
Sample records for 16s ribosomal rna

  1. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. (United States)

    Doi, Yohei; Arakawa, Yoshichika


    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  2. Research Techniques Made Simple: Bacterial 16S Ribosomal RNA Gene Sequencing in Cutaneous Research. (United States)

    Jo, Jay-Hyun; Kennedy, Elizabeth A; Kong, Heidi H


    Skin serves as a protective barrier and also harbors numerous microorganisms collectively comprising the skin microbiome. As a result of recent advances in sequencing (next-generation sequencing), our understanding of microbial communities on skin has advanced substantially. In particular, the 16S ribosomal RNA gene sequencing technique has played an important role in efforts to identify the global communities of bacteria in healthy individuals and patients with various disorders in multiple topographical regions over the skin surface. Here, we describe basic principles, study design, and a workflow of 16S ribosomal RNA gene sequencing methodology, primarily for investigators who are not familiar with this approach. This article will also discuss some applications and challenges of 16S ribosomal RNA sequencing as well as directions for future development. PMID:26902128

  3. RNA-DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA. (United States)

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan


    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA-DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the reads in all tested samples). The 2617 RDDs appeared already at the precursor polycistrone mitochondrial transcript. By using traditional Sanger sequencing, we identified the A-to-U RDD in six different cell lines and representative primates (Gorilla gorilla, Pongo pigmaeus, and Macaca mulatta), suggesting conservation of the mechanism generating such RDD. Phylogenetic analysis of more than 1700 vertebrate mtDNA sequences supported a thymine as the primate ancestral allele at position 2617, suggesting that the 2617 RDD recapitulates the ancestral 16S rRNA. Modeling U or G (the RDDs) at position 2617 stabilized the large ribosomal subunit structure in contrast to destabilization by an A (the pre-RDDs). Hence, these mitochondrial RDDs are likely functional. PMID:23913925

  4. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D;


    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  5. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence (United States)

    Ortega, Maya


    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  6. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)


    Triman, K L; Peister, A; R. A. Goel


    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  7. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans. (United States)

    Tomioka, N; Sugiura, M


    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  8. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu


    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  9. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing


    Naveed, Muhammad; Mubeen, Samavia; Khan, Samiullah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad


    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relat...

  10. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species. (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I


    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. PMID:23622485

  11. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.


    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  12. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.


    Melançon, P; Lemieux, C; Brakier-Gingras, L


    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  13. RNA–DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA


    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L.; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan


    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA–DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the...

  14. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole


    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  15. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing. (United States)

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad


    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  16. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed


    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  17. Quantification of uncultured Ruminococcus obeum-like bacteria in human fecal samples with fluorescent in situ hybridization and flow cytometry using 16S ribosomal RNA targeted probes


    Zoetendal, E.G.; Ben-Amor, K.; Harmsen, H. J. M.; Schut, F; Akkermans, A. D. L.; Vos, de, N.M.


    A 16S rRNA-targeted probe was designed and validated in order to quantify the number of uncultured Ruminococcus obeum-like bacteria by fluorescent in situ hybridization (FISH). These bacteria have frequently been found in 16S ribosomal DNA clone libraries prepared from bacterial communities in the human intestine. Thirty-two reference strains from the human intestine, including a phylogenetically related strain and strains of some other Ruminococcus species, were used as negative controls and...

  18. Genetic Analysis of the Invariant Residue G791 in Escherichia coli 16S rRNA Implicates RelA in Ribosome Function▿


    Kim, Hong-Man; Ryou, Sang-Mi; Song, Woo-Seok; Sim, Se-Hoon; Cha, Chang-Jun; Han, Seung Hyun; Ha, Nam-Chul; Kim, Jae-Hong; BAE, Jeehyeon; Cunningham, Philip R.; Lee, Kangseok


    Previous studies identified G791 in Escherichia coli 16S rRNA as an invariant residue for ribosome function. In order to establish the functional role of this residue in protein synthesis, we searched for multicopy suppressors of the mutant ribosomes that bear a G-to-U substitution at position 791. We identified relA, a gene whose product has been known to interact with ribosomes and trigger a stringent response. Overexpression of RelA resulted in the synthesis of approximately 1.5 times more...

  19. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA


    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.


    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is a...

  20. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    DEFF Research Database (Denmark)

    Moazed, D; Van Stolk, B J; Douthwaite, S;


    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  2. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C1400 was preserved. Changing C1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  3. Mutation detection analysis of a region of 16S-like ribosomal RNA gene of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii


    Khairnar Krishna; Parija Subhash


    Abstract Background The level of intra-species genetic variation in Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii populations in a localized geographic area, like Puducherry, India, remains unknown. Methods In the present study the existence of genetic variation in the nested multiplex polymerase chain reaction (NM-PCR) amplified region of the 16S-like ribosomal RNA genes of E. histolytica, E. dispar and E. moshkovskii was investigated by riboprinting and single strand con...

  4. FRET Characterization of Complex Conformational Changes in a Large 16S Ribosomal RNA Fragment Site-Specifically Labeled Using Unnatural Base Pairs. (United States)

    Lavergne, Thomas; Lamichhane, Rajan; Malyshev, Denis A; Li, Zhengtao; Li, Lingjun; Sperling, Edit; Williamson, James R; Millar, David P; Romesberg, Floyd E


    Ribosome assembly has been studied intensively using Förster resonance energy transfer (FRET) with fluorophore-labeled fragments of RNA produced by chemical synthesis. However, these studies are limited by the size of the accessible RNA fragments. We have developed a replicable unnatural base pair (UBP) formed between (d)5SICS and (d)MMO2 or (d)NaM, which efficiently directs the transcription of RNA containing unnatural nucleotides. We now report the synthesis and evaluation of several of the corresponding ribotriphosphates bearing linkers that enable the chemoselective attachment of different functionalities. We found that the RNA polymerase from T7 bacteriophage does not incorporate NaM derivatives but does efficiently incorporate 5SICS(CO), whose linker enables functional group conjugation via Click chemistry, and when combined with the previously identified MMO2(A), whose amine side chains permits conjugation via NHS coupling chemistry, enables site-specific double labeling of transcribed RNA. To study ribosome assembly, we transcribed RNA corresponding to a 243-nt fragment of the central domain of Thermus thermophilus 16S rRNA containing 5SICS(CO) and MMO2(A) at defined locations and then site-specifically attached the fluorophores Cy3 and Cy5. FRET was characterized using single-molecule total internal reflection fluorescence (smTIRF) microscopy in the presence of various combinations of added ribosomal proteins. We demonstrate that each of the fragment's two three-helix junctions exist in open and closed states, with the latter favored by sequential protein binding. These results elucidate early and previously uncharacterized folding events underlying ribosome assembly and demonstrate the applicability of UBPs for biochemical, structural, and functional studies of RNAs. PMID:26942998

  5. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Directory of Open Access Journals (Sweden)

    Ghosh Sujit K


    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  6. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA. (United States)

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R


    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  7. 16S ribosomal RNA-based methods to monitor changes in the hindgut bacterial community of piglets after oral administration of Lactobacillus sobrius S1. (United States)

    Su, Yong; Yao, Wen; Perez-Gutierrez, Odette N; Smidt, Hauke; Zhu, Wei-Yun


    16S ribosomal RNA (rRNA) gene based PCR/denaturing gradient gel electrophoresis (DGGE) and real-time PCR were used to monitor the changes in the composition of microbiota in the hindgut of piglets after oral administration of Lactobacillus sobrius S1. Six litters of neonatal piglets were divided randomly into control group and treatment group. At 7, 9, and 11 days of age, piglets in the treatment group orally received a preparation of L. sobrius S1. At 7, 14, 21(weaning), 24, and 35 days of age, one piglet from each litter was sacrificed and digesta samples of hindgut were collected. DGGE analysis of 16S rRNA gene V6-V8 region for all bacteria showed that several populations present in the hindgut of piglets, represented by far-migrating bands, disappeared after weaning. Most of these bands corresponded to Lactobacillus spp. as revealed by sequence analysis. Quantitative real-time PCR specific for lactobacilli further demonstrated that the number of lactobacilli population tended to decrease after the piglets were weaned. Drastic changes of L. amylovorus and L. sobrius in total Lactobacillus populations were also observed in the colon of piglets around weaning, as monitored by 16S rRNA gene V2-V3 region based Lactobacillus-specific PCR-DGGE. Species-specific real-time PCR also revealed that the population of L. sobrius declined apparently in the colon of piglets after weaning. No remarkable changes in the overall microbial community in the hindgut were found between control and treatment groups. However, comparison of DGGE profiles between the two groups revealed a specific band related to Clostridium disporicum that was found in treatment group on day 14. On day 35, a specific band appeared only in the control group, representing a population most closely related to Streptococcus suis (99%). Real-time PCR showed that L. sobrius 16S rRNA gene copies in treatment group were relatively higher than in the control group (10(8.45) vs. 10(6.83)) on day 35, but no

  8. Mutation detection analysis of a region of 16S-like ribosomal RNA gene of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii

    Directory of Open Access Journals (Sweden)

    Khairnar Krishna


    Full Text Available Abstract Background The level of intra-species genetic variation in Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii populations in a localized geographic area, like Puducherry, India, remains unknown. Methods In the present study the existence of genetic variation in the nested multiplex polymerase chain reaction (NM-PCR amplified region of the 16S-like ribosomal RNA genes of E. histolytica, E. dispar and E. moshkovskii was investigated by riboprinting and single strand conformation polymorphism (SSCP analysis. Results We found that 70 stool specimens were positive for E. histolytica, 171 stool specimens were positive for E. dispar, and 37 stool specimens were positive for E. moshkovskii by NM-PCR. Ninety liver abscess pus specimens, 21 urine specimens, and 8 saliva specimens were positive for E. histolytica by NM-PCR. Riboprinting analysis detected a mutation in the PCR product of only one E. histolytica isolate from a stool specimen. However, SSCP analysis detected mutations in the PCR products of five E. histolytica isolates and three E. moshkovskii isolates from stool specimens, and one E. histolytica isolate from a saliva specimen. The mutations detected by riboprinting and SSCP analysis were confirmed by sequencing. All the nucleotide sequences showing mutations in this study have already been deposited into the NCBI GenBank database under accession numbers [GenBank: EF682200 to GenBank: EF682208]. Conclusion The present study has revealed the subsistence of mutations in the ribosomal RNA genes of E. histolytica and E. moshkovskii, which points towards the existence of intra-species genetic variation in E. histolytica and E. moshkovskii isolates infecting humans.

  9. 利用线粒体16S rRNA 基因全序列分析直翅目主要类群的系统发生关系%Phylogenetic relationships among Orthoptera insect groups based on complete sequences of 16S ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    崔爱明; 黄原


    In order to reconstruct a robust phylogenetic relationship among major groups of Orthoptera and to explore the phylogenetic utility and performance of 16S Ribosomal RNA gene, complete sequences of 16S Ribosomal RNA were sequenced from 18 species in 9 families and 4 superfamilies of Orthoptera, and analyzed with other 40 species that have been completely sequenced. The result showed that the average length of 16S Ribosomal RNA was 1 310 bp. The positions of Tridactuloidea and Gryllotalpidae in Orthoptera were uncertain based on the 16S rRNA data, and the phylogenetic relationships of other major groups in Orthoptera were rather robust. Except for Oedipodidae and Gomphoceridae, Acrididae, Catantopidae, and Arcypteridae in Xia's taxonomic system were not monophyletic groups, and the genetic distances among the five groups were small. This indicates that the five families should be combined into one family. The genetic distances among Pamphagidae, Chrotogonidae, and Pyigomorphidae were also small. The loops of 16S rRNA gene could provide more information than stems when they were used for phylogenetic analysis. Complete sequence of 16S rRNA gene can be used to reconstruct robust phylogenetic relationship at the taxonomic category of species, genera, and suborder in Orthop-tera, but lack of resolution at family and superfamily levels.%为了构建稳健的直翅目主要类群间的系统发生关系并探讨16S rRNA 基因序列在构建直翅目昆虫不同分类阶元系统发生关系时的可行性、功效以及性能,文章测定了直翅目4 总科9 科18 种昆虫的16S rRNA 基因全序列,联合已知该基因全序列的其他40 种昆虫,构建了直翅目主要类群之间的系统发生关系,并分析了16S rRNA 基因全序列的系统发生性能和功效.结果表明,直翅目昆虫的16S rRNA 基因全长平均为1 310 bp; 除生活方式特化的蚤蝼总科和蝼蛄总科的地位无法确定外,直翅目其他主要类群

  10. Amplification of 16S ribosomal RNA genes of autotrophic ammonia-oxidizing bacteria demonstrates the ubiquity of nitrosospiras in the environment. (United States)

    Hiorns, W D; Hastings, R C; Head, I M; McCarthy, A J; Saunders, J R; Pickup, R W; Hall, G H


    Oligonucleotide sequences selected from the 16S rRNA genes of various species of ammonia-oxidizing bacteria were evaluated as specific PCR amplification primers and probes. The specificities of primer pairs for eubacterial, Nitrosospira and Nitrosomonas rRNA genes were established with sequence databases, and the primer pairs were used to amplify DNA from laboratory cultures and environmental samples. Eubacterial rRNA genes amplified from samples of soil and activated sludge hybridized with an oligonucleotide probe specific for Nitrosospira spp., but not with a Nitrosomonas-specific probe. Lakewater and sediment samples were analysed using a nested PCR technique in which eubacterial rRNA genes were subjected to a secondary amplification with Nitrosomonas or Nitrosospira specific primers. Again, the presence of Nitrosospira DNA, but not Nitrosomonas DNA, was detected and this was confirmed by hybridization of the amplified DNA with an internal oligonucleotide probe. Enrichments of lakewater and sediment samples, incubated for two weeks in the presence of ammonium, produced nitrite and were found to contain DNA from both Nitrosospira and Nitrosomonas as determined by nested PCR amplification and probing of 16S rRNA genes. This demonstrates that Nitrosospira spp. are widespread in the environment. The implications of the detection of Nitrosomonas DNA only after enrichment culture are discussed. PMID:8535507

  11. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Directory of Open Access Journals (Sweden)

    Carmen Fernández-Molina


    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  12. Genetic divergences of South and Southeast Asian frogs: a case study of several taxa based on 16S ribosomal RNA gene data with notes on the generic name Fejervarya


    Hasan, Mahmudul; Islam, Mohammed Mafizul; KHAN, Md. Mukhlesur Rahman; Igawa, Takeshi; ALAM, Mohammad Shafiqul


    To elucidate the genetic divergences of several Asian frog taxa, the mitochondrial 16S rRNA gene (16S) sequences of 81 populations across 6 Asian countries were analyzed. In total, 109 haplotypes were found, and the concept of a 3% difference in 16S sequence corresponding to species threshold was applied to define candidate amphibian species, for which corroborating evidence, such as morphology, ecological characteristics, and/or nuclear gene data, is required. Polypedates leucomystax, Hylara...

  13. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter


    Mycoplasma hyosynoviae strains from Denmark, Germany, Japan, Sweden, the Netherlands and the UK were examined for variations in the genomic DNA and within the 16S ribosomal RNA (rRNA) gene. Variations in the chromosomal DNA among 57 isolates recovered from the respiratory tract and joints of pigs...... examined for variation within the 16S rRNA gene. Ten field strains possessed the 16S rDNA sequences identical to the type strain, while the remaining six strains had sequences that differed by one to two nucleotides from that obtained from the type strain....

  14. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren


    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  15. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.


    Dron, M; Rahire, M; Rochaix, J D


    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...


    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  17. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.


    Pettersson, B; Johansson, K. E.; Uhlén, M


    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing wa...

  18. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige


    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  19. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    International Nuclear Information System (INIS)

    The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 106 protozoa/ml, 103-107 fungi/ml, 1010 bacteria/ml, and 109 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

  20. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes (United States)

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing


    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  1. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes. (United States)

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing


    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  2. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects (United States)

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic


    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  3. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects. (United States)

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic; Leese, Florian


    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  4. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett


    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on and on

  5. Nonenzymatic microorganism identification based on ribosomal RNA (United States)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.


    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  6. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  7. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly. (United States)

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra


    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  8. Estimation of Bacterial Cell Numbers in Humic Acid-Rich Salt Marsh Sediments with Probes Directed to 16S Ribosomal DNA


    Edgcomb, Virginia P; Mcdonald, John H.; Devereux, Richard; Smith, David W.


    The feasibility of using probes directed towards ribosomal DNAs (rDNAs) as a quantitative approach to estimating cell numbers was examined and applied to study the structure of a bacterial community in humic acid-rich salt marsh sediments. Hybridizations were performed with membrane-bound nucleic acids by using seven group-specific DNA oligonucleotide probes complementary to 16S rRNA coding regions. These included a general eubacterial probe and probes encompassing most members of the gram-ne...

  9. Visualization of ribosomal RNA operon copy number distribution


    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E


    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  10. Polynucleotide Probes That Target a Hypervariable Region of 16S rRNA Genes To Identify Bacterial Isolates Corresponding to Bands of Community Fingerprints


    Heuer, Holger; Hartung, Kathrin; Wieland, Gabriele; Kramer, Ina; Smalla, Kornelia


    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in ...

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson


    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  12. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    DEFF Research Database (Denmark)

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;


    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  13. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert;


    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  14. Viral IRES RNA structures and ribosome interactions


    Kieft, Jeffrey S.


    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  15. Viral IRES RNA structures and ribosome interactions. (United States)

    Kieft, Jeffrey S


    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  16. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis


    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja


    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  17. Quantification of Uncultured Ruminococcus obeum-Like Bacteria in Human Fecal Samples by Fluorescent In Situ Hybridization and Flow Cytometry Using 16S rRNA-Targeted Probes


    Zoetendal, Erwin G.; Ben-Amor, Kaouther; Harmsen, Hermie J. M.; Schut, Frits; Akkermans, Antoon D. L.; de Vos, Willem M.


    A 16S rRNA-targeted probe was designed and validated in order to quantify the number of uncultured Ruminococcus obeum-like bacteria by fluorescent in situ hybridization (FISH). These bacteria have frequently been found in 16S ribosomal DNA clone libraries prepared from bacterial communities in the human intestine. Thirty-two reference strains from the human intestine, including a phylogenetically related strain and strains of some other Ruminococcus species, were used as negative controls and...

  18. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline


    Trieber, Catharine A.; Taylor, Diane E.


    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  19. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.


    Honoré, N; Marchal, G.; Cole, S T


    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  20. Use of Quantitative 16S Ribosomal DNA Detection for Diagnosis of Central Vascular Catheter-Associated Bacterial Infection


    Warwick, S.; Wilks, M; Hennessy, E.; Powell-Tuck, J; Small, M.; Sharp, J.; Millar, M R


    Many central vascular catheters (CVCs) are removed unnecessarily because current diagnostic methods for CVC-associated infection are unreliable. A quantitative PCR assay using primers and probe targeted to bacterial 16S ribosomal DNA was used to measure the levels of bacterial DNA in blood samples drawn through the CVC in a population of patients receiving intravenous nutrition. Bacterial DNA concentrations were raised in 16 of 16 blood samples taken during episodes of probable bacterial CVC-...

  1. Nucleolar dominance and ribosomal RNA gene silencing


    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.


    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  2. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus. (United States)

    More, Ravi P; Purohit, Hemant J


    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  3. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis


    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.


    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  4. Depletion of pre-16S rRNA in starved Escherichia coli cells. (United States)

    Cangelosi, G A; Brabant, W H


    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  5. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.


    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  6. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;


    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  7. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium


    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.


    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  8. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon


    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  9. Molecular identification of bacteria from a coculture by denaturing gradient gel electrophoresis of 16S ribosomal DNA fragments as a tool for isolation in pure cultures.


    Teske, A; Sigalevich, P; Cohen, Y.; Muyzer, G.


    Molecular information about the bacterial composition of a coculture capable of sulfate reduction after exposure to oxic and microoxic conditions was used to identify and subsequently to isolate the components of the mixture in pure culture. PCR amplification of 16S ribosomal DNA fragments from the coculture, analyzed by denaturing gradient gel electrophoresis, resulted in two distinct 16S ribosomal DNA bands, indicating two different bacterial components. Sequencing showed that the bands wer...

  10. Bacterial diversity in Philippine fermented mustard (burong mustasa) as revealed by 16S rRNA gene analysis. (United States)

    Larcia, L L H; Estacio, R C; Dalmacio, L M M


    Previous studies on the bacterial profile of burong mustasa, a traditional Philippine fermented food, had been conducted using culture-dependent techniques. Since these methods may underestimate the total microbiota of a sample, a culture-independent study was done to determine the bacterial diversity in burong mustasa through molecular biology techniques. Bacterial DNA was isolated from fermented mustard samples at different stages of fermentation. The isolated genomic DNA was amplified by PCR using specific primers for the 16S ribosomal RNA gene (16S rDNA). The 1.5 kb amplicons obtained were subjected to nested PCR using primers for the internal variable region of the 16S rDNA. The 585 bp nested PCR amplicons were then subjected to denaturing gradient gel electrophoresis (DGGE) to separate the different bacteria present in each sample. Distinct and unique bands in the DGGE profile were excised, reamplified, purified and sequenced for bacterial identification. Molecular cloning of the 1.5 kb 16S rDNA was also performed using the pGEM-T Easy Vector System. The cloned gene was sequenced for bacterial identification. The identified microbiota in burong mustasa at different stages of fermentation include lactic acid bacteria and several uncultured bacteria (initial up to the final stages); acetic acid bacteria (middle stage); and Streptobacillus and Fusobacterium species (initial stage). The potential probiotic bacteria found in burong mustasa are Weissella and Lactobacillus. PMID:22146686

  11. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence. (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  12. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH


    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  13. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing. (United States)

    Balzer, M; Wagner, R


    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  14. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA


    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing


    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  15. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  16. Evaluation of Partial 16S Ribosomal DNA Sequencing for Identification of Nocardia Species by Using the MicroSeq 500 System with an Expanded Database


    Cloud, Joann L.; Patricia S Conville; Croft, Ann; Harmsen, Dag; Witebsky, Frank G.; Carroll, Karen C.


    Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5′ 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microo...

  17. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. (United States)

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  18. Structure of a mitochondrial ribosome with minimal RNA


    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.


    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  19. 16S rRNA is a better choice than COI for DNA barcoding hydrozoans in the coastal waters of China

    Institute of Scientific and Technical Information of China (English)

    ZHENG Lianming; HE Jinru; LIN Yuanshao; CAO Wenqing; ZHANG Wenjing


    Identification of hydrozoan species is challenging, even for taxonomic experts, due to the scarcity of distinct morphological characters and phenotypic plasticity. DNA barcoding provides an efficient method for spe-cies identification, however, the choice between mitochondrial cytochrome c oxidase subunit I (COI) and large subunit ribosomal RNA gene (16S) as a standard barcode for hydrozoans is subject to debate. Herein, we directly compared the barcode potential of COI and 16S in hydrozoans using 339 sequences from 47 pelagic hydrozoan species. Analysis of Kimura 2-parameter genetic distances (K2P) documented the mean intraspecific/interspecific variation for COI and 16S to be 0.004/0.204 and 0.003/0.223, respectively. An obvi-ous“barcoding gap”was detected for all species in both markers and all individuals of a species clustered together in both the COI and 16S trees. These results suggested that the species within the studied taxa can be efficiently and accurately identified by COI and 16S. Furthermore, our results confirmed that 16S was a better phylogenetic marker for hydrozoans at the genus level, and in some cases at the family level. Con-sidering the resolution and effectiveness for barcoding and phylogenetic analyses of Hydrozoa, we strongly recommend 16S as the standard barcode for hydrozoans.

  20. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations. (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C


    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). PMID:22136768

  1. Optimization of Real-Time PCR Assay for Rapid and Sensitive Detection of Eubacterial 16S Ribosomal DNA in Platelet Concentrates


    T. Mohammadi; Reesink, H W; Vandenbroucke-Grauls, C. M. J. E.; Savelkoul, P. H. M.


    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating this contaminating DNA without affecting the sensitivity of the assay.

  2. Quantitative Selective PCR of 16S Ribosomal DNA Correlates Well with Selective Agar Plating in Describing Population Dynamics of Indigenous Pseudomonas spp. in Soil Hot Spots


    Johnsen, Kaare; Enger, Øivind; Jacobsen, Carsten S.; Thirup, Laila; Torsvik, Vigdis


    We used a quantitative PCR method targeting 16S ribosomal DNA using competitive PCR for specific detection of indigenous Pseudomonas DNA in soil hot spots. The amount of Pseudomonas DNA corresponded to the number of culturable Pseudomonas bacteria on Gould’s S1 agar. This represents the first use of PCR for quantification of indigenous bacteria in more than one sample of soil.

  3. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip


    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  4. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA. (United States)

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E


    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  5. Regulating the Ribosome: A Spotlight on RNA Dark Matter


    Lintner, Nathanael G.; Cate, Jamie H. D.


    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  6. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes


    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun


    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  7. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.


    A 16S rRNA gene database ( addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  8. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing


    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  9. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report. (United States)

    Lee, Sin Hang


    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  10. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report (United States)

    Lee, Sin Hang


    Lyme disease (LD), the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA) gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. PMID:27186082

  11. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Sarah M. Boomer


    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  12. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Bryan E. Dutton


    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  13. Structure of a mitochondrial ribosome with minimal RNA. (United States)

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K


    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  14. An overview of pre-ribosomal RNA processing in eukaryotes


    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel


    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  15. Visualization of ribosomal RNA operon copy number distribution

    Directory of Open Access Journals (Sweden)

    DasGupta Indrani


    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  16. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  17. Design of Vibrio 16S rRNA Gene Specific Primers and Their Application in the Analysis of Seawater Vibrio Community

    Institute of Scientific and Technical Information of China (English)

    LIU Yong; YANG Guanpin; WANG Hualei; CHEN Jixiang; SHI Xianming; ZOU Guiwei; WEI Qiwei; SUN Xiuqin


    The pathogenic species of genus Vibrio cause vibriosis, one of the most prevalent diseases of maricultured animals and seafood consumers. Monitoring their kinetics in the chain of seafood production, processing and consumption is of great importance for food and mariculture safety. In order to enrich Vibrio-representing 16S ribosomal RNA gene (rDNA) fragments and identify these bacteria further real-timely and synchronously among bacterial flora in the chain, a pair of primers that selectively amplify Vibrio 16S rDNA fragments were designed with their specificities and coverage testified in the analysis of seawater Vibrio community. The specificities and coverage of two primers, VF169 and VR744, were determined theoretically among bacterial 16S rDNAs available in GenBank by using BLAST program and practically by amplifying Vibrio 16S rDNA fragments from seawater DNA. More than 88.3% of sequences in GenBank, which showed identical matches with VR744, belong to Vibrio genus. A total of 33 clones were randomly selected and sequenced. All of the sequences showed their highest similarities to and clustered around those of diverse known Vibrio species. The primers designed are capable of retrieving a wide range of Vibrio 16S rDNA fragments specifically among bacterial flora in seawater, the most important natural environment of seafood cultivation.

  18. Metagenomic analysis targeted on the 16S ribosomal DNA to study the quality of meat : a example with raw minced beef meat


    Delhalle, Laurent; Taminiau, Bernard; Nezer, Carine; Daube, Georges


    Introduction: Steak tartare is a popular meat dish in Belgium and some other European countries. This meat preparations due to their raw nature, is highly sensitive to bacterial spoilage. A better understanding of the bacterial content of this product will thus be insightful to control the risk of spoilage. Metagenomics targeted on the 16S ribosomal DNA has appeared as a powerful tool to study bacterial composition of food samples. The aim of this study is to identify the bacterial populatio...

  19. Development of Amplified 16S Ribosomal DNA Restriction Analysis for Identification of Actinomyces Species and Comparison with Pyrolysis-Mass Spectrometry and Conventional Biochemical Tests


    Hall, Val; O’Neill, G. L.; Magee, J T; Duerden, B I


    Identification of Actinomyces spp. by conventional phenotypic methods is notoriously difficult and unreliable. Recently, the application of chemotaxonomic and molecular methods has clarified the taxonomy of the group and has led to the recognition of several new species. A practical and discriminatory identification method is now needed for routine identification of clinical isolates. Amplified 16S ribosomal DNA restriction analysis (ARDRA) was applied to reference strains (n = 27) and clinic...

  20. Identification of Nonpoint Sources of Fecal Pollution in Coastal Waters by Using Host-Specific 16S Ribosomal DNA Genetic Markers from Fecal Anaerobes


    Bernhard, Anne E.; Field, Katharine G.


    We describe a new PCR-based method for distinguishing human and cow fecal contamination in coastal waters without culturing indicator organisms, and we show that the method can be used to track bacterial marker sequences in complex environments. We identified two human-specific genetic markers and five cow-specific genetic markers in fecal samples by amplifying 16S ribosomal DNA (rDNA) fragments from members of the genus Bifidobacterium and the Bacteroides-Prevotella group and performing leng...

  1. Phylogenetic systematics of Barn Owl (Tyto alba (Scopoli, 1769 complex inferred from mitochondrial rDNA (16S rRNA taxonomic implication

    Directory of Open Access Journals (Sweden)

    Mansour Aliabadian


    Full Text Available The Barn owl, Tyto alba (Scopoli, 1769, occurs worldwide and shows a considerable amount of morphological and geographical variations, leading to the recognition of many subspecies throughout the world. Yet, no comprehensive study has not been done on this species. Data from mitochondrial gene (16S Ribosomal RNA (16S with 569 bp length were analyzed for 41 individuals around the world. Maximum likelihood (ML, maximum parsimony (MP and Bayesian analysis showed two distinct clades including alba clad (old world and furcata clad (new world. The amount of genetic variation within each of these clades ranged from 0.5-1.7 but variation between clades was 3.7. This data may suggest that Barn owls of the Old World may be a separate species from those of the New World.

  2. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun


    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  3. Direct 16S rRNA-seq from bacterial communities: a PCR-independent approach to simultaneously assess microbial diversity and functional activity potential of each taxon. (United States)

    Rosselli, Riccardo; Romoli, Ottavia; Vitulo, Nicola; Vezzi, Alessandro; Campanaro, Stefano; de Pascale, Fabio; Schiavon, Riccardo; Tiarca, Maurizio; Poletto, Fabio; Concheri, Giuseppe; Valle, Giorgio; Squartini, Andrea


    The analysis of environmental microbial communities has largely relied on a PCR-dependent amplification of genes entailing species identity as 16S rRNA. This approach is susceptible to biases depending on the level of primer matching in different species. Moreover, possible yet-to-discover taxa whose rRNA could differ enough from known ones would not be revealed. DNA-based methods moreover do not provide information on the actual physiological relevance of each taxon within an environment and are affected by the variable number of rRNA operons in different genomes. To overcome these drawbacks we propose an approach of direct sequencing of 16S ribosomal RNA without any primer- or PCR-dependent step. The method was tested on a microbial community developing in an anammox bioreactor sampled at different time-points. A conventional PCR-based amplicon pyrosequencing was run in parallel. The community resulting from direct rRNA sequencing was highly consistent with the known biochemical processes operative in the reactor. As direct rRNA-seq is based not only on taxon abundance but also on physiological activity, no comparison between its results and those from PCR-based approaches can be applied. The novel principle is in this respect proposed not as an alternative but rather as a complementary methodology in microbial community studies. PMID:27577787

  4. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr (United States)

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie


    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  5. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops. (United States)

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A


    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants. PMID:26345903

  6. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.


    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.


    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  7. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa. (United States)

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli


    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  8. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae. (United States)

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C


    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  9. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  10. Eukaryotic ribosomes that lack a 5.8S RNA (United States)

    Vossbrinck, C. R.; Woese, C. R.


    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  11. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Ž. Radulović


    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  12. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  13. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon. (United States)

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A


    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  14. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei


    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  15. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes (United States)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.


    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  16. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles


    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  17. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9. (United States)

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G


    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  18. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9 (United States)

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.


    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  19. ColE1 cloning of a ribosomal RNA promoter region from lambdarifsup(d)18 by selection for lambda integration and excision functions

    International Nuclear Information System (INIS)

    The expression of the ribosomal RNA gene carried by the lambda transducing phage lambdarifsup(d)18 is shown to be subject to stringent amino acid control. lambdarifsup(d)18 DNA was digested with endonuclease EcoRI and ligated to similarly restricted ColE1 plasmid DNA. Selection for expression of lambda integration and excision gene activity carried by the same DNA fragment results in cloning of the promoter proximal portion of the 16S ribosomal RNA gene. The resulting chimera expresses lambda integration and excision functions as well as encoding the promoter proximal half of a 16S ribosomal RNA gene. The effect of ultraviolet dose on stringent control of phage lambdarifsup(d)18 dependent ribosomal RNA synthesis is included in the investigation. (Auth.)

  20. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments


    Korsak Koulagenko, Nicolas; Taminiau, Bernard; Leclercq, Mathilde; Nezer, Carine; Crevecoeur, Sébastien; Ferauche, Céline; Detry, Emilie; Delcenserie, Véronique; Daube, Georges


    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for ...

  1. Endodontic bacteria from primary and persistent endodontic lesions in Chinese patients as identified by cloning and 16S ribosomal DNA gene sequencing

    Institute of Scientific and Technical Information of China (English)

    LI Xin; ZHU Xiao-fei; ZHANG Cheng-fei; Peter Cathro; CJ Seneviratne; SHEN Song


    Background Few literatures pertain to the 16S ribosomal DNA (16S rDNA) analysis of bacteria contributing to primary and persistent endodontic lesions,with no information available for the Chinese population.As such,we investigated endodontic bacteria associated with primary and persistent endodontic lesions in adult Chinese patients living in Beijing,China using 16S rDNA gene sequencing techniques.Methods Endodontic microbial samples were obtained from fourteen adult Chinese patients and subjected to DNA extraction.Pllymerase chain reaction (PCR) products were cloned and 100 clones from each generated library were randomly selected.Purified plasmid DNA with 16S rDNA gene inserts was sequenced,and the sequences were searched against GenBank databases using the BLASTN algorithm.Only significant identification with the highest-scored BLAST result and 99% minimum similarity was considered for phylotyping.Results More than 150 taxa were obtained.Primary endodontic infection was mainly associated with Burkholderia cepacia,Actinomyces,Aranicola spp.and Streptococcus sanguinis,whilst Burkholderia cepacia was predominant in the persistent endodontic infections.Conclusion There is a difference in the species profile associated with endodontic infections of Chinese patients living in Beiiing in comoarison to other geographical or ethnic reports.

  2. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.

    Directory of Open Access Journals (Sweden)

    Stephen J Salipante

    Full Text Available Classifying individual bacterial species comprising complex, polymicrobial patient specimens remains a challenge for culture-based and molecular microbiology techniques in common clinical use. We therefore adapted practices from metagenomics research to rapidly catalog the bacterial composition of clinical specimens directly from patients, without need for prior culture. We have combined a semiconductor deep sequencing protocol that produces reads spanning 16S ribosomal RNA gene variable regions 1 and 2 (∼360 bp with a de-noising pipeline that significantly improves the fraction of error-free sequences. The resulting sequences can be used to perform accurate genus- or species-level taxonomic assignment. We explore the microbial composition of challenging, heterogeneous clinical specimens by deep sequencing, culture-based strain typing, and Sanger sequencing of bulk PCR product. We report that deep sequencing can catalog bacterial species in mixed specimens from which usable data cannot be obtained by conventional clinical methods. Deep sequencing a collection of sputum samples from cystic fibrosis (CF patients reveals well-described CF pathogens in specimens where they were not detected by standard clinical culture methods, especially for low-prevalence or fastidious bacteria. We also found that sputa submitted for CF diagnostic workup can be divided into a limited number of groups based on the phylogenetic composition of the airway microbiota, suggesting that metagenomic profiling may prove useful as a clinical diagnostic strategy in the future. The described method is sufficiently rapid (theoretically compatible with same-day turnaround times and inexpensive for routine clinical use.

  3. The role of human ribosomal proteins in the maturation of rRNA and ribosome production


    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica


    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  4. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4


    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  5. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  6. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep


    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  7. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene. (United States)

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao


    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  8. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR

    Directory of Open Access Journals (Sweden)

    Wang Nian


    Full Text Available Abstract Background Citrus Huanglongbing (HLB is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. Results We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Conclusion Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  9. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Directory of Open Access Journals (Sweden)

    Chi-Yong Ahn


    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  10. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)



    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  11. 16S rRNA gene pyrosequencing reveals shift in patient faecal microbiota during high-dose chemotherapy as conditioning regimen for bone marrow transplantation. (United States)

    Montassier, Emmanuel; Batard, Eric; Massart, Sébastien; Gastinne, Thomas; Carton, Thomas; Caillon, Jocelyne; Le Fresne, Sophie; Caroff, Nathalie; Hardouin, Jean Benoit; Moreau, Philippe; Potel, Gilles; Le Vacon, Françoise; de La Cochetière, Marie France


    Gastrointestinal disturbances are a side-effect frequently associated with haematological malignancies due to the intensive cytotoxic treatment given in connection with bone marrow transplantation (BMT). However, intestinal microbiota changes during chemotherapy remain poorly described, probably due to the use of culture-based and low-resolution molecular methods in previous studies. The objective of our study was to apply a next generation DNA sequencing technology to analyse chemotherapy-induced changes in faecal microbiota. We included eight patients with non-Hodgkin's lymphoma undergoing one course of BMT conditioning chemotherapy. We collected a prechemotherapy faecal sample, the day before chemotherapy was initiated, and a postchemotherapy sample, collected 1 week after the initiation of chemotherapy. Total DNA was extracted from faecal samples, denaturing high-performance liquid chromatography based on amplification of the V6 to V8 region of the 16S ribosomal RNA (rRNA) gene, and 454-pyrosequencing of the 16 S rRNA gene, using PCR primers targeting the V5 and V6 hypervariable 16S rRNA gene regions were performed. Raw sequence data were screened, trimmed, and filtered using the QIIME pipeline. We observed a steep reduction in alpha diversity and significant differences in the composition of the intestinal microbiota in response to chemotherapy. Chemotherapy was associated with a drastic drop in Faecalibacterium and accompanied by an increase of Escherichia. The chemotherapy-induced shift in the intestinal microbiota could induce severe side effects in immunocompromised cancer patients. Our study is a first step in identifying patients at risk for gastrointestinal disturbances and to promote strategies to prevent this drastic shift in intestinal microbiota. PMID:24402367

  12. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus


    Verma Mansi; Lal Devi; Lal Rup


    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  13. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol (United States)

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco


    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  14. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis


    El Saied, H.E.


    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  15. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  16. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    Institute of Scientific and Technical Information of China (English)

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai


    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  17. 16S rRNA gene survey of microbial communities in Winogradsky columns.

    Directory of Open Access Journals (Sweden)

    Ethan A Rundell

    Full Text Available A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities.

  18. Structural Insights into tRNA Dynamics on the Ribosome

    Directory of Open Access Journals (Sweden)

    Xabier Agirrezabala


    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  19. Structural Insights into tRNA Dynamics on the Ribosome. (United States)

    Agirrezabala, Xabier; Valle, Mikel


    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  20. Structural Insights into tRNA Dynamics on the Ribosome


    Xabier Agirrezabala; Mikel Valle


    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  1. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Czech Academy of Sciences Publication Activity Database

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.


    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  2. Microbial community structure of Arctic multiyear sea ice and surface seawater by 454 sequencing of the 16S RNA gene

    DEFF Research Database (Denmark)

    Bowman, Jeff S.; Rasmussen, Simon; Blom, Nikolaj;


    community in MYI at two sites near the geographic North Pole using parallel tag sequencing of the 16S rRNA gene. Although the composition of the MYI microbial community has been characterized by previous studies, microbial community structure has not been. Although richness was lower in MYI than...

  3. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp. (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  4. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Directory of Open Access Journals (Sweden)

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  5. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;


    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times for...... identification were 1.5 days and 2.8 days, respectively....

  6. Group-specific 16S rRNA-targeted oligonucleotide probes to identify thermophilic bacteria in marine hydrothermal vents

    NARCIS (Netherlands)

    Harmsen, HJM; Prieur, D; Jeanthon, C


    Four 16S rRNA-targeted oligonucleotide probes were designed for the detection of thermophilic members of the domain Bacteria known to thrive in marine hydrothermal systems, We developed and characterized probes encompassing most of the thermophilic members of the genus Bacillus, most species of the

  7. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer


    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  8. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  9. 16S rRNA gene-based metagenomic analysis reveals differences in bacteria-derived extracellular vesicles in the urine of pregnant and non-pregnant women (United States)

    Yoo, Jae Young; Rho, Mina; You, Young-Ah; Kwon, Eun Jin; Kim, Min-Hye; Kym, Sungmin; Jee, Young-Koo; Kim, Yoon-Keun; Kim, Young Ju


    Recent evidence has indicated that bacteria-derived extracellular vesicles (EVs) are important for host–microbe communication. The aims of the present study were to evaluate whether bacteria-derived EVs are excreted via the urinary tract and to compare the composition of bacteria-derived EVs in the urine of pregnant and non-pregnant women. Seventy-three non-pregnant and seventy-four pregnant women were enrolled from Dankook University and Ewha Womans University hospitals. DNA was extracted from urine EVs after EV isolation using the differential centrifugation method. 16S ribosomal RNA (16S rRNA) gene sequencing was performed using high-throughput 454 pyrosequencing after amplification of the V1–V3 region of the 16S rDNA. The composition of 13 taxa differed significantly between the pregnant and non-pregnant women. At the genus level, Bacillus spp. EVs were more significantly enriched in the urine of the pregnant women than in that of the non-pregnant women (45.61% vs 0.12%, respectively). However, Pseudomonas spp. EVs were more dominant in non-pregnant women than in pregnant women (13.2% vs 4.09%, respectively). Regarding the compositional difference between pregnant women with normal and preterm delivery, EVs derived from Ureaplasma spp. and the family Veillonellaceae (including Megasphaera spp.) were more abundant in the urine of preterm-delivered women than in that of women with normal deliveries. Taken together, these data showed that Bacillus spp. EVs predominate in the urine of pregnant women, whereas Pseudomonas spp. EVs predominate in the urine of non-pregnant women; this suggests that Bacillus spp. EVs might have an important role in the maintenance of pregnancy. PMID:26846451

  10. 16S rRNA gene-based metagenomic analysis reveals differences in bacteria-derived extracellular vesicles in the urine of pregnant and non-pregnant women. (United States)

    Yoo, Jae Young; Rho, Mina; You, Young-Ah; Kwon, Eun Jin; Kim, Min-Hye; Kym, Sungmin; Jee, Young-Koo; Kim, Yoon-Keun; Kim, Young Ju


    Recent evidence has indicated that bacteria-derived extracellular vesicles (EVs) are important for host-microbe communication. The aims of the present study were to evaluate whether bacteria-derived EVs are excreted via the urinary tract and to compare the composition of bacteria-derived EVs in the urine of pregnant and non-pregnant women. Seventy-three non-pregnant and seventy-four pregnant women were enrolled from Dankook University and Ewha Womans University hospitals. DNA was extracted from urine EVs after EV isolation using the differential centrifugation method. 16S ribosomal RNA (16S rRNA) gene sequencing was performed using high-throughput 454 pyrosequencing after amplification of the V1-V3 region of the 16S rDNA. The composition of 13 taxa differed significantly between the pregnant and non-pregnant women. At the genus level, Bacillus spp. EVs were more significantly enriched in the urine of the pregnant women than in that of the non-pregnant women (45.61% vs 0.12%, respectively). However, Pseudomonas spp. EVs were more dominant in non-pregnant women than in pregnant women (13.2% vs 4.09%, respectively). Regarding the compositional difference between pregnant women with normal and preterm delivery, EVs derived from Ureaplasma spp. and the family Veillonellaceae (including Megasphaera spp.) were more abundant in the urine of preterm-delivered women than in that of women with normal deliveries. Taken together, these data showed that Bacillus spp. EVs predominate in the urine of pregnant women, whereas Pseudomonas spp. EVs predominate in the urine of non-pregnant women; this suggests that Bacillus spp. EVs might have an important role in the maintenance of pregnancy. PMID:26846451

  11. Automated identification of medically important bacteria by 16S rRNA gene sequencing using a novel comprehensive database, 16SpathDB


    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung


    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB ( based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiol...

  12. Estimation of 16S rRNA gene copy number in several probiotic Lactobacillus strains isolated from the gastrointestinal tract of chicken


    Lee, Chin Mei; Sieo, Chin Chin; Abdullah, Norhani; Ho, Yin Wan


    The copy numbers of 16S rRNA genes in 12 probiotic Lactobacillus strains of poultry origin were analyzed. Genomic DNA of the strains was digested with restriction endonucleases that do not cut within the 16S rRNA gene of the strains. This was followed by Southern hybridization with a biotinylated probe complementary to the 16S rRNA gene. The copy number of the 16S rRNA gene within a Lactobacillus species was found to be conserved. From the hybridization results, Lactobacillus salivarius I 24 ...

  13. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen;


    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r...

  14. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  15. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  16. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA. (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T


    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps. PMID:27016627

  17. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  18. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach. (United States)

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti


    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  19. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Directory of Open Access Journals (Sweden)

    Tan Bertrand


    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  20. Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates


    Patel, Robin; Piper, Kerryl E.; Rouse, Mark S; Steckelberg, James M.; Uhl, Jim R.; Kohner, Peggy; Hopkins, Marlene K.; Cockerill, Franklin R.; Kline, Bruce C.


    The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faec...

  1. Unique 16S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain


    Elva Escobar-Briones; Eduardo Nájera-Hillman; Fernando Álvarez


    Amphipods of the species Eurythenes gryllus were collected at 2 locations on the abyssal plain (~3 400 m) of the Gulf of Mexico in order to test whether or not these scavenger amphipods are isolated in this peripheral sea or show connectivity by their predominant swimming behavior, moving horizontally along the abyssal water masses in the region. Partial sequences of the mitochondrial 16S rRNA gene from 2 individuals of E. gryllus were determined and showed small differences when compared to ...

  2. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing


    Diaz, Patricia I.; Abusleme, Loreto; Hong, Bo-Young; Amanda K. Dupuy; Linda D Strausbaugh


    Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction proced...

  3. Family- and Genus-Level 16S rRNA-Targeted Oligonucleotide Probes for Ecological Studies of Methanotrophic Bacteria


    J. Gulledge; Ahmad, A; Steudler, P. A.; Pomerantz, W. J.; Cavanaugh, Colleen Marie


    Methanotrophic bacteria play a major role in the global carbon cycle, degrade xenobiotic pollutants, and have the potential for a variety of biotechnological applications. To facilitate ecological studies of these important organisms, we developed a suite of oligonucleotide probes for quantitative analysis of methanotroph-specific 16S rRNA from environmental samples. Two probes target methanotrophs in the family Methylocystaceae (type II methanotrophs) as a group. No oligonucleotide signature...

  4. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample


    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.


    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  5. Analysis of Mixed Sequencing Chromatograms and Its Application in Direct 16S rRNA Gene Sequencing of Polymicrobial Samples▿


    Kommedal, Øyvind; Karlsen, Bjarte; Sæbø, Øystein


    Investigation of clinical samples by direct 16S rRNA gene sequencing provides the possibility to detect nonviable bacteria and bacteria with special growth requirements. This approach has been particularly valuable for the diagnosis of patients who have received antibiotics prior to sample collection. In specimens containing more than one bacterium, direct sequencing gives mixed chromatograms that complicate further interpretation. We designed an algorithm able to analyze these ambiguous chro...

  6. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing


    Jarvis, Karen G.; White, James R.; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E.


    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  7. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  8. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes


    Mu Peng; Xiaoxue Zi; Qiuyu Wang


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  9. Effects of 16S rRNA gene mutations on tetracycline resistance in Helicobacter pylori


    Gerrits, Monique; Berning, M.; Vliet, Arnoud; Kuipers, Ernst; Kusters, Johannes


    textabstractThe triple-base-pair 16S rDNA mutation AGA(926-928)-->TTC mediates high-level tetracycline resistance in Helicobacter pylori. In contrast, single- and double-base-pair mutations mediated only low-level tetracycline resistance and decreased growth rates in the presence of tetracycline, explaining the preference for the TTC mutation in tetracycline-resistant H. pylori isolates.

  10. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing. (United States)

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  11. Depletion of pre-16S rRNA in starved Escherichia coli cells.


    Cangelosi, G A; Brabant, W H


    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  12. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus (United States)

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  13. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.


    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  14. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J


    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  15. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells. (United States)

    Lochmann, E R; Ehrlich, W; Mangir, M


    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  16. Effect of ultraviolet irradiation on 30-S ribosomal subunits. Identification of the RNA region crosslinked to protein S7

    International Nuclear Information System (INIS)

    The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied. At the doses of radiation used in this work (0-4.5 x 105 quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA. In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly. Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm. No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes. The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease. The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G (position 1261-1266, see the sequence published by Carbon et al. (1979) Eur. J. Biochem. 160, 399-410). Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. (orig.)

  17. Experimental study of 16S rRNA gene sequence analysis for identification of atypical bacteria%16S rRNA基因序列分析鉴定非典型细菌的实验研究

    Institute of Scientific and Technical Information of China (English)

    沈亚娟; 夏云


    目的 建立以16S rRNA基因序列分析为基础的细菌鉴定方法,并初步将其应用于临床常规细菌的鉴定.方法 选择临床微生物实验室不能准确鉴定的细菌,以16S rRNA为靶序列,在两端保守区设计引物,PCR反应扩增目的 片段,测序后与数据库中已知细菌的16S rRNA序列进行序列比对.结果 13株菌中,有11株与数据库中的已知16S rRNA序列相似性达99.0%以上,成功鉴定到种的水平.结论 16S rRNA基因序列分析的方法可快速、准确地鉴定不典型菌株,可作为细菌常规鉴定的补充方法.%Objective To establish an approach for bacteria identification based on 16S rRNA gene sequence analysis ,and apply it to clinical routine bacteria identification initially .Methods Bacteria which can not be accurately identified in clinical microbiologi -cal laboratory were selected .16S rRNA served as target sequence ,primers were designed to match the conserved region at both ends and target fragments were amplified by means of PCR reaction .After sequencing ,their sequences were compared with 16S rRNA sequence of known bacteria in the database .Results Among 13 strains ,11 strains showed sequence similarity of 99 .0% with 16S rRNA sequence of known bacteria in the database ,and were successfully identified to the species level .Conclusion 16S rRNA gene sequence analysis can be applied to identify atypical bacteria quickly and accurately ,and serve as a supplementary method of routine bacteria identification .

  18. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Directory of Open Access Journals (Sweden)

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  19. Fluorescence-based Multiplex PCR-Single Strand Conformation Polymorphism (SSCP) Analysis of 16S Ribosomal DNA Using Capillary Electrophoresis

    Institute of Scientific and Technical Information of China (English)

    高鹏; 韩英; 许国旺; 赵春霞; 戴兵; 李萍; 王运铎; 温杰; 徐维家


    The rRNA genetic locus is found in all prokaryotic organisms, and is highly conservative, although its relatively stable variations are found frequently in different bacteria. The utility of this locus as a taxonomic and phylogenetic tool has been reported widely. This study, aimed at 16S rRNA gene ( 16S rDNA) and with the help of biomolecular methods, attempted to achieve the goal of rapid identification of common pathogens In this study, 333 clinical isolated pathogenic bacteria were collected。 Two pairs of primers were chosen and labeled with different fluorescent dyes and then used to amplify the genomic DNA extracted from bacteria. The PCR products were then detected by capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) . In order to pursue higher resolution and peak-separation effect, a high efficient separating medium, liner polyacrylamidedel (LPA), was put to use in this study. Finally, every bacteria colony generated distinct patterns from each other, which were easily to be used for identification.These results indicated that PCR-CE-SSCP was a rapid identification method for bacterial identification, with the aspects of high efficiency and high precision. Compared with traditional method, this technology is of great utility for clinical use especially for its high sensitivity.

  20. Phylogenetic relationship of 16 Oedipodidae species (Insecta: Orthoptera) based on the 16S rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)



    The sequences of the mitochondrial 16S rRNA gene of 16 Oedipodidae species were amplified and sequenced. All sequences were aligned and analyzed and the phyloge netic relationships were inferred. The properties of 16S gene in Oedipodidae showed typical patterns of many insects such as a high A+T content and variable distance-dependent transition/transversion ratios. The 0.2 weight for sites of loops may be advisable for phylogeny reconstruction using the maximum parsimony method. The phylogenetic analysis results do not support the current subfamily classification systems of Oedipodidae. Bryodemellinae and Bryodeminae are closely related and should be merged as one subfamily. The status of Oedipodinae and Locustinae is also problematic.

  1. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis (United States)

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  2. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis. (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio


    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  3. Rapid detection of the mutations of neisseria gonorrhoeae 16S rRNA gene using DNA chip%DNA芯片快速检测淋球菌16S rRNA基因突变

    Institute of Scientific and Technical Information of China (English)

    周文明; 杨森; 赵建龙; 曹慧敏; 张学军


    目的 探讨新研制的DNA芯片应用于快速检测淋球菌16S rRNA 基因突变的临床应用价值.方法 根据淋球菌16SrRNA 基因的序列信息设计探针并制作DNA芯片,PCR扩增并荧光标记包含16S rRNA 基因突变的目的 DNA片段,与芯片杂交,同时以测序法为对照.结果 87份泌尿生殖道拭子均可被DNA芯片检测,同时检测发现有1株淋球菌16S rRNA基因突变(2709 C→T),与测序结果 一致.结论 DNA芯片检测淋球菌16SrRNA基因突变具有快速、高特异性和高灵敏度,可以应用于对大观霉素的耐药性临床检测.%To develop a new method, DNA chip, for rapid detection the mutations of neisseria gonorrhoeae 16S rRNA gene. Methods Probe were design according to the sequence of neisseria gonorrhoeae 16S rRNA genes, then DNA chip was made. DNA fragment which contains 16S rRNA gene mutation was amplified by PCR technique, labeled with cy5 fluorescence, and then hybridized with DNA chip. Results of DNA sequencing were used as the control. Results All of urogenital swab specimens were detected by DNA chip. We found one specimen which had mutation in gene 16S rRNA( 2709 C->T), which was consistency between the DNA chip and DNA sequencing. Conclusion DNA chip is a rapid technique with high sensitivity and specificity for the detection of mutations of neisseria gonorrhoeae 16SrRNA gene. This method can be used for detection of spectinomycin resistance in clinical practice.

  4. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    International Nuclear Information System (INIS)

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  5. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja


    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  6. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    Directory of Open Access Journals (Sweden)

    Chia Sing eChan


    Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

  7. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria


    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C


    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  8. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)


    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  9. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    International Nuclear Information System (INIS)

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  10. Tetracycline-Resistant Clinical Helicobacter pylori Isolates with and without Mutations in 16S rRNA-Encoding Genes


    Wu, Jeng Yih; Kim, Jae J.; Reddy, Rita; W.M. Wang; David Y Graham; Kwon, Dong H.


    Tetracycline-resistant Helicobacter pylori strains have been increasingly reported worldwide. However, only a small number of tetracycline-resistant strains have been studied with regard to possible mechanisms of resistance and those studies have focused on mutations in the tetracycline binding sites of 16S rRNA-encoding genes. We here report studies of 41 tetracycline-resistant H. pylori strains (tetracycline MICs, 4 to 32 μg/ml) from North America (n = 12) and from East Asia (n = 29). DNA s...

  11. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments. (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G


    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  12. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics. (United States)

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G


    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  13. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Directory of Open Access Journals (Sweden)

    Neumann Elisabeth


    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  14. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata) (United States)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin


    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  15. 16s rRNA Identification of Pediococcus spp. from Broiler and Studies of Adherence Ability on Immobilized Mucus

    Directory of Open Access Journals (Sweden)

    Ema Damayanti


    Full Text Available The objectives of this research were to study taxonomical status of lactic acid bacteria (LAB isolated from broiler and adherence ability on mucus in vitro. Molecular analysis was performed by analyzing 16S rRNA gene using universal primer. The adherence assay on mucus was carried out using microplate method with total plate count (TPC, absorbance (A550 and confirmed by scanning electron microscopy (SEM. The results of this studies revealed that three of LAB isolates have closed relation to Pediococcus acidilactici (99.9% species.Three isolates of P. acidilactici have adherence ability on broiler mucus higher than that on porcine mucin with an adherence percentage of 55.5% versus 50.8% and absorbance A550 of 0.061 versus 0.051, respectively. The highest adherence ability showed by P. acidilactici R02 with adherence percentage was 59.3% and absorbance A550 = 0.068. Adherence on mucus were affected by the addition of 3 g/l of gastric juice and 0.3% (b/v of bile salt. Adherence analysis using SEM also showed that the adherence on broiler mucus was higher than the adherence on porcine mucin. Altogether this adherence studies, suggest that three isolates of P. acidilactici LAB were capable of colonizing host intestinal mucus in vitro as important property to be promising probiotic bacteria for broiler.Key words : adherence, broiler, Pediococcus, mucus, 16S rRNA

  16. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    Directory of Open Access Journals (Sweden)

    Heather Maughan

    Full Text Available The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq: a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients.

  17. 16S rRNA Gene Phylogenesis of Culturable Predominant Bacteria from Diseased Apostichopus japonicus(Holothuroidea, Echinodermata)

    Institute of Scientific and Technical Information of China (English)

    MA Haiyan; JIANG Guoliang; WU Zhiqiang; WANG Xin


    Cultured Apostichopusjaponicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopusjaponicus individuals.


    Directory of Open Access Journals (Sweden)

    Sri Darmawati


    Full Text Available The purpose of this study is to identify 8 strains of Staphylococcus genus members isolated from positive Widal blood (4 strains of Staphylococcus saprophyticus, 1 strain of Staphylococcus warneri, 2 strains of Staphylococcus hominis, 1 strain of Staphylococcus xylosus and 1 strain of Staphylococcus capitis based on 16S rRNA gene sequences. The methods used in this study are conducting PCR of 16S rRNA gene, cloning genes using T-Vector pMD20 which is transformed to E. coli DH5α, sequencing. The results show that four strains (BA 47.4, BA 19.2, KD 29.5 and TG 09.1 are identified as Stap. Saprophyticus strains of Stap. saprophyticus members of ATCC 15305T (99.01-100% similarity. The strain of TG 01.3 is identified as Stap. Warneri strain of TG 01.3 of Stap. Warneri members of ATCC 27836T (99.74-99.93% similarity, 2strains (KT 29.2 and KD 35.1 are identified as of Stap. hominis members of DSM 20328T (99.4-99.67% similarity. The strain of KT 30.5 is not identified

  19. Biodiversity characterization of cellulolytic bacteria present on native Chaco soil by comparison of ribosomal RNA genes. (United States)

    Talia, Paola; Sede, Silvana M; Campos, Eleonora; Rorig, Marcela; Principi, Dario; Tosto, Daniela; Hopp, H Esteban; Grasso, Daniel; Cataldi, Angel


    Sequence analysis of the 16S ribosomal RNA gene was used to study bacterial diversity of a pristine forest soil and of two cultures of the same soil enriched with cellulolytic bacteria. Our analysis revealed high bacterial diversity in the native soil sample, evidencing at least 10 phyla, in which Actinobacteria, Proteobacteria and Acidobacteria accounted for more than 76% of all sequences. In both enriched samples, members of Proteobacteria were the most frequently represented. The majority of bacterial genera in both enriched samples were identified as Brevundimonas and Caulobacter, but members of Devosia, Sphingomonas, Variovorax, Acidovorax, Pseudomonas, Xanthomonas, Stenotrophomonas, Achromobacter and Delftia were also found. In addition, it was possible to identify cellulolytic taxa such as Acidothermus, Micromonospora, Streptomyces, Paenibacillus and Pseudomonas, which indicates that this ecosystem could be an attractive source for study of novel enzymes for cellulose degradation. PMID:22202170

  20. Molecular Characterization of Stool Microbiota in HIV-Infected Subjects by Panbacterial and Order-Level 16S Ribosomal DNA (rDNA) Quantification and Correlations with Immune Activation (United States)

    Ellis, Collin L.; Ma, Zhong-Min; Mann, Surinder K.; Li, Chin-Shang; Wu, Jian; Knight, Thomas H.; Yotter, Tammy; Hayes, Timothy L.; Maniar, Archana H.; Troia-Cancio, Paolo V.; Overman, Heather A; Torok, Natalie J.; Albanese, Anthony; Rutledge, John C.; Miller, Christopher J.; Pollard, Richard B.; Asmuth, David M.


    Background The relationship between gut microbial community composition at the higher-taxonomic order-level and local and systemic immunologic abnormalities in HIV disease may provide insight into how bacterial translocation impacts HIV disease. Methods Antiretroviral (ART)-naive HIV patients underwent upper endoscopy before and nine months after starting ART. Duodenal tissue was paraffin-embedded for immunohistochemical analysis (IHC) and digested for FACS for T-cell subsets and immune activation (CD38+/HLA-DR+) enumeration. Stool samples were provided from patients and controls for comparison. Metagenomic microbial DNA was extracted from feces for optimized 16S ribosomal RNA gene (rDNA) real-time qPCR assays designed to quantify panbacterial loads and the relative abundances of proinflammatory Enterobacteriales order, and the dominant Bacteroidales and Clostridiales orders. Results Samples from 10 HIV-subjects prior to initiating, and from 6 subjects receiving, ART were available for analysis. There was a trend for a greater proportion of Enterobacteriales in HIV-positive subjects compared to controls (p=0.099). There were significant negative correlations between total bacterial load and duodenal CD4+ and CD8+ T-cell activation levels (r= −0.74, p= 0.004 and r= −0.67, p=0.013, respectively). The proportions of Enterobacteriales and Bacteroidales were significantly correlated with duodenal CD4+ T-cell depletion and peripheral CD8+ T-cell activation, respectively. Conclusions These data represent the first report of quantitative molecular and cellular correlations between total/universal and order-level gut bacterial populations and GALT levels of immune activation in HIV-infected subjects. The correlations between lower overall 16S rDNA levels and tissue immune activation suggest that the gut microbiome may contribute to immune activation and influence HIV progression. PMID:21436711

  1. Analysis of bacterial community structure in Saba-Narezushi (Narezushi of Mackerel) by 16S rRNA gene clone library. (United States)

    Matsui, Hiroki; Tsuchiya, Rie; Isobe, Yuka; Narita, Miyo


    Narezushi, a derivation of sushi, is a traditional Japanese food made by fermenting salted fish meat and cooked rice together. In this study, the microbial diversity of saba-narezushi (narezushi of mackerel, Scomber japonicus) was analyzed by the 16S ribosomal RNA gene clone library method. Chemical composition was also analyzed to compare with different kinds of narezushi. The chemical composition of the narezushi was similar to those obtained from samma-narezushi. Ninety-four clones were randomly selected and DNA sequences of cloned fragments (approx. 890 bp) were analyzed. The DNA sequences obtained were phylogenetically analyzed. The expected operational taxonomy units (OTUs) by Chao1 estimates and Shannon-Wiener index (H') at 97% identity threshold were 48 and 1.822, respectively. The sequence similarity of the cloned fragment was equal to or higher than 98% of the sequence of cultivated bacterial species in the public database. Most of the clones (85%) belonged to lactic acid bacteria (LAB). Lactobacillus curvatus was the most abundant species followed by Lactococcus piscium and Leuconostoc gasicomitatum, suggesting that these bacteria play important roles in the fermentation of saba-narezushi. PMID:24425983

  2. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)


    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  3. Heritability and Variability in Ribosomal RNA Genes of Vicia faba


    Rogers, Scott O; Bendich, Arnold J.


    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  4. Update and evaluation of 16SpathDB, an automated comprehensive database for identification of medically important bacteria by 16S rRNA gene sequencing


    Yeung, Shiu-yan; 楊兆恩


    Identification of pathogens is one of the important duties of clinical microbiology laboratory. Traditionally, phenotypic tests are used to identify the bacteria. However, due to some limitations of the phenotypic tests, the bacteria may not be identified sometimes and cannot be identified promptly. 16S rRNA gene sequencing is a rapid and accurate method to achieve this target. It is especially useful for identify rare or slow growing bacteria. However, the interpretation of the 16S rRNA gene...

  5. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes


    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Janaína F. Araújo; Alinne P. de Castro; Barreto, Cristine C.; Mercedes M.C. Bustamante; Betania F. Quirino; Krüger, Ricardo H.


    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial ...

  6. Identification of planctomycetes with order-, genus-, and strain-specific 16S rRNA-targeted probes. (United States)

    Gade, D; Schlesner, H; Glöckner, F O; Amann, R; Pfeiffer, S; Thomm, M


    A specific 16S rRNA-targeted oligonucleotide probe (PIR1223) for the genus Pirellula and a species-specific probe (RB454) for Pirellula sp. strain SH1 have been designed and optimized. Together with the already existing order-specific probe PLA886, the two newly designed probes were used to detect and identify planctomycetes, pirellulae, and close relatives of Pirellula sp. strain SH1 in different habitats. With the help of these probes for detection and identification, bacteria of the genus Pirellula were detected and cultivated from tissue of the Mediterranean sponge Aplysina aerophoba and from the water column of the Kiel Fjord. An unexpected result was the close phylogenetic relationship of the isolate from the sponge and the brackish water habitat Kiel Fjord as revealed by DNA/DNA hybridization. PMID:14994173

  7. Microbial community dynamics based on 16S rRNA gene profiles in a Pacific Northwest estuary and its tributaries. (United States)

    Bernhard, Anne E; Colbert, Debbie; McManus, James; Field, Katharine G


    We analyzed bacterioplankton community structure in Tillamook Bay, Oregon and its tributaries to evaluate phylogenetic variability and its relation to changes in environmental conditions along an estuarine gradient. Using eubacterial primers, we amplified 16S rRNA genes from environmental DNA and analyzed the PCR products by length heterogeneity polymerase chain reaction (LH-PCR), which discriminates products based on naturally occurring length differences. Analysis of LH-PCR profiles by multivariate ordination methods revealed differences in community composition along the estuarine gradient that were correlated with changes in environmental variables. Microbial community differences were also detected among different rivers. Using partial 16S rRNA sequences, we identified members of dominant or unique gene fragment size classes distributed along the estuarine gradient. Gammaproteobacteria and Betaproteobacteria and members of the Bacteroidetes dominated in freshwater samples, while Alphaproteobacteria, Cyanobacteria and chloroplast genes dominated in marine samples. Changes in the microbial communities correlated most strongly with salinity and dissolved silicon, but were also strongly correlated with precipitation. We also identified specific gene fragments that were correlated with inorganic nutrients. Our data suggest that there is a significant and predictable change in microbial species composition along an estuarine gradient, shifting from a more complex community structure in freshwater habitats to a community more typical of open ocean samples in the marine-influenced sites. We also demonstrate the resolution and power of LH-PCR and multivariate analyses to provide a rapid assessment of major community shifts, and show how these shifts correlate with environmental variables. PMID:16329898

  8. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Loreto Abusleme


    Full Text Available Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction procedures is important when comparing studies that use different methods. Identifying the method that best portrays communities is also desirable. Accordingly, the aim of this study was to evaluate bias introduced by different DNA extraction procedures on oral microbiome profiles. Design: Four DNA extraction methods were tested on mock communities consisting of seven representative oral bacteria. Additionally, supragingival plaque samples were collected from seven individuals and divided equally to test two commonly used DNA extraction procedures. Amplicon libraries of the 16S rRNA gene were generated and sequenced via 454-pyrosequencing. Results: Evaluation of mock communities revealed that DNA yield and bacterial species representation varied with DNA extraction methods. Despite producing the lowest yield of DNA, a method that included bead beating was the only protocol capable of detecting all seven species in the mock community. Comparison of the performance of two commonly used methods (crude lysis and a chemical/enzymatic lysis+column-based DNA isolation on plaque samples showed no effect of extraction protocols on taxa prevalence but global community structure and relative abundance of individual taxa were affected. At the phylum level, the latter method improved the recovery of Actinobacteria, Bacteroidetes, and Spirochaetes over crude lysis. Conclusion: DNA extraction distorts microbial profiles in simulated and clinical oral samples, reinforcing the

  9. Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available The advent of next generation sequencing has coincided with a growth in interest in using these approaches to better understand the role of the structure and function of the microbial communities in human, animal, and environmental health. Yet, use of next generation sequencing to perform 16S rRNA gene sequence surveys has resulted in considerable controversy surrounding the effects of sequencing errors on downstream analyses. We analyzed 2.7×10(6 reads distributed among 90 identical mock community samples, which were collections of genomic DNA from 21 different species with known 16S rRNA gene sequences; we observed an average error rate of 0.0060. To improve this error rate, we evaluated numerous methods of identifying bad sequence reads, identifying regions within reads of poor quality, and correcting base calls and were able to reduce the overall error rate to 0.0002. Implementation of the PyroNoise algorithm provided the best combination of error rate, sequence length, and number of sequences. Perhaps more problematic than sequencing errors was the presence of chimeras generated during PCR. Because we knew the true sequences within the mock community and the chimeras they could form, we identified 8% of the raw sequence reads as chimeric. After quality filtering the raw sequences and using the Uchime chimera detection program, the overall chimera rate decreased to 1%. The chimeras that could not be detected were largely responsible for the identification of spurious operational taxonomic units (OTUs and genus-level phylotypes. The number of spurious OTUs and phylotypes increased with sequencing effort indicating that comparison of communities should be made using an equal number of sequences. Finally, we applied our improved quality-filtering pipeline to several benchmarking studies and observed that even with our stringent data curation pipeline, biases in the data generation pipeline and batch effects were observed that could potentially

  10. A PCR Assay To Discriminate Human and Ruminant Feces on the Basis of Host Differences in Bacteroides-Prevotella Genes Encoding 16S rRNA


    Bernhard, Anne E.; Field, Katharine G.


    Our purpose was to develop a rapid, inexpensive method of diagnosing the source of fecal pollution in water. In previous research, we identified Bacteroides-Prevotella ribosomal DNA (rDNA) PCR markers based on analysis. These markers length heterogeneity PCR and terminal restriction fragment length polymorphism distinguish cow from human feces. Here, we recovered 16S rDNA clones from natural waters that were close phylogenetic relatives of the markers. From the sequence data, we designed spec...

  11. Footprinting of ribosomal RNA genes by transcription initiation factor and RNA polymerase I.


    Bateman, E.; Iida, C T; Kownin, P; Paule, M R


    The binding of a species-specific transcription initiation factor (TIF) and purified RNA polymerase I to the promoter region of the 39S ribosomal RNA gene from Acanthamoeba were studied by using DNase I "footprinting." Conditions were chosen such that the footprints obtained could be correlated with the transcriptional activity of the TIF-containing fractions used and that the labeled DNA present would itself serve as a template for transcription. The transcription factor binds upstream from ...

  12. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4 (United States)

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  13. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel. (United States)

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun


    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  14. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4. (United States)

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A


    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  15. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter


    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  16. Characterization by 16S rRNA gene analysis and in situ hybridization of bacteria living in the hindgut of a deposit-feeding echinoid (Echinodermata)


    da Silva, S.G.; Gillan, D. C.; Dubilier, N.; De Ridder, C.


    The hindgut caecum of the deposit-feeding echinoid Echinocardium cordatum harbours a symbiotic bacterial microflora, organized into layered mats around detrital particles owing to the proliferation of filamentous bacteria. The bacterial community was analysed using 16S rRNA gene analysis and fluorescence in situ hybridization. The purpose was to characterize its biodiversity and to identify its predominant members. The majority of the 16S sequences belong to the delta -Proteobacteria (61.5%),...

  17. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance. (United States)

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo


    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  18. Mechanism of translocation: relative arrangement of tRNA and mRNA on the ribosome.


    Matzke, A J; Barta, A; Kuechler, E


    AcPhe-tRNAPhe from yeast can be photocross-linked to poly(U) on Escherichia coli ribosomes. The photoreaction occurs at the wybutine base situated next to the 3' side of the anticodon. The kinetics and efficiency of crosslinking of AcPhe-Phe-tRNA are the same at both the acceptor site and the peptidyl site. Therefore, the orientation of wybutine with respect to the mRNA is similar in both the pretranslocational and posttranslocational states. AcPhe-Phe-tRNA crosslinked at the acceptor site ca...

  19. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.


    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  20. Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers▿


    Dar, Shabir A.; Yao, Li; van Dongen, Udo; Kuenen, J. Gijs; Muyzer, Gerard


    Here we describe the diversity and activity of sulfate-reducing bacteria (SRB) in sulfidogenic bioreactors by using the simultaneous analysis of PCR products obtained from DNA and RNA of the 16S rRNA and dissimilatory sulfite reductase (dsrAB) genes. We subsequently analyzed the amplified gene fragments by using denaturing gradient gel electrophoresis (DGGE). We observed fewer bands in the RNA-based DGGE profiles than in the DNA-based profiles, indicating marked differences in the populations...

  1. Complementarity of the 16S rRNA penultimate stem with sequences downstream of the AUG destabilizes the plastid mRNAs


    Kuroda, Hiroshi; Maliga, Pal


    Escherichia coli mRNA translation is facilitated by sequences upstream and downstream of the initiation codon, called Shine–Dalgarno (SD) and downstream box (DB) sequences, respectively. In E.coli enhancing the complementarity between the DB sequences and the 16S rRNA penultimate stem resulted in increased protein accumulation without a significant affect on mRNA stability. The objective of this study was to test whether enhancing the complementarity of plastid mRN...

  2. First microbiota assessments of children's paddling pool waters evaluated using 16S rRNA gene-based metagenome analysis. (United States)

    Sawabe, Toko; Suda, Wataru; Ohshima, Kenshiro; Hattori, Masahira; Sawabe, Tomoo


    Insufficient chloric sterilization of children's paddling pool waters increases the risk of diarrheal illness. Therefore, we investigated the microbiota changes after children use pools. First, we applied 16S rRNA gene-based metagenome analysis to understand the dynamics of microbiota in pool water, especially with respect to the bio-contamination by potential pathogens. Proteobacteria were major taxa detected in every pool water sample after children spent time in the pool. In more detail, Gammaproteobacteria comprised the dominant class, which was followed by Betaproteobacteria. Five phyla, Bacteroidetes, Firmicutes, Actinobacteria and Deinococcus-Thermus phyla were minor groups. The pool water microbiota are likely to be a consortium of intestinal and skin microbiota from humans. Interestingly, the ratio of Gammaproteobacteria and Betaproteobacteria differed according to the age of the children who used the pool, which means the pool water was additionally contaminated by soil microbiota as a result of the children's behavior. Furthermore, potential pathogens, such as Campylobacter spp., Comamonas testosteroni and Burkholderia pseudomallei, were also found. Considering the standard plate counts, the abundances of these human pathogens are unlikely to be a sufficiently infectious dose. We suggest the importance of sanitary measures in paddling pool waters to reduce bio-contamination from both humans and the environment. PMID:26671497

  3. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease. (United States)

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H


    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  4. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species (United States)

    Fogarty, L.R.; Voytek, M.A.


    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  5. Structural insights of microbial community of Deulajhari (India hot spring using 16s-rRNA based metagenomic sequencing

    Directory of Open Access Journals (Sweden)

    Archana Singh


    Full Text Available Insights about the distribution of the microbial community prove to be the major goal of understanding microbial ecology which remains to be fully deciphered. Hot springs being hub for the thermophilic microbiota attract the attention of the microbiologists. Deulajhari hot spring cluster is located in the Angul district of Odisha. Covered within a wooded area, Deulajhari hot spring is also fed by the plant litter resulting in a relatively high amount of total organic content (TOC. For the first time, Illumina sequencing based biodiversity analysis of microbial composition is studied through amplicon metagenome sequencing of 16s rRNA targeting V3‐V4 region using metagenomic DNA from the hot spring sediment. Over 28 phyla were detected through the amplicon metagenome sequencing of which the most dominating phyla at the existing physiochemical parameters like; temperature 69 °C, pH 8.09, electroconductivity 0.025 dSm−1 and total organic carbon 0.356%, were Proteobacteria (88.12%, Bacteriodetes (10.76%, Firmicutes (0.35%, Spirochetes (0.18% and chloroflexi (0.11%. Approximately 713 species were observed at the above physiochemical parameters. The analysis of the metagenome provides the quantitative insights into microbial populations based on the sequence data in Deulajhari hot spring. Metagenome sequence is deposited to SRA database which is available at NCBI with accession no. SRX1459736.

  6. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mu Peng


    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  7. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes. (United States)

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  8. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing. (United States)

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  9. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea (United States)

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.


    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  10. Diversity, Dynamics and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis


    Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de, R.; Vaughan, E E


    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  11. Direct 16S rRNA Gene Sequencing from Clinical Specimens, with Special Focus on Polybacterial Samples and Interpretation of Mixed DNA Chromatograms ▿


    Kommedal, Øyvind; Kvello, Kristine; Skjåstad, Rune; Langeland, Nina; Wiker, Harald G.


    RipSeq (iSentio, Bergen, Norway) is a web-based application for the analysis of mixed DNA chromatograms. It opens the possibility to analyze chromatograms obtained by direct 16S rRNA gene sequencing from polybacterial human clinical samples. In this study, we used direct 16S rRNA gene sequencing to investigate 264 samples from a wide range of suspected human bacterial infections. The sequence-based identification was compared with the results from routine culture-based identification. A total...

  12. Composition of fecal microbiota of laboratory mice derived from Japanese commercial breeders using 16S rRNA gene clone libraries (United States)

    NOZU, Ryoko; UENO, Masami; HAYASHIMOTO, Nobuhito


    The fecal microbiota of six mice derived from three Japanese commercial breeders was analyzed by using 16S rRNA gene clone libraries to construct a database for analyzing the gut microbiota of laboratory mice. The 566 clones were obtained from the clone libraries generated from the fecal DNA samples derived from BALB/c, C57BL/6N, DBA/2 and ICR mice. Among these 566 clones, there were 446 unique 16S rRNA gene sequences. When grouped at the 98% similarity level, the 446 unique sequences consisted of 103 Clostridiales, 43 Bacteroidales, 5 Lactobacillus and 3 Erysipelotricaceae, as well as sequences from 11 other phyla. PMID:26902692

  13. Comparative Analysis of 16S rRNA and amoA Genes from Archaea Selected with Organic and Inorganic Amendments in Enrichment Culture


    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Holly M Simon


    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the “root” clade, we detected no corresponding amoA gene. The amoA-contai...

  14. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites


    Anping Peng; Juan Liu; Wanting Ling; Zeyou Chen; Yanzheng Gao


    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg−1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollu...

  15. Estimation of Pig Fecal Contamination in a River Catchment by Real-Time PCR Using Two Pig-Specific Bacteroidales 16S rRNA Genetic Markers▿


    Mieszkin, Sophie; Furet, Jean-Pierre; Corthier, Gérard; Gourmelon, Michèle


    The microbiological quality of coastal or river water can be affected by fecal contamination from human or animal sources. To discriminate pig fecal pollution from other pollution, a library-independent microbial source tracking method targeting Bacteroidales host-specific 16S rRNA gene markers by real-time PCR was designed. Two pig-specific Bacteroidales markers (Pig-1-Bac and Pig-2-Bac) were designed using 16S rRNA gene Bacteroidales clone libraries from pig feces and slurry. For these two ...

  16. Controlling translation elongation efficiency: tRNA regulation of ribosome flux on the mRNA. (United States)

    Gorgoni, Barbara; Marshall, Elizabeth; McFarland, Matthew R; Romano, M Carmen; Stansfield, Ian


    Gene expression can be regulated by a wide variety of mechanisms. One example concerns the growing body of evidence that the protein-production rate can be regulated at the level of translation elongation by controlling ribosome flux across the mRNA. Variations in the abundance of tRNA molecules cause different rates of translation of their counterpart codons. This, in turn, produces a variable landscape of translational rate across each and every mRNA, with the dynamic formation and deformation of ribosomal queues being regulated by both tRNA availability and the rates of translation initiation and termination. In the present article, a range of examples of tRNA control of gene expression are reviewed, and the use of mathematical modelling to develop a predictive understanding of the consequences of that regulation is discussed and explained. These findings encourage a view that predicting the protein-synthesis rate of each mRNA requires a holistic understanding of how each stage of translation, including elongation, contributes to the overall protein-production rate. PMID:24450645

  17. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.


    Felske, A; B. Engelen; Nübel, U; Backhaus, H


    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  18. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    Directory of Open Access Journals (Sweden)

    David Kamanda Ngugi

    Full Text Available Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C and salinity (~41 psu from the mixed layer (~200 m to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS region of SAR11 in different depths of the Red Sea's water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen on the population dynamics of this ubiquitous marine bacterium.

  19. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David Kamanda


    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  20. Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA. (United States)

    Wachi, M; Umitsuki, G; Shimizu, M; Takada, A; Nagai, K


    We found that the Escherichia coli cafA::cat mutant accumulated a precursor of 16S rRNA. This precursor migrated to the same position with 16.3S precursor found in the BUMMER strain that is known to be deficient in the 5' end processing of 16S rRNA. Accumulation of 16. 3S rRNA in the BUMMER mutant was complemented by introduction of a plasmid carrying the cafA gene. The mutant type cafA gene cloned from the BUMMER strain had a 11-bp deletion in its coding region. A small amount of the mature 16S rRNA was still formed in the cafA::cat mutant. This residual activity was found to be due to RNase E encoded by the rne/ams gene by rifampicin-chase experiments of the cafA::cat ams1 double mutant. These results indicated that the cafA gene encodes a novel RNase responsible for processing of the 5' end of 16S rRNA. PMID:10362534

  1. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA


    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.


    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  2. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Directory of Open Access Journals (Sweden)

    Vincent J Denef


    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  3. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria (United States)

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.


    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  4. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    KAUST Repository

    Prest, Emmanuelle I E C


    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  5. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Alikunhi, Nabeel M.


    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  6. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing. (United States)

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  7. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K


    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  8. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”


    Cesarini, Elisa


    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  9. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth;


    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...

  10. True microbiota involved in chronic lung infection of cystic fibrosis patients found by culturing and 16S rRNA gene analysis

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine R; Alhede, Morten; Kragh, Kasper N; Nielsen, Per H; Johansen, Ulla; Givskov, Michael; Høiby, Niels; Bjarnsholt, Thomas


    Patients suffering from cystic fibrosis (CF) develop chronic lung infection. In this study, we investigated the microorganisms present in transplanted CF lungs (n = 5) by standard culturing and 16S rRNA gene analysis. A correspondence between culturing and the molecular methods was observed. In c...

  11. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    DEFF Research Database (Denmark)

    Holmsgaard, Peter N.; Sørensen, Søren J.; Hansen, Lars Hestbjerg


    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity of...

  12. High Prevalence of Metallo-β-Lactamase and 16S rRNA Methylase Coproduction among Imipenem-Resistant Pseudomonas aeruginosa Isolates in Brazil▿


    Doi, Yohei; Ghilardi, Angela C. R.; Adams, Jennifer; de Oliveira Garcia, Doroti; Paterson, David L.


    Rates of metallo-β-lactamase and 16S rRNA methylase production were investigated in 51 imipenem-resistant Pseudomonas aeruginosa clinical isolates collected from hospitals in São Paulo, Brazil. Of them, 57% and 75% produced SPM-1 and RmtD, respectively. Of note, 51% produced both enzymes, suggesting that their coproduction is already common in this geographic area.

  13. Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA


    Hogg, J.C.; Lehane, M. J.


    This was the first molecular study of the bacterial flora of the sheep scab mite (Psoroptes ovis). A sequence analysis of genes coding for 16S rRNA revealed that Serratia marcescens and bacteria closely related to Staphylococcus intermedius or Staphylococcus chromogens and Alloiococcus otitidis were present. These bacteria were associated with skin lesions, dermatitis, and otitis media caused by P. ovis.

  14. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp. (United States)

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  15. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing


    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.; Dharne, Mahesh S.


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  16. Characterisation of the human uterine microbiome in non-pregnant women through deep sequencing of the V1-2 region of the 16S rRNA gene. (United States)

    Verstraelen, Hans; Vilchez-Vargas, Ramiro; Desimpel, Fabian; Jauregui, Ruy; Vankeirsbilck, Nele; Weyers, Steven; Verhelst, Rita; De Sutter, Petra; Pieper, Dietmar H; Van De Wiele, Tom


    Background. It is widely assumed that the uterine cavity in non-pregnant women is physiologically sterile, also as a premise to the long-held view that human infants develop in a sterile uterine environment, though likely reflecting under-appraisal of the extent of the human bacterial metacommunity. In an exploratory study, we aimed to investigate the putative presence of a uterine microbiome in a selected series of non-pregnant women through deep sequencing of the V1-2 hypervariable region of the 16S ribosomal RNA (rRNA) gene. Methods. Nineteen women with various reproductive conditions, including subfertility, scheduled for hysteroscopy and not showing uterine anomalies were recruited. Subjects were highly diverse with regard to demographic and medical history and included nulliparous and parous women. Endometrial tissue and mucus harvesting was performed by use of a transcervical device designed to obtain endometrial biopsy, while avoiding cervicovaginal contamination. Bacteria were targeted by use of a barcoded Illumina MiSeq paired-end sequencing method targeting the 16S rRNA gene V1-2 region, yielding an average of 41,194 reads per sample after quality filtering. Taxonomic annotation was pursued by comparison with sequences available through the Ribosomal Database Project and the NCBI database. Results. Out of 183 unique 16S rRNA gene amplicon sequences, 15 phylotypes were present in all samples. In some 90% of the women included, community architecture was fairly similar inasmuch B. xylanisolvens, B. thetaiotaomicron, B. fragilis and an undetermined Pelomonas taxon constituted over one third of the endometrial bacterial community. On the singular phylotype level, six women showed predominance of L. crispatus or L. iners in the presence of the Bacteroides core. Two endometrial communities were highly dissimilar, largely lacking the Bacteroides core, one dominated by L. crispatus and another consisting of a highly diverse community, including Prevotella spp

  17. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates. (United States)

    Liu, Zhenru; Ling, Baodong; Zhou, Liming


    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  18. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers. (United States)

    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L


    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplification primer selection, and read length, which can affect the apparent microbial community. In this study, we compared short read 16S rRNA variable regions, V1-V3, with that of near-full length 16S regions, V1-V8, using highly diverse steer rumen microbial communities, in order to examine the impact of technology selection on phylogenetic profiles. Short paired-end reads from the Illumina MiSeq platform were used to generate V1-V3 sequence, while long "circular consensus" reads from the Pacific Biosciences RSII instrument were used to generate V1-V8 data. The two platforms revealed similar microbial operational taxonomic units (OTUs), as well as similar species richness, Good's coverage, and Shannon diversity metrics. However, the V1-V8 amplified ruminal community resulted in significant increases in several orders of taxa, such as phyla Proteobacteria and Verrucomicrobia (P niche-specific database to use in analyzing data from shorter read technologies when budgetary constraints preclude use of near-full length 16S sequencing. PMID:27282101

  19. Modeling of ribosome dynamics on a ds-mRNA under an external load (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid


    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  20. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid


    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  1. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling. (United States)

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  2. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene. (United States)

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying


    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China. PMID:26196543

  3. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Directory of Open Access Journals (Sweden)

    Youhua Yuan

    Full Text Available Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  4. Distribution of 16S rRNA methylases among different species of Gram-negative bacilli with high-level resistance to aminoglycosides. (United States)

    Zhou, Y; Yu, H; Guo, Q; Xu, X; Ye, X; Wu, S; Guo, Y; Wang, M


    16S rRNA methylases confer high-level resistance to most aminoglycosides in Gram-negative bacteria. Seven 16S rRNA methylase genes, armA, rmtA, rmtB, rmtC, rmtD, rmtE and npmA, have been identified since 2003. We studied the distribution of methylase genes in more than 200 aminoglycoside-resistant Gram-negative clinical isolates collected in 2007 at our hospital in Shanghai, China. 16S rRNA methylase genes were amplified by polymerase chain reaction (PCR) among 217 consecutive clinical isolates of Gram-negative bacilli resistant to gentamicin and amikacin by a disk diffusion method. 16S rRNA methylase genes were present in 97.5% (193/198) of clinical isolates highly resistant to amikacin (≥512 μg/ml), with armA and rmtB detected in 67.2 and 30.3% of strains, respectively, while no 16S rRNA methylase genes were detected in 19 strains with amikacin minimum inhibitory concentration (MIC) ≤256 μg/ml. armA or rmtB genes were detected in 100% of 104 strains of Enterobacteriaceae, and these two genes were equally represented (49 vs. 55 strains). Genes for armA or rmtB were detected in 94.7% (89/94) of Acinetobacter baumannii and Pseudomonas aeruginosa strains, and armA was predominant (84 vs. 5 strains with rmtB). No rmtA, rmtC, rmtD or npmA genes were found. Enterobacterial repetitive intergenic consensus sequence (ERIC-PCR) indicated that armA and rmtB genes were spread by both horizontal transfer and clonal dissemination. PMID:20614151

  5. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Directory of Open Access Journals (Sweden)

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  6. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism. (United States)

    Espah Borujeni, Amin; Salis, Howard M


    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  7. Analysis of 16S rRNA gene sequences and circulating cell-free DNA from plasma of chronic fatigue syndrome and non-fatigued subjects

    Directory of Open Access Journals (Sweden)

    Unger Elizabeth R


    Full Text Available Abstract Background The association of an infectious agent with chronic fatigue syndrome (CFS has been difficult and is further complicated by the lack of a known lesion or diseased tissue. Cell-free plasma DNA could serve as a sentinel of infection and disease occurring throughout the body. This type of systemic sample coupled with broad-range amplification of bacterial sequences was used to determine whether a bacterial pathogen was associated with CFS. Plasma DNA from 34 CFS and 55 non-fatigued subjects was assessed to determine plasma DNA concentration and the presence of bacterial 16S ribosomal DNA (rDNA sequences. Results DNA was isolated from 81 (91% of 89 plasma samples. The 55 non-fatigued subjects had higher plasma DNA concentrations than those with CFS (average 151 versus 91 ng and more CFS subjects (6/34, 18% had no detectable plasma DNA than non-fatigued subjects (2/55, 4%, but these differences were not significant. Bacterial sequences were detected in 23 (26% of 89. Only 4 (14% CFS subjects had 16S rDNA sequences amplified from plasma compared with 17 (32% of the non-fatigued (P = 0.03. All but 1 of the 23 16S rDNA amplicon-positive subjects had five or more unique sequences present. Conclusions CFS subjects had slightly lower concentrations or no detectable plasma DNA than non-fatigued subjects. There was a diverse array of 16S rDNA sequences in plasma DNA from both CFS and non-fatigued subjects. There were no unique, previously uncharacterized or predominant 16S rDNA sequences in either CFS or non-fatigued subjects.

  8. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen


    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  9. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis


    Surovtseva, Yulia V; Shadel, Gerald S.


    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  10. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection


    Zaher, Hani S.; Green, Rachel


    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  11. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.



    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  12. Application of 16s rDNA and cytochrome b ribosomal markers in studies of lineage and fish populations structure of aquatic species. (United States)

    Baharum, Syarul Nataqain; Nurdalila, A'wani Aziz


    The most economically important form of aquaculture is fish farming, which is an industry that accounts for an ever increasing share of world fishery production. Molecular markers can be used to enhance the productivity of the aquaculture and fish industries to meet the increasing demand. Molecular markers can be identified via a DNA test regardless of the developmental stage, age or environmental challenges experienced by the organism. The application of 16s and cytochrome b markers has enabled rapid progress in investigations of genetic variability and inbreeding, parentage assignments, species and strain identification and the construction of high resolution genetic linkage maps for aquaculture fisheries. In this review, the advantages of principles and potential power tools of 16s and cytochrome b markers are discussed. Main findings in term of trend, aspects and debates on the reviewed issue made from the model of aquatic species for the benefit of aquaculture genomics and aquaculture genetics research are discussed. The concepts in this review are illustrated with various research examples and results that relate theory to reality and provide a strong review of the current status of these biotechnology topics. PMID:22167328

  13. Obtaining representative community profiles of anaerobic digesters through optimisation of 16S rRNA amplicon sequencing protocols

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; McIlroy, Simon Jon; Karst, Søren Michael;

    A reliable and reproducible method for identification and quantification of the microorganisms involved in biogas production is important for the study and understanding of the microbial communities responsible for the function of anaerobic digester systems. DNA based identification using 16S rRN...

  14. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    DEFF Research Database (Denmark)

    Møller, Annette; Søborg, Ditte Andreasen; Al-Soud, Waleed Abu;


    controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input......The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...... of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers...

  15. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species. (United States)

    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H


    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  16. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Guanghong Zuo


    Full Text Available A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1 the whole-genome-based and alignment-free CVTree using 179 genomes; (2 the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3 the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation.

  17. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa.

    Directory of Open Access Journals (Sweden)

    Hagen Frickmann

    Full Text Available The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation.Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture.Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture.Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required.

  18. Stable morphospecies within the 16S rRNA monophyletic genus .i.Microcystis./i. (KÜTZING) KÜTZING

    Czech Academy of Sciences Publication Activity Database

    Komárková, Jaroslava; Mugnai, M. A.; Sili, C.; Komárek, Ondřej; Turicchia, S.

    -, č. 117 (2005), s. 279-295. ISSN 0342-1120. [Symposium of the International Association for Cyanophyte Research /16./. Luxembourg, 30.08.2004–03.09.2004] R&D Projects: GA AV ČR(CZ) IBS6017004 Grant ostatní: EU(XE) MIDI-CHIP EVK2-CT-1999-00026 Institutional research plan: CEZ:AV0Z60170517 Keywords : Microcystis * morhpospecies * 16S rRNA Subject RIV: EE - Microbiology, Virology

  19. 16S rRNA sequences of Bartonella bacilliformis and cat scratch disease bacillus reveal phylogenetic relationships with the alpha-2 subgroup of the class Proteobacteria.


    O'Connor, S P; Dorsch, M; Steigerwalt, A G; Brenner, D J; Stackebrandt, E


    The primary structures of 16S rRNAs of Bartonella bacilliformis, an isolate of the cat scratch disease (CSD) bacillus, and a strain phenotypically similar to the CSD bacillus were determined by reverse transcriptase sequencing. These microorganisms were found to be members of the alpha-2 subgroup of the class Proteobacteria. The sequence from B. bacilliformis was most closely related to the rRNA of Rochalimaea quintana (91.7% homology), the etiologic agent of trench fever. The sequence from t...

  20. 16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles


    Hang, Jun; Desai, Valmik; Zavaljevski, Nela; Yang, Yu; Lin, Xiaoxu; Satya, Ravi Vijaya; Martinez, Luis J.; Blaylock, Jason M.; Jarman, Richard G.; Thomas, Stephen J.; Kuschner, Robert A.


    Background Sample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. Most published studies were limited to the comparison of only one or two types of these factors. Systematic multi-factor explorations are needed to evaluate the conditions that may impact validity of a microbiome analysis. This study was aimed to improve methodological options to facilitate the best technical app...

  1. Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens


    Kommedal, Øyvind; Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.


    Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or ne...

  2. An effect of 16S rRNA intercistronic variability on coevolutionary analysis in symbiotic bacteria: Molecular phylogeny of Arsenophonus triatominarum

    Czech Academy of Sciences Publication Activity Database

    Šorfová, Pavlína; Škeříková, Andrea; Hypša, Václav


    Roč. 31, č. 2 (2008), s. 88-100. ISSN 0723-2020 R&D Projects: GA ČR GA206/04/0520; GA AV ČR IAA601410708 Institutional research plan: CEZ:AV0Z60220518 Keywords : intragenomic heterogeneity * 16S rRNA * coevolution * insect symbionts * molecular phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 2.582, year: 2008

  3. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene


    Pasupuleti Sreenivasa Rao


    Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Seq...

  4. Identification and quantification of Bifidobacterium species isolated from food with genus-specific 16S rRNA-targeted probes by colony hybridization and PCR.


    Kaufmann, P; Pfefferkorn, A; Teuber, M; Meile, L


    A Bifidobacterium genus-specific target sequence in the V9 variable region of the 16S rRNA has been elaborated and was used to develop a hybridization probe. The specificity of this probe, named lm3 (5'-CGGGTGCTI*CCCACTTTCATG-3'), was used to identify all known type strains and distinguish them from other bacteria. All of the 30 type strains of Bifidobacterium which are available at the German culture collection Deutsche Sammlung von Mikroorganismen und Zellkulturen, 6 commercially available ...

  5. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling


    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C


    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  6. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling


    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recov...

  7. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification

    Directory of Open Access Journals (Sweden)

    Stephan Roger


    Full Text Available Abstract Background E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a preliminary evaluation of this system to a number of target and non-target strains showed significant specificity problems of this system. In this study full-length 16S rRNA genes of thirteen E. sakazakii strains from food, environment and human origin as well as the type strain ATCC 51329 were sequenced. Based on this sequence data a new specific PCR system for E. sakazakii was developed and evaluated. Results By phylogenetic analysis of the new full-length 16S rRNA gene sequence data obtained we could show the presence of a second phylogenetic distinct lineage within the E. sakazakii species. The newly developed 16S rRNA gene targeting PCR system allows identification of E. sakazakii strains from both lineages. The assay's ability to correctly identify different E. sakazakii isolates as well as to differentiate E. sakazakii from other closely related Enterobacteriaceae species and other microorganisms was shown on 75 target and non-target strains. Conclusion By this study we are presenting a specific and reliable PCR identification system, which is able to correctly identify E. sakazakii isolates from both phylogenetic distinct lines within the E. sakazakii species. The impact of this second newly described phylogenetic line within the E. sakazakii species in view of clinical and food safety aspects need further investigation.

  8. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification


    Lehner, A J; Tasara, T.; Stephan, R


    BACKGROUND: E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a prelimin...

  9. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites (United States)

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng


    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  10. 16S rRNA gene-based metagenomic analysis identifies a novel bacterial co-prevalence pattern in dental caries


    Jagathrakshakan, Sri Nisha; Sethumadhava, Raghavendra Jayesh; Mehta, Dhaval Tushar; Ramanathan, Arvind


    Objective: To identify the prevalence of acidogenic and nonacidogenic bacteria in patients with polycaries lesions, and to ascertain caries specific bacterial prevalence in relation to noncaries controls. Materials and Methods: Total genomic DNA extracted from saliva of three adults and four children from the same family were subjected to 16S rRNA gene sequencing analysis on a next generation sequencer, the PGS-Ion Torrent. Those bacterial genera with read counts > 1000 were considered as sig...

  11. Entwicklung und Einsatz von 16S rRNA Gensonden zur Identifizierung biotechnologisch genutzter Laktobazillen-Stämme der L. acidophilus- und der L. casei-Gruppe


    Goldberg, Marc


    Development and application of 16S rRNA-targeted gene probes for the identification of biotechnologically used Lactobacillus-strains of the L. acidophilus- and L. casei-group Due to numerous desirable metabolic properties lactobacilli have long been used as starter cultures in food production, as feed additives in animal nutrition, and as therapeutic agents in the pharmaceutical industry. Members of the L. acidophilus- and the L. casei-group are increasingly appl...

  12. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water


    Ahmed, W.; Staley, C.; Sadowsky, M J; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.


    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial...

  13. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources


    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.


    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  14. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis


    Steelman Samantha M; Chowdhary Bhanu P; Dowd Scot; Suchodolski Jan; Janečka Jan E


    Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to character...

  15. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing. (United States)

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  16. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene


    Coêlho, Mariza M.; Ferreira-Nozawa, Monica S.; Nozawa, Sérgio R.; Santos, André L.W.


    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic...

  17. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    Institute of Scientific and Technical Information of China (English)

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan


    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  18. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae. (United States)

    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping


    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae. PMID:27147066

  19. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species. (United States)

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi


    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  20. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo Lazaro, Luis Ignacio; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel


    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recrui...

  1. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA (United States)

    Ikeuchi, Ken; Inada, Toshifumi


    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  2. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis. (United States)

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L


    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  3. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1. (United States)

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  4. A phylogenetic analysis of Brycon and Henochilus (Characiformes, Characidae, Bryconinae based on the mitochondrial gene 16S rRNA

    Directory of Open Access Journals (Sweden)

    Silva Hilsdorf


    Full Text Available The genus Brycon, the largest subunit of the Bryconinae, has 42 valid species distributed from southern Mexico to the La Plata River in Argentina. Henochilus is a monotypic genus, comprising a single species (H. wheatlandii found in the upper Rio Doce basin. In the present study, partial sequences of the mitochondrial gene 16S were obtained for fifteen species of Brycon and for Henochilus wheatlandii. The results showed that the genus Brycon is paraphyletic, since Henochilus is the sister-group of B. ferox and B. insignis. The most basal species analyzed were the trans-Andean species B. henni, B. petrosus, and B. chagrensis.

  5. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)


    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  6. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob


    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  7. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study. (United States)

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald


    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  8. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;


    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  9. Phylogeny and divergence time estimation of cheilostome bryozoans based on mitochodrial 16S rRNA sequences

    Institute of Scientific and Technical Information of China (English)

    HAO Jiasheng; LI Chunxiang; SUN Xiaoyan; YANG Qun


    The mitochondrial 16S rDNA sequences of 40 species of cheilostome bryozoans including those of 24 species newly determined were used to reconstruct the phylogenetic tree using neighboring-joining and maximum-parsimony methods. By applying molecular clock technique on the basis of the appropriate phylogeny and the fossil record, the divergence times of the two main cheilostome groups, Anasca and Ascophora sensu stricto, were estimated. The results show that the molecular phylogeny of the higher taxonomic groups (superfamilies and higher taxa) of cheilostome bryozoans is mostly in conflict with the morphology-based phylogenetic trees; the divergence of the extant groups of Anasca and those of Ascophora sensu stricto is estimated to have happened about 263 Ma (Permian Guadalupian Epoch) and 183 Ma (Early Jurassic), respectively.

  10. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.


    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  11. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.


    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  12. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平


    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  13. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Directory of Open Access Journals (Sweden)

    Paul B. Essers


    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  14. Quantitative identification of fecal water pollution sources by TaqMan real-time PCR assays using Bacteroidales 16S rRNA genetic markers. (United States)

    Lee, Dae-Young; Weir, Susan C; Lee, Hung; Trevors, Jack T


    PCR-based analysis of Bacteroidales 16S rRNA genes has emerged as a promising tool to identify sources of fecal water pollution. In this study, three TaqMan real-time PCR assays (BacGeneral, BacHuman, and BacBovine) were developed and evaluated for their ability to quantitatively detect general (total), human-specific, and bovine-specific Bacteroidales 16S rRNA genetic markers. The detection sensitivity was determined to be 6.5 copies of 16S rRNA gene for the BacGeneral and BacHuman assays and 10 copies for the BacBovine assay. The assays were capable of detecting approximately one to two cells per PCR. When tested with 70 fecal samples from various sources (human, cattle, pig, deer, dog, cat, goose, gull, horse, and raccoon), the three assays positively identified the target markers in all samples without any false-negative results. The BacHuman and BacBovine assays exhibited false-positive reactions with non-target samples in a few cases. However, the level of the false-positive reactions was about 50 times smaller than that of the true-positive ones, and therefore, these cross-reactions were unlikely to cause misidentifications of the fecal pollution sources. Microbial source-tracking capability was tested at two freshwater streams of which water quality was influenced by human and cattle feces, respectively. The assays accurately detected the presence of the corresponding host-specific markers upon fecal pollution and the persistence of the markers in downstream areas. The assays are expected to reliably determine human and bovine fecal pollution sources in environmental water samples. PMID:20871990

  15. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China. (United States)

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong


    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination. PMID:27139028

  16. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)


    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  17. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    International Nuclear Information System (INIS)

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities

  18. The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    Directory of Open Access Journals (Sweden)

    Arzu Coleri Cihan


    Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

  19. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Pasupuleti Sreenivasa Rao


    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  20. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  1. Ribosome engineering to promote new crystal forms

    International Nuclear Information System (INIS)

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors

  2. Early life stress inhibits expression of ribosomal RNA in the developing hippocampus.

    Directory of Open Access Journals (Sweden)

    Lan Wei

    Full Text Available Children that are exposed to abuse or neglect show abnormal hippocampal function. However, the developmental mechanisms by which early life stress (ELS impairs normal hippocampal development have not been elucidated. Here we propose that exposure to ELS blunts normal hippocampal growth by inhibiting the availability of ribosomal RNA (rRNA. In support of this hypothesis, we show that the normal mouse hippocampus undergoes a growth-spurt during the second week of life, followed by a gradual decrease in DNA and RNA content that persists into adulthood. This developmental pattern is associated with accelerated ribosomal RNA (rRNA synthesis during the second week of life, followed by a gradual decline in rRNA levels that continue into adulthood. Levels of DNA methylation at the ribosomal DNA (rDNA promoter are lower during the second week of life compared to earlier development or adulthood. Exposure to brief daily separation (BDS, a mouse model of early life stress, increased DNA methylation at the ribosomal DNA promoter, decreased rRNA levels, and blunted hippocampal growth during the second week of life. Exposure to acute (3 hrs maternal separation decreased rRNA and increased DNA methylation at the rDNA proximal promoter, suggesting that exposure to stress early in life can rapidly regulate the availability of rRNA levels in the developing hippocampus. Given the critical role that rRNA plays in supporting normal growth and development, these findings suggest a novel molecular mechanism to explain how stress early in life impairs hippocampus development in the mouse.

  3. Ribosome collisions and translation efficiency: optimization by codon usage and mRNA destabilization. (United States)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen


    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of mRNA breakdown is offset by the concomitant increase in translation efficiency. PMID:18619977

  4. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing


    Fei Gao; Fenghui Li; Jie Tan; Jingping Yan; Huiling Sun


    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±...

  5. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment. (United States)

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  6. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    Directory of Open Access Journals (Sweden)

    Jeongsu Oh

    Full Text Available High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs. The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM

  7. High-density universal 16S rRNA microarray analysis reveals broader diversity than typical clone library when sampling the environment. (United States)

    DeSantis, Todd Z; Brodie, Eoin L; Moberg, Jordan P; Zubieta, Ingrid X; Piceno, Yvette M; Andersen, Gary L


    Molecular approaches aimed at detection of a broad-range of prokaryotes in the environment routinely rely on classifying heterogeneous 16S rRNA genes amplified by polymerase chain reaction (PCR) using primers with broad specificity. The general method of sampling and categorizing DNA has been to clone then sequence the PCR products. However, the number of clones required to adequately catalog the majority of taxa in a sample is unwieldy. Alternatively, hybridizing target sequences to a universal 16S rRNA gene microarray may provide a more rapid and comprehensive view of prokaryotic community composition. This study investigated the breadth and accuracy of a microarray in detecting diverse 16S rRNA gene sequence types compared to clone-and-sequencing using three environmental samples: urban aerosol, subsurface soil, and subsurface water. PCR products generated from universal 16S rRNA gene-targeted primers were classified by using either the clone-and-sequence method or by hybridization to a novel high-density microarray of 297,851 probes complementary to 842 prokaryotic subfamilies. The three clone libraries comprised 1391 high-quality sequences. Approximately 8% of the clones could not be placed into a known subfamily and were considered novel. The microarray results confirmed the majority of clone-detected subfamilies and additionally demonstrated greater amplicon diversity extending into phyla not observed by the cloning method. Sequences matching operational taxonomic units within the phyla Nitrospira, Planctomycetes, and TM7, which were uniquely detected by the array, were verified with specific primers and subsequent amplicon sequencing. Subfamily richness detected by the array corresponded well with nonparametric richness predictions extrapolated from clone libraries except in the water community where clone-based richness predictions were greatly exceeded. It was concluded that although the microarray is unreliable in identifying novel prokaryotic taxa, it

  8. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment (United States)

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  9. Genetic Diversity of Pasteurella dagmatis as Assessed by Analysis of the 16S rRNA and rpoB Gene Sequences


    Król, Jarosław; Bania, Jacek; Florek, Magdalena; Podkowik, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzisław


    A total of 16 Pasteurella dagmatis strains, including 11 feline and 4 canine isolates as well as one strain isolated from a tiger, were analyzed using partial 16S rRNA and rpoB gene sequence comparison. Phylogenetic studies based on both genes revealed that the population of P. dagmatis recovered from cats in Poland differs markedly from canine strains, constituting a well-separated cluster within Pasteurella sensu stricto species group. The isolate from a tiger seems to represent yet another...

  10. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Directory of Open Access Journals (Sweden)

    Mariza M. Coêlho


    Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

  11. Molecular identification of bacteria by fluorescence-based PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene.


    Widjojoatmodjo, M N; Fluit, A.C.; Verhoef, J


    PCR-single-strand conformation polymorphism (PCR-SSCP) analysis is a rapid and convenient technique for the detection of mutations and allelic variants. We have adapted this technique for the identification of bacteria by PCR with fluorescein-labeled primers chosen from the conserved regions of the 16S rRNA gene flanking a variable region. The PCR product was denatured, separated on a nondenaturing gel, and detected by an automated DNA sequencer. The mobility of the single-stranded DNA is seq...

  12. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat


    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad


    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that ...

  13. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences. (United States)

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V


    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  14. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria. (United States)

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S


    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  15. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene. (United States)

    Coêlho, Mariza M; Ferreira-Nozawa, Monica S; Nozawa, Sérgio R; Santos, André L W


    Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla), were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species. PMID:22215973

  16. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn


    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  17. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  18. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S


    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  19. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen


    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  20. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling (United States)

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian


    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  1. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling. (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian


    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  2. Detection and identification of bacterial pathogens of fish in kidney tissue using terminal restriction fragment length polymorphism (T-RFLP) analysis of 16S rRNA genes. (United States)

    Nilsson, William B; Strom, Mark S


    We report the application of a nucleic acid-based assay that enables direct detection and identification of bacterial pathogens in fish kidney tissue without the need for bacterial culture. The technique, known as terminal restriction fragment length polymorphism (T-RFLP), employs the polymerase chain reaction (PCR) using a primer pair that targets 2 highly conserved regions of the gene that encodes for the 16S small subunit of the bacterial ribosome. Each primer is 5' labeled with a different fluorescent dye, which results in each terminus of the resulting amplicon having a distinguishable fluorescent tag. The amplicon is then digested with a series of 6 restriction endonucleases, followed by size determination of the 2 labeled terminal fragments by capillary electrophoresis with laser-induced fluorescence detection. Comparison of the lengths of the full set of 12 terminal fragments with those predicted based on analyses of GenBank submissions of 16S sequences leads to presumptive identification of the pathogen to at least the genus, but more typically the species level. Results of T-RFLP analyses of genomic DNA from multiple strains of a number of fish bacterial pathogens are presented. The assay is further demonstrated on fish kidney tissue spiked with a known number of cells of Flavobacterium psychrophilum where a detection limit of ca. 30 CFU mg(-1) of tissue was estimated. A similar detection limit was observed for several other gram-negative pathogens. This procedure was also used to detect Aeromonas salmonicida and Renibacterium salmoninarum in the kidney tissue of 2 naturally infected salmonids. PMID:12033704

  3. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.


    Hori, H.; Osawa, S; Murao, K.; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

  4. An unusual mechanism for EF-Tu activation during tmRNA-mediated ribosome rescue


    Miller, Mickey R; Buskirk, Allen R.


    When ribosomes are stalled on truncated mRNAs in prokaryotes, they are rescued by the tmRNA/SmpB complex. It has been unclear how EF-Tu is activated by this complex. This manuscript analyzes this problem, and the results indicate that the normal EF-Tu GTPase cycle does not appear to apply in this specialized situation.

  5. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips (United States)

    Bavykin, Sergei G.; Mirzabekov, Andrei D.


    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  6. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Directory of Open Access Journals (Sweden)

    Annette K. Møller


    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  7. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria. (United States)

    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J


    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  8. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies. (United States)

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H


    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  9. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes. (United States)

    Jiang, Xuexia; Jiao, Nianzhi


    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis. PMID:27407295

  10. Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing. (United States)

    Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S


    Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site. PMID:27138048

  11. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado


    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  12. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov. (United States)

    Collins, M D; Williams, A M; Wallbanks, S


    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  13. Comparative analysis of 16S rRNA and amoA genes from archaea selected with organic and inorganic amendments in enrichment culture. (United States)

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Simon, Holly M


    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the "root" clade, we detected no corresponding amoA gene. The amoA-containing archaea were present in media with either organic or inorganic amendments, whereas archaea representing the root clade were present only when organic amendment was used. Analysis of amoA gene abundance and expression, together with nitrification-coupled growth assays, indicated potential growth by autotrophic ammonia oxidation for members of two group 1.1b clades. Increased abundance of one of these clades, however, also occurred upon the addition of organic amendment. Finally, although amoA-containing group 1.1a archaea were present in enrichments, we detected neither expression of amoA genes nor evidence for nitrification-coupled growth of these organisms. These data support a model of a diverse metabolic community in mesophilic soil archaea that is just beginning to be characterized. PMID:22267662

  14. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing. (United States)

    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge


    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas. PMID:26688737

  15. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene (United States)

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.


    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  16. The human insulin receptor mRNA contains a functional internal ribosome entry segment


    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth


    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5'-UTR of the mRNA encoding human insulin receptor (hIR) contains a functiona...

  17. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting


    Maynard, Nathaniel D.; Macklin, Derek N.; Kirkegaard, Karla; Covert, Markus W


    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNALys uridin...

  18. RNA structure-based ribosome recruitment: Lessons from the Dicistroviridae intergenic region IRESes


    Pfingsten, Jennifer S; Kieft, Jeffrey S.


    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5′ end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by m...

  19. Species-level core oral bacteriome identified by 16S rRNA pyrosequencing in a healthy young Arab population

    Directory of Open Access Journals (Sweden)

    Nezar Noor Al-hebshi


    Full Text Available Background: Reports on the composition of oral bacteriome in Arabs are lacking. In addition, the majority of previous studies on other ethnic groups have been limited by low-resolution taxonomic assignment of next-generation sequencing reads. Furthermore, there has been a conflict about the existence of a ‘core’ bacteriome. Objective: The objective of this study was to characterize the healthy core oral bacteriome in a young Arab population at the species level. Methods: Oral rinse DNA samples obtained from 12 stringently selected healthy young subjects of Arab origin were pyrosequenced (454's FLX chemistry for the bacterial 16S V1–V3 hypervariable region at an average depth of 11,500 reads. High-quality, non-chimeric reads ≥380 bp were classified to the species level using the recently described, prioritized, multistage assignment algorithm. A core bacteriome was defined as taxa present in at least 11 samples. The Chao2, abundance-based coverage estimator (ACE, and Shannon indices were computed to assess species richness and diversity. Results: Overall, 557 species-level taxa (211±42 per subject were identified, representing 122 genera and 13 phyla. The core bacteriome comprised 55 species-level taxa belonging to 30 genera and 7 phyla, namely Firmicutes, Proteobacteria, Actinobacteria, Bacteroidetes, Fusobacteria, Saccharibacteria, and SR1. The core species constituted between 67 and 87% of the individual bacteriomes. However, the abundances differed by up to three orders of magnitude among the study subjects. On average, Streptococcus mitis, Rothia mucilaginosa, Haemophilus parainfluenzae, Neisseria flavescence/subflava group, Prevotella melaninogenica, and Veillonella parvula group were the most abundant. Streptococcus sp. C300, a taxon never reported in the oral cavity, was identified as a core species. Species richness was estimated at 586 (Chao2 and 614 (ACE species, whereas diversity (Shannon index averaged at 3.99. Conclusions

  20. RNA structure-based ribosome recruitment: lessons from the Dicistroviridae intergenic region IRESes. (United States)

    Pfingsten, Jennifer S; Kieft, Jeffrey S


    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5' end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by many viruses of medical and economic importance. In this review, we briefly describe and compare mechanistic and structural groups of viral IRES RNAs, focusing on those IRESes that are capable of direct ribosome recruitment using specific RNA structures. We then discuss in greater detail some recent advances in our understanding of the intergenic region IRESes of the Dicistroviridae, which use the most streamlined ribosome-recruitment mechanism yet discovered. By combining these findings with knowledge of canonical translation and the behavior of other IRESes, mechanistic models of this RNA structure-based process are emerging. PMID:18515544

  1. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.


    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  2. RNase II is important for A-site mRNA cleavage during ribosome pausing


    Garza-Sánchez, Fernando; Shoji, Shinichiro; Fredrick, Kurt; Hayes, Christopher S.


    In Escherichia coli, translational arrest can elicit cleavage of codons within the ribosomal A site. This A-site mRNA cleavage is independent of RelE, and has been proposed to be an endonucleolytic activity of the ribosome. Here, we show that the 3′→5′ exonuclease RNase II plays an important role in RelE-independent A-site cleavage. Instead of A-site cleavage, translational pausing in ΔRNase II cells produces transcripts that are truncated +12 and +28 nucleotides downstream of the A-site codo...

  3. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip


    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  4. Detection and Enumeration of Methanotrophs in Acidic Sphagnum Peat by 16S rRNA Fluorescence In Situ Hybridization, Including the Use of Newly Developed Oligonucleotide Probes for Methylocella palustris


    Dedysh, Svetlana N.; Derakshani, Manigee; Liesack, Werner


    Two 16S rRNA-targeted oligonucleotide probes, Mcell-1026 and Mcell-181, were developed for specific detection of the acidophilic methanotroph Methylocella palustris using fluorescence in situ hybridization (FISH). The fluorescence signal of probe Mcell-181 was enhanced by its combined application with the oligonucleotide helper probe H158. Mcell-1026 and Mcell-181, as well as 16S rRNA oligonucleotide probes with reported group specificity for either type I methanotrophs (probes M-84 and M-705...

  5. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis


    Meyer, Birte; Kuever, Jan


    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  6. Nutritional and growth control of ribosomal protein mRNA and rRNA in Neurospora crassa.


    Cujec, T P; Tyler, B M


    The effects of changing growth rates on the levels of 40S pre-rRNA and two r-protein mRNAs were examined to gain insight into the coordinate transcriptional regulation of ribosomal genes in the ascomycete fungus Neurospora crassa. Growth rates were varied either by altering carbon nutritional conditions, or by subjecting the isolates to inositol-limiting conditions. During carbon up- or down-shifts, r-protein mRNA levels were stoichiometrically coordinated. Changes in 40S pre-rRNA levels para...

  7. Metagenomic 16s rRNA investigation of microbial communities in the Black Sea estuaries in South-West of Ukraine. (United States)

    Bobrova, Oleksandra; Kristoffersen, Jon Bent; Oulas, Anastasis; Ivanytsia, Volodymyr


    The Black Sea estuaries represent interfaces of the sea and river environments. Microorganisms that inhabit estuarine water play an integral role in all biochemical processes that occur there and form unique ecosystems. There are many estuaries located in the Southern-Western part of Ukraine and some of them are already separated from the sea. The aim of this research was to determine the composition of microbial communities in the Khadzhibey, Dniester and Sukhyi estuaries by metagenomic 16S rDNA analysis. This study is the first complex analysis of estuarine microbiota based on isolation of total DNA from a biome that was further subjected to sequencing. DNA was extracted from water samples and sequenced on the Illumina Miseq platform using primers to the V4 variable region of the 16S rRNA gene. Computer analysis of the obtained raw sequences was done with QIIME (Quantitative Insights Into Microbial Ecology) software. As the outcome, 57970 nucleotide sequences were retrieved. Bioinformatic analysis of bacterial community in the studied samples demonstrated a high taxonomic diversity of Prokaryotes at above genus level. It was shown that majority of 16S rDNA bacterial sequences detected in the estuarine samples belonged to phyla Cyanobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Verrucomicrobia, Planctomycetes. The Khadhzibey estuary was dominated by the Proteobacteria phylum, while Dniester and Sukhyi estuaries were characterized by dominance of Cyanobacteria. The differences in bacterial populations between the Khadzhibey, Dniester and Sukhyi estuaries were demonstrated through the Beta-diversity analysis. It showed that the Khadzhibey estuary's microbial community significantly varies from the Sukhyi and Dniester estuaries. The majority of identified bacterial species is known as typical inhabitants of marine environments, however, for 2.5% of microbial population members in the studied estuaries no relatives were determined. PMID:26929931

  8. [Precursors of ribosomal RNA in freely suspended callus cells of parsley (Petroselinum sativum)]. (United States)

    Richter, G


    Six high molecular weight, rapidly labelled RNA species were detected in freely suspended callus cells of Petroselinum sativum by means of isotope labelling and electrophoretic separation in agarose-polyacrylamide gels. On the basis of their migration in the latter the RNA species were calculated to have the following molecular weights: 2.9×10(6), 2,4×10(6), 1.9×10(6), 1.4×10(6), 1.0×10(6) and 0.75×10(6) daltons. Thus they can clearly be distinguished from the two ribosomal RNA species (1.3×10(6) and 0.7×10(6) daltons). During incubation of the cells with [(3)H]methyl-methionine as a methyl donator all six components incorporated radioactivity rapidly. With [(3)H]nucleosides or [(3)H]orotic acid as precursors the 2.9×10(6) and the 2.4×10(6) daltons RNA were labelled within 10 min, while the other high molecular weight species appeared after about 20 min of labelling.Prolongation to 45-120 min resulted in accumulation of radioactivity preferentially in the 1.4×10(6) and 0.75×10(6) daltons RNA and in the ribosomal RNA species. The results of cell fractionation experiments provide evidence that these rapidly labelled high molecular weight RNA species are synthesized in the cell nucleus. The kinetics of their synthesis together with the other data obtained strongly support the suggestion that these RNA species function as precursors in the processing of ribosomal RNA. The possible mechanism of this process is discussed. PMID:24468848

  9. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification (United States)


    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  10. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Directory of Open Access Journals (Sweden)

    Dawyndt Peter


    Full Text Available Abstract Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the

  11. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China. (United States)

    Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin


    The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis. PMID:26203763

  12. Application of the Sequences Analysis of the 16S rRNA Gene and ITS of 16S-23S rRNA to the Systematic Study of the Genus Arthrospira and Spirulina%16S rRNA基因与16S-23S rRNA转录单元内间隔区序列分析及其在节旋藻和螺旋藻分类鉴定中的应用

    Institute of Scientific and Technical Information of China (English)

    茅云翔; 杨官品; 张宝红; 张学成


    测定了节旋藻属3个品系和螺旋藻属1个品系的全长16S rRNA基因和16S-23S rRNA转录单元内间隔区序列(ITS),分析了已知的节旋藻、螺旋藻和相关品系的相应序列的同源性,构建了系统发生树,并评价了这两段DNA序列在节旋藻、螺旋藻种属分类和种质鉴定中的意义.结果表明:(1)16S rRNA基因序列和ITS序列均可用于节旋藻属和螺旋藻属的属间分类,以两序列为基础的系统学分析结果一致;(2)ITS序列变异程度高于16S rDNA序列,适用于节旋藻和螺旋藻属内品系或种质鉴定;(3)节旋藻属可明确界定,16S rRNA基因序列相似性大于98%,ITS序列相似性大于88%;(4)螺旋藻属某些品系间16S rDNA序列和ITS序列相似性较低,与不同属间的序列相似性程度为同一水平.

  13. Unusual transcription termination of the ribosomal RNA genes in Ascaris lumbricoides.


    Müller, E; Neuhaus, H; Tobler, H; Müller, F.


    We studied termination of transcription of the ribosomal RNA genes in Ascaris lumbricoides, the first representative in the phylum of nemathelminthes analysed so far. RNase protection experiments in vivo reveal that the 3' end of the precursor rRNA coincides with the end of mature 26S rRNA. Promoter-containing miniplasmids are able to direct unique 3' end formation in vitro at a site identical to that observed in vivo, whereas deletion of these sequences abolishes 3' end formation throughout ...

  14. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne; Støttrup, Josianne; Buchmann, Kurt


    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested to be...... related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  15. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera. (United States)

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K


    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola. PMID:25944083

  16. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A


    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  17. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    Directory of Open Access Journals (Sweden)

    Yu Wang


    Full Text Available A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification.

  18. Investigating the etiology of bovine digital dermatitis by a combination of 16S rRNA gene analysis and fluorescence in situ hybridization

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Rasmussen, Marianne; Capion, Nynne; Boye, Mette; Jensen, Tim Kåre

    Bovine digital dermatitis, the cause of lameness and wasting in cattle, was first reported in 1974. Today, this disease has considerable negative effects on animal welfare and production economy in many parts of the world. A bacterial etiology of digital dermatitis is now well documented, and the...... etiology of the disease. Here, a PCR-based approach targeting the 16S rRNA gene along with fluorescence in situ hybridization was used to determine the prevalence and diversity of 17 Treponema phylotypes in 85 digital dermatitis lesions from six Danish dairy herds as well as additional biopsies of healthy...... skin and previously examined digital dermatitis lesions. All skin samples were evaluated histopathologically for possible predisposing abnormalities. Furthermore, fluorescence in situ hybridization tests for Fusobacterium. necrophorum and D. nodosus was applied. All lesions revealed intermingled...

  19. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.


    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  20. Identification and 16S rRNA phylogenetic analysis of 2 Streptococcus suis strains isolated in Changsha City%猪链球菌长沙分离株的鉴定与16S rRNA系统进化分析

    Institute of Scientific and Technical Information of China (English)

    苏良; 欧新华; 杨柳青; 张如胜; 刘如春; 陈田木; 李亚曼; 孙边成


    The aim of this study was to identify 2 strains of Streptococcus suis isolated in Changsha City and elucidate their phylogenetic relationship through the 16S rRNA . The 16S rRNA of 2 strains was amplified by polymerase chain reaction (PCR) through universal primer of 16S rRNA . The products of 16S rRNA of 2 strains were obtained successfully with length about 1 500 bp. The products were sequenced successfully then the sequences were submitted to GenBank . And the sequences were compared with related sequence through online BLAST in NCBI , showing the 2 strains of Streptococcus suis were Streptococcus suis type 2 . The identification result through the 16S rRNA was consistent with traditional method . Then the phylogenetic tree of 16S rRNA was constructed through the Mege 4.0 software. The phylogenetic tree showed that the 2 strains of Streptococcus suis were at the same evolutionary branch with most of Streptococcus suis type 2 and had the nearest phylogenetic relationship with Streptococcus suis 05ZYH33 in Sichuan Province . In conclusion , Streptococcus suis could be quickly and accurately identified through the 16S rRNA and this method could be applied in rapid detection . The 2 strains of Streptococcus suis isolated in Changsha City were Streptococcus suis type 2 and was not variable in 16S rRNA gene.%目的 对2株猪链球菌(Streptococcus suis,SS)长沙分离株进行分离培养和分子鉴定,并对其16S rRNA基因进行测序,阐明其系统进化关系.方法 利用分离培养法对2株 SS进行分离鉴定,同时对分离株16S rRNA 基因进行PCR扩增和核苷酸序列测定,将测序结果提交GenBank,通过在线Blast同源性分析进行菌株鉴定,并与传统培养鉴定方法进行比较,利用Mega4.0软件构建SS长沙分离株系统进化树.结果 成功扩增出2株菌的目的 片段,通过测序后Blast同源性分析,证实2株菌株均为SS,且与传统鉴定方法结果一致,进化树显示长沙2株SS和国内外2型位于同

  1. Assessment of a 16S rRNA amplicon Illumina sequencing procedure for studying the microbiome of a symbiont-rich aphid genus. (United States)

    Jousselin, E; Clamens, A-L; Galan, M; Bernard, M; Maman, S; Gschloessl, B; Duport, G; Meseguer, A S; Calevro, F; Coeur d'acier, A


    The bacterial communities inhabiting arthropods are generally dominated by a few endosymbionts that play an important role in the ecology of their hosts. Rather than comparing bacterial species richness across samples, ecological studies on arthropod endosymbionts often seek to identify the main bacterial strains associated with each specimen studied. The filtering out of contaminants from the results and the accurate taxonomic assignment of sequences are therefore crucial in arthropod microbiome studies. We aimed here to validate an Illumina 16S rRNA gene sequencing protocol and analytical pipeline for investigating endosymbiotic bacteria associated with aphids. Using replicate DNA samples from 12 species (Aphididae: Lachninae, Cinara) and several controls, we removed individual sequences not meeting a minimum threshold number of reads in each sample and carried out taxonomic assignment for the remaining sequences. With this approach, we show that (i) contaminants accounted for a negligible proportion of the bacteria identified in our samples; (ii) the taxonomic composition of our samples and the relative abundance of reads assigned to a taxon were very similar across PCR and DNA replicates for each aphid sample; in particular, bacterial DNA concentration had no impact on the results. Furthermore, by analysing the distribution of unique sequences across samples rather than aggregating them into operational taxonomic units (OTUs), we gained insight into the specificity of endosymbionts for their hosts. Our results confirm that Serratia symbiotica is often present in Cinara species, in addition to the primary symbiont, Buchnera aphidicola. Furthermore, our findings reveal new symbiotic associations with Erwinia- and Sodalis-related bacteria. We conclude with suggestions for generating and analysing 16S rRNA gene sequences for arthropod-endosymbiont studies. PMID:26458227

  2. Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis

    Directory of Open Access Journals (Sweden)

    De Ganck Catharine


    Full Text Available Abstract Background The pathogenesis of bacterial vaginosis remains largely elusive, although some microorganisms, including Gardnerella vaginalis, are suspected of playing a role in the etiology of this disorder. Recently culture-independent analysis of microbial ecosystems has proven its efficacy in characterizing the diversity of bacterial populations. Here, we report on the results obtained by combining culture and PCR-based methods to characterize the normal and disturbed vaginal microflora. Results A total of 150 vaginal swab samples from healthy women (115 pregnant and 35 non-pregnant were categorized on the basis of Gram stain of direct smear as grade I (n = 112, grade II (n = 26, grade III (n = 9 or grade IV (n = 3. The composition of the vaginal microbial community of eight of these vaginal swabs (three grade I, two grade II and three grade III, all from non-pregnant women, were studied by culture and by cloning of the 16S rRNA genes obtained after direct amplification. Forty-six cultured isolates were identified by tDNA-PCR, 854 cloned 16S rRNA gene fragments were analysed of which 156 by sequencing, yielding a total of 38 species, including 9 presumptively novel species with at least five species that have not been isolated previously from vaginal samples. Interestingly, cloning revealed that Atopobium vaginae was abundant in four out of the five non-grade I specimens. Finally, species specific PCR for A. vaginae and Gardnerella vaginalis pointed to a statistically significant co-occurrence of both species in the bacterial vaginosis samples. Conclusions Although historically the literature regarding bacterial vaginosis has largely focused on G. vaginalis in particular, several findings of this study – like the abundance of A. vaginae in disturbed vaginal microflora and the presence of several novel species – indicate that much is to be learned about the composition of the vaginal microflora and its relation to the etiology of BV.

  3. Bacterial communities of traditional salted and fermented seafoods from Jeju Island of Korea using 16S rRNA gene clone library analysis. (United States)

    Kim, Min-Soo; Park, Eun-Jin


    Jeotgal, which is widely consumed as a nutritional supplement in Korea, is traditional type of preserved seafood that is prepared by salting and fermenting. Here, we report on the bacterial community structure and diversity of jeotgal obtained from the Korean island of Jeju, which has a subtropical climate. Two samples of Jeotgal were collected from Jeju, made from either damselfish (Chromis notata; jari-dom-jeot, J1 and J2) or silver-stripe round herring (Spratelloides gracilis; ggot-myulchi-jeot, K1 and K2). The physical characteristics (pH and salinity) were assessed and the bacterial communities characterized using 16S rRNA gene-clone library analysis and cultural isolation. No difference was found in the community composition between the J and K fermented seafoods. Both fermented seafoods had relatively high salinity (26% to 33%) and high pH values (pH 6.08 to 6.72). Based on the 16S rRNA gene sequences, the halophilic lactic-acid bacteria Tetragenococcus halophilus and T. muriaticus were observed to be dominant in the J and K fermented seafoods, accompanied by halophilic bacteria including Halanaerobium spp., Halomonas spp., and Chromohalobacter spp. When compared with 7 other types of fermented seafood from a previous study, the communities of the J and K fermented seafoods were separated by the most influential group, the genus Tetragenococcus. The results suggest that these 2 types of traditional salted fermented seafood from Jeju have distinct communities dominated by Tetragenococcus spp., which are derived from the raw ingredients and are dependent on the physical conditions. This may explain how the seafoods that are made in Jeju may differ from other jeotgals. PMID:24689962

  4. PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples. (United States)

    Kox, L F; van Leeuwen, J; Knijper, S; Jansen, H M; Kolk, A H


    A PCR and a reverse cross blot hybridization assay were developed for the detection and identification of mycobacteria in clinical samples. The PCR amplifies a part of the DNA coding for 16S rRNA with a set of primers that is specific for the genus Mycobacterium and that flanks species-specific sequences within the genes coding for 16S rRNA. The PCR product is analyzed in a reverse cross blot hybridization assay with probes specific for M. tuberculosis complex (pTub1), M. avium (pAvi3), M. intracellulare (pInt5 and pInt7), M. kansasii complex-M. scrofulaceum complex (pKan1), M. xenopi (pXen1), M. fortuitum (pFor1), M. smegmatis (pSme1), and Mycobacterium spp. (pMyc5a). The PCR assay can detect 10 fg of DNA, the equivalent of two mycobacteria. The specificities of the probes were tested with 108 mycobacterial strains (33 species) and 31 nonmycobacterial strains (of 17 genera). The probes pAvi3, pInt5, pInt7, pKan1, pXen1, and pMyc5a were specific. With probes pTub1, pFor1, and pSme1, slight cross hybridization occurred. However, the mycobacterial strains from which the cross-hybridizing PCR products were derived belonged to nonpathogenic or nonopportunistic species which do not occur in clinical samples. The test was used on 31 different clinical specimens obtained from patients suspected of having mycobacterial disease, including a patient with a double mycobacterial infection. The samples included sputum, bronchoalveolar lavage, tissue biopsy samples, cerebrospinal fluid, pus, peritoneal fluid, pleural fluid, and blood. The results of the PCR assay agreed with those of conventional identification methods or with clinical data, showing that the test can be used for the direct and rapid detection and identification of mycobacteria in clinical samples. PMID:8586707

  5. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  6. Reduced expression of ribosomal proteins relieves microRNA-mediated repression. (United States)

    Janas, Maja M; Wang, Eric; Love, Tara; Harris, Abigail S; Stevenson, Kristen; Semmelmann, Karlheinz; Shaffer, Jonathan M; Chen, Po-Hao; Doench, John G; Yerramilli, Subrahmanyam V B K; Neuberg, Donna S; Iliopoulos, Dimitrios; Housman, David E; Burge, Christopher B; Novina, Carl D


    MicroRNAs (miRNAs) regulate physiological and pathological processes by inducing posttranscriptional repression of target messenger RNAs (mRNAs) via incompletely understood mechanisms. To discover factors required for human miRNA activity, we performed an RNAi screen using a reporter cell line of miRNA-mediated repression of translation initiation. We report that reduced expression of ribosomal protein genes (RPGs) dissociated miRNA complexes from target mRNAs, leading to increased polysome association, translation, and stability of miRNA-targeted mRNAs relative to untargeted mRNAs. RNA sequencing of polysomes indicated substantial overlap in sets of genes exhibiting increased or decreased polysomal association after Argonaute or RPG knockdowns, suggesting similarity in affected pathways. miRNA profiling of monosomes and polysomes demonstrated that miRNAs cosediment with ribosomes. RPG knockdowns decreased miRNAs in monosomes and increased their target mRNAs in polysomes. Our data show that most miRNAs repress translation and that the levels of RPGs modulate miRNA-mediated repression of translation initiation. PMID:22541556

  7. Phylogenetic Relationship of Duttaphrynus melanostictus From India and China as Revealed from the Study of 12S and 16S mtDNA Genes


    Sanjib Kr. Das; Debojyoti Dutta


    In the present study, the phylogenetic relationship of Duttaphrynus melanostictus from West Bengal, India with other members of the Bufonidiae group was undertaken using partial mitochondrial DNA (mtDNA) genes. Mitochondria were isolated from the liver of Duttaphrynus melanostictus by a non-conventional method of membrane filtration. The technique allows trapping of mitochondria on cellulose acetate membrane followed by mtDNA isolation. 12S ribosomal RNA and 16S ribosomal RNA was sequenced wi...

  8. Protein-RNA cross-linking in the ribosomes of yeast under oxidative stress. (United States)

    Mirzaei, Hamid; Regnier, Fred


    Living systems have efficient degradative pathways for dealing with the fact that reactive oxygen species (ROS) derived from cellular metabolism and the environment oxidatively damage proteins and DNA. But aggregation and cross-linking can occur as well, leading to a series of problems including disruption of cellular regulation, mutations, and even cell death. The mechanism(s) by which protein aggregation occurs and the macromolecular species involved are poorly understood. In the study reported here, evidence is provided for a new type of aggregate between proteins and RNA in ribosomes. While studying the effect of oxidative stress induced in the yeast proteome it was noted that ribosomal proteins were widely oxidized. Eighty six percent of the proteins in yeast ribosomes were found to be carbonylated after stressing yeast cell cultures with hydrogen peroxide. Moreover, many of these proteins appeared to be cross-linked based on their coelution patterns during RPC separation. Since they were not in direct contact, it was not clear how this could occur unless it was through the RNA separating them in the ribosome. This was confirmed in a multiple-step process, the first being derivatization of all carbonylated proteins in cell lysates with biotin hydrazide through Schiff base formation. Following reduction of Schiff bases with sodium cyanoborohydride, biotinylated proteins were selected from cell lysates with avidin affinity chromatography. Oxidized proteins thus captured were then selected again using boronate affinity chromatography to capture vicinal diol-containing proteins. This would include proteins cross-linked to an RNA fragment containing a ribose residue with 2',3'-hydroxyl groups. Some glycoproteins would also be selected by this process. LC/MS/MS analyses of tryptic peptides derived from proteins captured by this process along with MASCOT searches resulted in the identification of 37 ribosomal proteins that appear to be cross-linked to RNA

  9. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants. (United States)

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo


    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the 'Hop stunt viroid' accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  10. Quantitative studies of mRNA recruitment to the eukaryotic ribosome. (United States)

    Fraser, Christopher S


    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  11. Possible genetic consequences of epigenetic interactions between ribosomal RNA loci in Nicotiana allopolyploids

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, K.Y.; Součková Skalická, Kamila; Matyášek, Roman; Grandbastien, M.-A.; Leitch, A.

    Clermont-Ferrand, 2007. s. 1-1. [Réunion du Groupe de travail Cytogénétique & Polyploidie du DGAP. 18.04.2007-20.04.2007, Clermont-Ferrand] R&D Projects: GA ČR(CZ) GA521/07/0116; GA ČR(CZ) GA204/05/0687 Institutional research plan: CEZ:AV0Z50040507 Keywords : allopolyploidy * epigenetic silencing * ribosomal RNA gene Subject RIV: BO - Biophysics

  12. 霍乱弧菌毒力基因检测与16S rRNA基因分型研究%Toxigene detection and 16S rRNA gene typing of Vibrio cholerae

    Institute of Scientific and Technical Information of China (English)

    张政; 朱水荣


    目的:了解浙江省霍乱弧菌毒力基因携带情况和16S rRNA基因型状况,为霍乱防治提供科学依据.方法:利用16S rRNA基因探针分析了浙江省不同时期分离的88株霍乱弧菌经Bgl Ⅰ消化的16S rRNA基因限制性酶谱,以多重PCR法对140株霍乱弧菌进行6种毒力相关基因(ctxA、rtxA、Ace、TcpA、Cri、Zot)检测分析.结果:发现各菌株的杂交片断范围为2~12 Kb,每个菌株有6~9条杂交带不等.88株霍乱菌株可分为9个16S rRNA基因型(ribotype,RT),其中埃尔托型霍乱弧菌(el tor vibrio cholerae,EVC)可分为6个RT,O139群霍乱弧菌(vibrio cholerae O139,VC O139)分为3个RT;所有VC O139菌株均携带3种以上毒力基因,86.3%的菌株携带全部6种毒力基因,所有EVC流行株均携带2种以上毒力基因,79.1%的菌株携带全部6种毒力基因.结论:认为霍乱流行菌株基因型的变迁可能是引起新一次流行的原因.结合毒素基因检测结果,我们认为VC O139与EVC在遗传特征上有相近的特点,但又有所区别.

  13. Identification of the oligonucleotide and oligopeptide involved in an RNA-protein crosslink induced by ultraviolet irradiation of Escherichia coli 30 S ribosomal subunits

    International Nuclear Information System (INIS)

    When 30 S ribosomal subunits are irradiated with ultraviolet light, it has been found that an RNA-protein crosslinking reaction occurs whose primary target is protein S7. This paper describes the identification of the oligopeptide and oligonucleotide at the crosslinking point, by direct analysis (a) of the peptide remaining attached to an oligonucleotide (after total digestion of the RNA in the crosslinked complex with ribonucleases A and Tperpendicular, followed by digestion with trypsin), and (b) of the nucleotides remaining attached to the crosslinked protein (after digestion of the RNA in the complex with ribonuclease Tperpendicular alone). The crosslinking site was found to lie within a single short peptide, Ser-Met-Ala-Leu-Arg (positions 113 to 117 in the S7 sequence), with methionine as the probable amino acid concerned. The principal RNA site was found to lie within an oligonucleotide three to six bases long, the bracketed portion of the partially ordered sequence C-U-A-C-[A-A-U-G.G.C]-G in section P of the 16 S RNA. The methodology involved has been designed with a view to being generally applicable in future RNA-protein crosslinking studies, where several proteins are simultaneously attached to the RNA. (author)

  14. Biochemical Characterization and 16S rRNA Sequencing of Few Lipase-Producing Thermophilic Bacteria from Taptapani Hot Water Spring, Orissa, India

    Directory of Open Access Journals (Sweden)

    Satpal S. Bisht


    Full Text Available Three lipase-producing thermophilic bacteria (AK-P1, AK-P2, and AK-P3 were isolated from the Taptapani hot water spring in Orissa, India. The crude extra cellular lipases from cell-free culture supernatant were reacted in an olive oil mixture, and their lipolytic activities were compared. Identification of the bacteria was carried out using biochemical tests, 16SrRNA sequencing and sequences submitted to NCBI GenBank. Strain AK-P3, exhibited the highest lipolytic activity of 5.5 U/mL was identified as Porphyrobacter sp. The lipolytic activities of strains AK-P1 and AK-P 2 were 4.5 U/mL and 3.5 U/mL, respectively. Strains AK-P1 and AK-P2 were identified as Acinetobacter sp. and Brevibacillus spp. The GenBank accession numbers of the 16S rRNA gene sequences determined in this study for the strains AK-P1, AK-P2, and AK-P3 are HM359120, HM359119, and HM359118, respectively.

  15. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  16. Bacterial diversity in typical Italian salami at different ripening stages as revealed by high-throughput sequencing of 16S rRNA amplicons. (United States)

    Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo


    The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential


    Directory of Open Access Journals (Sweden)

    Anuraj N.S., Sabnani M.K., Mukesh Yadav, Jyotsana K., Deepika S., Rachna C. and Jyoti Sahu


    Full Text Available Development of natural antimicrobial strategies has always attracted researchers, as disease outbreaks are recognized as important constraints to living organisms because of the development of antibiotic resistance in microorganisms. Use of probiotic bacteria has been in practice as alternatives to antimicrobials in disease control as microbial control agents. Probiotics, the natural and beneficial micro flora has been widely accepted and used in farming and aquaculture because of its diversified applications. It improves water and pond sediment quality which inturn improves aquatic life. Bacterial pathogenicity and virulence can be controlled without using excessive antibiotics which help to minimize the risk of multiple antibiotic resistances. Probiotic help in increased productivity and profits when used properly as they produce antagonistic compounds that are inhibitory toward pathogens, compete with harmful microorganisms for nutrients and energy, compete with deleterious species for adhesion sites, enhance the immune response of the animal, improve water quality, and interact with phytoplankton. Among the large number of probiotic products in use today are bacterial spore formers, mostly of the genus Bacillus. The genus Bacillus is widely used as probiotic products because of its extremely resistant spores which provide exceptional longevity and release exoenzymes. The current investigation is to identify a novel strain of Bacillus licheniformis by application of 16S rRNA gene sequencing. The approach is to identify a novel, proteases and amylases producing bacteria which is used for detergent production. The sample was isolated from near Gudiwada, Krishna district, Andhra Pradesh, India. Subsequently the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The results showed the isolate to be a novel, high alkaline protease

  18. Impact of Fishmeal Replacement in Diets for Gilthead Sea Bream (Sparus aurata on the Gastrointestinal Microbiota Determined by Pyrosequencing the 16S rRNA Gene.

    Directory of Open Access Journals (Sweden)

    G Estruch

    Full Text Available Recent studies have demonstrated the impact of diet on microbiota composition, but the essential need for the optimization of production rates and costs forces farms and aquaculture production to carry out continuous dietary tests. In order to understand the effect of total fishmeal replacement by vegetable-based feed in the sea bream (Sparus aurata, the microbial composition of the stomach, foregut, midgut and hindgut was analysed using high-throughput 16S rDNA sequencing, also considering parameters of growth, survival and nutrient utilisation indices.A total of 91,539 16S rRNA filtered-sequences were analysed, with an average number of 3661.56 taxonomically assigned, high-quality sequences per sample. The dominant phyla throughout the whole gastrointestinal tract were Actinobacteria, Protebacteria and Firmicutes. A lower diversity in the stomach in comparison to the other intestinal sections was observed. The microbial composition of the Recirculating Aquaculture System was totally different to that of the sea bream gastrointestinal tract. Total fishmeal replacement had an important impact on microbial profiles but not on diversity. Streptococcus (p-value: 0.043 and Photobacterium (p-value: 0.025 were highly represented in fish fed with fishmeal and vegetable-meal diets, respectively. In the stomach samples with the vegetable diet, reads of chloroplasts and mitochondria from vegetable dietary ingredients were rather abundant. Principal Coordinate Analysis showed a clear differentiation between diets in the microbiota present in the gut, supporting the presence of specific bacterial consortia associated with the diet.Although differences in growth and nutritive parameters were not observed, a negative effect of the vegetable diet on the survival rate was determined. Further studies are required to shed more light on the relationship between the immune system and sea bream gastrointestinal tract microbiota and should consider the modulation of

  19. Impact of Fishmeal Replacement in Diets for Gilthead Sea Bream (Sparus aurata) on the Gastrointestinal Microbiota Determined by Pyrosequencing the 16S rRNA Gene. (United States)

    Estruch, G; Collado, M C; Peñaranda, D S; Tomás Vidal, A; Jover Cerdá, M; Pérez Martínez, G; Martinez-Llorens, S


    Recent studies have demonstrated the impact of diet on microbiota composition, but the essential need for the optimization of production rates and costs forces farms and aquaculture production to carry out continuous dietary tests. In order to understand the effect of total fishmeal replacement by vegetable-based feed in the sea bream (Sparus aurata), the microbial composition of the stomach, foregut, midgut and hindgut was analysed using high-throughput 16S rDNA sequencing, also considering parameters of growth, survival and nutrient utilisation indices.A total of 91,539 16S rRNA filtered-sequences were analysed, with an average number of 3661.56 taxonomically assigned, high-quality sequences per sample. The dominant phyla throughout the whole gastrointestinal tract were Actinobacteria, Protebacteria and Firmicutes. A lower diversity in the stomach in comparison to the other intestinal sections was observed. The microbial composition of the Recirculating Aquaculture System was totally different to that of the sea bream gastrointestinal tract. Total fishmeal replacement had an important impact on microbial profiles but not on diversity. Streptococcus (p-value: 0.043) and Photobacterium (p-value: 0.025) were highly represented in fish fed with fishmeal and vegetable-meal diets, respectively. In the stomach samples with the vegetable diet, reads of chloroplasts and mitochondria from vegetable dietary ingredients were rather abundant. Principal Coordinate Analysis showed a clear differentiation between diets in the microbiota present in the gut, supporting the presence of specific bacterial consortia associated with the diet.Although differences in growth and nutritive parameters were not observed, a negative effect of the vegetable diet on the survival rate was determined. Further studies are required to shed more light on the relationship between the immune system and sea bream gastrointestinal tract microbiota and should consider the modulation of the microbiota to

  20. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region. (United States)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko; Lo Svenningsen, Sine; Sneppen, Kim; Pedersen, Steen


    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described. Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction of the functional half-life of a given mRNA sequence. PMID:21255584

  1. Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

    International Nuclear Information System (INIS)

    A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

  2. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Directory of Open Access Journals (Sweden)

    Bethânia Figueiredo Barbosa de Toledo


    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  3. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons. (United States)

    Rausch, H; Larsen, N; Schmitt, R


    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  4. Detection of Clostridium sp. and its Relation to Different Ages and Gastrointestinal Segments as Measured by Molecular Analysis of 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Seyed Ziaeddin Mirhosseini


    Full Text Available The objective of this study was to establish a specific, sensitive and rapid PCR approach for the detection of Clostridium sp. at the genus level. Clostridium sp. in the duodenum, jejunum, ileum and cecum of broiler chickens were analyzed by 16S rRNA genes. The PCR detected the presence of Clostridium spp. in naturally contaminated intestinal samples. For the total gastrointestinal segments, 53.125, 65.625 and 59.375% samples were positive for naturally occurring Clostridium spp. at the ages 4, 14 and 30d, respectively. Analysis of the microbial contents indicated that Clostridium sp. was not consistently detected in all intestinal segments. These results can put in evidence the hypothesis that Clostridium spp. may be interfering in health and performance of chickens.Clostridium spp. são organismos patogénicos com distribuição mundial, podendo estar presente nos seres humanos, em animais domésticos e em animais selvagens. Estas bactérias habitam geralmente o trato gastrintestinal. Os métodos bacteriológicos convencionais como a microscopia e a cultura têm limitações. O objetivo deste estudo foi de estabelecer uma metodologia específica, sensível e rápida como a ténica de PCR para a deteção de Clostridium spp. A presença de Clostridium spp. Foi pesquisada no duodeno, o jejunum, o íleo e o cecum de galinhas usando análise molecular de genes do rRNA 16S. A técnica de PCR usada neste trabalho detectou Clostridium spp. em amostras intestinais naturalmente contaminadas. Considerando o trato gastrintestinal total, 53.125, 65.625 e 59.375% das amostras foram positivas para Clostridium nas idades 4, 14 e 30d respectivamente. A análise microbiana indicou que Clostridium spp. não foi detectado consistentemente em todos os segmentos intestinais. Os dados observados alertam para possíveis implicações significativas para a saúde e o desempenho das galinhas.

  5. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Directory of Open Access Journals (Sweden)

    Steelman Samantha M


    Full Text Available Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to characterize hindgut bacterial communities in healthy horses and those with chronic laminitis. Results Fecal samples were collected from 10 normal horses and 8 horses with chronic laminitis. Genomic DNA was extracted and the V4-V5 segment of the 16S rRNA gene was PCR amplified and sequenced on the 454 platform generating a mean of 2,425 reads per sample after quality trimming. The bacterial communities were dominated by Firmicutes (69.21% control, 56.72% laminitis and Verrucomicrobia (18.13% control, 27.63% laminitis, followed by Bacteroidetes, Proteobacteria, and Spirochaetes. We observed more OTUs per individual in the laminitis group than the control group (419.6 and 355.2, respectively, P = 0.019 along with a difference in the abundance of two unassigned Clostridiales genera (P = 0.03 and P = 0.01. The most abundant bacteria were Streptococcus spp., Clostridium spp., and Treponema spp.; along with unassigned genera from Subdivision 5 of Verrucomicrobia, Ruminococcaceae, and Clostridiaceae, which together constituted ~ 80% of all OTUs. There was a high level of individual variation across all taxonomic ranks. Conclusions Our exploration of the equine fecal microflora revealed higher bacterial diversity in horses with chronic laminitis and identification of two Clostridiales genera that differed in abundance from control horses. There was large individual variation in bacterial communities that was not explained in our study. The core hindgut microflora was

  6. Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences. (United States)

    Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J


    Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving

  7. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency. (United States)

    Kontos, H; Napthine, S; Brierley, I


    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  8. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.


    between the relative abundance, species richness and phylogenetic diversity of the microbial communities associated with the leaf midribs of HLB symptomatic and asymptomatic citrus trees were investigated using high-density 16S rDNA microarray PhyloChip and 16S rRNA gene clone library methods.

  9. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;


    codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described....... Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...

  10. Shifts of microbial community structure in soils of a photovoltaic plant observed using tag-encoded pyrosequencing of 16S rRNA. (United States)

    Wu, Shijin; Li, Yuan; Wang, Penghua; Zhong, Li; Qiu, Lequan; Chen, Jianmeng


    The environmental risk of fluoride and chloride pollution is pronounced in soils adjacent to solar photovoltaic sites. The elevated levels of fluoride and chloride in these soils have had significant impacts on the population size and overall biological activity of the soil microbial communities. The microbial community also plays an essential role in remediation of these soils. Questions remain as to how the fluoride and chloride contamination and subsequent remediation at these sites have impacted the population structure of the soil microbial communities. We analyzed the microbial communities in soils collected from close to a solar photovoltaic enterprise by pyrosequencing of the 16S rRNA tag. In addition, we used multivariate statistics to identity the relationships shared between sequence diversity and heterogeneity in the soil environment. The overall microbial communities were surprisingly diverse, harboring a wide variety of taxa and sharing significant correlations with different degrees of fluoride and chloride contamination. The contaminated soils harbored abundant bacteria that were probably resistant to the high acidity, high fluoride and chloride concentration, and high osmotic pressure environment. The dominant genera were Sphingomonas, Subgroup_6_norank, Clostridium sensu stricto, Nitrospira, Rhizomicrobium, and Acidithiobacillus. The results of this study provide new information regarding a previously uncharacterized ecosystem and show the value of high-throughput sequencing in the study of complex ecosystems. PMID:26695154

  11. Bacterial community composition in the gut content and ambient sediment of sea cucumber Apostichopus japonicus revealed by 16S rRNA gene pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Fei Gao

    Full Text Available The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments.

  12. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing (United States)

    Gao, Fei; Li, Fenghui; Tan, Jie; Yan, Jingping; Sun, Huiling


    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus) and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments. PMID:24967593

  13. bioOTU: An Improved Method for Simultaneous Taxonomic Assignments and Operational Taxonomic Units Clustering of 16s rRNA Gene Sequences. (United States)

    Chen, Shi-Yi; Deng, Feilong; Huang, Ying; Jia, Xianbo; Liu, Yi-Ping; Lai, Song-Jia


    Clustering of 16s rRNA amplicon sequences into operational taxonomic units (OTUs) is the most common bioinformatics pipeline for investigating microbial community by high-throughput sequencing technologies. However, the existing algorithms of OTUs clustering still remain to be improved at reliability. Here we propose an improved method (bioOTU) that first assigns taxonomy to unique tags at genus level for separating the error-free sequences of known species in reference database from artifacts, and then cluster them into OTUs by different strategies. The remaining tags, which fail to be clustered in the previous step, are further subjected to independent OTUs clustering by the optimized algorithm of heuristic clustering. The performance tests on both mock and real communities revealed that bioOTU is powerful for recovering the underlying profiles at both microbial composition and abundance, and it also produces comparable or less number of OTUs in comparison with the prevailing tools of Mothur and UPARSE. The bioOTU is implemented in C and Python languages with source codes freely available on the GitHub repository. PMID:26950196

  14. Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting. (United States)

    Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel


    Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control. PMID:19027065

  15. 16S rRNA-targeted probes for specific detection of Thermoanaerobacterium spp., Thermoanaerobacterium thermosaccharolyticum, and Caldicellulosiruptor spp. by fluorescent in situ hybridization in biohydrogen producing systems

    Energy Technology Data Exchange (ETDEWEB)

    O-Thong, Sompong [Department of Environmental Engineering, Technical University of Denmark, Bygningstorvet Bg 115, DK-2800, Kgs Lyngby (Denmark); Department of Biology, Faculty of Science, Thaksin University, Patthalung 93110 (Thailand); Prasertsan, Poonsuk [Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat-Yai, Songkhla 90112 (Thailand); Karakashev, Dimitar; Angelidaki, Irini [Department of Environmental Engineering, Technical University of Denmark, Bygningstorvet Bg 115, DK-2800, Kgs Lyngby (Denmark)


    16S rRNA gene targeted oligonucleotide probes for specific detection of genera Thermoanaerobacterium (Tbm1282), Caldicellulosiruptor (Ccs432), and specie Thermoanaerobacterium thermosaccharolyticum (Tbmthsacc184) were designed and used to monitor the spatial distribution of hydrogen producing bacteria in sludge and granules from anaerobic reactors. The designed probes were checked for their specificity and then validated using fluorescence in situ hybridization with target microorganisms and non-target microorganisms. Thermoanaerobacterium spp., T. thermosaccharolyticum and Caldicellulosiruptor spp. were detected with the probes designed with coverage of 75%, 100% and 93%, respectively. Thermophilic (60 C) hydrogen producing reactors, one fed with sucrose and another, fed with palm oil mill effluent comprised of following major groups of hydrogen producers: Thermoanaerobacterium spp. (49% and 36%), T. thermosaccharolyticum (16% and 10%), phylum Firmicutes (low G+C) gram positive bacteria (15% and 27%). Extreme-thermophilic (70 C) hydrogen producing reactors, one fed with xylose and another, fed with lignocellulosic hydrolysate comprised of following major groups of hydrogen producers: Caldicellulosiruptor spp. (40.5% and 20.5%), phylum Firmicutes (low G+C) gram positive bacteria (17% and 20%), Archaea (7% and 8.5%), and Thermoanaerobacterium spp. (0% and 5%). Results obtained, showed good applicability of the probes Tbm1282, Tbmthsacc184 and Ccs432 for specific detection and quantification of thermophilic and extreme-thermophilic hydrogen producers in complex environments. (author)

  16. Use of 16S rRNA sequencing and quantitative PCR to correlate venous leg ulcer bacterial bioburden dynamics with wound expansion, antibiotic therapy, and healing. (United States)

    Sprockett, Daniel D; Ammons, Christine G; Tuttle, Marie S


    Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876

  17. Characterization and potential of three temperature ranges for hydrogen fermentation of cellulose by means of activity test and 16s rRNA sequence analysis. (United States)

    Gadow, Samir I; Jiang, Hongyu; Li, Yu-You


    A series of standardized activity experiments were performed to characterize three different temperature ranges of hydrogen fermentation from different carbon sources. 16S rRNA sequences analysis showed that the bacteria were close to Enterobacter genus in the mesophilic mixed culture (MMC) and Thermoanaerobacterium genus in the thermophilic and hyper-thermophilic mixed cultures (TMC and HMC). The MMC was able to utilize the glucose and cellulose to produce methane gas within a temperature range between 25 and 45 °C and hydrogen gas from 35 to 60°C. While, the TMC and HMC produced only hydrogen gas at all temperature ranges and the highest activity of 521.4mlH2/gVSSd was obtained by TMC. The thermodynamic analysis showed that more energy is consumed by hydrogen production from cellulose than from glucose. The experimental results could help to improve the economic feasibility of cellulosic biomass energy using three-phase technology to produce hythane. PMID:26954308

  18. Effects of DNA extraction and universal primers on 16S rRNA gene-based DGGE analysis of a bacterial community from fish farming water

    Institute of Scientific and Technical Information of China (English)


    Among many reports investigating microbial diversity from environmental samples with denaturing gradient gel electrophoresis (DGGE), limited attention has been given to the effects of universal primers and DNA extraction on the outcome of DGGE analysis. In this study, these effects were tested with 16S rRNA gene-based DGGE on a bacterial community from farming water samples. The results indicate that the number of discernable bands in the DGGE fingerprint differed with the primer pairs used; the bands produced by 63f/518r, 341f/926r and 933f/1387r primer pairs were obviously fewer than those by 968f/1401r. Also, we found that each DNA extraction method resulted in different community profiles, reflected by the number and intensity of bands in the DGGE fingerprint. Furthermore,the main bands (theoretically representing dominant bacteria) differed with the extraction methods applied.It is therefore believed that the effects of universal primers and DNA extraction should be given more attention and carefully chosen before performing an investigation into a new environment with DGGE.

  19. Microbial profiles of liquid and solid fraction associated biomaterial in buffalo rumen fed green and dry roughage diets by tagged 16S rRNA gene pyrosequencing. (United States)

    Singh, K M; Jisha, T K; Reddy, Bhaskar; Parmar, Nidhi; Patel, Anand; Patel, A K; Joshi, C G


    The microbiome of buffalo rumen plays an important role in animal health and productivity. The rumen bacterial composition of both liquid and solid fraction was surveyed using pyrosequencing of the 16S rRNA gene. Sequences were analyzed using taxonomy-dependent clustering methods and revealed that the dominant ruminal bacteria shared by samples belonged to phyla Bacteroidetes, Firmicutes, Fibrobacteres and Proteobacteria. The core rumen microbiome of the rumen consisted of 10 phyla, 19 classes, 22 orders and 25 families. However, the relative abundance of these bacterial groups was markedly affected by diet composition as well as in type of biomaterial. In animals fed with a green and dry roughage diet, the cellulolytic bacteria, Ruminococcaceae, and Fibrobacteraceae was found in highest abundance in all biomaterials which reflected the need for enhanced fiber-digesting capacity in buffalo. The polysaccharide-degrading Prevotellaceae bacteria were most abundant in buffalo rumen. In taxonomic comparison of rumen bacteria, about 26 genera were differentially abundant among liquid and solid fraction of ruminal fluid. These results highlight the buffalo ruminal microbiome's ability to adapt to feed with different composition. PMID:25249226

  20. Black Box Chimera Check (B2C2): a Windows-Based Software for Batch Depletion of Chimeras from Bacterial 16S rRNA Gene Datasets. (United States)

    Gontcharova, Viktoria; Youn, Eunseog; Wolcott, Randall D; Hollister, Emily B; Gentry, Terry J; Dowd, Scot E


    The existing chimera detection programs are not specifically designed for "next generation" sequence data. Technologies like Roche 454 FLX and Titanium have been adapted over the past years especially with the introduction of bacterial tag-encoded FLX/Titanium amplicon pyrosequencing methodologies to produce over one million 250-600 bp 16S rRNA gene reads that need to be depleted of chimeras prior to downstream analysis. Meeting the needs of basic scientists who are venturing into high-throughput microbial diversity studies such as those based upon pyrosequencing and specifically providing a solution for Windows users, the B2C2 software is designed to be able to accept files containing large multi-FASTA formatted sequences and screen for possible chimeras in a high throughput fashion. The graphical user interface (GUI) is also able to batch process multiple files. When compared to popular chimera screening software the B2C2 performed as well or better while dramatically decreasing the amount of time required generating and screening results. Even average computer users are able to interact with the Windows .Net GUI-based application and define the stringency to which the analysis should be done. B2C2 may be downloaded from PMID:21339894


    Directory of Open Access Journals (Sweden)

    Muhammad Kaleem Sarwar


    Full Text Available Halophiles are salt loving microbes optimally growing at high concentrations of salt. Khewra salt mines of Pakistan provide extreme saline conditions where enormous halophilic microbial biota thrives. The present study aimed at isolation and molecular identification of bacterial strains from saline waters of Khewra salt mines. Using halophilic media, nine halophilic bacterial strains from saline water bodies were cultured and studied under optimized growth conditions (NaCl, pH and temperature. Bacterial growth at different NaCl concentrations was measured at 600nm wavelength, showing optimal growth at 1.5M NaCl. 769bp size 16S rRNA gene was amplified for molecular identification of bacterial strains. The amplified genes of the strains FA2.2 and FA3.3 were sequenced and their homology with other bacterial strains was analyzed. The results showed FA2.2 shared maximum homology with Bacillus anthracis strain while FA3.3 showed close resemblance with Staphylococcus saprophyticus subsp. bovis. Isolated halophilic bacterial strains possess potential for various biotechnological applications. They could be manipulated for synthesizing transgenic crops tolerating high salinity boosting the agricultural yield. Moreover extremozymes of these bacteria holds great industrial importance.

  2. Detection of Renibacterium salmoninarum in tissue samples by sequence capture and fluorescent PCR based on the 16S rRNA gene. (United States)

    Königsson, Malin Heldtander; Ballagi, Andras; Jansson, Eva; Johansson, Karl-Erik


    The 16S rRNA genes from eight isolates of Renibacterium salmoninarum with different origins and dates of isolation were sequenced to evaluate the possibility to construct a diagnostic PCR system with target sites within this gene. The sequences were found to be identical but for one single position in one of the isolates, and two regions with an adequate number of nucleotide differences as compared to closely related species were identified. Species-specific fluorescent PCR primers complementary to these regions were constructed as well as oligonucleotides for DNA preparation by sequence capture. A mimic molecule was constructed to be used as an internal control. The PCR was specific and allowed the detection of DNA equivalent to 1-10 R. salmoninarum genomes per reaction. The DNA preparation with sequence capture and analysis by PCR with a mimic was found to be a reliable method for analysis of kidneys from fish with BKD. The amount of PCR inhibiting substances present in the tissue was reduced, and the relevant DNA was concentrated in the capture step. Furthermore, the use of the mimic molecule in the system assured that false negative results could be identified. PMID:15708821

  3. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress (United States)


    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels.

  4. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress. (United States)

    Yoshikawa, Masaru; Fujii, Yoichi Robertus


    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels. PMID:27517048

  5. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana. (United States)

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D


    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  6. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display. (United States)

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh


    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  7. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization (United States)

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen


    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  8. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale


    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  9. Mechanical insights into ribosomal progression overcoming RNA G-quadruplex from periodical translation suppression in cells (United States)

    Endoh, Tamaki; Sugimoto, Naoki


    G-quadruplexes formed on DNA and RNA can be roadblocks to movement of polymerases and ribosome on template nucleotides. Although folding and unfolding processes of the G-quadruplexes are deliberately studied in vitro, how the mechanical and physical properties of the G-quadruplexes affect intracellular biological systems is still unclear. In this study, mRNAs with G-quadruplex forming sequences located either in the 5‧ untranslated region (UTR) or in the open reading frame (ORF) were constructed to evaluate positional effects of the G-quadruplex on translation suppression in cells. Periodic fluctuation of translation suppression was observed at every three nucleotides within the ORF but not within the 5‧ UTR. The results suggested that difference in motion of ribosome at the 5‧ UTR and the ORF determined the ability of the G-quadruplex structure to act as a roadblock to translation in cells and provided mechanical insights into ribosomal progression to overcome the roadblock.

  10. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation. (United States)

    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine


    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3'-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein, TbNCP1. RNAi targeting PUF7 reduced trypanosome growth and inhibited two steps in ribosomal RNA processing. PMID:20153321

  11. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification. (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei


    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity. PMID:26245685

  12. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes. (United States)

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui


    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  13. Profiling the Succession of Bacterial Communities throughout the Life Stages of a Higher Termite Nasutitermes arborum (Termitidae, Nasutitermitinae Using 16S rRNA Gene Pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Michel Diouf

    Full Text Available Previous surveys of the gut microbiota of termites have been limited to the worker caste. Termite gut microbiota has been well documented over the last decades and consists mainly of lineages specific to the gut microbiome which are maintained across generations. Despite this intimate relationship, little is known of how symbionts are transmitted to each generation of the host, especially in higher termites where proctodeal feeding has never been reported. The bacterial succession across life stages of the wood-feeding higher termite Nasutitermes arborum was characterized by 16S rRNA gene deep sequencing. The microbial community in the eggs, mainly affiliated to Proteobacteria and Actinobacteria, was markedly different from the communities in the following developmental stages. In the first instar and last instar larvae and worker caste termites, Proteobacteria and Actinobacteria were less abundant than Firmicutes, Bacteroidetes, Spirochaetes, Fibrobacteres and the candidate phylum TG3 from the last instar larvae. Most of the representatives of these phyla (except Firmicutes were identified as termite-gut specific lineages, although their relative abundances differed. The most salient difference between last instar larvae and worker caste termites was the very high proportion of Spirochaetes, most of which were affiliated to the Treponema Ic, Ia and If subclusters, in workers. The results suggest that termite symbionts are not transmitted from mother to offspring but become established by a gradual process allowing the offspring to have access to the bulk of the microbiota prior to the emergence of workers, and, therefore, presumably through social exchanges with nursing workers.

  14. Microbial diversity in hummock and hollow soils of three wetlands on the Qinghai-Tibetan Plateau revealed by 16S rRNA pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Yongcui Deng

    Full Text Available The wetlands of the Qinghai-Tibetan Plateau are believed to play an important role in global nutrient cycling, but the composition and diversity of microorganisms in this ecosystem are poorly characterized. An understanding of the effects of geography and microtopography on microbial populations will provide clues to the underlying mechanisms that structure microbial communities. In this study, we used pyrosequencing-based analysis of 16S rRNA gene sequences to assess and compare the composition of soil microbial communities present in hummock and hollow soils from three wetlands (Dangxiong, Hongyuan and Maduo on the Qinghai-Tibetan Plateau, the world's highest plateau. A total of 36 bacterial phyla were detected. Proteobacteria (34.5% average relative abundance, Actinobacteria (17.3% and Bacteroidetes (11% had the highest relative abundances across all sites. Chloroflexi, Acidobacteria, Verrucomicrobia, Firmicutes, and Planctomycetes were also relatively abundant (1-10%. In addition, archaeal sequences belonging to Euryarchaea, Crenarchaea and Thaumarchaea were detected. Alphaproteobacteria sequences, especially of the order Rhodospirillales, were significantly more abundant in Maduo than Hongyuan and Dangxiong wetlands. Compared with Hongyuan soils, Dangxiong and Maduo had significantly higher relative abundances of Gammaproteobacteria sequences (mainly order Xanthomonadales. Hongyuan wetland had a relatively high abundance of methanogens (mainly genera Methanobacterium, Methanosarcina and Methanosaeta and methanotrophs (mainly Methylocystis compared with the other two wetlands. Principal coordinate analysis (PCoA indicated that the microbial community structure differed between locations and microtopographies and canonical correspondence analysis indicated an association between microbial community structure and soil properties or geography. These insights into the microbial community structure and the main controlling factors in wetlands of

  15. Horizon-Specific Bacterial Community Composition of German Grassland Soils, as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes ▿ † (United States)

    Will, Christiane; Thürmer, Andrea; Wollherr, Antje; Nacke, Heiko; Herold, Nadine; Schrumpf, Marion; Gutknecht, Jessica; Wubet, Tesfaye; Buscot, François; Daniel, Rolf


    The diversity of bacteria in soil is enormous, and soil bacterial communities can vary greatly in structure. Here, we employed a pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to characterize the overall and horizon-specific (A and B horizons) bacterial community compositions in nine grassland soils, which covered three different land use types. The entire data set comprised 752,838 sequences, 600,544 of which could be classified below the domain level. The average number of sequences per horizon was 41,824. The dominant taxonomic groups present in all samples and horizons were the Acidobacteria, Betaproteobacteria, Actinobacteria, Gammaproteobacteria, Alphaproteobacteria, Deltaproteobacteria, Chloroflexi, Firmicutes, and Bacteroidetes. Despite these overarching dominant taxa, the abundance, diversity, and composition of bacterial communities were horizon specific. In almost all cases, the estimated bacterial diversity (H′) was higher in the A horizons than in the corresponding B horizons. In addition, the H′ was positively correlated with the organic carbon content, the total nitrogen content, and the C-to-N ratio, which decreased with soil depth. It appeared that lower land use intensity results in higher bacterial diversity. The majority of sequences affiliated with the Actinobacteria, Bacteroidetes, Cyanobacteria, Fibrobacteres, Firmicutes, Spirochaetes, Verrucomicrobia, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria were derived from A horizons, whereas the majority of the sequences related to Acidobacteria, Chloroflexi, Gemmatimonadetes, Nitrospira, TM7, and WS3 originated from B horizons. The distribution of some bacterial phylogenetic groups and subgroups in the different horizons correlated with soil properties such as organic carbon content, total nitrogen content, or microbial biomass. PMID:20729324

  16. Carbon transformations in deep granitic groundwater by attached bacterial populations characterized with 16S-rRNA gene sequencing technique and scanning electron microscopy

    International Nuclear Information System (INIS)

    This report presents molecular characterization of attached bacterial populations growing in slowly flowing (1-3 mm s-1) artesian groundwater from deep crystalline bed-rock of the Stripa research mine, south central Sweden. The assimilation rate of CO2 and lactate, and the lactate respiration rates were also determined. The bacteria studied grew in anoxic, high pH, 9-10, and low redox artesian groundwater flowing up through tubings from two levels of a borehole designated V2, 812-820 m and 970-1240 m below ground. The major groups of bacteria were found. Signature bases placed them in the appropriate systematic groups. All belonged to the Proteobacterial groups beta and gamma. One group was found only at the 812-820 m level, where it constituted 63% of the sequenced clones, whereas the second group existed almost exclusively and constituted 85% of the sequenced clones at the 970-1240 m level. The third group was equally distributed between the levels. A few other bacteria were also found. None of the 16S-rRNA genes from the dominating bacteria resembled any of the other by more than 90% similarity, and none of them resembled anything in the database by more than 96%. Temperature did not seem to have any effect on species composition at the deeper level. SEM images showed rods appearing in microcolonies. The difference in population diversity between the two levels studied presumably reflect the different environments. The earlier proposed presence of sulphate reducing bacteria could no be confirmed

  17. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available The glassy-winged sharpshooter (GWSS is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony, were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas. Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the

  18. Spin-coated Au-nanohole arrays engineered by nanosphere lithography for a Staphylococcus aureus 16S rRNA electrochemical sensor. (United States)

    Purwidyantri, Agnes; Chen, Ching-Hsiang; Hwang, Bing-Joe; Luo, Ji-Dung; Chiou, Chiuan-Chian; Tian, Ya-Chung; Lin, Chan-Yu; Cheng, Chi-Hui; Lai, Chao-Sung


    The nanopatterning of gold nanoparticle (AuNP) arrays on an indium tin oxide (ITO) electrode using efficient and low-cost methods is described. This process used nanosphere lithography (NSL) encompassing the deposition of monolayered Polystyrene (PS) followed by a convective self-assembly drop coating protocol onto the ITO substrate that further acted as the mask after the AuNP assembly. The results showed that spin-coating allowed AuNPs to follow the contour and adhere to the PS nanospheres. The final products, after etching the PS, generated a highly ordered Au-nanohole array on an ITO substrate. The Au-nanohole arrays on the ITO electrode provided a greater surface area and successfully enhanced the peak current of electrochemical measurements by 82% compared with bare ITO and was used to detect Staphylococcus aureus 16S rRNA hybridization. In contrast to non-templated AuNP structures, the Au-nanohole arrays on the ITO electrode contributed to an optimum sensitivity improvement in DNA hybridization detection by 23%, along with an impressive limit of detection (LOD) of 10 pM. The high specificity of this distinguished structure was also achieved in the hybridization measurements of multi-analyte pathogens. These findings indicate that the combination of PS nanosphere lithography, followed by the spin-coating of AuNPs, leads to an inexpensive and simple engineering process that effectively generates uniform Au-nanohole arrays on ITO, which provides a greater surface area to optimize the electrochemical performance of the DNA biosensor. PMID:26556186

  19. Identification and quantification of Bifidobacterium species isolated from food with genus-specific 16S rRNA-targeted probes by colony hybridization and PCR. (United States)

    Kaufmann, P; Pfefferkorn, A; Teuber, M; Meile, L


    A Bifidobacterium genus-specific target sequence in the V9 variable region of the 16S rRNA has been elaborated and was used to develop a hybridization probe. The specificity of this probe, named lm3 (5'-CGGGTGCTI*CCCACTTTCATG-3'), was used to identify all known type strains and distinguish them from other bacteria. All of the 30 type strains of Bifidobacterium which are available at the German culture collection Deutsche Sammlung von Mikroorganismen und Zellkulturen, 6 commercially available production strains, and 34 closely related relevant strains (as negative controls) were tested. All tested bifidobacteria showed distinct positive signals by colony hybridization, whereas all negative controls showed no distinct dots except Gardnerella vaginalis DSM4944 and Propionibacterium freudenreichii subsp. shermanii DSM4902, which gave slight signals. Furthermore, we established a method for isolation and identification of bifidobacteria from food by using a PCR assay without prior isolation of DNA but breaking the cells with proteinase K. By this method, all Bifidobacterium strains lead to a DNA product of the expected size. We also established a quick assay to quantitatively measure Bifidobacterium counts in food and feces by dilution plating and colony hybridization. We were able to demonstrate that 2.1 x 10(6) to 2.3 x 10(7) colonies/g of sour milk containing bifidobacteria hybridized with the specific nucleotide probe. With these two methods, genus-specific colony hybridization and genus-specific PCR, it is now possible to readily and accurately detect any bifidobacteria in food and fecal samples and to discriminate between them and members of other genera. PMID:9097423

  20. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects. (United States)

    Rogers, Elizabeth E; Backus, Elaine A


    The glassy-winged sharpshooter (GWSS) is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium) of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony), were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia) and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas). Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the cibarium and

  1. Analysis of microbial community adaptation in mesophilic hydrogen fermentation from food waste by tagged 16S rRNA gene pyrosequencing. (United States)

    Laothanachareon, Thanaporn; Kanchanasuta, Suwimon; Mhuanthong, Wuttichai; Phalakornkule, Chantaraporn; Pisutpaisal, Nipon; Champreda, Verawat


    Dark fermentation is an attractive process for generation of biohydrogen, which involves complex microbial processes on decomposition of organic wastes and subsequent conversion of metabolic intermediates to hydrogen. The microbes present in an upflow anaerobic sludge blanket (UASB) reactor for waste water treatment were tested for application in batch dark fermentation of food waste at varying ratios of feedstock to heat-treated microbial inoculum (F/M) of 1-8 (g TVS/g TVS). Biohydrogen yields between 0.39 and 2.68 mol H2/mol hexose were obtained, indicating that the yields were highly dependent on the starting F/M ratio. The highest H2 purity of 66% was obtained from the first 8 h of fermentation at the F/M ratio of 2, whereas the highest H2 production was obtained after 35 h of fermentation at the F/M ratio of 5. Tagged 16S rRNA gene pyrosequencing showed that the seed culture comprised largely of uncultured bacteria with various Proteobacteria, Bacteroidetes, and Firmicutes, while the starting food waste contained mainly lactic acid bacteria. Enrichment of Firmicutes, particularly Clostridia and lactic acid bacteria occurred within 8 h of the dark fermentation and the H2 producing microcosm at 35 h was dominated >80% by Clostridium spp. The major H2 producer was identified as a Clostridial strain related to Clostridium frigidicarnis. This work demonstrated the adaption of the microbial community during the dark fermentation of complex food waste and revealed the major roles of Clostridia in both substrate degradation and biohydrogen production. PMID:24945701

  2. Survey of culture, goldengate assay, universal biosensor assay, and 16S rRNA Gene sequencing as alternative methods of bacterial pathogen detection. (United States)

    Lindsay, Brianna; Pop, Mihai; Antonio, Martin; Walker, Alan W; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M; Kotloff, Karen; Li, Shan; Magder, Laurence S; Paulson, Joseph N; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E; Hannis, James; Manalili, Sheri; Deleon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J; Hossain, M Anowar; Breiman, Robert F; Morris, J Glenn; McDaniel, Timothy K; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O Colin; Nataro, James P


    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  3. Noma affected children from Niger have distinct oral microbial communities based on high-throughput sequencing of 16S rRNA gene fragments.

    Directory of Open Access Journals (Sweden)

    Katrine L Whiteson


    Full Text Available We aim to understand the microbial ecology of noma (cancrum oris, a devastating ancient illness which causes severe facial disfigurement in>140,000 malnourished children every year. The cause of noma is still elusive. A chaotic mix of microbial infection, oral hygiene and weakened immune system likely contribute to the development of oral lesions. These lesions are a plausible entry point for unidentified microorganisms that trigger gangrenous facial infections. To catalog bacteria present in noma lesions and identify candidate noma-triggering organisms, we performed a cross-sectional sequencing study of 16S rRNA gene amplicons from sixty samples of gingival fluid from twelve healthy children, twelve children suffering from noma (lesion and healthy sites, and twelve children suffering from Acute Necrotizing Gingivitis (ANG (lesion and healthy sites. Relative to healthy individuals, samples taken from lesions in diseased mouths were enriched with Spirochaetes and depleted for Proteobacteria. Samples taken from healthy sites of diseased mouths had proportions of Spirochaetes and Proteobacteria that were similar to healthy control individuals. Samples from noma mouths did not have a higher abundance of Fusobacterium, casting doubt on its role as a causative agent of noma. Microbial communities sampled from noma and ANG lesions were dominated by the same Prevotella intermedia OTU, which was much less abundant in healthy sites sampled from the same mouths. Multivariate analysis confirmed that bacterial communities in healthy and lesion sites were significantly different. Several OTUs in the Orders Erysipelotrichales, Clostridiales, Bacteroidales, and Spirochaetales were identified as indicators of noma, suggesting that one or more microbes within these Orders is associated with the development of noma lesions. Future studies should include longitudinal sampling of viral and microbial components of this community, before and early in noma lesion

  4. Characterization of the airborne bacteria community at different distances from the rotating brushes in a wastewater treatment plant by 16S rRNA gene clone libraries

    Institute of Scientific and Technical Information of China (English)

    Yunping Han; Lin Li; Junxin Liu


    Biological risks of bioaerosols emitted from wastewater treatment processes have attracted wide attention in the recent years.However,the culture-based analysis method has been mostly adopted for detecting the bacterial community in bioaerosols,which may result in the underestimation of total microorganism concentration as not all microorganisms are cultivable.In this study,oligonucleotide fingerprinting of 16S rRNA genes was applied to reveal the composition and structure of the bacterial community in bioaerosols from an Orbal oxidation ditch in a Beijing wastewater treatment plant (WWTP).Bioaerosols were collected at different distances from the aerosol source,rotating brushes,and the sampling height was 1.5 m which is the common respiratory height of a human being.The bacterial communities of bioaerosols were diverse,and the lowest bacterial diversity was found at the sampling site just after the rotating brush rotating brush.A large proportion of bacteria in bioaerosols were affiliated with Proteobacteria and Bacteroidetes.Numerous bacteria present in the bioaerosols also emerged in water,indicating that the bacterial community in the bioaerosols was related to that of the aerosols' sources.The forced aeration of rotating brushes brought about observably distinct bacterial communities between sampling sites situated before and after the rotating brush.Isolation sources of closest relatives in bioaerosols done libraries were associated with the aqueous environment in the WWTP.Common potential pathogens in bioaerosols as well as those not reported in previous research were also analyzed in this study.Measures should be adopted to reduce the emission of bioaerosols and prevent their exposure to workers.

  5. Characterization of the airborne bacteria community at different distances from the rotating brushes in a wastewater treatment plant by 16S rRNA gene clone libraries. (United States)

    Han, Yunping; Li, Lin; Liu, Junxin


    Biological risks of bioaerosols emitted from wastewater treatment processes have attracted wide attention in the recent years. However, the culture-based analysis method has been mostly adopted for detecting the bacterial community in bioaerosols, which may result in the underestimation of total microorganism concentration as not all microorganisms are cultivable. In this study, oligonucleotide fingerprinting of 16S rRNA genes was applied to reveal the composition and structure of the bacterial community in bioaerosols from an Orbal oxidation ditch in a Beijing wastewater treatment plant (WWTP). Bioaerosols were collected at different distances from the aerosol source, rotating brushes, and the sampling height was 1.5 in which is the common respiratory height of a human being. The bacterial communities of bioaerosols were diverse, and the lowest bacterial diversity was found at the sampling site just after the rotating brush rotating brush. A large proportion of bacteria in bioaerosols were affiliated with Proteobacteria and Bacteroidetes. Numerous bacteria present in the bioaerosols also emerged in water, indicating that the bacterial community in the bioaerosols was related to that of the aerosols' sources. The forced aeration of rotating brushes brought about observably distinct bacterial communities between sampling sites situated before and after the rotating brush. Isolation sources of closest relatives in bioaerosols clone libraries were associated with the aqueous environment in the WWTP. Common potential pathogens in bioaerosols as well as those not reported in previous research were also analyzed in this study. Measures should be adopted to reduce the emission of bioaerosols and prevent their exposure to workers. PMID:23586294

  6. Ultradeep 16S rRNA sequencing analysis of geographically similar but diverse unexplored marine samples reveal varied bacterial community composition.

    Directory of Open Access Journals (Sweden)

    Chairmandurai Aravindraja

    Full Text Available BACKGROUND: Bacterial community composition in the marine environment differs from one geographical location to another. Reports that delineate the bacterial diversity of different marine samples from geographically similar location are limited. The present study aims to understand whether the bacterial community compositions from different marine samples harbour similar bacterial diversity since these are geographically related to each other. METHODS AND PRINCIPAL FINDINGS: In the present study, 16S rRNA deep sequencing analysis targeting V3 region was performed using Illumina bar coded sequencing. A total of 22.44 million paired end reads were obtained from the metagenomic DNA of Marine sediment, Rhizosphere sediment, Seawater and the epibacterial DNA of Seaweed and Seagrass. Diversity index analysis revealed that Marine sediment has the highest bacterial diversity and the least bacterial diversity was observed in Rhizosphere sediment. Proteobacteria, Actinobacteria and Bacteroidetes were the dominant taxa present in all the marine samples. Nearly 62-71% of rare species were identified in all the samples and most of these rare species were unique to a particular sample. Further taxonomic assignment at the phylum and genus level revealed that the bacterial community compositions differ among the samples. CONCLUSION: This is the first report that supports the fact that, bacterial community composition is specific for specific samples irrespective of its similar geographical location. Existence of specific bacterial community for each sample may drive overall difference in bacterial structural composition of each sample. Further studies like whole metagenomic sequencing will throw more insights to the key stone players and its interconnecting metabolic pathways. In addition, this is one of the very few reports that depicts the unexplored bacterial diversity of marine samples (Marine sediment, Rhizosphere sediment, Seawater and the host associated

  7. Improved Multiplex PCR Using Conserved and Species-Specific 16S rRNA Gene Primers for Simultaneous Detection of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis (United States)

    Tran, Simon Dangtuan; Rudney, Joel D.


    Among putative periodontal pathogens, Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis are most convincingly implicated as etiological agents in periodontitis. Therefore, techniques for detection of those three species would be of value. We previously published a description of a multiplex PCR that detects A. actinomycetemcomitans and P. gingivalis. The present paper presents an improvement on that technique, which now allows more sensitive detection of all three periodontal pathogens. Sensitivity was determined by testing serial dilutions of A. actinomycetemcomitans, B. forsythus, and P. gingivalis cells. Primer specificity was tested against (i) all gene sequences from the GenBank-EMBL database, (ii) six A. actinomycetemcomitans, one B. forsythus, and four P. gingivalis strains, (iii) eight different species of oral bacteria, and (iv) supra- and subgingival plaque samples from 20 healthy subjects and subgingival plaque samples from 10 patients with periodontitis. The multiplex PCR had a detection limit of 10 A. actinomycetemcomitans, 10 P. gingivalis, and 100 B. forsythus cells. Specificity was confirmed by the fact that (i) none of our forward primers were homologous to the 16S rRNA genes of other oral species, (ii) amplicons of predicted size were detected for all A. actinomycetemcomitans, B. forsythus, and P. gingivalis strains tested, and (iii) no amplicons were detected for the eight other bacterial species. A. actinomycetemcomitans, B. forsythus, and P. gingivalis were detected in 6 of 20, 1 of 20, and 11 of 20 of supragingival plaque samples, respectively, and 4 of 20, 7 of 20, and 13 of 20 of subgingival plaque samples, respectively, from periodontally healthy subjects. Among patients with periodontitis, the organisms were detected in 7 of 10, 10 of 10, and 7 of 10 samples, respectively. The simultaneous detection of three periodontal pathogens is an advantage of this technique over conventional PCR assays. PMID

  8. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  9. Isolation and identification by 16S rRNA sequence analysis of plant growth-promoting azospirilla from the rhizosphere of wheat. (United States)

    Ayyaz, Khadija; Zaheer, Ahmad; Rasul, Ghulam; Mirza, Muhammad Sajjad


    The main objective of the present study was to isolate phytohormone-producing, phosphate-solubilizing strains of Azospirillum from wheat to be used as inoculants for plant growth promotion. Five Azospirillum strains were isolated from the rhizosphere of field-grown wheat (Triticum aestivum L.), and it was confirmed by BOX-polymerase chain reaction (PCR) that the isolates were different and not re-isolates of the same strain. Sequence analysis of the PCR-amplified 16S rRNA gene indicated that four isolates showed maximum similarity to Azospirillum brasilense and one isolate showed maximum similarity to Azospirillum zeae. This is the first report indicating the presence of an A. zeae like isolate in the wheat rhizosphere in Pakistan. The bacterial isolates were characterized for their plant growth-promoting traits, phosphate solubilization, and indole-3-acetic acid (IAA) production. None of the isolates showed phosphate solubilization activity in the commonly used Pikovskaya medium. However, all strains (except AzoK4) exhibited ability to solubilize tricalcium phosphate (TCP) in modified Pikovskaya medium in which sucrose was replaced by Na-malate, as well as in TCP-supplemented Luria-Bertani (LB) medium. Organic acids, such as acetic, citric, lactic, malic, and succinic acids, were detected in culture supernatants of the tested Azospirillum strains. All strains exhibited ability to produce IAA in the growth medium, except Azospirillum sp. AzoK1. Among the strains tested, the maximum IAA production (30.49±1.04mgL(-1)) and phosphate solubilization (105.50±4.93mgL(-1)) were shown by a pure culture of Azospirillum sp. AzoK2. In pot experiments, single-strain inocula of Azospirillum sp. AzoK1 and AzoK2 improved wheat plant growth. PMID:27133558

  10. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water. (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S


    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. PMID:26231650

  11. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    Institute of Scientific and Technical Information of China (English)

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静


    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  12. Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments (United States)

    The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

  13. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.


    Takaiwa, F; Sugiura, M


    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  14. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  15. Characterization of a Defined 2,3,5,6-Tetrachlorobiphenyl-ortho-Dechlorinating Microbial Community by Comparative Sequence Analysis of Genes Coding for 16S rRNA


    Pulliam Holoman, Tracey R; Elberson, Margaret A.; Cutter, Leah A.; May, Harold D.; Sowers, Kevin R.


    Defined microbial communities were developed by combining selective enrichment with molecular monitoring of total community genes coding for 16S rRNAs (16S rDNAs) to identify potential polychlorinated biphenyl (PCB)-dechlorinating anaerobes that ortho dechlorinate 2,3,5,6-tetrachlorobiphenyl. In enrichment cultures that contained a defined estuarine medium, three fatty acids, and sterile sediment, a Clostridium sp. was predominant in the absence of added PCB, but undescribed species in the δ ...

  16. A Comparison between Transcriptome Sequencing and 16S Metagenomics for Detection of Bacterial Pathogens in Wildlife.

    Directory of Open Access Journals (Sweden)

    Maria Razzauti

    Full Text Available Rodents are major reservoirs of pathogens responsible for numerous zoonotic diseases in humans and livestock. Assessing their microbial diversity at both the individual and population level is crucial for monitoring endemic infections and revealing microbial association patterns within reservoirs. Recently, NGS approaches have been employed to characterize microbial communities of different ecosystems. Yet, their relative efficacy has not been assessed. Here, we compared two NGS approaches, RNA-Sequencing (RNA-Seq and 16S-metagenomics, assessing their ability to survey neglected zoonotic bacteria in rodent populations.We first extracted nucleic acids from the spleens of 190 voles collected in France. RNA extracts were pooled, randomly retro-transcribed, then RNA-Seq was performed using HiSeq. Assembled bacterial sequences were assigned to the closest taxon registered in GenBank. DNA extracts were analyzed via a 16S-metagenomics approach using two sequencers: the 454 GS-FLX and the MiSeq. The V4 region of the gene coding for 16S rRNA was amplified for each sample using barcoded universal primers. Amplicons were multiplexed and processed on the distinct sequencers. The resulting datasets were de-multiplexed, and each read was processed through a pipeline to be taxonomically classified using the Ribosomal Database Project. Altogether, 45 pathogenic bacterial genera were detected. The bacteria identified by RNA-Seq were comparable to those detected by 16S-metagenomics approach processed with MiSeq (16S-MiSeq. In contrast, 21 of these pathogens went unnoticed when the 16S-metagenomics approach was processed via 454-pyrosequencing (16S-454. In addition, the 16S-metagenomics approaches revealed a high level of coinfection in bank voles.We concluded that RNA-Seq and 16S-MiSeq are equally sensitive in detecting bacteria. Although only the 16S-MiSeq method enabled identification of bacteria in each individual reservoir, with subsequent derivation of

  17. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno


    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  18. The ribosome triggers the stringent response by RelA via a highly distorted tRNA. (United States)

    Agirrezabala, Xabier; Fernández, Israel S; Kelley, Ann C; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel


    The bacterial stringent response links nutrient starvation with the transcriptional control of genes. This process is initiated by the stringent factor RelA, which senses the presence of deacylated tRNA in the ribosome as a symptom of amino-acid starvation to synthesize the alarmone (p)ppGpp. Here we report a cryo-EM study of RelA bound to ribosomes bearing cognate, deacylated tRNA in the A-site. The data show that RelA on the ribosome stabilizes an unusual distorted form of the tRNA, with the acceptor arm making contact with RelA and far from its normal location in the peptidyl transferase centre. PMID:23877429

  19. Dissemination mechanism of 16S rRNA methylase genes in Proteus mirabilis strains isolated from chickens%鸡源奇异变形杆菌16S rRNA甲基化酶基因的扩散机制

    Institute of Scientific and Technical Information of China (English)

    李德喜; 刘河冰; 李新生; 张素梅; 陈玉霞; 胡功政; 商艳红; 杜向党


    从某鸡场9日龄鸡群的粪便样本中分离、鉴定出奇异变形杆菌22株,并进行药敏试验和耐药基因(16S rRNA甲基化酶基因和超广谱β-内酰胺酶基因)的PCR检测.然后通过接合试验、电转化试验以及脉冲场凝胶电泳来分析16S rRNA甲基化酶基因的扩散机制.结果显示,22株鸡奇异变形杆菌对庆大霉素、阿米卡星、卡那霉素均呈现高水平耐药,对头孢噻呋、头孢噻肟、环丙沙星、氟苯尼考、多西环素呈现不同程度的耐药.PCR检测表明,在7种16S rRNA甲基化酶基因中仅扩增出rmtB基因;同时,这些菌株也携带有blaCTX-M基因.接合试验和电转化试验重复多次均未成功.脉冲场凝胶电泳结果显示,这些菌株具有相近的亲缘关系,提示该场鸡源奇异变形杆菌16SrRNA甲基化酶基因rmtB的扩散以克隆传播为主.%In order to clarify the dissemination mechanism of 16S rRNA methylase genes in Proteus mirabilis strains isolated from chickens, 22 Proteus mirabilis strains were isolated and identified from feces samples of the young chicken flocks in a chicken farm. Antimicrobial susceptibility testing was performed by the broth dilution methods, and the resistant genes including 16S rRNA methylase genes and extended-spectrum beta-lactamase genes were detected by PCR. Then, the conjugation,transformation experiments and pulsed field gel electrophoresis(PFGE) were carried out to clarify the dissemination mechanism of 16S rRNA methylase genes in Proteus mirabilis strains. The results indicated that all strains revealed the high-level resistant to gentamicin,amika-cin and kanamycin. In addtion,these strains also showed a different degree of resistance to ceftio-fur,ceftaxime,ciprofloxacin, florfenicol and doxycycline. PCR detection showed,of seven kinds of 16S rRNA methylase genes,only rmtB was positive. Moreover,these strains also carried blaCTX-M-Mutiple repeated attempts for conjugation and transformation experiments

  20. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M;


    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups. In an...... attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree. This...

  1. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Nicholas A Kennedy

    Full Text Available Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories.Fecal samples from two healthy volunteers (H3 and H4 and two relapsing IBD patients (I1 and I2 were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient.DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561 and 22 (IQR 9-36 ng/µL respectively (p<0.0001. Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05.This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring

  2. PyroTRF-ID: a novel bioinformatics methodology for the affiliation of terminal-restriction fragments using 16S rRNA gene pyrosequencing data (United States)


    Background In molecular microbial ecology, massive sequencing is gradually replacing classical fingerprinting techniques such as terminal-restriction fragment length polymorphism (T-RFLP) combined with cloning-sequencing for the characterization of microbiomes. Here, a bioinformatics methodology for pyrosequencing-based T-RF identification (PyroTRF-ID) was developed to combine pyrosequencing and T-RFLP approaches for the description of microbial communities. The strength of this methodology relies on the identification of T-RFs by comparison of experimental and digital T-RFLP profiles obtained from the same samples. DNA extracts were subjected to amplification of the 16S rRNA gene pool, T-RFLP with the HaeIII restriction enzyme, 454 tag encoded FLX amplicon pyrosequencing, and PyroTRF-ID analysis. Digital T-RFLP profiles were generated from the denoised full pyrosequencing datasets, and the sequences contributing to each digital T-RF were classified to taxonomic bins using the Greengenes reference database. The method was tested both on bacterial communities found in chloroethene-contaminated groundwater samples and in aerobic granular sludge biofilms originating from wastewater treatment systems. Results PyroTRF-ID was efficient for high-throughput mapping and digital T-RFLP profiling of pyrosequencing datasets. After denoising, a dataset comprising ca. 10′000 reads of 300 to 500 bp was typically processed within ca. 20 minutes on a high-performance computing cluster, running on a Linux-related CentOS 5.5 operating system, enabling parallel processing of multiple samples. Both digital and experimental T-RFLP profiles were aligned with maximum cross-correlation coefficients of 0.71 and 0.92 for high- and low-complexity environments, respectively. On average, 63±18% of all experimental T-RFs (30 to 93 peaks per sample) were affiliated to phylotypes. Conclusions PyroTRF-ID profits from complementary advantages of pyrosequencing and T-RFLP and is particularly

  3. PyroTRF-ID: a novel bioinformatics methodology for the affiliation of terminal-restriction fragments using 16S rRNA gene pyrosequencing data

    Directory of Open Access Journals (Sweden)

    Weissbrodt David G


    Full Text Available Abstract Background In molecular microbial ecology, massive sequencing is gradually replacing classical fingerprinting techniques such as terminal-restriction fragment length polymorphism (T-RFLP combined with cloning-sequencing for the characterization of microbiomes. Here, a bioinformatics methodology for pyrosequencing-based T-RF identification (PyroTRF-ID was developed to combine pyrosequencing and T-RFLP approaches for the description of microbial communities. The strength of this methodology relies on the identification of T-RFs by comparison of experimental and digital T-RFLP profiles obtained from the same samples. DNA extracts were subjected to amplification of the 16S rRNA gene pool, T-RFLP with the HaeIII restriction enzyme, 454 tag encoded FLX amplicon pyrosequencing, and PyroTRF-ID analysis. Digital T-RFLP profiles were generated from the denoised full pyrosequencing datasets, and the sequences contributing to each digital T-RF were classified to taxonomic bins using the Greengenes reference database. The method was tested both on bacterial communities found in chloroethene-contaminated groundwater samples and in aerobic granular sludge biofilms originating from wastewater treatment systems. Results PyroTRF-ID was efficient for high-throughput mapping and digital T-RFLP profiling of pyrosequencing datasets. After denoising, a dataset comprising ca. 10′000 reads of 300 to 500 bp was typically processed within ca. 20 minutes on a high-performance computing cluster, running on a Linux-related CentOS 5.5 operating system, enabling parallel processing of multiple samples. Both digital and experimental T-RFLP profiles were aligned with maximum cross-correlation coefficients of 0.71 and 0.92 for high- and low-complexity environments, respectively. On average, 63±18% of all experimental T-RFs (30 to 93 peaks per sample were affiliated to phylotypes. Conclusions PyroTRF-ID profits from complementary advantages of pyrosequencing and T

  4. The human insulin receptor mRNA contains a functional internal ribosome entry segment (United States)

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth


    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240

  5. Model of EF4-induced ribosomal state transitions and mRNA translocation

    International Nuclear Information System (INIS)

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region. (paper)

  6. Regulation of ribosomal RNA expression across the lifespan is fine-tuned by maternal diet before implantation. (United States)

    Denisenko, Oleg; Lucas, Emma S; Sun, Congshan; Watkins, Adam J; Mar, Daniel; Bomsztyk, Karol; Fleming, Tom P


    Cells and organisms respond to nutrient deprivation by decreasing global rates of transcription, translation and DNA replication. To what extent such changes can be reversed is largely unknown. We examined the effect of maternal dietary restriction on RNA synthesis in the offspring. Low protein diet fed either throughout gestation or for the preimplantation period alone reduced cellular RNA content across fetal somatic tissues during challenge and increased it beyond controls in fetal and adult tissues after challenge release. Changes in transcription of ribosomal RNA, the major component of cellular RNA, were responsible for this phenotype as evidenced by matching alterations in RNA polymerase I density and DNA methylation at ribosomal DNA loci. Cellular levels of the ribosomal transcription factor Rrn3 mirrored the rRNA expression pattern. In cell culture experiments, Rrn3 overexpression reduced rDNA methylation and increased rRNA expression; the converse occurred after inhibition of Rrn3 activity. These observations define novel mechanism where poor nutrition before implantation irreversibly alters basal rates of rRNA transcription thereafter in a process mediated by rDNA methylation and Rrn3 factor. PMID:27060415

  7. Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species. (United States)

    Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, Stéphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-Rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans


    Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin-Benson cycle enzymes. In mature leaves, soluble protein and Calvin-Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin-Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use. PMID:24895754

  8. Diversity of Free-Living and Attached Bacteria in Offshore Western Mediterranean Waters as Depicted by Analysis of Genes Encoding 16S rRNA


    Acinas, Silvia G; Antón, Josefa; Rodríguez-Valera, Francisco


    In a previous study (S. G. Acinas, F. Rodríguez-Valera, and C. Pedrós-Alió, FEMS Microbiol. Ecol. 24:27–40, 1997), community fingerprinting by 16S rDNA restriction analysis applied to Mediterranean offshore waters showed that the free-living pelagic bacterial community was very different from the bacterial cells aggregated or attached to particles of more than about 8 μm. Here we have studied both assemblages at three depths (5, 50, and 400 m) by cloning and sequencing the 16S rDNA obtained f...

  9. Purification and properties of new ribosome-inactivating proteins with RNA N-glycosidase activity. (United States)

    Bolognesi, A; Barbieri, L; Abbondanza, A; Falasca, A I; Carnicelli, D; Battelli, M G; Stirpe, F


    Ribosome-inactivating proteins (RIPs) similar to those already known (Stirpe & Barbieri (1986) FEBS Lett. 195, 1-8) were purified from the seeds of Asparagus officinalis (two proteins, asparin 1 and 2), of Citrullus colocynthis (two proteins, colocin 1 and 2), of Lychnis chalcedonica (lychnin) and of Manihot palmata (mapalmin), from the roots of Phytolacca americana (pokeweed antiviral protein from roots, PAP-R) and from the leaves of Bryonia dioica (bryodin-L). The two latter proteins can be considered as isoforms, respectively, of previously purified PAP, from the leaves of P. americana, and of bryodin-R, from the roots of B. dioica. All proteins have an Mr at approx, 30,000, and an alkaline isoelectric point. Bryodin-L, colocins, lychnin and mapalmin are glycoproteins. All RIPs inhibit protein synthesis by a rabbit reticulocyte lysate and phenylalanine polymerization by isolated ribosomes and alter rRNA in a similar manner as the A-chain of ricin and related toxins (Endo et al. (1987) J. Biol. Chem. 262, 5908-5912). PMID:2248976

  10. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Czech Academy of Sciences Publication Activity Database

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.


    Roč. 114, č. 2 (2013), s. 433-447. ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  11. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting. (United States)

    Maynard, Nathaniel D; Macklin, Derek N; Kirkegaard, Karla; Covert, Markus W


    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNA(Lys) uridine 34 modification inhibits PRF to influence the ratio of lambda phage proteins gpG and gpGT. Computational modeling and experiments suggest that the role of the iron-sulfur cluster biosynthesis pathway in infection is indirect, via competitive binding of the shared sulfur donor IscS. Based on the universality of many key components of this network, in both the host and the virus, we anticipate that these findings may have broad relevance to understanding other infections, including viral infection of humans. PMID:22294093

  12. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F


    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  13. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.


    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  14. The ribosome triggers the stringent response by RelA via a highly distorted tRNA


    Agirrezabala, Xabier; Fernández, Israel S.; Kelley, Ann C.; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel


    The bacterial stringent response is initiated by RelA and links nutrient starvation with the transcriptional control of genes. Cryo-EM now shows that RelA on the ribosome stabilizes an unusual distorted form of cognate, deacylated tRNA.

  15. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation


    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine


    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3′-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein,...

  16. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection


    Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric


    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  17. Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

    DEFF Research Database (Denmark)

    Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel; Desmolaize, Benoît; Douthwaite, Stephen Roger; Mechulam, Yves; Courvalin, Patrice


    Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium methyltr......Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium...... locations are required for catalysis. The tertiary structure of EfmM is highly similar to that of RsmF, consistent with m(5)C formation at adjacent sites on the 30S subunit, while distinctive structural features account for the enzymes' respective specificities for nucleotides C1404 and C1407....

  18. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes


    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.


    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restrict...

  19. Culturable autochthonous gut bacteria in Atlantic salmon (Salmo salar L.) fed diets with or without chitin. Characterization by 16S rRNA gene sequencing, ability to produce enzymes and in vitro growth inhibition of four fish pathogens


    Askarian, Fatemeh; Zhou, Zhigang; Olsen, Rolf Erik; Sperstad, Sigmund; Ringø, Einar


    The present investigation evaluated the effect of chitin (5% supplementation) on the adherent aerobic intestinal microbiota of Atlantic salmon (Salmo salar L.). One hundred and seventy three isolates were isolated but 34 isolates died prior to positive identification. Sixty four out of 139 autochthonous gut bacteria were further identified by 16S rRNA gene sequencing and further tested for protease, amylase, cellulase, phytase, lipase and chitinase activities. Moreover, the most promising enz...

  20. 16S rRNA gene-based identification of cultured bacterial flora from host-seeking Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks, vectors of vertebrate pathogens

    Czech Academy of Sciences Publication Activity Database

    Rudolf, Ivo; Mendel, Jan; Šikutová, Silvie; Švec, P.; Masaříková, J.; Nováková, D.; Buňková, L.; Sedláček, I.; Hubálek, Zdeněk


    Roč. 54, č. 5 (2009), s. 419-428. ISSN 0015-5632 R&D Projects: GA AV ČR KJB600930613 Institutional research plan: CEZ:AV0Z60930519 Keywords : ixodid ticks * 16S rRNA gene sequencing * Ixodes ricinus * Dermacentor reticulatus * Haemaphysalis concinna * microbial diversity Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  1. Impact of Fishmeal Replacement in Diets for Gilthead Sea Bream (Sparus aurata) on the Gastrointestinal Microbiota Determined by Pyrosequencing the 16S rRNA Gene


    Estruch, Guillem; COLLADO AMORES, MARÍA CARMEN; Peñaranda, D.S.; Tomas-Vidal, A.; Jover Cerda, Miguel; Pérez-Martínez, G; Martínez-Llorens, Silvia


    [EN] Recent studies have demonstrated the impact of diet on microbiota composition, but the essential need for the optimization of production rates and costs forces farms and aquaculture production to carry out continuous dietary tests. In order to understand the effect of total fishmeal replacement by vegetable-based feed in the sea bream (Sparus aurata), the microbial composition of the stomach, foregut, midgut and hindgut was analysed using high-throughput 16S rDNA sequ...

  2. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov (United States)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.


    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  3. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC


    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  4. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate. (United States)

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M


    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  5. 16S rRNA gene clone library analysis of bacterial communities of the tick with infection of 4 species of pathogens%4种病原菌特异基因片段阳性蜱的16S rRNA基因克隆文库分析

    Institute of Scientific and Technical Information of China (English)

    张守印; 俞东征; 孙继民; 贺金荣; 付秀萍; 张景山; 张建华; 蔡虹; 马凤琴; 海荣


    Objective To develop the method of 16S rRNA gene clone library for tick bacterial flora analysis, and to analyze the detection effective of pathogens in tick and capacity of bacterial flora diversity. Methods Primers were designed according to the specific gene of Borrelia burgdorferi, Bartonella henselae, Anaplasma phagocytophilum, Ehrlichia chaffeensis and templates were choosen by positive PCR result to amplify the DNA extracted from the ticks. One set of primers targeting 16S rRNA gene conserved region were chosen to amplify certain fragments, DNA extraction, PCR reaction, cloning and sequencing. Nucleotide sequences were compared with GenBank database. Calculated Coverage values of clone library and Shannon-Wiener diversity index. Results Sixteen defined genus-or species-bacteria were detected in 103 valid sequences. Eight species were edge type (Clone No. > 5). Three kinds of pathogens were identified (Borrelia burgdorferi, Bartonella henselae and Rickettsia sp). Three kinds of pathogens were not edge type(Clone No. 5个);检测到伯氏疏螺旋体、汉赛巴通体和立克次体3种病原菌,但这3种病原菌均不是优势类型(克隆子数均<5个).Coverage值为96.11%,Shannon-Wiener多样性指数为2.40.克隆序列分析结果表明,蜱寄生细菌主要为α、γ变形菌纲,占56.25%(9/16).结论 16S rRNA基因序列分析可以对蜱标本进行菌群相对定量研究,可以同时检出多种病原菌,是一种较好的细菌菌群多样性分析和病原菌筛检方法.

  6. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina


    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  7. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W;


    The distribution and repair of 8-methoxypsoralen-DNA interstrand cross-links in the ribosomal RNA genes (rDNA) in Tetrahymena thermophila have been studied in vivo by Southern blot analysis. It is found that the cross-links at a density of < or = 1/2 x 10(4) base pairs (bp) are distributed equall...

  8. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics (United States)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.


    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  9. PhytoREF: a reference database of the plastidial 16S rRNA gene of photosynthetic eukaryotes with curated taxonomy. (United States)

    Decelle, Johan; Romac, Sarah; Stern, Rowena F; Bendif, El Mahdi; Zingone, Adriana; Audic, Stéphane; Guiry, Michael D; Guillou, Laure; Tessier, Désiré; Le Gall, Florence; Gourvil, Priscillia; Dos Santos, Adriana L; Probert, Ian; Vaulot, Daniel; de Vargas, Colomban; Christen, Richard


    Photosynthetic eukaryotes have a critical role as the main producers in most ecosystems of the biosphere. The ongoing environmental metabarcoding revolution opens the perspective for holistic ecosystems biological studies of these organisms, in particular the unicellular microalgae that often lack distinctive morphological characters and have complex life cycles. To interpret environmental sequences, metabarcoding necessarily relies on taxonomically curated databases containing reference sequences of the targeted gene (or barcode) from identified organisms. To date, no such reference framework exists for photosynthetic eukaryotes. In this study, we built the PhytoREF database that contains 6490 plastidial 16S rDNA reference sequences that originate from a large diversity of eukaryotes representing all known major photosynthetic lineages. We compiled 3333 amplicon sequences available from public databases and 879 sequences extracted from plastidial genomes, and generated 411 novel sequences from cultured marine microalgal strains belonging to different eukaryotic lineages. A total of 1867 environmental Sanger 16S rDNA sequences were also included in the database. Stringent quality filtering and a phylogeny-based taxonomic classification were applied for each 16S rDNA sequence. The database mainly focuses on marine microalgae, but sequences from land plants (representing half of the PhytoREF sequences) and freshwater taxa were also included to broaden the applicability of PhytoREF to different aquatic and terrestrial habitats. PhytoREF, accessible via a web interface (, is a new resource in molecular ecology to foster the discovery, assessment and monitoring of the diversity of photosynthetic eukaryotes using high-throughput sequencing. PMID:25740460

  10. Classificação taxonômica das estirpes de rizóbio recomendadas para as culturas da soja e do feijoeiro baseada no seqüenciamento do gene 16S rRNA Taxonomic classification of rhizobial strains recommended for soybean and common bean crops in Brazil based on the sequencing of the 16s rRNA gene

    Directory of Open Access Journals (Sweden)

    L. M. O. Chueire


    Full Text Available As culturas da soja [Glycine max (L. Merrill] e do feijoeiro (Phaseolus vulgaris L. são de grande importância econômica e social para o Brasil e ambas podem ter seu requerimento de nitrogênio suprido pela simbiose com bactérias da ordem Rhizobiales. Para garantir a maximização do processo biológico, deve-se proceder à inoculação de estirpes de rizóbio eficientes e competitivas, recomendadas pela pesquisa. No Brasil, foram comercializados, na safra 2001/2002, 14 milhões de doses de inoculantes, dos quais 99 % para as culturas da soja e do feijoeiro. Neste trabalho, determinou-se a posição taxonômica das estirpes utilizadas em inoculantes comerciais para as duas culturas, pelo seqüenciamento da região do DNA que codifica o gene 16S rRNA, que é suficientemente variável, mas carrega as informações necessárias para permitir a análise filogenética de bactérias. O seqüenciamento permitiu definir que duas das estirpes recomendadas para a cultura da soja, SEMIA 587 e SEMIA 5019 (= 29 w, pertencem à espécie Bradyrhizobium elkanii e as duas outras, SEMIA 5079 (=CPAC 15 e SEMIA 5080 (= CPAC 7, à espécie B. japonicum. Determinou-se, ainda, que a estirpe SEMIA 4080 (=PRF 81, recomendada para o cultura do feijoeiro, pertence à espécie Rhizobium tropici. As seqüências obtidas foram depositadas no banco mundial de genes do National Center for Biotechnology Information.Soybean [Glycine max (L. Merrill] and common bean (Phaseolus vulgaris L. crops are of economical and social importance in Brazil; their requirement for nitrogen can be supplied by the symbiosis with bacteria belonging to the order Rhizobiales. However, to guarantee the maximization of the biological nitrogen fixation, seeds must be inoculated with efficient and competitive strains of rhizobia recommended by research. In 2001/2002, 14 million doses of inoculant were sold in Brazil, 99 % of these for soybean and common bean crops. In this study the taxonomic

  11. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    Institute of Scientific and Technical Information of China (English)

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良


    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  12. Isolation and Characterization of Lactococcus garvieae from Diseased Rainbow Trout (Oncorhynchus mykiss, Walbaum Cultured in Northern Iran Based on the Nucleotide Sequences of the 16s rRNA Gene

    Directory of Open Access Journals (Sweden)

    Milad ADEL


    Full Text Available This study was done to determine the molecular and biochemical identification of some causative agents of lactococcosis in farmed rainbow trout in Mazandaran provenience (northern Iran. A total of 200 moribund rainbow trout, suspected of lactococcosis from 10 rainbow trout farms in Mazandaran province, were collected during spring 2012 to winter 2012. Sampling was done from the kidney, spleen, liver and brain and cultured aseptically onto brain heart infusion (BHI agar plates and incubated at 25 °C for 24 - 48 h. Results of bacteriological cultures of these organs showed 19 % Lactococcus garvieae (38 fish, 9 % Streptococcus spp., (18 fish, 17 % Yersinia spp. (36 fish, and 55 % of fish were culture negative. The PCR assay was developed based on the 16s rRNA gene of L. garvieae for the rapid and specific detection and identification of this pathogen from different sources. Two pairs of primers were designed based on the nucleotide sequences of the 16s rRNA gene of L. garvieae. After PCR assay o