in vivo has not been conducted. In this report, rRNA gene expression was examined in interpopulation hybrids of the marine copepod Tigriopus californicus. This species offers a rare opportunity to test the role of IGS subrepeats in nucleolar dominance because the internal subrepeat structure, found in the IGS of virtually all animal and plant species, is absent in T. californicus. Our results clearly establish that nucleolar dominance occurs in F1 and F2 interpopulation hybrids of this species. In the F2 generation, nucleolar dominance appears to break down in some hybrids in a fashion that is inconsistent with a transcription factor titration model. These results are significant because they indicate that nucleolar dominance can be established and maintained without enhancer-bearing repeat elements in the IGS. This challenges the generality of the enhancer-imbalance model for nucleolar dominance and suggests that dominance of rRNA transcription in animals may be determined by epigenetic factors as has been established in plants.

  5. A genome-wide analysis of genetic diversity in Trypanosoma cruzi intergenic regions.

    Directory of Open Access Journals (Sweden)

    Leonardo G Panunzi

    2014-05-01

    Full Text Available BACKGROUND: Trypanosoma cruzi is the causal agent of Chagas Disease. Recently, the genomes of representative strains from two major evolutionary lineages were sequenced, allowing the construction of a detailed genetic diversity map for this important parasite. However this map is focused on coding regions of the genome, leaving a vast space of regulatory regions uncharacterized in terms of their evolutionary conservation and/or divergence. METHODOLOGY: Using data from the hybrid CL Brener and Sylvio X10 genomes (from the TcVI and TcI Discrete Typing Units, respectively, we identified intergenic regions that share a common evolutionary ancestry, and are present in both CL Brener haplotypes (TcII-like and TcIII-like and in the TcI genome; as well as intergenic regions that were conserved in only two of the three genomes/haplotypes analyzed. The genetic diversity in these regions was characterized in terms of the accumulation of indels and nucleotide changes. PRINCIPAL FINDINGS: Based on this analysis we have identified i a core of highly conserved intergenic regions, which remained essentially unchanged in independently evolving lineages; ii intergenic regions that show high diversity in spite of still retaining their corresponding upstream and downstream coding sequences; iii a number of defined sequence motifs that are shared by a number of unrelated intergenic regions. A fraction of indels explains the diversification of some intergenic regions by the expansion/contraction of microsatellite-like repeats.

  6. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    Science.gov (United States)

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  8. Regulatory roles of conserved intergenic domains in vertebrate Dlx bigene clusters.

    Science.gov (United States)

    Ghanem, Noël; Jarinova, Olga; Amores, Angel; Long, Qiaoming; Hatch, Gary; Park, Byung Keon; Rubenstein, John L R; Ekker, Marc

    2003-04-01

    Dlx homeobox genes of vertebrates are generally arranged as three bigene clusters on distinct chromosomes. The Dlx1/Dlx2, Dlx5/Dlx6, and Dlx3/Dlx7 clusters likely originate from duplications of an ancestral Dlx gene pair. Overlaps in expression are often observed between genes from the different clusters. To determine if the overlaps are a result of the conservation of enhancer sequences between paralogous clusters, we compared the Dlx1/2 and the Dlx5/Dlx6 intergenic regions from human, mouse, zebrafish, and from two pufferfish, Spheroides nephelus and Takifugu rubripes. Conservation between all five vertebrates is limited to four sequences, two in Dlx1/Dlx2 and two in Dlx5/Dlx6. These noncoding sequences are >75% identical over a few hundred base pairs, even in distant vertebrates. However, when compared to each other, the four intergenic sequences show a much more limited similarity. Each intergenic sequence acts as an enhancer when tested in transgenic animals. Three of them are active in the forebrain with overlapping patterns despite their limited sequence similarity. The lack of sequence similarity between paralogous intergenic regions and the high degree of sequence conservation of orthologous enhancers suggest a rapid divergence of Dlx intergenic regions early in chordate/vertebrate evolution followed by fixation of cis-acting regulatory elements.

  9. Chicken rRNA Gene Cluster Structure.

    Directory of Open Access Journals (Sweden)

    Alexander G Dyomin

    Full Text Available Ribosomal RNA (rRNA genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5'ETS (1836 bp, 18S rRNA gene (1823 bp, ITS1 (2530 bp, 5.8S rRNA gene (157 bp, ITS2 (733 bp, 28S rRNA gene (4441 bp and 3'ETS (343 bp. The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region. The results have confirmed the chicken rRNA gene cluster validity.

  10. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  11. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Directory of Open Access Journals (Sweden)

    Witoon Purahong

    Full Text Available Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub. Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected.

  12. Human Disease-Associated Genetic Variation Impacts Large Intergenic Non-Coding RNA Expression

    NARCIS (Netherlands)

    Kumar, Vinod; Westra, Harm-Jan; Karjalainen, Juha; Zhernakova, Daria V.; Esko, Tonu; Hrdlickova, Barbara; Almeida, Rodrigo; Zhernakova, Alexandra; Reinmaa, Eva; Hofker, Marten H.; Fehrmann, Rudolf S. N.; Fu, Jingyuan; Withoff, Sebo; Metspalu, Andres; Franke, Lude; Wijmenga, Cisca; Vosa, Urmo

    2013-01-01

    Recently it has become clear that only a small percentage (7%) of disease-associated single nucleotide polymorphisms (SNPs) are located in protein-coding regions, while the remaining 93% are located in gene regulatory regions or in intergenic regions. Thus, the understanding of how genetic variation

  13. Use of the CP and CPm Intergene Sequences to Discriminate CTV Strains

    Science.gov (United States)

    There is a need to develop a rapid assay to distinguish potentially mild vs severe strains of Citrus tristeza virus. Multiple alignment performed on the coat protein (CP) and the minor coat protein (CPm) intergene sequences (~80-100 bp) from different CTV isolates revealed that severe strains (VT, ...

  14. New species in the genus Francisella (Gammaproteobacteria; Francisellaceae); Francisella piscicida sp. nov. isolated from cod (Gadus morhua)

    DEFF Research Database (Denmark)

    Ottem, Karl F; Nylund, Are; Karlsbakk, Egil

    2007-01-01

    A Francisella strain, GM2212, previously isolated from moribund farmed Atlantic cod (Gadus morhua) in Norway, is closely related to Francisella philomiragia among Francisella spp. according to its complete 16S rDNA, 16S-23S intergenic spacer, 23S rDNA, 23S-5S intergenic spacer, 5S rDNA, Fop...

  15. Characterization of Francisella sp., GM2212, the first Francisella isolate from marine fish, Atlantic cod (Gadus morhua)

    DEFF Research Database (Denmark)

    Ottem, Karl F; Nylund, Are; Karlsbakk, Egil;

    2007-01-01

    A Francisella sp., isolate GM2212(T), previously isolated from diseased farmed Atlantic cod Gadus morhua in Norway is characterized. The complete 16S rDNA, 16S-23S intergenic spacer, 23S rDNA, 23S-5S intergenic spacer, 5S rDNA, FopA, lipoprotein TUL4 (LpnA), malate dehydrogenase and a hypothetical...

  16. High-prevalence Borrelia miyamotoi infection among [corrected] wild turkeys (Meleagris gallopavo) in Tennessee.

    Science.gov (United States)

    Scott, M C; Rosen, M E; Hamer, S A; Baker, E; Edwards, H; Crowder, C; Tsao, J I; Hickling, G J

    2010-11-01

    During spring and fall 2009, 60 wild turkeys (Meleagris gallopavo) harvested by Tennessee hunters were surveyed for Borrelia spp. by sampling their blood, tissue, and attached ticks. In both seasons, 70% of turkeys were infested with juvenile Amblyomma americanum; one spring turkey hosted an adult female Ixodes brunneus. Polymerase chain reaction assays followed by DNA sequencing indicated that 58% of the turkeys were positive for the spirochete Borrelia miyamotoi, with tissue testing positive more frequently than blood (P = 0.015). Sequencing of the 16S-23S rRNA intergenic spacer indicated > or = 99% similarity to previously published sequences of the North American strain of this spirochete. Positive turkeys were present in both seasons and from all seven middle Tennessee counties sampled. No ticks from the turkeys tested positive for any Borrelia spp. This is the first report of B. miyamotoi in birds; the transmission pathways and epidemiological significance of this high-prevalence spirochetal infection remain uncertain.

  17. Genetic diversity of nodulating and non-nodulating rhizobia associated with wild soybean (Glycine soja Sieb. & Zucc.) in different ecoregions of China.

    Science.gov (United States)

    Wu, Li Juan; Wang, Hai Qing; Wang, En Tao; Chen, Wen Xin; Tian, Chang Fu

    2011-06-01

    A total of 99 bacterial isolates that originated from root nodules of Glycine soja were characterized with restriction analyses of amplified 16S ribosomal DNA and 16S-23S rDNA intergenic spacers (ITS), and sequence analyses of 16S rRNA, rpoB, atpD, recA and nodC genes. When tested for nodulation of G. soja, 72 of the isolates were effective symbionts, and these belonged to five species: Bradyrhizobium japonicum, Bradyrhizobium elkanii, Bradyrhizobium yuanmingense, Bradyrhizobium liaoningense and Sinorhizobium fredii. All of these, except some B. yuanmingense strains, also formed effective nodules on the domesticated soybean Glycine max. The remaining 27 isolates did not nodulate either host, but were identified as Rhizobium. Phylogeny nodC in the G. soja symbionts suggested that this symbiosis gene was mainly maintained by vertical gene transfer. Different nodC sublineages and rrs-ITS clusters reflected the geographic origins of isolates in this study.

  18. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    Science.gov (United States)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

    2017-01-01

    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment. PMID:28262684

  19. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    Science.gov (United States)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

    2017-03-01

    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  20. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    Science.gov (United States)

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes.

  1. α-MSH regulates intergenic splicing of MC1R and TUBB3 in human melanocytes

    OpenAIRE

    Dalziel, Martin; Kolesnichenko, Marina; das Neves, Ricardo Pires; Iborra, Francisco; Goding, Colin; Furger, André

    2010-01-01

    Alternative splicing enables higher eukaryotes to increase their repertoire of proteins derived from a restricted number of genes. However, the possibility that functional diversity may also be augmented by splicing between adjacent genes has been largely neglected. Here, we show that the human melanocortin 1 receptor (MC1R) gene, a critical component of the facultative skin pigmentation system, has a highly complex and inefficient poly(A) site which is instrumental in allowing intergenic spl...

  2. The Mitochondrial Genome of Conus textile, coxI-coxII Intergenic Sequences and Conoidean Evolution

    OpenAIRE

    2007-01-01

    The cone snails belong to the superfamily Conoidea, comprising ∼10,000 venomous marine gastropods. We determined the complete mitochondrial DNA sequence of Conus textile. The gene order is identical in Conus textile, Lophiotoma cerithiformis (another Conoidean gastropod), and the neogastropod Ilyanassa obsoleta, (not in the superfamily Conoidea). However, the intergenic interval between the coxI/coxII genes, was much longer in C. textile (165 bp) than in any other previously analyzed gastropo...

  3. Intergenic and repeat transcription in human, chimpanzee and macaque brains measured by RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Augix Guohua Xu

    Full Text Available Transcription is the first step connecting genetic information with an organism's phenotype. While expression of annotated genes in the human brain has been characterized extensively, our knowledge about the scope and the conservation of transcripts located outside of the known genes' boundaries is limited. Here, we use high-throughput transcriptome sequencing (RNA-Seq to characterize the total non-ribosomal transcriptome of human, chimpanzee, and rhesus macaque brain. In all species, only 20-28% of non-ribosomal transcripts correspond to annotated exons and 20-23% to introns. By contrast, transcripts originating within intronic and intergenic repetitive sequences constitute 40-48% of the total brain transcriptome. Notably, some repeat families show elevated transcription. In non-repetitive intergenic regions, we identify and characterize 1,093 distinct regions highly expressed in the human brain. These regions are conserved at the RNA expression level across primates studied and at the DNA sequence level across mammals. A large proportion of these transcripts (20% represents 3'UTR extensions of known genes and may play roles in alternative microRNA-directed regulation. Finally, we show that while transcriptome divergence between species increases with evolutionary time, intergenic transcripts show more expression differences among species and exons show less. Our results show that many yet uncharacterized evolutionary conserved transcripts exist in the human brain. Some of these transcripts may play roles in transcriptional regulation and contribute to evolution of human-specific phenotypic traits.

  4. Intergenic regions of Borrelia plasmids contain phylogenetically conserved RNA secondary structure motifs

    Directory of Open Access Journals (Sweden)

    Delihas Nicholas

    2009-03-01

    Full Text Available Abstract Background Borrelia species are unusual in that they contain a large number of linear and circular plasmids. Many of these plasmids have long intergenic regions. These regions have many fragmented genes, repeated sequences and appear to be in a state of flux, but they may serve as reservoirs for evolutionary change and/or maintain stable motifs such as small RNA genes. Results In an in silico study, intergenic regions of Borrelia plasmids were scanned for phylogenetically conserved stem loop structures that may represent functional units at the RNA level. Five repeat sequences were found that could fold into stable RNA-type stem loop structures, three of which are closely linked to protein genes, one of which is a member of the Borrelia lipoprotein_1 super family genes and another is the complement regulator-acquiring surface protein_1 (CRASP-1 family. Modeled secondary structures of repeat sequences display numerous base-pair compensatory changes in stem regions, including C-G→A-U transversions when orthologous sequences are compared. Base-pair compensatory changes constitute strong evidence for phylogenetic conservation of secondary structure. Conclusion Intergenic regions of Borrelia species carry evolutionarily stable RNA secondary structure motifs. Of major interest is that some motifs are associated with protein genes that show large sequence variability. The cell may conserve these RNA motifs whereas allow a large flux in amino acid sequence, possibly to create new virulence factors but with associated RNA motifs intact.

  5. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    Science.gov (United States)

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  6. Disruption of a Large Intergenic Noncoding RNA in Subjects with Neurodevelopmental Disabilities

    OpenAIRE

    Talkowski, Michael E.; Maussion, Gilles; Crapper, Liam; Rosenfeld, Jill A.; Blumenthal, Ian; Hanscom, Carrie; Chiang, Colby; Lindgren, Amelia; Pereira, Shahrin; Ruderfer, Douglas; Diallo, Alpha B.; Lopez, Juan Pablo; Turecki, Gustavo; Chen, Elizabeth S.; Gigek, Carolina

    2012-01-01

    Large intergenic noncoding (linc) RNAs represent a newly described class of ribonucleic acid whose importance in human disease remains undefined. We identified a severely developmentally delayed 16-year-old female with karyotype 46,XX,t(2;11)(p25.1;p15.1)dn in the absence of clinically significant copy number variants (CNVs). DNA capture followed by next-generation sequencing of the translocation breakpoints revealed disruption of a single noncoding gene on chromosome 2, LINC00299, whose RNA ...

  7. Partial Deletion of the L-Segment Intergenic Region Produces an Attenuated Machupo Virus that Protects Guinea Pigs Against Lethal Guanarito Virus Infection

    Science.gov (United States)

    2017-01-11

    1 Golden, J.W. et al. Machupo virus live-attenuated vaccine Partial deletion of the L-segment intergenic region produces an attenuated Machupo...had a 35 nucleotide deletion in the L-segment non-coding intergenic region . Contrary to Car91, Car68 produced a lethal infection in guinea pigs with...Keywords: Arenavirus, Machupo virus, Guanarito virus, intergenic region , live-attenuated vaccines, cross-protection 45 TR-17-030 DISTRIBUTION

  8. De Novo Identification of Regulatory Regions in Intergenic Spaces of Prokaryotic Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Chain, P; Garcia, E; Mcloughlin, K; Ovcharenko, I

    2007-02-20

    This project was begun to implement, test, and experimentally validate the results of a novel algorithm for genome-wide identification of candidate transcription-factor binding sites in prokaryotes. Most techniques used to identify regulatory regions rely on conservation between different genomes or have a predetermined sequence motif(s) to perform a genome-wide search. Therefore, such techniques cannot be used with new genome sequences, where information regarding such motifs has not yet been discovered. This project aimed to apply a de novo search algorithm to identify candidate binding-site motifs in intergenic regions of prokaryotic organisms, initially testing the available genomes of the Yersinia genus. We retrofitted existing nucleotide pattern-matching algorithms, analyzed the candidate sites identified by these algorithms as well as their target genes to screen for meaningful patterns. Using properly annotated prokaryotic genomes, this project aimed to develop a set of procedures to identify candidate intergenic sites important for gene regulation. We planned to demonstrate this in Yersinia pestis, a model biodefense, Category A Select Agent pathogen, and then follow up with experimental evidence that these regions are indeed involved in regulation. The ability to quickly characterize transcription-factor binding sites will help lead to a better understanding of how known virulence pathways are modulated in biodefense-related organisms, and will help our understanding and exploration of regulons--gene regulatory networks--and novel pathways for metabolic processes in environmental microbes.

  9. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  10. Eukaryotic 5S rRNA biogenesis.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2011-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. Copyright © 2011 John Wiley & Sons, Ltd.

  11. Characterization of IS6110 insertions in the dnaA-dnaN intergenic region of Mycobacterium tuberculosis clinical isolates.

    Science.gov (United States)

    Turcios, L; Casart, Y; Florez, I; de Waard, J; Salazar, L

    2009-02-01

    Mycobacterium tuberculosis isolates with identical IS6110 restriction fragment length polymorphism (RFLP) patterns are considered to be clonally related. The presence of IS6110 in the dnaA-dnaN intergenic region, one preferential locus for the integration of IS6110, was evaluated in 125 M. tuberculosis isolates. Five isolates had IS6110 inserted in this region, and two consisted of a mix of isogenic strains that putatively have evolved during a single infection. Strains from the same isolate had identical spoligo and mycobacterial interspersed repetitive unit-variable-number tandem repeat profiles, but had slight variations in IS6110 RFLP patterns, due to the presence of IS6110 in the dnaA-dnaN intergenic region. Duplication of the dnaA-dnaN intergenic region was found in one isogenic strain.

  12. The 28S-18S rDNA intergenic spacer from Crithidia fasciculata: repeated sequences, length heterogeneity, putative processing sites and potential interactions between U3 small nucleolar RNA and the ribosomal RNA precursor.

    Science.gov (United States)

    Schnare, M N; Collings, J C; Spencer, D F; Gray, M W

    2000-09-15

    In Crithidia fasciculata, the ribosomal RNA (rRNA) gene repeats range in size from approximately 11 to 12 kb. This length heterogeneity is localized to a region of the intergenic spacer (IGS) that contains tandemly repeated copies of a 19mer sequence. The IGS also contains four copies of an approximately 55 nt repeat that has an internal inverted repeat and is also present in the IGS of Leishmania species. We have mapped the C.fasciculata transcription initiation site as well as two other reverse transcriptase stop sites that may be analogous to the A0 and A' pre-rRNA processing sites within the 5' external transcribed spacer (ETS) of other eukaryotes. Features that could influence processing at these sites include two stretches of conserved primary sequence and three secondary structure elements present in the 5' ETS. We also characterized the C.fasciculata U3 snoRNA, which has the potential for base-pairing with pre-rRNA sequences. Finally, we demonstrate that biosynthesis of large subunit rRNA in both C. fasciculata and Trypanosoma brucei involves 3'-terminal addition of three A residues that are not present in the corresponding DNA sequences.

  13. Sequence analysis of the rDNA intergenic spacer of Metarhizium strains isolated in Brazil

    Directory of Open Access Journals (Sweden)

    Fabiana Y. Yanaka-Schäfer

    2008-01-01

    Full Text Available To assess the extent of genetic variability of rDNA intergenic spacer (IGS in Metarhizium sp., 34 strains (27 isolated in Brazil were sequenced and analyzed together with an additional 20 Metarhizium anisopliae var. anisopliae sequences retrieved from GenBank. Overall, the global nucleotide diversity for the region under study was of 0.090, while for the Brazilian isolates it was only 0.016. Phylogenetic analyses showed four well-supported groups (A, B, C, and D, one of which (D has not been previously identified. All but one of the Brazilian strains cluster in this novel D phylogroup, suggesting that the genetic variation found in Brazil is a subset of the worldwide M. anisopiliae var. anisopliae variation.

  14. Optimisation of automated ribosomal intergenic spacer analysis for the estimation of microbial diversity in fynbos soil

    Directory of Open Access Journals (Sweden)

    Karin Jacobs

    2010-07-01

    Full Text Available Automated ribosomal intergenic spacer analysis (ARISA has become a commonly used molecular technique for the study of microbial populations in environmental samples. The reproducibility and accuracy of ARISA, with and without the polymerase chain reaction (PCR are important aspects that influence the results and effectiveness of these techniques. We used the primer set ITS4/ITS5 for ARISA to assess the fungal community composition of two sites situated in the Sand Fynbos. The primer set proved to deliver reproducible ARISA profiles of the fungal community composition with little variation observed between ARISA-PCRs. Variation that occurred in a sample due to repeated DNA extraction is expected for ecological studies. This reproducibility made ARISA a useful tool for the assessment and comparison of diversity in ecological samples. In this paper, we also offered particular suggestions concerning the binning strategy for the analysis of ARISA profiles.

  15. Genome-wide identification, characterization and evolutionary analysis of long intergenic noncoding RNAs in cucumber.

    Directory of Open Access Journals (Sweden)

    Zhiqiang Hao

    Full Text Available Long intergenic noncoding RNAs (lincRNAs are intergenic transcripts with a length of at least 200 nt that lack coding potential. Emerging evidence suggests that lincRNAs from animals participate in many fundamental biological processes. However, the systemic identification of lincRNAs has been undertaken in only a few plants. We chose to use cucumber (Cucumis sativus as a model to analyze lincRNAs due to its importance as a model plant for studying sex differentiation and fruit development and the rich genomic and transcriptome data available. The application of a bioinformatics pipeline to multiple types of gene expression data resulted in the identification and characterization of 3,274 lincRNAs. Next, 10 lincRNAs targeted by 17 miRNAs were also explored. Based on co-expression analysis between lincRNAs and mRNAs, 94 lincRNAs were annotated, which may be involved in response to stimuli, multi-organism processes, reproduction, reproductive processes, and growth. Finally, examination of the evolution of lincRNAs showed that most lincRNAs are under purifying selection, while 16 lincRNAs are under natural selection. Our results provide a rich resource for further validation of cucumber lincRNAs and their function. The identification of lincRNAs targeted by miRNAs offers new clues for investigations into the role of lincRNAs in regulating gene expression. Finally, evaluation of the lincRNAs suggested that some lincRNAs are under positive and balancing selection.

  16. Cotranscription and intergenic splicing of the PPARG and TSEN2 genes in cattle

    Directory of Open Access Journals (Sweden)

    Amarger Valérie

    2006-04-01

    Full Text Available Abstract Background Intergenic splicing resulting in the combination of mRNAs sequences from distinct genes is a newly identified mechanism likely to contribute to protein diversity. Few cases have been described, most of them involving neighboring genes and thus suggesting a cotranscription event presumably due to transcriptional termination bypass. Results We identified bovine chimeric transcripts resulting from cotranscription and intergenic splicing of two neighboring genes, PPARG and TSEN2. These two genes encode the Peroxisome Proliferator Activated Receptors γ1 and γ2 and the tRNA Splicing Endonuclease 2 homolog and are situated in the same orientation about 50 kb apart on bovine chromosome 22q24. Their relative position is conserved in human and mouse. We identified two types of chimeric transcripts containing all but the last exon of the PPARG gene followed by all but the first exon of the TSEN2 gene. The two chimers differ by the presence/absence of an intermediate exon resulting from transcription of a LINE L2 sequence situated between the two genes. Both transcripts use canonical splice sites for all exons coming from both genes, as well as for the LINE L2 sequence. One of these transcripts harbors a premature STOP codon and the other encodes a putative chimeric protein combining most of the PPARγ protein and the entire TSEN2 protein, but we could not establish the existence of this protein. Conclusion By showing that both individual and chimeric transcripts are transcribed from PPARG and TSEN2, we demonstrated regulation of transcription termination. Further, the existence and functionality of a chimeric protein harboring active motifs that are a priori unrelated is hypothesized.

  17. Cytomolecular analysis of ribosomal DNA evolution in a natural allotetraploid Brachypodium hybridum and its putative ancestors – dissecting complex repetitive structure of intergenic spacers

    Directory of Open Access Journals (Sweden)

    Natalia Borowska-Zuchowska

    2016-10-01

    Full Text Available Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n=30, which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n=10 and B. stacei (2n=20. Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 kb and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level.

  18. Genomic plasticity of the rrn-nqrF intergenic segment in the Chlamydiaceae

    NARCIS (Netherlands)

    Liu, Zhi; Rank, Roger; Kaltenboeck, Bernhard; Magnino, Simone; Dean, Deborah; Burall, Laurel; Plaut, Roger D.; Read, Timothy D.; Myers, Garry; Bavoil, Patrik M.

    2007-01-01

    In Chlamydiaceae, the nucleotide sequence between the 5S rRNA gene and the gene for subunit F of the Na+-translocating NADH-quinone reductase (nqrF or dmpP) has varied lengths and gene contents. We analyzed this site in 45 Chlamydiaceae strains having diverse geographical and pathological origins an

  19. Genomic plasticity of the rrn-nqrF intergenic segment in the Chlamydiaceae

    NARCIS (Netherlands)

    Liu, Zhi; Rank, Roger; Kaltenboeck, Bernhard; Magnino, Simone; Dean, Deborah; Burall, Laurel; Plaut, Roger D.; Read, Timothy D.; Myers, Garry; Bavoil, Patrik M.

    2007-01-01

    In Chlamydiaceae, the nucleotide sequence between the 5S rRNA gene and the gene for subunit F of the Na+-translocating NADH-quinone reductase (nqrF or dmpP) has varied lengths and gene contents. We analyzed this site in 45 Chlamydiaceae strains having diverse geographical and pathological origins an

  20. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  1. Sequence analysis of rDNA intergenic spacer region (IGS) as a tool for phylogenetic studies in Trichoderma spp.

    Institute of Scientific and Technical Information of China (English)

    Mercatelli Elisabetta; Pecchia Susanna; Ciliegi Sandro; Vannacci Giovanni

    2004-01-01

    @@ Different from ribosomal genes, which contain highly conserved sequences that are detected in all organisms, the intergenic spacer of rDNA (IGS) appears to be the most rapidly-evolving spacer region. For this reason we tested this region for phylogenetic studies.

  2. Identification and Functional Prediction of Large Intergenic Noncoding RNAs (lincRNAs) in Rainbow Trout (Oncorhynchus mykiss)

    Science.gov (United States)

    Long noncoding RNAs (lncRNAs) have been recognized in recent years as key regulators of diverse cellular processes. Genome-wide large-scale projects have uncovered thousands of lncRNAs in many model organisms. Large intergenic noncoding RNAs (lincRNAs) are lncRNAs that are transcribed from intergeni...

  3. Limitations and benefits of ARISA intra-genomic diversity fingerprinting.

    Science.gov (United States)

    Popa, Radu; Popa, Rodica; Mashall, Matthew J; Nguyen, Hien; Tebo, Bradley M; Brauer, Suzanna

    2009-08-01

    Monitoring diversity changes and contamination in mixed cultures and simple microcosms is challenged by fast community structure dynamics, and the need for means allowing fast, cost-efficient and accurate identification of microorganisms at high phylogenetic resolution. The method we explored is a variant of Automated rRNA Intergenic Spacer Analysis based on Intra-Genomic Diversity Fingerprinting (ARISA-IGDF), and identifies phylotypes with multiple 16S-23S rRNA gene Intergenic Transcribed Spacers. We verified the effect of PCR conditions (annealing temperature, duration of final extension, number of cycles, group-specific primers and formamide) on ARISA-IGD fingerprints of 44 strains of Shewanella. We present a digitization algorithm and data analysis procedures needed to determine confidence in strain identification. Though using stringent PCR conditions and group-specific primers allow reasonably accurate identification of strains with three ARISA-IGD amplicons within the 82-1000 bp size range, ARISA-IGDF is best for phylotypes with >or=4 unambiguously different amplicons. This method allows monitoring the occurrence of culturable microbes and can be implemented in applications requiring high phylogenetic resolution, reproducibility, low cost and high throughput such as identifying contamination and monitoring the evolution of diversity in mixed cultures and low diversity microcosms and periodic screening of small microbial culture libraries.

  4. Application of rps16 Intron and trnL-trnF Intergenic Spacer Sequences to Identify Rengas Clone Riau

    Directory of Open Access Journals (Sweden)

    Dewi Indriyani Roslim

    2017-07-01

    Full Text Available Rengas clone Riau has been identified using morphological characters and molecular technique with a psbA-trnH intergenic spacer, however, this method can only determine its taxonomic status at genus level, namely Gluta sp.  This study reports application two DNA barcodes, i.e. rps16 intron and trnL-trnF intergenic spacer, to identify Rengas clone Riau.  The methods included collection of the leaves from Kajuik Lake, total DNA isolation, electrophoresis, PCR (polymerase chain reaction, gel purification and sequencing.  The rps16 intron size was 659 bp and the trnL-trnF intergenic spacer was 527 bp. The BLASTn analysis showed that sequences of the rps16 intron and the trnL-trnF intergenic spacer of Gluta sp clone Riau had 100% similarity to those of G. renghas deposited in GenBank.  These results were supported by high max score, high total score, query cover = 100%, and E-value = 0.  The dendrograms also showed the closest relationship of Gluta sp clone Riau with G. renghas deposited in GenBank compared to other species of Gluta.  In conclusion, this study succeeded in identifying Rengas clone Riau as Gluta renghas by using sequences of the rps16 intron and the trnL-trnF intergenic spacer. A combination of DNA barcodes could be applied to identify various plants as long as the database for the DNA barcodes is available in public database such as GenBank. 

  5. A small intergenic region drives exclusive tissue-specific expression of the adjacent genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Valle Estela M

    2009-10-01

    Full Text Available Abstract Background Transcription initiation by RNA polymerase II is unidirectional from most genes. In plants, divergent genes, defined as non-overlapping genes organized head-to-head, are highly represented in the Arabidopsis genome. Nevertheless, there is scarce evidence on functional analyses of these intergenic regions. The At5g06290 and At5g06280 loci are head-to-head oriented and encode a chloroplast-located 2-Cys peroxiredoxin B (2CPB and a protein of unknown function (PUF, respectively. The 2-Cys peroxiredoxins are proteins involved in redox processes, they are part of the plant antioxidant defence and also act as chaperons. In this study, the transcriptional activity of a small intergenic region (351 bp shared by At5g06290 and At5g06280 in Arabidopsis thaliana was characterized. Results Activity of the intergenic region in both orientations was analyzed by driving the β-glucuronidase (GUS reporter gene during the development and growth of Arabidopsis plants under physiological and stressful conditions. Results have shown that this region drives expression either of 2cpb or puf in photosynthetic or vascular tissues, respectively. GUS expression driven by the promoter in 2cpb orientation was enhanced by heat stress. On the other hand, the promoter in both orientations has shown similar down-regulation of GUS expression under low temperatures and other stress conditions such as mannitol, oxidative stress, or fungal elicitor. Conclusion The results from this study account for the first evidence of an intergenic region that, in opposite orientation, directs GUS expression in different spatially-localized Arabidopsis tissues in a mutually exclusive manner. Additionally, this is the first demonstration of a small intergenic region that drives expression of a gene whose product is involved in the chloroplast antioxidant defence such as 2cpb. Furthermore, these results contribute to show that 2cpb is related to the heat stress defensive system

  6. Disruption of a large intergenic noncoding RNA in subjects with neurodevelopmental disabilities.

    Science.gov (United States)

    Talkowski, Michael E; Maussion, Gilles; Crapper, Liam; Rosenfeld, Jill A; Blumenthal, Ian; Hanscom, Carrie; Chiang, Colby; Lindgren, Amelia; Pereira, Shahrin; Ruderfer, Douglas; Diallo, Alpha B; Lopez, Juan Pablo; Turecki, Gustavo; Chen, Elizabeth S; Gigek, Carolina; Harris, David J; Lip, Va; An, Yu; Biagioli, Marta; Macdonald, Marcy E; Lin, Michael; Haggarty, Stephen J; Sklar, Pamela; Purcell, Shaun; Kellis, Manolis; Schwartz, Stuart; Shaffer, Lisa G; Natowicz, Marvin R; Shen, Yiping; Morton, Cynthia C; Gusella, James F; Ernst, Carl

    2012-12-07

    Large intergenic noncoding (linc) RNAs represent a newly described class of ribonucleic acid whose importance in human disease remains undefined. We identified a severely developmentally delayed 16-year-old female with karyotype 46,XX,t(2;11)(p25.1;p15.1)dn in the absence of clinically significant copy number variants (CNVs). DNA capture followed by next-generation sequencing of the translocation breakpoints revealed disruption of a single noncoding gene on chromosome 2, LINC00299, whose RNA product is expressed in all tissues measured, but most abundantly in brain. Among a series of additional, unrelated subjects referred for clinical diagnostic testing who showed CNV affecting this locus, we identified four with exon-crossing deletions in association with neurodevelopmental abnormalities. No disruption of the LINC00299 coding sequence was seen in almost 14,000 control subjects. Together, these subjects with disruption of LINC00299 implicate this particular noncoding RNA in brain development and raise the possibility that, as a class, abnormalities of lincRNAs may play a significant role in human developmental disorders. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Ribosomal intergenic spacer analysis as a tool for monitoring methanogenic Archaea changes in an anaerobic digester.

    Science.gov (United States)

    Ciesielski, Slawomir; Bułkowska, Katarzyna; Dabrowska, Dorota; Kaczmarczyk, Dariusz; Kowal, Przemyslaw; Możejko, Justyna

    2013-08-01

    The applicability of a newly-designed PCR primer pair in examination of methanogenic Archaea in a digester treating plant biomass was evaluated by Ribosmal Intergenic Spacer Analysis (RISA). To find a suitable approach, three variants of RISA were tested: (1) standard, polyacrylamide gel-based, (2) automated, utilized capillary electrophoresis (GA-ARISA), and (3) automated microfluidics-based (MF-ARISA). All three techniques yielded a consistent picture of archaeal community structure changes during anaerobic digestion monitored for more than 6 weeks. While automated variants were more practical for handling and rapid analysis of methanogenic Archaea, the gel-based technique was advantageous when micro-organism identification was required. A DNA-sequence analysis of dominant bands extracted from the gel revealed that the main role in methane synthesis was played by micro-organisms affiliated with Methanosarcina barkeri. The obtained results revealed that RISA is a robust method allowing for detailed analysis of archaeal community structure during organic biomass conversion into biogas. In addition, our results showed that GA-ARISA has a higher resolution and reproducibility than other variants of RISA and could be used as a technique for tracking changes in methanogenic Archaea in an anaerobic digester.

  8. Epistasis in intra- and inter-gene pool crosses of the common bean.

    Science.gov (United States)

    Borel, J C; Ramalho, M A P; Abreu, A F B

    2016-02-26

    Epistasis has been shown to have an important role in the genetic control of several quantitative traits in the common bean. This study aimed to investigate the occurrence of epistasis in intra- and inter-pool gene crosses of the common bean. Four elite lines adapted to Brazilian conditions were used as parents, two from the Andean gene pool (ESAL 686; BRS Radiante) and two from the Mesoamerican gene pool (BRSMG Majestoso; BRS Valente). Four F2 populations were obtained: "A" (ESAL 686 x BRS Radiante), "B" (BRSMG Majestoso x BRS Valente), "C" (BRS Radiante x BRSMG Majestoso), and "D" (BRS Valente x ESAL 686). A random sample of F2 plants from each population was backcrossed to parents and F1 individuals, according to the triple test cross. Three types of progenies from each population were evaluated in contiguous trials. Seed yield and 100-seed weight were evaluated. Dominance genetic variance was predominant in most cases. However, the estimates of genetic variance may be biased by the occurrence of linkage disequilibrium and epistasis. Epistasis was detected for both traits; however, the occurrence differed among the populations and between the two traits. The results of this study reinforce the hypothesis that epistasis is present in the genetic control of traits in the common bean and suggest that the phenomenon is more frequent in inter-gene pool crosses than in intra-gene pool crosses.

  9. Computational identification of human long intergenic non-coding RNAs using a GA-SVM algorithm.

    Science.gov (United States)

    Wang, Yanqiu; Li, Yang; Wang, Qi; Lv, Yingli; Wang, Shiyuan; Chen, Xi; Yu, Xuexin; Jiang, Wei; Li, Xia

    2014-01-01

    Long intergenic non-coding RNAs (lincRNAs) are a new type of non-coding RNAs and are closely related with the occurrence and development of diseases. In previous studies, most lincRNAs have been identified through next-generation sequencing. Because lincRNAs exhibit tissue-specific expression, the reproducibility of lincRNA discovery in different studies is very poor. In this study, not including lincRNA expression, we used the sequence, structural and protein-coding potential features as potential features to construct a classifier that can be used to distinguish lincRNAs from non-lincRNAs. The GA-SVM algorithm was performed to extract the optimized feature subset. Compared with several feature subsets, the five-fold cross validation results showed that this optimized feature subset exhibited the best performance for the identification of human lincRNAs. Moreover, the LincRNA Classifier based on Selected Features (linc-SF) was constructed by support vector machine (SVM) based on the optimized feature subset. The performance of this classifier was further evaluated by predicting lincRNAs from two independent lincRNA sets. Because the recognition rates for the two lincRNA sets were 100% and 99.8%, the linc-SF was found to be effective for the prediction of human lincRNAs.

  10. A novel intergenic ETnII-β insertion mutation causes multiple malformations in polypodia mice.

    Directory of Open Access Journals (Sweden)

    Jessica A Lehoczky

    Full Text Available Mouse early transposon insertions are responsible for ~10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd, a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5' LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development.

  11. Ribosomal Intergenic Spacer 1 Based Characterization of Button Mushroom (Agaricus bisporus) Strains.

    Science.gov (United States)

    Kwon, Hyuk Woo; Choi, Min Ah; Kim, Dae Wook; Oh, Youn-Lee; Hyun, Min Woo; Kong, Won-Sik; Kim, Seong Hwan

    2016-12-01

    Breeding the button mushroom requires genetic information about its strains. This study was undertaken to genetically characterize four domestically bred button mushroom strains (Saea, Saejung, Saedo, Saeyeon cultivars) and to assess the possibility of using the intergenic spacer 1 (IGS1) region of rDNA as a genetically variable region in the genetic characterization. For the experiment, 34 strains of Agaricus bisporus, two strains of A. bitorquis, and one strain of A. silvaticus, from 17 countries were used. Nucleotide sequence analysis of IGS1 rDNA in these 37 Agaricus strains confirmed that genetic variations exist, not only among the four domestic strains, but also between the four domestic strains and foreign strains. Crossing two different haploid strains of A. bisporus seems to generate genetic variation in the IGS1 region in their off-spring haploid strains. Phylogenetic analysis based on the IGS1 sequence revealed all A. bisporus strains could be differentiated from A. silvaticus and A. bitorquis strains. Five genetic groups were resolved among A. bisporus strains. Saejung and Saeyeon cultivars formed a separate genetic group. Our results suggest that IGS1 could be complementarily applied in the polymorphism analysis of button mushroom.

  12. A long-term demasculinization of X-linked intergenic noncoding RNAs in Drosophila melanogaster.

    Science.gov (United States)

    Gao, Ge; Vibranovski, Maria D; Zhang, Li; Li, Zheng; Liu, Ming; Zhang, Yong E; Li, Xinmin; Zhang, Wenxia; Fan, Qichang; VanKuren, Nicholas W; Long, Manyuan; Wei, Liping

    2014-04-01

    Recent studies have revealed key roles of noncoding RNAs in sex-related pathways, but little is known about the evolutionary forces acting on these noncoding RNAs. Profiling the transcriptome of Drosophila melanogaster with whole-genome tiling arrays found that 15% of male-biased transcribed fragments are intergenic noncoding RNAs (incRNAs), suggesting a potentially important role for incRNAs in sex-related biological processes. Statistical analysis revealed a paucity of male-biased incRNAs and coding genes on the X chromosome, suggesting that similar evolutionary forces could be affecting the genomic organization of both coding and noncoding genes. Expression profiling across germline and somatic tissues further suggested that both male meiotic sex chromosome inactivation (MSCI) and sexual antagonism could contribute to the chromosomal distribution of male-biased incRNAs. Comparative sequence analysis showed that the evolutionary age of male-biased incRNAs is a significant predictor of their chromosomal locations. In addition to identifying abundant sex-biased incRNAs in the fly genome, our work unveils a global picture of the complex interplay between noncoding RNAs and sexual chromosome evolution.

  13. The evolutionary landscape of intergenic trans-splicing events in insects.

    Science.gov (United States)

    Kong, Yimeng; Zhou, Hongxia; Yu, Yao; Chen, Longxian; Hao, Pei; Li, Xuan

    2015-11-02

    To explore the landscape of intergenic trans-splicing events and characterize their functions and evolutionary dynamics, we conduct a mega-data study of a phylogeny containing eight species across five orders of class Insecta, a model system spanning 400 million years of evolution. A total of 1,627 trans-splicing events involving 2,199 genes are identified, accounting for 1.58% of the total genes. Homology analysis reveals that mod(mdg4)-like trans-splicing is the only conserved event that is consistently observed in multiple species across two orders, which represents a unique case of functional diversification involving trans-splicing. Thus, evolutionarily its potential for generating proteins with novel function is not broadly utilized by insects. Furthermore, 146 non-mod trans-spliced transcripts are found to resemble canonical genes from different species. Trans-splicing preserving the function of 'breakup' genes may serve as a general mechanism for relaxing the constraints on gene structure, with profound implications for the evolution of genes and genomes.

  14. LOC100287225, novel long intergenic non-coding RNA, misregulates in colorectal cancer.

    Science.gov (United States)

    Kazemzadeh, Mina; Safaralizadeh, Reza; Feizi, Mohammad Ali Hosseinpour; Ravanbakhsh, Reyhaneh; Somi, Mohammad Hossein; Hashemzadeh, Shahryar

    2016-01-01

    Colorectal cancer (CRC) is one of the most common cancers in the world; therefore, extensive research is needed to find new molecular therapeutic targets and biomarkers. LncRNA (long non-coding RNA), a new class of non-coding RNAs, has a crucial role in the onset and progression of various cancers including colorectal cancer. Research on lncRNA is still at initial stages and underlying molecular mechanisms of the vast majority of lncRNA have remained unclear. LOC100287225 is one of these novel lncRNAs (long intergenic non-coding RNA) located in the long arm of the chromosome 18. The purpose of this study was to determine the expression of LOC100287225 in colorectal tissue, and its misregulation in CRC patients. Quantitative real-time-PCR (qRT-PCR) was used to investigate the LOC100287225 expression in pairs of tumorous and adjacent tumor-free tissues of 39 colorectal cancer patients. Also, the relationship between the clinicopathology and expression of LOC100287225 was determined. QRT-PCR results revealed that not only is LOC100287225 expressed in the intestinal tissue, but has also been misregulated during tumorigenesis. Moreover, LOC100287225 RNA relative expression levels were significantly lower in tumor tissues compared with adjacent tumor-free tissues (P< 0.001). RNA expression level of LOC100287225 did not show significant correlation with clinical characteristics. In conclusion, our study demonstrated that LOC100287225 misregulation could be a potential target for gene therapy in colorectal cancer.

  15. Transposable element insertions in long intergenic non-coding RNA genes

    Directory of Open Access Journals (Sweden)

    Sivakumar eKannan

    2015-06-01

    Full Text Available Transposable elements (TE are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences, followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TE-derived sequences in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the RIDL (Repeat Insertion Domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and in particular functional diversification, of lincRNA genes.

  16. Identifying putative breast cancer-associated long intergenic non-coding RNA loci by high density SNP array analysis

    Directory of Open Access Journals (Sweden)

    Zhengyu eJiang

    2012-12-01

    Full Text Available Recent high-throughput transcript discoveries have yielded a growing recognition of long intergenic non-coding RNAs (lincRNAs, a class of arbitrarily defined transcripts (>200 nt that are primarily produced from the intergenic space. LincRNAs have been increasingly acknowledged for their expressional dynamics and likely functional associations with cancers. However, differential gene dosage of lincRNA genes between cancer genomes is less studied. By using the high-density Human Omni5-Quad BeadChips (Illumina, we investigated genomic copy number aberrations in a set of seven tumor-normal paired primary human mammary epithelial cells (HMECs established from patients with invasive ductal carcinoma. This Beadchip platform includes a total of 2,435,915 SNP loci dispersed at an average interval of ~700 nt throughout the intergenic region of the human genome. We mapped annotated or putative lincRNA genes to a subset of 332,539 SNP loci, which were included in our analysis for lincRNA-associated copy number variations (CNV. We have identified 122 lincRNAs, which were affected by somatic CNV with overlapped aberrations ranging from 0.14% to 100% in length. LincRNA-associated aberrations were detected predominantly with copy number losses and preferential clustering to the ends of chromosomes. Interestingly, lincRNA genes appear to be much less susceptible to CNV in comparison to both protein-coding and intergenic regions (CNV affected segments in percentage: 1.8%, 37.5% and 60.6%, respectively. In summary, our study established a novel approach utilizing high-resolution SNP array to identify lincRNA candidates, which could functionally link to tumorigenesis, and provide new strategies for the diagnosis and treatment of breast cancer.

  17. Molecular Epidemiology and Sequencing of the G-L Intergenic Region of Rabies Viruses Isolated in China

    Institute of Scientific and Technical Information of China (English)

    Sheng-Li MENG; QI-You XIAO; Guan-Mu DONG; Ge-Lin XU; Jia-Xin YAN; Ping-Gang MING; Jie WU; Xiao-Ming YANG; He-Tian MING; Feng-Cai ZHU; Dun-Jin ZHOU

    2007-01-01

    A group of 25 rabies viruses (RABVs),recovered from 24 dogs and one human case,were collected from various areas in China between 2004 and 2006.Genetic and phylogenetic analyses of the G-L intergenic region were carried out in 25 street RABV isolates and CTN vaccine strains of 7 generations.The study was based on the comparison of a 519 bp nucleotide sequence,encompassing the G-L intergenic region.The nucleotide sequence homologies of Chinese street strains were from 95.5% to 100%.The phylogenetic analysis showed that all Chinese isolates clearly supported the placement of all Chinese viruses in Lyssavirus genotype 1 and they were distributed according to their geographical origins.All of the Chinese strains were closely related but they could still be divided into two groups:group of street strains and group of CTN strains.This study presents details about the molecular epidemiology of rabies viruses based on the sequences of the G-L Intergenic region.

  18. First insight into the genome of an uncultivated crenarchaeote from soil

    DEFF Research Database (Denmark)

    Quaiser, Achim; Ochsenreiter, Torsten; Klenk, Hans-Peter;

    2002-01-01

    have constructed complex large-insert genomic libraries. Using archaea-specific 16S rRNA probes we have isolated a 34 kbp fragment from a 900 Mbp fosmid library of soil DNA. The clone contained a complete 16S/23S rRNA operon and 17 genes encoding putative proteins. Phylogenetic analyses of the r...

  19. Intergenic DNA sequences from the human X chromosome reveal high rates of global gene flow

    Directory of Open Access Journals (Sweden)

    Wall Jeffrey D

    2008-11-01

    Full Text Available Abstract Background Despite intensive efforts devoted to collecting human polymorphism data, little is known about the role of gene flow in the ancestry of human populations. This is partly because most analyses have applied one of two simple models of population structure, the island model or the splitting model, which make unrealistic biological assumptions. Results Here, we analyze 98-kb of DNA sequence from 20 independently evolving intergenic regions on the X chromosome in a sample of 90 humans from six globally diverse populations. We employ an isolation-with-migration (IM model, which assumes that populations split and subsequently exchange migrants, to independently estimate effective population sizes and migration rates. While the maximum effective size of modern humans is estimated at ~10,000, individual populations vary substantially in size, with African populations tending to be larger (2,300–9,000 than non-African populations (300–3,300. We estimate mean rates of bidirectional gene flow at 4.8 × 10-4/generation. Bidirectional migration rates are ~5-fold higher among non-African populations (1.5 × 10-3 than among African populations (2.7 × 10-4. Interestingly, because effective sizes and migration rates are inversely related in African and non-African populations, population migration rates are similar within Africa and Eurasia (e.g., global mean Nm = 2.4. Conclusion We conclude that gene flow has played an important role in structuring global human populations and that migration rates should be incorporated as critical parameters in models of human demography.

  20. Negative correlation between expression level and evolutionary rate of long intergenic noncoding RNAs.

    Science.gov (United States)

    Managadze, David; Rogozin, Igor B; Chernikova, Diana; Shabalina, Svetlana A; Koonin, Eugene V

    2011-01-01

    Mammalian genomes contain numerous genes for long noncoding RNAs (lncRNAs). The functions of the lncRNAs remain largely unknown but their evolution appears to be constrained by purifying selection, albeit relatively weakly. To gain insights into the mode of evolution and the functional range of the lncRNA, they can be compared with much better characterized protein-coding genes. The evolutionary rate of the protein-coding genes shows a universal negative correlation with expression: highly expressed genes are on average more conserved during evolution than the genes with lower expression levels. This correlation was conceptualized in the misfolding-driven protein evolution hypothesis according to which misfolding is the principal cost incurred by protein expression. We sought to determine whether long intergenic ncRNAs (lincRNAs) follow the same evolutionary trend and indeed detected a moderate but statistically significant negative correlation between the evolutionary rate and expression level of human and mouse lincRNA genes. The magnitude of the correlation for the lincRNAs is similar to that for equal-sized sets of protein-coding genes with similar levels of sequence conservation. Additionally, the expression level of the lincRNAs is significantly and positively correlated with the predicted extent of lincRNA molecule folding (base-pairing), however, the contributions of evolutionary rates and folding to the expression level are independent. Thus, the anticorrelation between evolutionary rate and expression level appears to be a general feature of gene evolution that might be caused by similar deleterious effects of protein and RNA misfolding and/or other factors, for example, the number of interacting partners of the gene product.

  1. Unusual structure of ribosomal DNA in the copepod Tigriopus californicus: intergenic spacer sequences lack internal subrepeats.

    Science.gov (United States)

    Burton, R S; Metz, E C; Flowers, J M; Willett, C S

    2005-01-03

    Eukaryotic nuclear ribosomal DNA (rDNA) is typically arranged as a series of tandem repeats coding for 18S, 5.8S, and 28S ribosomal RNAs. Transcription of rDNA repeats is initiated in the intergenic spacer (IGS) region upstream of the 18S gene. The IGS region itself typically consists of a set of subrepeats that function as transcriptional enhancers. Two important evolutionary forces have been proposed to act on the IGS region: first, selection may favor changes in the number of subrepeats that adaptively adjust rates of rDNA transcription, and second, coevolution of IGS sequence with RNA polymerase I transcription factors may lead to species specificity of the rDNA transcription machinery. To investigate the potential role of these forces on population differentiation and hybrid breakdown in the intertidal copepod Tigriopus californicus, we have characterized the rDNA of five T. californicus populations from the Pacific Coast of North America and one sample of T. brevicornicus from Scotland. Major findings are as follows: (1) the structural genes for 18S and 28S are highly conserved across T. californicus populations, in contrast to other nuclear and mitochondrial DNA (mtDNA) genes previously studied in these populations. (2) There is extensive differentiation among populations in the IGS region; in the extreme, no homology is observed across the IGS sequences (>2 kb) from the two Tigriopus species. (3) None of the Tigriopus IGS sequences have the subrepeat structure common to other eukaryotic IGS regions. (4) Segregation of rDNA in laboratory crosses indicates that rDNA is located on at least two separate chromosomes in T. californicus. These data suggest that although IGS length polymorphism does not appear to play the adaptive role hypothesized in some other eukaryotic systems, sequence divergence in the rDNA promoter region within the IGS could lead to population specificity of transcription in hybrids.

  2. Genome-wide identification and characterization of long intergenic non-coding RNAs in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Jianqin Li

    Full Text Available Ganoderma lucidum is a white-rot fungus best-known for its medicinal activities. We have previously sequenced its genome and annotated the protein coding genes. However, long non-coding RNAs in G. lucidum genome have not been analyzed. In this study, we have identified and characterized long intergenic non-coding RNAs (lincRNA in G. lucidum systematically. We developed a computational pipeline, which was used to analyze RNA-Seq data derived from G. lucidum samples collected from three developmental stages. A total of 402 lincRNA candidates were identified, with an average length of 609 bp. Analysis of their adjacent protein-coding genes (apcGenes revealed that 46 apcGenes belong to the pathways of triterpenoid biosynthesis and lignin degradation, or families of cytochrome P450, mating type B genes, and carbohydrate-active enzymes. To determine if lincRNAs and these apcGenes have any interactions, the corresponding pairs of lincRNAs and apcGenes were analyzed in detail. We developed a modified 3' RACE method to analyze the transcriptional direction of a transcript. Among the 46 lincRNAs, 37 were found unidirectionally transcribed, and 9 were found bidirectionally transcribed. The expression profiles of 16 of these 37 lincRNAs were found to be highly correlated with those of the apcGenes across the three developmental stages. Among them, 11 are positively correlated (r>0.8 and 5 are negatively correlated (r<-0.8. The co-localization and co-expression of lincRNAs and those apcGenes playing important functions is consistent with the notion that lincRNAs might be important regulators for cellular processes. In summary, this represents the very first study to identify and characterize lincRNAs in the genomes of basidiomycetes. The results obtained here have laid the foundation for study of potential lincRNA-mediated expression regulation of genes in G. lucidum.

  3. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  4. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  5. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species wer...

  6. Genomic organization of Tropomodulins 2 and 4 and unusual intergenic and intraexonic splicing of YL-1 and Tropomodulin 4

    Directory of Open Access Journals (Sweden)

    Zoghbi Huda Y

    2001-10-01

    Full Text Available Abstract Background The tropomodulins (TMODs are a family of proteins that cap the pointed ends of actin filaments. Four TMODs have been identified in humans, with orthologs in mice. Mutations in actin or actin-binding proteins have been found to cause several human diseases, ranging from hypertrophic cardiomyopathy to immunodefiencies such as Wiskott-Aldrich syndrome. We had previously mapped Tropomodulin 2 (TMOD2 to the genomic region containing the gene for amyotrophic lateral sclerosis 5 (ALS5. We determined the genomic structure of Tmod2 in order to better analyze patient DNA for mutations; we also determined the genomic structure of Tropomodulin 4 (TMOD4. Results In this study, we determined the genomic structure of TMOD2 and TMOD4 and found the organization of both genes to be similar. Sequence analysis of TMOD2 revealed no mutations or polymorphisms in ALS5 patients or controls. Interestingly, we discovered that another gene, YL-1, intergenically splices into TMOD4. YL-1 encodes six exons, the last of which is 291 bp from a 5' untranslated exon of TMOD4. We used 5' RACE and RT-PCR from TMOD4 to identify several intergenic RACE products. YL-1 was also found to undergo unconventional splicing using non-canonical splice sites within exons (intraexonic splicing to produce several alternative transcripts. Conclusions The genomic structure of TMOD2 and TMOD4 have been delineated. This should facilitate future mutational analysis of these genes. In addition, intergenic splicing at TMOD4/YL-1 was discovered, demonstrating yet another level of complexity of gene organization and regulation.

  7. Functional analysis of an intergenic non-coding sequence within mce1 operon of M.tuberculosis

    Directory of Open Access Journals (Sweden)

    Bose Mridula

    2010-04-01

    Full Text Available Abstract Background The mce operons play an important role in the entry of M. tuberculosis into macrophages and non-phagocytic cells. Their non-redundant function as well as complex regulation is implied by the phenotype of mce mutants. Recently, mce1 operon was found to extend over 13 genes, fadD5 (Rv0166 being the first gene of the operon. The presence of a non-coding sequence of 200 base pairs between Rv0166 and Rv0167 is peculiar to mce1 among the four mce operons of M.tuberculosis. We have examined the function of this region. Results We predicted putative promoter activity of the 200 base pairs of non-coding, intergenic region between Rv0166 and Rv0167 in silico using MEME software and designate it as intergenic promoter, IGPr. We demonstrate both promoter activity and a putative negative regulatory function of this fragment by reporter assays carried out in the surrogate host M.smegmatis. We find that the repressive elements not only control the native promoter but also repress a heterologous promoter of M.smegmatis. The higher activity of the intergenic promoter in a clinical isolate in comparison with the wild type sequence from M.tuberculosis H37Rv could be correlated with a point mutation within the negative element. We have mapped two transcription start sites for mce1 operon both of which are utilized in M.tuberculosis H37Rv as well as the clinical isolate VPCI591. Our studies show that the promoter activity in the non-coding region is relevant not only in reporter gene expression but also in the expression of mce1 operon in M. tuberculosis cells grown in synthetic medium. Conclusion The mce operon of M.tuberculosis H37Rv potentially can be transcribed from two promoters P1 and P2, former mapping upstream of Rv0166 and the latter in the non-coding intergenic region between Rv0166 and Rv0167. The transcription initiation from P1 results in a transcript with Rv0166 while that from P2 will be without it. The sequences between the

  8. Replication intermediate analysis confirms that chromosomal replication origin initiates from an unusual intergenic region in Caulobacter crescentus.

    Science.gov (United States)

    Brassinga, A K; Marczynski, G T

    2001-11-01

    The alpha-proteobacterium Caulobacter crescentus possesses a developmental cell cycle that restricts chromosome replication to a stalked cell type. The proposed C.crescentus chromosome replication origin (Cori) lies between hemE and RP001, an unusual intergenic region not previously associated with bacterial replication origins, although a similar genomic arrangement is also present at the putative replication origin in the related bacterium Rickettsia prowazekii. The cloned Cori supports autonomous plasmid replication selectively in the stalked cell type implying that replication of the entire chromosome also initiates between hemE and RP001. To confirm this location, we applied the 2-D (N/N) agarose gel electrophoresis technique to resolve and identify chromosome replication intermediates throughout a 30 kb region spanning Cori. Replication initiation in Cori was uniquely characterized by an 'origin bubble and Y-arc' pattern and this observation was supported by simple replication fork 'Y-arc' patterns that characterized the regions flanking Cori. These replication forks originated bi-directionally from within Cori as determined by the fork direction assay. Therefore, chromosomal replication initiates from the unusual hemE/RP001 intergenic region that we propose represents a new class of replication origins.

  9. Effects of structural changes in the dsdA-dsdC intergenic region on D-serine deaminase synthesis.

    Science.gov (United States)

    McFall, E; Nikam, S S; Palchaudhuri, S

    1991-02-01

    Single-base-pair changes well upstream of its transcription initiation site resulted in partially to fully constitutive expression of the D-serine deaminase structural gene, dsdA, independently of the cyclic AMP-cyclic AMP-binding protein complex and of the specific D-serine deaminase activator protein. These promoter mutations appear to define a consensus sequence that is repeated several times. Basal expression of dsdA+ was also strongly enhanced by subcloning on multicopy plasmids, by the DNA gyrase inhibitor novobiocin, and in dsdC(Con) mutants by increasing growth temperature. These results suggest that activation of dsdA+ expression by the dsdC-encoded protein involves distortion of promoter DNA. A dsdA translation start at bp -731 was verified by subcloning of dsdC+. Plasmid-specified activator at a high concentration interfered with chromosomal dsdC(Con) expression, and the interference was enhanced by deletion of most of the intergenic region from the plasmid. Even at a high concentration, however, plasmid-specified activator did not activate expression of chromosomal dsdA+, and in one case it was actually repressive. These results confirm the strong cis tropism of plasmid-specified dsdC-encoded protein and suggest that it is mediated by multiple sites in the dsdA-dsdC intergenic region.

  10. Genome-assisted development of nuclear intergenic sequence markers for entomopathogenic fungi of the Metarhizium anisopliae species complex.

    Science.gov (United States)

    Kepler, R M; Rehner, S A

    2013-03-01

    Entomopathogenic fungi in the genus Metarhizium are useful for biological control programmes against economically important arthropod pests worldwide. However, understanding the true diversity and ecology of these organisms is hampered by convergent morphologies between species. The application of molecular techniques has enabled greater resolution of species than allowed by morphology alone. In particular, the commonly used biocontrol agent M. anisopliae was found to be a species complex composed of nine species. This prior work was conducted with commonly used markers in fungal phylogenetics (BTUB, RPB1, RPB2 and TEF), which likely under-represent diversity in the M. anisopliae complex. Using sequence data from nuclear genomes of M. acridum and M. robertsii we identified regions of conserved gene synteny and developed primers to amplify intergenic regions of seven loci. Using ex-type and authenticated tissue specimens for species in the M. anisopliae complex, we demonstrate that sequence data derived from intergenic loci is more variable and phylogenetically informative than previously available markers. These new markers will facilitate investigations at or below the species level for the M. anisopliae complex. The method of marker development employed here should be extendable to any group with sufficiently divergent genome data available.

  11. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  12. Rhizobium vignae sp. nov., a symbiotic bacterium isolated from multiple legume species.

    Science.gov (United States)

    Ren, Da Wei; Chen, Wen Feng; Sui, Xin Hua; Wang, En Tao; Chen, Wen Xin

    2011-03-01

    A group of rhizobial strains isolated from nodules of multiple legume species grown in different geographical regions of China had identical 16S rRNA genes. Phylogenetic analysis based on the 16S rRNA gene sequences showed that the novel strains formed a subclade in the genus Rhizobium together with Rhizobium galegae, Rhizobium huautlense and Rhizobium alkalisoli, with 99.8  % gene sequence similarity between the strains. The DNA-DNA relatedness values between the representative strain CCBAU 05176(T) and R. galegae ATCC 43677(T), R. huautlense S02(T) and R. alkalisoli CCBAU 01393(T) were 22.6  %, 8.9  % and 15.9  %, respectively. The novel strains were distinguished from recognized species of the genus Rhizobium by using a polyphasic approach, including PCR-based restriction fragment length polymorphism analysis (RFLP) of the 16S-23S intergenic spacer (IGS), phenotypic and physiological tests, sequence comparisons of housekeeping genes and cellular fatty acid profiles. Therefore, it is suggested that this group of strains represents a novel species for which the name Rhizobium vignae sp. nov. is proposed. The type strain is CCBAU 05176(T) (=HAMBI 3039(T)=LMG 25447(T)).

  13. Microcosm enrichment of biphenyl-degrading microbial communities from soils and sediments

    Energy Technology Data Exchange (ETDEWEB)

    Wagner-Doebler, I.; Bennasar, A.; Stroempl, C.; Bruemmer, I.; Eichner, C.; Grammel, I.; Moore, E.R.B. [GBF National Research Inst. for Biotechnology, Braunschweig (Germany). Dept. of Microbiology; Vancanneyt, M. [Univ. Gent, Ghent (Belgium). Lab. voor Microbiologie

    1998-08-01

    A microcosm enrichment approach was employed to isolate bacteria which are representative of long-term biphenyl-adapted microbial communities. Growth of microorganisms was stimulated by incubating soil and sediment samples from polluted and nonpolluted sites with biphenyl crystals. After 6 months, stable population densities between 8 {times} 10{sup 9} and 2 {times} 10{sup 11} CFU/ml were established in the microcosms, and a large percentage of the organisms were able to grow on biphenyl-containing minimal medium plates. A total of 177 biphenyl-degrading strains were subsequently isolated and characterized by their ability to grow on biphenyl in liquid culture and to accumulate a yellow meta cleavage product when they were sprayed with dihydroxy-biphenyl. Isolates were identified by using a polyphasic approach, including fatty acid methyl ester (FAME) analysis, 16S rRNA gene sequence comparison, sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, and genomic fingerprinting based on sequence variability in the 16S-23S ribosomal DNA intergenic spacer region. In all of the microcosms, isolates identified as Rhodococcus opacus dominated the cultivable microbial community, comprising a cluster of 137 isolates with very similar FAME profiles (Euclidean distances, <10) and identical 16S rRNA gene sequences.

  14. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    Science.gov (United States)

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history.

  15. Trypanosoma cruzi 5S rRNA arrays define five groups and indicate the geographic origins of an ancestor of the heterozygous hybrids.

    Science.gov (United States)

    Westenberger, Scott J; Sturm, Nancy R; Campbell, David A

    2006-03-01

    Isolates of the etiological agent of Chagas disease, Trypanosoma cruzi, have been subdivided into six subgroups referred to as discrete typing units. The subgroups are related through two distinct hybridisation events: representatives of homozygous discrete typing units I and IIb fused to form discrete typing units IIa and IIc, whose homozygous genotypes have features of both ancestral types; a second fusion between strains of homozygous discrete typing units IIb and IIc created the heterozygous hybrid strains discrete typing units IId and IIe. The intergenic region of the tandemly repeated 5S rRNA array displays four variant sequence classes, allowing the discrimination of five discrete typing units. The genome project reference strain, CL Brener, is a hybrid discrete typing unit IIe strain that contains both discrete typing unit IIb and IIc classes of 5S rRNA repeats in distinct arrays present on different chromosomes. The CL Brener discrete typing unit IIb-type array contains approximately 193 repeated units, of which about one-third contain a 129 bp sequence that replaces a majority of the 5S rRNA sequence. The 129 bp 'invader' sequence was detected within the arrays of all hybrid discrete typing unit IId and IIe strains and in a subset of discrete typing unit IIb strains. This array invader replaces the internal promoter elements conserved in 5S rRNA. The discrete typing unit IIb Esmeraldo strain contains approximately 135 repeats and shows a region of homology to the array invader in the 5' flank of the array, but no evidence of the invading sequence element within the array. A survey of additional discrete typing unit IIb strains revealed a split within the subgroup, in which some strains contained invaded arrays and others were homogeneous for the 5S rRNA. The putative discrete typing unit IIb ancestor of the hybrid discrete typing units IId and IIe more closely resembles the extant Bolivian/Chilean IIb isolates than the Brazilian IIb isolates based on the

  16. Absence of DNA sequence diversity of the intergenic spacer 1 region in Malassezia nana isolates from cats.

    Science.gov (United States)

    de Bellis, Filippo; Castellá, Gemma; Cabañes, F Javier; Bond, Ross

    2010-03-01

    Malassezia nana is a recently-described lipophilic yeast that has been isolated from the ear canals and skin of cats in Japan and Europe and from Brazilian cattle with or without otitis externa. Previous reports have demonstrated that significant intra-species variability exists in the DNA sequence of the intergenic spacer 1 region (IGS1), particularly amongst M. globosa, M. restricta and M. pachydermatis, and that certain IGS genotypes are associated with various epidemiological factors, including host disease status. In the present study, we demonstrated that the IGS1 sequences of 12 UK isolates of M. nana from cats and of six isolates from Spain (5 cat, 1 dog) were identical to each other and to CBS 9557, the M. nana type culture originally obtained from a Japanese cat with otitis externa. Further studies are needed to determine whether other genotypes of M. nana can be identified and associated with geographical regions and the species and disease status of mammalian hosts.

  17. Conservation of the Exon-Intron Structure of Long Intergenic Non-Coding RNA Genes in Eutherian Mammals

    Directory of Open Access Journals (Sweden)

    Diana Chernikova

    2016-07-01

    Full Text Available The abundance of mammalian long intergenic non-coding RNA (lincRNA genes is high, yet their functions remain largely unknown. One possible way to study this important question is to use large-scale comparisons of various characteristics of lincRNA with those of protein-coding genes for which a large body of functional information is available. A prominent feature of mammalian protein-coding genes is the high evolutionary conservation of the exon-intron structure. Comparative analysis of putative intron positions in lincRNA genes from various mammalian genomes suggests that some lincRNA introns have been conserved for over 100 million years, thus the primary and/or secondary structure of these molecules is likely to be functionally important.

  18. Capturing intergenerativity: the use of student reflective journals to identify learning within an undergraduate course in gerontological nursing.

    Science.gov (United States)

    Davies, Susan M; Reitmaier, Amy B; Smith, Linda Reveling; Mangan-Danckwart, Deborah

    2013-03-01

    The benefits of intergenerational contact between older and young adults have been demonstrated; yet, nursing programs have underexplored the potential of such relationships for enhancing student learning. This article presents an analysis of student reflective journals as part of an evaluation of an undergraduate gerontological nursing course. The course aims to create positive learning experiences by involving older adults as partners in student learning. Older adults are recruited to receive visits from a designated student to share aspects of their life and experiences. Students write reflective journals based on these visits as a method of evaluating their learning. A framework analysis of 80 journals completed by 59 students identified four major themes representing the impact of these visits on student learning: becoming aware, making connections, seeing the unique person, and valuing intergenerational relationships. The analysis suggests the relevance of the concept of intergenerativity in illuminating shared benefits of the practicum experience.

  19. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    Science.gov (United States)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  20. Modulation of Re-initiation of Measles Virus Transcription at Intergenic Regions by PXD to NTAIL Binding Strength.

    Science.gov (United States)

    Bloyet, Louis-Marie; Brunel, Joanna; Dosnon, Marion; Hamon, Véronique; Erales, Jenny; Gruet, Antoine; Lazert, Carine; Bignon, Christophe; Roche, Philippe; Longhi, Sonia; Gerlier, Denis

    2016-12-01

    Measles virus (MeV) and all Paramyxoviridae members rely on a complex polymerase machinery to ensure viral transcription and replication. Their polymerase associates the phosphoprotein (P) and the L protein that is endowed with all necessary enzymatic activities. To be processive, the polymerase uses as template a nucleocapsid made of genomic RNA entirely wrapped into a continuous oligomer of the nucleoprotein (N). The polymerase enters the nucleocapsid at the 3'end of the genome where are located the promoters for transcription and replication. Transcription of the six genes occurs sequentially. This implies ending and re-initiating mRNA synthesis at each intergenic region (IGR). We explored here to which extent the binding of the X domain of P (XD) to the C-terminal region of the N protein (NTAIL) is involved in maintaining the P/L complex anchored to the nucleocapsid template during the sequential transcription. Amino acid substitutions introduced in the XD-binding site on NTAIL resulted in a wide range of binding affinities as determined by combining protein complementation assays in E. coli and human cells and isothermal titration calorimetry. Molecular dynamics simulations revealed that XD binding to NTAIL involves a complex network of hydrogen bonds, the disruption of which by two individual amino acid substitutions markedly reduced the binding affinity. Using a newly designed, highly sensitive dual-luciferase reporter minigenome assay, the efficiency of re-initiation through the five measles virus IGRs was found to correlate with NTAIL/XD KD. Correlatively, P transcript accumulation rate and F/N transcript ratios from recombinant viruses expressing N variants were also found to correlate with the NTAIL to XD binding strength. Altogether, our data support a key role for XD binding to NTAIL in maintaining proper anchor of the P/L complex thereby ensuring transcription re-initiation at each intergenic region.

  1. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei.

  2. Enterobacterial repetitive intergenic consensus 1R PCR assay for detection of Raoultella sp. isolates among strains identified as Klebsiella oxytoca in the clinical laboratory.

    Science.gov (United States)

    Granier, Sophie A; Leflon-Guibout, Véronique; Goldstein, Fred W; Nicolas-Chanoine, Marie-Hélène

    2003-04-01

    The enterobacterial repetitive intergenic consensus 1R PCR method, which provided recognizable profiles for reference strains of the three species of Raoultella and the two genetic groups of Klebsiella oxytoca, was applied to 19 clinical isolates identified as K. oxytoca. By this method, as confirmed by species-specific gene sequencing, two Raoultella ornithinolytica and two unclassifiable K. oxytoca isolates were identified.

  3. High prevalence of spotted fever group rickettsiae in Amblyomma variegatum from Uganda and their identification using sizes of intergenic spacers.

    Science.gov (United States)

    Nakao, Ryo; Qiu, Yongjin; Igarashi, Manabu; Magona, Joseph W; Zhou, Lijia; Ito, Kimihito; Sugimoto, Chihiro

    2013-12-01

    The spotted fever group (SFG) rickettsiae are obligate intracellular bacteria transmitted by ticks that cause several tick-borne rickettsioses in humans worldwide. This study was intended to determine the prevalence of SFG rickettsiae in Amblyomma variegatum from 7 districts across Uganda. In addition to sequencing of gltA and ompA genes, identification of Rickettsia species based on the sizes of highly variable intergenic spacers, namely, dksA-xerC, mppA-purC, and rpmE-tRNA(fMet) was carried out. Application of multiplex PCR for simultaneous amplification of 3 spacers combined with capillary electrophoresis separation allowed simple, accurate, and high-throughput fragment sizing with considerable time and cost savings. Rickettsia genus-specific real-time PCR detected 136 positives out of 140 samples, giving an overall prevalence of 97.1%. Most samples (n=113) had a size combination of 225, 195, and 341 bp for dksA-xerC, mppA-purC, and rpmE-tRNA(fMet), respectively, which was identical to that of R. africae, a causative agent of African tick bite fever. In addition, several samples had size variants in either dksA-xerC or rpmE-tRNA(fMet). Nonetheless, the partial sequences of gltA and ompA genes of samples of all size combinations showed the greatest similarity to R. africae (99.3-100% for gltA and 98.1-100% for ompA). Given these results, it is highly possible that the tested ticks were infected with R. africae or closely related species. This is a first report on molecular genetic detection of R. africae and its high endemicity in Uganda. Clinicians in this country should be aware of this pathogen as a cause of non-malarial febrile illness. This study provided a starting point for the development of Rickettsia species identification based on the sizes of intergenic spacers. The procedure is simple, rapid, and cost-effective to perform; hence it might be particularly well suited for preliminary species identification in epidemiological investigations. The results

  4. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  5. Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

    OpenAIRE

    Kernif, Tahar; Aissi, Meriem; DOUMANDJI, Salah-eddine; Chomel, Bruno B; Raoult, Didier; Bitam, Idir

    2010-01-01

    Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae we...

  6. Phylogeny and Virulence of Naturally Occurring Type III Secretion System-Deficient Pectobacterium Strains▿

    OpenAIRE

    Kim, Hye-Sook; Ma, Bing; Perna, Nicole T.; Charkowski, Amy O.

    2009-01-01

    Pectobacterium species are enterobacterial plant-pathogenic bacteria that cause soft rot disease in diverse plant species. Previous epidemiological studies of Pectobacterium species have suffered from an inability to identify most isolates to the species or subspecies level. We used three previously described DNA-based methods, 16S-23S intergenic transcribed spacer PCR-restriction fragment length polymorphism analysis, multilocus sequence analysis (MLSA), and pulsed-field gel electrophoresis,...

  7. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  8. The Xis2d protein of CTnDOT binds to the intergenic region between the mob and tra operons.

    Science.gov (United States)

    Hopp, Crystal M; Gardner, Jeffrey F; Salyers, Abigail A

    2015-09-01

    CTnDOT is a 65kbp integrative and conjugative element (ICE) that carries genes encoding both tetracycline and erythromycin resistances. The excision operon of this element encodes Xis2c, Xis2d, and Exc proteins involved in the excision of CTnDOT from host chromosomes. These proteins are also required in the complex transcriptional regulation of the divergently transcribed transfer (tra) and mobilization (mob) operons of CTnDOT. Transcription of the tra operon is positively regulated by Xis2c and Xis2d, whereas, transcription of the mob operon is positively regulated by Xis2d and Exc. Xis2d is the only protein that is involved in the excision reaction, as well as the transcriptional regulation of both the mob and tra operons. This paper helps establish how Xis2d binds the DNA in the mob and tra region. Unlike other excisionase proteins, Xis2d binds a region of dyad symmetry. The binding site is located in the intergenic region between the mob and tra promoters, and once bound Xis2d induces a bend in the DNA. Xis2d binding to this region could be the preliminary step for the activation of both operons. Then the other proteins, like Exc, can interact with Xis2d and form higher order complexes. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. DNA Hypomethylation in Intragenic and Intergenic Enhancer Chromatin of Muscle-Specific Genes Usually Correlates with their Expression.

    Science.gov (United States)

    Ehrlich, Kenneth C; Paterson, Heather L; Lacey, Michelle; Ehrlich, Melanie

    2016-12-01

    Tissue-specific enhancers are critical for gene regulation. In this study, we help elucidate the contribution of muscle-associated differential DNA methylation to the enhancer activity of highly muscle-specific genes. By bioinformatic analysis of 44 muscle-associated genes, we show that preferential gene expression in skeletal muscle (SkM) correlates with SkM-specific intragenic and intergenic enhancer chromatin and overlapping foci of DNA hypomethylation. Some genes, e.g., CASQ1 and FBXO32, displayed broad regions of both SkM- and heart-specific enhancer chromatin but exhibited focal SkM-specific DNA hypomethylation. Half of the genes had SkM-specific super-enhancers. In contrast to simple enhancer/gene-expression correlations, a super-enhancer was associated with the myogenic MYOD1 gene in both SkM and myoblasts even though SkM has < 1 percent as much MYOD1 expression. Local chromatin differences in this super-enhancer probably contribute to the SkM/myoblast differential expression. Transfection assays confirmed the tissue-specificity of the 0.3-kb core enhancer within MYOD1's super-enhancer and demonstrated its repression by methylation of its three CG dinucleotides. Our study suggests that DNA hypomethylation increases enhancer tissue-specificity and that SkM super-enhancers sometimes are poised for physiologically important, rapid up-regulation.

  10. Pan-Cancer Analyses Reveal Long Intergenic Non-Coding RNAs Relevant to Tumor Diagnosis, Subtyping and Prognosis.

    Science.gov (United States)

    Ching, Travers; Peplowska, Karolina; Huang, Sijia; Zhu, Xun; Shen, Yi; Molnar, Janos; Yu, Herbert; Tiirikainen, Maarit; Fogelgren, Ben; Fan, Rong; Garmire, Lana X

    2016-05-01

    Long intergenic noncoding RNAs (lincRNAs) are a relatively new class of non-coding RNAs that have the potential as cancer biomarkers. To seek a panel of lincRNAs as pan-cancer biomarkers, we have analyzed transcriptomes from over 3300 cancer samples with clinical information. Compared to mRNA, lincRNAs exhibit significantly higher tissue specificities that are then diminished in cancer tissues. Moreover, lincRNA clustering results accurately classify tumor subtypes. Using RNA-Seq data from thousands of paired tumor and adjacent normal samples in The Cancer Genome Atlas (TCGA), we identify six lincRNAs as potential pan-cancer diagnostic biomarkers (PCAN-1 to PCAN-6). These lincRNAs are robustly validated using cancer samples from four independent RNA-Seq data sets, and are verified by qPCR in both primary breast cancers and MCF-7 cell line. Interestingly, the expression levels of these six lincRNAs are also associated with prognosis in various cancers. We further experimentally explored the growth and migration dependence of breast and colon cancer cell lines on two of the identified lncRNAs. In summary, our study highlights the emerging role of lincRNAs as potentially powerful and biologically functional pan-cancer biomarkers and represents a significant leap forward in understanding the biological and clinical functions of lincRNAs in cancers.

  11. A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

    Science.gov (United States)

    Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

    2016-01-01

    We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

  12. Genome-wide identification of long intergenic noncoding RNA genes and their potential association with domestication in pigs.

    Science.gov (United States)

    Zhou, Zhong-Yin; Li, Ai-Min; Adeola, Adeniyi C; Liu, Yan-Hu; Irwin, David M; Xie, Hai-Bing; Zhang, Ya-Ping

    2014-06-02

    Thousands of long intergenic noncoding RNAs (lincRNAs) have been identified in the human and mouse genomes, some of which play important roles in fundamental biological processes. The pig is an important domesticated animal, however, pig lincRNAs remain poorly characterized and it is unknown if they were involved in the domestication of the pig. Here, we used available RNA-seq resources derived from 93 samples and expressed sequence tag data sets, and identified 6,621 lincRNA transcripts from 4,515 gene loci. Among the identified lincRNAs, some lincRNA genes exhibit synteny and sequence conservation, including linc-sscg2561, whose gene neighbor Dnmt3a is associated with emotional behaviors. Both linc-sscg2561 and Dnmt3a show differential expression in the frontal cortex between domesticated pigs and wild boars, suggesting a possible role in pig domestication. This study provides the first comprehensive genome-wide analysis of pig lincRNAs.

  13. An improved PCR method for direct identification of Porphyra (Bangiales, Rhodophyta) using conchocelis based on a RUBISCO intergenic spacer

    Institute of Scientific and Technical Information of China (English)

    WANG Chao; DONG Dong; WANG Guangce; ZHANG Baoyu; PENG Guang; XU Pu; TANG Xiaorong

    2009-01-01

    An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.

  14. Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA).

    Science.gov (United States)

    Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

    2011-08-01

    During collection, maple sap is contaminated by bacteria and fungi that subsequently colonize the tubing system. The bacterial microbiota has been more characterized than the fungal microbiota, but the impact of both components on maple sap quality remains unclear. This study focused on identifying bacterial and fungal members of maple sap and correlating microbiota composition with maple sap properties. A multiplex automated ribosomal intergenic spacer analysis (MARISA) method was developed to presumptively identify bacterial and fungal members of maple sap samples collected from 19 production sites during the tapping period. Results indicate that the fungal community of maple sap is mainly composed of yeast related to Mrakia sp., Mrakiella sp., Guehomyces pullulans, Cryptococcus victoriae and Williopsis saturnus. Mrakia, Mrakiella and Guehomyces peaks were identified in samples of all production sites and can be considered dominant and stable members of the fungal microbiota of maple sap. A multivariate analysis based on MARISA profiles and maple sap chemical composition data showed correlations between Candida sake, Janthinobacterium lividum, Williopsis sp., Leuconostoc mesenteroides, Mrakia sp., Rhodococcus sp., Pseudomonas tolaasii, G. pullulans and maple sap composition at different flow periods. This study provides new insights on the relationship between microbial community and maple sap quality.

  15. Molecular typing among beef isolates of Escherichia coli using consensus repetitive intergenic enterobacteria-polymerase chain reaction (ERIC-PCR)

    Science.gov (United States)

    Zoolkifli, Nurliyana Wan; Mutalib, Sahilah Abd

    2013-11-01

    Genomic DNA of Escherichia coli were characterized by enterobacterial repetitive intergenic consensus-Polymerase chain reaction (ERIC-PCR) and the presence of Shiga toxin gene-I (Stx1) and Shiga toxin gene-2 (Stx2). These isolates were originated from imported raw beef which are come from two countries namely Australia and India. The isolation of E. coli was conducted by using Eosin Methylene Blue Agar (EMBA). A total of 94 strains had been isolated from 30 samples of imported raw beefand 42 strains had been detected positively E. coli by doing biochemical tests. All strains had been tested and the results of biochemical tests showed that 3 strains were from Australia samples while the other 39 strains were from India samples. The biochemical tests used are Indole test, Methyl Red test, Voges-Proskauer test and Citrate test. All the 42 strains were examined for Shiga toxin (stx1 and stx2) gene detection by two pair primers which are stx2F (5'-TTCTTCGGTATCCTATTCCC-3'), stx2R (5'-ATGCATCTCTGGTCATTGTA-3'), stx1F (5'-CAGTTAATGTGGTGGCGAAG-3'), and stx1R (5'-CTGTCACAGTAACAACCGT-3'). The results showed that none of the strains are positive for Shiga toxin gene. Application of ERIC-PCR method towards E. coli had successfully shown the high diversity polymorphism in 21 different genome types of DNA with primers ERIC1R (5'- CACTTAGGGGTCCTCGAATGTA- 3') and ERIC2R (5'- AAGTAAGTGACTGGGGTGACGC- 3').

  16. Characterization of mitochondrial control region, two intergenic spacers and tRNAs of Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    da Silva, Norma Machado; de Souza Dias, Aline; da Silva Valente, Vera Lúcia; Valiati, Victor Hugo

    2009-12-01

    The control region in insects is the major noncoding region in animal mitochondrial DNA (mtDNA), and is responsible for a large part of the variation in the DNA sequence and size of the genome of this organelle. In this study, the mtDNA control region, two intergenic spacers and tRNA genes of a Zaprionus indianus strain were cloned, sequenced and compared with other Drosophila species. The overall A+T content in the Z. indianus control region is 94.3%, and a comparison with other Drosophila species demonstrated that the most conserved region appears to be the 420 base pairs nearest to the tRNA(ile), similar to the findings of other authors. We also describe conserved sequence blocks, including a poly-T involved in the replication process of Drosophila mtDNA; a putative secondary structure also involved in the replication process and repeated sequences. tRNA(ile) sequence demonstrated the greatest variability when the tRNA sequences of species were compared.

  17. The mitochondrial genome of the leaf-cutter ant Atta laevigata: a mitogenome with a large number of intergenic spacers.

    Directory of Open Access Journals (Sweden)

    Cynara de Melo Rodovalho

    Full Text Available In this paper we describe the nearly complete mitochondrial genome of the leaf-cutter ant Atta laevigata, assembled using transcriptomic libraries from Sanger and Illumina next generation sequencing (NGS, and PCR products. This mitogenome was found to be very large (18,729 bp, given the presence of 30 non-coding intergenic spacers (IGS spanning 3,808 bp. A portion of the putative control region remained unsequenced. The gene content and organization correspond to that inferred for the ancestral pancrustacea, except for two tRNA gene rearrangements that have been described previously in other ants. The IGS were highly variable in length and dispersed through the mitogenome. This pattern was also found for the other hymenopterans in particular for the monophyletic Apocrita. These spacers with unknown function may be valuable for characterizing genome evolution and distinguishing closely related species and individuals. NGS provided better coverage than Sanger sequencing, especially for tRNA and ribosomal subunit genes, thus facilitating efforts to fill in sequence gaps. The results obtained showed that data from transcriptomic libraries contain valuable information for assembling mitogenomes. The present data also provide a source of molecular markers that will be very important for improving our understanding of genomic evolutionary processes and phylogenetic relationships among hymenopterans.

  18. Effectiveness of enterobacterial repetitive intergenic consensus PCR and random amplified polymorphic DNA fingerprinting for Helicobacter pylori strain differentiation.

    Science.gov (United States)

    Finger, S Alison; Velapatiño, Billie; Kosek, Margaret; Santivañez, Livia; Dailidiene, Daiva; Quino, Willi; Balqui, Jacqueline; Herrera, Phabiola; Berg, Douglas E; Gilman, Robert H

    2006-07-01

    We compared the robustness and discriminatory power of the enterobacterial repetitive intergenic consensus (ERIC) and random amplified polymorphic DNA (RAPD) fingerprinting methods for detecting cases of mixed Helicobacter pylori infection in Peruvian shantytown residents. H. pylori isolates from 63 participants were cultured, and five single colonies and a pool of additional colonies from each participant were analyzed by ERIC-PCR and by RAPD tests with four 10-nucleotide primers (one primer per reaction). There was 94% agreement between the ERIC and RAPD profiles in classifying sets of isolates as uniform versus closely related but not identical versus probably unrelated, indicating a high kappa statistic of 0.8942. Subtle differences in related ERIC or RAPD patterns likely reflect gene transfer between strains, recombination, and/or mutation, whereas markedly different patterns reflect infection by unrelated strains. At least half of infected shantytown residents seemed to carry more than one H. pylori strain, although in 19 of 31 persons, the strains were closely related. Three RAPD tests, each with a different primer, were needed to achieve the sensitivity of one ERIC test. ERIC-PCR constitutes a resource- and time-efficient method for H. pylori strain differentiation.

  19. Expressing activity of promoter elements of large intergenic region from cotton leaf curl virus in host plant*

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Cotton leaf curl virus (CLCuV) is a type of single-stranded DNAvirus, belonging to geminivirus of subgroup III. In order to determine the function of CLCuV large intergenic region (LIR), total DNA of CLCuV-infected cotton leaves was used as template, and fragment of LIR was obtained by PCR and inserted into clone vector. The fragment of LIR was fused with gus reporter gene and nos terminator in the orientation of transcription of virion sense and complementary sense respectively, and the plant expression vectors were constructed. GUS activity of Agrobacterium-mediated transgenic tobacco was measured. The result indicated that LIR showed strong promoter activity in complementary sense gene orientation. Average GUS activity of the complementary sense promoter was 5-6 times that of CaMV 35S promoter, and the highest GUS activity of individual plant was ten times of that of CaMV 35S promoter. Histochemical localization confirmed its activity in both mesophyll and vascular tissues. Activity of virion sense of LIR was rather low. Thus LIR isolated from CLCuV could be used as a novel strong promoter in plant genetic manipulation.

  20. An attenuated Machupo virus with a disrupted L-segment intergenic region protects guinea pigs against lethal Guanarito virus infection.

    Science.gov (United States)

    Golden, Joseph W; Beitzel, Brett; Ladner, Jason T; Mucker, Eric M; Kwilas, Steven A; Palacios, Gustavo; Hooper, Jay W

    2017-07-05

    Machupo virus (MACV) is a New World (NW) arenavirus and causative agent of Bolivian hemorrhagic fever (HF). Here, we identified a variant of MACV strain Carvallo termed Car(91) that was attenuated in guinea pigs. Infection of guinea pigs with an earlier passage of Carvallo, termed Car(68), resulted in a lethal disease with a 63% mortality rate. Sequencing analysis revealed that compared to Car(68), Car(91) had a 35 nucleotide (nt) deletion and a point mutation within the L-segment intergenic region (IGR), and three silent changes in the polymerase gene that did not impact amino acid coding. No changes were found on the S-segment. Because it was apathogenic, we determined if Car(91) could protect guinea pigs against Guanarito virus (GTOV), a distantly related NW arenavirus. While naïve animals succumbed to GTOV infection, 88% of the Car(91)-exposed guinea pigs were protected. These findings indicate that attenuated MACV vaccines can provide heterologous protection against NW arenaviruses. The disruption in the L-segment IGR, including a single point mutant and 35 nt partial deletion, were the only major variance detected between virulent and avirulent isolates, implicating its role in attenuation. Overall, our data support the development of live-attenuated arenaviruses as broadly protective pan-arenavirus vaccines.

  1. Transcriptome analysis reveals long intergenic non-coding RNAs involved in skeletal muscle growth and development in pig.

    Science.gov (United States)

    Zou, Cheng; Li, Jingxuan; Luo, Wenzhe; Li, Long; Hu, An; Fu, Yuhua; Hou, Ye; Li, Changchun

    2017-08-18

    Long intergenic non-coding RNAs (lincRNAs) play essential roles in numerous biological processes and are widely studied. The skeletal muscle is an important tissue that plays an essential role in individual movement ability. However, lincRNAs in pig skeletal muscles are largely undiscovered and their biological functions remain elusive. In this study, we assembled transcriptomes using RNA-seq data published in previous studies of our laboratory group and identified 323 lincRNAs in porcine leg muscle. We found that these lincRNAs have shorter transcript length, fewer exons and lower expression level than protein-coding genes. Gene ontology and pathway analyses indicated that many potential target genes (PTGs) of lincRNAs were involved in skeletal-muscle-related processes, such as muscle contraction and muscle system process. Combined our previous studies, we found a potential regulatory mechanism in which the promoter methylation of lincRNAs can negatively regulate lincRNA expression and then positively regulate PTG expression, which can finally result in abnormal phenotypes of cloned piglets through a certain unknown pathway. This work detailed a number of lincRNAs and their target genes involved in skeletal muscle growth and development and can facilitate future studies on their roles in skeletal muscle growth and development.

  2. Bartonella melophagi in Melophagus ovinus (sheep ked) collected from sheep in northern Oromia, Ethiopia.

    Science.gov (United States)

    Kumsa, Bersissa; Parola, Philippe; Raoult, Didier; Socolovschi, Cristina

    2014-01-01

    Melophagus ovinus (sheep ked) is one of the most common ectoparasites that contributes to enormous economic losses in the productivity of sheep in many countries. The present study was conducted from January 2012 to July 2013 on M. ovinus collected from sheep at three sites in Ethiopia. Of the sheep studied, 65.7% (88/134) were infested with M. ovinus. The prevalence of M. ovinus was 76% (76/100), 47% (8/17) and 23.5% (4/17) at the Kimbibit, Chacha and Shano sites, respectively. An overall number of 229 M. ovinus specimens (138 females, 86 males and five pupae) and 554 M. ovinus specimens (272 females, 282 males) were collected from young and adult sheep, respectively. Bartonella DNA was detected in 89% (694/783) of M. ovinus using a quantitative Bartonella genus-specific PCR assay targeting the 16S/23S rRNA intergenic spacer region. The sequencing of the PCR products of fragments of the gltA and rpoB genes showed 99.6-100% and 100% homology, respectively, with B. melophagi. Statistically significant variation was not noted in the overall prevalence of Bartonella DNA between female and male M. ovinus. All of the sheep infested with M. ovinus 100% (88/88) harbored at least one M. ovinus specimen that contained Bartonella DNA. This study highlights that B. melophagi in M. ovinus from sheep in highlands in Ethiopia possibly has certain zoonotic importance.

  3. Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia.

    Science.gov (United States)

    Su, Y-L; Feng, J; Li, Y-W; Bai, J-S; Li, A-X

    2016-02-01

    Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 μL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days post-injection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish.

  4. The analysis of core and symbiotic genes of rhizobia nodulating Vicia from different continents reveals their common phylogenetic origin and suggests the distribution of Rhizobium leguminosarum strains together with Vicia seeds.

    Science.gov (United States)

    Alvarez-Martínez, Estela R; Valverde, Angel; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Tejedor, Carmen; Mateos, Pedro F; Santillana, Nery; Zúñiga, Doris; Peix, Alvaro; Velázquez, Encarna

    2009-08-01

    In this work, we analysed the core and symbiotic genes of rhizobial strains isolated from Vicia sativa in three soils from the Northwest of Spain, and compared them with other Vicia endosymbionts isolated in other geographical locations. The analysis of rrs, recA and atpD genes and 16S-23S rRNA intergenic spacer showed that the Spanish strains nodulating V. sativa are phylogenetically close to those isolated from V. sativa and V. faba in different European, American and Asian countries forming a group related to Rhizobium leguminosarum. The analysis of the nodC gene of strains nodulating V. sativa and V. faba in different continents showed they belong to a phylogenetically compact group indicating that these legumes are restrictive hosts. The results of the nodC gene analysis allow the delineation of the biovar viciae showing a common phylogenetic origin of V. sativa and V. faba endosymbionts in several continents. Since these two legume species are indigenous from Europe, our results suggest a world distribution of strains from R. leguminosarum together with the V. sativa and V. faba seeds and a close coevolution among chromosome, symbiotic genes and legume host in this Rhizobium-Vicia symbiosis.

  5. Diversity and antimicrobial properties of lactic acid bacteria isolated from rhizosphere of olive trees and desert truffles of Tunisia.

    Science.gov (United States)

    Fhoula, Imene; Najjari, Afef; Turki, Yousra; Jaballah, Sana; Boudabous, Abdelatif; Ouzari, Hadda

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota.

  6. Bacterial functional redundancy along a soil reclamation gradient.

    Science.gov (United States)

    Yin, B; Crowley, D; Sparovek, G; De Melo, W J; Borneman, J

    2000-10-01

    A strategy to measure bacterial functional redundancy was developed and tested with soils collected along a soil reclamation gradient by determining the richness and diversity of bacterial groups capable of in situ growth on selected carbon substrates. Soil cores were collected from four sites along a transect from the Jamari tin mine site in the Jamari National Forest, Rondonia, RO, Brazil: denuded mine spoil, soil from below the canopy of invading pioneer trees, revegetated soil under new growth on the forest edge, and the forest floor of an adjacent preserved forest. Bacterial population responses were analyzed by amending these soil samples with individual carbon substrates in the presence of bromodeoxyuridine (BrdU). BrdU-labeled DNA was then subjected to a 16S-23S rRNA intergenic analysis to depict the actively growing bacteria from each site. The number and diversity of bacterial groups responding to four carbon substrates (L-serine, L-threonine, sodium citrate, and alpha-lactose hydrate) increased along the reclamation-vegetation gradient such that the preserved forest soil samples contained the highest functional redundancy for each substrate. These data suggest that bacterial functional redundancy increases in relation to the regrowth of plant communities and may therefore represent an important aspect of the restoration of soil biological functionality to reclaimed mine spoils. They also suggest that bacterial functional redundancy may be a useful indicator of soil quality and ecosystem functioning.

  7. Genotypic and symbiotic diversity of Rhizobium populations associated with cultivated lentil and pea in sub-humid and semi-arid regions of Eastern Algeria.

    Science.gov (United States)

    Riah, Nassira; Béna, Gilles; Djekoun, Abdelhamid; Heulin, Karine; de Lajudie, Philippe; Laguerre, Gisèle

    2014-07-01

    The genetic structure of rhizobia nodulating pea and lentil in Algeria, Northern Africa was determined. A total of 237 isolates were obtained from root nodules collected on lentil (Lens culinaris), proteaginous and forage pea (Pisum sativum) growing in two eco-climatic zones, sub-humid and semi-arid, in Eastern Algeria. They were characterised by PCR-restriction fragment length polymorphism (RFLP) of the 16S-23S rRNA intergenic region (IGS), and the nodD-F symbiotic region. The combination of these haplotypes allowed the isolates to be clustered into 26 distinct genotypes, and all isolates were classified as Rhizobium leguminosarum. Symbiotic marker variation (nodD-F) was low but with the predominance of one nod haplotype (g), which had been recovered previously at a high frequency in Europe. Sequence analysis of the IGS further confirmed its high variability in the studied strains. An AMOVA analysis showed highly significant differentiation in the IGS haplotype distribution between populations from both eco-climatic zones. This differentiation was reflected by differences in dominant genotype frequencies. Conversely, no host plant effect was detected. The nodD gene sequence-based phylogeny suggested that symbiotic gene diversity in pea and lentil nodulating rhizobial populations in Algeria was low compared to that reported elsewhere in the world.

  8. Diversity and Antimicrobial Properties of Lactic Acid Bacteria Isolated from Rhizosphere of Olive Trees and Desert Truffles of Tunisia

    Directory of Open Access Journals (Sweden)

    Imene Fhoula

    2013-01-01

    Full Text Available A total of 119 lactic acid bacteria (LAB were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota.

  9. Detection of Campylobacter jejuni in rectal swab samples from Rousettus amplexicaudatus in the Philippines.

    Science.gov (United States)

    Hatta, Yuki; Omatsu, Tsutomu; Tsuchiaka, Shinobu; Katayama, Yukie; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Une, Yumi; Yoshikawa, Yasuhiro; Maeda, Ken; Kyuwa, Shigeru; Mizutani, Tetsuya

    2016-09-01

    Bats are the second diversity species of mammals and widely distributed in the world. They are thought to be reservoir and vectors of zoonotic pathogens. However, there is scarce report of the evidence of pathogenic bacteria kept in bats. The precise knowledge of the pathogenic bacteria in bat microbiota is important for zoonosis control. Thus, metagenomic analysis targeting the V3-V4 region of the 16S rRNA of the rectal microbiota in Rousettus amplexicaudatus was performed using high throughput sequencing. The results revealed that 103 genera of bacteria including Camplyobacter were detected. Campylobacter was second predominant genus, and Campylobacter coli and Campylobacter jejuni were identified in microbiome of R. amplexicaudatus. Campylobacteriosis is one of the serious bacterial diarrhea in human, and the most often implicated species as the causative agent of campylobacteriosis is C. jejuni. Therefore, we investigated the prevalence of C. jejuni in 91 wild bats with PCR. As a result of PCR assay targeted on 16S-23S intergenic spacer, partial genome of C. jejuni was detected only in five R. amplexicaudatus. This is the first report that C. jejuni was detected in bat rectal swab samples. C. jejuni is the most common cause of campylobacteriosis in humans, transmitted through water and contact with livestock animals. This result indicated that R. amplexicaudatus may be a carrier of C. jejuni.

  10. A pmp genes-based PCR as a valuable tool for the diagnosis of avian chlamydiosis.

    Science.gov (United States)

    Laroucau, Karine; Trichereau, Alain; Vorimore, Fabien; Mahé, Anne-Marie

    2007-03-31

    In a previous study we described the use of a new set of PCR primers (CpsiA/CpsiB) specific of the conserved pmp-family genes of Chlamydophila abortus as an efficient tool for the detection of these bacteria in ruminants including also preliminary results on avian strains. In this work, the use of this set of primers was extended to representative strains of the six major avian serovars (serovars A-F) and to field isolates of C. psittaci. For all the studied representative strains, using purified genomic DNA as a template, CpsiA/CpsiB primers allowed, as observed for C. abortus, a minimal 10-fold PCR signal increase compared to the one observed with ompA specific primers. In comparison to primers targeting the 16S-23S rRNA intergenic spacer, similar or increased sensitivity was observed depending on the strain. All the field isolates were amplified with CpsiA/CpsiB primers. On clinical samples, our primers are the best among those tested for detection of C. psittaci by simple conventional PCR. RFLP experiments performed using PCR fragments amplified with the CpsiA/CpsiB primers gave promising results demonstrating that these primers may provide an interesting tool for molecular typing when the bacterium cannot be grown from pathological samples.

  11. Phylogeny and virulence of naturally occurring type III secretion system-deficient Pectobacterium strains.

    Science.gov (United States)

    Kim, Hye-Sook; Ma, Bing; Perna, Nicole T; Charkowski, Amy O

    2009-07-01

    Pectobacterium species are enterobacterial plant-pathogenic bacteria that cause soft rot disease in diverse plant species. Previous epidemiological studies of Pectobacterium species have suffered from an inability to identify most isolates to the species or subspecies level. We used three previously described DNA-based methods, 16S-23S intergenic transcribed spacer PCR-restriction fragment length polymorphism analysis, multilocus sequence analysis (MLSA), and pulsed-field gel electrophoresis, to examine isolates from diseased stems and tubers and found that MLSA provided the most reliable classification of isolates. We found that strains belonging to at least two Pectobacterium clades were present in each field examined, although representatives of only three of five Pectobacterium clades were isolated. Hypersensitive response and DNA hybridization assays revealed that strains of both Pectobacterium carotovorum and Pectobacterium wasabiae lack a type III secretion system (T3SS). Two of the T3SS-deficient strains assayed lack genes adjacent to the T3SS gene cluster, suggesting that multiple deletions occurred in Pectobacterium strains in this locus, and all strains appear to have only six rRNA operons instead of the seven operons typically found in Pectobacterium strains. The virulence of most of the T3SS-deficient strains was similar to that of T3SS-encoding strains in stems and tubers.

  12. Phylogeny and Virulence of Naturally Occurring Type III Secretion System-Deficient Pectobacterium Strains▿

    Science.gov (United States)

    Kim, Hye-Sook; Ma, Bing; Perna, Nicole T.; Charkowski, Amy O.

    2009-01-01

    Pectobacterium species are enterobacterial plant-pathogenic bacteria that cause soft rot disease in diverse plant species. Previous epidemiological studies of Pectobacterium species have suffered from an inability to identify most isolates to the species or subspecies level. We used three previously described DNA-based methods, 16S-23S intergenic transcribed spacer PCR-restriction fragment length polymorphism analysis, multilocus sequence analysis (MLSA), and pulsed-field gel electrophoresis, to examine isolates from diseased stems and tubers and found that MLSA provided the most reliable classification of isolates. We found that strains belonging to at least two Pectobacterium clades were present in each field examined, although representatives of only three of five Pectobacterium clades were isolated. Hypersensitive response and DNA hybridization assays revealed that strains of both Pectobacterium carotovorum and Pectobacterium wasabiae lack a type III secretion system (T3SS). Two of the T3SS-deficient strains assayed lack genes adjacent to the T3SS gene cluster, suggesting that multiple deletions occurred in Pectobacterium strains in this locus, and all strains appear to have only six rRNA operons instead of the seven operons typically found in Pectobacterium strains. The virulence of most of the T3SS-deficient strains was similar to that of T3SS-encoding strains in stems and tubers. PMID:19411432

  13. Molecular identification of Lactobacillus spp. associated with puba, a Brazilian fermented cassava food.

    Science.gov (United States)

    Crispim, S M; Nascimento, A M A; Costa, P S; Moreira, J L S; Nunes, A C; Nicoli, J R; Lima, F L; Mota, V T; Nardi, R M D

    2013-01-01

    Puba or carimã is a Brazilian staple food obtained by spontaneous submerged fermentation of cassava roots. A total of 116 lactobacilli and three cocci isolates from 20 commercial puba samples were recovered on de Man, Rogosa and Sharpe agar (MRS); they were characterized for their antagonistic activity against foodborne pathogens and identified taxonomically by classical and molecular methods. In all samples, lactic acid bacteria were recovered as the dominant microbiota (7.86 ± 0.41 log10 CFU/g). 16S-23S rRNA ARDRA pattern assigned 116 isolates to the Lactobacillus genus, represented by the species Lactobacillus fermentum (59 isolates), Lactobacillus delbrueckii (18 isolates), Lactobacillus casei (9 isolates), Lactobacillus reuteri (6 isolates), Lactobacillus brevis (3 isolates), Lactobacillus gasseri (2 isolates), Lactobacillus nagelii (1 isolate), and Lactobacillus plantarum group (18 isolates). recA gene-multiplex PCR analysis revealed that L. plantarum group isolates belonged to Lactobacillus plantarum (15 isolates) and Lactobacillus paraplantarum (3 isolates). Genomic diversity was investigated by molecular typing with rep (repetitive sequence)-based PCR using the primer ERIC2 (enterobacterial repetitive intergenic consensus). The Lactobacillus isolates exhibited genetic heterogeneity and species-specific fingerprint patterns. All the isolates showed antagonistic activity against the foodborne pathogenic bacteria tested. This antibacterial effect was attributed to acid production, except in the cases of three isolates that apparently produced bacteriocin-like inhibitory substances. This study provides the first insight into the genetic diversity of Lactobacillus spp. of puba.

  14. Molecular identification of Lactobacillus spp. associated with puba, a Brazilian fermented cassava food

    Directory of Open Access Journals (Sweden)

    S.M. Crispim

    2013-01-01

    Full Text Available Puba or carimã is a Brazilian staple food obtained by spontaneous submerged fermentation of cassava roots. A total of 116 lactobacilli and three cocci isolates from 20 commercial puba samples were recovered on de Man, Rogosa and Sharpe agar (MRS; they were characterized for their antagonistic activity against foodborne pathogens and identified taxonomically by classical and molecular methods. In all samples, lactic acid bacteria were recovered as the dominant microbiota (7.86 ± 0.41 log10 CFU/g. 16S-23S rRNA ARDRA pattern assigned 116 isolates to the Lactobacillus genus, represented by the species Lactobacillus fermentum (59 isolates, Lactobacillus delbrueckii (18 isolates, Lactobacillus casei (9 isolates, Lactobacillus reuteri (6 isolates, Lactobacillus brevis (3 isolates, Lactobacillus gasseri (2 isolates, Lactobacillus nagelii (1 isolate, and Lactobacillus plantarum group (18 isolates. recA gene-multiplex PCR analysis revealed that L. plantarum group isolates belonged to Lactobacillus plantarum (15 isolates and Lactobacillus paraplantarum (3 isolates. Genomic diversity was investigated by molecular typing with rep (repetitive sequence-based PCR using the primer ERIC2 (enterobacterial repetitive intergenic consensus. The Lactobacillus isolates exhibited genetic heterogeneity and species-specific fingerprint patterns. All the isolates showed antagonistic activity against the foodborne pathogenic bacteria tested. This antibacterial effect was attributed to acid production, except in the cases of three isolates that apparently produced bacteriocin-like inhibitory substances. This study provides the first insight into the genetic diversity of Lactobacillus spp. of puba.

  15. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay.

    Science.gov (United States)

    Chen, Te-Li; Lee, Yi-Tzu; Kuo, Shu-Chen; Yang, Su-Pen; Fung, Chang-Phone; Lee, Shou-Dong

    2014-09-01

    Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii are clinically relevant members of the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and important nosocomial pathogens. These three species are genetically closely related and phenotypically similar; however, they differ in their epidemiology, antibiotic resistance and pathogenicity. In this study, we investigated the use of a multiplex PCR-based assay designed to detect internal fragments of the 16S-23S rRNA intergenic region and the gyrB and recA genes. The assay was capable of differentiating A. baumannii, A. nosocomialis and A. pittii in a reliable manner. In 23 different reference strains and 89 clinical isolates of Acinetobacter species, the assay accurately identified clinically relevant Acb complex species except those 'between 1 and 3' or 'close to 13TU'. None of the non-Acb complex species was misidentified. In an analysis of 1034 positive blood cultures, the assay had a sensitivity of 92.4 % and specificity of 98.2 % for Acb complex identification. Our results show that a single multiplex PCR assay can reliably differentiate clinically relevant Acb complex species. Thus, this method may be used to better understand the clinical differences between infections caused by these species.

  16. Detection of Bartonella henselae and Bartonella clarridgeiae DNA in hepatic specimens from two dogs with hepatic disease.

    Science.gov (United States)

    Gillespie, Tracey N; Washabau, Robert J; Goldschmidt, Michael H; Cullen, John M; Rogala, Allison R; Breitschwerdt, Edward B

    2003-01-01

    A 4-year-old Basset Hound and a 6-year-old Doberman Pinscher were referred for diagnostic evaluation following documentation of persistently increased hepatic enzyme activities and hepatic dysfunction. Histologic evaluation of hepatic biopsy specimens from the 2 dogs revealed granulomatous hepatitis in the Basset Hound and lymphocytic hepatitis with fibrosis and copper accumulation in the Doberman Pinscher. No etiologic agents were identified histologically. Bartonella henselae DNA was subsequently amplified from hepatic tissue from the Basset Hound and Bartonella clarridgeiae was amplified from hepatic tissue from the Doberman Pinscher. Amplification was performed with a polymerase chain reaction assay incorporating primers that target a portion of the 16S-23S rRNA intergenic spacer region. Both dogs were treated with azithromycin, in combination with a variety of other medications and herbal treatments, and improved clinically. Identification of Bartonella DNA in these dogs indicates the need for future prospective studies to determine the clinical relevance of Bartonella spp infection in dogs with hepatic disease.

  17. Prevalence of Bartonella species infections in cats in Southern Germany.

    Science.gov (United States)

    Bergmann, M; Englert, T; Stuetzer, B; Hawley, J R; Lappin, M R; Hartmann, K

    2017-04-01

    Bartonella species are zoonotic pathogens, and infections in cats are common. However, prevalence in cats in Southern Germany is still unknown. Therefore, prevalence of Bartonella species DNA in blood of 479 Southern German cats was determined using a previously published conventional PCR targeting a fragment of the 16S-23S rRNA intergenic spacer region. Associations between Bartonella bacteraemia, housing conditions, feline immunodeficiency virus (FIV) and feline leukaemia virus (FeLV) status, including progressive, regressive and abortive FeLV infection, were evaluated using Fisher's exact test. Prevalence of Bartonella species bacteraemia was 2.5 per cent (12/479; CI 0.01-0.04 per cent). Bartonella henselae DNA was amplified in 11 of the 12 cats. One cat was positive for Bartonella clarridgeiae DNA. Of the infected cats, 2/12 cats were ill; 6/12 cats had thrombocytopenia. There was a significantly higher risk of Bartonella species infection in young and shelter cats, but not in FIV-infected or FeLV-infected cats. Prevalence of Bartonella species bacteraemia is low in Southern German cats, but there is still a risk of zoonotic transmission associated with ownership of young cats. Most of the infected cats did not show clinical signs. Thrombocytopenia was common in Bartonella species-infected cats and further studies are required to define its clinical relevance. British Veterinary Association.

  18. Lactobacillus bobalius sp. nov., a lactic acid bacterium isolated from Spanish Bobal grape must.

    Science.gov (United States)

    Mañes-Lázaro, Rosario; Ferrer, Sergi; Rodas, Ana María; Urdiain, Mercedes; Pardo, Isabel

    2008-12-01

    A Lactobacillus strain, designated 203(T), previously isolated from Bobal grape must was characterized phylogenetically, genotypically and phenotypically in order to establish whether it represents a novel species. On the basis of the 16S rRNA gene sequence, strain 203(T) was shown to belong to the genus Lactobacillus, falling within the Lactobacillus alimentarius-Lactobacillus farciminis group and being closely related to the type strains of L. alimentarius, Lactobacillus kimchii and Lactobacillus paralimentarius. DNA-DNA hybridization results confirmed the separate status of strain 203(T) at the species level. To establish the similarities and differences between 203(T) and the three aforementioned closest species, the following methods were used: amplified rDNA restriction analysis, analysis of the 16S-23S rDNA intergenic spacer region, random amplification of polymorphic DNA (RAPD) profiling, ribotyping, carbohydrate fermentation and physiological tests. Strain 203(T) could be differentiated genetically using RAPD analysis and ribotyping. Phenotypically, it can be distinguished from its closest relatives by its ability to grow at pH 3.3, by gas production from gluconate and by certain carbohydrate fermentations. On the basis of these data, strain 203(T) represents a novel species of the genus Lactobacillus, for which the name Lactobacillus bobalius sp. nov. is proposed. The type strain is 203(T) (=CECT 7310(T) =DSM 19674(T)).

  19. Optimization and head-to-head comparison of MISSR-PCR, ERIC-PCR, RAPD and 16S rRNA evolutionary clock for the genotyping of Vibrio cholerae isolated in China.

    Science.gov (United States)

    Mo, Q H; Wang, H B; Tan, H; An, S L; Feng, Z L; Wang, Q; Lin, J C; Yang, Z

    2015-01-01

    To establish a new genotyping method for Vibrio cholerae and compare it with other methods. In the current study, a modified inter simple sequence repeat-polymerase chain reaction (MISSR-PCR) system was developed via several rounds of optimisation. Comparison study was then conducted between MISSR-PCR and three other methods, including enterobacterial repetitive intergenic consensus sequences-based PCR (ERIC-PCR), randomly amplified polymorphic DNA (RAPD) and 16S rRNA evolutionary clock, for the detection and genetic tracing of Vibrio cholerae isolated from seafood in China. The results indicated that the MISSR-PCR system could generate the highest polymorphic fingerprinting map in a single round PCR and showed the best discriminatory ability for Vibrio cholerae genotyping by clearly separating toxigenic/nontoxigenic strains, local/foreign strains, and O1/O139/non-O1/non-O139 serogroup strains, comparing to ERIC-PCR, RAPD and 16S rRNA evolutionary clock. Moreover, the MISSR-PCR is superior to previously described traditional simple sequence repeat based PCR method on genotyping by more clearly separating different clusters. To the best of our knowledge, this is the first head-to-head comparison of four detection and genotyping methods for Vibrio cholerae The MISSR-PCR system established here could serve as a simple, quick, reliable and cost-effective tool for the genotyping and epidemiological study.

  20. Optimization and head-to-head comparison of MISSR-PCR, ERIC-PCR, RAPD and 16S rRNA evolutionary clock for the genotyping of Vibrio cholerae isolated in China

    Directory of Open Access Journals (Sweden)

    Q H Mo

    2015-01-01

    Full Text Available Purpose: To establish a new genotyping method for Vibrio cholerae and compare it with other methods. Materials and Methods: In the current study, a modified inter simple sequence repeat-polymerase chain reaction (MISSR-PCR system was developed via several rounds of optimisation. Comparison study was then conducted between MISSR-PCR and three other methods, including enterobacterial repetitive intergenic consensus sequences-based PCR (ERIC-PCR, randomly amplified polymorphic DNA (RAPD and 16S rRNA evolutionary clock, for the detection and genetic tracing of Vibrio cholerae isolated from seafood in China. Result: The results indicated that the MISSR-PCR system could generate the highest polymorphic fingerprinting map in a single round PCR and showed the best discriminatory ability for Vibrio cholerae genotyping by clearly separating toxigenic/nontoxigenic strains, local/foreign strains, and O1/O139/non-O1/non-O139 serogroup strains, comparing to ERIC-PCR, RAPD and 16S rRNA evolutionary clock. Moreover, the MISSR-PCR is superior to previously described traditional simple sequence repeat based PCR method on genotyping by more clearly separating different clusters. Conclusion: To the best of our knowledge, this is the first head-to-head comparison of four detection and genotyping methods for Vibrio cholerae The MISSR-PCR system established here could serve as a simple, quick, reliable and cost-effective tool for the genotyping and epidemiological study.

  1. Evidence of uneven selective pressure on different subsets of the conserved human genome; implications for the significance of intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    MacKenzie Alasdair

    2009-12-01

    Full Text Available Abstract Background Human genetic variation produces the wide range of phenotypic differences that make us individual. However, little is known about the distribution of variation in the most conserved functional regions of the human genome. We examined whether different subsets of the conserved human genome have been subjected to similar levels of selective constraint within the human population. We used set theory and high performance computing to carry out an analysis of the density of Single Nucleotide Polymorphisms (SNPs within the evolutionary conserved human genome, at three different selective stringencies, intersected with exonic, intronic and intergenic coordinates. Results We demonstrate that SNP density across the genome is significantly reduced in conserved human sequences. Unexpectedly, we further demonstrate that, despite being conserved to the same degree, SNP density differs significantly between conserved subsets. Thus, both the conserved exonic and intronic genomes contain a significantly reduced density of SNPs compared to the conserved intergenic component. Furthermore the intronic and exonic subsets contain almost identical densities of SNPs indicating that they have been constrained to the same degree. Conclusion Our findings suggest the presence of a selective linkage between the exonic and intronic subsets and ascribes increased significance to the role of introns in human health. In addition, the identification of increased plasticity within the conserved intergenic subset suggests an important role for this subset in the adaptation and diversification of the human population.

  2. Inferring a role for methylation of intergenic DNA in the regulation of genes aberrantly expressed in precursor B-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Almamun, Md; Kholod, Olha; Stuckel, Alexei J; Levinson, Benjamin T; Johnson, Nathan T; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2017-01-17

    A complete understanding of the mechanisms involved in the development of pre-B ALL is lacking. In this study, we integrated DNA methylation data and gene expression data to elucidate the impact of aberrant intergenic DNA methylation on gene expression in pre-B ALL. We found a subset of differentially methylated intergenic loci that were associated with altered gene expression in pre-B ALL patients. Notably, 84% of these regions were also bound by transcription factors (TF) known to play roles in differentiation and B-cell development in a lymphoblastoid cell line. Further, an overall downregulation of eRNA transcripts was observed in pre-B ALL patients and these transcripts were associated with the downregulation of putative target genes involved in B-cell migration, proliferation, and apoptosis. The identification of novel putative regulatory regions highlights the significance of intergenic DNA sequences and may contribute to the identification of new therapeutic targets for the treatment of pre-B ALL.

  3. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... to the presence of filamentous microorganisms was monitored weekly over 4 months. Microthrix was identified as a causative filament and suitable control measures were introduced. The level of Microthrix was reduced after 1-2 months but a number of other filamentous species were still present, with most of them...

  4. Increased expression of long intergenic non-coding RNA LINC00152 in gastric cancer and its clinical significance.

    Science.gov (United States)

    Pang, Qianqian; Ge, Jiaxin; Shao, Yongfu; Sun, Weiliang; Song, Haojun; Xia, Tian; Xiao, Bingxiu; Guo, Junming

    2014-06-01

    It has been known that differential expression of long non-coding RNA (lncRNA) plays critical roles in carcinogenesis. However, the significance of lncRNA, especially long intergenic ncRNA (lincRNA, the main type of lncRNA family), in the diagnosis of gastric cancer is largely unknown. The aim of this study was to determine the expression level of LINC00152, a newfound lincRNA, in gastric carcinoma and its clinical association. The expression of LINC00152 in 71 pairs of tumorous and adjacent normal tissues from patients with gastric cancer was detected by quantitative real-time reverse transcription-polymerase chain reaction. And then, the potential associations between its level in gastric cancer tissue and the clinicopathological features were analyzed. Finally, a receiver operating characteristic (ROC) curve was constructed for differentiating patients with gastric cancer from patients with benign gastric diseases. The results showed that the expression level of LINC00152 in gastric carcinoma was significantly increased, compared with matched normal tissue (P=0.045) and normal mucosa from health control (P=0.004), respectively. Levels of LINC00152 in gastric cancer cell lines, BGC-823, MGC-803, and SGC-7901, were significantly higher than those in human normal gastric epithelial cell line GES-1. In addition, high expression of LINC00152 was correlated with invasion (P=0.042). LINC00152 levels in gastric juice from patients with gastric cancer were further found significantly higher than those from normal controls (P=0.002). Moreover, the area under the ROC curve (AUC) was up to 0.645 (95 % CI=0.559-0.740, P=0.003). This study highlights that lincRNA LINC00152 might be a novel biomarker for predicting gastric cancer.

  5. Detection of Clostridium tyrobutyricum in milk to prevent late blowing in cheese by automated ribosomal intergenic spacer analysis.

    Science.gov (United States)

    Panelli, Simona; Brambati, Eva; Bonacina, Cesare; Feligini, Maria

    2013-10-01

    Clostridium tyrobutyricum has been identified as the main causal agent of the late blowing defect in cheese, with major effects on quality and commercial value. In this work, for the first time, we applied automated ribosomal intergenic spacer analysis (ARISA) approach to diagnose the presence of C. tyrobutyricum in raw milk before cheesemaking. A species-specific primer set was designed and used for this original application of the ARISA. Sensitivity of detection, reproducibility of the fluorescent PCR assay, and repeatability of the capillary electrophoretic analysis of amplicons were evaluated using DNA extracted from milk added with known amounts of C. tyrobutyricum genome copies, ranging from 3 × 10(6) to 3. Results indicated that the sensitivity of the technique permits to detect the bacterium in all the samples. The reproducibility, evaluated by analyzing 3 sets of serial dilutions, resulted satisfactory, with little deviation within PCR reactions amplifying the same starting amount of template (standard deviations ≤ 0.1, coefficients of variation ≤ 3%). The peaks' fluorescence displayed an evident correspondence with the number of genome copies contained in each dilution. The capillary electrophoretic analysis, tested by running a single PCR product per dilution point in 10 repeats, resulted efficient and highly repeatable, with excellent coefficients of variation ≤ 2% and standard deviations ≤ 0.1 in all the sample sets. This application of ARISA gives good estimates of the total C. tyrobutyricum DNA content allowing a specific, fine-scale resolution of this pollutant species in a complex system as milk. A further advantage linked to the automatization of the process.

  6. Concerted actions of a thermo-labile regulator and a unique intergenic RNA thermosensor control Yersinia virulence.

    Directory of Open Access Journals (Sweden)

    Katja Böhme

    2012-02-01

    Full Text Available Expression of all Yersinia pathogenicity factors encoded on the virulence plasmid, including the yop effector and the ysc type III secretion genes, is controlled by the transcriptional activator LcrF in response to temperature. Here, we show that a protein- and RNA-dependent hierarchy of thermosensors induce LcrF synthesis at body temperature. Thermally regulated transcription of lcrF is modest and mediated by the thermo-sensitive modulator YmoA, which represses transcription from a single promoter located far upstream of the yscW-lcrF operon at moderate temperatures. The transcriptional response is complemented by a second layer of temperature-control induced by a unique cis-acting RNA element located within the intergenic region of the yscW-lcrF transcript. Structure probing demonstrated that this region forms a secondary structure composed of two stemloops at 25°C. The second hairpin sequesters the lcrF ribosomal binding site by a stretch of four uracils. Opening of this structure was favored at 37°C and permitted ribosome binding at host body temperature. Our study further provides experimental evidence for the biological relevance of an RNA thermometer in an animal model. Following oral infections in mice, we found that two different Y. pseudotuberculosis patient isolates expressing a stabilized thermometer variant were strongly reduced in their ability to disseminate into the Peyer's patches, liver and spleen and have fully lost their lethality. Intriguingly, Yersinia strains with a destabilized version of the thermosensor were attenuated or exhibited a similar, but not a higher mortality. This illustrates that the RNA thermometer is the decisive control element providing just the appropriate amounts of LcrF protein for optimal infection efficiency.

  7. Mutations in the embC-embA intergenic region contribute to Mycobacterium tuberculosis resistance to ethambutol.

    Science.gov (United States)

    Cui, Zhenling; Li, Yuanyuan; Cheng, Song; Yang, Hua; Lu, Junmei; Hu, Zhongyi; Ge, Baoxue

    2014-11-01

    The rapid increase in Mycobacterium tuberculosis resistance to ethambutol (EMB) threatens the diagnosis and treatment of tuberculosis (TB). We investigated the role of mutations in the embC-embA intergenic region (IGR) in EMB-resistant clinical strains from east China. A total of 767 M. tuberculosis clinical strains were collected and analyzed for their drug susceptibility to EMB using the MGIT 960 system and MIC assay, and the embC-embA IGRs of these strains were sequenced. The transcriptional activity of the embC-embA IGR mutations was examined by reporter gene assays in recombinant Mycobacterium smegmatis strains, and the effect of IGR mutations on its binding to EmbR, a transcription regulator of embAB, was analyzed by gel mobility shift assays. Correlation coefficient analysis showed that the embC-embA IGR mutation is associated with EMB resistance. The clinical strains carrying IGR mutations had a much higher level of embA and embB mRNA as well as higher MICs to EMB. IGR mutations had higher transcriptional activity when transformed into M. smegmatis strains. Mutated IGRs bound to EmbR with much higher affinity than wild-type fragments. The sensitivity of molecular drug susceptibility testing (DST) with IGR mutations as an additional marker increased from 65.5% to 73.5%. Mutations of the embC-embA IGR enhance the binding of EmbR to the promoter region of embAB and increase the expression of embAB, thus contributing to EMB resistance. Therefore, identification of IGR mutations as markers of EMB resistance could increase the sensitivity of molecular DST.

  8. Concerted Actions of a Thermo-labile Regulator and a Unique Intergenic RNA Thermosensor Control Yersinia Virulence

    Science.gov (United States)

    Kortmann, Jens; Seekircher, Stephanie; Heroven, Ann Kathrin; Berger, Evelin; Pisano, Fabio; Thiermann, Tanja; Wolf-Watz, Hans; Narberhaus, Franz; Dersch, Petra

    2012-01-01

    Expression of all Yersinia pathogenicity factors encoded on the virulence plasmid, including the yop effector and the ysc type III secretion genes, is controlled by the transcriptional activator LcrF in response to temperature. Here, we show that a protein- and RNA-dependent hierarchy of thermosensors induce LcrF synthesis at body temperature. Thermally regulated transcription of lcrF is modest and mediated by the thermo-sensitive modulator YmoA, which represses transcription from a single promoter located far upstream of the yscW-lcrF operon at moderate temperatures. The transcriptional response is complemented by a second layer of temperature-control induced by a unique cis-acting RNA element located within the intergenic region of the yscW-lcrF transcript. Structure probing demonstrated that this region forms a secondary structure composed of two stemloops at 25°C. The second hairpin sequesters the lcrF ribosomal binding site by a stretch of four uracils. Opening of this structure was favored at 37°C and permitted ribosome binding at host body temperature. Our study further provides experimental evidence for the biological relevance of an RNA thermometer in an animal model. Following oral infections in mice, we found that two different Y. pseudotuberculosis patient isolates expressing a stabilized thermometer variant were strongly reduced in their ability to disseminate into the Peyer's patches, liver and spleen and have fully lost their lethality. Intriguingly, Yersinia strains with a destabilized version of the thermosensor were attenuated or exhibited a similar, but not a higher mortality. This illustrates that the RNA thermometer is the decisive control element providing just the appropriate amounts of LcrF protein for optimal infection efficiency. PMID:22359501

  9. Identification of Aedes aegypti Long Intergenic Non-coding RNAs and Their Association with Wolbachia and Dengue Virus Infection.

    Directory of Open Access Journals (Sweden)

    Kayvan Etebari

    2016-10-01

    Full Text Available Long intergenic non-coding RNAs (lincRNAs are appearing as an important class of regulatory RNAs with a variety of biological functions. The aim of this study was to identify the lincRNA profile in the dengue vector Aedes aegypti and evaluate their potential role in host-pathogen interaction. The majority of previous RNA-Seq transcriptome studies in Ae. aegypti have focused on the expression pattern of annotated protein coding genes under different biological conditions. Here, we used 35 publically available RNA-Seq datasets with relatively high depth to screen the Ae. aegypti genome for lincRNA discovery. This led to the identification of 3,482 putative lincRNAs. These lincRNA genes displayed a slightly lower GC content and shorter transcript lengths compared to protein-encoding genes. Ae. aegypti lincRNAs also demonstrate low evolutionary sequence conservation even among closely related species such as Culex quinquefasciatus and Anopheles gambiae. We examined their expression in dengue virus serotype 2 (DENV-2 and Wolbachia infected and non-infected adult mosquitoes and Aa20 cells. The results revealed that DENV-2 infection increased the abundance of a number of host lincRNAs, from which some suppress viral replication in mosquito cells. RNAi-mediated silencing of lincRNA_1317 led to enhancement in viral replication, which possibly indicates its potential involvement in the host anti-viral defense. A number of lincRNAs were also differentially expressed in Wolbachia-infected mosquitoes. The results will facilitate future studies to unravel the function of lncRNAs in insects and may prove to be beneficial in developing new ways to control vectors or inhibit replication of viruses in them.

  10. Identification of Aedes aegypti Long Intergenic Non-coding RNAs and Their Association with Wolbachia and Dengue Virus Infection

    Science.gov (United States)

    Etebari, Kayvan; Asad, Sultan; Zhang, Guangmei; Asgari, Sassan

    2016-01-01

    Long intergenic non-coding RNAs (lincRNAs) are appearing as an important class of regulatory RNAs with a variety of biological functions. The aim of this study was to identify the lincRNA profile in the dengue vector Aedes aegypti and evaluate their potential role in host-pathogen interaction. The majority of previous RNA-Seq transcriptome studies in Ae. aegypti have focused on the expression pattern of annotated protein coding genes under different biological conditions. Here, we used 35 publically available RNA-Seq datasets with relatively high depth to screen the Ae. aegypti genome for lincRNA discovery. This led to the identification of 3,482 putative lincRNAs. These lincRNA genes displayed a slightly lower GC content and shorter transcript lengths compared to protein-encoding genes. Ae. aegypti lincRNAs also demonstrate low evolutionary sequence conservation even among closely related species such as Culex quinquefasciatus and Anopheles gambiae. We examined their expression in dengue virus serotype 2 (DENV-2) and Wolbachia infected and non-infected adult mosquitoes and Aa20 cells. The results revealed that DENV-2 infection increased the abundance of a number of host lincRNAs, from which some suppress viral replication in mosquito cells. RNAi-mediated silencing of lincRNA_1317 led to enhancement in viral replication, which possibly indicates its potential involvement in the host anti-viral defense. A number of lincRNAs were also differentially expressed in Wolbachia-infected mosquitoes. The results will facilitate future studies to unravel the function of lncRNAs in insects and may prove to be beneficial in developing new ways to control vectors or inhibit replication of viruses in them. PMID:27760142

  11. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  12. Higher-order structure of rRNA

    Science.gov (United States)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  13. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  14. Genome sequencing and annotation of Morganella sp. SA36

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Morganella sp. Strain SA36, isolated from water spring in Aljouf region, Saudi Arabia. The draft genome size is 2,564,439 bp with a G + C content of 51.1% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDNQ00000000.

  15. Genome sequencing and annotation of Stenotrophomonas sp. SAM8

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Stenotrophomonas sp. strain SAM8, isolated from environmental water. The draft genome size is 3,665,538 bp with a G + C content of 67.2% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDAV00000000.

  16. Genome sequencing and annotation of Proteus sp. SAS71

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Proteus sp. strain SAS71, isolated from water spring in Aljouf region, Saudi Arabia. The draft genome size is 3,037,704 bp with a G + C content of 39.3% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDIU00000000.

  17. Rapid Identification of Pathogenic Bacteria by means of Two Conservative Gene Loci' Specific PCR-CE-RFLP

    Institute of Scientific and Technical Information of China (English)

    高鹏; 张卓然; 徐维家; 安万新; 张晓慧; 戴兵; 范艳萍; 王运锋; 李萍; 温杰; 于卫健; 高向仪; 谢凡迪; 王永海

    2003-01-01

    To establish a rapid identification method for common pathogenic bacteria on the basis of molecular biology and to construct a preliminary Polymerase Chain Reaction-Capillary Electrophoresis-Restriction Fragment Length Polymorphism (PCR-CE-RFLP) database of bacteria isolated from clinical specimens frequently, 183 strains collected from clinical samples belonging to 12 genera and 19 species whose biochemical characterizations corresponded to the typical ones were examined.The genomic DNAs were amplified by two pairs of fluorescence labeled primers aiming at 16S rRNA gene and 16S-23S rRNA spacer region gene respectively at the same time. PCR products were then digested by restriction endonuclease Hae Ⅲ in-completely before taking capillary electrophoresis. The results with the PCR-CE-RFLP patterns of 16S rRNA genes were just alike within some genera, but when it comes to 16S-23S rRNA spacer region genes, each bacterium showed a unique pattern, which can be distinguished from each other easily. It seems that PCR-CE-RFLP patterns of 16S rRNA gene could only be used to classify the bacteria into family level, whereas the data of 16S-23S rRNA spacer region gene could be utilized to identify the whole microorganisms as precisely as the species level. In spite of the data of the spacer region gene alone can be sufficiently to verify the whole bacteria, we insist that the 16S rRNA gene could be of some assistant in case that there should be lots of families of bacteria, in which some similar ones, with the same RFLP data of 16S-23S rRNA spacer region gene, may coexist. This study proves that the utility of PCR-CE-RFLP is a convenient, rapid method to identify pathogenic bacteria, and is also a quick diagnosis measure for application to clinical use.

  18. Adaptation of the short intergenic spacers between co-directional genes to the Shine-Dalgarno motif among prokaryote genomes

    DEFF Research Database (Denmark)

    Caro, Albert Pallejà; García-Vallvé, Santiago; Romeu, Antoni

    2009-01-01

    influence the stop codon usage or the spacing lengths between co-directional genes. RESULTS: The SD sequences for 530 prokaryote genomes have been predicted using computer calculations of the base-pairing free energy between translation initiation regions and the 16S rRNA 3' tail. Genomes with a large......ABSTRACT: BACKGROUND: In prokaryote genomes most of the co-directional genes are in close proximity. Even the coding sequence or the stop codon of a gene can overlap with the Shine-Dalgarno (SD) sequence of the downstream co-directional gene. In this paper we analyze how the presence of SD may...... number of genes with the SD sequence concentrate this regulatory motif from 4 to 11 bps before the start codon. However, not all genes seem to have the SD sequence. Genes separated from 1 to 4 bps from a co-directional upstream gene show a high SD presence, though this regulatory signal is located...

  19. Microbial analysis of bite marks by sequence comparison of streptococcal DNA.

    Directory of Open Access Journals (Sweden)

    Darnell M Kennedy

    Full Text Available Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA gene, 16S-23S intergenic spacer (ITS and RNA polymerase beta subunit (rpoB. High throughput sequencing (GS FLX 454, followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants.

  20. Phylogenetic analysis based on 28S rRNA of Babesia spp. in ruminants in China.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-04-01

    Molecular phylogenetic analyses are mainly based on the small ribosomal RNA subunit (18S rRNA), internal transcribed spacer regions, and other molecular markers. We compared the phylogenetic relationships of Babesia spp. using large subunit ribosomal RNA, i.e., 28S rRNA, and the united 28S + 18S rRNA sequence fragments from 11 isolates of Babesia spp. collected in China. Due to sequence length and variability, the 28S rRNA gene contained more information than the 18S rRNA gene and could be used to elucidate the phlyogenetic relationships of B. motasi, B. major, and B. bovis. Thus, 28S rRNA is another candidate marker that can be used for the phylogenetic analysis of Babesia spp. However, the united fragment (28S + 18S) analysis provided better supported phylogenetic relationships than single genes for Babesia spp. in China.

  1. Genetic diversity, inter-gene pool introgression and nutritional quality of common beans (Phaseolus vulgaris L.) from Central Africa.

    Science.gov (United States)

    Blair, Matthew W; González, Laura F; Kimani, Paul M; Butare, Louis

    2010-07-01

    The Great Lakes region of Central Africa is a major producer of common beans in Africa. The region is known for high population density and small average farm size. The common bean represents the most important legume crop of the region, grown on over a third of the cultivated land area, and the per capita consumption is among the highest in the world for the food crop. The objective of this study was to evaluate the genetic diversity in a collection of 365 genotypes from the Great Lakes region of Central Africa, including a large group of landraces from Rwanda as well as varieties from primary centers of diversity and from neighboring countries of Central Africa, such as the Democratic Republic of Congo and Uganda, using 30 fluorescently labeled microsatellite markers and automated allele detection. In addition, the landraces were evaluated for their seed iron and zinc concentration to determine if genetic diversity influenced nutritional quality. Principal coordinate and neighbor-joining analyses allowed the separation of the landraces into 132 Andean and 195 Mesoamerican (or Middle American) genotypes with 32 landraces and 6 varieties intermediate between the gene pools and representing inter-gene pool introgression in terms of seed characteristics and alleles. Genetic diversity and the number of alleles were high for the collection, reflecting the preference for a wide range of seed types in the region and no strong commercial class preference, although red, red mottled and brown seeded beans were common. Observed heterozygosity was also high and may be explained by the common practice of maintaining seed and plant mixtures, a coping strategy practiced by Central African farmers to reduce the effects of abiotic and biotic stresses. Finally, nutritional quality differed between the gene pools with respect to seed iron and zinc concentration, while genotypes from the intermediate group were notably high in both minerals. In conclusion, this study has shown that

  2. Detailed characterization of the mouse embryonic stem cell transcriptome reveals novel genes and intergenic splicing associated with pluripotency

    Directory of Open Access Journals (Sweden)

    Stanton Lawrence W

    2008-04-01

    Full Text Available Abstract Background Transcriptional control of embryonic stem (ES cell pluripotency has been a subject of intense study. Transcriptional regulators including Oct4 (Oct3/4 index, Sox2 and Nanog are fundamental for maintaining the undifferentiated state. However, the ES cell transcriptome is not limited to their targets, and exhibits considerable complexity when assayed with microarray, MPSS, cDNA/EST sequencing, and SAGE technologies. To identify novel genes associated with pluripotency, we globally searched for ES transcripts not corresponding to known genes, validated their sequences, determined their expression profiles, and employed RNAi to test their function. Results Gene Identification Signature (GIS analysis, a SAGE derivative distinguished by paired 5' and 3' transcript end tags, identified 153 candidate novel transcriptional units (TUs distinct from known genes in a mouse E14 ES mRNA library. We focused on 16 TUs free of artefacts and mapping discrepancies, five of which were validated by RTPCR product sequencing. Two of the TUs were revealed by annotation to represent novel protein-coding genes: a PRY-domain cluster member and a KRAB-domain zinc finger. The other three TUs represented intergenic splicing events involving adjacent, functionally unrelated protein-coding genes transcribed in the same orientation, with one event potentially encoding a fusion protein containing domains from both component genes (Clk2 and Scamp3. Expression profiling using embryonic samples and adult tissue panels confirmed that three of the TUs were unique to or most highly expressed in ES cells. Expression levels of all five TUs dropped dramatically during three distinct chemically induced differentiation treatments of ES cells in culture. However, siRNA knockdowns of the TUs did not alter mRNA levels of pluripotency or differentiation markers, and did not affect cell morphology. Conclusion Transcriptome libraries retain considerable potential for novel

  3. New approaches for genotyping of Helicobacter pylori based on amplification of polymorphisms in intergenic DNA regions and at the insertion site of the cag pathogenicity island.

    Science.gov (United States)

    Bereswill, S; Schönenberger, R; Thies, C; Stähler, F; Strobel, S; Pfefferle, P; Wille, L; Kist, M

    2000-11-01

    The population of the gastric pathogen Helicobacter pylori shows a high degree of genetic diversity. It is well established that heterogeneity at the isolate level is caused by nucleotide transitions within genes, differences in the gene order, and by genetic instability of single genes as well as of a large virulence-associated genomic DNA region, the cag pathogenicity island (PAI). Analysis of intergenic regions with specific PCR-assays developed in this study, revealed that DNA polymorphisms in the noncoding DNA localized in front of the genes ribA and vacA and at the insertion site of the cag PAI contribute to the genetic diversity of H. pylori and are useful for differentiation of individual isolates. Thirteen individual genotypes were identified by PCR analysis of these polymorphic loci in 487, 241, and 182 clinical H. pylori isolates. Sequence analysis revealed that genetic variability in front of genes ribA and vacA, and in the intergenic region at the PAI insertion site is caused by insertion and deletions of so-far-unknown DNA sequences as well as by parts of the H. pylori IS elements IS605 and IS606, respectively. The new genotypes identified could be used to differentiate antrum and corpus isolates from the same patients. Their combination with vacA allele subtypes and with the cagA status allowed to differentiate 140 isolates in 51 subtypes. In 36 cases the corresponding genotype patterns were isolate specific. In summary, the results confirm that DNA polymorphisms in intergenic regions contribute to the genetic diversity of H. pylori. Although individual H. pylori genotypes were not associated with peptic ulcer disease, the PCR-based approaches for their detection developed here should be of use for further investigation of genetic diversity in H. pylori and for epidemiological purposes.

  4. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    Science.gov (United States)

    2011-01-01

    Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD) followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes) and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes) hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease. PMID:21669002

  5. Phylogeny of Panax using chloroplast trnC-trnD intergenic region and the utility of trnC-trnD in interspecific studies of plants.

    Science.gov (United States)

    Lee, Chunghee; Wen, Jun

    2004-06-01

    Sequences of the chloroplast trnC-trnD region and the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA were obtained for all species of Panax L. (the ginseng plant genus, Araliaceae) to reconstruct phylogenetic relationships. The trnC-trnD phylogeny is congruent with the ITS phylogeny for the diploid taxa of Panax. This study is the first use of the trnC-trnD sequence data for phylogenetic analysis at the interspecific level. We evaluated this DNA region for its phylogenetic utility at the lower taxonomic level for flowering plants. The trnC-trnD region includes the trnC-petN intergenic spacer, the petN gene, the petN-psbM intergenic spacer, the psbM gene, and the psbM-trnD intergenic spacer. The petN and psbM genes are small, 90 and 104-114 bp across angiosperms, respectively, and have conserved sequences. We have designed universal amplification and sequencing primers within these two genes. Using these primers, we have successfully amplified the entire trnC-trnD region for a diversity of flowering plant groups, including Aralia L. (Araliaceae), Calycanthus L. (Calycanthaceae), Corylus L. (Betulaceae), Hamamelis L. (Hamamelidaceae), Hydrocotyle L. (Apiaceae), Illigera Blume (Hernandiaceae), Nelumbo Adans. (Nelumbonaceae), Nolana L. ex L.f. (Solanaceae), Prunus L. (Rosaceae), and Staphylea L. (Staphyleaceae). In Panax, the trnC-trnD region provides a similar number of informative phylogenetic characters as the ITS regions and a slightly higher number of informative characters than the chloroplast ndhF gene. We thus demonstrate the utility of the trnC-trnD region for lower-level phylogenetic studies in flowering plants.

  6. The intergenic region between the divergently transcribed niiA and niaD genes of Aspergillus nidulans contains multiple NirA binding sites which act bidirectionally.

    OpenAIRE

    1995-01-01

    The niaD and niiA genes of Aspergillus nidulans, which code, respectively, for nitrate and nitrite reductases, are divergently transcribed, and their ATGs are separated by 1,200 bp. The genes are under the control of the positively acting NirA transcription factor, which mediates nitrate induction. The DNA binding domain of NirA was expressed as a fusion protein with the glutathione S-transferase of Schistosoma japonicum. Gel shift and footprint experiments have shown that in the intergenic r...

  7. New species in the genus Francisella (Gammaproteobacteria; Francisellaceae); Francisella piscicida sp. nov. isolated from cod (Gadus morhua)

    DEFF Research Database (Denmark)

    Ottem, Karl F; Nylund, Are; Karlsbakk, Egil;

    2007-01-01

    A Francisella strain, GM2212, previously isolated from moribund farmed Atlantic cod (Gadus morhua) in Norway, is closely related to Francisella philomiragia among Francisella spp. according to its complete 16S rDNA, 16S-23S intergenic spacer, 23S rDNA, 23S-5S intergenic spacer, 5S rDNA, FopA, lip...... the establishment of GM2212 as a novel species, for which the name Francisella piscicida sp. nov. is proposed (=CNCM I-3511(T) = DSM 18777(T) = LMG registration number not yet available)....

  8. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  9. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  10. Phylogenetic analysis of the genus Avena based on chloroplast intergenic spacer psbA-trnH and single-copy nuclear gene Acc1.

    Science.gov (United States)

    Yan, Hong-Hai; Baum, Bernard R; Zhou, Ping-Ping; Zhao, Jun; Wei, Yu-Ming; Ren, Chang-Zhong; Xiong, Fang-Qiu; Liu, Gang; Zhong, Lin; Zhao, Gang; Peng, Yuan-Ying

    2014-05-01

    Two uncorrelated nucleotide sequences, chloroplast intergenic spacer psbA-trnH and acetyl CoA carboxylase gene (Acc1), were used to perform phylogenetic analyses in 75 accessions of the genus Avena, representing 13 diploids, seven tetraploid, and four hexaploids by maximum parsimony and Bayesian inference. Phylogenic analyses based on the chloroplast intergenic spacer psbA-trnH confirmed that the A genome diploid might be the maternal donor of species of the genus Avena. Two haplotypes of the Acc1 gene region were obtained from the AB genome tetraploids, indicating an allopolyploid origin for the tetraploid species. Among the AB genome species, both gene trees revealed differences between Avena agadiriana and the other species, suggesting that an AS genome diploid might be the A genome donor and the other genome diploid donor might be the Ac genome diploid Avena canariensis or the Ad genome diploid Avena damascena. Three haplotypes of the Acc1 gene have been detected among the ACD genome hexaploid species. The haplotype that seems to represent the D genome clustered with the tetraploid species Avena murphyi and Avena maroccana, which supported the CD genomic designation instead of AC for A. murphyi and A. maroccana.

  11. Evidence for introduction bottleneck and extensive inter-gene pool (Mesoamerica x Andes) hybridization in the European common bean (Phaseolus vulgaris L.) germplasm.

    Science.gov (United States)

    Gioia, Tania; Logozzo, Giuseppina; Attene, Giovanna; Bellucci, Elisa; Benedettelli, Stefano; Negri, Valeria; Papa, Roberto; Spagnoletti Zeuli, Pierluigi

    2013-01-01

    Common bean diversity within and between Mesoamerican and Andean gene pools was compared in 89 landraces from America and 256 landraces from Europe, to elucidate the effects of bottleneck of introduction and selection for adaptation during the expansion of common bean (Phaseolus vulgaris L.) in Europe. Thirteen highly polymorphic nuclear microsatellite markers (nuSSRs) were used to complement chloroplast microsatellite (cpSSRs) and nuclear markers (phaseolin and Pv-shatterproof1) data from previous studies. To verify the extent of the introduction bottleneck, inter-gene pool hybrids were distinguished from "pure" accessions. Hybrids were identified on the basis of recombination of gene pool specific cpSSR, phaseolin and Pv-shatterproof1 markers with a Bayesian assignments based on nuSSRs, and with STRUCTURE admixture analysis. More hybrids were detected than previously, and their frequency was almost four times larger in Europe (40.2%) than in America (12.3%). The genetic bottleneck following the introduction into Europe was not evidenced in the analysis including all the accessions, but it was significant when estimated only with "pure" accessions, and five times larger for Mesoamerican than for Andean germplasm. The extensive inter-gene pool hybridization generated a large amount of genotypic diversity that mitigated the effects of the bottleneck that occurred when common bean was introduced in Europe. The implication for evolution and the advantages for common bean breeding are discussed.

  12. Evidence for introduction bottleneck and extensive inter-gene pool (Mesoamerica x Andes hybridization in the European common bean (Phaseolus vulgaris L. germplasm.

    Directory of Open Access Journals (Sweden)

    Tania Gioia

    Full Text Available Common bean diversity within and between Mesoamerican and Andean gene pools was compared in 89 landraces from America and 256 landraces from Europe, to elucidate the effects of bottleneck of introduction and selection for adaptation during the expansion of common bean (Phaseolus vulgaris L. in Europe. Thirteen highly polymorphic nuclear microsatellite markers (nuSSRs were used to complement chloroplast microsatellite (cpSSRs and nuclear markers (phaseolin and Pv-shatterproof1 data from previous studies. To verify the extent of the introduction bottleneck, inter-gene pool hybrids were distinguished from "pure" accessions. Hybrids were identified on the basis of recombination of gene pool specific cpSSR, phaseolin and Pv-shatterproof1 markers with a Bayesian assignments based on nuSSRs, and with STRUCTURE admixture analysis. More hybrids were detected than previously, and their frequency was almost four times larger in Europe (40.2% than in America (12.3%. The genetic bottleneck following the introduction into Europe was not evidenced in the analysis including all the accessions, but it was significant when estimated only with "pure" accessions, and five times larger for Mesoamerican than for Andean germplasm. The extensive inter-gene pool hybridization generated a large amount of genotypic diversity that mitigated the effects of the bottleneck that occurred when common bean was introduced in Europe. The implication for evolution and the advantages for common bean breeding are discussed.

  13. Characteristic archaebacterial 16S rRNA oligonucleotides

    Science.gov (United States)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  14. Defects in 18 S or 28 S rRNA processing activate the p53 pathway.

    Science.gov (United States)

    Hölzel, Michael; Orban, Mathias; Hochstatter, Julia; Rohrmoser, Michaela; Harasim, Thomas; Malamoussi, Anastassia; Kremmer, Elisabeth; Längst, Gernot; Eick, Dirk

    2010-02-26

    The p53 tumor suppressor pathway is activated by defective ribosome synthesis. Ribosomal proteins are released from the nucleolus and block human double minute-2 (Hdm2) that targets p53 for degradation. However, it remained elusive how abrogation of individual rRNA processing pathways contributes to p53 stabilization. Here, we show that selective inhibition of 18 S rRNA processing provokes accumulation of p53 as efficiently as abrogated 28 S rRNA maturation. We describe hUTP18 as a novel mammalian rRNA processing factor that is specifically involved in 18 S rRNA production. hUTP18 was essential for the cleavage of the 5'-external transcribed spacer leader sequence from the primary polymerase I transcript, but was dispensable for rRNA transcription. Because maturation of the 28 S rRNA was unaffected in hUTP18-depleted cells, our results suggest that the integrity of both the 18 S and 28 S rRNA synthesis pathways can be monitored independently by the p53 pathway. Interestingly, accumulation of p53 after hUTP18 knock down required the ribosomal protein L11. Therefore, cells survey the maturation of the small and large ribosomal subunits by separate molecular routes, which may merge in an L11-dependent signaling pathway for p53 stabilization.

  15. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  16. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kiparisov, Sergey; Petrov, Alexey; Meskauskas, Arturas; Sergiev, Petr V; Dontsova, Olga A; Dinman, Jonathan D

    2005-10-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semi-dominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression.

  17. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  18. Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region.

    Science.gov (United States)

    Yang, G; Benson, R; Pelish, T; Brown, E; Winchell, J M; Fields, B

    2010-03-01

    Although the majority of cases of Legionnaires' disease (LD) are caused by Legionella pneumophila, an increasing number of other Legionella species have been reported to cause human disease. There are no clinical presentations unique to LD and hence accurate laboratory tests are required for early diagnosis. Therefore, we designed a real-time PCR assay that targets the 23S-5S rRNA intergenic spacer region (23S-5S PCR) and allows for detection of all Legionella species and discrimination of L. pneumophila from other Legionella species. In total, 271 isolates representing 50 Legionella species were tested and the assay was validated using 39 culture-positive and 110 culture-negative patient specimens collected between 1989 and 2006. PCR-positive results were obtained with all 39 culture-positive samples (100% sensitivity). Specimens that tested positive according to 23S-5S PCR, but were culture-negative, were further analysed by DNA sequencing of the amplicon or the macrophage infectivity potentiator (mip) gene. In addition to L. pneumophila, Legionella longbeachae, Legionella cincinnatiensis and Legionella micdadei were identified in the specimens. The assay showed a 7-log dynamic range displaying a sensitivity of 7.5 CFU/mL or three genome equivalents per reaction. Sixty-one specimens containing viruses or bacteria other than Legionellae were negative according to 23S-5S PCR, demonstrating its specificity. Use of this assay should contribute to the earlier detection of respiratory disease caused by Legionella species, as well as to increased rates of detection.

  19. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements.

    Science.gov (United States)

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-10-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  20. Resurrection of an ancestral 5S rRNA

    Directory of Open Access Journals (Sweden)

    Fox George E

    2011-07-01

    to resurrect additional meaningful 5S rRNA ancestors as well as ancestral sequences of many different types of RNA.

  1. Resurrection of an ancestral 5S rRNA.

    Science.gov (United States)

    Lu, Qing; Fox, George E

    2011-07-22

    In addition to providing phylogenetic relationships, tree making procedures such as parsimony and maximum likelihood can make specific predictions of actual historical sequences. Resurrection of such sequences can be used to understand early events in evolution. In the case of RNA, the nature of parsimony is such that when applied to multiple RNA sequences it typically predicts ancestral sequences that satisfy the base pairing constraints associated with secondary structure. The case for such sequences being actual ancestors is greatly improved, if they can be shown to be biologically functional. A unique common ancestral sequence of 28 Vibrio 5S ribosomal RNA sequences predicted by parsimony was resurrected and found to be functional in the context of the E. coli cellular environment. The functionality of various point variants and intermediates that were constructed as part of the resurrection were examined in detail. When separately introduced the changes at single stranded positions and individual double variants at base-paired positions were also viable. An additional double variant was examined at a different base-paired position and it was also valid. The results show that at least in the case of the 5S rRNAs considered here, ancestors predicted by parsimony are likely to be realistic when the prediction is not overly influenced by single outliers. It is especially noteworthy that the phenotype of the predicted ancestors could be anticipated as a cumulative consequence of the phenotypes of the individual variants that comprised them. Thus, point mutation data is potentially useful in evaluating the reasonableness of ancestral sequences predicted by parsimony or other methods. The results also suggest that in the absence of significant tertiary structure constraints double variants that preserve pairing in stem regions will typically be accepted. Overall, the results suggest that it will be feasible to resurrect additional meaningful 5S rRNA ancestors as well

  2. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  3. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  4. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  5. 18S rRNA degradation is not accompanied by altered rRNA transport at early times following irradiation of HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, P.; Krolak, J.M.; McClain, D.; Minton, K.W.

    1990-01-01

    In recent investigations on the effects of radiation on rRNA processing in HeLa S3 cells, the authors pulse-labeled the cells with uridine immediately prior to irradiation. The 45 S rRNA precursor, which undergoes nuclear processing to form one each of its major daughter species, 28S and 18S rRNA, was separated from the daughter species by gel electrophoresis and the radiolabel in each species determined at various times after irradiation. By pulse-labeling the cells prior to irradiation, superimposed effects caused by radiation-induced alterations of rRNA transcription and Refs. therein were minimized, permitting selective analysis of the processing of that fraction of 45S precursor that had been synthesized (radiolabeled) predominantly prior to irradiation. They now report more detailed studies on 45S rRNA processing within the first 2 h following irradiation in which they have found a maximum 28 S:18 S ratio of 2:1 that is observed about 1 h following irradiation of 5 or 10 Gy.

  6. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes.

    Science.gov (United States)

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima

    2015-01-01

    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa.

  7. Inter- and intraspecies identification of Bartonella (Rochalimaea) species.

    Science.gov (United States)

    Roux, V; Raoult, D

    1995-06-01

    Species of the genus Rochalimaea, recently renamed Bartonella, are of a growing medical interest. Bartonella quintana was reported as the cause of trench fever, endocarditis, and bacillary angiomatosis. B. henselae has been implicated in symptoms and infections of human immunodeficiency virus-infected patients, such as fever, endocarditis, and bacillary angiomatosis, and is involved in the etiology of cat scratch disease. Such a wide spectrum of infections makes it necessary to obtain an intraspecies identification tool in order to perform epidemiological studies. B. vinsonii, B. elizabethae, seven isolates of B. quintana, and four isolates of B. henselae were studied by pulsed-field gel electrophoresis (PFGE) after restriction with the infrequently cutting endonucleases NotI, EagI, and SmaI. Specific profiles were obtained for each of the four Bartonella species. Comparison of genomic fingerprints of isolates of the same species showed polymorphism in DNA restriction patterns, and a specific profile was obtained for each isolate. A phylogenetic analysis of the B. quintana isolates was obtained by using the Dice coefficient, UPGMA (unweighted pair-group method of arithmetic averages), and Package Philip programming. Amplification by PCR and subsequent sequencing using an automated laser fluorescent DNA sequencer (Pharmacia) was performed on the intergenic spacer region (ITS) between the 16 and 23S rRNA genes. It was found that each B. henselae isolate had a specific sequence, while the B. quintana isolates fell into only two groups. When endonuclease restriction analysis of the ITS PCR product was done, three enzymes, TaqI, HindIII, and HaeIII, allowed species identification of Bartonella spp. Restriction fragment length polymorphism after PCR amplification of the 16S-23S rRNA gene ITS may be useful for rapid species identification, and PFGE could be an efficient method for isolate identification.

  8. Bradyrhizobium pachyrhizi sp. nov. and Bradyrhizobium jicamae sp. nov., isolated from effective nodules of Pachyrhizus erosus.

    Science.gov (United States)

    Ramírez-Bahena, Martha Helena; Peix, Alvaro; Rivas, Raúl; Camacho, María; Rodríguez-Navarro, Dulce N; Mateos, Pedro F; Martínez-Molina, Eustoquio; Willems, Anne; Velázquez, Encarna

    2009-08-01

    Several strains isolated from the legume Pachyrhizus erosus were characterized on the basis of diverse genetic, phenotypic and symbiotic approaches. These novel strains formed two groups closely related to Bradyrhizobium elkanii according to their 16S rRNA gene sequences. Strains PAC48T and PAC68T, designated as the type strains of these two groups, presented 99.8 and 99.1% similarity, respectively, in their 16S rRNA gene sequences with respect to B. elkanii USDA 76T. In spite of these high similarity values, the analysis of additional phylogenetic markers such as atpD and glnII genes and the 16S-23S intergenic spacer (ITS) showed that strains PAC48T and PAC68T represented two separate novel species of the genus Bradyrhizobium with B. elkanii as their closest relative. Phenotypic differences among the novel strains isolated from Pachyrhizus and B. elkanii were found regarding the assimilation of carbon sources and antibiotic resistance. All these differences were congruent with DNA-DNA hybridization analysis which revealed 21% genetic relatedness between strains PAC48T and PAC68T and 46% and 25%, respectively, between these strains and B. elkanii LMG 6134T. The nodD and nifH genes of strains PAC48T and PAC68T were phylogenetically divergent from those of bradyrhizobia species that nodulate soybean. Soybean was not nodulated by the novel Pachyrhizus isolates. Based on the genotypic and phenotypic data obtained in this study, the new strains represent two novel species for which the names Bradyrhizobium pachyrhizi sp. nov. (type strain PAC48T=LMG 24246T=CECT 7396T) and Bradyrhizobium jicamae sp. nov. (type strain PAC68T=LMG 24556T=CECT 7395T) are proposed.

  9. Isolation, identification and characterisation of three novel probiotic strains (Lactobacillus paracasei CNCM I-4034, Bifidobacterium breve CNCM I-4035 and Lactobacillus rhamnosus CNCM I-4036) from the faeces of exclusively breast-fed infants.

    Science.gov (United States)

    Muñoz-Quezada, Sergio; Chenoll, Empar; Vieites, José María; Genovés, Salvador; Maldonado, José; Bermúdez-Brito, Miriam; Gomez-Llorente, Carolina; Matencio, Esther; Bernal, María José; Romero, Fernando; Suárez, Antonio; Ramón, Daniel; Gil, Angel

    2013-01-01

    The aim of the present study was to isolate, identify and characterise novel strains of lactic acid bacteria and bifidobacteria with probiotic properties from the faeces of exclusively breast-fed infants. Of the 4680 isolated colonies, 758 exhibited resistance to low pH and tolerance to high concentrations of bile salts; of these, only forty-two exhibited a strong ability to adhere to enterocytes in vitro. The identities of the isolates were confirmed by 16S ribosomal RNA (rRNA) sequencing, which permitted the grouping of the forty-two bacteria into three different strains that showed more than 99 % sequence identity with Lactobacillus paracasei, Lactobacillus rhamnosus and Bifidobacterium breve, respectively. The strain identification was confirmed by sequencing the 16S-23S rRNA intergenic spacer regions. Strains were assayed for enzymatic activity and carbohydrate utilisation, and they were deposited in the Collection Nationale de Cultures de Microorganismes (CNCM) of the Institute Pasteur and named L. paracasei CNCM I-4034, B. breve CNCM I-4035 and L. rhamnosus CNCM I-4036. The strains were susceptible to antibiotics and did not produce undesirable metabolites, and their safety was assessed by acute ingestion in immunocompetent and immunosuppressed BALB/c mouse models. The three novel strains inhibited in vitro the meningitis aetiological agent Listeria monocytogenes and human rotavirus infections. B. breve CNCM I-4035 led to a higher IgA concentration in faeces and plasma of mice. Overall, these results suggest that L. paracasei CNCM I-4034, B. breve CNCM I-4035 and L. rhamnosus CNCM I-4036 should be considered as probiotic strains, and their human health benefits should be further evaluated.

  10. Rhizobium borbori sp. nov., aniline-degrading bacteria isolated from activated sludge.

    Science.gov (United States)

    Zhang, Guo Xia; Ren, Sui Zhou; Xu, Mei Ying; Zeng, Guo Qu; Luo, Hui Dong; Chen, Jin Lin; Tan, Zhi Yuan; Sun, Guo Ping

    2011-04-01

    Three aniline-degrading bacteria, strains DN316(T), DN316-1 and DN365, were isolated from activated sludge. According to 16S rRNA gene sequence-based phylogenetic analysis, the isolates belonged to the genus Rhizobium, with Rhizobium ( = Agrobacterium) radiobacter LMG 140(T) as the closest relative, with 96.5 % sequence similarity. Phylogenetic analysis of the representative strain DN316(T) using sequences of the glnA, thrC and recA genes and the 16S-23S intergenic spacer region confirmed the phylogenetic arrangement obtained from analysis of the 16S rRNA gene. DNA-DNA relatedness between DN316(T) and R. radiobacter LMG 140(T) was 43.7 %, clearly indicating that the representative strain DN316(T) represents a novel species. Phenotypic and biochemical characterization of the isolates and insertion sequence-PCR fingerprinting patterns showed several distinctive features that differentiated them from closely related species. The major components of the cellular fatty acids were C(18 : 1)ω7c (57.10 %), C(16 : 0) (11.31 %) and C(19 : 0) cyclo ω8c (10.13 %). Based on our taxonomic analysis, the three isolates from activated sludge represent a novel species of the genus Rhizobium, for which the name Rhizobium borbori sp. nov. is proposed. The type strain is DN316(T) ( = CICC 10378(T)  = LMG 23925(T)).

  11. A panel of real-time PCR assays for specific detection of three phytoplasmas from the apple proliferation group.

    Science.gov (United States)

    Nikolić, Petra; Mehle, Natasa; Gruden, Kristina; Ravnikar, Maja; Dermastia, Marina

    2010-10-01

    We report here on the development of combination of assays for fast, reliable, specific and sensitive detection and discrimination of 'Candidatus Phytoplasma mali', 'Ca. P. prunorum' and 'Ca. P. pyri' from the 16Sr-X (apple proliferation - AP) group. These phytoplasmas are causal agents of diseases of fruit trees within the family Rosaceae, namely apple proliferation (AP), European stone fruit yellows (ESFY) and pear decline (PD). The designed panel of assays uses TaqMan minor groove binder probes (MGB). It comprises the same set of primers and specific probes for species-specific amplification within the 16S-23S rRNA intergenic spacer region, a set of primers and probes for amplification of the 16S ribosomal DNA region for the universal phytoplasma detection, and an additional set of primers and probe for 18S rRNA as an endogenous quality control of DNA extraction. The performance characteristics of the panel were evaluated. The advantages of new assays were shown in a comparative study with the conventional PCR, which proved their higher sensitivity combined with three-fold shorter time of testing process; and in comparison with two reported multiplex real-time PCR assays for detection of 'Ca. P. mali' or 'Ca. P. pyri'. New panel of assays were tested on the DNA samples of 'Ca. P. mali', 'Ca. P. prunorum', 'Ca. P. pyri', other phytoplasmas and other bacteria isolated from plant material. Additionally, 198 symptomatic and asymptomatic fruit tree field samples collecting during several growing seasons were tested with new assays as well. The results of this study indicate that the combination of three specific assays may be applied in routine phytoplasma surveys and in the certification programs.

  12. Epigenetic Programming of the rRNA Promoter by MBD3

    OpenAIRE

    2008-01-01

    Within the human genome there are hundreds of copies of the rRNA gene, but only a fraction of these genes are active. Silencing through epigenetics has been extensively studied; however, it is essential to understand how active rRNA genes are maintained. Here, we propose a role for the methyl-CpG binding domain protein MBD3 in epigenetically maintaining active rRNA promoters. We show that MBD3 is localized to the nucleolus, colocalizes with upstream binding factor, and binds to unmethylated r...

  13. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Directory of Open Access Journals (Sweden)

    Nakajima Rafael T

    2012-10-01

    Full Text Available Abstract Background Among multigene families, ribosomal RNA (rRNA genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a

  14. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  15. Evolutionary dynamics of rRNA gene clusters in cichlid fish

    Science.gov (United States)

    2012-01-01

    Background Among multigene families, ribosomal RNA (rRNA) genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. Results The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the number of sites ranged from 2 to 6, with the most common pattern being the presence of 2 sites per diploid genome. Furthermore, searching the Oreochromis niloticus genome database led to the identification of a total of 59 copies of 5S rRNA and 38 copies of 18S rRNA genes that were distributed in several genomic scaffolds. The rRNA genes were frequently flanked by transposable elements (TEs) and spread throughout the genome, complementing the FISH analysis that detect only clustered copies of rRNA genes. Conclusions The organization of rRNA gene clusters seems to reflect their intense and particular evolutionary pathway and not the evolutionary history of the associated taxa. The possible role of TEs as one source of rRNA gene movement, that could generates the spreading of ribosomal clusters/copies, is discussed. The present paper reinforces the notion that the integration of cytogenetic data and genomic analysis provides a more complete picture for

  16. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C.; Dennis, P. P.

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  17. Identification and chromosomal distribution of 5S rRNA genes in Neurospora crassa.

    OpenAIRE

    Metzenberg, R L; Stevens, J N; Selker, E U; Morzycka-Wroblewska, E

    1985-01-01

    The 5S rRNA genes of Neurospora crassa, unlike those of most organisms, are not tandemly arranged, and they are found imbedded in a variety of unique sequences. The 5S rRNA regions of most of the genes are of one type, alpha; however, several other "isotypes" (beta, gamma, delta, zeta, and eta) are also found. We asked whether Neurospora 5S rRNA genes are dispersed on a chromosomal scale and whether genes of different isotypes are spatially segregated. We identified, by DNA sequencing, 5S rRN...

  18. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  19. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    Energy Technology Data Exchange (ETDEWEB)

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  20. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    The rRNAs in Escherichia coli contain methylations at 24 nucleotides, which collectively are important for ribosome function. Three of these methylations are m5C modifications located at nucleotides C967 and C1407 in 16S rRNA and at nucleotide C1962 in 23S rRNA. Bacterial rRNA modifications gener...... methyltransferase gene rsmF, and that the nomenclature system be extended to include the rRNA methyltransferases that still await identification....

  1. Fusion of HMGA1 to the LPP/TPRG1 intergenic region in a lipoma identified by mapping paraffin-embedded tissues.

    Science.gov (United States)

    Wang, Xiaoke; Zamolyi, Renata Q; Zhang, Hongying; Pannain, Vera L; Medeiros, Fabiola; Erickson-Johnson, Michele; Jenkins, Robert B; Oliveira, Andre M

    2010-01-01

    Ordinary lipoma frequently harbors rearrangement of HMGA2. LPP is the most common partner gene to HMGA2, but has not been seen fused to HMGA1. We report the fusion of HMGA1 to the intergenic region between LPP and TPRG1 in a lipoma. Conventional cytogenetic analysis of an abdominal-wall lipoma diagnosed in a 60-year-old woman showed a t(3;6)(q27;p21). Molecular cytogenetic mapping of available paraffin-embedded tissues revealed the fusion of HMGA1 to a 139-kb genomic region between the LPP and TPRG1 loci. No rearrangement of HMGA2 was found. The biological function of this novel fusion could be similar to the role of HMGA2-LPP in tumorigenesis.

  2. Identification of a novel DRB1 allele through intergenic recombination between HLA-DRB1 and HLA-DRB3∗02 in a Chinese family.

    Science.gov (United States)

    Huang, Weijin; Liu, Xiangjun; Li, Erwei; Zhao, Chenyan; Liu, Qiang; Liang, Zhenglun; Wang, Youchun; Lu, Fengmin

    2013-12-01

    In this study, a novel DRB1 allele was revealed by routine HLA-SBT typing noted for its extensive mismatches to any known DRB1 alleles within the exon 2. Sequences containing the exons 2, 3 of HLA-DRB1, their surrounding introns, and the full-length cDNA of DRB1 were analyzed to determine a possible recombination event. Interestingly, the sequences of entire exon 2 were characterized as DRB3(∗)02:02:01:01/02; while exon 3 were characterized as DRB1(∗)14 like alleles. Further analysis of the sequences using Simplot software suggested that an intergenic recombinant event (i.e. exchange of sequence between non-allelic genes) may have occurred between DRB3(∗)02 allele and DRB1(∗)14 like allele, and the recombination sites are located at intron 1 and the boundary of exon 2 and intron 2 of DRB1. There are 5 CGGGG sequences flanking each side of exon 2 could serve as potential recombination site. Moreover, the full-length cDNA of the novel allele has been identified. The exon 1 and exon 3 to exon 6 share the same sequence as DRB1(∗)14 like alleles. At the mRNA level, the new allele has no significant difference when compared with the other DRB1 allele. This novel recombinant allele is also found to be paternally inherited. In conclusion, this is the first report of a DRB1 and DRB3 intergenic recombination event involving whole exon 2, which generate a new DRB1(∗)14:141.

  3. Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

    Directory of Open Access Journals (Sweden)

    J Stephen Dumler

    2016-09-01

    Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

  4. An intergenic risk locus containing an enhancer deletion in 2q35 modulates breast cancer risk by deregulating IGFBP5 expression.

    Science.gov (United States)

    Wyszynski, Asaf; Hong, Chi-Chen; Lam, Kristin; Michailidou, Kyriaki; Lytle, Christian; Yao, Song; Zhang, Yali; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Hopper, John L; Southey, Melissa C; Schmidt, Marjanka K; Broeks, Annegien; Muir, Kenneth; Lophatananon, Artitaya; Fasching, Peter A; Beckmann, Matthias W; Peto, Julian; Dos-Santos-Silva, Isabel; Sawyer, Elinor J; Tomlinson, Ian; Burwinkel, Barbara; Marme, Frederik; Guénel, Pascal; Truong, Thérèse; Bojesen, Stig E; Nordestgaard, Børge G; González-Neira, Anna; Benitez, Javier; Neuhausen, Susan L; Brenner, Hermann; Dieffenbach, Aida Karina; Meindl, Alfons; Schmutzler, Rita K; Brauch, Hiltrud; Nevanlinna, Heli; Khan, Sofia; Matsuo, Keitaro; Ito, Hidemi; Dörk, Thilo; Bogdanova, Natalia V; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kosma, Veli-Matti; Wu, Anna H; Van Den Berg, David; Lambrechts, Diether; Wildiers, Hans; Chang-Claude, Jenny; Rudolph, Anja; Radice, Paolo; Peterlongo, Paolo; Couch, Fergus J; Olson, Janet E; Giles, Graham G; Milne, Roger L; Haiman, Christopher A; Henderson, Brian E; Dumont, Martine; Teo, Soo Hwang; Wong, Tien Y; Kristensen, Vessela; Zheng, Wei; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Andrulis, Irene L; Knight, Julia A; Devilee, Peter; Seynaeve, Caroline; García-Closas, Montserrat; Figueroa, Jonine; Klevebring, Daniel; Czene, Kamila; Hooning, Maartje J; van den Ouweland, Ans M W; Darabi, Hatef; Shu, Xiao-Ou; Gao, Yu-Tang; Cox, Angela; Blot, William; Signorello, Lisa B; Shah, Mitul; Kang, Daehee; Choi, Ji-Yeob; Hartman, Mikael; Miao, Hui; Hamann, Ute; Jakubowska, Anna; Lubinski, Jan; Sangrajrang, Suleeporn; McKay, James; Toland, Amanda E; Yannoukakos, Drakoulis; Shen, Chen-Yang; Wu, Pei-Ei; Swerdlow, Anthony; Orr, Nick; Simard, Jacques; Pharoah, Paul D P; Dunning, Alison M; Chenevix-Trench, Georgia; Hall, Per; Bandera, Elisa; Amos, Chris; Ambrosone, Christine; Easton, Douglas F; Cole, Michael D

    2016-09-01

    Breast cancer is the most diagnosed malignancy and the second leading cause of cancer mortality in females. Previous association studies have identified variants on 2q35 associated with the risk of breast cancer. To identify functional susceptibility loci for breast cancer, we interrogated the 2q35 gene desert for chromatin architecture and functional variation correlated with gene expression. We report a novel intergenic breast cancer risk locus containing an enhancer copy number variation (enCNV; deletion) located approximately 400Kb upstream to IGFBP5, which overlaps an intergenic ERα-bound enhancer that loops to the IGFBP5 promoter. The enCNV is correlated with modified ERα binding and monoallelic-repression of IGFBP5 following oestrogen treatment. We investigated the association of enCNV genotype with breast cancer in 1,182 cases and 1,362 controls, and replicate our findings in an independent set of 62,533 cases and 60,966 controls from 41 case control studies and 11 GWAS. We report a dose-dependent inverse association of 2q35 enCNV genotype (percopy OR = 0.68 95%CI 0.55-0.83, P = 0.0002; replication OR = 0.77 95% CI 0.73-0.82, P = 2.1 × 10(-19)) and identify 13 additional linked variants (r(2 )>( )0.8) in the 20Kb linkage block containing the enCNV (P = 3.2 × 10(-15) - 5.6 × 10(-17)). These associations were independent of previously reported 2q35 variants, rs13387042/rs4442975 and rs16857609, and were stronger for ER-positive than ER-negative disease. Together, these results suggest that 2q35 breast cancer risk loci may be mediating their effect through IGFBP5.

  5. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    Science.gov (United States)

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  6. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    Science.gov (United States)

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  7. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  8. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    Science.gov (United States)

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  9. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim;

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems...... growth. The amounts of 23S rRNA and pre-16S rRNA measured for E. coli growing in intestinal mucus corresponded to that expected for bacteria with the observed growth rate. In contrast, the slow-growing E. coli cells present in intestinal contents turned out to have an approximately ninefold higher...

  10. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    Science.gov (United States)

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  11. Detection of Babesia microti parasites by highly sensitive 18S rRNA reverse transcription PCR.

    Science.gov (United States)

    Hanron, Amelia E; Billman, Zachary P; Seilie, Annette M; Chang, Ming; Murphy, Sean C

    2017-03-01

    Babesia are increasingly appreciated as a cause of transfusion-transmitted infection. Sensitive methods are needed to screen blood products. We report herein that B. microti 18S rRNA is over 1,000-fold more abundant than its coding genes, making reverse transcription PCR (RT-PCR) much more sensitive than PCR. Babesia 18S rRNA may be useful for screening the blood supply.

  12. rRNA Pseudogenes in Filamentous Ascomycetes as Revealed by Genome Data

    Directory of Open Access Journals (Sweden)

    Yi Li

    2017-08-01

    Full Text Available The nuclear ribosomal DNA (rDNA is considered as a paradigm of concerted evolution. Components of the rDNA tandem repeats (45S are widely used in phylogenetic studies of different organisms and the internal transcribed spacer (ITS region was recently selected as a fungal DNA bar code. However, rRNA pseudogenes, as one kind of escape from concerted evolution, were reported in a wide range of organisms, especially in plants and animals. Moreover, large numbers of 5S rRNA pseudogenes were identified in several filamentous ascomycetes. To study whether rDNA evolves in a strict concerted manner and test whether rRNA pseudogenes exist in more species of ascomycetes, intragenomic rDNA polymorphisms were analyzed using whole genome sequences. Divergent rDNA paralogs were found to coexist within a single genome in seven filamentous ascomycetes examined. A great number of paralogs were identified as pseudogenes according to the mutation and secondary structure analyses. Phylogenetic analyses of the three rRNA coding regions of the 45S rDNA repeats, i.e., 18S, 5.8S, and 28S, revealed an interspecies clustering pattern of those different rDNA paralogs. The identified rRNA pseudogenic sequences were validated using specific primers designed. Mutation analyses revealed that the repeat-induced point (RIP mutation was probably responsible for the formation of those rRNA pseudogenes.

  13. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil.

    Science.gov (United States)

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo; Seldin, Lucy

    2016-05-26

    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs).

  14. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    Directory of Open Access Journals (Sweden)

    Marissa B Hirst

    Full Text Available Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of

  15. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  16. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Directory of Open Access Journals (Sweden)

    Huijing Hao

    Full Text Available API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  17. Identification of novel growth phase- and media-dependent small non-coding RNAs in Streptococcus pyogenes M49 using intergenic tiling arrays

    Directory of Open Access Journals (Sweden)

    Patenge Nadja

    2012-10-01

    Full Text Available Abstract Background Small non-coding RNAs (sRNAs have attracted attention as a new class of gene regulators in both eukaryotes and bacteria. Genome-wide screening methods have been successfully applied in Gram-negative bacteria to identify sRNA regulators. Many sRNAs are well characterized, including their target mRNAs and mode of action. In comparison, little is known about sRNAs in Gram-positive pathogens. In this study, we identified novel sRNAs in the exclusively human pathogen Streptococcus pyogenes M49 (Group A Streptococcus, GAS M49, employing a whole genome intergenic tiling array approach. GAS is an important pathogen that causes diseases ranging from mild superficial infections of the skin and mucous membranes of the naso-pharynx, to severe toxic and invasive diseases. Results We identified 55 putative sRNAs in GAS M49 that were expressed during growth. Of these, 42 were novel. Some of the newly-identified sRNAs belonged to one of the common non-coding RNA families described in the Rfam database. Comparison of the results of our screen with the outcome of two recently published bioinformatics tools showed a low level of overlap between putative sRNA genes. Previously, 40 potential sRNAs have been reported to be expressed in a GAS M1T1 serotype, as detected by a whole genome intergenic tiling array approach. Our screen detected 12 putative sRNA genes that were expressed in both strains. Twenty sRNA candidates appeared to be regulated in a medium-dependent fashion, while eight sRNA genes were regulated throughout growth in chemically defined medium. Expression of candidate genes was verified by reverse transcriptase-qPCR. For a subset of sRNAs, the transcriptional start was determined by 5′ rapid amplification of cDNA ends-PCR (RACE-PCR analysis. Conclusions In accord with the results of previous studies, we found little overlap between different screening methods, which underlines the fact that a comprehensive analysis of s

  18. Mutations of mitochondrial 12S rRNA in gastric carcinoma and their significance

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Jia-Ming Ma; Yan Xin; Xiao-Yun Mao; Yu-Jie Zhao; Dong-Ying Wu; Su-Min Zhang; Yu-Kui Zhang

    2005-01-01

    AIM: To detect the variations of mitochondrial 12S rRNA in patients with gastric carcinoma, and to study their significance and the relationship between these variations and the genesis of gastric carcinoma.METHODS: PCR amplified mitochondrial 12S rRNA of 44 samples including 22 from gastric carcinoma tissues and 22 from adjacent normal tissues, was detected by direct DNA sequencing. Then laser capture microdissection technique (LCM) was used to separate the cancerous cells and dysplasia cells with specific mutations. Denaturing high performance liquid chromatography (DHPLC) plus allele-specific PCR (ASPCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE)were used to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplasia cells. Finally, RNAdraw biosoft was used to analyze the RNA secondary structure of mutant-type 12S rRNA.RESULTS: Compared with Mitomap database, some new variations were found, among which np652 G insertion and np716 T-G transversion were found only in cancerous tissues.There was a statistic difference in the frequency of 12S rRNA variation between intestinal type (12/17, 70.59%) and diffusive type (5/17, 29.41%) of gastric carcinoma (P<0.05).DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutations.The frequency of 12S rRNA variation in cancerous cells was higher than that in dysplasia cells (P<0.01). 12S rRNA np652 G insertion showed obviously negative effects on the stability of 12S rRNA secondary structure, while others such as T-G transversion did not.CONCLUSION: The mutations of mitochondrial 12S rRNA may be associated with the occurrence of intestinal-type gastric carcinoma. Most variations exist both in gastric carcinomas and in normal tissues, and they might not be the characteristics of tumors. However, np652 G insertion and np716 T-G transversion may possess some molecular significance in gastric carcinogenesis. During

  19. Rapid in vivo exploration of a 5S rRNA neutral network.

    Science.gov (United States)

    Zhang, Zhengdong D; Nayar, Madhavi; Ammons, David; Rampersad, Joanne; Fox, George E

    2009-02-01

    A partial knockout compensation method to screen 5S ribosomal RNA sequence variants in vivo is described. The system utilizes an Escherichia coli strain in which five of eight genomic 5S rRNA genes were deleted in conjunction with a plasmid which is compensatory when carrying a functionally active 5S rRNA. The partial knockout strain is transformed with a population of potentially compensatory plasmids each carrying a randomly generated 5S rRNA gene variant. a The ability to compensate the slow growth rate of the knockout strain is used in conjunction with sequencing to rapidly identify variant 5S rRNAs that are functional as well as those that likely are not. The assay is validated by showing that the growth rate of 15 variants separately expressed in the partial knockout strain can be accurately correlated with in vivo assessments of the potential validity of the same variants. A region of 5S rRNA was mutagenized with this approach and nine novel variants were recovered and characterized. Unlike a complete knockout system, the method allows recovery of both deleterious and functional variants.. The method can be used to study variants of any 5S rRNA in the E. coli context including those of E. coli.

  20. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA.

    Science.gov (United States)

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W Brad

    2009-05-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element.

  2. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  3. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    Science.gov (United States)

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  4. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  5. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  6. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  7. Genetic characterization and antimicrobial resistance of Staphylococcus aureus isolated from bovine milk in Tunisia.

    Science.gov (United States)

    Ben Said, M; Abbassi, M S; Bianchini, V; Sghaier, S; Cremonesi, P; Romanò, A; Gualdi, V; Hassen, A; Luini, M V

    2016-12-01

    Staphylococcus aureus is a major agent of bovine mastitis in dairy herds, causing economic losses in dairy industry worldwide. In addition, milk and milk-products contaminated by Staph. aureus can cause harmful human diseases. The aim of this study was to characterize Staph. aureus strains isolated from dairy farms in Tunisia. Bulk tank milk (n = 32) and individual cow milk (n = 130) samples were collected during the period of 2013-2014. Forty-three Staph. aureus isolates were recovered and typed by spa typing, 16S-23S rRNA intergenic spacer (RS-PCR) and multiplex PCRs for 22 virulence genes. Antimicrobial resistance was also investigated with a disc diffusion test. A selected subsample of 22 strains was additionally genotyped by multilocus sequence typing. Seventeen spa types were recovered, and t2421 (n = 10), t521 (n = 6) and t2112 (n = 5) were the most common. Fourteen different RS-PCR genotypes grouped into 11 clusters were detected in our study, with predominance of the R(VI) genotype (n = 24). Eight sequence types were identified and Clonal Complex 97, corresponding to RS-PCR cluster R, was the most common (n = 10), followed by CC1 (n = 4), CC15 (n = 3) and other four accounting for one or two strains. Different combinations of virulence genes were reported, and enterotoxin genes were present in few strains (seh, n = 4; sea, n = 2; sea and seh, n = 2; sec and sel, n = 2). The majority of strains were resistant only to penicillin; only one strain was found to be multiresistant and no methicillin-resistant Staph. aureus was demonstrated. Our study reported the isolation of CC97 from bovine milk in Tunisia for the first time and confirmed the relevance of this lineage in intramammary infection in cows. This paper describes the characteristics of Staphylococcus aureus isolated from bulk tank and individual cow milk in Tunisia. All strains were genotyped by spa typing and RS-PCR, a method based on the amplification of the 16S-23S rRNA

  8. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex.......The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...

  9. Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions.

    Science.gov (United States)

    Smirnov, A V; Entelis, N S; Krasheninnikov, I A; Martin, R; Tarassov, I A

    2008-12-01

    Small non-coding RNAs are today a topic of great interest for molecular biologists because they can be regarded as relicts of a hypothetical "RNA world" which, apparently, preceded the modern stage of organic evolution on Earth. The small molecule of 5S rRNA (approximately 120 nucleotides) is a component of large ribosomal subunits of all living beings (5S rRNAs are not found only in mitoribosomes of fungi and metazoans). This molecule interacts with various protein factors and 23S (28S) rRNA. This review contains the accumulated data to date concerning 5S rRNA structure, interactions with other biological macromolecules, intracellular traffic, and functions in the cell.

  10. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    Science.gov (United States)

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  11. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  12. Identification of Trichosporon spp. Strains by Sequencing D1/D2 Region and Sub-typing by Sequencing Ribosomal Intergenic Spacer Region of Ribosomal DNA

    Institute of Scientific and Technical Information of China (English)

    Jingsi ZENG; Cristina Maria de Souza Motta; Kazutaka Fukushima; Kayoko Takizawa; Oliane Maria Correia Magalhes; Rejane Pereira Neves; Kazuko Nishimura

    2009-01-01

    To re-identify and further group 25 isolates of Trichosporon spp. identified morphologically previously, sequences of D1/D2 region of large subunit (LSU) of ribosomal DNA (rDNA) of 25 tested strains for identification and those of ribosomal intergenic space 1 (IGS1) region of 11 strains for sub-grouping were detected. The identifications of tested strains were changed except 6 strains. According to the alignment of the IGS1 region, 6 T. asahii isolates tested fell into 4 groups and 5 T. faecale isolates into 3 groups. Polymorphism of 2 T.japonicum isolates was found in 10 positions. With the alignments obtained in this research compared with the relative GenBank entries, it was found that T. asahii, T.faecale and T.japonicum species were divided into 7, 3 and 2 subtypes respectively. Morphological and biophysical methods are not sufficient for Trichosporon spp. identification. Sequencing becomes neces-sary for Trichosporon diagnosis. There is obvious diversity within a species.

  13. Population genetic structure and phylogeographical pattern of a relict tree fern, Alsophila spinulosa (Cyatheaceae), inferred from cpDNA atpB- rbcL intergenic spacers.

    Science.gov (United States)

    Su, Yingjuan; Wang, Ting; Zheng, Bo; Jiang, Yu; Chen, Guopei; Gu, Hongya

    2004-11-01

    Sequences of chloroplast DNA (cpDNA) atpB- rbcL intergenic spacers of individuals of a tree fern species, Alsophila spinulosa, collected from ten relict populations distributed in the Hainan and Guangdong provinces, and the Guangxi Zhuang region in southern China, were determined. Sequence length varied from 724 bp to 731 bp, showing length polymorphism, and base composition was with high A+T content between 63.17% and 63.95%. Sequences were neutral in terms of evolution (Tajima's criterion D=-1.01899, P>0.10 and Fu and Li's test D*=-1.39008, P>0.10; F*=-1.49775, P>0.10). A total of 19 haplotypes were identified based on nucleotide variation. High levels of haplotype diversity (h=0.744) and nucleotide diversity (Dij=0.01130) were detected in A. spinulosa, probably associated with its long evolutionary history, which has allowed the accumulation of genetic variation within lineages. Both the minimum spanning network and neighbor-joining trees generated for haplotypes demonstrated that current populations of A. spinulosa existing in Hainan, Guangdong, and Guangxi were subdivided into two geographical groups. An analysis of molecular variance indicated that most of the genetic variation (93.49%, Phistory. Gene genealogies together with coalescent theory provided significant information for uncovering phylogeography of A. spinulosa.

  14. Ribosomic DNA intergenic spacer 1 region is useful when identifying Candida parapsilosis spp. complex based on high-resolution melting analysis.

    Science.gov (United States)

    Gago, Sara; Alastruey-Izquierdo, Ana; Marconi, Marco; Buitrago, María José; Kerhornou, Arnaud; Kersey, Paul J; Mellado, Emilia; Cuenca-Estrella, Manuel; Rodríguez-Tudela, Juan Luis; Cuesta, Isabel

    2014-07-01

    The epidemiology of Candida parapsilosis and the closely related species C. orthopsilosis and C. metapsilosis has changed in recent years, justify the need to identify this complex at the species level. In this study we investigate the intergenic spacer 1 (IGS1) of the ribosomal DNA (rDNA) to evaluate the utility of this gene region as a phylogenetic molecular marker and the suitability of a high-resolution melting (HRM) strategy based on this region for identification of members of the C. parapsilosis spp. complex. We sequenced the IGS1 and the internal transcribed spacer (ITS) regions of the rDNA from 33 C. parapsilosis sensu lato strains. Although both regions are useful in identifying species, comparative sequence analysis showed that the diversity in the IGS1 region was higher than in the ITS sequences. We also developed an HRM analysis that reliably identifies C. parapsilosis spp. complex based on the amplification of 70 bp in the IGS1 region. All isolates were correctly identified with a confidence interval >98%. Our results demonstrate that HRM analysis based on the IGS1 region is a powerful tool for distinguishing C. parapsilosis from cryptic species.

  15. Informational redundancy of tRNA(4Ser) and tRNA(7Ser) genes in Drosophila melanogaster and evidence for intergenic recombination.

    Science.gov (United States)

    Leung, J; Sinclair, D A; Hayashi, S; Tener, G M; Grigliatti, T A

    1991-05-20

    Variant tRNA genes have been widely observed in multicellular eukaryotes. Recent biochemical studies have shown that some of them are expressed in a tissue- or a stage-specific manner. These findings would thus imply that certain modified tRNAs may be crucial for the development of the organism. Using Drosophila melanogaster as a model, we have taken a combined genetic and molecular approach to examine critically the possible biological functions of tRNA(4, 7Ser) genes. We showed that at least 50% of the total templates can be deleted from the genome without inducing abnormal phenotypes such as Minute, or a decrease in viability. In addition, two of the tRNASer variant genes that are unique in sequence are also completely dispensable. This strongly implies that even though they may be expressed in vivo, they play no essential role in the development of the fruitfly. By comparison with some of the corresponding tRNA genes in another sibling species, Drosophila erecta, our results suggest strongly that the variants are products non-reciprocal exchanges among the tRNA(4, 7Ser), genes. Such intergenic recombination events may have a major influence in the concerted evolution of the two gene families.

  16. Molecular assessment of bacterial vaginosis by Lactobacillus abundance and species diversity.

    Science.gov (United States)

    Dols, Joke A M; Molenaar, Douwe; van der Helm, Jannie J; Caspers, Martien P M; de Kat Angelino-Bart, Alie; Schuren, Frank H J; Speksnijder, Adrianus G C L; Westerhoff, Hans V; Richardus, Jan Hendrik; Boon, Mathilde E; Reid, Gregor; de Vries, Henry J C; Kort, Remco

    2016-04-23

    To date, women are most often diagnosed with bacterial vaginosis (BV) using microscopy based Nugent scoring or Amsel criteria. However, the accuracy is less than optimal. The aim of the present study was to confirm the identity of known BV-associated composition profiles and evaluate indicators for BV using three molecular methods. Evaluation of indicators for BV was carried out by 16S rRNA amplicon sequencing of the V5-V7 region, a tailor-made 16S rRNA oligonucleotide-based microarray, and a PCR-based profiling technique termed IS-profiling, which is based on fragment variability of the 16S-23S rRNA intergenic spacer region. An inventory of vaginal bacterial species was obtained from 40 females attending a Dutch sexually transmitted infection outpatient clinic, of which 20 diagnosed with BV (Nugent score 7-10), and 20 BV negative (Nugent score 0-3). Analysis of the bacterial communities by 16S rRNA amplicon sequencing revealed two clusters in the BV negative women, dominated by either Lactobacillus iners or Lactobacillus crispatus and three distinct clusters in the BV positive women. In the former, there was a virtually complete, negative correlation between L. crispatus and L. iners. BV positive subjects showed cluster profiles that were relatively high in bacterial species diversity and dominated by anaerobic species, including Gardnerella vaginalis, and those belonging to the Families of Lachnospiraceae and Leptotrichiaceae. Accordingly, the Gini-Simpson index of species diversity, and the relative abundance Lactobacillus species appeared consistent indicators for BV. Under the conditions used, only the 16S rRNA amplicon sequencing method was suitable to assess species diversity, while all three molecular composition profiling methods were able to indicate Lactobacillus abundance in the vaginal microbiota. An affordable and simple molecular test showing a depletion of the genus Lactobacillus in combination with an increased species diversity of vaginal

  17. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  18. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Directory of Open Access Journals (Sweden)

    Shu Wu

    Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  19. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Science.gov (United States)

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  20. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    Science.gov (United States)

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  1. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Science.gov (United States)

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  2. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose

    OpenAIRE

    Rozier, Claude; Mache, Régis

    1984-01-01

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20° C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloropl...

  3. Phylogeny of protostome worms derived from 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  4. Survey of Bartonella spp. in U.S. bed bugs detects Burkholderia multivorans but not Bartonella.

    Science.gov (United States)

    Saenz, Virna L; Maggi, Ricardo G; Breitschwerdt, Edward B; Kim, Jung; Vargo, Edward L; Schal, Coby

    2013-01-01

    Bed bugs (Cimex lectularius L.) have resurged in the United States and globally. Bed bugs are hematophagous ectoparasites of humans and other animals, including domestic pets, chickens, and bats, and their blood feeding habits contribute to their potential as disease vectors. Several species of Bartonella are re-emergent bacterial pathogens that also affect humans, domestic pets, bats and a number of other wildlife species. Because reports of both bed bugs and Bartonella have been increasing in the U.S., and because their host ranges can overlap, we investigated whether the resurgences of these medically important pathogens and their potential vector might be linked, by screening for Bartonella spp. in bed bugs collected from geographic areas where these pathogens are prevalent and from bed bugs that have been in culture in the laboratory for several years. We screened a total of 331 bed bugs: 316 bed bugs from 36 unique collections in 29 geographic locations in 13 states, 10 bed bugs from two colonies maintained in the laboratory for 3 yr, and 5 bed bugs from a colony that has been in culture since before the recent resurgence of bed bugs. Bartonella spp. DNA was screened using a polymerase chain reaction assay targeting the 16S-23S rRNA intergenic transcribed spacer region. Bartonella DNA was not amplified from any bed bug, but five bed bugs from four different apartments of an elderly housing building in North Carolina contained DNA sequences that corresponded to Burkholderia multivorans, an important pathogen in nosocomial infections that was not previously linked to an arthropod vector.

  5. Genetic transformation of novel isolates of chicken Lactobacillus bearing probiotic features for expression of heterologous proteins: a tool to develop live oral vaccines

    Directory of Open Access Journals (Sweden)

    Neumann Elisabeth

    2006-01-01

    Full Text Available Abstract Background The use of lactic acid bacteria as vehicles to delivery antigens to immunize animals is a promising issue. When genetically modified, these bacteria can induce a specific local and systemic immune response against selected pathogens. Gastric acid and bile salts tolerance, production of antagonistic substances against pathogenic microorganisms, and adhesive ability to gut epithelium are other important characteristics that make these bacteria useful for oral immunization. Results Bacteria isolated on de Man, Rogosa and Sharpe medium (MRS from different gastrointestinal portions of broiler chicks were evaluated for their resistance to artificial gastric acid and bile salts, production of hydrogen peroxide, and cell surface hydrophobicity. Thirty-eight isolates were first typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR amplicons (PCR-ARDRA. An expression cassette was assembled onto the pCR2.1-Topo vector by cloning the promoter, leader peptide, cell wall anchor and terminator sequences derived from the laminin binding S-layer protein gene of L. crispatus strain F5.7 (lbs gene. A sequence encoding the green fluorescent protein (GFP was inserted as reporter gene, and an erythromycin resistance gene was added as selective marker. All constructs were able to express GFP in the cloning host E. coli XL1-Blue and different Lactobacillus strains as verified by FACS and laser scanning confocal microscopy. Conclusion Lactobacillus isolated from gastrointestinal tract of broiler chickens and selected for probiotic characteristics can be genetically modified by introducing an expression cassette into the lbs locus. The transformed bacteria expressed on its cell wall surface different fluorescent proteins used as reporters of promoter function. It is possible then that similar bacterial model

  6. Marine mesocosm bacterial colonisation of volcanic ash

    Science.gov (United States)

    Witt, Verena; Cimarelli, Corrado; Ayris, Paul; Kueppers, Ulrich; Erpenbeck, Dirk; Dingwell, Donald; Woerheide, Gert

    2015-04-01

    Volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, wind-delivered volcanic ash may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, which bacteria are involved in pioneer colonisation remain unknown. We hypothesize that physico-chemical properties (i.e., morphology, mineralogy) of the ash may dictate bacterial colonisation. The effect of substrate properties on bacterial colonisation was tested by exposing five substrates: i) quartz sand ii) crystalline ash (Sakurajima, Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size, in controlled marine coral reef aquaria under low light conditions for six months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis of Similarity supported significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community with the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community composition during colonisation of volcanic ash in a coral reef-like environment is controlled by the

  7. Genetic transformation of novel isolates of chicken Lactobacillus bearing probiotic features for expression of heterologous proteins: a tool to develop live oral vaccines

    Science.gov (United States)

    Mota, Rodrigo M; Moreira, João Luiz S; Souza, Marcelo R; Fátima Horta, M; Teixeira, Santuza MR; Neumann, Elisabeth; Nicoli, Jacques R; Nunes, Álvaro C

    2006-01-01

    Background The use of lactic acid bacteria as vehicles to delivery antigens to immunize animals is a promising issue. When genetically modified, these bacteria can induce a specific local and systemic immune response against selected pathogens. Gastric acid and bile salts tolerance, production of antagonistic substances against pathogenic microorganisms, and adhesive ability to gut epithelium are other important characteristics that make these bacteria useful for oral immunization. Results Bacteria isolated on de Man, Rogosa and Sharpe medium (MRS) from different gastrointestinal portions of broiler chicks were evaluated for their resistance to artificial gastric acid and bile salts, production of hydrogen peroxide, and cell surface hydrophobicity. Thirty-eight isolates were first typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR amplicons (PCR-ARDRA). An expression cassette was assembled onto the pCR2.1-Topo vector by cloning the promoter, leader peptide, cell wall anchor and terminator sequences derived from the laminin binding S-layer protein gene of L. crispatus strain F5.7 (lbs gene). A sequence encoding the green fluorescent protein (GFP) was inserted as reporter gene, and an erythromycin resistance gene was added as selective marker. All constructs were able to express GFP in the cloning host E. coli XL1-Blue and different Lactobacillus strains as verified by FACS and laser scanning confocal microscopy. Conclusion Lactobacillus isolated from gastrointestinal tract of broiler chickens and selected for probiotic characteristics can be genetically modified by introducing an expression cassette into the lbs locus. The transformed bacteria expressed on its cell wall surface different fluorescent proteins used as reporters of promoter function. It is possible then that similar bacterial model expressing pathogen antigens can

  8. Allelic Diversity and Population Structure in Oenococcus oeni as Determined from Sequence Analysis of Housekeeping Genes

    Science.gov (United States)

    de las Rivas, Blanca; Marcobal, Ángela; Muñoz, Rosario

    2004-01-01

    Oenococcus oeni is the organism of choice for promoting malolactic fermentation in wine. The population biology of O. oeni is poorly understood and remains unclear. For a better understanding of the mode of genetic variation within this species, we investigated by using multilocus sequence typing (MLST) with the gyrB, pgm, ddl, recP, and mleA genes the genetic diversity and genetic relationships among 18 O. oeni strains isolated in various years from wines of the United States, France, Germany, Spain, and Italy. These strains have also been characterized by ribotyping and restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S-23S rRNA gene intergenic spacer region (ISR). Ribotyping grouped the strains into two groups; however, the RFLP analysis of the ISRs showed no differences in the strains analyzed. In contrast, MLST in oenococci had a good discriminatory ability, and we have found a higher genetic diversity than indicated by ribotyping analysis. All sequence types were represented by a single strain, and all the strains could be distinguished from each other because they had unique combinations of alleles. Strains assumed to be identical showed the same sequence type. Phylogenetic analyses indicated a panmictic population structure in O. oeni. Sequences were analyzed for evidence of recombination by split decomposition analysis and analysis of clustered polymorphisms. All results indicated that recombination plays a major role in creating the genetic heterogeneity of O. oeni. A low standardized index of association value indicated that the O. oeni genes analyzed are close to linkage equilibrium. This study constitutes the first step in the development of an MLST method for O. oeni and the first example of the application of MLST to a nonpathogenic food production bacteria. PMID:15574919

  9. Survey of Bartonella spp. in U.S. bed bugs detects Burkholderia multivorans but not Bartonella.

    Directory of Open Access Journals (Sweden)

    Virna L Saenz

    Full Text Available Bed bugs (Cimex lectularius L. have resurged in the United States and globally. Bed bugs are hematophagous ectoparasites of humans and other animals, including domestic pets, chickens, and bats, and their blood feeding habits contribute to their potential as disease vectors. Several species of Bartonella are re-emergent bacterial pathogens that also affect humans, domestic pets, bats and a number of other wildlife species. Because reports of both bed bugs and Bartonella have been increasing in the U.S., and because their host ranges can overlap, we investigated whether the resurgences of these medically important pathogens and their potential vector might be linked, by screening for Bartonella spp. in bed bugs collected from geographic areas where these pathogens are prevalent and from bed bugs that have been in culture in the laboratory for several years. We screened a total of 331 bed bugs: 316 bed bugs from 36 unique collections in 29 geographic locations in 13 states, 10 bed bugs from two colonies maintained in the laboratory for 3 yr, and 5 bed bugs from a colony that has been in culture since before the recent resurgence of bed bugs. Bartonella spp. DNA was screened using a polymerase chain reaction assay targeting the 16S-23S rRNA intergenic transcribed spacer region. Bartonella DNA was not amplified from any bed bug, but five bed bugs from four different apartments of an elderly housing building in North Carolina contained DNA sequences that corresponded to Burkholderia multivorans, an important pathogen in nosocomial infections that was not previously linked to an arthropod vector.

  10. Diversity and biogeography of rhizobia isolated from root nodules of Glycine max grown in Hebei Province, China.

    Science.gov (United States)

    Li, Qin Qin; Wang, En Tao; Zhang, Yun Zeng; Zhang, Yan Ming; Tian, Chang Fu; Sui, Xin Hua; Chen, Wen Feng; Chen, Wen Xin

    2011-05-01

    A total of 215 rhizobial strains were isolated and analyzed with 16S rRNA gene, 16S-23S intergenic spacer, housekeeping genes atpD, recA, and glnII, and symbiotic genes nifH and nodC to understand the genetic diversity of soybean rhizobia in Hebei province, China. All the strains except one were symbiotic bacteria classified into nine genospecies in the genera of Bradyrhizobium and Sinorhizobium. Surveys on the distribution of these rhizobia in different regions showed that Bradyrhizobium japonicum and Bradyrhizobium elkanii strains were found only in neutral to slightly alkaline soils whereas Bradyrhizobium yuanmingense, Bradyrhizobium liaoningense-related strains and strains of five Sinorhizobium genospecies were found in alkaline-saline soils. Correspondence and canonical correspondence analyses on the relationship of rhizobial distribution and their soil characteristics reveal that high soil pH, electrical conductivity, and potassium content favor distribution of the B. yuanmingense and the five Sinorhizobium species but inhibit B. japonicum and B. elkanii. High contents of available phosphorus and organic matters benefit Sinorhizobium fredii and B. liaoningense-related strains and inhibit the others groups mentioned above. The symbiotic gene (nifH and nodC) lineages among B. elkanii, B. japonicum, B. yuanmingense, and Sinorhizobium spp. were observed in the strains, signifying that vertical gene transfer was the main mechanism to maintain these genes in the soybean rhizobia. However, lateral transfer of symbiotic genes commonly in Sinorhizobium spp. and rarely in Bradyrhizobium spp. was also detected. These results showed the genetic diversity, the biogeography, and the soil determinant factors of soybean rhizobia in Hebei province of China.

  11. Distinguishing bacterial pathogens of potato using a genome-wide microarray approach.

    Science.gov (United States)

    Aittamaa, M; Somervuo, P; Pirhonen, M; Mattinen, L; Nissinen, R; Auvinen, P; Valkonen, J P T

    2008-09-01

    A set of 9676 probes was designed for the most harmful bacterial pathogens of potato and tested in a microarray format. Gene-specific probes could be designed for all genes of Pectobacterium atrosepticum, c. 50% of the genes of Streptomyces scabies and c. 30% of the genes of Clavibacter michiganensis ssp. sepedonicus utilizing the whole-genome sequence information available. For Streptomyces turgidiscabies, 226 probes were designed according to the sequences of a pathogenicity island containing important virulence genes. In addition, probes were designed for the virulence-associated nip (necrosis-inducing protein) genes of P. atrosepticum, P. carotovorum and Dickeya dadantii and for the intergenic spacer (IGS) sequences of the 16S-23S rRNA gene region. Ralstonia solanacearum was not included in the study, because it is a quarantine organism and is not presently found in Finland, but a few probes were also designed for this species. The probes contained on average 40 target-specific nucleotides and were synthesized on the array in situ, organized as eight sub-arrays with an identical set of probes which could be used for hybridization with different samples. All bacteria were readily distinguished using a single channel system for signal detection. Nearly all of the c. 1000 probes designed for C. michiganensis ssp. sepedonicus, c. 50% and 40% of the c. 4000 probes designed for the genes of S. scabies and P. atrosepticum, respectively, and over 100 probes for S. turgidiscabies showed significant signals only with the respective species. P. atrosepticum, P. carotovorum and Dickeya strains were all detected with 110 common probes. By contrast, the strains of these species were found to differ in their signal profiles. Probes targeting the IGS region and nip genes could be used to place strains of Dickeya to two groups, which correlated with differences in virulence. Taken together, the approach of using a custom-designed, genome-wide microarray provided a robust means

  12. Borrelia burgdorferi genetic markers and disseminated disease in patients with early Lyme disease.

    Science.gov (United States)

    Jones, Kathryn L; Glickstein, Lisa J; Damle, Nitin; Sikand, Vijay K; McHugh, Gail; Steere, Allen C

    2006-12-01

    Three genetic markers of Borrelia burgdorferi have been associated with disseminated disease: the OspC type, the 16S-23S rRNA intergenic spacer type (RST), and vlsE. Here, we modified previous methods so as to identify the three markers by PCR and restriction fragment length polymorphism in parallel, analyzed B. burgdorferi isolates from erythema migrans (EM) skin lesions in 91 patients, and correlated the results with evidence of dissemination. OspC type A was found approximately twice as frequently in patients with disseminated disease, whereas type K was identified approximately twice as often in those without evidence of dissemination, but these trends were not statistically significant. The remaining seven types identified were found nearly equally in patients with or without evidence of dissemination. RST 1 strains were significantly associated with dissemination (P=0.03), whereas RST 2 and RST 3 strains tended to have an inverse association with this outcome. The vlsE gene was identified in all 91 cases, using primer sets specific for an N-terminal sequence of B. burgdorferi strain B31 (vlsEB31) or strain 297 (vlsE297), but neither marker was associated with dissemination. Specific combinations of the three genetic markers usually occurred together. OspC type A was always found with RST 1 and vlsEB31, type K was always identified with RST 2 and more often with vlsE297, and types E and I were almost always found with RST 3 and equally often with vlsEB31 and vlsE297. We conclude that B. burgdorferi strains vary in their capacity to disseminate, but almost all strains isolated from EM lesions sometimes caused disseminated disease.

  13. Analysis of Borrelia burgdorferi Genotypes in Patients with Lyme Arthritis: High Frequency of RST 1 Strains in Antibiotic-Refractory Arthritis

    Science.gov (United States)

    Jones, Kathryn L.; McHugh, Gail A.; Glickstein, Lisa J.; Steere, Allen C.

    2009-01-01

    Objective Most of the B. burgdorferi genotypes have been isolated from erythema migrans (EM) skin lesions in patients with Lyme disease; outer-surface protein C (OspC) type K strains, which are 16S-23S rRNA intergenic spacer type 2 (RST 2), are most commonly recovered, but a higher percentage of OspC type A strains (RST 1), the next most common type, are detectable in blood. Our goals were to determine the B. burgdorferi genotypes in the joints of patients with Lyme arthritis. Methods Joint fluid samples from 124 patients seen over a 30-year period were analyzed for OspC types by semi-nested PCR and sequencing, and for RST by nested PCR and RFLP techniques. This information was correlated with clinical outcome. Results OspC and RST genotypes could be determined in 49 of the 124 joint fluid samples (40%). Of the 49 samples, 21 (43%) were OspC type K (RST 2), 11 (22%) were type A (RST 1), and 17 (35%) were distributed among 8 other OspC types and all 3 RSTs. However, among 17 patients who received current antibiotic regimens, all 7 infected with RST 1 strains had antibiotic-refractory arthritis compared with 4 of 6 patients infected with RST 2 strains and only 1 of 4 infected with RST 3 strains (P=0.03). Conclusions Most of the B. burgdorferi genotypes infected the joints of patients with Lyme arthritis, particularly OspC type K (RST 2); and genotype frequencies reflected those in EM skin lesions. However, RST 1 strains were most frequent in patients with antibiotic-refractory arthritis. PMID:19565522

  14. Borrelia burgdorferi Genetic Markers and Disseminated Disease in Patients with Early Lyme Disease▿

    Science.gov (United States)

    Jones, Kathryn L.; Glickstein, Lisa J.; Damle, Nitin; Sikand, Vijay K.; McHugh, Gail; Steere, Allen C.

    2006-01-01

    Three genetic markers of Borrelia burgdorferi have been associated with disseminated disease: the OspC type, the 16S-23S rRNA intergenic spacer type (RST), and vlsE. Here, we modified previous methods so as to identify the three markers by PCR and restriction fragment length polymorphism in parallel, analyzed B. burgdorferi isolates from erythema migrans (EM) skin lesions in 91 patients, and correlated the results with evidence of dissemination. OspC type A was found approximately twice as frequently in patients with disseminated disease, whereas type K was identified approximately twice as often in those without evidence of dissemination, but these trends were not statistically significant. The remaining seven types identified were found nearly equally in patients with or without evidence of dissemination. RST 1 strains were significantly associated with dissemination (P = 0.03), whereas RST 2 and RST 3 strains tended to have an inverse association with this outcome. The vlsE gene was identified in all 91 cases, using primer sets specific for an N-terminal sequence of B. burgdorferi strain B31 (vlsEB31) or strain 297 (vlsE297), but neither marker was associated with dissemination. Specific combinations of the three genetic markers usually occurred together. OspC type A was always found with RST 1 and vlsEB31, type K was always identified with RST 2 and more often with vlsE297, and types E and I were almost always found with RST 3 and equally often with vlsEB31 and vlsE297. We conclude that B. burgdorferi strains vary in their capacity to disseminate, but almost all strains isolated from EM lesions sometimes caused disseminated disease. PMID:17035489

  15. Mycoplasma corogypsi associated polyarthritis and tenosynovitis in black vultures (Coragyps atratus)

    Science.gov (United States)

    Van Wettere, A. J.; Ley, D. H.; Scott, D. E.; Buckanoff, H. D.; Degernes, L. A.

    2013-01-01

    Three wild American black vultures (Coragyps atratus) were presented to rehabilitation centers with swelling of multiple joints, including elbows, stifles, hocks, and carpal joints, and of the gastrocnemius tendons. Cytological examination of the joint fluid exudate indicated heterophilic arthritis. Radiographic examination in 2 vultures demonstrated periarticular soft tissue swelling in both birds and irregular articular surfaces with subchondral bone erosion in both elbows in 1 bird. Prolonged antibiotic therapy administered in 2 birds did not improve the clinical signs. Necropsy and histological examination demonstrated a chronic lymphoplasmacytic arthritis involving multiple joints and gastrocnemius tenosynovitis. Articular lesions varied in severity and ranged from moderate synovitis and cartilage erosion and fibrillation to severe synovitis, diffuse cartilage ulceration, subchondral bone loss and/or sclerosis, pannus, synovial cysts, and epiphyseal osteomyelitis. No walled bacteria were observed or isolated from the joints. However, mycoplasmas polymerase chain reactions were positive in at least 1 affected joint from each bird. Mycoplasmas were isolated from joints of 1 vulture that did not receive antibiotic therapy. Sequencing of 16S rRNA gene amplicons from joint samples and the mycoplasma isolate identified Mycoplasma corogypsi in 2 vultures and was suggestive in the third vulture. Mycoplasma corogypsi identification was confirmed by sequencing the 16S-23S intergenic spacer region of mycoplasma isolates. This report provides further evidence that M. corogypsi is a likely cause of arthritis and tenosynovitis in American black vultures. Cases of arthritis and tenosynovitis in New World vultures should be investigated for presence of Mycoplasma spp, especially M. corogypsi. PMID:22903399

  16. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  17. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  18. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gen

  19. Rapid identification of rumen protozoa by restriction analysis of amplified 18S rRNA gene

    NARCIS (Netherlands)

    Regensbogenova, M.; Kisidayova, S.; Michalowski, T.; Javorsky, P.; Moon-van der Staay, S.Y.; Hackstein, J.H.P.; McEwan, N.R.; Jouany, J.P.; Newbold, J.C.; Pristas, P.

    2004-01-01

    A rapid method has been developed for molecular identification of rumen ciliates without the need for cultivation. Total DNA was isolated from single protozoal cells by the Chelex method and nearly complete protozoal 18S rRNA genes were amplified and subjected to restriction fragment length polymorp

  20. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  1. NOF1 encodes an Arabidopsis protein involved in the control of rRNA expression.

    Directory of Open Access Journals (Sweden)

    Erwana Harscoët

    Full Text Available The control of ribosomal RNA biogenesis is essential for the regulation of protein synthesis in eukaryotic cells. Here, we report the characterization of NOF1 that encodes a putative nucleolar protein involved in the control of rRNA expression in Arabidopsis. The gene has been isolated by T-DNA tagging and its function verified by the characterization of a second allele and genetic complementation of the mutants. The nof1 mutants are affected in female gametogenesis and embryo development. This result is consistent with the detection of NOF1 mRNA in all tissues throughout plant life's cycle, and preferentially in differentiating cells. Interestingly, the closely related proteins from zebra fish and yeast are also necessary for cell division and differentiation. We showed that the nof1-1 mutant displays higher rRNA expression and hypomethylation of rRNA promoter. Taken together, the results presented here demonstrated that NOF1 is an Arabidopsis gene involved in the control of rRNA expression, and suggested that it encodes a putative nucleolar protein, the function of which may be conserved in eukaryotes.

  2. Direct regulation of rRNA transcription by fibroblast growth factor 2.

    Science.gov (United States)

    Sheng, Zhi; Liang, Yanping; Lin, Chih-Yin; Comai, Lucio; Chirico, William J

    2005-11-01

    Fibroblast growth factor 2 (FGF-2), which is highly expressed in developing tissues and malignant cells, regulates cell growth, differentiation, and migration. Five isoforms (18 to approximately 34 kDa) of FGF-2 are derived from alternative initiation codons of a single mRNA. The 18-kDa FGF-2 isoform is released from cells by a nonclassical secretory pathway and regulates gene expression by binding to cell surface receptors. This isoform also localizes to the nucleolus, raising the possibility that it may directly regulate ribosome biogenesis, a rate-limiting process in cell growth. Although several growth factors have been shown to accumulate in the nucleolus, their function and mechanism of action remain unclear. Here we show that 18-kDa FGF-2 interacts with upstream binding factor (UBF), an architectural transcription factor essential for rRNA transcription. The maximal activation of rRNA transcription in vitro by 18-kDa FGF-2 requires UBF. The 18-kDa FGF-2 localizes to rRNA genes and is necessary for the full activation of pre-rRNA synthesis in vivo. Our results demonstrate that 18-kDa FGF-2 directly regulates rRNA transcription.

  3. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    Science.gov (United States)

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  4. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten;

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  5. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...

  6. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S rRNA a...

  7. Changes in the conformation of 5S rRNA cause alterations in principal functions of the ribosomal nanomachine.

    Science.gov (United States)

    Kouvela, Ekaterini C; Gerbanas, George V; Xaplanteri, Maria A; Petropoulos, Alexandros D; Dinos, George P; Kalpaxis, Dimitrios L

    2007-01-01

    5S rRNA is an integral component of the large ribosomal subunit in virtually all living organisms. Polyamine binding to 5S rRNA was investigated by cross-linking of N1-azidobenzamidino (ABA)-spermine to naked 5S rRNA or 50S ribosomal subunits and whole ribosomes from Escherichia coli cells. ABA-spermine cross-linking sites were kinetically measured and their positions in 5S rRNA were localized by primer extension analysis. Helices III and V, and loops A, C, D and E in naked 5S rRNA were found to be preferred polyamine binding sites. When 50S ribosomal subunits or poly(U)-programmed 70S ribosomes bearing tRNA(Phe) at the E-site and AcPhe-tRNA at the P-site were targeted, the susceptibility of 5S rRNA to ABA-spermine was greatly reduced. Regardless of 5S rRNA assembly status, binding of spermine induced significant changes in the 5S rRNA conformation; loop A adopted an apparent 'loosening' of its structure, while loops C, D, E and helices III and V achieved a more compact folding. Poly(U)-programmed 70S ribosomes possessing 5S rRNA cross-linked with spermine were more efficient than control ribosomes in tRNA binding, peptidyl transferase activity and translocation. Our results support the notion that 5S rRNA serves as a signal transducer between regions of 23S rRNA responsible for principal ribosomal functions.

  8. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  9. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  10. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  11. Growth increase of Arabidopsis by forced expression of rice 45S rRNA gene.

    Science.gov (United States)

    Makabe, So; Motohashi, Reiko; Nakamura, Ikuo

    2017-02-01

    Forced expression of rice 45S rRNA gene conferred ca. 2-fold increase of above-ground growth in transgenic Arabidopsis . This growth increase was probably brought by cell proliferation, not by cell enlargement. Recent increase in carbon dioxide emissions is causing global climate change. The use of plant biomass as alternative energy source is one way to reduce these emissions. Therefore, reinforcement of plant biomass production is an urgent key issue to overcome both depletion of fossil energies and emission of carbon dioxide. Here, we created transgenic Arabidopsis with a 2-fold increase in above-ground growth by forced expression of the rice 45S rRNA gene using the maize ubiquitin promoter. Although the size of guard cells and ploidy of leaf-cells were similar between transgenic and control plants, numbers of stomata and pavement cells were much increased in the transgenic leaf. This data suggested that cell number, not cell expansion, was responsible for the growth increase, which might be brought by the forced expression of exogenous and full-length 45S rRNA gene. The expression level of rice 45S rRNA transcripts was very low, possibly triggering unknown machinery to enhance cell proliferation. Although microarray analysis showed enhanced expression of ethylene-responsive transcription factors, these factors might respond to ethylene induced by abiotic/biotic stresses or genomic incompatibility, which might be involved in the expression of species-specific internal transcribed spacer (ITS) sequences within rice 45S rRNA transcripts. Further analysis of the mechanism underlying the growth increase will contribute to understanding the regulation of the cell proliferation and the mechanism of hybrid vigor.

  12. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  13. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    Science.gov (United States)

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  14. Fleas and Flea-Associated Bartonella Species in Dogs and Cats from Peru.

    Science.gov (United States)

    Rizzo, M F; Billeter, S A; Osikowicz, L; Luna-Caipo, D V; Cáceres, A G; Kosoy, M

    2015-11-01

    In the present study, we investigated 238 fleas collected from cats and dogs in three regions of Peru (Ancash, Cajamarca, and Lima) for the presence of Bartonella DNA. Bartonella spp. were detected by amplification of the citrate synthase gene (16.4%) and the 16S-23S intergenic spacer region (20.6%). Bartonella rochalimae was the most common species detected followed by Bartonella clarridgeiae and Bartonella henselae. Our results demonstrate that dogs and cats in Peru are infested with fleas harboring zoonotic Bartonella spp. and these infected fleas could pose a disease risk for humans.

  15. Expression of Trypanosoma cruzi surface antigen FL-160 is controlled by elements in the 3' untranslated, the 3' intergenic, and the coding regions.

    Science.gov (United States)

    Weston, D; La Flamme, A C; Van Voorhis, W C

    1999-07-30

    The FL-160 surface antigen gene family of T. cruzi consists of hundreds of members of 160 kDa glycoproteins expressed in trypomastigotes, but not in epimastigotes. Steady-state levels of FL-160 mRNA were 80 to 100-fold higher in trypomastigotes than in epimastigotes, yet transcription rates were equivalent between the lifecycle stages. Luciferase reporter constructs demonstrated that the 3' untranslated region (UTR) and intergenic region (IR) following the coding sequence of FL-160 was sufficient to generate 8-fold higher luciferase expression in trypomastigotes compared with epimastigotes. Transfection of 3' UTR/IR deletion constructs revealed cis-acting elements which conferred a trypomastigote-specific expression pattern similar to that of FL-160. Parasites treated with translation and transcription inhibitors, cyclohexamide and Actinomycin D, respectively, displayed a stage-specific pattern of FL-160 mRNA degradation. Epimastigotes, but not trypomastigotes, treated with the inhibitors accumulated a 1.4 Kb FL-160 cleavage product. The cleavage site mapped to a 31 base poly-purine tract in the FL-160 coding region. The first 526 aa of FL-160, containing the 31 base poly-purine tract and several smaller tracts, were fused to green fluorescent protein (GFP) and expressed from the T. cruzi tubulin locus. Stable transformants expressed 4-fold more FL-160:GFP fusion mRNA and 12-fold more fusion protein in the trypomastigote stage than in the epimastigote stage suggesting post-transcriptional and translational control elements. These data reveal at least two distinct control mechanisms for trypomastigote-specific expression of FL-160 surface glycoproteins, one involving the 3' UTR/IR and one involving the coding region of FL-160.

  16. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  17. Trypanosoma cruzi I genotypes in different geographical regions and transmission cycles based on a microsatellite motif of the intergenic spacer of spliced-leader genes.

    Science.gov (United States)

    Cura, Carolina I; Mejía-Jaramillo, Ana M; Duffy, Tomás; Burgos, Juan M; Rodriguero, Marcela; Cardinal, Marta V; Kjos, Sonia; Gurgel-Gonçalves, Rodrigo; Blanchet, Denis; De Pablos, Luis M; Tomasini, Nicolás; da Silva, Alexandre; Russomando, Graciela; Cuba, Cesar A Cuba; Aznar, Christine; Abate, Teresa; Levin, Mariano J; Osuna, Antonio; Gürtler, Ricardo E; Diosque, Patricio; Solari, Aldo; Triana-Chávez, Omar; Schijman, Alejandro G

    2010-12-01

    The intergenic region of spliced-leader (SL-IR) genes from 105 Trypanosoma cruzi I (Tc I) infected biological samples, culture isolates and stocks from 11 endemic countries, from Argentina to the USA were characterised, allowing identification of 76 genotypes with 54 polymorphic sites from 123 aligned sequences. On the basis of the microsatellite motif proposed by Herrera et al. (2007) to define four haplotypes in Colombia, we could classify these genotypes into four distinct Tc I SL-IR groups, three corresponding to the former haplotypes Ia (11 genotypes), Ib (11 genotypes) and Id (35 genotypes); and one novel group, Ie (19 genotypes). Genotypes harbouring the Tc Ic motif were not detected in our study. Tc Ia was associated with domestic cycles in southern and northern South America and sylvatic cycles in Central and North America. Tc Ib was found in all transmission cycles from Colombia. Tc Id was identified in all transmission cycles from Argentina and Colombia, including Chagas cardiomyopathy patients, sylvatic Brazilian samples and human cases from French Guiana, Panama and Venezuela. Tc Ie gathered five samples from domestic Triatoma infestans from northern Argentina, nine samples from wild Mepraia spinolai and Mepraia gajardoi and two chagasic patients from Chile and one from a Bolivian patient with chagasic reactivation. Mixed infections by Tc Ia+Tc Id, Tc Ia+Tc Ie and Tc Id+Tc Ie were detected in vector faeces and isolates from human and vector samples. In addition, Tc Ia and Tc Id were identified in different tissues from a heart transplanted Chagas cardiomyopathy patient with reactivation, denoting histotropism. Trypanosoma cruzi I SL-IR genotypes from parasites infecting Triatoma gerstaeckeri and Didelphis virginiana from USA, T. infestans from Paraguay, Rhodnius nasutus and Rhodnius neglectus from Brazil and M. spinolai and M. gajardoi from Chile are to our knowledge described for the first time.

  18. Evolution of the rpoB-psbZ region in fern plastid genomes: notable structural rearrangements and highly variable intergenic spacers

    Directory of Open Access Journals (Sweden)

    Su Ying-Juan

    2011-04-01

    Full Text Available Abstract Background The rpoB-psbZ (BZ region of some fern plastid genomes (plastomes has been noted to go through considerable genomic changes. Unraveling its evolutionary dynamics across all fern lineages will lead to clarify the fundamental process shaping fern plastome structure and organization. Results A total of 24 fern BZ sequences were investigated with taxon sampling covering all the extant fern orders. We found that: (i a tree fern Plagiogyria japonica contained a novel gene order that can be generated from either the ancestral Angiopteris type or the derived Adiantum type via a single inversion; (ii the trnY-trnE intergenic spacer (IGS of the filmy fern Vandenboschia radicans was expanded 3-fold due to the tandem 27-bp repeats which showed strong sequence similarity with the anticodon domain of trnY; (iii the trnY-trnE IGSs of two horsetail ferns Equisetum ramosissimum and E. arvense underwent an unprecedented 5-kb long expansion, more than a quarter of which was consisted of a single type of direct repeats also relevant to the trnY anticodon domain; and (iv ycf66 has independently lost at least four times in ferns. Conclusions Our results provided fresh insights into the evolutionary process of fern BZ regions. The intermediate BZ gene order was not detected, supporting that the Adiantum type was generated by two inversions occurring in pairs. The occurrence of Vandenboschia 27-bp repeats represents the first evidence of partial tRNA gene duplication in fern plastomes. Repeats potentially forming a stem-loop structure play major roles in the expansion of the trnY-trnE IGS.

  19. Existence of HbF Enhancer Haplotypes at HBS1L-MYB Intergenic Region in Transfusion-Dependent Saudi β-Thalassemia Patients

    Directory of Open Access Journals (Sweden)

    Cyril Cyrus

    2017-01-01

    Full Text Available Background and Objectives. β-Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β-globin chain production, respectively. The elevation of fetal hemoglobin (HbF can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs, BCL11A, HBG2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β-thalassemia patients. Materials and Methods. A total of 174 transfusion-dependent β-thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs from the three QTL regions using TaqMan assay on real-time PCR. Results. Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p=0.0009, rs9399137C p=0.008, rs4895441G p=0.004, rs9389269C p=0.008, rs9402686A p=0.008, and rs9494142C p=0.002 were predominantly associated with β-thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p=0.022 and HBG2 (GTT p=0.009 were also predominantly associated with β-thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion. The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β-thalassemia.

  20. Existence of HbF Enhancer Haplotypes at HBS1L-MYB Intergenic Region in Transfusion-Dependent Saudi β-Thalassemia Patients.

    Science.gov (United States)

    Cyrus, Cyril; Vatte, Chittibabu; Borgio, J Francis; Al-Rubaish, Abdullah; Chathoth, Shahanas; Nasserullah, Zaki A; Jarrash, Sana Al; Sulaiman, Ahmed; Qutub, Hatem; Alsaleem, Hassan; Alzahrani, Alhusain J; Steinberg, Martin H; Ali, Amein K Al

    2017-01-01

    Background and Objectives. β-Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β-globin chain production, respectively. The elevation of fetal hemoglobin (HbF) can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs), BCL11A, HBG2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β-thalassemia patients. Materials and Methods. A total of 174 transfusion-dependent β-thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs) from the three QTL regions using TaqMan assay on real-time PCR. Results. Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p = 0.0009, rs9399137C p = 0.008, rs4895441G p = 0.004, rs9389269C p = 0.008, rs9402686A p = 0.008, and rs9494142C p = 0.002) were predominantly associated with β-thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p = 0.022) and HBG2 (GTT p = 0.009) were also predominantly associated with β-thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion. The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β-thalassemia.

  1. Analysis of stress-induced duplex destabilization (SIDD properties of replication origins, genes and intergenes in the fission yeast, Schizosaccharomyces pombe

    Directory of Open Access Journals (Sweden)

    Yadav Mukesh P

    2012-11-01

    Full Text Available Abstract Background Replication and transcription, the two key functions of DNA, require unwinding of the DNA double helix. It has been shown that replication origins in the budding yeast, Saccharomyces cerevisiae contain an easily unwound stretch of DNA. We have used a recently developed method for determining the locations and degrees of stress-induced duplex destabilization (SIDD for all the reported replication origins in the genome of the fission yeast, Schizosaccharomyces pombe. Results We have found that the origins are more susceptible to SIDD as compared to the non-origin intergenic regions (NOIRs and genes. SIDD analysis of many known origins in other eukaryotes suggests that SIDD is a common property of replication origins. Interestingly, the previously shown deletion-dependent changes in the activities of the origins of the ura4 origin region on chromosome 3 are paralleled by changes in SIDD properties, suggesting SIDD’s role in origin activity. SIDD profiling following in silico deletions of some origins suggests that many of the closely spaced S. pombe origins could be clusters of two or three weak origins, similar to the ura4 origin region. Conclusion SIDD appears to be a highly conserved, functionally important property of replication origins in S. pombe and other organisms. The distinctly low SIDD scores of origins and the long range effects of genetic alterations on SIDD properties provide a unique predictive potential to the SIDD analysis. This could be used in exploring different aspects of structural and functional organization of origins including interactions between closely spaced origins.

  2. Trypanosoma cruzi I genotypes in different geographic regions and transmission cycles based on a microsatellite motif of the intergenic spacer of spliced leader genes✯

    Science.gov (United States)

    Cura, Carolina I.; Mejía-Jaramillo, Ana M.; Duffy, Tomás; Burgos, Juan M.; Rodriguero, Marcela; Cardinal, Marta V.; Kjos, Sonia; Gurgel-Gonçalves, Rodrigo; Blanchet, Denis; De Pablos, Luis M.; Tomasini, Nicolás; Silva, Alex Da; Russomando, Graciela; Cuba Cuba, Cesar A.; Aznar, Christine; Abate, Teresa; Levin, Mariano J.; Osuna, Antonio; Gürtler, Ricardo E.; Diosque, Patricio; Solari, Aldo; Triana-Chávez, Omar; Schijman, Alejandro G.

    2011-01-01

    The intergenic region of spliced-leader (SL-IR) genes from 105 Trypanosoma cruzi I (Tc I) infected biological samples, culture isolates and stocks from 11 endemic countries, from Argentina to the USA were characterised, allowing identification of 76 genotypes with 54 polymorphic sites from 123 aligned sequences. On the basis of the microsatellite motif proposed by Herrera et al. (2007) to define four haplotypes in Colombia, we could classify these genotypes into four distinct Tc I SL-IR groups, three corresponding to the former haplotypes Ia (11 genotypes), Ib (11 genotypes) and Id (35 genotypes); and one novel group, Ie (19 genotypes). Genotypes harboring the Tc Ic motif were not detected in our study. Tc Ia was associated with domestic cycles in southern and northern South America and sylvatic cycles in Central and North America. Tc Ib was found in all transmission cycles from Colombia. Tc Id was identified in all transmission cycles from Argentina and Colombia, including Chagas cardiomyopathy patients, sylvatic Brazilian samples and human cases from French Guiana, Panama and Venezuela. Tc Ie gathered five samples from domestic Triatoma infestans from northern Argentina, nine samples from wild Mepraia spinolai and Mepraia gajardoi and two chagasic patients from Chile and one from a Bolivian patient with chagasic reactivation. Mixed infections by Tc Ia + Tc Id, Tc Ia + Tc Ie and Tc Id + Tc Ie were detected in vector faeces and isolates from human and vector samples. In addition, Tc Ia and Tc Id were identified in different tissues from a heart transplanted Chagas cardiomyopathy patient with reactivation, denoting histotropism. Trypanosoma cruzi I SL-IR genotypes from parasites infecting Triatoma gerstaeckeri and Didelphis virginiana from USA, T. infestans from Paraguay, Rhodnius nasutus and Rhodnius neglectus from Brazil and M. spinolai and M. gajardoi from Chile are to our knowledge described for the first time. PMID:20670628

  3. Existence of HbF Enhancer Haplotypes at HBS1L-MYB Intergenic Region in Transfusion-Dependent Saudi β-Thalassemia Patients

    Science.gov (United States)

    Vatte, Chittibabu; Borgio, J. Francis; Al-Rubaish, Abdullah; Nasserullah, Zaki A.; Jarrash, Sana Al; Sulaiman, Ahmed; Qutub, Hatem; Alsaleem, Hassan; Alzahrani, Alhusain J.; Steinberg, Martin H.

    2017-01-01

    Background and Objectives. β-Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β-globin chain production, respectively. The elevation of fetal hemoglobin (HbF) can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs), BCL11A, HBG2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β-thalassemia patients. Materials and Methods. A total of 174 transfusion-dependent β-thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs) from the three QTL regions using TaqMan assay on real-time PCR. Results. Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p = 0.0009, rs9399137C p = 0.008, rs4895441G p = 0.004, rs9389269C p = 0.008, rs9402686A p = 0.008, and rs9494142C p = 0.002) were predominantly associated with β-thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p = 0.022) and HBG2 (GTT p = 0.009) were also predominantly associated with β-thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion. The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β-thalassemia. PMID:28280727

  4. Genotypic Characterization of Escherichia coli O157:H7 Isolates from Different Sources in the North-West Province, South Africa, Using Enterobacterial Repetitive Intergenic Consensus PCR Analysis

    Directory of Open Access Journals (Sweden)

    Collins Njie Ateba

    2014-05-01

    Full Text Available In many developing countries, proper hygiene is not strictly implemented when animals are slaughtered and meat products become contaminated. Contaminated meat may contain Escherichia coli (E. coli O157:H7 that could cause diseases in humans if these food products are consumed undercooked. In the present study, a total of 94 confirmed E. coli O157:H7 isolates were subjected to the enterobacterial repetitive intergenic consensus (ERIC polymerase chain reaction (PCR typing to generate genetic fingerprints. The ERIC fragments were resolved by electrophoresis on 2% (w/v agarose gels. The presence, absence and intensity of band data were obtained, exported to Microsoft Excel (Microsoft Office 2003 and used to generate a data matrix. The unweighted pair group method with arithmetic mean (UPGMA and complete linkage algorithms were used to analyze the percentage of similarity and matrix data. Relationships between the various profiles and/or lanes were expressed as dendrograms. Data from groups of related lanes were compiled and reported on cluster tables. ERIC fragments ranged from one to 15 per isolate, and their sizes varied from 0.25 to 0.771 kb. A large proportion of the isolates produced an ERIC banding pattern with three duplets ranging in sizes from 0.408 to 0.628 kb. Eight major clusters (I–VIII were identified. Overall, the remarkable similarities (72% to 91% between the ERIC profiles for the isolate from animal species and their corresponding food products indicated some form of contamination, which may not exclude those at the level of the abattoirs. These results reveal that ERIC PCR analysis can be reliable in comparing the genetic profiles of E. coli O157:H7 from different sources in the North-West Province of South Africa.

  5. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features.

    Directory of Open Access Journals (Sweden)

    Matthew Wohlgemuth Blair

    Full Text Available Highly polymorphic markers such as simple sequence repeats (SSRs or microsatellites are very useful for genetic mapping. In this study novel SSRs were identified in BAC-end sequences (BES from non-contigged, non-overlapping bacterial artificial clones (BACs in common bean (Phaseolus vulgaris L.. These so called "singleton" BACs were from the G19833 Andean gene pool physical map and the new BES-SSR markers were used for the saturation of the inter-gene pool, DOR364×G19833 genetic map. A total of 899 SSR loci were found among the singleton BES, but only 346 loci corresponded to the single di- or tri-nucleotide motifs that were likely to be polymorphic (ATT or AG motifs, principally and useful for primer design and individual marker mapping. When these novel SSR markers were evaluated in the DOR364×G19833 population parents, 136 markers revealed polymorphism and 106 were mapped. Genetic mapping resulted in a map length of 2291 cM with an average distance between markers of 5.2 cM. The new genetic map was compared to the most recent cytogenetic analysis of common bean chromosomes. We found that the new singleton BES-SSR were helpful in filling peri-centromeric spaces on the cytogenetic map. Short genetic distances between some new singleton-derived BES-SSR markers was common showing suppressed recombination in these regions compared to other parts of the genome. The correlation of singleton-derived SSR marker distribution with other cytogenetic features of the bean genome is discussed.

  6. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  7. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  8. Activity profiles for marine sponge-associated bacteria obtained by 16S rRNA vs 16S rRNA gene comparisons.

    Science.gov (United States)

    Kamke, Janine; Taylor, Michael W; Schmitt, Susanne

    2010-04-01

    The phylogenetic diversity of microorganisms in marine sponges is becoming increasingly well described, yet relatively little is known about the activities of these symbionts. Given the seemingly favourable environment provided to microbes by their sponge hosts, as indicated by the extraordinarily high abundance of sponge symbionts, we hypothesized that the majority of sponge-associated bacteria are active in situ. To test this hypothesis we compared, for the first time in sponges, 16S rRNA gene- vs 16S rRNA-derived bacterial community profiles to gain insights into symbiont composition and activity, respectively. Clone libraries revealed a highly diverse bacterial community in Ancorina alata, and a much lower diversity in Polymastia sp., which were identified by electron microscopy as a high- and a low-microbial abundance sponge, respectively. Substantial overlap between DNA and RNA libraries was evident at both phylum and phylotype levels, indicating in situ activity for a large fraction of sponge-associated bacteria. This active fraction included uncultivated, sponge-specific lineages within, for example, Actinobacteria, Chloroflexi and Gemmatimonadetes. This study shows the potential of RNA vs DNA comparisons based on the 16S rRNA gene to provide insights into the activity of sponge-associated microorganisms.

  9. 16S rRNA beacons for bacterial monitoring during human space missions.

    Science.gov (United States)

    Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

    2007-04-01

    Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

  10. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Directory of Open Access Journals (Sweden)

    Jolanta Kwasniewska

    Full Text Available In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley by maleic hydrazide (MH cells was performed. Simultaneously fluorescence in situ hybridization (FISH with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment.

  11. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  12. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    Science.gov (United States)

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  13. Improving oligonucleotide fingerprinting of rRNA genes by implementation of polony microarray technology

    Science.gov (United States)

    Ruegger, Paul M.; Bent, Elizabeth; Li, Wei; Jeske, Daniel R.; Cui, Xinping; Braun, Jonathan; Jiang, Tao; Borneman, James

    2012-01-01

    Improvements to oligonucleotide fingerprinting of rRNA genes (OFRG) were obtained by implementing polony microarray technology. OFRG is an array-based method for analyzing microbial community composition. Polonies are discrete clusters of DNA, produced by solid-phase PCR in hydrogels, and derived from individual, spatially isolated DNA molecules. The advantages of a polony-based OFRG method include higher throughput and reductions in the PCR-induced errors and compositional skew inherent in all other PCR-based community composition methods, including high throughput sequencing of rRNA genes. Given the similarities between polony microarrays and certain aspects of sequencing methods such as the Illumina platform, we suggest that if concepts presented in this study were implemented in high throughput sequencing protocols, a reduction of PCR-induced errors and compositional skew may be realized. PMID:22640891

  14. Phylogenetic analysis of freshwater mussel corbicula regularis by 18s rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Magare V N

    2015-04-01

    Full Text Available Corbicula regularis is a freshwater mussel found in the Indian sub-continent. In the present study, phylogenetic characterization of this important bivalve was attempted using 18S ribosomal RNA gene markers. Genomic DNA was extracted and 18S rRNA gene was amplified by universal primers. The amplification product was sequenced and compared with the nucleotide databases available online to evaluate phylogenetic relationship of the animal under study. Results indicated that 18S rRNA gene sequences of C. regularis showed high degree of similarity to another freshwater mussel, C. fluminea. This work constitutes the first ever sequence deposition of the C. regularis in the nucleotide databases highlighting the usefulness of 18S ribosomal gene markers for phylogenetic analysis.

  15. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  16. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Science.gov (United States)

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  17. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons.

    Science.gov (United States)

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function.

  18. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  19. PCR-based bioprospecting for homing endonucleases in fungal mitochondrial rRNA genes.

    Science.gov (United States)

    Hafez, Mohamed; Guha, Tuhin Kumar; Shen, Chen; Sethuraman, Jyothi; Hausner, Georg

    2014-01-01

    Fungal mitochondrial genomes act as "reservoirs" for homing endonucleases. These enzymes with their DNA site-specific cleavage activities are attractive tools for genome editing and gene therapy applications. Bioprospecting and characterization of naturally occurring homing endonucleases offers an alternative to synthesizing artificial endonucleases. Here, we describe methods for PCR-based screening of fungal mitochondrial rRNA genes for homing endonuclease encoding sequences, and we also provide protocols for the purification and biochemical characterization of putative native homing endonucleases.

  20. Stimulation of the mouse rRNA gene promoter by a distal spacer promoter.

    OpenAIRE

    Paalman, M H; Henderson, S L; Sollner-Webb, B

    1995-01-01

    We show that the mouse ribosomal DNA (rDNA) spacer promoter acts in vivo to stimulate transcription from a downstream rRNA gene promoter. This augmentation of mammalian RNA polymerase I transcription is observed in transient-transfection experiments with three different rodent cell lines, under noncompetitive as well as competitive transcription conditions, over a wide range of template concentrations, whether or not the enhancer repeats alone stimulate or repress expression from the downstre...

  1. Novel variants of the 5S rRNA genes in Eruca sativa.

    Science.gov (United States)

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Comparative bioinformatics and experimental analysis of the intergenic regulatory regions of Bacillus cereus hbl and nhe enterotoxin operons and the impact of CodY on virulence heterogeneity

    Directory of Open Access Journals (Sweden)

    Maria-Elisabeth eBöhm

    2016-05-01

    Full Text Available Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5’ intergenic regions (5’IGRs upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5’IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5’ untranslated regions (5’UTRs upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5’UTR in B. cereus INRA C3 showed that the entire 331 bp 5’UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5’UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5’IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5’UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription

  3. Minor contribution of mutations at iniA codon 501 and embC-embA intergenic region in ethambutol-resistant clinical Mycobacterium tuberculosis isolates in Kuwait

    Directory of Open Access Journals (Sweden)

    Ahmad Suhail

    2009-01-01

    Full Text Available Abstract Background Ethambutol (EMB is a first-line drug for the treatment of tuberculosis (TB. Resistance to EMB in Mycobacterium tuberculosis isolates is mediated by mutations in several genes involved in arabinan synthesis notably three emb (arabinosyl transferase and iniA (isoniazid-inducible genes. Most epidemiologically unrelated EMB-resistant M. tuberculosis strains contain mutations at embB codons 306, 406 and 497, embC-embA intergenic region (IGR and iniA codon 501 (iniA501. Objective To develop a more comprehensive molecular screen for EMB-resistance detectioamong epidemiologically unrelated EMB-resistant M. tuberculosis strains previously analyzed for embB codon 306, 406 and 497 mutations by including analysis of mutations at iniA501 and in embC-embA IGR. Methods Fifty consecutive and phenotypically documented EMB-resistant and 25 pansusceptible M. tuberculosis strains isolated from 75 different TB patients over a four-year period in Kuwait were analyzed. Mutations at iniA501 were detected by PCR amplification followed by restriction fragment length polymorphism (RFLP patterns generated with Hpy 99 I. Direct DNA sequencing was used to confirm RFLP results and for detecting mutations in embC-embA IGR. Results Nearly same number of EMB-resistant M. tuberculosis strains were resistant to EMB alone and EMB together with additional resistance to rifampicin and isoniazid (9 of 50, 18% and 11 of 50, 22%, respectively. All the 25 pansusceptible strains contained wild-type sequences at iniA501 and in embC-embA IGR. The analysis of 50 EMB-resistant M. tuberculosis isolates showed that only one strain contained a mutated iniA501 while no mutation was detected in embC-embA IGR in any of the isolate. Conclusion Analysis of iniA501 and embC-embA IGR in epidemiologically unrelated EMB-resistant M. tuberculosis isolates in Kuwait indicate that mutations at these locations occur very infrequently and their inclusion for the development of a

  4. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus hbl and nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity.

    Science.gov (United States)

    Böhm, Maria-Elisabeth; Krey, Viktoria M; Jeßberger, Nadja; Frenzel, Elrike; Scherer, Siegfried

    2016-01-01

    Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl, and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5' intergenic regions (5' IGRs) upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5' IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5' untranslated regions (5' UTRs) upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5' UTR in B. cereus INRA C3 showed that the entire 331 bp 5' UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5' UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5' IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5' UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription. PlcR binding sites are

  5. Upregulated long intergenic noncoding RNA KRT18P55 acts as a novel biomarker for the progression of intestinal-type gastric cancer

    Directory of Open Access Journals (Sweden)

    Ma B

    2016-01-01

    Full Text Available Bin Ma,* Jiajun Wang,* Yongxi Song, Peng Gao, Jingxu Sun, Xiaowan Chen, Yuchong Yang, Zhenning Wang Department of Surgical Oncology and General Surgery, The First Hospital of China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: Long noncoding RNAs (lncRNAs with dysregulated expression levels have been investigated in numerous types of different cancer. Whether lncRNAs can predict the progression of gastric cancer (GC still remains largely unclear. The aim of our study was to investigate whether KRT18P55, a novel intergenic lncRNA, can be a predictive biomarker for GC. Methods: To determine the expression levels of KRT18P55 in GC, we evaluated it in five GC cell lines (SGC-7901, MGC-803, BGC-823, AGS, and HG27 and 97 GC tissue samples in comparison with a normal control by quantitative polymerase chain reaction. In addition, the association with patient clinicopathological characteristics was analyzed to identify the clinical significance of KRT18P55. We also used publicly accessible data from The Cancer Genome Atlas (TCGA to further verify the expression levels and clinical significance of KRT18P55. Furthermore, a receiver operating characteristic curve was also conducted to evaluate the diagnostic value of KRT18P55 for GC. Results: A significant upregulation was observed in GC cell lines (P<0.01 and tissue samples (P<0.01. This finding was consistent with the results of 29 pairs of GC tissue samples from TCGA (P<0.01. Additionally, we indicated that the increased expression of KRT18P55 was related to the progression of intestinal type (P=0.032, which was also supported by results of independent GC cohorts from TCGA (P<0.01. However, we did not find significant difference in prognosis between patients with high and low expression of KRT18P55 (P>0.05. Finally, KRT18P55 showed potential diagnostic value for GC with an area under the receiver operating characteristic curve of

  6. Environmental rRNA inventories miss over half of protistan diversity

    Directory of Open Access Journals (Sweden)

    Hong Sunhee

    2008-12-01

    Full Text Available Abstract Background The main tool to discover novel microbial eukaryotes is the rRNA approach. This approach has important biases, including PCR discrimination against certain rRNA gene species, which makes molecular inventories skewed relative to the source communities. The degree of this bias has not been quantified, and it remains unclear whether species missed from clone libraries could be recovered by increasing sequencing efforts, or whether they cannot be detected in principle. Here we attempt to discriminate between these possibilities by statistically analysing four protistan inventories obtained using different general eukaryotic PCR primers. Results We show that each PCR primer set-specific clone library is not a sample from the community diversity but rather from a fraction of this diversity. Therefore, even sequencing such clone libraries to saturation would only recover that fraction, which, according to the parametric models, varies between 17 ± 4% to 49 ± 10%, depending on the set of primers. The pooled data is thus qualitatively richer than individual libraries, even if normalized to the same sequencing effort. Conclusion The use of a single pair of primers leads to significant underestimation of the true community richness at all levels of taxonomic hierarchy. The majority of available protistan rRNA gene surveys likely sampled less than half of the target diversity, and might have completely missed the rest. The use of multiple PCR primers reduces this bias but does not necessarily eliminate it.

  7. 4-thiouridine inhibits rRNA synthesis and causes a nucleolar stress response.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Kellner, Markus; Rohrmoser, Michaela; Gruber-Eber, Anita; Windhager, Lukas; Friedel, Caroline C; Dölken, Lars; Eick, Dirk

    2013-10-01

    High concentrations (> 100 µM) of the ribonucleoside analog 4-thiouridine (4sU) is widely used in methods for RNA analysis like photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) and nascent messenger (m)RNA labeling (4sU-tagging). Here, we show that 4sU-tagging at low concentrations ≤ 10 µM can be used to measure production and processing of ribosomal (r)RNA. However, elevated concentrations of 4sU (> 50 µM), which are usually used for mRNA labeling experiments, inhibit production and processing of 47S rRNA. The inhibition of rRNA synthesis is accompanied by nucleoplasmic translocation of nucleolar nucleophosmin (NPM1), induction of the tumor suppressor p53, and inhibition of proliferation. We conclude that metabolic labeling of RNA by 4sU triggers a nucleolar stress response, which might influence the interpretation of results. Therefore, functional ribosome biogenesis, nucleolar integrity, and cell cycle should be addressed in 4sU labeling experiments.

  8. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  9. Purine and pyrimidine composition in 5S rRNA and its mutational significance

    Directory of Open Access Journals (Sweden)

    Subacius Sandra Maria Rodrigues

    1998-01-01

    Full Text Available Variations observed in 5S rRNA base compositions are almost entirely due to fixation of point mutations. As a consequence, 5S rRNA size has remained relatively constant during evolution and, therefore, dependencies among the four bases can be predicted. In order to characterize the nature and to determine the degree of such dependencies, correlation analysis followed by principal component factorial analysis was conducted on a large sample of 5S rRNA sequences. The results show that the purine and pyrimidine contents tend to remain constant, so that A + G = Kpur and C + U = Kpyr. The composition of the four bases expressed now by Kpur/Kpyr relationships is also constant (Ks. These relationships imply that the behavior of the mutations in the variable sites of the molecule follows rules imposed by the chemical nature of the bases involved. Consequently, transition mutations would be more favored than substitutions in transversion sites and also than insertion-deletion (rare in 5S rRNAs, since transitions would not significantly alter the values of the Ks-index.

  10. Crystallization and X-ray diffraction data of Thermus flavus 5S rRNA helices

    Science.gov (United States)

    Vallazza, Marco; Senge, Andrea; Lippmann, Corinna; Perbandt, Markus; Betzel, Christian; Bald, Rolf; Erdmann, Volker A.

    2001-11-01

    5S rRNA is an essential component of the large ribosomal subunit in prokaryotes and eukaryotes. Its unknown function in the ribosome will eventually be revealed in part by structural studies. To promote crystallization and enhance resolution in X-ray diffraction the molecule was subdivided into five domains A-E. Several RNA oligonucleotides were chemically produced by solid-phase phosphoramidite synthesis in order to construct the domains of the 5S rRNA. An improved RNA-MPD-screen was applied in crystallization which covers a complete 2D matrix for the components used. Crystallization analysis resulted in preferred combinations of pH, polyamine, monovalent and divalent cations for short RNA molecules. Six types of crystals corresponding to the domains B, C and E of Thermus flavus 5S rRNA could be obtained which were suitable for X-ray diffraction. Four RNA helices consist of seven base pairs and two of eight base pairs. As special features, they contain two adenines in a bulge position or G : U wobble base pairs assumed to be involved in RNA-protein recognition. With an increase in crystal size an increase in resolution by X-ray analysis was observed. X-ray diffraction data were collected to 1.5 Å resolution using synchrotron radiation and cryogenic cooling techniques.

  11. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  12. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  13. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  14. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    Science.gov (United States)

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  16. Improved identification of Gordonia, Rhodococcus and Tsukamurella species by 5'-end 16S rRNA gene sequencing.

    Science.gov (United States)

    Wang, Tao; Kong, Fanrong; Chen, Sharon; Xiao, Meng; Sorrell, Tania; Wang, Xiaoyan; Wang, Shuo; Sintchenko, Vitali

    2011-01-01

    The identification of fastidious aerobic Actinomycetes such as Gordonia, Rhodococcus, and Tsukamurella has remained a challenge leading to clinically significant misclassifications. This study is intended to examine the feasibility of partial 5'-end 16S rRNA gene sequencing for the identification of Gordonia, Rhodococcus, and Tsukamurella, and defined potential reference sequences for species from each of these genera. The 16S rRNA gene sequence based identification algorithm for species identification was used and enhanced by aligning test sequences with reference sequences from the List of Prokaryotic Names with Standing in Nomenclature. Conventional PCR based 16S rRNA gene sequencing and the alignment of the isolate 16S rRNA gene sequence with reference sequences accurately identified 100% of clinical strains of aerobic Actinomycetes. While partial 16S rRNA gene sequences of reference type strains matched with the 16S rRNA gene sequences of 19 isolates in our data set, another 13 strains demonstrated a degree of polymorphism with a 1-4 bp difference in the regions of difference. 5'-end 606 bp 16S rRNA gene sequencing, coupled with the assignment of well defined reference sequences to clinically relevant species of bacteria, can be a useful strategy for improving the identification of clinically relevant aerobic Actinomycetes.

  17. [Phylogenetic comparison between Spirulina and Arthrospira based on 16S rRNA and rpoC1 gene].

    Science.gov (United States)

    Wu, Yuemei; Wang, Suying; Dong, Shirui

    2016-02-04

    Based on 16S rRNA and rpoC1 gene sequences, the phylogenetic relationship between Spirulina and Arthrospira were studied and compared. We amplified, sequenced and analyzed 16S rRNA and rpoC1 of 84 strains. Then the phylogenetic trees were constructed and compared. The conserved sites percentage, average G+C content and sequence identity of rpoC1 were 49.7%, 47.7%, 76%-100% respectively, significantly lower than 79.4%, 55.6% and 91%-100% of 16S rRNA, and the heterogeneity degree was higher. The trees generated with two different genes showed similar topologies and thus inferred consistent phylogenetic relationships. Eighty-four experimental strains were divided into 3 groups belonging to 2 genera: F-35 1, F-904-2, F-1070 and TJBC14 were Spirulina and the rest were Arthrospira. Although morphospecies and geographical species could not be distinguished based on 16S rRNA and rpoC1 gene sequences, the bootstrap value of rpoC1 (100%) was higher than that of 16S rRNA (99%). Moreover, clustering effect of rpoC1 for Spirulina and Arthrospirai was better than 16S rRNA. Spirulina and Arthrospira were different genera, rpoC1 gene has more advantage to distinguish the strains in the same genus than that of 16S rRNA gene.

  18. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    Science.gov (United States)

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  19. rRNA gene restriction patterns of Haemophilus influenzae biogroup aegyptius strains associated with Brazilian purpuric fever.

    Science.gov (United States)

    Irino, K; Grimont, F; Casin, I; Grimont, P A

    1988-08-01

    The rRNA gene restriction patterns of 92 isolates of Haemophilus influenzae biogroup aegyptius, associated with conjunctivitis or Brazilian purpuric fever in the State of São Paulo, Brazil, were studied with 16 + 23S rRNA from Escherichia coli as a probe. All strains were classified into 15 patterns. Isolates from Brazilian purpuric fever cases were seen only in patterns 3 (most frequently) and 4 (rarely), whereas isolates from conjunctivitis were found in all 15 patterns. The study demonstrated that rRNA from E. coli can serve as a probe for molecular epidemiology.

  20. The Final Step in 5.8S rRNA Processing Is Cytoplasmic in Saccharomyces cerevisiae▿ †

    OpenAIRE

    Thomson, Emma; TOLLERVEY, DAVID

    2009-01-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3' cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3'-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading t...

  1. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  2. Evolution of RNA editing sites in the mitochondrial small subunit rRNA of the Myxomycota.

    Science.gov (United States)

    Krishnan, Uma; Barsamian, Arpi; Miller, Dennis L

    2007-01-01

    Because of their unique and unprecedented character, it is often difficult to imagine how and why the different, diverse types of RNA editing have evolved. Information about the evolution of a particular RNA editing system can be obtained by comparing RNA editing characteristics in contemporary organisms whose phylogenetic relationships are known so that editing patterns in ancestral organisms can be inferred. This information can then be used to build models of the origins, constraints, variability, and mechanisms of RNA editing. As an example of the types of information that can be obtained from these analyses, we describe how we have used cDNA, covariation, and phylogenetic analyses to study the evolution of the variation in RNA editing site location in the core region of the small subunit rRNA gene in the mtDNA of seven myxomycetes, including Physarum polycephalum. We find that the unique type of insertional RNA editing present in mitochondria of P. polycephalum is also present in the mitochondrial small subunit (SSU) rRNA of the other six myxomycetes. As in Physarum, this editing predominantly consists of cytidine insertions, but also includes uridine insertions and certain dinucleotide insertions such that any of the four canonical ribonucleotides can be inserted. Although the characteristics of RNA editing in these organisms are the same as in Physarum, the location of the insertion sites varies among the seven organisms relative to the conserved primary sequence and secondary structure of the rRNA. Nucleotide insertions have been identified at 29 different sites within this core region of the rRNA, but no one organism has more than 10 of these insertion sites, suggesting that editing sites have been created and/or eliminated since the divergence of these organisms. To determine the order in which editing sites have been created or eliminated, the sequences of the mitochondrial SSU rRNA have been aligned and this alignment has been used to produce

  3. Asociación del intervalo intergenésico y la morbimortalidad materno fetal en el Hospital María Auxiliadora de San Juan de Miraflores, Lima. 2014

    OpenAIRE

    Huamaní Cueto, Silvia Constanza

    2015-01-01

    Determina la asociación del intervalo intergenésico sobre la morbilidad materno fetal en el Hospital María Auxiliadora, 2014. Material y métodos: estudio descriptivo correlacional y retrospectivo; la muestra estuvo conformada por 7631 historias clínicas de gestantes que dieron parto, y cuyo embarazo finalizó en un nacido vivo o muerto; se estudió 3138 historias clínicas de gestantes divididas en intervalos según criterios de inclusión. Los datos fueron obtenidos del Sistema Informático Perina...

  4. Phylogenetic and biogeographic implications inferred by mitochondrial intergenic region analyses and ITS1-5.8S-ITS2 of the entomopathogenic fungi Beauveria bassiana and B. brongniartii

    Directory of Open Access Journals (Sweden)

    Typas Milton A

    2010-06-01

    Full Text Available Abstract Background The entomopathogenic fungi of the genus Beauveria are cosmopolitan with a variety of different insect hosts. The two most important species, B. bassiana and B. brongniartii, have already been used as biological control agents of pests in agriculture and as models for the study of insect host - pathogen interactions. Mitochondrial (mt genomes, due to their properties to evolve faster than the nuclear DNA, to contain introns and mobile elements and to exhibit extended polymorphisms, are ideal tools to examine genetic diversity within fungal populations and genetically identify a species or a particular isolate. Moreover, mt intergenic region can provide valuable phylogenetic information to study the biogeography of the fungus. Results The complete mt genomes of B. bassiana (32,263 bp and B. brongniartii (33,920 bp were fully analysed. Apart from a typical gene content and organization, the Beauveria mt genomes contained several introns and had longer intergenic regions when compared with their close relatives. The phylogenetic diversity of a population of 84 Beauveria strains -mainly B. bassiana (n = 76 - isolated from temperate, sub-tropical and tropical habitats was examined by analyzing the nucleotide sequences of two mt intergenic regions (atp6-rns and nad3-atp9 and the nuclear ITS1-5.8S-ITS2 domain. Mt sequences allowed better differentiation of strains than the ITS region. Based on mt and the concatenated dataset of all genes, the B. bassiana strains were placed into two main clades: (a the B. bassiana s. l. and (b the "pseudobassiana". The combination of molecular phylogeny with criteria of geographic and climatic origin showed for the first time in entomopathogenic fungi, that the B. bassiana s. l. can be subdivided into seven clusters with common climate characteristics. Conclusions This study indicates that mt genomes and in particular intergenic regions provide molecular phylogeny tools that combined with criteria of

  5. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  6. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    Science.gov (United States)

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  7. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Olivares-Fuster, Oscar; Shoemaker, Craig A; Klesius, Phillip H; Arias, Covadonga R

    2007-04-01

    Flavobacterium columnare intraspecies diversity was revealed by analyzing the 16S rRNA gene and the 16S-23S internal spacer region (ISR). Standard restriction fragment length polymorphism (RFLP) of these sequences was compared with single-strand conformation polymorphism (SSCP). Diversity indexes showed that both 16S-SSCP and ISR-SSCP improved resolution (D>or=0.9) when compared with standard RFLP. ISR-SSCP offered a simpler banding pattern than 16S-SSCP while providing high discrimination between isolates. SSCP analysis of rRNA genes proved to be a simple, rapid, and cost-effective method for routine fingerprinting of F. columnare.

  8. Hawaii Energy and Environmental Technologies (HEET) Initiative

    Science.gov (United States)

    2009-05-01

    TC U TC U TC Filter TC =*=*- TC Water Gas Shift :3=LJ TC 5s WGS Bypass Reformer and Insulation High pressure System...N2, CH4, H2. J. Geophys. Res. 97, 20335-20343. Lane, D. J. (1991). 16S/23S rRNA sequencing, in Nucleic Acid Techniques in Bacterial Systematics...evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA . Appl Environ Microbiol 64, 795-799. Masoudi

  9. Transcription of the 5S rRNA heterochromatic genes is epigenetically controlled in Arabidopsis thaliana and Xenopus laevis.

    Science.gov (United States)

    Douet, J; Tourmente, S

    2007-07-01

    5S ribosomal DNA is a highly conserved tandemly repeated multigenic family. As suggested for a long time, we have shown that only a fraction of the 5S rRNA genes are expressed in Arabidopsis thaliana. In Xenopus laevis, there is a developmental control of the expression of the 5S rRNA genes with only one of the two 5S rDNA families expressed during oogenesis. For both Arabidopsis and Xenopus, the strongest transcription of 5S rRNA, respectively in the seed and during oogenesis is correlated with heterogeneity in the transcribed 5S rRNAs. Epigenetic mechanisms such as modification of the chromatin structure are involved in the transcriptional regulation of the 5S rRNA genes in both organisms. In Arabidopsis, two silencing pathways, methylation-dependent (RNAi) and methylation-independent (MOM pathway), are involved in the silencing of a 5S rDNA fraction.

  10. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    National Research Council Canada - National Science Library

    Nossa, Carlos W; Oberdorf, William E; Yang, Liying; Aas, Jørn A; Paster, Bruce J; Desantis, Todd Z; Brodie, Eoin L; Malamud, Daniel; Poles, Michael A; Pei, Zhiheng

    2010-01-01

    .... A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral, esophageal, and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species...

  11. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    DEFF Research Database (Denmark)

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes...... that FISH and rRNA slot blot hybridization gave comparable results. Furthermore, a combination of the two methods allowed us to calculate specific cellular rRNA contents with respect to localization in the sediment profile. The rRNA contents of Desulfosarcina-Desulfococcus cells were highest in the first 5...... mm of the sediment (0.9 and 1.4 fg, respectively) and decreased steeply with depth, indicating that maximal metabolic activity occurred close to the surface, Based on SRB cell numbers, cellular sulfate reduction rates were calculated. The rates were highest in the surface layer (0.14 fmol cell(-1...

  12. Rhizobium halophytocola sp. nov., isolated from the root of a coastal dune plant.

    Science.gov (United States)

    Bibi, Fehmida; Chung, Eu Jin; Khan, Ajmal; Jeon, Che Ok; Chung, Young Ryun

    2012-08-01

    During a study of endophytic bacteria from coastal dune plants, a bacterial strain, designated YC6881(T), was isolated from the root of Rosa rugosa collected from the coastal dune areas of Namhae Island, Korea. The bacterium was found to be Gram-staining-negative, motile, halophilic and heterotrophic with a single polar flagellum. Strain YC6881(T) grew at temperatures of 4-37 °C (optimum, 28-32 °C), at pH 6.0-9.0 (optimum, pH 7.0-8.0), and at NaCl concentrations in the range of 0-7.5% (w/v) (optimum, 4-5% NaCl). Strain YC6881(T) was catalase- and oxidase-positive and negative for nitrate reduction. According to phylogenetic analysis using 16S rRNA gene sequences, strain YC6881(T) belonged to the genus Rhizobium and showed the highest 16S rRNA gene sequence similarity of 96.9% to Rhizobium rosettiformans, followed by Rhizobium borbori (96.3%), Rhizobium radiobacter (96.1%), Rhizobium daejeonense (95.9%), Rhizobium larrymoorei (95.6%) and Rhizobium giardinii (95.4%). Phylogenetic analysis of strain YC6881(T) by recA, atpD, glnII and 16S-23S intergenic spacer (IGS) sequences all confirmed the phylogenetic arrangements obtained by using 16S rRNA gene sequences. Cross-nodulation tests showed that strain YC6881(T) was a symbiotic bacterium that nodulated Vigna unguiculata and Pisum sativum. The major components of the cellular fatty acids were C(18:1)ω7c (53.7%), C(19:0) cyclo ω8c (12.6%) and C(12:0) (8.1%). The DNA G+C content was 52.8 mol%. Phenotypic and physiological tests with respect to carbon source utilization, antibiotic resistance, growth conditions, phylogenetic analyses of housekeeping genes recA, atpD and glnII, and fatty acid composition could be used to discriminate strain YC6881(T) from other species of the genus Rhizobium in the same sublineage. Based on the results obtained in this study, strain YC6881(T) is considered to represent a novel species of the genus Rhizobium, for which the name Rhizobium halophytocola sp. nov. is proposed. The type

  13. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  14. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  15. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  16. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    . coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  17. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    Science.gov (United States)

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  18. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    Science.gov (United States)

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  19. Hypomethylation and hypermethylation of the tandem repetitive 5S rRNA genes in Arabidopsis.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Jasencakova, Zuzana; Douet, Julien; Schubert, Ingo; Tourmente, Sylvette

    2008-04-01

    5S ribosomal DNA (5S rDNA) is organized in tandem repeats on chromosomes 3, 4 and 5 in Arabidopsis thaliana. One part of the 5S rDNA is located within the heterochromatic chromocenters, and the other fraction forms loops with euchromatic features that emanate from the chromocenters. We investigated whether the A. thaliana heterochromatin, and particularly the 5S rDNA, is modified when changing the culture conditions (cultivation in growth chamber versus greenhouse). Nuclei from challenged tissues displayed larger total, as well as 5S rDNA, heterochromatic fractions, and the DNA methyltransferase mutants met1 and cmt3 had different impacts in Arabidopsis. The enlarged fraction of heterochromatic 5S rDNA was observed, together with the reversal of the silencing of some 5S rRNA genes known as minor genes. We observed hypermethylation at CATG sites, and a concomitant DNA hypomethylation at CG/CXG sites in 5S rDNA. Our results show that the asymmetrical hypermethylation is correlated with the ageing of the plants, whereas hypomethylation results from the growth chamber/culture conditions. In spite of severely reduced DNA methylation, the met1 mutant revealed no increase in minor 5S rRNA transcripts in these conditions. The increasing proportion of cytosines in asymmetrical contexts during transition from the euchromatic to the heterochromatic state in the 5S rDNA array suggests that 5S rDNA units are differently affected by the (hypo and hyper)methylation patterns along the 5S rDNA locus. This might explain the different behaviour of 5S rDNA subpopulations inside a 5S array in terms of chromatin compaction and expression, i.e. some 5S rRNA genes would become derepressed, whereas others would join the heterochromatic fraction.

  20. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  1. Diversity and evolution of 5S rRNA gene family organization in Pythium.

    Science.gov (United States)

    Bedard, James E J; Schurko, Andrew M; de Cock, Arthur W A M; Klassen, Glen R

    2006-01-01

    The 5S rRNA gene family organization among 87 species and varieties of Pythium was investigated to assess evolutionary stability of the two patterns detected and to determine which pattern is likely the ancestral state in the genus. Species with filamentous sporangia (Groups A-C according to the ITS phylogenetic tree for Pythium) had 5S genes linked to the rDNA repeat that were predominantly coded for on the DNA strand opposite to the one with the other rRNA genes ('inverted' orientation). A small group of species with contiguous sporangia (Group D) is related to Groups A-C but had unlinked 5S genes. The main group of species with spherical zoosporangia (Groups E-J) generally had unlinked 5S genes in tandem arrays. The six species in Group K, although they also have spherical sporangia, had linked genes on the same strand as the other rRNA genes 'non-inverted' and most of them had pairs of tandem 5S genes. The evolutionary stability of 5S sequence organization was compared with the stability of morphological characters as interpreted from a phylogeny based on ITS sequence analysis. Features of 5S sequence organization were found to be just as consistent within groups as were the morphological characters. To determine the ancestral type of 5S family organization, a survey of Phytophthora strains was conducted to supply an outgroup reference. The most parsimonious interpretation of the data in this survey yielded the tentative conclusion that the linked condition of the 5S sequences was ancestral.

  2. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    Directory of Open Access Journals (Sweden)

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  3. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    communities, and in this study activated sludge sampled from 32 Wastewater Treatment Plants (WWTPs) around the world was described and compared. The top abundant bacteria in the global activated sludge ecosystem were found and the core population shared by multiple samples was investigated. The results......Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  4. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    Institute of Scientific and Technical Information of China (English)

    陶伟; 焦明大; 赫杰; 何孟元; 郝水

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electron microscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distribution and position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat liver cells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillar component (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore, by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcription sites of rRNA genes and testified that localization of transcription sites not only to DFC but also to the periphery of FC.

  5. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  6. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    Science.gov (United States)

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  7. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  8. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resis...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  9. Detection of Vibrio splendidus and related species in Chamelea gallina sampled in the Adriatic along the Abruzzi coastline.

    Science.gov (United States)

    Torresi, Marina; Acciari, Vicdalia A; Piano, Annamaria; Serratore, Patrizia; Prencipe, Vincenza; Migliorati, Giacomo

    2011-01-01

    Vibrio species are an important and widespread component of marine microbial communities. Some Vibrio strains are potentially pathogenic to marine vertebrates and invertebrates. The aim of this study was to identify vibrios, in particular Vibrio splendidus and related species, isolated from clams (Chamelea gallina) collected along the coasts of the Abruzzi region from May to October 2007. The isolates obtained were phenotyped and classified as belonging to the genus Vibrio. The strains underwent biochemical testing in accordance with Alsina's scheme for V. splendidus identification. Molecular analysis of the 16S-23S intergenic space region and recA gene was used to identify V. splendidus and related species. All the samples examined were found to contain halophylic Vibrio species, with V. alginolyticus, V. splendidus-related species and V. mediterranei most commonly found. A polymerase chain reaction of the 16S-23S intergenic space region and sequencing of the recA gene from isolates confirmed that phenotyping of Vibrio species is not sufficient to distinguish between different species. Differentiation of the highly related species among V. splendidus-related clusters remains an important issue. In this regard, our data suggests sequencing the recA genes was far more discriminatory than sequencing 16S rDNA for this purpose.

  10. Interaction of tRNA with domain II of 23S rRNA.

    Science.gov (United States)

    Hill, W E; Tassanakajohn, A; Tapprich, W E

    1990-08-27

    The interaction of tRNA with domain II of 23S rRNA in E. coli ribosomes has been probed using short, complementary DNA oligodeoxyribonucleotides. Specifically, cDNA oligomers to the region 801-811 of the 23S rRNA were used to ascertain the interaction of this region with tRNA. It was found that when tRNA was bound to the P site, considerable competition occurred between tRNA and the cDNA oligomers which base paired with the nucleotides 807-811. However, A-site bound tRNA neither displaced, nor was displaced, by cDNA oligomers to this region. Additionally, the binding of tRNA lacking the CACCA nucleotides on the 3' terminus was unaffected by the presence a cDNA oligomer complementary to nucleotides 803-811, indicating that the cDNA-tRNA competition was dependent on the 3' terminal nucleotides of tRNA.

  11. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Nan Cheng

    Full Text Available Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states, all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one, complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  12. Coevolution in RNA molecules driven by selective constraints: evidence from 5S rRNA.

    Science.gov (United States)

    Cheng, Nan; Mao, Yuanhui; Shi, Youyi; Tao, Shiheng

    2012-01-01

    Understanding intra-molecular coevolution helps to elucidate various structural and functional constraints acting on molecules and might have practical applications in predicting molecular structure and interactions. In this study, we used 5S rRNA as a template to investigate how selective constraints have shaped the RNA evolution. We have observed the nonrandom occurrence of paired differences along the phylogenetic trees, the high rate of compensatory evolution, and the high TIR scores (the ratio of the numbers of terminal to intermediate states), all of which indicate that significant positive selection has driven the evolution of 5S rRNA. We found three mechanisms of compensatory evolution: Watson-Crick interaction (the primary one), complex interactions between multiple sites within a stem, and interplay of stems and loops. Coevolutionary interactions between sites were observed to be highly dependent on the structural and functional environment in which they occurred. Coevolution occurred mostly in those sites closest to loops or bulges within structurally or functionally important helices, which may be under weaker selective constraints than other stem positions. Breaking these pairs would directly increase the size of the adjoining loop or bulge, causing a partial or total structural rearrangement. In conclusion, our results indicate that sequence coevolution is a direct result of maintaining optimal structural and functional integrity.

  13. Midkine accumulated in nucleolus of HepG2 cells involved in rRNA transcription

    Institute of Scientific and Technical Information of China (English)

    Li-Cheng Dai; Jian-Zhong Shao; Li-Shan Min; Yong-Tao Xiao; Li-Xin Xiang; Zhi-Hong Ma

    2008-01-01

    AIM: To invesgate the ultrastructural location of midkine (MK) in nucleolus and function corresponding to its location. METHODS: To investigate the ultrastructural location of MK in nucleolus with immunoelectronic microscopy. To study the role that MK plays in ribosomal biogenesis by real-time PCR. The effect of MK on anti-apoptotic activity of HepG2 cells was studied with FITC-conjugated annexin V and propidium iodide PI double staining through FACS assay. RESULTS: MK mainly localized in the granular component (GC), dense fibrillar component (DFC) and the border between the DF-C and fibrillar center (FC). The production of 45S precursor rRNA level was decreased significantly in the presence of IK antisense oligonucleotide in the HepG2 cells. Furthermore, it was found that exogenous MK could protect HepG2 from apoptosis significantly. CONCLUSION: NK was constitutively translocated to the nucleolus of HepG2 cells, where it accumulated and mostly distributed at DFC, GC components and at the region between FC and DFC, MK played an important role in rRNA transcription, ribosome biogenesis, and cell proliferation in HepG2 cells. MK might serve as a molecular target for therapeutic intervention of human carcinomas.

  14. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  15. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    Science.gov (United States)

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  16. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... to be recognized by the RNA polymerase holoenzyme containing sigma hrdB, the principal sigma factor in S. coelicolor. P2 also shares homology with the consensus for vegetative promoters, but has a sequence overlapping the consensus -35 region that is also present in the -35 regions of P3 and P4. The -35 sequence...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  17. Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians

    Directory of Open Access Journals (Sweden)

    Chiari Ylenia

    2005-03-01

    Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.

  18. Control of rRNA Synthesis in Escherichia coli: a Systems Biology Approach†

    Science.gov (United States)

    Dennis, Patrick P.; Ehrenberg, Mans; Bremer, Hans

    2004-01-01

    The first part of this review contains an overview of the various contributions and models relating to the control of rRNA synthesis reported over the last 45 years. The second part describes a systems biology approach to identify the factors and effectors that control the interactions between RNA polymerase and rRNA (rrn) promoters of Escherichia coli bacteria during exponential growth in different media. This analysis is based on measurements of absolute rrn promoter activities as transcripts per minute per promoter in bacterial strains either deficient or proficient in the synthesis of the factor Fis and/or the effector ppGpp. These absolute promoter activities are evaluated in terms of rrn promoter strength (Vmax/Km) and free RNA polymerase concentrations. Three major conclusions emerge from this evaluation. First, the rrn promoters are not saturated with RNA polymerase. As a consequence, changes in the concentration of free RNA polymerase contribute to changes in rrn promoter activities. Second, rrn P2 promoter strength is not specifically regulated during exponential growth at different rates; its activity changes only when the concentration of free RNA polymerase changes. Third, the effector ppGpp reduces the strength of the rrn P1 promoter both directly and indirectly by reducing synthesis of the stimulating factor Fis. This control of rrn P1 promoter strength forms part of a larger feedback loop that adjusts the synthesis of ribosomes to the availability of amino acids via amino acid-dependent control of ppGpp accumulation. PMID:15590778

  19. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    Directory of Open Access Journals (Sweden)

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  20. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  1. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates...... the relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell...... in the hrcA-grpE-dnaK operon was analyzed. The hybridization data suggested a complex heat shock regulation indicating that the mRNA levels continued to rise after 30 min, but after renormalization the calculated average cellular levels exhibited a much simpler induction pattern, eventually attaining...

  2. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    Science.gov (United States)

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  3. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    Science.gov (United States)

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  4. A critical role for the non-coding 5S rRNA in regulating Mdmx stability

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2013-01-01

    Summary Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most of cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2 whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal an critical role of noncoding 5S rRNA in modulating the p53-Mdmx axis. PMID:21925390

  5. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    Science.gov (United States)

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes.

  6. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    Science.gov (United States)

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  7. Trends in evolution of 5S rRNA of deuterostomes: bases and homogeneous clusters

    Directory of Open Access Journals (Sweden)

    Sandra Maria Rodrigues Subacius

    2002-01-01

    Full Text Available Evolution of metazoan 5S rRNA sequences was analyzed through base composition and types, location and frequency of clustered bases. Characters from sequences of protostomes did not show regular trends as compared with paleontology dating or organism complexity. Trends of increasing G and C, stronger in G clusters, and decreasing A and U, were detected in deuterostomes, in parallel with evolution of complexity. The multifunctional domain 71-104 was highlighted among conserved stretches. Clusters of C were typical of helices. Those of G were longer, extending from helices into loops or related to bulges, which is suggestive of functional significance. Deuterostomian trends were installed early in the lineage and reached full development in aquatic organisms, not increasing further after reptiles. It can be suggested that ribosomal RNA structures participated in deuterostomian high regulatory complexity, either specifically or as part of the widespread processes of chromosomal regionalization.

  8. Genetic Diversity in Populations of Sepiella maindroni Using 16S rRNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Part of the 16S rRNA gene is amplified with PCR and sequenced for 5 populations of common Chinese cuttlefish Sepiella maindroni: three from the South China Sea, one from East China Sea and one from Japan. The result shows that a total of 5 nucleotide positions are found to have gaps or insertions of base pairs among these individuals, and 13 positions are examined to be variable in all the sequences, which range from 494 to 509 base pairs. All of the individuals are grouped into 7 haplotypes (h1-h7). No marked genetic difference is observed among those populations. All of the individuals from Nagasaki belong to h1 and the h3 haplotype is found only in the coastal waters of China. AG transition in Nucleotide 255 is suggested to be taken as a kind of genetic marker to identify the populations distributed in East-South China Sea and the Nagasaki waters of Japan.

  9. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K.bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  10. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... that also confer antibiotic resistance. Both the domain II deletion and the 2057A mutation relieve the hypersensitive effect of the 2032A mutation, producing an erythromycin-resistant phenotype; in addition, the combination of the 2032A and 2057A mutations confers a higher level of chloramphenicol...... and chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  11. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content......, the distal part from Meckels diverticulum to the ileo-caecal junction was removed. Fixation was performed in ethanol and phosphate buffered saline. After washing by centrifugation, the sample was resuspended in pre-heated hybridization buffer with oligonucleotide probe labelled with Cy3 (10ng/µl). The cells...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...

  12. PHYLOGENETIC STATUS OF BABYLONIA ZEYLANICA (FAMILY BABYLONIIDAE BASED ON 18S rRNA GENE FRAGMENT

    Directory of Open Access Journals (Sweden)

    Vaithilingam RAVITCHANDIRANE

    2013-12-01

    Full Text Available Neogastropoda, highly diversed group of predatory marine snails, often been confused by shell colour and design pattern for identification. Gastropod resources which became economically important in India during the last decade are the whelk. The species Babylonia zeylanica of the family Babyloniidae began to be fished and exported from the country to China, Singapore, Thailand and Europe. This paper reports the molecular study of the group published to date with eight families of neogastropod taxa. For this study the 18S rRNA gene of B. zeylanica and other published data were collected from the GenBank. Kimura-2-Parameter genetic distance, nucleotide composition and neighbour joining analyses were conducted in all the eight families. The result clearly shows that Babyloniidae is clustered closely with Columbellidae of super family of Buccinoidea. Further additional gene data and increased sampling is warranted to give new insights into the phylogenetic relationships of Neogastropoda.

  13. discussion on validity of rana maoershanensis based on partial sequence of 16s rrna gene

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    rana maoershanensis found in mt.maoershan in guangxi,china was reported as a new species in 2007,but there was no molecular data for this frog.the partial sequences (543 bp) of 16s rrna gene from 12 specimens of 3 brown frog species (rana hanluica,r.maoershanensis and r.chensinensis) were analyzed with 17 specimens of 9 species from genbank.the nucleotide sequence divergence between r.maoershanensis and the other brown frog species were 4.5%-6.5%,with 22-30 nucleotide substitutions at this locus.the phylogenetic relationships based on mp,ml,and bayesian inference indicate that the brown frogs from southern china were diverged into three groups (clades a,b and c).r.maoershanensis was clustered together a well-supported subclade (b-l).it is suggested that r.maoershanensis is a valid species.

  14. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  15. Comparative sequence analysis of 16S rRNA gene of Pasteurella multocida serogroup B isolates from different animal species.

    Science.gov (United States)

    Dey, S; Singh, V P; Kumar, A A; Sharma, B; Srivastava, S K; Singh, Nem

    2007-08-01

    The phylogenetic relationships of five isolates of Pasteurella multocida serotype B:2 belonging to buffalo, cattle, pig, sheep and goat were investigated by comparative sequence analysis of 16S rRNA gene. The 1468bp fragment of 16S rRNA gene sequence comparison showed that the isolates of cattle (PM75), pig (PM49) and sheep (PM82) shared 99.9% homology with the buffalo isolate (vaccine strain P52) whereas, the goat isolate (PM86) shared 99.8% homology with the vaccine strain. The 16S rRNA gene sequences of these isolates were also found monophyletic with type B reference strain NCTC 10323 of P. multocida subsp. multocida. The present study indicated the close relationships of haemorrhagic septicaemia causing P. multocida serotype B:2 isolates of buffalo and cattle with other uncommon hosts (pig, sheep and goat).

  16. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain

    2015-01-01

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study investigated microbial...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  17. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    Directory of Open Access Journals (Sweden)

    Martin Ciganda

    Full Text Available P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  18. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  19. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  20. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  1. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  2. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    Science.gov (United States)

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  3. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Science.gov (United States)

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  4. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  5. H2A.Z demarcates intergenic regions of the plasmodium falciparum epigenome that are dynamically marked by H3K9ac and H3K4me3.

    Directory of Open Access Journals (Sweden)

    Richárd Bártfai

    Full Text Available Epigenetic regulatory mechanisms and their enzymes are promising targets for malaria therapeutic intervention; however, the epigenetic component of gene expression in P. falciparum is poorly understood. Dynamic or stable association of epigenetic marks with genomic features provides important clues about their function and helps to understand how histone variants/modifications are used for indexing the Plasmodium epigenome. We describe a novel, linear amplification method for next-generation sequencing (NGS that allows unbiased analysis of the extremely AT-rich Plasmodium genome. We used this method for high resolution, genome-wide analysis of a histone H2A variant, H2A.Z and two histone H3 marks throughout parasite intraerythrocytic development. Unlike in other organisms, H2A.Z is a constant, ubiquitous feature of euchromatic intergenic regions throughout the intraerythrocytic cycle. The almost perfect colocalisation of H2A.Z with H3K9ac and H3K4me3 suggests that these marks are preferentially deposited on H2A.Z-containing nucleosomes. By performing RNA-seq on 8 time-points, we show that acetylation of H3K9 at promoter regions correlates very well with the transcriptional status whereas H3K4me3 appears to have stage-specific regulation, being low at early stages, peaking at trophozoite stage, but does not closely follow changes in gene expression. Our improved NGS library preparation procedure provides a foundation to exploit the malaria epigenome in detail. Furthermore, our findings place H2A.Z at the cradle of P. falciparum epigenetic regulation by stably defining intergenic regions and providing a platform for dynamic assembly of epigenetic and other transcription related complexes.

  6. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  7. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    Science.gov (United States)

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  8. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    Science.gov (United States)

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  9. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  10. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  11. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D;

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  12. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  13. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR).

    Science.gov (United States)

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio

    2015-01-01

    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  14. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.;

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  15. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  16. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Science.gov (United States)

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  17. Assessing the fecal microbiota: an optimized ion torrent 16S rRNA gene-based analysis protocol.

    Directory of Open Access Journals (Sweden)

    Christian Milani

    Full Text Available Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota.

  18. Sulphate reduction and vertical distribution of sulphate-reducing bacteria quantified by rRNA slot-blot hybridization in a coastal marine sediment

    DEFF Research Database (Denmark)

    Sahm, K.; MacGregor, BJ; Jørgensen, BB

    1999-01-01

    is a valuable tool for a more realistic assessment of SRB abundance in the natural environment. The distribution of SRB was investigated in a coastal marine sediment by hybridization of membrane-immobilized rRNA with oligonucleotide probes. As represented by general probe-target groups, SRB rRNA contributed...... between 18% and 25% to the prokaryotic rRNA pool. The dominant SRB were related to complete oxidizing genera (Desulphococcus, Desulphosarcina and Desulphobacterium), while Desulpho-bacter could not be detected. The vertical profile and quantity of rRNA from SRB was compared with sulphate reduction rates...

  19. The participation of 5S rRNA in the co-translational formation of a eukaryotic 5S ribonucleoprotein complex

    OpenAIRE

    Lin, Elong; Lin, Sue-Wen; Lin, Alan

    2001-01-01

    The eukaryotic ribosomal 5S RNA–protein complex (5S rRNP) is formed by a co-translational event that requires 5S rRNA binding to the nascent peptide chain of eukaryotic ribosomal protein L5. Binding between 5S rRNA and the nascent chain is specific: neither the 5S rRNA nor the nascent chain of L5 protein can be substituted by other RNAs or other ribosomal proteins. The region responsible for binding 5S rRNA is located at positions 35–50 with amino acid sequence RLV...

  20. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2016-12-06

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development.

  1. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Science.gov (United States)

    Flavobacterium columnare is the causative agent of columnaris disease which severely impacts channel catfish production in the USA and may be emerging as an important pathogen in the rainbow trout industry. The 16S rRNA gene is a housekeeping gene commonly used for bacterial taxonomy and genotyping...

  2. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment

    Science.gov (United States)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  3. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96.4...

  4. Campylobacter jejuni, an uncommon cause of splenic abscess diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Seng, Piseth; Quenard, Fanny; Menard, Amélie; Heyries, Laurent; Stein, Andreas

    2014-12-01

    Splenic abscess is a rare disease that primarily occurs in patients with splenic trauma, endocarditis, sickle cell anemia, or other diseases that compromise the immune system. This report describes a culture-negative splenic abscess in an immunocompetent patient caused by Campylobacter jejuni, as determined by 16S rRNA gene sequencing.

  5. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, Human Papilloma Virus infection and surgical treatment

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodriguez-Hilario, Arnold; Gonzalez, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David

    2016-01-01

    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropha

  6. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    Science.gov (United States)

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  7. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    Science.gov (United States)

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  8. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J;

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  9. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  10. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato (Solanum lycopersicum) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  11. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Science.gov (United States)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  12. Micelle PCR reduces chimera formation in 16S rRNA profiling of complex microbial DNA mixtures

    NARCIS (Netherlands)

    S.A. Boers (Stefan A.); J.P. Hays (John P.); R. Jansen (Ruud)

    2015-01-01

    textabstract16S rRNA gene profiling has revolutionized the field of microbial ecology. Many researchers in various fields have embraced this technology to investigate bacterial compositions of samples derived from many different ecosystems. However, it is important to acknowledge the current

  13. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database

    NARCIS (Netherlands)

    Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.

    2015-01-01

    Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to f

  14. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  15. First report of neonatal bacteremia caused by "Haemophilus quentini" diagnosed by 16S rRNA gene sequencing, Italy.

    Science.gov (United States)

    Giufrè, Maria; Cardines, Rita; Degl'Innocenti, Roberto; Cerquetti, Marina

    2015-10-01

    We report the first case of neonatal bacteremia caused by a "Haemophilus quentini" isolate in Italy. The isolate was differentiated from H. influenzae by 16S rRNA sequencing and was characterized by comparison with the wild-type "H. quentini" CCUG 36167. Both isolates carried substitutions in penicillin-binding protein 3 but were susceptible to aminopenicillins.

  16. Direct 16S rRNA gene sequencing of polymicrobial culture-negative samples with analysis of mixed chromatograms

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Justesen, Ulrik S

    2010-01-01

    Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...

  17. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment.

    Science.gov (United States)

    LaFrentz, B R; Waldbieser, G C; Welch, T J; Shoemaker, C A

    2014-07-01

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare, and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing of this important fish pathogen. Interpretation of restriction patterns can be difficult due to the lack of a formal description of the expected number and sizes of DNA fragments generated for each of the described genomovars. In this study, partial 16S rRNA gene sequences (ca. 1250-bp fragment) from isolates representing each described genomovar and isolates generating unique restriction patterns were cloned and sequenced. The results demonstrated that some isolates contained up to three different 16S rRNA genes whose sequences generate different RFLP patterns due to intragenomic heterogeneity within HaeIII restriction sites. The occurrence of HaeIII restriction sites within the portion of the 16S rRNA gene used for typing the F. columnare isolates and intragenomic heterogeneity within these sites explained the restriction patterns observed following RFLP analyses. This research provides a standard protocol for typing isolates of F. columnare by RFLP and a formal description of the expected restriction patterns for the previously described genomovars I, II, II-B and III. Additionally, we describe a new genomovar, I/II.

  18. Dynamics and persistence of Dead Sea microbial populations as shown by high-throughput sequencing of rRNA.

    Science.gov (United States)

    Rhodes, Matthew E; Oren, Aharon; House, Christopher H

    2012-04-01

    16S rRNA amplicon libraries from a haloarchaeal bloom in the hypersaline Dead Sea in 1992 were analyzed together with the 2007 residual population and simulated blooms in experimental mesocosms. Significant population shifts were observed during the bloom, and surprisingly a signature from the bloom was retained 15 years later.

  19. The final step in 5.8S rRNA processing is cytoplasmic in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thomson, Emma; Tollervey, David

    2010-02-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3' cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3'-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading to TRAMP-dependent pre-rRNA degradation. The 6S pre-rRNA was coprecipitated with the 60S export adapter Nmd3 and cytoplasmic 60S synthesis factor Lsg1. The longer 5.8S+30 pre-rRNA (a form of 5.8S rRNA 3' extended by approximately 30 nucleotides) is processed to 6S by the nuclear exonuclease Rrp6, and nuclear pre-rRNA accumulated in the absence of Rrp6. In contrast, 6S to 5.8S processing requires the cytoplasmic exonuclease Ngl2, and cytoplasmic pre-rRNA accumulated in strains lacking Ngl2. We conclude that nuclear pre-60S particles containing the 6S pre-rRNA bind Nmd3 and Crm1 and are exported to the cytoplasm prior to final maturation by Ngl2.

  20. The Final Step in 5.8S rRNA Processing Is Cytoplasmic in Saccharomyces cerevisiae▿ †

    Science.gov (United States)

    Thomson, Emma; Tollervey, David

    2010-01-01

    The 18S rRNA component of yeast (Saccharomyces cerevisiae) 40S ribosomes undergoes cytoplasmic 3′ cleavage following nuclear export, whereas exported pre-60S subunits were believed to contain only mature 5.8S and 25S rRNAs. However, in situ hybridization detected 3′-extended forms of 5.8S rRNA in the cytoplasm, which were lost when Crm1-dependent preribosome export was blocked by treatment with leptomycin B (LMB). LMB treatment rapidly blocked processing of 6S pre-rRNA to 5.8S rRNA, leading to TRAMP-dependent pre-rRNA degradation. The 6S pre-rRNA was coprecipitated with the 60S export adapter Nmd3 and cytoplasmic 60S synthesis factor Lsg1. The longer 5.8S+30 pre-rRNA (a form of 5.8S rRNA 3′ extended by ∼30 nucleotides) is processed to 6S by the nuclear exonuclease Rrp6, and nuclear pre-rRNA accumulated in the absence of Rrp6. In contrast, 6S to 5.8S processing requires the cytoplasmic exonuclease Ngl2, and cytoplasmic pre-rRNA accumulated in strains lacking Ngl2. We conclude that nuclear pre-60S particles containing the 6S pre-rRNA bind Nmd3 and Crm1 and are exported to the cytoplasm prior to final maturation by Ngl2. PMID:20008552

  1. Analysis of the secondary structure of mitochondrial LSU rRNA of Peruvian land snails (Orthalicidae: Gastropoda

    Directory of Open Access Journals (Sweden)

    Jorge Ramirez Ramirez

    2011-05-01

    Full Text Available The alignment of ribosomal genes is difficult due to insertion and deletion events of nucleotides, making the alignment ambiguous. This can be overcome by using information from the secondary structure of ribosomal genes. The aim of this study was to evaluate the utility of the secondary structure in improving the alignment of the 16S rRNA gene in land snails of the family Orthalicidae. We assessed 10 Orthalicid species (five genera. Total DNA was isolated and the partial 16S rRNA gene was amplified and sequenced using internal primers. The sequences were aligned with ClustalX and manually corrected, in DCSE format, using the 16S rRNA secondary structure of Albinaria caerulea (Pulmonata: Clausiliidae. The sequences obtained ranged from 323 to 345 bp corresponding to parts of both domains IV and V of the 16S rRNA gene. The secondary structure was recovered by homology using RnaViz 2.0. Most stems are conserved, and in general the loops are more variable. The compensatory mutations in stems are related to maintenance of the structure. The absence of a bulge-stem-loop in domain V places the family Orthalicidae within the Heterobranchia.

  2. Spatial Distribution of Escherichia coli in the Mouse Large Intestine Inferred from rRNA In Situ Hybridization

    DEFF Research Database (Denmark)

    Poulsen, Lars Kærgaard; Lan, Fusheng; Sternberg, Claus

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from th...

  3. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  4. Molecular diagnosis of Kingella kingae pericarditis by amplification and sequencing of the 16S rRNA gene.

    Science.gov (United States)

    Matta, Matta; Wermert, Delphine; Podglajen, Isabelle; Sanchez, Olivier; Buu-Hoï, Annie; Gutmann, Laurent; Meyer, Guy; Mainardi, Jean-Luc

    2007-09-01

    Kingella kingae is a fastidious gram-negative bacillus that is considered an emerging pathogen in pediatric settings but remains less common in adults. Here we describe a case of pericarditis in an immunocompetent adult host. The microorganism was identified directly from the clinical sample by molecular techniques, i.e., 16S rRNA gene amplification and sequencing.

  5. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  6. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A.

    Science.gov (United States)

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-06-05

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation.

  7. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid-coded Escheri...

  8. A comparison of rpoB and 16S rRNA as markers in pyrosequencing studies of bacterial diversity

    NARCIS (Netherlands)

    Vos, M.; Quince, C.; Pijl, A.S.; De Hollander, M.; Kowalchuk, G.A.

    2012-01-01

    Background The 16S rRNA gene is the gold standard in molecular surveys of bacterial and archaeal diversity, but it has the disadvantages that it is often multiple-copy, has little resolution below the species level and cannot be readily interpreted in an evolutionary framework. We compared the 16S r

  9. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    Science.gov (United States)

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  10. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  11. Micelle PCR reduces chimera formation in 16S rRNA profiling of complex microbial DNA mixtures

    NARCIS (Netherlands)

    S.A. Boers (Stefan A.); J.P. Hays (John P.); R. Jansen (Ruud)

    2015-01-01

    textabstract16S rRNA gene profiling has revolutionized the field of microbial ecology. Many researchers in various fields have embraced this technology to investigate bacterial compositions of samples derived from many different ecosystems. However, it is important to acknowledge the current limitat

  12. Improving the microbial community reconstruction at the genus level by multiple 16S rRNA regions.

    Science.gov (United States)

    Wang, Shengqin; Sun, Beili; Tu, Jing; Lu, Zuhong

    2016-06-07

    16S rRNA genes have been widely used for phylogenetic reconstruction and the quantification of microbial diversity through the application of next-generation sequencing technology. However, long-read sequencing is still costly, while short-read sequencing carries less information for complex microbial community profiling; therefore, the applications of high throughput sequencing platforms still remain challenging in microbial community reconstruction analysis. Here, we developed a method to investigate the profile of aligned 16S rRNA gene sequences and to measure the proper region for microbial community reconstruction, as a step in creating a more efficient way to detect microorganism at the genus level. Finally, we found that each genus has its own preferential genus-specific amplicons for a genus assignment, which are not always located in hyper variable regions (HVRs). It was also noted that the rare genera should contribute less than dominant ones to the common profile of the aligned 16S rRNA sequences and have lower affinity to the common universal primer. Therefore, using multiple 16S rRNA regions rather than one "universal" region can significantly improve the ability of microbial community reconstruction. In addition, we found that a short fragment is suitable for most genera identifications, and the proper conserved regions used for primer design are larger than before. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto

    2016-11-27

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  14. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, Human Papilloma Virus infection and surgical treatment

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodriguez-Hilario, Arnold; Gonzalez, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David

    2016-01-01

    Systemic inflammatory events and localize