
Sample records for 1-4-alkyloxybenzyl-3-methyl-1h-imidazol-3-ium organic backbone

  1. 1-(4-Alkyloxybenzyl-3-methyl-1H-imidazol-3-ium organic backbone: A versatile smectogenic moiety

    Directory of Open Access Journals (Sweden)

    William Dobbs


    Full Text Available The merger of ionic liquid and liquid crystal fields, obtained by using the imidazolium ring as a common element, has allowed us to tailor a new set of materials which associate specific functionalities. These functionalities are consequences of the original properties of the component, ionic liquids, liquid crystals and their association in a single compound. The study of this interesting association led us to elaborate environment-flexible cationic architectures from which mesomorphic properties emerge. Moreover, we have also explored the influence of different anions on the mesomorphic properties.

  2. 1-(4-Alkyloxybenzyl)-3-methyl-1H-imidazol-3-ium organic backbone: A versatile smectogenic moiety


    Dobbs, William; Douce, Laurent; Heinrich, Benoît


    The merger of ionic liquid and liquid crystal fields, obtained by using the imidazolium ring as a common element, has allowed us to tailor a new set of materials which associate specific functionalities. These functionalities are consequences of the original properties of the component, ionic liquids, liquid crystals and their association in a single compound. The study of this interesting association led us to elaborate environment-flexible cationic architectures from which mesomorphic prope...

  3. Impact of Backbone Fluorination on π-Conjugated Polymers in Organic Photovoltaic Devices: A Review

    Directory of Open Access Journals (Sweden)

    Nicolas Leclerc


    Full Text Available Solution-processed bulk heterojunction solar cells have experienced a remarkable acceleration in performances in the last two decades, reaching power conversion efficiencies above 10%. This impressive progress is the outcome of a simultaneous development of more advanced device architectures and of optimized semiconducting polymers. Several chemical approaches have been developed to fine-tune the optoelectronics and structural polymer parameters required to reach high efficiencies. Fluorination of the conjugated polymer backbone has appeared recently to be an especially promising approach for the development of efficient semiconducting polymers. As a matter of fact, most currently best-performing semiconducting polymers are using fluorine atoms in their conjugated backbone. In this review, we attempt to give an up-to-date overview of the latest results achieved on fluorinated polymers for solar cells and to highlight general polymer properties’ evolution trends related to the fluorination of their conjugated backbone.

  4. Testing Backbone.js

    CERN Document Server

    Roemer, Ryan


    This book is packed with the step by step tutorial and instructions in recipe format helping you setup test infrastructure and gradually advance your skills to plan, develop, and test your backbone applications.If you are a JavaScript developer looking for recipes to create and implement test support for your backbone application, then this book is ideal for you.

  5. Backbone amide linker strategy

    DEFF Research Database (Denmark)

    Shelton, Anne Pernille Tofteng; Jensen, Knud Jørgen


    In the backbone amide linker (BAL) strategy, the peptide is anchored not at the C-terminus but through a backbone amide, which leaves the C-terminal available for various modifications. This is thus a very general strategy for the introduction of C-terminal modifications. The BAL strategy was...... assemble the final peptide. One useful application of this strategy is in the synthesis of C-terminal peptide aldehydes. The C-terminal aldehyde is masked as an acetal during synthesis and then conveniently demasked in the final cleavage step to generate the free aldehyde. Another application is in the...

  6. Getting started with Backbone Marionette

    CERN Document Server

    Armendariz, Raymundo


    This book is written with an easy-to-understand approach with the intention of giving small but concrete examples that will help you to quickly understand each component of Marionette. Follow along as we work together to build a practical application using Backbone Marionette.If you are a web application developer interested in using Backbone Marionette for a real-life project, then this book is for you. As a prerequisite, knowledge of JavaScript and a working knowledge of Backbone.js is required.

  7. A direct electrifying algorithm for backbone identification

    International Nuclear Information System (INIS)

    This paper proposes a new algorithm for identifying backbones in the application of percolation theory. This algorithm is based on the current-carrying definition of backbone and is carried out on the predetermined spanning cluster. It is fairly easy to implement and further parallelize. The efficiency is enhanced by the fact that the conductivity of a percolating system can be obtained in the same processing of backbone identification. The critical exponents of backbone mass, red bonds (sites) and conductivity obtained by this algorithm are in very good agreement with the existing results

  8. Green Network Planning Model for Optical Backbones

    DEFF Research Database (Denmark)

    Gutierrez Lopez, Jose Manuel; Riaz, M. Tahir; Jensen, Michael;


    Communication networks are becoming more essential for our daily lives and critically important for industry and governments. The intense growth in the backbone traffic implies an increment of the power demands of the transmission systems. This power usage might have a significant negative effect...... an analytical model to consider environmental aspects in the planning stage of backbones design....

  9. Increasing protein production by directed vector backbone evolution


    Jakob, Felix; Lehmann, Christian; Martinez, Ronny; Schwaneberg, Ulrich


    Recombinant protein production in prokaryotic and eukaryotic organisms was a key enabling technology for the rapid development of industrial and molecular biotechnology. However, despite all progress the improvement of protein production is an ongoing challenge and of high importance for cost-effective enzyme production. With the epMEGAWHOP mutagenesis protocol for vector backbone optimization we report a novel directed evolution based approach to increase protein production levels by randoml...

  10. Exercise: The Backbone of Spine Treatment

    Medline Plus

    Full Text Available Exercise: The Backbone of Spine Treatment | View Video Back Purchase Video Struggling with Low Back Pain? Many people are surprised to learn that carefully selected exercise can ...

  11. Exercise: The Backbone of Spine Treatment (United States)

    Exercise: The Backbone of Spine Treatment | View Video Back Purchase Video Struggling with Low Back Pain? Many people are surprised to learn that carefully selected exercise can actually reduce back pain. Some exercises can ...

  12. Exercise: The Backbone of Spine Treatment

    Medline Plus

    Full Text Available Exercise: The Backbone of Spine Treatment | View Video Back Purchase Video Struggling with Low Back Pain? Many people are surprised to learn that carefully selected exercise can actually reduce back pain. Some exercises can ...

  13. Identical repeated backbone of the human genome

    Directory of Open Access Journals (Sweden)

    Gonzaga-Jauregui Claudia


    Full Text Available Abstract Background Identical sequences with a minimal length of about 300 base pairs (bp have been involved in the generation of various meiotic/mitotic genomic rearrangements through non-allelic homologous recombination (NAHR events. Genomic disorders and structural variation, together with gene remodelling processes have been associated with many of these rearrangements. Based on these observations, we identified and integrated all the 100% identical repeats of at least 300 bp in the NCBI version 36.2 human genome reference assembly into non-overlapping regions, thus defining the Identical Repeated Backbone (IRB of the reference human genome. Results The IRB sequences are distributed all over the genome in 66,600 regions, which correspond to ~2% of the total NCBI human genome reference assembly. Important structural and functional elements such as common repeats, segmental duplications, and genes are contained in the IRB. About 80% of the IRB bp overlap with known copy-number variants (CNVs. By analyzing the genes embedded in the IRB, we were able to detect some identical genes not previously included in the Ensembl release 50 annotation of human genes. In addition, we found evidence of IRB gene copy-number polymorphisms in raw sequence reads of two diploid sequenced genomes. Conclusions In general, the IRB offers new insight into the complex organization of the identical repeated sequences of the human genome. It provides an accurate map of potential NAHR sites which could be used in targeting the study of novel CNVs, predicting DNA copy-number variation in newly sequenced genomes, and improve genome annotation.

  14. Orientation-dependent backbone-only residue pair scoring functions for fixed backbone protein design

    Directory of Open Access Journals (Sweden)

    Bordner Andrew J


    Full Text Available Abstract Background Empirical scoring functions have proven useful in protein structure modeling. Most such scoring functions depend on protein side chain conformations. However, backbone-only scoring functions do not require computationally intensive structure optimization and so are well suited to protein design, which requires fast score evaluation. Furthermore, scoring functions that account for the distinctive relative position and orientation preferences of residue pairs are expected to be more accurate than those that depend only on the separation distance. Results Residue pair scoring functions for fixed backbone protein design were derived using only backbone geometry. Unlike previous studies that used spherical harmonics to fit 2D angular distributions, Gaussian Mixture Models were used to fit the full 3D (position only and 6D (position and orientation distributions of residue pairs. The performance of the 1D (residue separation only, 3D, and 6D scoring functions were compared by their ability to identify correct threading solutions for a non-redundant benchmark set of protein backbone structures. The threading accuracy was found to steadily increase with increasing dimension, with the 6D scoring function achieving the highest accuracy. Furthermore, the 3D and 6D scoring functions were shown to outperform side chain-dependent empirical potentials from three other studies. Next, two computational methods that take advantage of the speed and pairwise form of these new backbone-only scoring functions were investigated. The first is a procedure that exploits available sequence data by averaging scores over threading solutions for homologs. This was evaluated by applying it to the challenging problem of identifying interacting transmembrane alpha-helices and found to further improve prediction accuracy. The second is a protein design method for determining the optimal sequence for a backbone structure by applying Belief Propagation

  15. Net neutrality at internet backbone provider level


    Baglioni, Laura; Calabrese, Armando; Ghiron, Nathan Levialdi


    This paper analysis the Internet interconnection market and combine the main technical (i.e. service quality) and economic aspects (i.e. profits and utility) characterizing relations between market players (end users, EUs; Internet Service Providers, ISPs; Internet Backbone Providers, IBPs) in order to determine possible economic outcomes in the strategic interaction between them. The proposed model enables a comparison to be made between expected values of social welfare (i.e. EU utility and...

  16. Backbone Dynamics of Triple-helical Collagen-like Structure


    Lazarev, Yu.A.; Lazareva, A.V.; Komarov, V.M.


    Some details of the backbone dynamics in the collagen-like triple helix is discussed and the role of backbone dynamics in functioning collagen proteins is illustrated. On a series of oligotripeptides synthetic analogs of collagen formation of high-frequency vibrational backbone dynamics and low-frequency nonlinear backbone dynamics upon stepwise elongation of peptide chain have been described using infrared spectroscopy and hydrogen-exchange method. In the fully completed triple helix the lev...

  17. Porous solid backbone impregnation for electrochemical energy conversion systems

    KAUST Repository

    Boulfrad, Samir


    An apparatus and method for impregnating a porous solid backbone. The apparatus may include a platform for holding a porous solid backbone, an ink jet nozzle configured to dispense a liquid solution onto the porous solid backbone, a positioning mechanism configured to position the ink jet nozzle proximate to a plurality of locations of the porous solid backbone, and a control unit configured to control the positioning mechanism to position the ink jet nozzle proximate to the plurality of locations and cause the ink jet nozzle to dispense the liquid solution onto the porous solid backbone.

  18. Backbone Guided Local Search for the Weighted Maximum Satisfiability Problem


    Jiang, He; Xuan, Jifeng


    In this chapter, analytical results on the backbone in weighted MAX-SAT were presented in this paper. We showed that it is intractable to retrieve the backbone in weighted MAX-SAT with any performance guarantee under the assumption that P NP . And a backbone guided local search algorithm was proposed for weighted MAX-SAT. Results of this paper imply a new way to incorporate the backbone in heuristics. The approximate backbone used to guide the flipping of literals in those local search based...

  19. Understanding VoIP from Backbone Measurements


    Birke, Robert Rene' Maria; Petracca, Michele; Mellia, Marco


    VoIP has widely been addressed as the technology that will change the Telecommunication model opening the path for convergence. Still today this revolution is far from being complete, since the majority of telephone calls are originated by circuit-oriented networks. In this paper for the first time to the best of our knowledge, we present a large dataset of measurements collected from the FastWeb backbone, which is one of the first worldwide Telecom operator to offer VoIP and high-speed data ...

  20. Peptoid-Peptide hybrid backbone architectures

    DEFF Research Database (Denmark)

    Olsen, Christian Adam


    Peptidomimetic oligomers and foldamers have received considerable attention for over a decade, with beta-peptides and the so-called peptoids (N-alkylglycine oligomers) representing prominent examples of such architectures. Lately, hybrid or mixed backbones consisting of both alpha- and beta......-amino acids (alpha/beta-peptides) have been investigated in some detail as well. The present Minireview is a survey of the literature concerning hybrid structures of alpha-amino acids and peptoids, including beta-peptoids (N-alkyl-beta-alanine oligomers), and is intended to give an overview of this area...

  1. Geometry motivated alternative view on local protein backbone structures


    Zacharias, Jan; Knapp, Ernst Walter


    We present an alternative to the classical Ramachandran plot (R-plot) to display local protein backbone structure. Instead of the (ϕ, ψ)-backbone angles relating to the chemical architecture of polypeptides generic helical parameters are used. These are the rotation or twist angle ϑ and the helical rise parameter d. Plots with these parameters provide a different view on the nature of local protein backbone structures. It allows to display the local structures in polar (d, ϑ)-coordinates, whi...

  2. Navigating the massive world of reddit: Using backbone networks to map user interests in social media


    Olson, Randal S.; Neal, Zachary P.


    In the massive online worlds of social media, users frequently rely on organizing themselves around specific topics of interest to find and engage with like-minded people. However, navigating these massive worlds and finding topics of specific interest often proves difficult because the worlds are mostly organized haphazardly, leaving users to find relevant interests by word of mouth or using a basic search feature. Here, we report on a method using the backbone of a network to create a map o...

  3. High Performance Infiltrated Backbones for Cathode-Supported SOFC's

    DEFF Research Database (Denmark)

    Gil, Vanesa; Kammer Hansen, Kent


    A four-step infiltration method has been developed to infiltrate La0.75Sr0.25MnO3+δ (LSM25) nanoparticles into porous structures (YSZ or LSM-YSZ backbones). The pore size distribution in the backbones is obtained either by using PMMA and/or graphites as pore formers or by leaching treatment of...

  4. Determination of Protein Backbone Structures from Residual Dipolar Couplings


    Prestegard, J H; Mayer, K. L.; Valafar, H.; Benison, G. C.


    There are a number of circumstances where a focus on determination of the backbone structure of a protein, as opposed to a complete all-atom structure, may be appropriate. This is particularly the case for structures determined as a part of a structural genomics initiative where computational modeling of many sequentially related structures from the backbone of a single family representative is anti...

  5. Free backbone carbonyls mediate rhodopsin activation. (United States)

    Kimata, Naoki; Pope, Andreyah; Sanchez-Reyes, Omar B; Eilers, Markus; Opefi, Chikwado A; Ziliox, Martine; Reeves, Philip J; Smith, Steven O


    Conserved prolines in the transmembrane helices of G-protein-coupled receptors (GPCRs) are often considered to function as hinges that divide the helix into two segments capable of independent motion. Depending on their potential to hydrogen-bond, the free C=O groups associated with these prolines can facilitate conformational flexibility, conformational switching or stabilization of the receptor structure. To address the role of conserved prolines in family A GPCRs through solid-state NMR spectroscopy, we focus on bovine rhodopsin, a GPCR in the visual receptor subfamily. The free backbone C=O groups on helices H5 and H7 stabilize the inactive rhodopsin structure through hydrogen-bonds to residues on adjacent helices. In response to light-induced isomerization of the retinal chromophore, hydrogen-bonding interactions involving these C=O groups are released, thus facilitating repacking of H5 and H7 onto the transmembrane core of the receptor. These results provide insights into the multiple structural and functional roles of prolines in membrane proteins. PMID:27376589

  6. A data acquisition backbone core library

    International Nuclear Information System (INIS)

    For the new experiments at FAIR new concepts of data acquisition systems have to be developed like the distribution of self-triggered, time stamped data streams over high performance networks for event building. The data acquisition backbone core (DABC) is a general purpose software framework designed for the implementation of such data acquisition systems. It provides the event building over networks like InfiniBand or Gigabit Ethernet. All kinds of data channels (front-end systems) are supported by program plug-ins into functional components of DABC like data input, combiner, scheduler, event builder, analysis and storage components. Commands and parameters of DABC and its application plug-ins are published by DIM servers. A Java based Graphical User Interface provides the dynamic control and visualization of these components. Application specific GUIs can be added. After a testing phase, DABC can be used to develop high performance data acquisition systems. Besides that DABC will be used for the implementation of various test beds needed for the final design of data acquisition systems at FAIR like detector tests, readout components test, and data flow investigations

  7. Backbone flexibility in protein design theory and experiment (United States)

    Su, Alyce

    The role of backbone flexibility in protein design was studied. First, the effect of explicit backbone motion on the selection of amino acids in protein design was assessed in the core of the streptococcal protein Gβ1 domain (Gβ1). Concerted backbone motion was introduced by varying Gβ1's supersecondary structure parameter values. The stability and structural flexibility of seven of the redesigned proteins were determined experimentally. Core variants containing as many as six of ten possible mutations retained native-like properties. This result demonstrates that backbone flexibility can be combined with amino acid side-chain selection and that the selection algorithm is sufficiently robust to tolerate perturbations as large as 15% of the native parameter values. Second, a general, quantitative design method for computing de novo backbone templates was developed. The method had to compute atomic resolution backbones compatible with the atomistic sequence selection algorithm we were using and it had to be applicable to all protein motifs. We again developed a method that uses super-secondary structure parameters to determine the orientation among secondary structural elements, given a target protein fold. Possible backbone arrangements were screened using a cost function which evaluates core packing, hydrogen bonding, loop closure, and backbone torsional geometry. Given a specified number of residues for each secondary structural element, a family of optimal configurations was found. We chose three motifs to test our method (ββα, βαβ, and αα) since their combination could be used to approximate most possible backbone fold. The best structure found for the ββα motif is similar to a zinc finger, and the best structure for the ββα motif is similar to a segment of a β-barrel. The backbone obtained for the αα motif resembles minimized protein A. Last, our backbone design method was evaluated by testing the thermal stability and structural properties

  8. Efficient Algorithms for Extension of Mobile Backbone Networks

    Directory of Open Access Journals (Sweden)

    Eswaramoorthi. R


    Full Text Available Network wide communication is an essential criterion for all wireless sensor networks, to transmit the collected data from environment to base station (sink node in an efficient way. The wide network coverage is provided by constructing Mobile Backbone Networks (MBN, which are dynamic networks. These networks have two types of nodes. They are Mobile backbone nodes and Regular nodes. The Mobile backbone nodes have superior mobility and communication capability than regular nodes. All the information needs to be routed through mobile backbone nodes to regular nodes. The communication between clusters is done through backbone node so that transmission overhead is less. In this paper, we are mainly concentrates on throughput optimization and assigning new regular nodes. First the throughput range is calculated for each cluster, and then data packets are transmitted in such a way that the calculated range of throughput for each cluster is satisfied. The number of regular nodes that can be successfully assigned to mobile backbone nodes can be improved by means of adopting network design formulation technique. In case of any failure of mobile backbone node ,new cluster head is elected based on high energy first (HEF algorithm, where the residual energy of the nodes are considered for election.

  9. Radiation safety system (RSS) backbones: Design, engineering, fabrication and installation

    Energy Technology Data Exchange (ETDEWEB)

    Wilmarth, J.E.; Sturrock, J.C.; Gallegos, F.R.


    The Radiation Safety System (RSS) Backbones are part of an electrical/electronic/mechanical system insuring safe access and exclusion of personnel to areas at the Los Alamos Neutron Science Center (LANSCE) accelerator. The RSS Backbones control the safety fusible beam plugs which terminate transmission of accelerated ion beams in response to predefined conditions. Any beam or access fault of the backbone inputs will cause insertion of the beam plugs in the low energy beam transport. The Backbones serve the function of tying the beam plugs to the access control systems, beam spill monitoring systems and current-level limiting systems. In some ways the Backbones may be thought of as a spinal column with beam plugs at the head and nerve centers along the spinal column. The two Linac Backbone segments and experimental area segments form a continuous cable plant over 3,500 feet from beam plugs to the tip on the longest tail. The Backbones were installed in compliance with current safety standards, such as installation of the two segments in separate conduits or tray. Monitoring for ground-faults and input wiring verification was an added enhancement to the system. The system has the capability to be tested remotely.

  10. Radiation safety system (RSS) backbones: Design, engineering, fabrication and installation

    International Nuclear Information System (INIS)

    The Radiation Safety System (RSS) Backbones are part of an electrical/electronic/mechanical system insuring safe access and exclusion of personnel to areas at the Los Alamos Neutron Science Center (LANSCE) accelerator. The RSS Backbones control the safety fusible beam plugs which terminate transmission of accelerated ion beams in response to predefined conditions. Any beam or access fault of the backbone inputs will cause insertion of the beam plugs in the low energy beam transport. The Backbones serve the function of tying the beam plugs to the access control systems, beam spill monitoring systems and current-level limiting systems. In some ways the Backbones may be thought of as a spinal column with beam plugs at the head and nerve centers along the spinal column. The two Linac Backbone segments and experimental area segments form a continuous cable plant over 3,500 feet from beam plugs to the tip on the longest tail. The Backbones were installed in compliance with current safety standards, such as installation of the two segments in separate conduits or tray. Monitoring for ground-faults and input wiring verification was an added enhancement to the system. The system has the capability to be tested remotely

  11. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A.; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto


    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to

  12. Security in Packet-Switched Land Mobile Radio Backbone Networks


    Thomschutz, Hans Olaf Rutger


    Spurred by change in government regulations and to leverage lower-cost technology and services, many land mobile radio (LMR) operators have begun transitioning from circuit-switched to packet-switched backbone networks to handle their future communication needs. Due to the unique demands of packet-switched backbone networks for LMR, it may not be wise to carry over the previously implemented security methods used with circuit-switch systems or to treat an LMR backbone as a regular packet-swit...

  13. A sampling approach for protein backbone fragment conformations. (United States)

    Yu, J Y; Zhang, W


    In protein structure prediction, backbone fragment bias information can narrow down the conformational space of the whole polypeptide chain significantly. Unlike existing methods that use fragments as building blocks, the paper presents a probabilistic sampling approach for protein backbone torsion angles by modelling angular correlation of (phi, psi) with a directional statistics distribution. Given a protein sequence and secondary structure information, this method samples backbone fragments conformations by using a backtrack sampling algorithm for the hidden Markov model with multiple inputs and a single output. The proposed approach is applied to a fragment library, and some well-known structural motifs are sampled very well on the optimal path. Computational results show that the method can help to obtain native-like backbone fragments conformations. PMID:23777175


    Institute of Scientific and Technical Information of China (English)

    Yuan Yuan; Zheng Baoyu


    Wireless Mesh Networks (WMNs) are envisioned to support the wired backbone with a wireless Backbone Networks (BNet) for providing internet connectivity to large-scale areas.With a wide range of internet-oriented applications with different Quality of Service (QoS) requirement,the large-scale WMNs should have good scalability and large bandwidth.In this paper,a Load Aware Adaptive Backbone Synthesis (LAABS) algorithm is proposed to automatically balance the traffic flow in the WMNs.The BNet will dynamically split into smaller size or merge into bigger one according to statistic load information of Backbone Nodes (BNs).Simulation results show LAABS generates moderate BNet size and converges quickly,thus providing scalable and stable BNet to facilitate traffic flow.

  15. 使用Backbone JS搭建SPA

    Institute of Scientific and Technical Information of China (English)



    Backbone JSR从2010年发布以来,受到了业界的广泛关注。“豆瓣说”和“豆瓣阅读(阅读器)”是两款以它为基础框架搭建的SPA,本文将结合这两款产品,向读者介绍BackboneJS的方方面面。

  16. Side chain and backbone ordering in a polypeptide

    CERN Document Server

    Wei, Y; Hansmann, U H E


    We report results from multicanonical simulations of polyglutamic acid chains of length of ten residues. For this simple polypeptide we observe a decoupling of backbone and side-chain ordering in the folding process. While the details of the two transitions vary between the peptide in gas phase and in an implicit solvent, our results indicate that, independent of the specific surroundings, upon continuously lowering the temperature side-chain ordering occurs only after the backbone topology is completely formed.

  17. Large-scale measurement and modeling of backbone Internet traffic (United States)

    Roughan, Matthew; Gottlieb, Joel


    There is a brewing controversy in the traffic modeling community concerning how to model backbone traffic. The fundamental work on self-similarity in data traffic appears to be contradicted by recent findings that suggest that backbone traffic is smooth. The traffic analysis work to date has focused on high-quality but limited-scope packet trace measurements; this limits its applicability to high-speed backbone traffic. This paper uses more than one year's worth of SNMP traffic data covering an entire Tier 1 ISP backbone to address the question of how backbone network traffic should be modeled. Although the limitations of SNMP measurements do not permit us to comment on the fine timescale behavior of the traffic, careful analysis of the data suggests that irrespective of the variation at fine timescales, we can construct a simple traffic model that captures key features of the observed traffic. Furthermore, the model's parameters are measurable using existing network infrastructure, making this model practical in a present-day operational network. In addition to its practicality, the model verifies basic statistical multiplexing results, and thus sheds deep insight into how smooth backbone traffic really is.

  18. A Consistent Phylogenetic Backbone for the Fungi


    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt


    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen...

  19. Automated protein backbone assignment using the projection-decomposition approach

    International Nuclear Information System (INIS)

    Spectral projection experiments by NMR in conjunction with decomposition analysis have been previously introduced for the backbone assignment of proteins; various pulse sequences as well as the behaviour with low signal-to-noise or chemical shift degeneracy have been illustrated. As a guide for routine applications of this combined tool, we provide here a systematic analysis on different types of proteins using welldefined run-time parameters. As a second result of this study, the backbone assignment module SHABBA was extensively rewritten and improved. Calculations on ubiquitin yielded again fully correct and nearly complete backbone and CHβ assignments. For the 128 residue long azurin, missing assignments mostly affect Hα and Hβ. Among the remaining backbone (plus Cβ) nuclei 97.5% could be assigned with 1.0% differences to a reference. Finally, the new SHABBA algorithm was applied to projections recorded for a yeast histone protein domain at room temperature, where the protein is subject to partial unfolding: this leads to unobservable resonances (about a dozen missing signals in a normal 15N-HSQC) and extensive degeneracy among the resonances. From the clearly observable residues, 97.5% of the backbone and CHβresonances could be assigned, of which only 0.8 % showed differences to published shifts. An additional study on the protein MMP20, which exhibits spectral difficulties to an even larger extent, explores the limitations of the approach.

  20. Backbone Fragility and the Local Search Cost Peak

    CERN Document Server

    Gent, I P; Smaill, A; 10.1613/jair.711


    The local search algorithm WSat is one of the most successful algorithms for solving the satisfiability (SAT) problem. It is notably effective at solving hard Random 3-SAT instances near the so-called `satisfiability threshold', but still shows a peak in search cost near the threshold and large variations in cost over different instances. We make a number of significant contributions to the analysis of WSat on high-cost random instances, using the recently-introduced concept of the backbone of a SAT instance. The backbone is the set of literals which are entailed by an instance. We find that the number of solutions predicts the cost well for small-backbone instances but is much less relevant for the large-backbone instances which appear near the threshold and dominate in the overconstrained region. We show a very strong correlation between search cost and the Hamming distance to the nearest solution early in WSat's search. This pattern leads us to introduce a measure of the backbone fragility of an instance, ...

  1. High Performance Infiltrated Backbones for Cathode-Supported SOFC's

    DEFF Research Database (Denmark)

    Gil, Vanesa; Kammer Hansen, Kent


    The concept of using highly ionic conducting backbones with subsequent infiltration of electronically conducting particles has widely been used to develop alternative anode-supported SOFC's. In this work, the idea was to develop infiltrated backbones as an alternative design based on cathode-supported...... printed symmetrical cells. Samples with LSM/YSZ composite and YSZ backbones made with graphite+PMMA as pore formers exhibited comparable Rp values to the screen printed LSM/YSZ cathode. This route was chosen as the best to fabricate the cathode supported cells. SEM micrograph of a cathode supported cell...... with infiltrated LSM nanoparticles is shown in Fig. 1. Figure 1. Cross section of LSM infiltrated cathode supported cell. [Formula]...

  2. Adding diverse noncanonical backbones to rosetta: enabling peptidomimetic design.

    Directory of Open Access Journals (Sweden)

    Kevin Drew

    Full Text Available Peptidomimetics are classes of molecules that mimic structural and functional attributes of polypeptides. Peptidomimetic oligomers can frequently be synthesized using efficient solid phase synthesis procedures similar to peptide synthesis. Conformationally ordered peptidomimetic oligomers are finding broad applications for molecular recognition and for inhibiting protein-protein interactions. One critical limitation is the limited set of design tools for identifying oligomer sequences that can adopt desired conformations. Here, we present expansions to the ROSETTA platform that enable structure prediction and design of five non-peptidic oligomer scaffolds (noncanonical backbones, oligooxopiperazines, oligo-peptoids, [Formula: see text]-peptides, hydrogen bond surrogate helices and oligosaccharides. This work is complementary to prior additions to model noncanonical protein side chains in ROSETTA. The main purpose of our manuscript is to give a detailed description to current and future developers of how each of these noncanonical backbones was implemented. Furthermore, we provide a general outline for implementation of new backbone types not discussed here. To illustrate the utility of this approach, we describe the first tests of the ROSETTA molecular mechanics energy function in the context of oligooxopiperazines, using quantum mechanical calculations as comparison points, scanning through backbone and side chain torsion angles for a model peptidomimetic. Finally, as an example of a novel design application, we describe the automated design of an oligooxopiperazine that inhibits the p53-MDM2 protein-protein interaction. For the general biological and bioengineering community, several noncanonical backbones have been incorporated into web applications that allow users to freely and rapidly test the presented protocols ( This work helps address the peptidomimetic community's need for an automated and expandable

  3. Telehealth: the backbone of healthcare financing. (United States)

    Suleiman, Abu Bakar


    Malaysia, like many other countries faces major challenges in meeting increasing demands with limited resources. Changes in demography, life-style diseases, increasing consumer expectations, new medical technologies and rapid economic growth all fuel demand for more healthcare services. There are problems related to the distribution and delivery of healthcare services, and there is inadequate integration of healthcare delivery and continuity of care is a major concern. Resources tend to be concentrated in the very expensive hospital sector, although services would be cost-effectively and conveniently delivered at primary care level. There is no ideal healthcare system, and how healthcare is supported and organized for service delivery influences the country's social, economic and political well-being. Like many other countries, Malaysia is undergoing health reform in meeting these challenges, and is becoming more reliant on telemedicine and telehealth. PMID:15747978

  4. APPECT: An Approximate Backbone-Based Clustering Algorithm for Tags

    DEFF Research Database (Denmark)

    Zong, Yu; Xu, Guandong; Jin, Pin;


    resulting from the severe difficulty of ambiguity, redundancy and less semantic nature of tags. Clustering method is a useful tool to address the aforementioned difficulties. Most of the researches on tag clustering are directly using traditional clustering algorithms such as K-means or Hierarchical...... algorithm for Tags (APPECT). The main steps of APPECT are: (1) we execute the K-means algorithm on a tag similarity matrix for M times and collect a set of tag clustering results Z={C1,C2,…,Cm}; (2) we form the approximate backbone of Z by executing a greedy search; (3) we fix the approximate backbone as...

  5. A Consistent Phylogenetic Backbone for the Fungi (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt


    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  6. The Graphical Representation of the Digital Astronaut Physiology Backbone (United States)

    Briers, Demarcus


    This report summarizes my internship project with the NASA Digital Astronaut Project to analyze the Digital Astronaut (DA) physiology backbone model. The Digital Astronaut Project (DAP) applies integrated physiology models to support space biomedical operations, and to assist NASA researchers in closing knowledge gaps related to human physiologic responses to space flight. The DA physiology backbone is a set of integrated physiological equations and functions that model the interacting systems of the human body. The current release of the model is HumMod (Human Model) version 1.5 and was developed over forty years at the University of Mississippi Medical Center (UMMC). The physiology equations and functions are scripted in an XML schema specifically designed for physiology modeling by Dr. Thomas G. Coleman at UMMC. Currently it is difficult to examine the physiology backbone without being knowledgeable of the XML schema. While investigating and documenting the tags and algorithms used in the XML schema, I proposed a standard methodology for a graphical representation. This standard methodology may be used to transcribe graphical representations from the DA physiology backbone. In turn, the graphical representations can allow examination of the physiological functions and equations without the need to be familiar with the computer programming languages or markup languages used by DA modeling software.

  7. Determination of backbone chain direction of PDA using FFM (United States)

    Jo, Sadaharu; Okamoto, Kentaro; Takenaga, Mitsuru


    The effect of backbone chains on friction force was investigated on both Langmuir-Blodgett (LB) films of 10,12-heptacosadiynoic acid and the (0 1 0) surfaces of single crystals of 2,4-hexadiene-1,6-diol using friction force microscopy (FFM). It was observed that friction force decreased when the scanning direction was parallel to the [0 0 1] direction in both samples. Moreover, friction force decreased when the scanning direction was parallel to the crystallographic [1 0 2], [1 0 1], [1 0 0] and [1 0 1¯] directions in only the single crystals. For the LB films, the [0 0 1] direction corresponds to the backbone chain direction of 10,12-heptacosadiynoic acid. For the single crystals, both the [0 0 1] and [1 0 1] directions correspond to the backbone chain direction, and the [1 0 2], [1 0 0] and [1 0 1¯] directions correspond to the low-index crystallographic direction. In both the LB films and single crystals, the friction force was minimized when the directions of scanning and the backbone chain were parallel.

  8. Protein-Backbone Thermodynamics across the Membrane Interface. (United States)

    Bereau, Tristan; Kremer, Kurt


    The thermodynamics of insertion of a protein in a membrane depends on the fine interplay between backbone and side-chain contributions interacting with the lipid environment. Using computer simulations, we probe how different descriptions of the backbone glycyl unit affect the thermodynamics of insertion of individual residues, dipeptides, and entire transmembrane helices. Due to the lack of reference data, we first introduce an efficient methodology to estimate atomistic potential of mean force (PMF) curves from a series of representative and uncorrelated coarse-grained (CG) snapshots. We find strong discrepancies between two CG models, Martini and PLUM, against reference atomistic PMFs and experiments. Atomistic simulations suggest a weak free energy of insertion between water and a POPC membrane for the glycyl unit, in overall agreement with experimental results despite severe assumptions in our calculations. We show that refining the backbone contribution in PLUM significantly improves the PMF of insertion of the WALP16 transmembrane peptide. An improper balance between the glycyl backbone and the attached side chain will lead to energetic artifacts, rationalizing Martini's overstabilization of WALP's adsorbed interfacial state. It illustrates difficulties associated with free-energy-based parametrizations of single-residue models, as the relevant free energy of partitioning used for force-field parametrization does not arise from the entire residue but rather the solvent-accessible chemical groups. PMID:27138459

  9. Constructing Battery-Aware Virtual Backbones in Wireless Sensor Networks


    Chi Ma; Yuanyuan Yang; Zhenghao Zhang


    A critical issue in battery-powered sensor networks is to construct energy efficient virtual backbones for network routing. Recent study in battery technology reveals that batteries tend to discharge more power than needed and reimburse the over-discharged power if they are recovered. In this paper we first provide a mathematical battery model suitable for implementation in sensor networks. We then introduce the concept of battery-aware connected dominating set (BACDS) and show that in gener...

  10. Primerjava JavaScript ogrodij Angular, Backbone in Ember


    Simin, Matija


    Diplomsko delo primerja tri JavaScript ogrodja za razvoj spletnih aplikacij, in sicer AngularJS, Ember.js in Backbone.js. V okviru dela smo primerjali njihovo implementacijo MVC arhitekturnega modela ali različice le-tega. Poleg implementacije MVC arhitekturnega modela smo primerjali njihove funkcionalnosti in lastnosti, kot so sistem predlog, implementacija usmerjevalnika, komunikacija s strežnikom, podatkovne povezave, prilagodljivosti, velikost in aktivnost skupnosti, kvaliteta obstoje...

  11. Comparison of JavaScript frameworks, Angular, Backbone, and Ember


    Simin, Matija


    The thesis compares three JavaScript frameworks for developing web applications: AngularJS, Ember.js and Backbone.js. In the thesis we compared their implementation of the MVC design pattern and their subversions. Besides their implementation of MVC design pattern we compared their functionalities and features, such as templating system, routing implementation, communications with a server, data binding, adjustability, size and activity of the community, quality of existing documentation, pos...

  12. Backbone decomposition for continuous-state branching processes with immigration

    CERN Document Server

    Ren, A E Kyprianou Y-X


    In the spirit of Duqesne and Winkel (2007) and Berestycki et al. (2011) we show that supercritical continuous-state branching process with a general branching mechanism and general immigration mechanism is equal in law to a continuous-time Galton Watson process with immigration with Poissonian dressing. The result also characterises the limiting backbone decomposition which is predictable from the work on consistent growth of Galton-Watson trees with immigration in Cao and Winkel (2010).

  13. Variation of protein backbone amide resonance by electrostatic field


    Sharley, John N.


    Amide resonance is found to be sensitive to electrostatic field with component parallel or antiparallel the amide C-N bond. This effect is linear and without threshold in the biologically plausible electrostatic field range -0.005 to 0.005 au. Variation of amide resonance varies Resonance-Assisted Hydrogen Bonding such as occurs in the hydrogen bonded chains of backbone amides of protein secondary structures such as beta sheet and alpha helix, varying the stability of the secondary structure....

  14. Control of polymer-packing orientation in thin films through synthetic tailoring of backbone coplanarity

    KAUST Repository

    Chen, Mark S.


    Controlling solid-state order of π-conjugated polymers through macromolecular design is essential for achieving high electronic device performance; yet, it remains a challenge, especially with respect to polymer-packing orientation. Our work investigates the influence of backbone coplanarity on a polymer\\'s preference to pack face-on or edge-on relative to the substrate. Isoindigo-based polymers were synthesized with increasing planarity by systematically substituting thiophenes for phenyl rings in the acceptor comonomer. This increasing backbone coplanarity, supported by density functional theory (DFT) calculations of representative trimers, leads to the narrowing of polymer band gaps as characterized by ultraviolet-visible-near infrared (UV-vis-NIR) spectroscopy and cyclic voltammetry. Among the polymers studied, regiosymmetric II and TII polymers exhibited the highest hole mobilities in organic field-effect transistors (OFETs), while in organic photovoltaics (OPVs), TBII polymers that display intermediate levels of planarity provided the highest power conversion efficiencies. Upon thin-film analysis by atomic force microscropy (AFM) and grazing-incidence X-ray diffraction (GIXD), we discovered that polymer-packing orientation could be controlled by tuning polymer planarity and solubility. Highly soluble, planar polymers favor face-on orientation in thin films while the less soluble, nonplanar polymers favor an edge-on orientation. This study advances our fundamental understanding of how polymer structure influences nanostructural order and reveals a new synthetic strategy for the design of semiconducting materials with rationally engineered solid-state properties. © 2013 American Chemical Society.

  15. Design of an IPTV Multicast System for Internet Backbone Networks


    Gilbert, D.; Szymanski, T. H.


    The design of an IPTV multicast system for the Internet backbone network is presented and explored through extensive simulations. In the proposed system, a resource reservation algorithm such as RSVP, IntServ, or DiffServ is used to reserve resources (i.e., bandwidth and buffer space) in each router in an IP multicast tree. Each router uses an Input-Queued, Output-Queued, or Crosspoint-Queued switch architecture with unity speedup. A recently proposed Recursive Fair Stochastic Matrix Decompos...

  16. Performance of Flow-Aware Networking in LTE backbone

    DEFF Research Database (Denmark)

    Sniady, Aleksander; Soler, José


    According to traffic predictions, the growth in data networks usage will be increasing in the coming years, what will be especially visible in the mobile access networks. This brings new challenges in terms of traffic differentiation and network resource sharing, which need to be faced by wireless...... technologies, such as Long Term Evolution (LTE). This paper proposes usage of a modified Flow Aware Networking (FAN) technique for enhancing Quality of Service (QoS) in the all-IP transport networks underlying LTE backbone. The results obtained with OPNET Modeler show that FAN, in spite of being relatively...

  17. Synthesis of Polynucleotide Analogs Containing a Polyvinyl Alcohol Backbone

    Directory of Open Access Journals (Sweden)

    Per Carlsen


    Full Text Available Water soluble homo-base polynucleotide analogues were synthesized in whichpolyvinyl alcohol and partially phosphonated polyvinyl alcohol constituted the backbones,onto which were grafted uracil or adenine via 1,3-dioxane spacers formed by acetalformation with the 1,3-diol moieties in PVA. The resulting adenine-PVA polynucleotideanalogs exhibited hyperchromic effects, which was not the case for the correspondinguracil compounds. Mixtures of the adenine- and aracil PVA-phosphate polynucleotideanalogs in solutions exhibited characteristic S-shaped UV-absorbance vs temperature andmelting curves with melting points at approximately 40 oC.

  18. Application of Multicast-based Video Conference on CERNET Backbone

    Institute of Scientific and Technical Information of China (English)


    Multicast-based video conference is a representative application in advanced network. In multi-point video conference using multicast can get better efficiency facilitated by inner-group broadcast mechanism. In the application, the multicast-based network resources assignment, management and security should be considered together. This paper presents a framework model of multicast-based video conferencing application with three layers. And a practical multicast-based video conferencing is implemented in CERNET(China Education and Research Network) backbone. The practice is valuable for the development of multicast-based video conferencing application in China.

  19. Constructing Battery-Aware Virtual Backbones in Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Chi Ma


    Full Text Available A critical issue in battery-powered sensor networks is to construct energy efficient virtual backbones for network routing. Recent study in battery technology reveals that batteries tend to discharge more power than needed and reimburse the over-discharged power if they are recovered. In this paper we first provide a mathematical battery model suitable for implementation in sensor networks. We then introduce the concept of battery-aware connected dominating set (BACDS and show that in general the minimum BACDS (MBACDS can achieve longer lifetime than the previous backbone structures. Then we show that finding a MBACDS is NP-hard and give a distributed approximation algorithm to construct the BACDS. The resulting BACDS constructed by our algorithm is at most (8+Δopt size, where Δ is the maximum node degree and opt is the size of an optimal BACDS. Simulation results show that the BACDS can save a significant amount of energy and achieve up to 30% longer network lifetime than previous schemes.

  20. Long-term forecasting of internet backbone traffic. (United States)

    Papagiannaki, Konstantina; Taft, Nina; Zhang, Zhi-Li; Diot, Christophe


    We introduce a methodology to predict when and where link additions/upgrades have to take place in an Internet protocol (IP) backbone network. Using simple network management protocol (SNMP) statistics, collected continuously since 1999, we compute aggregate demand between any two adjacent points of presence (PoPs) and look at its evolution at time scales larger than 1 h. We show that IP backbone traffic exhibits visible long term trends, strong periodicities, and variability at multiple time scales. Our methodology relies on the wavelet multiresolution analysis (MRA) and linear time series models. Using wavelet MRA, we smooth the collected measurements until we identify the overall long-term trend. The fluctuations around the obtained trend are further analyzed at multiple time scales. We show that the largest amount of variability in the original signal is due to its fluctuations at the 12-h time scale. We model inter-PoP aggregate demand as a multiple linear regression model, consisting of the two identified components. We show that this model accounts for 98% of the total energy in the original signal, while explaining 90% of its variance. Weekly approximations of those components can be accurately modeled with low-order autoregressive integrated moving average (ARIMA) models. We show that forecasting the long term trend and the fluctuations of the traffic at the 12-h time scale yields accurate estimates for at least 6 months in the future. PMID:16252820

  1. Reconstruction of the Sunspot Group Number: the Backbone Method

    CERN Document Server

    Svalgaard, Leif


    We have reconstructed the sunspot group count, not by comparisons with other reconstructions and correcting those where they were deemed to be deficient, but by a re-assessment of original sources. The resulting series is a pure solar index and does not rely on input from other proxies, e.g. radionuclides, auroral sightings, or geomagnetic records. 'Backboning' the data sets, our chosen method, provides substance and rigidity by using long-time observers as a stiffness character. Solar activity, as defined by the Group Number, appears to reach and sustain for extended intervals of time the same level in each of the last three centuries since 1700 and the past several decades do not seem to have been exceptionally active, contrary to what is often claimed.

  2. Variation of protein backbone amide resonance by electrostatic field

    CERN Document Server

    Sharley, John N


    Amide resonance is found to be sensitive to electrostatic field with component parallel or antiparallel the amide C-N bond. This effect is linear and without threshold in the biologically plausible electrostatic field range -0.005 to 0.005 au. Variation of amide resonance varies Resonance Assisted Hydrogen Bonding such as occurs in the hydrogen bonded chains of backbone amides of protein secondary structures such as beta sheet and non-polyproline helix such as alpha helix, varying the stability of the secondary structure. The electrostatic properties including permittivity of amino acid residue sidegroups influence the electrostatic field component parallel or antiparallel the C-N bond of each amide. The significance of this factor relative to other factors in protein folding depends on the magnitude of electrostatic field component parallel or antiparallel the C-N bond of each amide, and preliminary protein-scale calculations of the magnitude of these components suggest this factor warrants investigation in ...

  3. Design of an IPTV Multicast System for Internet Backbone Networks

    Directory of Open Access Journals (Sweden)

    D. Gilbert


    Full Text Available The design of an IPTV multicast system for the Internet backbone network is presented and explored through extensive simulations. In the proposed system, a resource reservation algorithm such as RSVP, IntServ, or DiffServ is used to reserve resources (i.e., bandwidth and buffer space in each router in an IP multicast tree. Each router uses an Input-Queued, Output-Queued, or Crosspoint-Queued switch architecture with unity speedup. A recently proposed Recursive Fair Stochastic Matrix Decomposition algorithm used to compute near-perfect transmission schedules for each IP router. The IPTV traffic is shaped at the sources using Application-Specific Token Bucker Traffic Shapers, to limit the burstiness of incoming network traffic. The IPTV traffic is shaped at the destinations using Application-Specific Playback Queues, to remove residual network jitter and reconstruct the original bursty IPTV video streams at each destination. All IPTV traffic flows are regenerated at the destinations with essentially zero delay jitter and essentially-perfect QoS. The destination nodes deliver the IPTV streams to the ultimate end users using the same IPTV multicast system over a regional Metropolitan Area Network. It is shown that all IPTV traffic is delivered with essentially-perfect end-to-end QoS, with deterministic bounds on the maximum delay and jitter on each video frame. Detailed simulations of an IPTV distribution system, multicasting several hundred high-definition IPTV video streams over several essentially saturated IP backbone networks are presented.

  4. Backbone dynamics of the human CC-chemokine eotaxin

    International Nuclear Information System (INIS)

    Eotaxin is a CC chemokine with potent chemoattractant activity towards eosinophils. 15N NMR relaxation data have been used to characterize the backbone dynamics of recombinant human eotaxin. 15N longitudinal (R1) and transverse (R2) auto relaxation rates, heteronuclear 1H-15N steady-state NOEs, and transverse cross-relaxation rates (ηxy) were obtained at 30 deg. C for all resolved backbone secondary amide groups using 1 H-detected two-dimensional NMR experiments. Ratios of transverse auto and cross relaxation rates were used to identify NH groups influenced by slow conformational rearrangement. Relaxation data were fit to the extended model free dynamics formalism, yielding parameters describing axially symmetric molecular rotational diffusion and the internal dynamics of each NH group. The molecular rotational correlation time (τm) is 5.09±0.02 ns, indicating that eotaxin exists predominantly as a monomer under the conditions of the NMR study. The ratio of diffusion rates about unique and perpendicular axes (Dparallel/Dperpendicular) is 0.81±0.02. Residues with large amplitudes of subnanosecond motion are clustered in the N-terminal region (residues 1-19), the C-terminus (residues 68-73) and the loop connecting the first two β-strands (residues 30-37). N-terminal flexibility appears to be conserved throughout the chemokine family and may have implications for the mechanism of chemokine receptor activation. Residues exhibiting significant dynamics on the microsecond-millisecond time scale are located close to the two conserved disulfide bonds, suggesting that these motions may be coupled to disulfide bond isomerization

  5. Controlled Conjugated Backbone Twisting for an Increased Open-Circuit Voltage while Having a High Short-Circuit Current in Poly(hexylthiophene) Derivatives

    KAUST Repository

    Ko, Sangwon


    Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone-due to an increase in the polymer ionization potential-while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2′:5′,2′′- terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C 71-butyric acid methyl ester (PC 71BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current. © 2012 American

  6. A New Secondary Structure Assignment Algorithm Using Cα Backbone Fragments. (United States)

    Cao, Chen; Wang, Guishen; Liu, An; Xu, Shutan; Wang, Lincong; Zou, Shuxue


    The assignment of secondary structure elements in proteins is a key step in the analysis of their structures and functions. We have developed an algorithm, SACF (secondary structure assignment based on Cα fragments), for secondary structure element (SSE) assignment based on the alignment of Cα backbone fragments with central poses derived by clustering known SSE fragments. The assignment algorithm consists of three steps: First, the outlier fragments on known SSEs are detected. Next, the remaining fragments are clustered to obtain the central fragments for each cluster. Finally, the central fragments are used as a template to make assignments. Following a large-scale comparison of 11 secondary structure assignment methods, SACF, KAKSI and PROSS are found to have similar agreement with DSSP, while PCASSO agrees with DSSP best. SACF and PCASSO show preference to reducing residues in N and C cap regions, whereas KAKSI, P-SEA and SEGNO tend to add residues to the terminals when DSSP assignment is taken as standard. Moreover, our algorithm is able to assign subtle helices (310-helix, π-helix and left-handed helix) and make uniform assignments, as well as to detect rare SSEs in β-sheets or long helices as outlier fragments from other programs. The structural uniformity should be useful for protein structure classification and prediction, while outlier fragments underlie the structure-function relationship. PMID:26978354

  7. Solid state radiation chemistry of the DNA backbone

    International Nuclear Information System (INIS)

    The long term goal of this program is to determine the fundamental rules needed to predict the type and yield of damage produced in DNA due to direct effects of ionizing radiation. The focus is on damage to the sugar-phosphate backbone, damage that would lead to strand breaks. Model systems have been chosen that permit various aspects of this problem to be investigated. The emphasis will be on single crystals of monosaccharides, nucleosides, and nucleotides but will also include some powder work on polynucleotides. In these model systems, free radical products and reactions are observed by electron spin resonance (ESR) and electron nuclear double resonance (ENDOR) techniques. The information thus gained is used in constructing rules that predict what primary free radicals are formed in single crystals of model compounds and the reactions stemming from the primary radicals. The formulation of a set of rules that work in model systems will represent a major advance toward formulating a set of rules that predict the direct damage in DNA itself. In a broader context this program is part of the effort to understand and predict the effects of exposure to ionizing radiation received at low dose rates over long periods of time. Assessment of low dose effects requires a basic understanding of the action of radiation at the molecular level. By contributing to that basic understanding, this program will help solve the problems of risk assessment under low dose conditions. 5 refs., 3 figs

  8. Backbone of complex networks of corporations: The flow of control (United States)

    Glattfelder, J. B.; Battiston, S.


    We present a methodology to extract the backbone of complex networks based on the weight and direction of links, as well as on nontopological properties of nodes. We show how the methodology can be applied in general to networks in which mass or energy is flowing along the links. In particular, the procedure enables us to address important questions in economics, namely, how control and wealth are structured and concentrated across national markets. We report on the first cross-country investigation of ownership networks, focusing on the stock markets of 48 countries around the world. On the one hand, our analysis confirms results expected on the basis of the literature on corporate control, namely, that in Anglo-Saxon countries control tends to be dispersed among numerous shareholders. On the other hand, it also reveals that in the same countries, control is found to be highly concentrated at the global level, namely, lying in the hands of very few important shareholders. Interestingly, the exact opposite is observed for European countries. These results have previously not been reported as they are not observable without the kind of network analysis developed here.

  9. Data acquisition backbone core DABC release v1.0

    International Nuclear Information System (INIS)

    The new experiments at FAIR require new concepts of data acquisition systems for the distribution of self-triggered, time stamped data streams over high performance networks for event building. The Data Acquisition Backbone Core (DABC) is a general purpose software framework developed for the implementation of such data acquisition systems. A DABC application consists of functional components like data input, combiner, scheduler, event builder, filter, analysis and storage which can be configured at runtime. Application specific code including the support of all kinds of data channels (front-end systems) is implemented by C++ program plug-ins. DABC is also well suited as environment for various detector and readout components test beds. A set of DABC plug-ins has been developed for the FAIR experiment CBM (Compressed Baryonic Matter) at GSI. This DABC application is used as DAQ system for test beamtimes. Front-end boards equipped with n-XYTER ASICs and ADCs are connected to read-out controller boards (ROC). From there the data is sent over Ethernet (UDP), or over optics and PCIe interface cards into Linux PCs. DABC does the controlling, event building, archiving and data serving. The first release of DABC was published in 2009 and is available under GPL license.

  10. Resistance issues with new nucleoside/nucleotide backbone options. (United States)

    Wainberg, Mark A; Turner, Dan


    The nucleoside and nucleotide reverse transcriptase inhibitors (NRTIs/NtRTIs) remain an enduring feature of combination therapy. As NRTI/NtRTI options continue to expand, questions arise about how best to combine these agents to create effective dual NRTI/NtRTI backbones in antiretroviral regimens while avoiding treatment-emergent drug resistance. Clinicians must consider how NRTIs/NtRTIs such as tenofovir DF (TDF), abacavir (ABC), and emtricitabine (FTC), as well as new once-daily and coformulated NRTIs/NtRTIs, interact with older agents when combined in novel regimens and how sequencing the new NRTIs can preserve future treatment options. Resistance data from clinical trials have revealed important information on the patterns, prevalence, and effects of resistance seen among patients experiencing virologic failure. In recent years, the prevalence of some mutations such as M184V and Q151M has remained relatively constant, while the L74V mutation, the 69 insertions, and thymidine analogue mutations have decreased in prevalence. Other mutations such as K65R and Y115F, while still relatively uncommon, are increasing in prevalence. This increase may be due to the use of new treatment combinations that select for these mutations at a higher rate. Clinical trials suggest that new regimens containing TDF or ABC select for K65R and that this mutation is observed more frequently with TDF; in contrast, L74V is observed more frequently in ABC-containing regimens but is not commonly selected by TDF-containing regimens. Several lines of evidence are converging to suggest that the presence of zidovudine may decrease the risk of L74V and K65R in ABC- or TDF-containing regimens. This review summarizes the clinical implications of resistance profiles associated with new NRTI/NtRTI regimens in current use and in advanced clinical studies. PMID:15319668

  11. Pseudo 5D HN(C)N Experiment to Facilitate the Assignment of Backbone Resonances in Proteins Exhibiting High Backbone Shift Degeneracy

    CERN Document Server

    Kumar, Dinesh; Shukla, Vaibhav Kumar; Pandey, Himanshu; Arora, Ashish; Guleria, Anupam


    Assignment of protein backbone resonances is most routinely carried out using triple resonance three dimensional NMR experiments involving amide 1H and 15N resonances. However for intrinsically unstructured proteins, alpha-helical proteins or proteins containing several disordered fragments, the assignment becomes problematic because of high degree of backbone shift degeneracy. In this backdrop, a novel reduced dimensionality (RD) experiment -(5,3)D-hNCO-CANH- is presented to facilitate (and/or to validate) the sequential backbone resonance assignment in such proteins. The proposed 3D NMR experiment makes use of the modulated amide 15N chemical shifts (resulting from the joint sampling along both its indirect dimensions) to resolve the ambiguity involved in connecting the neighboring amide resonances (i.e. HiNi and Hi-1Ni-1) for overlapping amide NH peaks. The experiment -encoding 5D spectral information- leads to a conventional 3D spectrum with significantly reduced spectral crowding and complexity. The impr...

  12. A transfer matrix for the backbone exponent of two-dimensional percolation

    International Nuclear Information System (INIS)

    Rephrasing the backbone of two-dimensional percolation as a monochromatic path crossing problem, we investigate the latter by a transfer matrix approach. Conformal invariance links the backbone dimension Db to the highest eigenvalue of the transfer matrix T, and we obtain the result Db=1.6431±0.0006. For a strip of width L, T is roughly of size 23L, but we manage to reduce it to ∼L!. We find that the value of Db is stable with respect to inclusion of additional 'blobs' tangent to the backbone in a finite number of points. (author)

  13. A synthetic HIV-1 subtype C backbone generates comparable PR and RT resistance profiles to a subtype B backbone in a recombinant virus assay.

    Directory of Open Access Journals (Sweden)

    David Nauwelaers

    Full Text Available In order to determine phenotypic protease and reverse transcriptase inhibitor-associated resistance in HIV subtype C virus, we have synthetically constructed an HIV-1 subtype C (HIV-1-C viral backbone for use in a recombinant virus assay. The in silico designed viral genome was divided into 4 fragments, which were chemically synthesized and joined together by conventional subcloning. Subsequently, gag-protease-reverse-transcriptase (GPRT fragments from 8 HIV-1 subtype C-infected patient samples were RT-PCR-amplified and cloned into the HIV-1-C backbone (deleted for GPRT using In-Fusion reagents. Recombinant viruses (1 to 5 per patient sample were produced in MT4-eGFP cells where cyto-pathogenic effect (CPE, p24 and Viral Load (VL were monitored. The resulting HIV-1-C recombinant virus stocks (RVS were added to MT4-eGFP cells in the presence of serial dilutions of antiretroviral drugs (PI, NNRTI, NRTI to determine the fold-change in IC50 compared to the IC50 of wild-type HIV-1 virus. Additionally, viral RNA was extracted from the HIV-1-C RVS and the amplified GPRT products were used to generate recombinant virus in a subtype B backbone. Phenotypic resistance profiles in a subtype B and subtype C backbone were compared. The following observations were made: i functional, infectious HIV-1 subtype C viruses were generated, confirmed by VL and p24 measurements; ii their rate of infection was slower than viruses generated in the subtype B backbone; iii they did not produce clear CPE in MT4 cells; and iv drug resistance profiles generated in both backbones were very similar, including re-sensitizing effects like M184V on AZT.

  14. Toward High Performance n-Type Thermoelectric Materials by Rational Modification of BDPPV Backbones. (United States)

    Shi, Ke; Zhang, Fengjiao; Di, Chong-An; Yan, Tian-Wei; Zou, Ye; Zhou, Xu; Zhu, Daoben; Wang, Jie-Yu; Pei, Jian


    Three n-type polymers BDPPV, ClBDPPV, and FBDPPV which exhibit outstanding electrical conductivities when mixed with an n-type dopant, N-DMBI ((4-(1,3-dimethyl-2,3-dihydro-1H-benzoimidazol-2-yl)phenyl)dimethylamine), in solution. High electron mobility and an efficient doping process endow FBDPPV with the highest electrical conductivities of 14 S cm(-1) and power factors up to 28 μW m(-1) K(-2), which is the highest thermoelectric (TE) power factor that has been reported for solution processable n-type conjugated polymers. Our investigations reveal that introduction of halogen atoms to the polymer backbones has a dramatic influence on not only the electron mobilities but also the doping levels, both of which are critical to the electrical conductivities. This work suggests the significance of rational modification of polymer structures and opens the gate for applying the rapidly developed organic semiconductors with high carrier mobilities to thermoelectric field. PMID:25997085

  15. Dependence of crystallite formation and preferential backbone orientations on the side chain pattern in PBDTTPD polymers

    KAUST Repository

    El Labban, Abdulrahman


    (Figure Presented) Alkyl substituents appended to the π-conjugated main chain account for the solution-processability and film-forming properties of most π-conjugated polymers for organic electronic device applications, including field-effect transistors (FETs) and bulk-heterojunction (BHJ) solar cells. Beyond film-forming properties, recent work has emphasized the determining role that side-chain substituents play on polymer self-assembly and thin-film nanostructural order, and, in turn, on device performance. However, the factors that determine polymer crystallite orientation in thin-films, implying preferential backbone orientation relative to the device substrate, are a matter of some debate, and these structural changes remain difficult to anticipate. In this report, we show how systematic changes in the side-chain pattern of poly(benzo[1,2-b:4,5-b′]dithiophene-alt-thieno[3,4-c]pyrrole-4,6-dione) (PBDTTPD) polymers can (i) influence the propensity of the polymer to order in the π-stacking direction, and (ii) direct the preferential orientation of the polymer crystallites in thin films (e.g., "face-on" vs "edge-on"). Oriented crystallites, specifically crystallites that are well-ordered in the π-stacking direction, are believed to be a key contributor to improved thin-film device performance in both FETs and BHJ solar cells.

  16. Increasing Sequence Diversity with Flexible Backbone Protein Design: The Complete Redesign of a Protein Hydrophobic Core

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, Grant S.; Mills, Jeffrey L.; Miley, Michael J.; Machius, Mischa; Szyperski, Thomas; Kuhlman, Brian (UNC); (Buffalo)


    Protein design tests our understanding of protein stability and structure. Successful design methods should allow the exploration of sequence space not found in nature. However, when redesigning naturally occurring protein structures, most fixed backbone design algorithms return amino acid sequences that share strong sequence identity with wild-type sequences, especially in the protein core. This behavior places a restriction on functional space that can be explored and is not consistent with observations from nature, where sequences of low identity have similar structures. Here, we allow backbone flexibility during design to mutate every position in the core (38 residues) of a four-helix bundle protein. Only small perturbations to the backbone, 12 {angstrom}, were needed to entirely mutate the core. The redesigned protein, DRNN, is exceptionally stable (melting point >140C). An NMR and X-ray crystal structure show that the side chains and backbone were accurately modeled (all-atom RMSD = 1.3 {angstrom}).

  17. Polyolefin Backbone Substitution in Binders for Low Temperature Powder Injection Moulding Feedstocks


    Berenika Hausnerova; Ivo Kuritka; Davit Bleyan


    This paper reports the substitution of polyolefin backbone binder components with low melting temperature carnauba wax for powder injection moulding applications. The effect of various binder compositions of Al2O3 feedstock on thermal degradation parameters is investigated by thermogravimetric analysis. Within the experimental framework 29 original feedstock compositions were prepared and the superiority of carnauba wax over the polyethylene binder backbone was demonstrated in compositions co...

  18. Elucidating the backbone conformation of photoswitchable foldamers using vibrational circular dichroism


    Domingos, S.R.; Roeters, S.J.; Amirjalayer, S.; Yu, Z.L.; Hecht, S; Woutersen, S.


    The backbone conformation of amphiphilic oligo(azobenzene) foldamers is investigated using vibrational circular dichroism (VCD) spectroscopy on a mode involving the stretching of the N=N bonds in the backbone. From denaturation experiments, we find that the VCD response in the helical conformation arises mainly from through-space interaction between the N=N-stretch transition-dipole moments, so that the coupled-oscillator model can be used to predict the VCD spectrum associated with a particu...

  19. Pseudo 5D HN(C)N experiment to facilitate the assignment of backbone resonances in proteins exhibiting high backbone shift degeneracy

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Dinesh, E-mail: [Centre of Biomedical Research (CBMR), SGPGIMS Campus, Raibareli Road, Lucknow 226014 (India); Raikwal, Nisha [Centre of Biomedical Research (CBMR), SGPGIMS Campus, Raibareli Road, Lucknow 226014 (India); Shukla, Vaibhav Kumar; Pandey, Himanshu; Arora, Ashish [Molecular and Structural Biology Division, CSIR, Central Drug Research Institute, Lucknow 226031 (India); Guleria, Anupam, E-mail: [Centre of Biomedical Research (CBMR), SGPGIMS Campus, Raibareli Road, Lucknow 226014 (India)


    Graphical abstract: - Highlights: • A reduced dimensionality experiment – referred as pseudo 5D HN(C)N- is presented. • Encodes highly resolved 5D spectral information in a 3D spectrum. • Superior in terms of peak dispersion. • Facilitates assignment of crowded HSQC spectra of moderately sized proteins. • Modulated {sup 15}N chemical shifts are used to break the amide shift degeneracy. - Abstract: Assignment of protein backbone resonances is most routinely carried out using triple resonance three-dimensional NMR experiments involving amide {sup 1}H/{sup 15}N resonances. However for intrinsically unstructured proteins, alpha-helical proteins or proteins containing several disordered fragments, the assignment becomes problematic because of high-degree of backbone shift degeneracy. In this backdrop, a novel reduced-dimensionality (RD) experiment –(5, 3)D-hNCO-CANH- is presented to facilitate/validate the sequential backbone resonance assignment in such proteins. The proposed 3D NMR experiment makes use of the modulated amide {sup 15}N chemical shifts (resulting from the joint sampling along both its indirect dimensions) to resolve the ambiguity involved in connecting the neighboring amide resonances (i.e. H{sub i}N{sub i} and H{sub i−1}N{sub i−1}) for overlapping amide-NH peaks. The experiment -in combination with routine triple resonance 3D-NMR experiments involving backbone amide ({sup 1}H/{sup 15}N) and carbon ({sup 13}C{sup α}/{sup 13}C′) chemical shifts- will serve as a powerful complementary tool to achieve the nearly complete assignment of protein backbone resonances in a time efficient manner.

  20. Quantification of protein backbone hydrogen-deuterium exchange rates by solid state NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Lopez del Amo, Juan-Miguel; Fink, Uwe; Reif, Bernd, E-mail: reif@tum.d [Leibniz-Institut fuer Molekulare Pharmakologie (FMP) (Germany)


    We present the quantification of backbone amide hydrogen-deuterium exchange rates (HDX) for immobilized proteins. The experiments make use of the deuterium isotope effect on the amide nitrogen chemical shift, as well as on proton dilution by deuteration. We find that backbone amides in the microcrystalline {alpha}-spectrin SH3 domain exchange rather slowly with the solvent (with exchange rates negligible within the individual {sup 15}N-T{sub 1} timescales). We observed chemical exchange for 6 residues with HDX exchange rates in the range from 0.2 to 5 s{sup -1}. Backbone amide {sup 15}N longitudinal relaxation times that we determined previously are not significantly affected for most residues, yielding no systematic artifacts upon quantification of backbone dynamics (Chevelkov et al. 2008b). Significant exchange was observed for the backbone amides of R21, S36 and K60, as well as for the sidechain amides of N38, N35 and for W41{epsilon}. These residues could not be fit in our previous motional analysis, demonstrating that amide proton chemical exchange needs to be considered in the analysis of protein dynamics in the solid-state, in case D{sub 2}O is employed as a solvent for sample preparation. Due to the intrinsically long {sup 15}N relaxation times in the solid-state, the approach proposed here can expand the range of accessible HDX rates in the intermediate regime that is not accessible so far with exchange quench and MEXICO type experiments.

  1. Poly(meta-phenylene) Derivative with Rigid Twisted Biphenyl Units in Backbone: Synthesis, Structural Characterization,Photophysical Properties and Electroluminescence

    Institute of Scientific and Technical Information of China (English)

    ZHENG Yan; YANG Bing; ZHANG Hai-quan; LU Ping; SHEN Fang-zhong; LIU Lin-lin; XU Hai; YANG Guang-di; MA Yu-guang


    A soluble poly(meta-phenylene) derivative with rigid twisted biphenyl unit was synthesized by the Yamamoto coupling reaction. The polymer is soluble in common organic solvents, and the number-average molecular weight is about 6500. The UV-Vis and quantum chemical calculation indicate that the different conformation segments named "conformers" exist in the polymer backbones; it was also further confirmed by the single crystal X-ray diffraction study of the dimeric model compound. The π-π* transition of biphenyl segments of twisted and planar conformations made the polymer exhibit a strong absorption around 256 nm and a weak absorption at about 300 nm. Furthermore,the polymer exhibits a strong UV photoluminescence at 372 nm when the excitation wavelengths are longer than 300 nm. The ultraviolet-emitting electroluminescence(EL) device with the single layer structure shows EL λmax of the derivative at 370 nm.

  2. Integrated Data as backbone of e-Navigation


    Michael Bergmann


    e-Navigation, a theme introduced but IMO to improve safety of navigation at sea, is starting to gain traction in various organizations. As the concept develops, the importance of data, both static as well as dynamic, is more and more realized. IALA and IHO, in their efforts to help making e-Navigation a reality, have agreed to propose the IHO GI Register (often known as S-100 Register) as the conceptual basis for the Common Maritime Data Structure (CMDS). Utilizing this common understanding o...

  3. A transfer matrix for the backbone exponent of two-dimensional percolation

    Energy Technology Data Exchange (ETDEWEB)

    Jacobsen, Jesper Lykke; Zinn-Justin, Paul [Laboratoire de Physique Theorique et Modeles Statistiques, Universite Paris-Sud, Orsay (France)


    Rephrasing the backbone of two-dimensional percolation as a monochromatic path crossing problem, we investigate the latter by a transfer matrix approach. Conformal invariance links the backbone dimension D{sub b} to the highest eigenvalue of the transfer matrix T, and we obtain the result D{sub b}=1.6431{+-}0.0006. For a strip of width L, T is roughly of size 2{sup 3L}, but we manage to reduce it to {approx}L{exclamation_point}. We find that the value of D{sub b} is stable with respect to inclusion of additional 'blobs' tangent to the backbone in a finite number of points. (author)

  4. Mnn10 Maintains Pathogenicity in Candida albicans by Extending α-1,6-Mannose Backbone to Evade Host Dectin-1 Mediated Antifungal Immunity. (United States)

    Zhang, Shi Qun; Zou, Zui; Shen, Hui; Shen, Shuai Shuai; Miao, Qi; Huang, Xin; Liu, Wei; Li, Li Ping; Chen, Si Min; Yan, Lan; Zhang, Jun Dong; Zhao, Jing Jun; Xu, Guo Tong; An, Mao Mao; Jiang, Yuan Ying


    The cell wall is a dynamic structure that is important for the pathogenicity of Candida albicans. Mannan, which is located in the outermost layer of the cell wall, has been shown to contribute to the pathogenesis of C. albicans, however, the molecular mechanism by which this occurs remains unclear. Here we identified a novel α-1,6-mannosyltransferase encoded by MNN10 in C. albicans. We found that Mnn10 is required for cell wall α-1,6-mannose backbone biosynthesis and polysaccharides organization. Deletion of MNN10 resulted in significant attenuation of the pathogenesis of C. albicans in a murine systemic candidiasis model. Inhibition of α-1,6-mannose backbone extension did not, however, impact the invasive ability of C. albicans in vitro. Notably, mnn10 mutant restored the invasive capacity in athymic nude mice, which further supports the notion of an enhanced host antifungal defense related to this backbone change. Mnn10 mutant induced enhanced Th1 and Th17 cell mediated antifungal immunity, and resulted in enhanced recruitment of neutrophils and monocytes for pathogen clearance in vivo. We also demonstrated that MNN10 could unmask the surface β-(1,3)-glucan, a crucial pathogen-associated molecular pattern (PAMP) of C. albicans recognized by host Dectin-1. Our results demonstrate that mnn10 mutant could stimulate an enhanced Dectin-1 dependent immune response of macrophages in vitro, including the activation of nuclear factor-κB, mitogen-activated protein kinase pathways, and secretion of specific cytokines such as TNF-α, IL-6, IL-1β and IL-12p40. In summary, our study indicated that α-1,6-mannose backbone is critical for the pathogenesis of C. albicans via shielding β-glucan from recognition by host Dectin-1 mediated immune recognition. Moreover, our work suggests that inhibition of α-1,6-mannose extension by Mnn10 may represent a novel modality to reduce the pathogenicity of C. albicans. PMID:27144456

  5. Mnn10 Maintains Pathogenicity in Candida albicans by Extending α-1,6-Mannose Backbone to Evade Host Dectin-1 Mediated Antifungal Immunity.

    Directory of Open Access Journals (Sweden)

    Shi Qun Zhang


    Full Text Available The cell wall is a dynamic structure that is important for the pathogenicity of Candida albicans. Mannan, which is located in the outermost layer of the cell wall, has been shown to contribute to the pathogenesis of C. albicans, however, the molecular mechanism by which this occurs remains unclear. Here we identified a novel α-1,6-mannosyltransferase encoded by MNN10 in C. albicans. We found that Mnn10 is required for cell wall α-1,6-mannose backbone biosynthesis and polysaccharides organization. Deletion of MNN10 resulted in significant attenuation of the pathogenesis of C. albicans in a murine systemic candidiasis model. Inhibition of α-1,6-mannose backbone extension did not, however, impact the invasive ability of C. albicans in vitro. Notably, mnn10 mutant restored the invasive capacity in athymic nude mice, which further supports the notion of an enhanced host antifungal defense related to this backbone change. Mnn10 mutant induced enhanced Th1 and Th17 cell mediated antifungal immunity, and resulted in enhanced recruitment of neutrophils and monocytes for pathogen clearance in vivo. We also demonstrated that MNN10 could unmask the surface β-(1,3-glucan, a crucial pathogen-associated molecular pattern (PAMP of C. albicans recognized by host Dectin-1. Our results demonstrate that mnn10 mutant could stimulate an enhanced Dectin-1 dependent immune response of macrophages in vitro, including the activation of nuclear factor-κB, mitogen-activated protein kinase pathways, and secretion of specific cytokines such as TNF-α, IL-6, IL-1β and IL-12p40. In summary, our study indicated that α-1,6-mannose backbone is critical for the pathogenesis of C. albicans via shielding β-glucan from recognition by host Dectin-1 mediated immune recognition. Moreover, our work suggests that inhibition of α-1,6-mannose extension by Mnn10 may represent a novel modality to reduce the pathogenicity of C. albicans.

  6. Mnn10 Maintains Pathogenicity in Candida albicans by Extending α-1,6-Mannose Backbone to Evade Host Dectin-1 Mediated Antifungal Immunity (United States)

    Zhang, Shi Qun; Zou, Zui; Shen, Hui; Shen, Shuai Shuai; Miao, Qi; Huang, Xin; Liu, Wei; Li, Li Ping; Chen, Si Min; Yan, Lan; Zhang, Jun Dong; Zhao, Jing Jun; Xu, Guo Tong; An, Mao Mao; Jiang, Yuan Ying


    The cell wall is a dynamic structure that is important for the pathogenicity of Candida albicans. Mannan, which is located in the outermost layer of the cell wall, has been shown to contribute to the pathogenesis of C. albicans, however, the molecular mechanism by which this occurs remains unclear. Here we identified a novel α-1,6-mannosyltransferase encoded by MNN10 in C. albicans. We found that Mnn10 is required for cell wall α-1,6-mannose backbone biosynthesis and polysaccharides organization. Deletion of MNN10 resulted in significant attenuation of the pathogenesis of C. albicans in a murine systemic candidiasis model. Inhibition of α-1,6-mannose backbone extension did not, however, impact the invasive ability of C. albicans in vitro. Notably, mnn10 mutant restored the invasive capacity in athymic nude mice, which further supports the notion of an enhanced host antifungal defense related to this backbone change. Mnn10 mutant induced enhanced Th1 and Th17 cell mediated antifungal immunity, and resulted in enhanced recruitment of neutrophils and monocytes for pathogen clearance in vivo. We also demonstrated that MNN10 could unmask the surface β-(1,3)-glucan, a crucial pathogen-associated molecular pattern (PAMP) of C. albicans recognized by host Dectin-1. Our results demonstrate that mnn10 mutant could stimulate an enhanced Dectin-1 dependent immune response of macrophages in vitro, including the activation of nuclear factor-κB, mitogen-activated protein kinase pathways, and secretion of specific cytokines such as TNF-α, IL-6, IL-1β and IL-12p40. In summary, our study indicated that α-1,6-mannose backbone is critical for the pathogenesis of C. albicans via shielding β-glucan from recognition by host Dectin-1 mediated immune recognition. Moreover, our work suggests that inhibition of α-1,6-mannose extension by Mnn10 may represent a novel modality to reduce the pathogenicity of C. albicans. PMID:27144456

  7. Polyolefin Backbone Substitution in Binders for Low Temperature Powder Injection Moulding Feedstocks

    Directory of Open Access Journals (Sweden)

    Berenika Hausnerova


    Full Text Available This paper reports the substitution of polyolefin backbone binder components with low melting temperature carnauba wax for powder injection moulding applications. The effect of various binder compositions of Al2O3 feedstock on thermal degradation parameters is investigated by thermogravimetric analysis. Within the experimental framework 29 original feedstock compositions were prepared and the superiority of carnauba wax over the polyethylene binder backbone was demonstrated in compositions containing polyethylene glycol as the initial opening agent and governing the proper mechanism of the degradation process. Moreover, the replacement of synthetic polymer by the natural wax contributes to an increase of environmental sustainability of modern industrial technologies.

  8. Electric field induced localization phenomena in a ladder network with superlattice configuration: Effect of backbone environment

    Directory of Open Access Journals (Sweden)

    Paramita Dutta


    Full Text Available Electric field induced localization properties of a tight-binding ladder network in presence of backbone sites are investigated. Based on Green's function formalism we numerically calculate two-terminal transport together with density of states for different arrangements of atomic sites in the ladder and its backbone. Our results lead to a possibility of getting multiple mobility edges which essentially plays a switching action between a completely opaque to fully or partly conducting region upon the variation of system Fermi energy, and thus, support in fabricating mesoscopic or DNA-based switching devices.

  9. A Transfer Matrix for the Backbone Exponent of Two-Dimensional Percolation


    Jacobsen, J. L.; Zinn-Justin, P.


    Rephrasing the backbone of two-dimensional percolation as a monochromatic path crossing problem, we investigate the latter by a transfer matrix approach. Conformal invariance links the backbone dimension D_b to the highest eigenvalue of the transfer matrix T, and we obtain the result D_b=1.6431 \\pm 0.0006. For a strip of width L, T is roughly of size 2^{3^L}, but we manage to reduce it to \\sim L!. We find that the value of D_b is stable with respect to inclusion of additional ``blobs'' tangen...

  10. Convenient and scalable synthesis of fmoc-protected Peptide nucleic Acid backbone. (United States)

    Feagin, Trevor A; Shah, Nirmal I; Heemstra, Jennifer M


    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  11. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone


    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.


    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this mo...

  12. Using Excel To Study The Relation Between Protein Dihedral Angle Omega And Backbone Length (United States)

    Shew, Christopher; Evans, Samari; Tao, Xiuping

    How to involve the uninitiated undergraduate students in computational biophysics research? We made use of Microsoft Excel to carry out calculations of bond lengths, bond angles and dihedral angles of proteins. Specifically, we studied protein backbone dihedral angle omega by examining how its distribution varies with the length of the backbone length. It turns out Excel is a respectable tool for this task. An ordinary current-day desktop or laptop can handle the calculations for midsized proteins in just seconds. Care has to be taken to enter the formulas for the spreadsheet column after column to minimize the computing load. Supported in part by NSF Grant #1238795.

  13. Integrated Data as backbone of e-Navigation

    Directory of Open Access Journals (Sweden)

    Michael Bergmann


    Full Text Available e-Navigation, a theme introduced but IMO to improve safety of navigation at sea, is starting to gain traction in various organizations. As the concept develops, the importance of data, both static as well as dynamic, is more and more realized. IALA and IHO, in their efforts to help making e-Navigation a reality, have agreed to propose the IHO GI Register (often known as S-100 Register as the conceptual basis for the Common Maritime Data Structure (CMDS. Utilizing this common understanding of key players in e-Navigation arena, the IMO e-Navigation Correspondence Group has firmed up the overarching architecture, enabling a series to test beds proving the concept of integration of various data streams to enable improved communication between the stakeholders on shore or at sea. The integration of pre-composed, expert generated navigational data with real time and semi real-time data like Virtual AtoNs, Tide Gages Data or MSI transmission from VTS into a single e-Navigation display, if correctly developed, implemented and executed, will be the enabler of increased situational awareness.

  14. Organizations

    DEFF Research Database (Denmark)

    Hatch, Mary Jo

    Most of us recognize that organizations are everywhere. You meet them on every street corner in the form of families and shops, study in them, work for them, buy from them, pay taxes to them. But have you given much thought to where they came from, what they are today, and what they might become in...... considers many more. Mary Jo Hatch introduces the concept of organizations by presenting definitions and ideas drawn from the a variety of subject areas including the physical sciences, economics, sociology, psychology, anthropology, literature, and the visual and performing arts. Drawing on examples from...... prehistory and everyday life, from the animal kingdom as well as from business, government, and other formal organizations, Hatch provides a lively and thought provoking introduction to the process of organization....

  15. Beta-scission of alkoxyl radicals on peptides and proteins can give rise to backbone cleavage and loss of side-chains

    International Nuclear Information System (INIS)

    Full text: Exposure of proteins to radicals in the presence of O2 brings about multiple changes including side-chain oxidation, backbone fragmentation, cross-linking, unfolding, changes in hydrophobicity and conformation, altered susceptibility to proteolytic enzymes and formation of new reactive groups (e.g. hydroperoxides and 3,4-dihydroxyphenylalanine). All of these processes can result in loss of structural or enzymatic activity. The mechanisms that give rise to backbone cleavage are only partly understood. Whilst it is known that direct hydrogen atom abstraction at a-carbon sites gives backbone cleavages it has also been proposed that initial attack at side-chain sites might also give rise to backbone cleavage. In this study we have examined whether initial attack at the β- (C-3) position can give rise to α-carbon radicals (and hence backbone cleavage) via the formation, and subsequent β- scission, of C-3 alkoxyl radicals. This process has been observed previously with protected amino acids in organic solvents (J. Chem. Soc. Perkin Trans. 2, 1997, 503-507) but the occurrence of such reactions with proteins in aqueous solution has not been explored. Alkoxyl radicals were generated at the C-3 position of a variety of protected amino acids and small peptides by two methods: metal-ion catalysed decomposition of hydroperoxides formed as a result of γ-radiolysis in the presence of O2, and UV photolysis of nitrate esters. In most cases radicals have been detected by EPR spectroscopy using nitroso and nitrone spin traps, which can be assigned by comparison with literature data to α-carbon radicals; in some case assignments were confirmed by the generation of the putative species by other routes. With Ala peptide hydroperoxides and nitrate esters, and MNP as the spin trap, the major radical detected in each case has been assigned to the adduct of an α-carbon radical with partial structure - NH-.CH-C(O) - consistent with the rapid occurrence of the above reaction

  16. Lactobacillus rhamnosus accelerates zebrafish backbone calcification and gonadal differentiation through effects on the GnRH and IGF systems.

    Directory of Open Access Journals (Sweden)

    Matteo A Avella

    Full Text Available Endogenous microbiota play essential roles in the host's immune system, physiology, reproduction and nutrient metabolism. We hypothesized that a continuous administration of an exogenous probiotic might also influence the host's development. Thus, we treated zebrafish from birth to sexual maturation (2-months treatment with Lactobacillus rhamnosus, a probiotic species intended for human use. We monitored for the presence of L. rhamnosus during the entire treatment. Zebrafish at 6 days post fertilization (dpf exhibited elevated gene expression levels for Insulin-like growth factors -I and -II, Peroxisome proliferator activated receptors -α and -β, VDR-α and RAR-γ when compared to untreated-10 days old zebrafish. Using a gonadotropin-releasing hormone 3 GFP transgenic zebrafish (GnRH3-GFP, higher GnRH3 expression was found at 6, 8 and 10 dpf upon L. rhamnosus treatment. The same larvae exhibited earlier backbone calcification and gonad maturation. Noteworthy in the gonad development was the presence of first testes differentiation at 3 weeks post fertilization in the treated zebrafish population -which normally occurs at 8 weeks- and a dramatic sex ratio modulation (93% females, 7% males in control vs. 55% females, 45% males in the treated group. We infer that administration of L. rhamnosus stimulated the IGF system, leading to a faster backbone calcification. Moreover we hypothesize a role for administration of L. rhamnosus on GnRH3 modulation during early larval development, which in turn affects gonadal development and sex differentiation. These findings suggest a significant role of the microbiota composition on the host organism development profile and open new perspectives in the study of probiotics usage and application.

  17. Animals without Backbones: The Invertebrate Story. Grade Level 5-9. (United States)

    Jerome, Brian; Fuqua, Paul

    This guide, when used in tandem with the videotape "Animals Without Backbones," helps students learn about invertebrates. These materials promote hands-on discovery and learning. The guide is composed of six curriculum-based teaching units: (1) "Getting Started"; (2) "Porifera"; (3) "Cnidarians"; (4) "Worms"; (5) "Mollusks"; (6) "Arthropods"; and…

  18. Quantum Chemical Benchmark Study on 46 RNA Backbone Families Using a Dinucleotide Unit

    Czech Academy of Sciences Publication Activity Database

    Kruse, H.; Mládek, Arnošt; Gkionis, Konstantinos; Hansen, A.; Grimme, S.; Šponer, Jiří


    Roč. 11, č. 10 (2015), s. 4972-4991. ISSN 1549-9618 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * DENSITY-FUNCTIONAL THEORY * SUGAR-PHOSPHATE BACKBONE Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  19. Purification, crystallization and halide phasing of a Streptococcus agalactiae backbone pilin GBS80 fragment


    Vengadesan, Krishnan; Ma, Xin; Dwivedi, Prabhat; Ton-That, Hung; Narayana, Sthanam V. L


    The C-terminal fragment of Streptococcus agalactiae (group B streptococcus) major (backbone) pilin GBS80 was purified and crystallized in two different space groups. Single-wavelength anomalous dispersion (SAD) data collected to 2.0 Å resolution on a iodide (NaI) derivative crystal using the home source were used to obtain initial phases.

  20. Treatment Results of Injuries of Thoracic and Lumbar Backbone Departments at Osteoporosis Patients

    Directory of Open Access Journals (Sweden)

    D.Y. Sumin


    Full Text Available Information relates to radiologic (computer tomography manifestations providing the visualization of thoracic and lumbar backbone department injuries at osteoporotic patients. Contemporary methods of transcutaneous and trans-pedicle vertebroplasty with bone cement allows to obtain a stable positive healing effect against such pathologies.

  1. Relative specificities of water and ammonia losses from backbone fragments in collision-activated dissociation

    DEFF Research Database (Denmark)

    Savitski, Mikhail M; Kjeldsen, Frank; Nielsen, Michael L; Zubarev, Roman A


    Analysis of a database containing over 20,000 high-resolution collision-activation mass spectra of tryptic peptide dications was employed to study the relative specificity of neutral losses from backbone fragments. The high resolution of the FTMS instrument allowed for the first time the first is...

  2. High dimensional and high resolution pulse sequences for backbone resonance assignment of intrinsically disordered proteins

    Czech Academy of Sciences Publication Activity Database

    Zawadzka-Kazimierczuk, A.; Kozminski, W.; Šanderová, Hana; Krásný, Libor


    Roč. 52, č. 4 (2012), s. 329-337. ISSN 0925-2738 R&D Projects: GA ČR GA204/09/0583 Institutional research plan: CEZ:AV0Z50200510 Keywords : Intrinsically disordered proteins * Non-uniform sampling * Backbone assignment Subject RIV: EE - Microbiology, Virology Impact factor: 2.845, year: 2012

  3. Toward Improved Description of DNA Backbone: Revisiting Epsilon and Zeta Torsion Force Field Parameters

    Czech Academy of Sciences Publication Activity Database

    Zgarbová, M.; Luque, F. J.; Šponer, Jiří; Cheatham III, Thomas E.; Otyepka, M.; Jurečka, P.


    Roč. 9, č. 5 (2013), s. 2339-2354. ISSN 1549-9618 Grant ostatní: GA ČR(CZ) GAP208/10/1742 Institutional support: RVO:68081707 Keywords : MOLECULAR- DYNAMICS SIMULATIONS * PHOSPHORUS CHEMICAL-SHIFTS * SUGAR-PHOSPHATE BACKBONE Subject RIV: BO - Biophysics Impact factor: 5.310, year: 2013

  4. Graduate Education in Kinesiology: Are We Part of "America's Backbone for Competitiveness and Innovation"? (United States)

    DePauw, Karen P.


    Graduate education in the United States has been identified as being the backbone of American competitiveness and innovation in a recent report by the Council of Graduate Schools. The report provides a framework for examining the role of graduate education in partnership with business and government to advance an action agenda for achieving…

  5. Lactobacillus plantarum possesses the capability for wall teichoic acid backbone alditol switching

    Directory of Open Access Journals (Sweden)

    Bron Peter A


    Full Text Available Abstract Background Specific strains of Lactobacillus plantarum are marketed as health-promoting probiotics. The role and interplay of cell-wall compounds like wall- and lipo-teichoic acids (WTA and LTA in bacterial physiology and probiotic-host interactions remain obscure. L. plantarum WCFS1 harbors the genetic potential to switch WTA backbone alditol, providing an opportunity to study the impact of WTA backbone modifications in an isogenic background. Results Through genome mining and mutagenesis we constructed derivatives that synthesize alternative WTA variants. The mutants were shown to completely lack WTA, or produce WTA and LTA that lack D-Ala substitution, or ribitol-backbone WTA instead of the wild-type glycerol-containing backbone. DNA micro-array experiments established that the tarIJKL gene cluster is required for the biosynthesis of this alternative WTA backbone, and suggest ribose and arabinose are precursors thereof. Increased tarIJKL expression was not observed in any of our previously performed DNA microarray experiments, nor in qRT-PCR analyses of L. plantarum grown on various carbon sources, leaving the natural conditions leading to WTA backbone alditol switching, if any, to be identified. Human embryonic kidney NF-κB reporter cells expressing Toll like receptor (TLR-2/6 were exposed to purified WTAs and/or the TA mutants, indicating that WTA is not directly involved in TLR-2/6 signaling, but attenuates this signaling in a backbone independent manner, likely by affecting the release and exposure of immunomodulatory compounds such as LTA. Moreover, human dendritic cells did not secrete any cytokines when purified WTAs were applied, whereas they secreted drastically decreased levels of the pro-inflammatory cytokines IL-12p70 and TNF-α after stimulation with the WTA mutants as compared to the wild-type. Conclusions The study presented here correlates structural differences in WTA to their functional characteristics, thereby

  6. Phase behaviour of two-component bottle-brush polymers with flexible backbones under poor solvent conditions

    International Nuclear Information System (INIS)

    The phase behaviour of two-component bottle-brush polymers with fully flexible backbones under poor solvent conditions is studied via molecular-dynamics simulations, using a coarse-grained bead-spring model and side chains of up to N = 40 effective monomers. We consider a symmetric model where side chains of type A and B are grafted alternately onto a flexible backbone. The aim of this study is to explore the phase behaviour of two-component bottle-brushes depending on parameters, such as as the grafting density σ, the backbone length Nb, the side-chain length N, and the temperature T. Based on a cluster analysis, we identify for our range of parameters the regimes of fully phase separated systems, i.e., A-type side chains form one cluster and B-type chains another, while the interface that separates these two clusters contains the backbone monomers. We find that pearl-necklace or Janus-like structures, which normally occur for bottle-brush polymers with rigid backbones under poor solvent conditions, are fully attributed to the backbone rigidity, and, therefore, such structures are unlikely in the case of bottle brushes with fully flexible backbones. Also, a comparative discussion with earlier work on the phase behaviour of single-component bottle-brush polymers with flexible backbones is performed. (paper)

  7. Smart-Grid Backbone Network Real-Time Delay Reduction via Integer Programming. (United States)

    Pagadrai, Sasikanth; Yilmaz, Muhittin; Valluri, Pratyush


    This research investigates an optimal delay-based virtual topology design using integer linear programming (ILP), which is applied to the current backbone networks such as smart-grid real-time communication systems. A network traffic matrix is applied and the corresponding virtual topology problem is solved using the ILP formulations that include a network delay-dependent objective function and lightpath routing, wavelength assignment, wavelength continuity, flow routing, and traffic loss constraints. The proposed optimization approach provides an efficient deterministic integration of intelligent sensing and decision making, and network learning features for superior smart grid operations by adaptively responding the time-varying network traffic data as well as operational constraints to maintain optimal virtual topologies. A representative optical backbone network has been utilized to demonstrate the proposed optimization framework whose simulation results indicate that superior smart-grid network performance can be achieved using commercial networks and integer programming. PMID:25935050

  8. Elucidating the backbone conformation of photoswitchable foldamers using vibrational circular dichroism. (United States)

    Domingos, Sérgio R; Roeters, Steven J; Amirjalayer, Saeed; Yu, Zhilin; Hecht, Stefan; Woutersen, Sander


    The backbone conformation of amphiphilic oligo(azobenzene) foldamers is investigated using vibrational circular dichroism (VCD) spectroscopy on a mode involving the stretching of the N=N bonds in the backbone. From denaturation experiments, we find that the VCD response in the helical conformation arises mainly from through-space interaction between the N=N-stretch transition-dipole moments, so that the coupled-oscillator model can be used to predict the VCD spectrum associated with a particular conformation. Using this approach, we elucidate the origin of the VCD signals in the folded conformation, and can assign the observed partial loss of VCD signals upon photo-induced unfolding to specific conformational changes. Our results show that the N=N-stretch VCD response provides an excellent probe of the helical conformation of the N=N bonds in this type of switchable molecular system. PMID:24018416

  9. Efficient identification of amino acid types for fast protein backbone assignments

    International Nuclear Information System (INIS)

    We describe a procedure that allows for very efficient identification of amino acid types in proteins by selective 15N-labeling. The usefulness of selective incorporation of 15N-labeled amino acids into proteins for the backbone assignment has been recognized for several years. However, widespread use of this method has been hindered by the need to purify each selectively labeled sample and by the relatively high cost of labeling with 15N-labeled amino acids. Here we demonstrate that purification of the selectively 15N-labeled samples is not necessary and that background-free HSQC spectra containing only the peaks of the overexpressed heterologous protein can be obtained in crude lysates from as little as 100 ml cultures, thus saving time and money. This method can be used for fast and automated backbone assignment of proteins

  10. New nucleoside/nucleotide backbone options: a review of recent studies. (United States)

    Ruane, Peter J; DeJesus, Edwin


    The nucleoside/nucleotide reverse transcriptase inhibitor (NRTI/NtRTI) class continues to serve as an important component of the standard of care for HIV infection. Combinations of dual NRTIs/NtRTIs with protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs) remain the most commonly used regimens in clinical practice. In recent years, clinical outcomes data on previously novel NRTI/NtRTI backbone combinations have provided clinicians with new options to address potency, tolerability, and convenience of antiretroviral therapy. However, the tolerability, drug-drug interactions, and resistance profiles of specific regimens using new NRTI/NtRTI combinations must be weighed against the needs and preferences of individual patients. This review summarizes recent efficacy and safety data on emerging NRTI/NtRTI combination backbones, including tenofovir DF (TDF) with lamivudine (3TC), abacavir with 3TC, didanosine (ddI) with 3TC, ddI with emtricitabine (FTC), and TDF with FTC. PMID:15319666

  11. Protein backbone and sidechain torsion angles predicted from NMR chemical shifts using artificial neural networks

    International Nuclear Information System (INIS)

    A new program, TALOS-N, is introduced for predicting protein backbone torsion angles from NMR chemical shifts. The program relies far more extensively on the use of trained artificial neural networks than its predecessor, TALOS+. Validation on an independent set of proteins indicates that backbone torsion angles can be predicted for a larger, ≥90 % fraction of the residues, with an error rate smaller than ca 3.5 %, using an acceptance criterion that is nearly two-fold tighter than that used previously, and a root mean square difference between predicted and crystallographically observed (φ, ψ) torsion angles of ca 12º. TALOS-N also reports sidechain χ1 rotameric states for about 50 % of the residues, and a consistency with reference structures of 89 %. The program includes a neural network trained to identify secondary structure from residue sequence and chemical shifts

  12. Protein backbone and sidechain torsion angles predicted from NMR chemical shifts using artificial neural networks

    Energy Technology Data Exchange (ETDEWEB)

    Shen Yang; Bax, Ad, E-mail: [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)


    A new program, TALOS-N, is introduced for predicting protein backbone torsion angles from NMR chemical shifts. The program relies far more extensively on the use of trained artificial neural networks than its predecessor, TALOS+. Validation on an independent set of proteins indicates that backbone torsion angles can be predicted for a larger, {>=}90 % fraction of the residues, with an error rate smaller than ca 3.5 %, using an acceptance criterion that is nearly two-fold tighter than that used previously, and a root mean square difference between predicted and crystallographically observed ({phi}, {psi}) torsion angles of ca 12 Masculine-Ordinal-Indicator . TALOS-N also reports sidechain {chi}{sup 1} rotameric states for about 50 % of the residues, and a consistency with reference structures of 89 %. The program includes a neural network trained to identify secondary structure from residue sequence and chemical shifts.

  13. Structure and dynamics of the RNA backbone resolved with NMR spin-spin couplings

    Czech Academy of Sciences Publication Activity Database

    Vokáčová, Zuzana; Buděšínský, Miloš; Rosenberg, Ivan; Schneider, Bohdan; Šponer, Jiří; Sychrovský, Vladimír

    Helsinki : University of Helsinki, 2009 - (J. Polvi and H. Ristolainen). s. 320-320 ISBN 978-952-10-5618-5. [International Congress of Quantum Chemistry ICQC /13./. 22.06.2009-27-06.2009, Helsinki] R&D Projects: GA AV ČR IAA400550701 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507 Keywords : NMR * nucleic acid backbone * ab initio calculations Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Extensive Air Showers: from the muonic smoking guns to the hadronic backbone


    Cazon L.


    Extensive Air Showers are complex macroscopic objects initiated by single ultra-high energy particles. They are the result of millions of high energy reactions in the atmosphere and can be described as the superposition of hadronic and electromagnetic cascades. The hadronic cascade is the air shower backbone, and it is mainly made of pions. Decays of neutral pions initiate electromagnetic cascades, while the decays of charged pions produce muons which leave the hadronic core and travel many k...

  15. Backbone resonance assignments of the outer membrane lipoprotein FrpD from Neisseria meningitidis

    Czech Academy of Sciences Publication Activity Database

    Bumba, Ladislav; Sviridova, E.; Kutá-Smatanová, Ivana; Řezáčová, Pavlína; Veverka, Václav


    Roč. 8, č. 1 (2014), s. 53-55. ISSN 1874-2718 R&D Projects: GA ČR(CZ) GAP207/11/0717; GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:61388971 ; RVO:67179843 Keywords : Neisseria meningitidis * FrpC * FrpD * backbone assignments * NMR * iron-regulated protein Subject RIV: CE - Biochemistry Impact factor: 0.760, year: 2014

  16. Integrating the university medical center. Phase one: providing an information backbone.


    Berry, S J; Reber, E.; Offeman, W. E.


    UCLA School of Medicine represents a diverse computing community where the creation of each individual network has been driven by applications, price/performance and functionality. Indeed, the ability to connect to other computers has had no bearing on selection. Yet, there exists a need to seamlessly connect the individual networks to other minicomputers, mainframes and remote computers. We have created a school wide backbone network that will enable an individual from a single workstation t...

  17. Inferential protein structure determination and refinement using fast, electronic structure based backbone amide chemical shift predictions

    CERN Document Server

    Christensen, Anders S


    This report covers the development of a new, fast method for calculating the backbone amide proton chemical shifts in proteins. Through quantum chemical calculations, structure-based forudsiglese the chemical shift for amidprotonen in protein has been parameterized. The parameters are then implemented in a computer program called Padawan. The program has since been implemented in protein folding program Phaistos, wherein the method andvendes to de novo folding of the protein structures and to refine the existing protein structures.

  18. Tritium containing polymers having a polymer backbone substantially void of tritium (United States)

    Jensen, George A.; Nelson, David A.; Molton, Peter M.


    A radioluminescent light source comprises a solid mixture of a phosphorescent substance and a tritiated polymer. The solid mixture forms a solid mass having length, width, and thickness dimensions, and is capable of self-support. In one aspect of the invention, the phosphorescent substance comprises solid phosphor particles supported or surrounded within a solid matrix by a tritium containing polymer. The tritium containing polymer comprises a polymer backbone which is essentially void of tritium.

  19. Effect of Backbone Structure on Membrane Properties for Poly(arylene ether) Random and Multiblock Copolymers


    Rowlett, Jarrett Robert


    Poly(arylene ether)s are a well-established class of thermoplastics that are known for their mechanical toughness, thermal stability, and fabrication into membranes. These materials can undergo a myriad of modifications including backbone structure variability, sulfonation, and crosslinking. In this dissertation, structure-property relationships are considered for poly(arylene ether)s with regard to membrane applications for proton exchange and gas separation membranes. All of the proton...

  20. Synthesis, Characterization and Structure of Chiral Amino Acids and Their Corresponding Amino Alcohols with Camphoric Backbone

    Institute of Scientific and Technical Information of China (English)

    QIAN Hui-Fen; HUANG Wei; LI Hui-Hui; YAO Cheng


    Chiral amino acids and their corresponding amino alcohols bearing camphoric backbone were prepared from D-(+)-camphoric imide and characterized by infrared, elemental analysis, ESI-MS, and NMR measurements. Among them, one intermediate (lS,3R)-3-amino-2,2,3-trimethyl cyclopentane-1-carboxylic acid hydrochloride 3 was structurally elucidated by X-ray diffraction techniques. Versatile intermolecular hydrogen bonding interactions observed in its packing structure result in a two-dimensional framework.

  1. Backbone resonance assignments of human cytosolic dNT-1 nucleotidase

    Czech Academy of Sciences Publication Activity Database

    Hnízda, Aleš; Skleničková, Radka; Pachl, Petr; Fábry, Milan; Tošner, Z.; Brynda, Jiří; Veverka, Václav


    Roč. 8, č. 2 (2014), s. 425-428. ISSN 1874-2718 R&D Projects: GA MŠk(CZ) LK11205; GA ČR GA203/09/0820 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : 5 '-nucleotidase * haloacid dehalogenase superfamily * backbone assignments * NMR * perdeuterated protein * dimer * pyrimidine nucleotides Subject RIV: CE - Biochemistry; EB - Genetics ; Molecular Biology (UMG-J) Impact factor: 0.760, year: 2014

  2. Hash: a program to accurately predict protein H{sup {alpha}} shifts from neighboring backbone shifts

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Jianyang, E-mail: [Tsinghua University, Institute for Interdisciplinary Information Sciences (China); Zhou Pei [Duke University Medical Center, Department of Biochemistry (United States); Donald, Bruce Randall [Duke University, Department of Computer Science (United States)


    Chemical shifts provide not only peak identities for analyzing nuclear magnetic resonance (NMR) data, but also an important source of conformational information for studying protein structures. Current structural studies requiring H{sup {alpha}} chemical shifts suffer from the following limitations. (1) For large proteins, the H{sup {alpha}} chemical shifts can be difficult to assign using conventional NMR triple-resonance experiments, mainly due to the fast transverse relaxation rate of C{sup {alpha}} that restricts the signal sensitivity. (2) Previous chemical shift prediction approaches either require homologous models with high sequence similarity or rely heavily on accurate backbone and side-chain structural coordinates. When neither sequence homologues nor structural coordinates are available, we must resort to other information to predict H{sup {alpha}} chemical shifts. Predicting accurate H{sup {alpha}} chemical shifts using other obtainable information, such as the chemical shifts of nearby backbone atoms (i.e., adjacent atoms in the sequence), can remedy the above dilemmas, and hence advance NMR-based structural studies of proteins. By specifically exploiting the dependencies on chemical shifts of nearby backbone atoms, we propose a novel machine learning algorithm, called Hash, to predict H{sup {alpha}} chemical shifts. Hash combines a new fragment-based chemical shift search approach with a non-parametric regression model, called the generalized additive model, to effectively solve the prediction problem. We demonstrate that the chemical shifts of nearby backbone atoms provide a reliable source of information for predicting accurate H{sup {alpha}} chemical shifts. Our testing results on different possible combinations of input data indicate that Hash has a wide rage of potential NMR applications in structural and biological studies of proteins.

  3. Release management as the backbone of service delivery for business critical enterprise applications


    Ojasalo, Hannu


    Application management services are initiated to take care of enterprise applications in the use phase of their lifecycle. Most important of the application management processes are incident, problem, change, knowledge and release management. The aim of this thesis of mine is to validate the position of release management. Release management can be the backbone for enterprise application management. It makes sure that the risk of negatively affecting the operation of the application is m...

  4. Power consumption evaluation of circuit-switched versus packet-switched optical backbone networks


    Van Heddeghem W.; Lannoo B.; Colle D.; Pickavet M.; Musumeci F.; Pattavina A.; Idzikowski F.


    While telecommunication networks have historically been dominated by a circuit-switched paradigm, the last decades have seen a clear trend towards packet-switched networks. In this paper we evaluate how both paradigms perform in optical backbone networks from a power consumption point of view, and whether the general agreement of circuit switching being more power-efficient holds. We consider artificially generated topologies of various sizes, mesh degrees and not yet previously explored in t...

  5. Monitoring Backbone Hydrogen-Bond Formation in β-Barrel Membrane Protein Folding. (United States)

    Raschle, Thomas; Rios Flores, Perla; Opitz, Christian; Müller, Daniel J; Hiller, Sebastian


    β-barrel membrane proteins are key components of the outer membrane of bacteria, mitochondria and chloroplasts. Their three-dimensional structure is defined by a network of backbone hydrogen bonds between adjacent β-strands. Here, we employ hydrogen-deuterium (H/D) exchange in combination with NMR spectroscopy and mass spectrometry to monitor backbone hydrogen bond formation during folding of the outer membrane protein X (OmpX) from E. coli in detergent micelles. Residue-specific kinetics of interstrand hydrogen-bond formation were found to be uniform in the entire β-barrel and synchronized to formation of the tertiary structure. OmpX folding thus propagates via a long-lived conformational ensemble state in which all backbone amide protons exchange with the solvent and engage in hydrogen bonds only transiently. Stable formation of the entire OmpX hydrogen bond network occurs downhill of the rate-limiting transition state and thus appears cooperative on the overall folding time scale. PMID:27062600

  6. East vergent structure of Backbone Range: Insights from A-Lan-Yi area and sandbox modeling (United States)

    Lee, C. A.; Lu, C. Y.


    Southern Taiwan, including Pingtung peninsula and Taitung, is the incipient oblique collision zone of Eurasian plate and Philippine Sea plate. The Luzon volcanic arc converged toward Taiwan Island and formed Hengchun Ridge south offshore Taiwan. Thus, Taiwan mountain belt developed from north to south as the Backbone Range, so that we can infer the incipient feature structure from the topography and outcrop study of southern Taiwan. Our field survey of this study concentrated at the southeast coastline of Taiwan, also known as A-Lan-Yi Trail. According to previous study, the deformational structures such as faults and folds are consistent with regional kinematic processes, and the preserved transpression structure is the most important evidence of incipient collision. In this study, we use the sedimentary sequences of study area to trace the regional tectonics from north to south. Discovered structures in this area show the similar kinematic history as the eastern flank of Backbone Range, so that we suggest they are at the same series of a tectonic event. To complete the regional structure mapping in this accessible area, besides the field geological data, we also applied the LiDAR-derived DTM which is a 3D visualization technology to improve our topography information. In addition, we use the sandbox modeling to demonstrate the development of structures in the eastern flank of Backbone Range. After combining the results of field observation and regional structure mapping, this study provides a strong evidence of backthrusting and backfolding deformation during the incipient oblique collision stage.

  7. An Analytic Method for the Kinematics and Dynamics of a Multiple-Backbone Continuum Robot

    Directory of Open Access Journals (Sweden)

    Bin He


    Full Text Available Continuum robots have been the subject of extensive research due to their potential use in a wide range of applications. In this paper, we propose a new continuum robot with three backbones, and provide a unified analytic method for the kinematics and dynamics of a multiple‐backbone continuum robot. The robot achieves actuation by independently pulling three backbones to carry out a bending motion of two‐degrees‐of‐freedom (DoF. A three‐dimensional CAD model of the robot is built and the kinematical equation is established on the basis of the Euler‐Bernoulli beam. The dynamical model of the continuum robot is constructed by using the Lagrange method. The simulation and the experiment’s validation results show the continuum robot can exactly bend into pre‐set angles in the two‐dimensional space (the maximum error is less than 5% of the robot length and can make a circular motion in three‐dimensional space. The results demonstrate that the proposed analytic method for the kinematics and dynamics of a continuum robot is feasible.

  8. Reconstruction of protein backbones from the BriX collection of canonical protein fragments. (United States)

    Baeten, Lies; Reumers, Joke; Tur, Vicente; Stricher, François; Lenaerts, Tom; Serrano, Luis; Rousseau, Frederic; Schymkowitz, Joost


    As modeling of changes in backbone conformation still lacks a computationally efficient solution, we developed a discretisation of the conformational states accessible to the protein backbone similar to the successful rotamer approach in side chains. The BriX fragment database, consisting of fragments from 4 to 14 residues long, was realized through identification of recurrent backbone fragments from a non-redundant set of high-resolution protein structures. BriX contains an alphabet of more than 1,000 frequently observed conformations per peptide length for 6 different variation levels. Analysis of the performance of BriX revealed an average structural coverage of protein structures of more than 99% within a root mean square distance (RMSD) of 1 Angstrom. Globally, we are able to reconstruct protein structures with an average accuracy of 0.48 Angstrom RMSD. As expected, regular structures are well covered, but, interestingly, many loop regions that appear irregular at first glance are also found to form a recurrent structural motif, albeit with lower frequency of occurrence than regular secondary structures. Larger loop regions could be completely reconstructed from smaller recurrent elements, between 4 and 8 residues long. Finally, we observed that a significant amount of short sequences tend to display strong structural ambiguity between alpha helix and extended conformations. When the sequence length increases, this so-called sequence plasticity is no longer observed, illustrating the context dependency of polypeptide structures. PMID:18483555

  9. Synthesis of novel cationic lipids with fully or partially non-scissile linkages between the hydrocarbon chains and pseudoglyceryl backbone

    Indian Academy of Sciences (India)

    Santanu Bhattacharya; Saubhik Haldar


    Five novel cationic lipids with fully or partially non-scissile linkage regions between the pseudoglyceryl backbone and the hydrocarbon chains have been synthesized. The membrane-forming properties of these new lipids are briefly presented.

  10. Development of a Backbone Cyclic Peptide Library as Potential Antiparasitic Therapeutics Using Microwave Irradiation. (United States)

    Qvit, Nir; Kornfeld, Opher S


    Protein-protein interactions (PPIs) are intimately involved in almost all biological processes and are linked to many human diseases. Therefore, there is a major effort to target PPIs in basic research and in the pharmaceutical industry. Protein-protein interfaces are usually large, flat, and often lack pockets, complicating the discovery of small molecules that target such sites. Alternative targeting approaches using antibodies have limitations due to poor oral bioavailability, low cell-permeability, and production inefficiency. Using peptides to target PPI interfaces has several advantages. Peptides have higher conformational flexibility, increased selectivity, and are generally inexpensive. However, peptides have their own limitations including poor stability and inefficiency crossing cell membranes. To overcome such limitations, peptide cyclization can be performed. Cyclization has been demonstrated to improve peptide selectivity, metabolic stability, and bioavailability. However, predicting the bioactive conformation of a cyclic peptide is not trivial. To overcome this challenge, one attractive approach it to screen a focused library to screen in which all backbone cyclic peptides have the same primary sequence, but differ in parameters that influence their conformation, such as ring size and position. We describe a detailed protocol for synthesizing a library of backbone cyclic peptides targeting specific parasite PPIs. Using a rational design approach, we developed peptides derived from the scaffold protein Leishmania receptor for activated C-kinase (LACK). We hypothesized that sequences in LACK that are conserved in parasites, but not in the mammalian host homolog, may represent interaction sites for proteins that are critical for the parasites' viability. The cyclic peptides were synthesized using microwave irradiation to reduce reaction times and increase efficiency. Developing a library of backbone cyclic peptides with different ring sizes facilitates a

  11. Simultaneous NMR assignment of backbone and side chain amides in large proteins with IS-TROSY

    International Nuclear Information System (INIS)

    A new strategy for the simultaneous NMR assignment of both backbone and side chain amides in large proteins with isotopomer-selective transverse-relaxation-optimized spectroscopy (IS-TROSY) is reported. The method considers aspects of both the NMR sample preparation and the experimental design. First, the protein is dissolved in a buffer with 50%H2O/50%D2O in order to promote the population of semideuterated NHD isotopomers in side chain amides of Asn/Gln residues. Second, a 13C'-coupled 2D 15N-1H IS-TROSY spectrum provides a stereospecific distinction between the geminal protons in the E and Z configurations of the carboxyamide group. Third, a suite of IS-TROSY-based triple-resonance NMR experiments, e.g. 3D IS-TROSY-HNCA and 3D IS-TROSY-HNCACB, are designed to correlate aliphatic carbon atoms with backbone amides and, for Asn/Gln residues, at the same time with side chain amides. The NMR assignment procedure is similar to that for small proteins using conventional 3D HNCA/3D HNCACB spectra, in which, however, signals from NH2 groups are often very weak or even missing due to the use of broad-band proton decoupling schemes and NOE data have to be used as a remedy. For large proteins, the use of conventional TROSY experiments makes resonances of side chain amides not observable at all. The application of IS-TROSY experiments to the 35-kDa yeast cytosine deaminase has established a complete resonance assignment for the backbone and stereospecific assignment for side chain amides, which otherwise could not be achieved with existing NMR experiments. Thus, the development of IS-TROSY-based method provides new opportunities for the NMR study of important structural and biological roles of carboxyamides and side chain moieties of arginine and lysine residues in large proteins as well as amino moieties in nucleic acids

  12. CORBA and MPI-based 'backbone' for coupling advanced simulation tools

    International Nuclear Information System (INIS)

    There is a growing international interest in using coupled, multidisciplinary computer simulations for a variety of purposes, including nuclear reactor safety analysis. Reactor behaviour can be modeled using a suite of computer programs simulating phenomena or predicting parameters that can be categorized into disciplines such as Thermalhydraulics, Neutronics, Fuel, Fuel Channels, Fission Product Release and Transport, Containment and Atmospheric Dispersion, and Severe Accident Analysis. Traditionally, simulations used for safety analysis individually addressed only the behaviour within a single discipline, based upon static input data from other simulation programs. The limitation of using a suite of stand-alone simulations is that phenomenological interdependencies or temporal feedback between the parameters calculated within individual simulations cannot be adequately captured. To remove this shortcoming, multiple computer simulations for different disciplines must exchange data during runtime to address these interdependencies. This article describes the concept of a new framework, which we refer to as the 'Backbone', to provide the necessary runtime exchange of data. The Backbone, currently under development at AECL for a preliminary feasibility study, is a hybrid design using features taken from the Common Object Request Broker Architecture (CORBA), a standard defined by the Object Management Group, and the Message Passing Interface (MPI), a standard developed by a group of researchers from academia and industry. Both have well-tested and efficient implementations, including some that are freely available under the GNU public licenses. The CORBA component enables individual programs written in different languages and running on different platforms within a network to exchange data with each other, thus behaving like a single application. MPI provides the process-to-process intercommunication between these programs. This paper outlines the different CORBA and

  13. Backbone tuning in indenylidene–ruthenium complexes bearing an unsaturated N-heterocyclic carbene

    Directory of Open Access Journals (Sweden)

    César A. Urbina-Blanco


    Full Text Available The steric and electronic influence of backbone substitution in IMes-based (IMes = 1,3-bis(2,4,6-trimethylphenylimidazol-2-ylidene N-heterocyclic carbenes (NHC was probed by synthesizing the [RhCl(CO2(NHC] series of complexes to quantify experimentally the Tolman electronic parameter (electronic and the percent buried volume (%Vbur, steric parameters. The corresponding ruthenium–indenylidene complexes were also synthesized and tested in benchmark metathesis transformations to establish possible correlations between reactivity and NHC electronic and steric parameters.

  14. Silence is Golden with High Probability: Maintaining a Connected Backbone in Wireless Sensor Networks


    Santi, Paolo; Simon, J?nos


    Reducing node energy consumption to extend network life- time is a vital requirement in wireless sensor networks. In this paper, we present and analyze the energy consumption of a class of cell-based energy conservation protocols. The goal of our protocols is to alternately turn off/on the transceivers of the nodes, while maintaining a connected backbone of active nodes. The protocols presented in this paper are shown to be optimal, in the sense that they extend the network lifetime by a fact...

  15. Dynamic Resource Allocation and QoS Control Capabilities of the Japanese Academic Backbone Network

    Directory of Open Access Journals (Sweden)

    Michihiro Aoki


    Full Text Available Dynamic resource control capabilities have become increasingly important for academic networks that must support big scientific research projects at the same time as less data intensive research and educational activities. This paper describes the dynamic resource allocation and QoS control capabilities of the Japanese academic backbone network, called SINET3, which supports a variety of academic applications with a wide range of network services. The article describes the network architecture, networking technologies, resource allocation, QoS control, and layer-1 bandwidth on-demand services. It also details typical services developed for scientific research, including the user interface, resource control, and management functions, and includes performance evaluations.

  16. On the photostability of peptides after selective photoexcitation of the backbone: Prompt versus slow dissociation

    DEFF Research Database (Denmark)

    Byskov, Camilla Skinnerup; Jensen, Frank; Jørgensen, Thomas J D;


    , which is remote from the initial site of excitation. Hence loss of CE serves as direct proof that energy has reached the charge-site end, leaving the backbone intact. Our work demonstrates that excitation of tertiary amide moieties (proline linkages) results in both prompt dissociation and statistical...... present a protocol to disentangle slow and non-hazardous statistical dissociation from prompt cleavage of peptide bonds by 210 nm light based on experiments on protonated peptides isolated in vacuo and tagged by 18-crown-6 ether (CE). The weakest link in the system is between the charged site and CE...

  17. RosettaRemodel: a generalized framework for flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Po-Ssu Huang

    Full Text Available We describe RosettaRemodel, a generalized framework for flexible protein design that provides a versatile and convenient interface to the Rosetta modeling suite. RosettaRemodel employs a unified interface, called a blueprint, which allows detailed control over many aspects of flexible backbone protein design calculations. RosettaRemodel allows the construction and elaboration of customized protocols for a wide range of design problems ranging from loop insertion and deletion, disulfide engineering, domain assembly, loop remodeling, motif grafting, symmetrical units, to de novo structure modeling.

  18. Colloidal quantum dot lasers built on a passive two-dimensional photonic crystal backbone (United States)

    Chang, Hojun; Min, Kyungtaek; Lee, Myungjae; Kang, Minsu; Park, Yeonsang; Cho, Kyung-Sang; Roh, Young-Geun; Woo Hwang, Sung; Jeon, Heonsu


    We report the room-temperature lasing action from two-dimensional photonic crystal (PC) structures composed of a passive Si3N4 backbone with an over-coat of CdSe/CdS/ZnS colloidal quantum dots (CQDs) for optical gain. When optically excited, devices lased in dual PC band-edge modes, with the modal dominance governed by the thickness of the CQD over-layer. The demonstrated laser platform should have an impact on future photonic integrated circuits as the on-chip coupling between active and passive components is readily achievable.We report the room-temperature lasing action from two-dimensional photonic crystal (PC) structures composed of a passive Si3N4 backbone with an over-coat of CdSe/CdS/ZnS colloidal quantum dots (CQDs) for optical gain. When optically excited, devices lased in dual PC band-edge modes, with the modal dominance governed by the thickness of the CQD over-layer. The demonstrated laser platform should have an impact on future photonic integrated circuits as the on-chip coupling between active and passive components is readily achievable. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr08544f

  19. On the role of thermal backbone fluctuations in myoglobin ligand gate dynamics

    CERN Document Server

    Krokhotin, Andrey; Peng, Xubiao


    We construct an energy function that describes the crystallographic structure of spermwhale myoglobin backbone. As a model in our construction, we use the Protein Data Bank entry 1ABS that has been measured at liquid helium temperature. Consequently the thermal B-factor fluctuations are very small, which is an advantage in our construction. The energy function that we utilize resembles that of the discrete non-linear Schrodinger equation. Likewise, ours supports solitons as local minimum energy configurations. We describe the 1ABS backbone in terms of solitons with a precision that deviates from 1ABS by an average root-mean-square distance, which is less than the experimentally observed Debye-Waller B-factor fluctuation distance. We then subject the multisoliton solution to extensive numerical heating and cooling experiments, over a very wide range of temperatures. We concentrate in particular to temperatures above 300K and below the theta-point unfolding temperature, which is around 348K. We confirm that the...

  20. Investigating the Tradeoffs between Power Consumption and Quality of Service in a Backbone Network

    Directory of Open Access Journals (Sweden)

    Erol Gelenbe


    Full Text Available Energy saving in networks has traditionally focussed on reducing battery consumption through smart wireless network design. Recently, researchers have turned their attention to the energy cost and carbon emissions of the backbone network that both fixed and mobile communications depend on, proposing primarily mechanisms that turn equipments OFF or put them into deep sleep. This is an effective way of saving energy, provided that the nodes can return to working condition quickly, but it introduces increased delays and packet losses that directly affect the quality of communication experienced by the users. Here we investigate the associated tradeoffs between power consumption and quality of service in backbone networks that employ deep sleep energy savings. We examine these tradeoffs by conducting experiments on a real PC-based network topology, where nodes are put into deep sleep at random times and intervals, resulting in a continuously changing network with reduced total power consumption. The average power consumption, the packet loss and the average delay of this network are examined with respect to the average value of the ON rate and the ON/OFF cycle of the nodes.

  1. Protein backbone chemical shifts predicted from searching a database for torsion angle and sequence homology

    International Nuclear Information System (INIS)

    Chemical shifts of nuclei in or attached to a protein backbone are exquisitely sensitive to their local environment. A computer program, SPARTA, is described that uses this correlation with local structure to predict protein backbone chemical shifts, given an input three-dimensional structure, by searching a newly generated database for triplets of adjacent residues that provide the best match in φ/ψ/χ1 torsion angles and sequence similarity to the query triplet of interest. The database contains 15N, 1HN, 1Hα, 13Cα, 13Cβ and 13C' chemical shifts for 200 proteins for which a high resolution X-ray (≤2.4 A) structure is available. The relative importance of the weighting factors for the φ/ψ/χ1 angles and sequence similarity was optimized empirically. The weighted, average secondary shifts of the central residues in the 20 best-matching triplets, after inclusion of nearest neighbor, ring current, and hydrogen bonding effects, are used to predict chemical shifts for the protein of known structure. Validation shows good agreement between the SPARTA-predicted and experimental shifts, with standard deviations of 2.52, 0.51, 0.27, 0.98, 1.07 and 1.08 ppm for 15N, 1HN, 1Hα, 13Cα, 13Cβ and 13C', respectively, including outliers

  2. An Optimized microRNA Backbone for Effective Single-Copy RNAi

    Directory of Open Access Journals (Sweden)

    Christof Fellmann


    Full Text Available Short hairpin RNA (shRNA technology enables stable and regulated gene repression. For establishing experimentally versatile RNAi tools and minimizing toxicities, synthetic shRNAs can be embedded into endogenous microRNA contexts. However, due to our incomplete understanding of microRNA biogenesis, such “shRNAmirs” often fail to trigger potent knockdown, especially when expressed from a single genomic copy. Following recent advances in design of synthetic shRNAmir stems, here we take a systematic approach to optimize the experimental miR-30 backbone. Among several favorable features, we identify a conserved element 3′ of the basal stem as critically required for optimal shRNAmir processing and implement it in an optimized backbone termed “miR-E”, which strongly increases mature shRNA levels and knockdown efficacy. Existing miR-30 reagents can be easily converted to miR-E, and its combination with up-to-date design rules establishes a validated and accessible platform for generating effective single-copy shRNA libraries that will facilitate the functional annotation of the genome.

  3. An optimized microRNA backbone for effective single-copy RNAi. (United States)

    Fellmann, Christof; Hoffmann, Thomas; Sridhar, Vaishali; Hopfgartner, Barbara; Muhar, Matthias; Roth, Mareike; Lai, Dan Yu; Barbosa, Inês A M; Kwon, Jung Shick; Guan, Yuanzhe; Sinha, Nishi; Zuber, Johannes


    Short hairpin RNA (shRNA) technology enables stable and regulated gene repression. For establishing experimentally versatile RNAi tools and minimizing toxicities, synthetic shRNAs can be embedded into endogenous microRNA contexts. However, due to our incomplete understanding of microRNA biogenesis, such "shRNAmirs" often fail to trigger potent knockdown, especially when expressed from a single genomic copy. Following recent advances in design of synthetic shRNAmir stems, here we take a systematic approach to optimize the experimental miR-30 backbone. Among several favorable features, we identify a conserved element 3' of the basal stem as critically required for optimal shRNAmir processing and implement it in an optimized backbone termed "miR-E", which strongly increases mature shRNA levels and knockdown efficacy. Existing miR-30 reagents can be easily converted to miR-E, and its combination with up-to-date design rules establishes a validated and accessible platform for generating effective single-copy shRNA libraries that will facilitate the functional annotation of the genome. PMID:24332856

  4. Protein backbone motions viewed by intraresidue and sequential HN-Hα residual dipolar couplings

    International Nuclear Information System (INIS)

    Triple resonance E.COSY-based techniques were used to measure intra-residue and sequential HN-Hα residual dipolar couplings (RDCs) for the third IgG-binding domain of protein G (GB3), aligned in Pf1 medium. Measurements closely correlate with values predicted on the basis of an NMR structure, previously determined on the basis of a large number of one-bond backbone RDCs measured in five alignment media. However, in particular the sequential HN-Hα RDCs are smaller than predicted for a static structure, suggesting a degree of motion for these internuclear vectors that exceeds that of the backbone amide N-H vectors. Of all experimentally determined GB3 structures available, the best correlation between experimental 1H-1H couplings is observed for a GB3 ensemble, previously derived to generate a realistic picture of the conformational space sampled by GB3 (Clore and Schwieters, J Mol Biol 355:879-886, 2006). However, for both NMR and X-ray-derived structures the 1H-1H couplings are found to be systematically smaller than expected on the basis of alignment tensors derived from 15N-1H amide RDCs, assuming librationally corrected N-H bond lengths of 1.041 A

  5. A fusion networking model for smart grid power distribution backbone communication network based on PTN

    Directory of Open Access Journals (Sweden)

    Wang Hao


    Full Text Available In current communication network for distribution in Chinese power grid systems, the fiber communication backbone network for distribution and TD-LTE power private wireless backhaul network of power grid are both bearing by the SDH optical transmission network, which also carries the communication network of transformer substation and main electric. As the data traffic of the distribution communication and TD-LTE power private wireless network grow rapidly in recent years, it will have a big impact with the SDH network’s bearing capacity which is mainly used for main electric communication in high security level. This paper presents a fusion networking model which use a multiple-layer PTN network as the unified bearing of the TD-LTE power private wireless backhaul network and fiber communication backbone network for distribution. Network dataflow analysis shows that this model can greatly reduce the capacity pressure of the traditional SDH network as well as ensure the reliability of the transmission of the communication network for distribution and TD-LTE power private wireless network.

  6. Refinement of the protein backbone angle {psi} in NMR structure calculations

    Energy Technology Data Exchange (ETDEWEB)

    Sprangers, R.; Bottomley, M.J.; Linge, J.P.; Schultz, J.; Nilges, M.; Sattler, M. [European Molecular Biology Laboratory (Germany)


    Cross-correlated relaxation rates involving the C{sup {alpha}}-H{sup {alpha}} dipolar interaction and the carbonyl (C') chemical shift anisotropy (CSA) have been measured using two complementary 3D experiments. We show that the protein backbone angle {psi} can be directly refined against such cross-correlated relaxation rates ({gamma}{sup H{alpha}}{sup C{alpha}}{sup ,C'}) and the three-bond H/D isotope effect on the C{sup {alpha}} chemical shifts ({sup 3}{delta}C{sup {alpha}}{sub (ND)}). By simultaneously using both experimental parameters as restraints during NMR structure calculations, a unique value for the backbone angle {psi} is defined. We have applied the new refinement method to the {alpha}-Spectrin SH3 domain (a {beta}-sheet protein) and to the Sgs1p HRDC domain (an {alpha}-helical protein) and show that the quality of the NMR structures is substantially improved, judging from the atomic coordinate precision and the Ramachandran map. In addition, the {psi}-refined NMR structures of the SH3 domain deviate less from the 1.8 A crystal structure, suggesting an improved accuracy. The proposed refinement method can be used to significantly improve the quality of NMR structures and will be applicable to larger proteins.

  7. Influence of Backbone Fluorination in Regioregular Poly(3-alkyl-4-fluoro)thiophenes

    KAUST Repository

    Fei, Zhuping


    © 2015 American Chemical Society. We report two strategies toward the synthesis of 3-alkyl-4-fluorothiophenes containing straight (hexyl and octyl) and branched (2-ethylhexyl) alkyl groups. We demonstrate that treatment of the dibrominated monomer with 1 equiv of alkyl Grignard reagent leads to the formation of a single regioisomer as a result of the pronounced directing effect of the fluorine group. Polymerization of the resulting species affords highly regioregular poly(3-alkyl-4-fluoro)thiophenes. Comparison of their properties to those of the analogous non-fluorinated polymers shows that backbone fluorination leads to an increase in the polymer ionization potential without a significant change in optical band gap. Fluorination also results in an enhanced tendency to aggregate in solution, which is ascribed to a more co-planar backbone on the basis of Raman and DFT calculations. Average charge carrier mobilities in field-effect transistors are found to increase by up to a factor of 5 for the fluorinated polymers.

  8. Di-Isocyanate Crosslinked Aerogels with 1, 6-Bis (Trimethoxysilyl) Hexane Incorporated in Silica Backbone (United States)

    Vivod, Stephanie L.; Meador, Mary Ann B.; Nguyen, Baochau N.; Quade, Derek; Randall, Jason; Perry, Renee


    Silica aerogels are desirable materials for many applications that take advantage of their light weight and low thermal conductivity. Addition of a conformal polymer coating which bonds with the amine decorated surface of the silica network improves the strength of the aerogels by as much as 200 times. Even with vast improvement in strength they still tend to undergo brittle failure due to the rigid silica backbone. We hope to increase the flexibility and elastic recovery of the silica based aerogel by altering the silica back-bone by incorporation of more flexible hexane links. To this end, we investigated the use of 1,6-bis(trimethoxysilyl)hexane (BTMSH), a polysilsesquioxane precursor3, as an additional co-reactant to prepare silica gels which were subsequently cross-linked with di-isocyanate. Previously, this approach of adding flexibility by BTMSH incorporation was demonstrated with styrene cross-linked aerogels. In our study, we varied silane concentration, mol % of silicon from BTMSH and di-isocyanate concentration by weight percent to attempt to optimize both the flexibility and the strength of the aerogels.

  9. Improving VANETs Connectivity with a Totally Ad Hoc Living Mobile Backbone

    Directory of Open Access Journals (Sweden)

    Joilson Alves Junior


    Full Text Available The vehicular ad hoc network (VANET for intelligent transportation systems is an emerging concept to improve transportation security, reliability, and management. The network behavior can be totally different in topological aspects because of the mobility of vehicular nodes. The topology can be fully connected when the flow of vehicles is high and may have low connectivity or be invalid when the flow of vehicles is low or unbalanced. In big cities, the metropolitan buses that travel on exclusive lanes may be used to set up a metropolitan vehicular data network (backbone, raising the connectivity among the vehicles. Therefore, this paper proposes the implementation of a living mobile backbone, totally ad hoc (MOB-NET, which will provide infrastructure and raise the network connectivity. In order to show the viability of MOB-NET, statistical analyses were made with real data of express buses that travel through exclusive lanes, besides evaluations through simulations and analytic models. The statistic, analytic, and simulation results prove that the buses that travel through exclusive lanes can be used to build a communication network totally ad hoc and provide connectivity in more than 99% of the time, besides raising the delivery rate up to 95%.

  10. Characterization of the Burkholderia mallei tonB Mutant and Its Potential as a Backbone Strain for Vaccine Development.

    Directory of Open Access Journals (Sweden)

    Tiffany M Mott

    Full Text Available In this study, a Burkholderia mallei tonB mutant (TMM001 deficient in iron acquisition was constructed, characterized, and evaluated for its protective properties in acute inhalational infection models of murine glanders and melioidosis.Compared to the wild-type, TMM001 exhibits slower growth kinetics, siderophore hyper-secretion and the inability to utilize heme-containing proteins as iron sources. A series of animal challenge studies showed an inverse correlation between the percentage of survival in BALB/c mice and iron-dependent TMM001 growth. Upon evaluation of TMM001 as a potential protective strain against infection, we found 100% survival following B. mallei CSM001 challenge of mice previously receiving 1.5 x 10(4 CFU of TMM001. At 21 days post-immunization, TMM001-treated animals showed significantly higher levels of B. mallei-specific IgG1, IgG2a and IgM when compared to PBS-treated controls. At 48 h post-challenge, PBS-treated controls exhibited higher levels of serum inflammatory cytokines and more severe pathological damage to target organs compared to animals receiving TMM001. In a cross-protection study of acute inhalational melioidosis with B. pseudomallei, TMM001-treated mice were significantly protected. While wild type was cleared in all B. mallei challenge studies, mice failed to clear TMM001.Although further work is needed to prevent chronic infection by TMM001 while maintaining immunogenicity, our attenuated strain demonstrates great potential as a backbone strain for future vaccine development against both glanders and melioidosis.

  11. Comparison of backbone dynamics of the type III antifreeze protein and antifreeze-like domain of human sialic acid synthase

    International Nuclear Information System (INIS)

    Antifreeze proteins (AFPs) are found in a variety of cold-adapted (psychrophilic) organisms to promote survival at subzero temperatures by binding to ice crystals and decreasing the freezing temperature of body fluids. The type III AFPs are small globular proteins that consist of one α-helix, three 310-helices, and two β-strands. Sialic acids play important roles in a variety of biological functions, such as development, recognition, and cell adhesion and are synthesized by conserved enzymatic pathways that include sialic acid synthase (SAS). SAS consists of an N-terminal catalytic domain and a C-terminal antifreeze-like (AFL) domain, which is similar to the type III AFPs. Despite having very similar structures, AFL and the type III AFPs exhibit very different temperature-dependent stability and activity. In this study, we have performed backbone dynamics analyses of a type III AFP (HPLC12 isoform) and the AFL domain of human SAS (hAFL) at various temperatures. We also characterized the structural/dynamic properties of the ice-binding surfaces by analyzing the temperature gradient of the amide proton chemical shift and its correlation with chemical shift deviation from random coil. The dynamic properties of the two proteins were very different from each other. While HPLC12 was mostly rigid with a few residues exhibiting slow motions, hAFL showed fast internal motions at low temperature. Our results provide insight into the molecular basis of thermostability and structural flexibility in homologous psychrophilic HPLC12 and mesophilic hAFL proteins

  12. Comparison of backbone dynamics of the type III antifreeze protein and antifreeze-like domain of human sialic acid synthase

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Yong-Geun [Gyeongsang National University, Department of Chemistry and Research Institute of Natural Science (Korea, Republic of); Park, Chin-Ju [Gwangju Institute of Science and Technology, Division of Liberal Arts and Sciences and Department of Chemistry (Korea, Republic of); Kim, Hee-Eun; Seo, Yeo-Jin; Lee, Ae-Ree; Choi, Seo-Ree; Lee, Shim Sung; Lee, Joon-Hwa, E-mail: [Gyeongsang National University, Department of Chemistry and Research Institute of Natural Science (Korea, Republic of)


    Antifreeze proteins (AFPs) are found in a variety of cold-adapted (psychrophilic) organisms to promote survival at subzero temperatures by binding to ice crystals and decreasing the freezing temperature of body fluids. The type III AFPs are small globular proteins that consist of one α-helix, three 3{sub 10}-helices, and two β-strands. Sialic acids play important roles in a variety of biological functions, such as development, recognition, and cell adhesion and are synthesized by conserved enzymatic pathways that include sialic acid synthase (SAS). SAS consists of an N-terminal catalytic domain and a C-terminal antifreeze-like (AFL) domain, which is similar to the type III AFPs. Despite having very similar structures, AFL and the type III AFPs exhibit very different temperature-dependent stability and activity. In this study, we have performed backbone dynamics analyses of a type III AFP (HPLC12 isoform) and the AFL domain of human SAS (hAFL) at various temperatures. We also characterized the structural/dynamic properties of the ice-binding surfaces by analyzing the temperature gradient of the amide proton chemical shift and its correlation with chemical shift deviation from random coil. The dynamic properties of the two proteins were very different from each other. While HPLC12 was mostly rigid with a few residues exhibiting slow motions, hAFL showed fast internal motions at low temperature. Our results provide insight into the molecular basis of thermostability and structural flexibility in homologous psychrophilic HPLC12 and mesophilic hAFL proteins.

  13. On correlation between protein secondary structure, backbone bond angles, and side-chain orientations

    CERN Document Server

    Lundgren, Martin


    We investigate the fine structure of the sp3 hybridized covalent bond geometry that governs the tetrahedral architecture around the central C$_\\alpha$ carbon of a protein backbone, and for this we develop new visualization techniques to analyze high resolution X-ray structures in Protein Data Bank. We observe that there is a correlation between the deformations of the ideal tetrahedral symmetry and the local secondary structure of the protein. We propose a universal coarse grained energy function to describe the ensuing side-chain geometry in terms of the C$_\\beta$ carbon orientations. The energy function can model the side-chain geometry with a sub-atomic precision. As an example we construct the C$_\\alpha$-C$_\\beta$ structure of HP35 chicken villin headpiece. We obtain a configuration that deviates less than 0.4 \\.A in root-mean-square distance from the experimental X-ray structure.

  14. A renormalization approach to describe charge transport in quasiperiodic dangling backbone ladder (DBL)-DNA molecules

    International Nuclear Information System (INIS)

    Highlights: → One-step renormalization approach to describe the DBL-DNA molecule. → Electronic tight-binding Hamiltonian model. → A quasiperiodic sequence to mimic the DNA nucleotides arrangement. → Electronic transmission spectra. → I-V characteristics. -- Abstract: We study the charge transport properties of a dangling backbone ladder (DBL)-DNA molecule focusing on a quasiperiodic arrangement of its constituent nucleotides forming a Rudin-Shapiro (RS) and Fibonacci (FB) Poly (CG) sequences, as well as a natural DNA sequence (Ch22) for the sake of comparison. Making use of a one-step renormalization process, the DBL-DNA molecule is modeled in terms of a one-dimensional tight-binding Hamiltonian to investigate its transmissivity and current-voltage (I-V) profiles. Beyond the semiconductor I-V characteristics, a striking similarity between the electronic transport properties of the RS quasiperiodic structure and the natural DNA sequence was found.

  15. A recombinant, chimeric tetravalent dengue vaccine candidate based on a dengue virus serotype 2 backbone. (United States)

    Osorio, Jorge E; Wallace, Derek; Stinchcomb, Dan T


    Dengue fever is caused by infection with one of four dengue virus (DENV) serotypes (DENV-1-4), necessitating tetravalent dengue vaccines that can induce protection against all four DENV. Takeda's live attenuated tetravalent dengue vaccine candidate (TDV) comprises an attenuated DENV-2 strain plus chimeric viruses containing the prM and E genes of DENV-1, -3 and -4 cloned into the attenuated DENV-2 'backbone'. In Phase 1 and 2 studies, TDV was well tolerated by children and adults aged 1.5-45 years, irrespective of prior dengue exposure; mild injection-site symptoms were the most common adverse events. TDV induced neutralizing antibody responses and seroconversion to all four DENV as well as cross-reactive T cell-mediated responses that may be necessary for broad protection against dengue fever. PMID:26635182

  16. Modulation of Backbone Flexibility for Effective Dissociation of Antibacterial and Hemolytic Activity in Cyclic Peptides. (United States)

    Oddo, Alberto; Thomsen, Thomas T; Britt, Hannah M; Løbner-Olesen, Anders; Thulstrup, Peter W; Sanderson, John M; Hansen, Paul R


    Bacterial resistance to antibiotic therapy is on the rise and threatens to evolve into a worldwide emergency: alternative solutions to current therapies are urgently needed. Cationic amphipathic peptides are potent membrane-active agents that hold promise as the next-generation therapy for multidrug-resistant infections. The peptides' behavior upon encountering the bacterial cell wall is crucial, and much effort has been dedicated to the investigation and optimization of this amphipathicity-driven interaction. In this study we examined the interaction of a novel series of nine-membered flexible cyclic AMPs with liposomes mimicking the characteristics of bacterial membranes. Employed techniques included circular dichroism and marker release assays, as well as microbiological experiments. Our analysis was aimed at correlating ring flexibility with their antimicrobial, hemolytic, and membrane activity. By doing so, we obtained useful insights to guide the optimization of cyclic antimicrobial peptides via modulation of their backbone flexibility without loss of activity. PMID:27563396

  17. Increased Diels-Alderase activity through backbone remodeling guided by Foldit players. (United States)

    Eiben, Christopher B; Siegel, Justin B; Bale, Jacob B; Cooper, Seth; Khatib, Firas; Shen, Betty W; Players, Foldit; Stoddard, Barry L; Popovic, Zoran; Baker, David


    Computational enzyme design holds promise for the production of renewable fuels, drugs and chemicals. De novo enzyme design has generated catalysts for several reactions, but with lower catalytic efficiencies than naturally occurring enzymes. Here we report the use of game-driven crowdsourcing to enhance the activity of a computationally designed enzyme through the functional remodeling of its structure. Players of the online game Foldit were challenged to remodel the backbone of a computationally designed bimolecular Diels-Alderase to enable additional interactions with substrates. Several iterations of design and characterization generated a 24-residue helix-turn-helix motif, including a 13-residue insertion, that increased enzyme activity >18-fold. X-ray crystallography showed that the large insertion adopts a helix-turn-helix structure positioned as in the Foldit model. These results demonstrate that human creativity can extend beyond the macroscopic challenges encountered in everyday life to molecular-scale design problems. PMID:22267011

  18. Extensive Air Showers: From the muonic smoking guns to the hadronic backbone

    International Nuclear Information System (INIS)

    Extensive Air Showers are complex macroscopic objects initiated by single ultra-high energy particles. They are the result of millions of high energy reactions in the atmosphere and can be described as the superposition of hadronic and electromagnetic cascades. The hadronic cascade is the air shower backbone, and it is mainly made of pions. Decays of neutral pions initiate electromagnetic cascades, while the decays of charged pions produce muons which leave the hadronic core and travel many kilometers almost unaffected. Muons are smoking guns of the hadronic cascade: the energy, transverse momentum, spatial distribution and depth of production are key to reconstruct the history of the air shower. In this work, we overview the phenomenology of muons on the air shower and its relation to the hadronic cascade. We briefly review the experimental efforts to analyze muons within air showers and discuss possible paths to use this information. (authors)

  19. Polystyrene Backbone Polymers Consisting of Alkyl-Substituted Triazine Side Groups for Phosphorescent OLEDs

    Directory of Open Access Journals (Sweden)

    Beatrice Ch. D. Salert


    Full Text Available This paper describes the synthesis of new electron-transporting styrene monomers and their corresponding polystyrenes all with a 2,4,6-triphenyl-1,3,5-triazine basic structure in the side group. The monomers differ in the alkyl substitution and in the meta-/paralinkage of the triazine to the polymer backbone. The thermal and spectroscopic properties of the new electron-transporting polymers are discussed in regard to their chemical structures. Phosphorescent OLEDs were prepared using the obtained electron-transporting polymers as the emissive layer material in blend systems together with a green iridium-based emitter 13 and a small molecule as an additional cohost with wideband gap characteristics (CoH-001. The performance of the OLEDs was characterized and discussed in regard to the chemical structure of the new electron-transporting polymers.

  20. Sequential backbone resonance assignments of the E. coli dihydrofolate reductase Gly67Val mutant: folate complex. (United States)

    Puthenpurackal Narayanan, Sunilkumar; Maeno, Akihiro; Wada, Yuji; Tate, Shin-Ichi; Akasaka, Kazuyuki


    Occasionally, a mutation in an exposed loop region causes a significant change in protein function and/or stability. A single mutation Gly67Val of E. coli dihydrofolate reductase (DHFR) in the exposed CD loop is such an example. We have carried out the chemical shift assignments for H(N), N(H), C(α) and C(β) atoms of the Gly67Val mutant of E. coli DHFR complexed with folate at pH 7.0, 35 °C, and then evaluated the H(N), N(H), C(α) and C(β) chemical shift changes caused by the mutation. The result indicates that, while the overall secondary structure remains the same, the single mutation Gly67Val causes site-specific conformational changes of the polypeptide backbone restricted around the adenosine-binding subdomain (residues 38-88) and not in the distant catalytic domain. PMID:26482924

  1. Side chain and backbone contributions of Phe508 to CFTR folding

    Energy Technology Data Exchange (ETDEWEB)

    Thibodeau, Patrick H.; Brautigam, Chad A.; Machius, Mischa; Thomas, Philip J. (U. of Texas-SMED)


    Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an integral membrane protein, cause cystic fibrosis (CF). The most common CF-causing mutant, deletion of Phe508, fails to properly fold. To elucidate the role Phe508 plays in the folding of CFTR, missense mutations at this position were generated. Only one missense mutation had a pronounced effect on the stability and folding of the isolated domain in vitro. In contrast, many substitutions, including those of charged and bulky residues, disrupted folding of full-length CFTR in cells. Structures of two mutant nucleotide-binding domains (NBDs) reveal only local alterations of the surface near position 508. These results suggest that the peptide backbone plays a role in the proper folding of the domain, whereas the side chain plays a role in defining a surface of NBD1 that potentially interacts with other domains during the maturation of intact CFTR.

  2. A renormalization approach to describe charge transport in quasiperiodic dangling backbone ladder (DBL)-DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofisica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Albuquerque, E.L., E-mail: [Departamento de Biofisica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Caetano, E.W.S. [Instituto Federal de Educacao, Ciencia e Tecnologia do Ceara, 60040-531 Fortaleza, CE (Brazil); Freire, V.N. [Departamento de Fisica, Universidade Federal do Ceara, 60455-760 Fortaleza, CE (Brazil)


    Highlights: → One-step renormalization approach to describe the DBL-DNA molecule. → Electronic tight-binding Hamiltonian model. → A quasiperiodic sequence to mimic the DNA nucleotides arrangement. → Electronic transmission spectra. → I-V characteristics. -- Abstract: We study the charge transport properties of a dangling backbone ladder (DBL)-DNA molecule focusing on a quasiperiodic arrangement of its constituent nucleotides forming a Rudin-Shapiro (RS) and Fibonacci (FB) Poly (CG) sequences, as well as a natural DNA sequence (Ch22) for the sake of comparison. Making use of a one-step renormalization process, the DBL-DNA molecule is modeled in terms of a one-dimensional tight-binding Hamiltonian to investigate its transmissivity and current-voltage (I-V) profiles. Beyond the semiconductor I-V characteristics, a striking similarity between the electronic transport properties of the RS quasiperiodic structure and the natural DNA sequence was found.

  3. Extensive Air Showers: from the muonic smoking guns to the hadronic backbone

    CERN Document Server

    Cazon, L


    Extensive Air Showers are complex macroscopic objects initiated by single ultra-high energy particles. They are the result of millions of high energy reactions in the atmosphere and can be described as the superposition of hadronic and electromagnetic cascades. The hadronic cascade is the air shower backbone, and it is mainly made of pions. Decays of neutral pions initiate electromagnetic cascades, while the decays of charged pions produce muons which leave the hadronic core and travel many kilometers almost unaffected. Muons are smoking guns of the hadronic cascade: the energy, transverse momentum, spatial distribution and depth of production are key to reconstruct the history of the air shower. In this work, we overview the phenomenology of muons on the air shower and its relation to the hadronic cascade. We briefly review the experimental efforts to analyze muons within air showers and discuss possible paths to use this information.

  4. Extensive Air Showers: from the muonic smoking guns to the hadronic backbone

    Directory of Open Access Journals (Sweden)

    Cazon L.


    Full Text Available Extensive Air Showers are complex macroscopic objects initiated by single ultra-high energy particles. They are the result of millions of high energy reactions in the atmosphere and can be described as the superposition of hadronic and electromagnetic cascades. The hadronic cascade is the air shower backbone, and it is mainly made of pions. Decays of neutral pions initiate electromagnetic cascades, while the decays of charged pions produce muons which leave the hadronic core and travel many kilometers almost unaffected. Muons are smoking guns of the hadronic cascade: the energy, transverse momentum, spatial distribution and depth of production are key to reconstruct the history of the air shower. In this work, we overview the phenomenology of muons on the air shower and its relation to the hadronic cascade. We briefly review the experimental efforts to analyze muons within air showers and discuss possible paths to use this information.

  5. Constructing Path Efficient and Energy Aware Virtual Multicast Backbones in Static Ad Hoc Wireless Networks

    Directory of Open Access Journals (Sweden)

    Tamaghna Acharya


    Full Text Available For stationary wireless ad hoc networks, one of the key challenging issues in routing and multicasting isto conserve as much energy as possible without compromising path efficiency measured as end-to-enddelay. In this paper, we address the problem of path efficient and energy aware multicasting in staticwireless ad hoc networks. We propose a novel distributed scalable algorithm for finding a virtualmulticast backbone (VMB. Based on this VMB, we have further developed a multicasting scheme thatjointly improves path efficiency and energy conservation. By exploiting inherent broadcast advantage ofwireless communication and employing a more realistic energy consumption model for wirelesscommunication which not only depends on radio propagation losses but also on energy losses intransceiver circuitry, our simulation results show that the proposed VMB-based multicasting schemeoutperforms existing prominent tree based energy conserving, path efficient multicasting schemes.

  6. Effects of Tryptophan Content and Backbone Spacing on the Uptake Efficiency of Cell-Penetrating Peptides

    KAUST Repository

    Rydberg, Hanna A.


    Cell-penetrating peptides (CPPs) are able to traverse cellular membranes and deliver macromolecular cargo. Uptake occurs through both endocytotic and nonendocytotic pathways, but the molecular requirements for efficient internalization are not fully understood. Here we investigate how the presence of tryptophans and their position within an oligoarginine influence uptake mechanism and efficiency. Flow cytometry and confocal fluorescence imaging are used to estimate uptake efficiency, intracellular distribution and toxicity in Chinese hamster ovarian cells. Further, membrane leakage and lipid membrane affinity are investigated. The peptides contain eight arginine residues and one to four tryptophans, the tryptophans positioned either at the N-terminus, in the middle, or evenly distributed along the amino acid sequence. Our data show that the intracellular distribution varies among peptides with different tryptophan content and backbone spacing. Uptake efficiency is higher for the peptides with four tryptophans in the middle, or evenly distributed along the peptide sequence, than for the peptide with four tryptophans at the N-terminus. All peptides display low cytotoxicity except for the one with four tryptophans at the N-terminus, which was moderately toxic. This finding is consistent with their inability to induce efficient leakage of dye from lipid vesicles. All peptides have comparable affinities for lipid vesicles, showing that lipid binding is not a decisive parameter for uptake. Our results indicate that tryptophan content and backbone spacing can affect both the CPP uptake efficiency and the CPP uptake mechanism. The low cytotoxicity of these peptides and the possibilities of tuning their uptake mechanism are interesting from a therapeutic point of view. © 2012 American Chemical Society.

  7. Antigenic characterization of influenza viruses produced using synthetic DNA and novel backbones. (United States)

    Suphaphiphat, Pirada; Whittaker, Lynne; De Souza, Ivna; Daniels, Rodney S; Dormitzer, Philip R; McCauley, John W; Settembre, Ethan C


    The global system for manufacturing seasonal influenza vaccines has been developed to respond to the natural evolution of influenza viruses, but the problem of antigenic mismatch continues to be a challenge in certain years. In some years, mismatches arise naturally due to the antigenic drift of circulating viruses after vaccine strain selection has already been made. In other years, antigenic differences between the vaccine virus and circulating viruses are introduced as part of the current system, which relies on the use of egg-adapted isolates as a starting material for candidate vaccine viruses (CVVs). Improving the current process for making vaccine viruses can provide great value. We have previously established a synthetic approach for rapidly generating influenza viruses in a vaccine-approved Madin Darby canine kidney (MDCK) cell line using novel, high-growth backbones that increase virus rescue efficiency and antigen yield. This technology also has the potential to produce viruses that maintain antigenic similarity to the intended reference viruses, depending on the hemagglutinin (HA) and neuraminidase (NA) sequences used for gene synthesis. To demonstrate this utility, we generated a panel of synthetic viruses using HA and NA sequences from recent isolates and showed by hemagglutination inhibition (HI) tests that all synthetic viruses were antigenically-like their conventional egg- or cell-propagated reference strains and there was no impact of the novel backbones on antigenicity. This synthetic approach can be used for the efficient production of CVVs that may be more representative of circulating viruses and may be used for both egg- and cell-based vaccine manufacturing platforms. When combined with mammalian cell culture technology for antigen production, synthetic viruses generated using HA and NA sequences from a non-egg-adapted prototype can help to reduce the potential impact of antigenic differences between vaccine virus and circulating viruses on

  8. 40-Gbps optical backbone network deep packet inspection based on FPGA (United States)

    Zuo, Yuan; Huang, Zhiping; Su, Shaojing


    In the era of information, the big data, which contains huge information, brings about some problems, such as high speed transmission, storage and real-time analysis and process. As the important media for data transmission, the Internet is the significant part for big data processing research. With the large-scale usage of the Internet, the data streaming of network is increasing rapidly. The speed level in the main fiber optic communication of the present has reached 40Gbps, even 100Gbps, therefore data on the optical backbone network shows some features of massive data. Generally, data services are provided via IP packets on the optical backbone network, which is constituted with SDH (Synchronous Digital Hierarchy). Hence this method that IP packets are directly mapped into SDH payload is named POS (Packet over SDH) technology. Aiming at the problems of real time process of high speed massive data, this paper designs a process system platform based on ATCA for 40Gbps POS signal data stream recognition and packet content capture, which employs the FPGA as the CPU. This platform offers pre-processing of clustering algorithms, service traffic identification and data mining for the following big data storage and analysis with high efficiency. Also, the operational procedure is proposed in this paper. Four channels of 10Gbps POS signal decomposed by the analysis module, which chooses FPGA as the kernel, are inputted to the flow classification module and the pattern matching component based on TCAM. Based on the properties of the length of payload and net flows, buffer management is added to the platform to keep the key flow information. According to data stream analysis, DPI (deep packet inspection) and flow balance distribute, the signal is transmitted to the backend machine through the giga Ethernet ports on back board. Practice shows that the proposed platform is superior to the traditional applications based on ASIC and NP.

  9. Quantum chemical benchmark study on 46 RNA backbone families using a dinucleotide unit. (United States)

    Kruse, Holger; Mladek, Arnost; Gkionis, Konstantinos; Hansen, Andreas; Grimme, Stefan; Sponer, Jiri


    We have created a benchmark set of quantum chemical structure-energy data denoted as UpU46, which consists of 46 uracil dinucleotides (UpU), representing all known 46 RNA backbone conformational families. Penalty-function-based restrained optimizations with COSMO TPSS-D3/def2-TZVP ensure a balance between keeping the target conformation and geometry relaxation. The backbone geometries are close to the clustering-means of their respective RNA bioinformatics family classification. High-level wave function methods (DLPNO-CCSD(T) as reference) and a wide-range of dispersion-corrected or inclusive DFT methods (DFT-D3, VV10, LC-BOP-LRD, M06-2X, M11, and more) are used to evaluate the conformational energies. The results are compared to the Amber RNA bsc0χOL3 force field. Most dispersion-corrected DFT methods surpass the Amber force field significantly in accuracy and yield mean absolute deviations (MADs) for relative conformational energies of ∼0.4-0.6 kcal/mol. Double-hybrid density functionals represent the most accurate class of density functionals. Low-cost quantum chemical methods such as PM6-D3H+, HF-3c, DFTB3-D3, as well as small basis set calculations corrected for basis set superposition errors (BSSEs) by the gCP procedure are also tested. Unfortunately, the presently available low-cost methods are struggling to describe the UpU conformational energies with satisfactory accuracy. The UpU46 benchmark is an ideal test for benchmarking and development of fast methods to describe nucleic acids, including force fields. PMID:26574283

  10. In the Near Future Backbone Aluminum Enterprises will Close Down About 2.4 million Tonnes of Capacity

    Institute of Scientific and Technical Information of China (English)


    On August 21,China Nonferrous Metals Industry Association Aluminum Industry Branch assembled some backbone aluminum enterprises and Henan Nonferrous Metal Industry Association to hold a discussion meeting in Beijing over the current operation trend of aluminum industry,dilemma and opportunity ahead and measures to diffuse surplus capacity,the meeting also discussed the

  11. VPLS: alternativa de interconexión a través del backbone IP/MPLS de ETECSA

    Directory of Open Access Journals (Sweden)

    Osmel Barreto Prieto


    Full Text Available La Empresa de Telecomunicaciones de Cuba (ETECSA maneja en condiciones de exclusividad la infraestructura de telecomunicaciones del país, por lo que el resto de los proveedores necesitan utilizar dicha infraestructura como soporte para la interconexión de los nodos que componen sus redes. Teniendo en cuenta el desarrollo de las tecnologías de las telecomunicaciones, ETECSA ha apostado por la implementación de un backbone IP/MPLS (Internet Protocol over  MultiProtocol Label Switching: Protocolo de Internet sobre Conmutación Multiprotocolo basada en Etiquetas en su red, el cual se espera absorba todos los servicios actualmente soportados por el backbone ATM (Asynchronous Transfer Mode/Frame Relay. Sin embargo, en estos momentos, la red IP/MPLS solamente oferta servicios VPN (Virtual Private Network: Red Privada Virtual a nivel de red (nivel tres del modelo OSI, cuestión que, para los otros proveedores, resulta inadmisible. El presente artículo describe una propuesta de implementación de una entidad VPLS (Virtual Private LAN Service: Servicio de LAN Privada Virtual como alternativa para la migración de los servicios de VPN de nivel dos que actualmente se soportan sobre el backbone ATM/Frame Relay, hacia el backbone IP/MPLS, variante que garantiza la independencia por parte de los proveedores que son clientes de ETECSA en la operación y enrutamiento de su red.

  12. Adsorption of molecular brushes with polyelectrolyte backbones onto oppositely charged surfaces: A self-consistent field theory

    NARCIS (Netherlands)

    Feuz, L.; Leermakers, F.A.M.; Textor, M.; Borisov, O.V.


    The two-gradient version of the Scheutjens¿Fleer self-consistent field (SF-SCF) theory is employed to model the interaction between a molecular bottle brush with a polyelectrolyte backbone and neutral hydrophilic side chains and an oppositely charged surface. Our system mimics graft-copolymers with

  13. Interaction of Al-induced peptide backbone ring structure with the sidechains of His, Phe, Trp and Tyr

    Institute of Scientific and Technical Information of China (English)

    吴清雷; 宋波


    Aluminium is widely used as an antimicrobial coagulant, food additive, and cookware. However, many reports indicate that aluminium may be a critical factor in many amyloid diseases, such as Alzheimer’s disease and Parkinson’s disease. Unfortunately, the underlying mechanism is still poorly understood, which limits efforts to prevent and treat these diseases. In this paper, using an ab initio method, we studied the interaction of Al-backbone ring structure with theπ-electron-rich sidechains of His, Phe, Trp, and Tyr. We found that in the absence of water, the Al-backbone ring can stably bind with those sidechains. In the presence of water, the Al-backbone ring can bind to the His sidechain and cannot bind to the other sidechains. As revealed by further investigations, this could be attributed to the fact that there was a coordinate bond of the Al-backbone ring with the His sidechain, while there were theπ-πstacking and cation-π-like interactions with the other sidechains. These findings potentially provide a molecular understanding of Al-related toxicity, and may be helpful in designing drugs for those aforementioned aluminum-linked diseases and encourage treatment of Al-polluted water.

  14. Research on the Incentive Management of Backbone Stu-dent Teams in Colleges and Universities%高等学校学生骨干队伍激励管理研究

    Institute of Scientific and Technical Information of China (English)



    高校大学生骨干队伍是高校学生工作中一支不可忽略的力量,他们承担着大学生自我管理、自我教育和自我服务的重要功能,在高校中发挥着宣传向导、组织管理和服务沟通的作用。如何培养和建设一支高素质的高校大学生骨干队伍,以适应新时期大学生思想政治教育工作的实际需要,是当前高校在学生管理工作中必须认真思考和研究的一个重要课题。本文基于差异化激励理论,针对高校学生骨干队伍中存在的问题,探讨根据不同类型学生骨干,因时、因地、因活动采用不同的激励方式,从而有效地促进学生骨干的健康成长、班集体的和谐发展。%The university backbone student team is a significant power in university student work. They shoulder the important functions of university students' self-management, self-education and self-service, and play the role of publicity and guidance, or-ganization and management, service and communication in uni-versities. How to cultivate and construct a high-quality university backbone student team in order to meet the practical demands of university students' ideological and political education in the new period, is an important topic for the current university student management work. Based on the differentiated incentive theory, in view of the problems existing in university backbone student teams, this paper explored the adoption of different incentive methods in accordance with different types of backbone students, as well as different time, places and activities, thus effectively promoting the healthy growth of backbone students and the har-monious development of class collectives.

  15. An Enhanced Backbone-Assisted Reliable Framework for Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Amna Ali


    Full Text Available An extremely reliable source to sink communication is required for most of the contemporary WSN applications especially pertaining to military, healthcare and disaster-recovery. However, due to their intrinsic energy, bandwidth and computational constraints, Wireless Sensor Networks (WSNs encounter several challenges in reliable source to sink communication. In this paper, we present a novel reliable topology that uses reliable hotlines between sensor gateways to boost the reliability of end-to-end transmissions. This reliable and efficient routing alternative reduces the number of average hops from source to the sink. We prove, with the help of analytical evaluation, that communication using hotlines is considerably more reliable than traditional WSN routing. We use reliability theory to analyze the cost and benefit of adding gateway nodes to a backbone-assisted WSN. However, in hotline assisted routing some scenarios where source and the sink are just a couple of hops away might bring more latency, therefore, we present a Signature Based Routing (SBR scheme. SBR enables the gateways to make intelligent routing decisions, based upon the derived signature, hence providing lesser end-to-end delay between source to the sink communication. Finally, we evaluate our proposed hotline based topology with the help of a simulation tool and show that the proposed topology provides manifold increase in end-to-end reliability.

  16. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds. (United States)

    Cino, Elio A; Soares, Iaci N; Pedrote, Murilo M; de Oliveira, Guilherme A P; Silva, Jerson L


    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  17. 4D experiments measured with APSY for automated backbone resonance assignments of large proteins

    International Nuclear Information System (INIS)

    Detailed structural and functional characterization of proteins by solution NMR requires sequence-specific resonance assignment. We present a set of transverse relaxation optimization (TROSY) based four-dimensional automated projection spectroscopy (APSY) experiments which are designed for resonance assignments of proteins with a size up to 40 kDa, namely HNCACO, HNCOCA, HNCACB and HN(CO)CACB. These higher-dimensional experiments include several sensitivity-optimizing features such as multiple quantum parallel evolution in a ‘just-in-time’ manner, aliased off-resonance evolution, evolution-time optimized APSY acquisition, selective water-handling and TROSY. The experiments were acquired within the concept of APSY, but they can also be used within the framework of sparsely sampled experiments. The multidimensional peak lists derived with APSY provided chemical shifts with an approximately 20 times higher precision than conventional methods usually do, and allowed the assignment of 90 % of the backbone resonances of the perdeuterated primase-polymerase ORF904, which contains 331 amino acid residues and has a molecular weight of 38.4 kDa.

  18. Suitability assessment of OPC UA as the backbone of ground-based observatory control systems

    International Nuclear Information System (INIS)

    A common requirement of modern observatory control systems is to allow interaction between various heterogeneous subsystems in a transparent way. However, the integration of off-the-shelf (OTS) industrial products - such as Programmable Logic Controllers (PLCs) and Supervisory Control And Data Acquisition (SCADA) software - has long been hampered by the lack of an adequate interfacing method. With the advent of the Unified Architecture (UA) version of OPC (Object Linking and Embedding for Process Control), the limitations of the original industry accepted interface are now lifted, and also much more functionality has been defined. In this paper the most important features of OPC UA are matched against the requirements of ground-based observatory control systems in general and in particular of the 1.2 m Mercator Telescope. We investigate the opportunities of the 'information modelling' idea behind OPC UA, which could allow an extensive standardization in the field of astronomical instrumentation, similar to the efforts emerging in several industry domains. Because OPC UA is designed for both horizontal and vertical integration of heterogeneous subsystems, we explore its capabilities to serve as the backbone of a dependable and scalable observatory control system, treating industrial components like PLCs no differently than custom software components. Performance measurements and tests with a sample of OTS OPC UA products are presented. (authors)

  19. Highly automated protein backbone resonance assignment within a few hours: the strategy and software package

    International Nuclear Information System (INIS)

    Sequential resonance assignment represents an essential step towards the investigation of protein structure, dynamics, and interaction surfaces. Although the experimental sensitivity has significantly increased in recent years, with the availability of high field magnets and cryogenically cooled probes, resonance assignment, even of small globular proteins, still generally requires several days of data collection and analysis using standard protocols. Here we introduce the BATCH strategy for fast and highly automated backbone resonance assignment of 13C, 15N-labelled proteins. BATCH makes use of the fast data acquisition and analysis tools BEST, ASCOM, COBRA, and HADAMAC, recently developed in our laboratory. An improved Hadamard encoding scheme, presented here, further increases the performance of the HADAMAC experiment. A new software platform, interfaced to the NMRView software package, has been developed that enables highly automated NMR data processing and analysis, sequential resonance assignment, and 13C chemical shift extraction. We demonstrate for four small globular proteins that sequential resonance assignment can be routinely obtained within a few hours, or less, in a highly automated and robust way

  20. STARD6 on steroids: solution structure, multiple timescale backbone dynamics and ligand binding mechanism (United States)

    Létourneau, Danny; Bédard, Mikaël; Cabana, Jérôme; Lefebvre, Andrée; LeHoux, Jean-Guy; Lavigne, Pierre


    START domain proteins are conserved α/β helix-grip fold that play a role in the non-vesicular and intracellular transport of lipids and sterols. The mechanism and conformational changes permitting the entry of the ligand into their buried binding sites is not well understood. Moreover, their functions and the identification of cognate ligands is still an active area of research. Here, we report the solution structure of STARD6 and the characterization of its backbone dynamics on multiple time-scales through 15N spin-relaxation and amide exchange studies. We reveal for the first time the presence of concerted fluctuations in the Ω1 loop and the C-terminal helix on the microsecond-millisecond time-scale that allows for the opening of the binding site and ligand entry. We also report that STARD6 binds specifically testosterone. Our work represents a milestone for the study of ligand binding mechanism by other START domains and the elucidation of the biological function of STARD6. PMID:27340016

  1. Reversible Self-Assembly of Backbone-Thermoresponsive Long Chain Hyperbranched Poly(N-Isopropyl Acrylamide

    Directory of Open Access Journals (Sweden)

    Ting-Ting Liu


    Full Text Available In this paper, we mainly described the reversible self-assembly of a backbone-thermoresponsive, long-chain, hyperbranched poly(N-isopropyl acrylamide (LCHBPNIPAM in aqueous solution. Here, we revealed a reversible self-assembly behavior of LCHBPNIPAM aqueous solution derived from temperature. By controlling the temperature of LCHBPNIPAM aqueous solution, we tune the morphology of the LCHBPNIPAM self-assemblies. When the solution temperature increased from the room temperature to the lower critical solution temperature of PNIPAM segments, LCHBPNIPAM self-assembled from multi-compartment vesicles into solid micelles. The morphology of LCHBPNIPAM self-assemblies changed from solid micelles to multi-compartment vesicles again when the temperature decreased back to the room temperature. The size presented, at first, an increase, and then a decrease, tendency in the heating-cooling process. The above thermally-triggered self-assembly behavior of LCHBPNIPAM aqueous solution was investigated by dynamic/static light scattering, transmission electron microscopy, atomic force microscopy, fluorescence spectroscopy, 1H nuclear magnetic resonance in D2O, and attenuated total reflectance Fourier transform infrared spectroscopy. These results indicated that LCHBPNIPAM aqueous solution presents a reversible self-assembly process. The controlled release behaviors of doxorubicin from the vesicles and micelles formed by LCHBPNIPAM further proved the feasibility of these self-assemblies as the stimulus-responsive drug delivery system.

  2. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds (United States)

    Cino, Elio A.; Soares, Iaci N.; Pedrote, Murilo M.; de Oliveira, Guilherme A. P.; Silva, Jerson L.


    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  3. APSY-NMR for protein backbone assignment in high-throughput structural biology

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, Samit Kumar; Serrano, Pedro; Proudfoot, Andrew; Geralt, Michael [The Scripps Research Institute, Department of Integrative Structural and Computational Biology (United States); Pedrini, Bill [Paul Scherrer Institute (PSI), SwissFEL Project (Switzerland); Herrmann, Torsten [Université de Lyon, Institut des Sciences Analytiques, Centre de RMN à Très Hauts Champs, UMR 5280 CNRS, ENS Lyon, UCB Lyon 1 (France); Wüthrich, Kurt, E-mail: [The Scripps Research Institute, Department of Integrative Structural and Computational Biology (United States)


    A standard set of three APSY-NMR experiments has been used in daily practice to obtain polypeptide backbone NMR assignments in globular proteins with sizes up to about 150 residues, which had been identified as targets for structure determination by the Joint Center for Structural Genomics (JCSG) under the auspices of the Protein Structure Initiative (PSI). In a representative sample of 30 proteins, initial fully automated data analysis with the software UNIO-MATCH-2014 yielded complete or partial assignments for over 90 % of the residues. For most proteins the APSY data acquisition was completed in less than 30 h. The results of the automated procedure provided a basis for efficient interactive validation and extension to near-completion of the assignments by reference to the same 3D heteronuclear-resolved [{sup 1}H,{sup 1}H]-NOESY spectra that were subsequently used for the collection of conformational constraints. High-quality structures were obtained for all 30 proteins, using the J-UNIO protocol, which includes extensive automation of NMR structure determination.

  4. Noise assisted excitation energy transfer in a linear model of a selectivity filter backbone strand (United States)

    Bassereh, Hassan; Salari, Vahid; Shahbazi, Farhad


    In this paper, we investigate the effect of noise and disorder on the efficiency of excitation energy transfer (EET) in a N=5 sites linear chain with ‘static’ dipole-dipole couplings. In fact, here, the disordered chain is a toy model for one strand of the selectivity filter backbone in ion channels. It has recently been discussed that the presence of quantum coherence in the selectivity filter is possible and can play a role in mediating ion-conduction and ion-selectivity in the selectivity filter. The question is ‘how a quantum coherence can be effective in such structures while the environment of the channel is dephasing (i.e. noisy)?’ Basically, we expect that the presence of the noise should have a destructive effect in the quantum transport. In fact, we show that such expectation is valid for ordered chains. However, our results indicate that introducing the dephasing in the disordered chains leads to the weakening of the localization effects, arising from the multiple back-scatterings due to the randomness, and then increases the efficiency of quantum energy transfer. Thus, the presence of noise is crucial for the enhancement of EET efficiency in disordered chains. We also show that the contribution of both classical and quantum mechanical effects are required to improve the speed of energy transfer along the chain. Our analysis may help for better understanding of fast and efficient functioning of the selectivity filters in ion channels.

  5. APSY-NMR for protein backbone assignment in high-throughput structural biology

    International Nuclear Information System (INIS)

    A standard set of three APSY-NMR experiments has been used in daily practice to obtain polypeptide backbone NMR assignments in globular proteins with sizes up to about 150 residues, which had been identified as targets for structure determination by the Joint Center for Structural Genomics (JCSG) under the auspices of the Protein Structure Initiative (PSI). In a representative sample of 30 proteins, initial fully automated data analysis with the software UNIO-MATCH-2014 yielded complete or partial assignments for over 90 % of the residues. For most proteins the APSY data acquisition was completed in less than 30 h. The results of the automated procedure provided a basis for efficient interactive validation and extension to near-completion of the assignments by reference to the same 3D heteronuclear-resolved [1H,1H]-NOESY spectra that were subsequently used for the collection of conformational constraints. High-quality structures were obtained for all 30 proteins, using the J-UNIO protocol, which includes extensive automation of NMR structure determination

  6. Dolutegravir treatment response by baseline viral load and NRTI backbone in treatment-naïve HIV-infected individuals

    Directory of Open Access Journals (Sweden)

    C Small


    Full Text Available Background: In two 48-week studies in naïve subjects, dolutegravir with NRTI of choice has shown non-inferiority to raltegravir and, with ABC/3TC, superiority to Atripla. Factors that influenced choice of NRTIs included viral load, resistance and safety. Methods: We analysed response rates and time to virologic failure by NRTI backbone and baseline viral load in the pivotal DTG-naïve studies. SPRING-2 randomized participants to DTG 50 mg QD or RAL 400 mg BID, each in combination with investigator-selected NRTIs (TDF/FTC or ABC/3TC. SINGLE randomised participants to DTG 50 mg+ABC/3TC QD or TDF/FTC/EFV (Atripla QD. In SPRING-2, changes in serum creatinine were examined by INI and NRTI backbone. Results: The two studies randomized and treated 1655 subjects, of whom 249 (15% were female, 388 (23% non-white, 495 (30% had HIV-1 RNA >100,000 c/ml, and 224 (14% had CD4+ count <200 cells/mm3. Primary analyses demonstrated non-inferiority of DTG to RAL in SPRING-2 (Δ=2.5%; 95% CI:−2.2% to +7.1%, excluding −10%, and superiority of the DTG regimen in SINGLE (7.4%; +2.5% to +12.3%. In SPRING-2, response rates by NRTI backbone were comparable in each viral load stratum. In SINGLE, a 7% difference in response (favoring DTG+ABC/3TC was observed in each viral load stratum. Exploratory analyses examining time-to-virologic failure showed no difference in response rates between the NRTIs irrespective of baseline viral load or study. Resistance to INIs or NRTIs was not demonstrated in any subject on DTG-based therapy through 48 weeks. Withdrawals due to AEs on DTG-based regimen were few (2% in both studies. In SPRING-2, no significant differences were observed in serum creatinine change from baseline to Week 48 by NRTI backbones. Conclusions: In SPRING-2 and SINGLE, DTG was effective with both ABC/3TC and TDF/FTC, and in subjects with high and low viral load. DTG was well tolerated in both studies. Renal safety also was similar by NRTI backbone. DTG is a once

  7. Catalytic mechanism of RNA backbone cleavage by ribonuclease H from quantum mechanics/molecular mechanics simulations. (United States)

    Rosta, Edina; Nowotny, Marcin; Yang, Wei; Hummer, Gerhard


    We use quantum mechanics/molecular mechanics simulations to study the cleavage of the ribonucleic acid (RNA) backbone catalyzed by ribonuclease H. This protein is a prototypical member of a large family of enzymes that use two-metal catalysis to process nucleic acids. By combining Hamiltonian replica exchange with a finite-temperature string method, we calculate the free energy surface underlying the RNA-cleavage reaction and characterize its mechanism. We find that the reaction proceeds in two steps. In a first step, catalyzed primarily by magnesium ion A and its ligands, a water molecule attacks the scissile phosphate. Consistent with thiol-substitution experiments, a water proton is transferred to the downstream phosphate group. The transient phosphorane formed as a result of this nucleophilic attack decays by breaking the bond between the phosphate and the ribose oxygen. In the resulting intermediate, the dissociated but unprotonated leaving group forms an alkoxide coordinated to magnesium ion B. In a second step, the reaction is completed by protonation of the leaving group, with a neutral Asp132 as a likely proton donor. The overall reaction barrier of ∼15 kcal mol(-1), encountered in the first step, together with the cost of protonating Asp132, is consistent with the slow measured rate of ∼1-100/min. The two-step mechanism is also consistent with the bell-shaped pH dependence of the reaction rate. The nonmonotonic relative motion of the magnesium ions along the reaction pathway agrees with X-ray crystal structures. Proton-transfer reactions and changes in the metal ion coordination emerge as central factors in the RNA-cleavage reaction. PMID:21539371

  8. Catalytic Mechanism of RNA Backbone Cleavage by Ribonuclease H from QM/MM Simulations (United States)

    Rosta, Edina; Nowotny, Marcin; Yang, Wei; Hummer, Gerhard


    We use quantum mechanics/molecular mechanics (QM/MM) simulations to study the cleavage of the ribonucleic acid (RNA) backbone catalyzed by ribonuclease H. This protein is a prototypical member of a large family of enzymes that use two-metal catalysis to process nucleic acids. By combining Hamiltonian replica exchange with a finite-temperature string method, we calculate the free energy surface underlying the RNA cleavage reaction and characterize its mechanism. We find that the reaction proceeds in two steps. In a first step, catalyzed primarily by magnesium ion A and its ligands, a water molecule attacks the scissile phosphate. Consistent with thiol-substitution experiments, a water proton is transferred to the downstream phosphate group. The transient phosphorane formed as a result of this nucleophilic attack decays by breaking the bond between the phosphate and the ribose oxygen. In the resulting intermediate, the dissociated but unprotonated leaving group forms an alkoxide coordinated to magnesium ion B. In a second step, the reaction is completed by protonation of the leaving group, with a neutral Asp132 as a likely proton donor. The overall reaction barrier of ~15 kcal mol−1, encountered in the first step, together with the cost of protonating Asp132, is consistent with the slow measured rate of ~1–100/min. The two-step mechanism is also consistent with the bell-shaped pH dependence of the reaction rate. The non-monotonic relative motion of the magnesium ions along the reaction pathway agrees with X-ray crystal structures. Proton transfer reactions and changes in the metal ion coordination emerge as central factors in the RNA cleavage reaction. PMID:21539371

  9. Reduced Dimensionality (4,3)D-hnCOCANH Experiment: An Efficient Backbone Assignment tool for NMR studies of Proteins

    CERN Document Server

    Kumar, Dinesh


    Sequence specific resonance assignment and secondary structure determination of proteins form the basis for variety of structural and functional proteomics studies by NMR. In this context, an efficient standalone method for rapid assignment of backbone (1H, 15N, 13Ca and 13C') resonances and secondary structure determination of proteins has been presented here. Compared to currently available strategies used for the purpose, the method employs only a single reduced dimensionality (RD) experiment -(4,3)D-hnCOCANH and exploits the linear combinations of backbone (13Ca and 13C') chemical shifts to achieve a dispersion relatively better compared to those of individual chemical shifts (see the text) for efficient and rapid data analysis. Further, the experiment leads to the spectrum with direct distinction of self (intra-residue) and sequential (inter-residue) carbon correlation peaks; these appear opposite in signs and therefore can easily be discriminated without using an additional complementary experiment. On ...

  10. Free vibration analysis of a robotic fish based on a continuous and non-uniform flexible backbone with distributed masses (United States)

    Coral, W.; Rossi, C.; Curet, O. M.


    This paper presents a Differential Quadrature Element Method for free transverse vibration of a robotic fish based on a continuous and non-uniform flexible backbone with distributed masses (fish ribs). The proposed method is based on the theory of a Timoshenko cantilever beam. The effects of the masses (number, magnitude and position) on the value of natural frequencies are investigated. Governing equations, compatibility and boundary conditions are formulated according to the Differential Quadrature rules. The convergence, efficiency and accuracy are compared to other analytical solution proposed in the literature. Moreover, the proposed method has been validate against the physical prototype of a flexible fish backbone. The main advantages of this method, compared to the exact solutions available in the literature are twofold: first, smaller computational cost and second, it allows analysing the free vibration in beams whose section is an arbitrary function, which is normally difficult or even impossible with other analytical methods.

  11. Fluorous Peptide Nucleic Acids: PNA Analogues with Fluorine in Backbone (γ-CF2-apg-PNA) Enhance Cellular Uptake. (United States)

    Ellipilli, Satheesh; Ganesh, Krishna N


    Fluorous PNA analogues possessing fluorine as inherent part of aminopropylglycine (apg) backbone (γ-CF2-apg PNA) have been synthesized and evaluated for biophysical and cell penetrating properties. These form duplexes of higher thermal stability with cRNA than cDNA, although destabilized compared to duplexes of standard aeg-PNA. Cellular uptake of the fluorinated γ-CF2-apg PNAs in NIH 3T3 and HeLa cells was 2-3-fold higher compared to that of nonfluorinated apg PNA, with NIH 3T3 cells showing better permeability compared to HeLa cells. The backbone fluorinated PNAs, which are first in this class, when combined with other chemical modifications may have potential for future PNA-based antisense agents. PMID:26322827

  12. A new default restraint library for the protein backbone in Phenix: a conformation-dependent geometry goes mainstream (United States)

    Moriarty, Nigel W.; Tronrud, Dale E.; Adams, Paul D.; Karplus, P. Andrew


    Chemical restraints are a fundamental part of crystallographic protein structure refinement. In response to mounting evidence that conventional restraints have shortcomings, it has previously been documented that using backbone restraints that depend on the protein backbone conformation helps to address these shortcomings and improves the performance of refinements [Moriarty et al. (2014 ▸), FEBS J. 281, 4061–4071]. It is important that these improvements be made available to all in the protein crystallography community. Toward this end, a change in the default geometry library used by Phenix is described here. Tests are presented showing that this change will not generate increased numbers of outliers during validation, or deposition in the Protein Data Bank, during the transition period in which some validation tools still use the conventional restraint libraries. PMID:26894545

  13. Direct measurement of the correlated dynamics of the protein-backbone and proximal waters of hydration in mechanically strained elastin

    CERN Document Server

    Sun, Cheng; Huang, Jiaxin; Boutis, Gregory S


    We report on the direct measurement of the correlation times of the protein backbone carbons and proximal waters of hydration in mechanically strained elastin by nuclear magnetic resonance methods. The experimental data indicate a decrease in the correlation times of the carbonyl carbons as the strain on the biopolymer is increased. These observations are in good agreement with short 4ns molecular dynamics simulations of (VPGVG)3, a well studied mimetic peptide of elastin. The experimental results also indicate a reduction in the correlation time of proximal waters of hydration with increasing strain applied to the elastomer. A simple model is suggested that correlates the increase in the motion of proximal waters of hydration to the increase in frequency of libration of the protein backbone that develops with increasing strain. Together, the reduction in the protein entropy accompanied with the increase in entropy of the proximal waters of hydration with increasing strain, support the notion that the source ...

  14. Backbone dynamics of reduced plastocyanin from the cyanobacterium Anabaena variabilis: Regions involved in electron transfer have enhanced mobility

    DEFF Research Database (Denmark)

    Ma, L.X.; Hass, M.A.S.; Vierick, N.; Kristensen, S.M.; Ulstrup, Jens; Led, J.J.


    -free approach. The C-13 relaxation studies were performed using C-13 in natural abundance. Overall, it is found that the protein backbone is rigid. However, the regions that are important for the function of the protein show moderate mobility primarily on the microsecond to millisecond time scale. These regions...... are the "northern" hydrophobic site close to the metal site, the metal site itself, and the "eastern" face of the molecule. In particular, the mobility of the latter region is interesting in light of recent findings indicating that residues also on the eastern face of plastocyanins from prokaryotes...... are important for the function of the protein. The study also demonstrates that relaxation rates and NOEs of the C-13(alpha) nuclei of proteins are valuable supplements to the conventional N-15 relaxation measurements in studies of protein backbone dynamics....

  15. TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence


    Fortin, Connor H.; Schulze, Katharina V.; Babbitt, Gregory A.


    Background It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence lo...

  16. De novo backbone and sequence design of an idealized alpha/beta-barrel protein: Evidence of stable tertiary structure


    Offredi, Fabrice; Dubail, Fabien; Kischel, Philippe; Sarinski, K.; Stern, A S; Van de Weerdt, Cécile; Hoch, J. C.; Prosperi, Christelle; François, Jean-Marie; Mayo, S. L.; Martial, Joseph


    We have designed, synthesized, and characterized a 216 amino acid residue sequence encoding a putative idealized alpha/beta-barrel protein. The design was elaborated in two steps. First, the idealized backbone was defined with geometric parameters representing our target fold: a central eight parallel-stranded beta-sheet surrounded by eight parallel alpha-helices, connected together with short structural turns on both sides of the barrel. An automated sequence selection algorithm, based on th...

  17. The topology and the emerging urban geographies of the Internet backbone and aviation networks in Europe: a comparative study


    Emmanouil Tranos


    The objective of this paper is to compare the topology and the emerging urban geographies of two infrastructural networks across European cities: the international intercity Internet backbone and aviation networks. Both of them are facilitators of the knowledge economy and contribute to what was identified by Castells as the first layer of the space of flows, supporting the world city process. In order to compare them, network analysis methods and complex networks theory are employed. The res...

  18. C alpha-C backbone fragmentation dominates in electron detachment dissociation of gas-phase polypeptide polyanions

    DEFF Research Database (Denmark)

    Silivra, Oleg A; Ivonin, Igor A; Haselmann, Kim F;


    Fragmentation of peptide polyanions by electron detachment dissociation (EDD) has been induced by electron irradiation of deprotonated polypeptides [M-nH](n-) with >10 eV electrons. EDD has been found to lead preferentially to a* and x fragment ions (C(alpha)-C backbone cleavage) arising from the...... dissociation of oxidized radical anions [M-nH]((n-1)-*. We demonstrate that C(alpha)-C cleavages, which are otherwise rarely observed in tandem mass spectrometry, can account for most of the backbone fragmentation, with even-electron x fragments dominating over radical a* ions. Ab initio calculations at the B3...... LYP level of theory with the 6-311+G(2 p,2 d)//6-31+G(d,p) basis set suggested a unidirectional mechanism for EDD (cleavage always N-terminal to the radical site), with a*, x formation being favored over a, x* fragmentation by 74.2 kJ mol(-1). Thus, backbone C(alpha)-C bonds N-terminal to proline...

  19. The Role of Backbone Hydrogen Bonds in the Transition State for Protein Folding of a PDZ Domain.

    Directory of Open Access Journals (Sweden)

    Søren W. Pedersen

    Full Text Available Backbone hydrogen bonds are important for the structure and stability of proteins. However, since conventional site-directed mutagenesis cannot be applied to perturb the backbone, the contribution of these hydrogen bonds in protein folding and stability has been assessed only for a very limited set of small proteins. We have here investigated effects of five amide-to-ester mutations in the backbone of a PDZ domain, a 90-residue globular protein domain, to probe the influence of hydrogen bonds in a β-sheet for folding and stability. The amide-to-ester mutation removes NH-mediated hydrogen bonds and destabilizes hydrogen bonds formed by the carbonyl oxygen. The overall stability of the PDZ domain generally decreased for all amide-to-ester mutants due to an increase in the unfolding rate constant. For this particular region of the PDZ domain, it is therefore clear that native hydrogen bonds are formed after crossing of the rate-limiting barrier for folding. Moreover, three of the five amide-to-ester mutants displayed an increase in the folding rate constant suggesting that the hydrogen bonds are involved in non-native interactions in the transition state for folding.

  20. Backbone Dynamics of Alamethicin Bound to Lipid Membranes: Spin-Echo Electron Paramagnetic Resonance of TOAC-Spin Labels (United States)

    Bartucci, Rosa; Guzzi, Rita; De Zotti, Marta; Toniolo, Claudio; Sportelli, Luigi; Marsh, Derek


    Alamethicin F50/5 is a hydrophobic peptide that is devoid of charged residues and that induces voltage-dependent ion channels in lipid membranes. The peptide backbone is likely to be involved in the ion conduction pathway. Electron spin-echo spectroscopy of alamethicin F50/5 analogs in which a selected Aib residue (at position n = 1, 8, or 16) is replaced by the TOAC amino-acid spin label was used to study torsional dynamics of the peptide backbone in association with phosphatidylcholine bilayer membranes. Rapid librational motions of limited angular amplitude were observed at each of the three TOAC sites by recording echo-detected spectra as a function of echo delay time, 2τ. Simulation of the time-resolved spectra, combined with conventional EPR measurements of the librational amplitude, shows that torsional fluctuations of the peptide backbone take place on the subnanosecond to nanosecond timescale, with little temperature dependence. Associated fluctuations in polar fields from the peptide could facilitate ion permeation. PMID:18096632

  1. The determinants of bond angle variability in protein/peptide backbones: A comprehensive statistical/quantum mechanics analysis. (United States)

    Improta, Roberto; Vitagliano, Luigi; Esposito, Luciana


    The elucidation of the mutual influence between peptide bond geometry and local conformation has important implications for protein structure refinement, validation, and prediction. To gain insights into the structural determinants and the energetic contributions associated with protein/peptide backbone plasticity, we here report an extensive analysis of the variability of the peptide bond angles by combining statistical analyses of protein structures and quantum mechanics calculations on small model peptide systems. Our analyses demonstrate that all the backbone bond angles strongly depend on the peptide conformation and unveil the existence of regular trends as function of ψ and/or φ. The excellent agreement of the quantum mechanics calculations with the statistical surveys of protein structures validates the computational scheme here employed and demonstrates that the valence geometry of protein/peptide backbone is primarily dictated by local interactions. Notably, for the first time we show that the position of the H(α) hydrogen atom, which is an important parameter in NMR structural studies, is also dependent on the local conformation. Most of the trends observed may be satisfactorily explained by invoking steric repulsive interactions; in some specific cases the valence bond variability is also influenced by hydrogen-bond like interactions. Moreover, we can provide a reliable estimate of the energies involved in the interplay between geometry and conformations. PMID:26264789

  2. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks. (United States)

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian


    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  3. Coupling Protein Side-Chain and Backbone Flexibility Improves the Re-design of Protein-Ligand Specificity.

    Directory of Open Access Journals (Sweden)

    Noah Ollikainen

    Full Text Available Interactions between small molecules and proteins play critical roles in regulating and facilitating diverse biological functions, yet our ability to accurately re-engineer the specificity of these interactions using computational approaches has been limited. One main difficulty, in addition to inaccuracies in energy functions, is the exquisite sensitivity of protein-ligand interactions to subtle conformational changes, coupled with the computational problem of sampling the large conformational search space of degrees of freedom of ligands, amino acid side chains, and the protein backbone. Here, we describe two benchmarks for evaluating the accuracy of computational approaches for re-engineering protein-ligand interactions: (i prediction of enzyme specificity altering mutations and (ii prediction of sequence tolerance in ligand binding sites. After finding that current state-of-the-art "fixed backbone" design methods perform poorly on these tests, we develop a new "coupled moves" design method in the program Rosetta that couples changes to protein sequence with alterations in both protein side-chain and protein backbone conformations, and allows for changes in ligand rigid-body and torsion degrees of freedom. We show significantly increased accuracy in both predicting ligand specificity altering mutations and binding site sequences. These methodological improvements should be useful for many applications of protein-ligand design. The approach also provides insights into the role of subtle conformational adjustments that enable functional changes not only in engineering applications but also in natural protein evolution.


    Institute of Scientific and Technical Information of China (English)

    Hai-yang Gao; Feng-shou Liu; Hai-bin Hu; Fang-ming Zhu; Qing Wu


    A series of unsymmetrical α-diimine nickel complexes with various backbones and substituted aniline moieties were synthesized and characterized.The crystallographic analysis of the nickel complexes confirmed the existence of mesoand rac-configuration in solid structure.Nickel complexes after activation by MAO were screened for ethylene polymerization to evaluate backbone substituent effect on synthesis of bimodal PE.Acenaphthyl nickel complex with planar backbone afforded a bimodal PE with a broad polydispersity,whereas camphyl nickel complex with rigid and bulky backbone afforded a monomodal PE with a narrow polydispersity.Steric effect of aniline moiety for acenaphthyl nickel complex was also examined,and bimodal PE with dominant high-molecular-weight fraction was obtained by modifying substituents on aniline moiety.

  5. Protein side-chain resonance assignment and NOE assignment using RDC-defined backbones without TOCSY data

    Energy Technology Data Exchange (ETDEWEB)

    Zeng Jianyang [Duke University, Department of Computer Science (United States); Zhou Pei [Duke University Medical Center, Department of Biochemistry (United States); Donald, Bruce Randall [Duke University, Department of Computer Science (United States)


    One bottleneck in NMR structure determination lies in the laborious and time-consuming process of side-chain resonance and NOE assignments. Compared to the well-studied backbone resonance assignment problem, automated side-chain resonance and NOE assignments are relatively less explored. Most NOE assignment algorithms require nearly complete side-chain resonance assignments from a series of through-bond experiments such as HCCH-TOCSY or HCCCONH. Unfortunately, these TOCSY experiments perform poorly on large proteins. To overcome this deficiency, we present a novel algorithm, called Nasca (NOE Assignment and Side-Chain Assignment), to automate both side-chain resonance and NOE assignments and to perform high-resolution protein structure determination in the absence of any explicit through-bond experiment to facilitate side-chain resonance assignment, such as HCCH-TOCSY. After casting the assignment problem into a Markov Random Field (MRF), Nasca extends and applies combinatorial protein design algorithms to compute optimal assignments that best interpret the NMR data. The MRF captures the contact map information of the protein derived from NOESY spectra, exploits the backbone structural information determined by RDCs, and considers all possible side-chain rotamers. The complexity of the combinatorial search is reduced by using a dead-end elimination (DEE) algorithm, which prunes side-chain resonance assignments that are provably not part of the optimal solution. Then an A* search algorithm is employed to find a set of optimal side-chain resonance assignments that best fit the NMR data. These side-chain resonance assignments are then used to resolve the NOE assignment ambiguity and compute high-resolution protein structures. Tests on five proteins show that Nasca assigns resonances for more than 90% of side-chain protons, and achieves about 80% correct assignments. The final structures computed using the NOE distance restraints assigned by Nasca have backbone RMSD 0

  6. Synthesis of graft copolymers with 1,4-polybutadiene backbone and polar grafts by combination of ROP and ROMP


    Leroux, Flavien


    The objective of this work was the preparation of graft copolymers with a poly(1,4-butadiene) backbone and a high density of polar grafts. We used a consecutive Ring-Opening Metathesis Polymerization (ROMP)/Ring-Opening Polymerization (ROP) route to prepare poly(1,4-butadiene)-g-polyesters from cyclobutenyl macromonomers bearing one or two polyester segment(s) derived from L-lactide (L-LA) or Ɛ-caprolactone (Ɛ-CL). Poly(L-lactide)s (PLLA) or poly(Ɛ-caprolactone)s (PCL) are important polymers ...

  7. Synthesis of graft polyrotaxane by simultaneous capping of backbone and grafting from rings of pseudo-polyrotaxane


    Kazuaki Kato; Katsunari Inoue; Masabumi Kudo; Kohzo Ito


    Graft polyrotaxanes, with poly(ε-caprolactone) (PCL) graft chains on the ring components were synthesized by the simultaneous ring-opening polymerization of ε-caprolactone from both ends of the backbone polymer, an end-functionalized polyethylene glycol (PEG) and the formation of inclusion complexes with α-cyclodextrin (α-CD). PEG with multiple functional groups at each end was prepared by the condensation of PEG-amine and D-gluconic acid; the PEG derivative formed an inclusion complex with α...


    Institute of Scientific and Technical Information of China (English)

    ZhuoRenxi; WangJun; 等


    The immunomodulation of several Charged synthetic polymers containing phosphorus in the backbone was studied in vitro through examining their inhibition or promotion effect on the proliferatioin of both T and B lymphocytes,It is found that polymers based on long chain alkyl ester of tyrosine exhibit immunomodulative activity.Negatively charged polymers show stimulative activity on LPS-induced B lymphocytes proliferation.Positively charged polymers exhibit inhibitory activity on both Con A-induced T lymphocytes and LPS-induced B lymplhyocytes proliferation.

  9. An Unusual Conformational Isomer of Verrucosidin Backbone from a Hydrothermal Vent Fungus, Penicillium sp. Y-50-10. (United States)

    Pan, Chengqian; Shi, Yutong; Auckloo, Bibi Nazia; Chen, Xuegang; Chen, Chen-Tung Arthur; Tao, Xinyi; Wu, Bin


    A new verrucosidin derivative, methyl isoverrucosidinol (1), was isolated from the marine fungus Penicillium sp. Y-50-10, dwelling in sulfur rich sediment in the Kueishantao hydrothermal vents off Taiwan. The structure was established by spectroscopic means including HRMS and 2D-NMR spectroscopic analysis. The absolute configuration was defined mainly by comparison of quantum chemical TDDFT calculated and experimental ECD spectra. Among hitherto known compounds with a verrucosidine backbone isolated from natural resource, compound 1 represents the first example of a new conformational isomer of its skeleton, exhibiting antibiotic activity against Bacillus subtilis with MIC value 32 μg/mL. PMID:27548192

  10. An Unusual Conformational Isomer of Verrucosidin Backbone from a Hydrothermal Vent Fungus, Penicillium sp. Y-50-10

    Directory of Open Access Journals (Sweden)

    Chengqian Pan


    Full Text Available A new verrucosidin derivative, methyl isoverrucosidinol (1, was isolated from the marine fungus Penicillium sp. Y-50-10, dwelling in sulfur rich sediment in the Kueishantao hydrothermal vents off Taiwan. The structure was established by spectroscopic means including HRMS and 2D-NMR spectroscopic analysis. The absolute configuration was defined mainly by comparison of quantum chemical TDDFT calculated and experimental ECD spectra. Among hitherto known compounds with a verrucosidine backbone isolated from natural resource, compound 1 represents the first example of a new conformational isomer of its skeleton, exhibiting antibiotic activity against Bacillus subtilis with MIC value 32 μg/mL.

  11. The "Legislative Backbone" keeping the Institution upright? The Role of European Parliament Committees in the EU Policy-Making Process


    Christine Neuhold


    Over the past five decades the European Parliament (EP) has moved from being a largely consultative assembly to being a genuine co-legislature. The growth in the EPs powers was accompanied by a revaluation of its Standing Committees. It is in these committees, the legislative backbone of the EP, that scrutiny of European Union (EU) legislation takes place. As in the US Congress the real work of the Parliament is done in its committees. They have become a key element in the EU policy-making pr...

  12. Synthesis of graft polyrotaxane by simultaneous capping of backbone and grafting from rings of pseudo-polyrotaxane

    Directory of Open Access Journals (Sweden)

    Kazuaki Kato


    Full Text Available Graft polyrotaxanes, with poly(ε-caprolactone (PCL graft chains on the ring components were synthesized by the simultaneous ring-opening polymerization of ε-caprolactone from both ends of the backbone polymer, an end-functionalized polyethylene glycol (PEG and the formation of inclusion complexes with α-cyclodextrin (α-CD. PEG with multiple functional groups at each end was prepared by the condensation of PEG-amine and D-gluconic acid; the PEG derivative formed an inclusion complex with α-CD. The polymerization of multiple hydroxy groups at the backbone ends resulted in a star-shaped end group, which served as a bulky capping group to prevent dethreading. In contrast, PEG with only one hydroxy group at each end did not produce polyrotaxanes, indicating that single PCL chains were too thin to confine α-CDs to the complex. In addition, the grafting polymerization proceeded properly only when robust hydrogen bonds formed between α-CDs were dissociated using a basic catalyst. Since the dissociation also induced dethreading, kinetic control of the polymerization and dissociation were crucial for producing graft polyrotaxanes. Consequently, this three-step reaction yielded graft polyrotaxanes in a good yield, demonstrating a significant simplification of the synthesis of graft polyrotaxanes.

  13. Vanishing amplitude of backbone dynamics causes a true protein dynamical transition: H2 NMR studies on perdeuterated C-phycocyanin (United States)

    Kämpf, Kerstin; Kremmling, Beke; Vogel, Michael


    Using a combination of H2 nuclear magnetic resonance (NMR) methods, we study internal rotational dynamics of the perdeuterated protein C-phycocyanin (CPC) in dry and hydrated states over broad temperature and dynamic ranges with high angular resolution. Separating H2 NMR signals from methyl deuterons, we show that basically all backbone deuterons exhibit highly restricted motion occurring on time scales faster than microseconds. The amplitude of this motion increases when a hydration shell exists, while it decreases upon cooling and vanishes near 175 K. We conclude that the vanishing of the highly restricted motion marks a dynamical transition, which is independent of the time window and of a fundamental importance. This conclusion is supported by results from experimental and computational studies of the proteins myoglobin and elastin. In particular, we argue based on findings in molecular dynamics simulations that the behavior of the highly restricted motion of proteins at the dynamical transition resembles that of a characteristic secondary relaxation of liquids at the glass transition, namely the nearly constant loss. Furthermore, H2 NMR studies on perdeuterated CPC reveal that, in addition to highly restricted motion, small fractions of backbone segments exhibit weakly restricted dynamics when temperature and hydration are sufficiently high.

  14. Dynamics of ultraviolet-induced DNA lesions: Dewar formation guided by pre-tension induced by the backbone

    International Nuclear Information System (INIS)

    The photophysical and photochemical processes driving the formation of the ultraviolet (UV)-induced DNA Dewar lesion from the T(6-4)T dimer are investigated by time-resolved spectroscopy and quantum chemical modelling. Time-resolved absorption and emission spectroscopy in the UV revealed a biexponential decay of the electronically excited state (S1) with time constants in the 100 ps and 1 ns range. From the S1 state the system forms the Dewar lesion (proven by time-resolved infrared spectroscopy), the triplet state of the T(6-4)T dimer and the ground state of the original T(6-4)T dimer. The decay process from the excited singlet is activated and thus temperature dependent. Quantum chemical modelling is used to describe the reaction path via a minimum on the excited electronic potential energy surface in close proximity to a triplet state. The transition to the Dewar isomer competes with internal conversion and with triplet formation. Only if the backbone between the two thymines is closed, is the Dewar isomer formed with a significant yield. The simulations reveal that the tension built up by the backbone is required for guiding the reaction to the conical intersection leading to the Dewar isomer. (paper)

  15. Improved site-specific recombinase-based method to produce selectable marker- and vector-backbone-free transgenic cells (United States)

    Yu, Yuan; Tong, Qi; Li, Zhongxia; Tian, Jinhai; Wang, Yizhi; Su, Feng; Wang, Yongsheng; Liu, Jun; Zhang, Yong


    PhiC31 integrase-mediated gene delivery has been extensively used in gene therapy and animal transgenesis. However, random integration events are observed in phiC31-mediated integration in different types of mammalian cells; as a result, the efficiencies of pseudo attP site integration and evaluation of site-specific integration are compromised. To improve this system, we used an attB-TK fusion gene as a negative selection marker, thereby eliminating random integration during phiC31-mediated transfection. We also excised the selection system and plasmid bacterial backbone by using two other site-specific recombinases, Cre and Dre. Thus, we generated clean transgenic bovine fetal fibroblast cells free of selectable marker and plasmid bacterial backbone. These clean cells were used as donor nuclei for somatic cell nuclear transfer (SCNT), indicating a similar developmental competence of SCNT embryos to that of non-transgenic cells. Therefore, the present gene delivery system facilitated the development of gene therapy and agricultural biotechnology.

  16. Inorganic-organic composites by sol-gel techniques


    Schmidt, Helmut K.


    The sol-gel process opens the possibility of combining inorganic and organic units to new hybrid polymers. Organic units can be used for structural modification of the inorganic backbone, for creating new functions within an inorganic network and for building up organic polymeric chains. The materials show interesting perspectives with respect to structural (surface hardness, strength) and functional properties (e.g. diffusion, photocuring, incorporation of dyes, optical properties). A review...

  17. An employment karate - one of backbone factors of psychohygiene of youth.

    Directory of Open Access Journals (Sweden)

    Uskov S.V.


    Full Text Available The analysis of the scientifically-methodical and special literature on a research problem is carried out. Questions of preservation and perfection of psychological health of schoolboys and the students, solved by means of employment by single combats are opened. Methodical workings out on formation of the psychophysiological qualities necessary for healthy development of youth are offered. At the correct organization they can essentially increase stability to stressful situations, stability of the central nervous system and other important psychological qualities.

  18. Treatment of Gram-negative pneumonia in the critical care setting: is the beta-lactam antibiotic backbone broken beyond repair? (United States)

    Bassetti, Matteo; Welte, Tobias; Wunderink, Richard G


    Beta-lactam antibiotics form the backbone of treatment for Gram-negative pneumonia in mechanically ventilated patients in the intensive care unit. However, this beta-lactam antibiotic backbone is increasingly under pressure from emerging resistance across all geographical regions, and health-care professionals in many countries are rapidly running out of effective treatment options. Even in regions that currently have only low levels of resistance, the effects of globalization are likely to increase local pressures on the beta-lactam antibiotic backbone in the near future. Therefore, clinicians are increasingly faced with a difficult balancing act: the need to prescribe adequate and appropriate antibiotic therapy while reducing the emergence of resistance and the overuse of antibiotics. In this review, we explore the burden of Gram-negative pneumonia in the critical care setting and the pressure that antibiotic resistance places on current empiric therapy regimens (and the beta-lactam antibiotic backbone) in this patient population. New treatment approaches, such as systemic and inhaled antibiotic alternatives, are on the horizon and are likely to help tackle the rising levels of beta-lactam antibiotic resistance. In the meantime, it is imperative that the beta-lactam antibiotic backbone of currently available antibiotics be supported through stringent antibiotic stewardship programs. PMID:26821535

  19. Backbone dynamics of free barnase and its complex with barstar determined by 15N NMR relaxation study. (United States)

    Sahu, S C; Bhuyan, A K; Udgaonkar, J B; Hosur, R V


    Backbone dynamics of uniformly 15N-labeled free barnase and its complex with unlabelled barstar have been studied at 40 degrees C, pH 6.6, using 15N relaxation data obtained from proton-detected 2D [1H]-15N NMR spectroscopy. 15N spin-lattice relaxation rate constants (R1), spin-spin relaxation rate constants (R2), and steady-state heteronuclear [1H]-15N NOEs have been measured at a magnetic field strength of 14.1 Tesla for 91 residues of free barnase and for 90 residues out of a total of 106 in the complex (excluding three prolines and the N-terminal residue) backbone amide 15N sites of barnase. The primary relaxation data for both the cases have been analyzed in the framework of the model-free formalism using both isotropic and axially symmetric models of the rotational diffusion tensor. As per the latter, the overall rotational correlation times (tau(m)) are 5.0 and 9.5 ns for the free and complexed barnase, respectively. The average order parameter is found to be 0.80 for free barnase and 0.86 for the complex. However, the changes are not uniform along the backbone and for about 5 residues near the binding interface there is actually a significant decrease in the order parameters on complex formation. These residues are not involved in the actual binding. For the residues where the order parameter increases, the magnitudes vary significantly. It is observed that the complex has much less internal mobility, compared to free barnase. From the changes in the order parameters, the entropic contribution of NH bond vector motion to the free energy of complex formation has been calculated. It is apparent that these motion's cause significant unfavorable contributions and therefore must be compensated by many other favorable contributions to effect tight complex formation. The observed variations in the motion and their different locations with regard to the binding interface may have important implications for remote effects and regulation of the enzyme action. PMID

  20. Backbone dynamics of free barnase and its complex with barstar determined by 15N NMR relaxation study

    International Nuclear Information System (INIS)

    Backbone dynamics of uniformly 15N-labeled free barnase and its complex with unlabelled barstar have been studied at 40 deg. C, pH 6.6, using 15N relaxation data obtained from proton-detected 2D {1H}-15N NMR spectroscopy. 15N spin-lattice relaxation rate constants (R1), spin-spin relaxation rate constants (R2), and steady-state heteronuclear {1H}-15N NOEs have been measured at a magnetic field strength of 14.1 Tesla for 91 residues of free barnase and for 90 residues out of a total of 106 in the complex (excluding three prolines and the N-terminal residue) backbone amide 15N sites of barnase. The primary relaxation data for both the cases have been analyzed in the framework of the model-free formalism using both isotropic and axially symmetric models of the rotational diffusion tensor. As per the latter, the overall rotational correlation times (τm) are 5.0 and 9.5 ns for the free and complexed barnase, respectively. The average order parameter is found to be 0.80 for free barnase and 0.86 for the complex. However, the changes are not uniform along the backbone and for about 5 residues near the binding interface there is actually a significant decrease in the order parameters on complex formation. These residues are not involved in the actual binding. For the residues where the order parameter increases, the magnitudes vary significantly. It is observed that the complex has much less internal mobility, compared to free barnase. From the changes in the order parameters, the entropic contribution of NH bond vector motion to the free energy of complex formation has been calculated. It is apparent that these motions cause significant unfavorable contributions and therefore must be compensated by many other favorable contributions to effect tight complex formation. The observed variations in the motion and their different locations with regard to the binding interface may have important implications for remote effects and regulation of the enzyme action

  1. Backbone dynamics of free barnase and its complex with barstar determined by 15N NMR relaxation study

    Energy Technology Data Exchange (ETDEWEB)

    Sahu, Sarata C. [Tata Institute of Fundamental Research, Department of Chemical Sciences (India); Bhuyan, Abani K.; Udgaonkar, Jayant B. [University of Agricultural Sciences (UAS), National Centre for Biological Sciences, Tata Institute of Fundamental Research (India); Hosur, R.V. [Tata Institute of Fundamental Research, Department of Chemical Sciences (India)


    Backbone dynamics of uniformly {sup 15}N-labeled free barnase and its complex with unlabelled barstar have been studied at 40 deg. C, pH 6.6, using {sup 15}N relaxation data obtained from proton-detected 2D {l_brace}{sup 1}H{r_brace}-{sup 15}N NMR spectroscopy. {sup 15}N spin-lattice relaxation rate constants (R{sub 1}), spin-spin relaxation rate constants (R{sub 2}), and steady-state heteronuclear {l_brace}{sup 1}H{r_brace}-{sup 15}N NOEs have been measured at a magnetic field strength of 14.1 Tesla for 91 residues of free barnase and for 90 residues out of a total of 106 in the complex (excluding three prolines and the N-terminal residue) backbone amide {sup 15}N sites of barnase. The primary relaxation data for both the cases have been analyzed in the framework of the model-free formalism using both isotropic and axially symmetric models of the rotational diffusion tensor. As per the latter, the overall rotational correlation times ({tau}{sub m}) are 5.0 and 9.5 ns for the free and complexed barnase, respectively. The average order parameter is found to be 0.80 for free barnase and 0.86 for the complex. However, the changes are not uniform along the backbone and for about 5 residues near the binding interface there is actually a significant decrease in the order parameters on complex formation. These residues are not involved in the actual binding. For the residues where the order parameter increases, the magnitudes vary significantly. It is observed that the complex has much less internal mobility, compared to free barnase. From the changes in the order parameters, the entropic contribution of NH bond vector motion to the free energy of complex formation has been calculated. It is apparent that these motions cause significant unfavorable contributions and therefore must be compensated by many other favorable contributions to effect tight complex formation. The observed variations in the motion and their different locations with regard to the binding interface

  2. Thermoresponsive Poly(2-oxazoline) Molecular Brushes by Living Ionic Polymerization: Kinetic Investigations of Pendant Chain Grafting and Cloud Point Modulation by Backbone and Side Chain Length Variation

    KAUST Repository

    Zhang, Ning


    Molecular brushes of poly(2-oxazoline)s were prepared by living anionic polymerization of 2-iso-propenyl-2-oxazoline to form the backbone and subsequent living cationic ring-opening polymerization of 2-n- or 2-iso-propyl-2-oxazoline for pendant chain grafting. In situ kinetic studies indicate that the initiation efficiency and polymerization rates are independent from the number of initiator functions per initiator molecule. This was attributed to the high efficiency of oxazolinium salt and the stretched conformation of the backbone, which is caused by the electrostatic repulsion of the oxazolinium moieties along the macroinitiator. The resulting molecular brushes showed thermoresponsive properties, that is, having a defined cloud point (CP). The dependence of the CP as a function of backbone and side chain length as well as concentration was studied. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Synthesis and Characterization of New Polyimide Containing Calix[4]arenes in the Polymer Backbone with Transport Ability

    Institute of Scientific and Technical Information of China (English)

    LI Lei; XIAN Chun-ying; ZHENG Li-min


    New polyimide containing cvalix[4]arene moieties on the polymer backbone was successfully synthesized in N-methyl-2-pyrrolidone(NMP) by polycondensations of 3,3', 4, 4'- oxydiphthalic anhydride (ODPA) with the diaminocalix[4]arene monomer using 3,3'-dimethyl-4, 4'-diaminodiphenylmethane(DADPM) as a third comononmer.The polyimide prepared is soluble in common solvents, such as NMP, DMAc, DMF and chloroform. The polyimide films obtained have excellent thermal stability and mechanical property. At the same time, the liquid membrane transport of potassimn ions by the new polyimide was investigated, which testified that compared to ODPA-DADPM polyimide, the polyimide containing calix[4] arenes has the transport ability to metal ions in regard to bulky, cone-like calix [4] arene moieties.

  4. Backbone structure of Yersinia pestis Ail determined in micelles by NMR-restrained simulated annealing with implicit membrane solvation

    Energy Technology Data Exchange (ETDEWEB)

    Marassi, Francesca M., E-mail:; Ding, Yi [Sanford-Burnham Medical Research Institute (United States); Schwieters, Charles D. [National Institutes of Health, Division of Computational Bioscience, Center for Information Technology (United States); Tian, Ye; Yao, Yong [Sanford-Burnham Medical Research Institute (United States)


    The outer membrane protein Ail (attachment invasion locus) is a virulence factor of Yersinia pestis that mediates cell invasion, cell attachment and complement resistance. Here we describe its three-dimensional backbone structure determined in decyl-phosphocholine (DePC) micelles by NMR spectroscopy. The NMR structure was calculated using the membrane function of the implicit solvation potential, eefxPot, which we have developed to facilitate NMR structure calculations in a physically realistic environment. We show that the eefxPot force field guides the protein towards its native fold. The resulting structures provide information about the membrane-embedded global position of Ail, and have higher accuracy, higher precision and improved conformational properties, compared to the structures calculated with the standard repulsive potential.

  5. Backbone and stereospecific (13)C methyl Ile (δ1), Leu and Val side-chain chemical shift assignments of Crc. (United States)

    Sharma, Rakhi; Sahu, Bhubanananda; Ray, Malay K; Deshmukh, Mandar V


    Carbon catabolite repression (CCR) allows bacteria to selectively assimilate a preferred compound among a mixture of several potential carbon sources, thus boosting growth and economizing the cost of adaptability to variable nutrients in the environment. The RNA-binding catabolite repression control (Crc) protein acts as a global post-transcriptional regulator of CCR in Pseudomonas species. Crc triggers repression by inhibiting the expression of genes involved in transport and catabolism of non-preferred substrates, thus indirectly favoring assimilation of preferred one. We report here a nearly complete backbone and stereospecific (13)C methyl side-chain chemical shift assignments of Ile (δ1), Leu and Val of Crc (~ 31 kDa) from Pseudomonas syringae Lz4W. PMID:24496608

  6. Backbone structure of Yersinia pestis Ail determined in micelles by NMR-restrained simulated annealing with implicit membrane solvation

    International Nuclear Information System (INIS)

    The outer membrane protein Ail (attachment invasion locus) is a virulence factor of Yersinia pestis that mediates cell invasion, cell attachment and complement resistance. Here we describe its three-dimensional backbone structure determined in decyl-phosphocholine (DePC) micelles by NMR spectroscopy. The NMR structure was calculated using the membrane function of the implicit solvation potential, eefxPot, which we have developed to facilitate NMR structure calculations in a physically realistic environment. We show that the eefxPot force field guides the protein towards its native fold. The resulting structures provide information about the membrane-embedded global position of Ail, and have higher accuracy, higher precision and improved conformational properties, compared to the structures calculated with the standard repulsive potential

  7. Binary Assembly of Au Nanoparticles with Controllable Two-dimensional Architecture Directed by Phosphate Backbone Modified Oligonucleotide

    Institute of Scientific and Technical Information of China (English)

    MA,Yu-Dan; GUO,Yi; LI,Jun; YANG,Wen-Sheng


    A three complementary strand oligonucleotide system was employed to assemble two different-sized,15 and 25 nm,Au nanoparticles into binary two-dimensional (2D) structures.First,two non-complementary strands of phosphate backbone modified oligonucleotides (PM oligo-DNA) were loaded on the surface of the 15 and 25 nm Au nanoparticles,respectively.Upon the addition of the third linker DNA,which was half complementary to each of the modified DNA,the An nanoparticles would be assembled to binary 2D aggregates.The number of the 15 nm Au nanoparticles around a 25 nm Au naoparticle can be readily controlled by the length of the DNA helix used.

  8. Ultrafast vibrational dynamics of the DNA backbone at different hydration levels mapped by two-dimensional infrared spectroscopy. (United States)

    Guchhait, Biswajit; Liu, Yingliang; Siebert, Torsten; Elsaesser, Thomas


    DNA oligomers are studied at 0% and 92% relative humidity, corresponding to N  20 water molecules per base pair. Two-dimensional (2D) infrared spectroscopy of DNA backbone modes between 920 and 1120 cm(-1) maps fluctuating interactions at the DNA surface. At both hydration levels, a frequency fluctuation correlation function with a 300 fs decay and a slow decay beyond 10 ps is derived from the 2D lineshapes. The fast component reflects motions of DNA helix, counterions, and water shell. Its higher amplitude at high hydration level reveals a significant contribution of water to the fluctuating forces. The slow component reflects disorder-induced inhomogeneous broadening. PMID:26798841

  9. Photoleucine Survives Backbone Cleavage by Electron Transfer Dissociation. A Near-UV Photodissociation and Infrared Multiphoton Dissociation Action Spectroscopy Study (United States)

    Shaffer, Christopher J.; Martens, Jonathan; Marek, Aleš; Oomens, Jos; Tureček, František


    We report a combined experimental and computational study aimed at elucidating the structure of N-terminal fragment ions of the c type produced by electron transfer dissociation of photo-leucine (L*) peptide ions GL*GGKX. The c 4 ion from GL*GGK is found to retain an intact diazirine ring that undergoes selective photodissociation at 355 nm, followed by backbone cleavage. Infrared multiphoton dissociation action spectra point to the absence in the c 4 ion of a diazoalkane group that could be produced by thermal isomerization of vibrationally hot ions. The c 4 ion from ETD of GL*GGK is assigned an amide structure by a close match of the IRMPD action spectrum and calculated IR absorption. The energetics and kinetics of c 4 ion dissociations are discussed.

  10. Electric myographic control of electric therapeutic apparatus -ceragem master cgm 3500 influence on backbone of patients with scoliosis

    Directory of Open Access Journals (Sweden)

    Kupreenko M. V.


    Full Text Available Purpose: determination of effectiveness of electric therapeutic apparatus Ceragem master CGM 3500 in its influence on backbone of patients with scoliosis. Material: in examination 11 female patients with scoliosis of age from 21 to 35 years and 12 practically healthy persons participated. The research of para-vertebral muscles of back was fulfilled with method of electric myography. Results: we determined positive effect in nervous-muscular functioning of back. The proof was increase of integrated amplitude of back muscles’ electric activity on convex and concave sides of scolytinae arc; increase of maximal amplitude of H-reflex and M-response. Conclusions: standard electric myography permits to receive objective information about functional state of muscles of patients with scoliosis and assess effectiveness of rehabilitation process with application of electric therapeutic apparatus - - Ceragem Master CGM 3500.

  11. Backbone cyclised peptides from plants show molluscicidal activity against the rice pest Pomacea canaliculata (golden apple snail). (United States)

    Plan, Manuel Rey R; Saska, Ivana; Cagauan, Arsenia G; Craik, David J


    Golden apple snails ( Pomacea canaliculata) are serious pests of rice in South East Asia. Cyclotides are backbone cyclized peptides produced by plants from Rubiaceae and Violaceae. In this study, we investigated the molluscicidal activity of cyclotides against golden apple snails. Crude cyclotide extracts from both Oldenlandia affinis and Viola odorata plants showed molluscicidal activity comparable to the synthetic molluscicide metaldehyde. Individual cyclotides from each extract demonstrated a range of molluscicidal activities. The cyclotides cycloviolacin O1, kalata B1, and kalata B2 were more toxic to golden apple snails than metaldehyde, while kalata B7 and kalata B8 did not cause significant mortality. The toxicity of the cyclotide kalata B2 on a nontarget species, the Nile tilapia ( Oreochromis niloticus), was three times lower than the common piscicide rotenone. Our findings suggest that the existing diversity of cyclotides in plants could be used to develop natural molluscicides. PMID:18557620

  12. General order parameter based correlation analysis of protein backbone motions between experimental NMR relaxation measurements and molecular dynamics simulations

    International Nuclear Information System (INIS)

    Internal backbone dynamic motions are essential for different protein functions and occur on a wide range of time scales, from femtoseconds to seconds. Molecular dynamic (MD) simulations and nuclear magnetic resonance (NMR) spin relaxation measurements are valuable tools to gain access to fast (nanosecond) internal motions. However, there exist few reports on correlation analysis between MD and NMR relaxation data. Here, backbone relaxation measurements of 15N-labeled SH3 (Src homology 3) domain proteins in aqueous buffer were used to generate general order parameters (S2) using a model-free approach. Simultaneously, 80 ns MD simulations of SH3 domain proteins in a defined hydrated box at neutral pH were conducted and the general order parameters (S2) were derived from the MD trajectory. Correlation analysis using the Gromos force field indicated that S2 values from NMR relaxation measurements and MD simulations were significantly different. MD simulations were performed on models with different charge states for three histidine residues, and with different water models, which were SPC (simple point charge) water model and SPC/E (extended simple point charge) water model. S2 parameters from MD simulations with charges for all three histidines and with the SPC/E water model correlated well with S2 calculated from the experimental NMR relaxation measurements, in a site-specific manner. - Highlights: • Correlation analysis between NMR relaxation measurements and MD simulations. • General order parameter (S2) as common reference between the two methods. • Different protein dynamics with different Histidine charge states in neutral pH. • Different protein dynamics with different water models

  13. The backbone of the post-synaptic density originated in a unicellular ancestor of choanoflagellates and metazoans

    Directory of Open Access Journals (Sweden)

    Manuel Michaël


    Full Text Available Abstract Background Comparative genomics of the early diverging metazoan lineages and of their unicellular sister-groups opens new window to reconstructing the genetic changes which preceded or accompanied the evolution of multicellular body plans. A recent analysis found that the genome of the nerve-less sponges encodes the homologues of most vertebrate post-synaptic proteins. In vertebrate excitatory synapses, these proteins assemble to form the post-synaptic density, a complex molecular platform linking membrane receptors, components of their signalling pathways, and the cytoskeleton. Newly available genomes from Monosiga brevicollis (a member of Choanoflagellata, the closest unicellular relatives of animals and Trichoplax adhaerens (a member of Placozoa: besides sponges, the only nerve-less metazoans offer an opportunity to refine our understanding of post-synaptic protein evolution. Results Searches for orthologous proteins and reconstruction of gene gains/losses based on the taxon phylogeny indicate that post-synaptic proteins originated in two main steps. The backbone scaffold proteins (Shank, Homer, DLG and some of their partners were acquired in a unicellular ancestor of choanoflagellates and metazoans. A substantial additional set appeared in an exclusive ancestor of the Metazoa. The placozoan genome contains most post-synaptic genes but lacks some of them. Notably, the master-scaffold protein Shank might have been lost secondarily in the placozoan lineage. Conclusions The time of origination of most post-synaptic proteins was not concomitant with the acquisition of synapses or neural-like cells. The backbone of the scaffold emerged in a unicellular context and was probably not involved in cell-cell communication. Based on the reconstructed protein composition and potential interactions, its ancestral function could have been to link calcium signalling and cytoskeleton regulation. The complex later became integrated into the evolving

  14. General order parameter based correlation analysis of protein backbone motions between experimental NMR relaxation measurements and molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Qing; Shi, Chaowei [Hefei National Laboratory for Physical Sciences at The Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); Yu, Lu [Hefei National Laboratory for Physical Sciences at The Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); High Magnetic Field Laboratory, Chinese Academy of Science, Hefei, Anhui, 230031 (China); Zhang, Longhua [Hefei National Laboratory for Physical Sciences at The Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); Xiong, Ying, E-mail: [Hefei National Laboratory for Physical Sciences at The Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); Tian, Changlin, E-mail: [Hefei National Laboratory for Physical Sciences at The Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); High Magnetic Field Laboratory, Chinese Academy of Science, Hefei, Anhui, 230031 (China)


    Internal backbone dynamic motions are essential for different protein functions and occur on a wide range of time scales, from femtoseconds to seconds. Molecular dynamic (MD) simulations and nuclear magnetic resonance (NMR) spin relaxation measurements are valuable tools to gain access to fast (nanosecond) internal motions. However, there exist few reports on correlation analysis between MD and NMR relaxation data. Here, backbone relaxation measurements of {sup 15}N-labeled SH3 (Src homology 3) domain proteins in aqueous buffer were used to generate general order parameters (S{sup 2}) using a model-free approach. Simultaneously, 80 ns MD simulations of SH3 domain proteins in a defined hydrated box at neutral pH were conducted and the general order parameters (S{sup 2}) were derived from the MD trajectory. Correlation analysis using the Gromos force field indicated that S{sup 2} values from NMR relaxation measurements and MD simulations were significantly different. MD simulations were performed on models with different charge states for three histidine residues, and with different water models, which were SPC (simple point charge) water model and SPC/E (extended simple point charge) water model. S{sup 2} parameters from MD simulations with charges for all three histidines and with the SPC/E water model correlated well with S{sup 2} calculated from the experimental NMR relaxation measurements, in a site-specific manner. - Highlights: • Correlation analysis between NMR relaxation measurements and MD simulations. • General order parameter (S{sup 2}) as common reference between the two methods. • Different protein dynamics with different Histidine charge states in neutral pH. • Different protein dynamics with different water models.

  15. Marburg virus VP35 can both fully coat the backbone and cap the ends of dsRNA for interferon antagonism.

    Directory of Open Access Journals (Sweden)

    Shridhar Bale


    Full Text Available Filoviruses, including Marburg virus (MARV and Ebola virus (EBOV, cause fatal hemorrhagic fever in humans and non-human primates. All filoviruses encode a unique multi-functional protein termed VP35. The C-terminal double-stranded (dsRNA-binding domain (RBD of VP35 has been implicated in interferon antagonism and immune evasion. Crystal structures of the VP35 RBD from two ebolaviruses have previously demonstrated that the viral protein caps the ends of dsRNA. However, it is not yet understood how the expanses of dsRNA backbone, between the ends, are masked from immune surveillance during filovirus infection. Here, we report the crystal structure of MARV VP35 RBD bound to dsRNA. In the crystal structure, molecules of dsRNA stack end-to-end to form a pseudo-continuous oligonucleotide. This oligonucleotide is continuously and completely coated along its sugar-phosphate backbone by the MARV VP35 RBD. Analysis of dsRNA binding by dot-blot and isothermal titration calorimetry reveals that multiple copies of MARV VP35 RBD can indeed bind the dsRNA sugar-phosphate backbone in a cooperative manner in solution. Further, MARV VP35 RBD can also cap the ends of the dsRNA in solution, although this arrangement was not captured in crystals. Together, these studies suggest that MARV VP35 can both coat the backbone and cap the ends, and that for MARV, coating of the dsRNA backbone may be an essential mechanism by which dsRNA is masked from backbone-sensing immune surveillance molecules.

  16. Backbone dynamics of a biologically active human FGF-1 monomer, complexed to a hexasaccharide heparin-analogue, by {sup 15}N NMR relaxation methods

    Energy Technology Data Exchange (ETDEWEB)

    Canales-Mayordomo, Angeles; Fayos, Rosa [Centro de Investigaciones Biologicas, CSIC, Departamento de Estructura y Funcion de Proteinas (Spain); Angulo, Jesus; Ojeda, Rafael [Instituto de Investigaciones Quimicas, CSIC, Grupo de Carbohidratos (Spain); Martin-Pastor, Manuel [Unidad de RM y Unidad de RMN de Biomoleculas Asociada al CSIC, Laboratorio de Estructura e Estructura de Biomoleculas Jose Carracido (Spain); Nieto, Pedro M.; Martin-Lomas, Manuel [Instituto de Investigaciones Quimicas, CSIC, Grupo de Carbohidratos (Spain); Lozano, Rosa; Gimenez-Gallego, Guillermo; Jimenez-Barbero, Jesus [Centro de Investigaciones Biologicas, CSIC, Departamento de Estructura y Funcion de Proteinas (Spain)], E-mail:


    The binding site and backbone dynamics of a bioactive complex formed by the acidic fibroblast growth factor (FGF-1) and a specifically designed heparin hexasaccharide has been investigated by HSQC and relaxation NMR methods. The comparison of the relaxation data for the free and bound states has allowed showing that the complex is monomeric, and still induces mutagenesis, and that the protein backbone presents reduced motion in different timescale in its bound state, except in certain points that are involved in the interaction with the fibroblast growth factor receptor (FGFR)

  17. Highly efficient bioinspired molecular Ru water oxidation catalysts with negatively charged backbone ligands. (United States)

    Duan, Lele; Wang, Lei; Li, Fusheng; Li, Fei; Sun, Licheng


    The oxygen evolving complex (OEC) of the natural photosynthesis system II (PSII) oxidizes water to produce oxygen and reducing equivalents (protons and electrons). The oxygen released from PSII provides the oxygen source of our atmosphere; the reducing equivalents are used to reduce carbon dioxide to organic products, which support almost all organisms on the Earth planet. The first photosynthetic organisms able to split water were proposed to be cyanobacteria-like ones appearing ca. 2.5 billion years ago. Since then, nature has chosen a sustainable way by using solar energy to develop itself. Inspired by nature, human beings started to mimic the functions of the natural photosynthesis system and proposed the concept of artificial photosynthesis (AP) with the view to creating energy-sustainable societies and reducing the impact on the Earth environments. Water oxidation is a highly energy demanding reaction and essential to produce reducing equivalents for fuel production, and thereby effective water oxidation catalysts (WOCs) are required to catalyze water oxidation and reduce the energy loss. X-ray crystallographic studies on PSII have revealed that the OEC consists of a Mn4CaO5 cluster surrounded by oxygen rich ligands, such as oxyl, oxo, and carboxylate ligands. These negatively charged, oxygen rich ligands strongly stabilize the high valent states of the Mn cluster and play vital roles in effective water oxidation catalysis with low overpotential. This Account describes our endeavors to design effective Ru WOCs with low overpotential, large turnover number, and high turnover frequency by introducing negatively charged ligands, such as carboxylate. Negatively charged ligands stabilized the high valent states of Ru catalysts, as evidenced by the low oxidation potentials. Meanwhile, the oxygen production rates of our Ru catalysts were improved dramatically as well. Thanks to the strong electron donation ability of carboxylate containing ligands, a seven

  18. Live virus vaccines based on a yellow fever vaccine backbone: Standardized template with key considerations for a risk/benefit assessment


    Monath, Thomas P.; Seligman, Stephen J.; Robertson, James S; Guy, Bruno; Hayes, Edward B.; Condit, Richard C.; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T.


    The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called "chimeric virus vaccines"). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for mark...

  19. Backbone and sidechain 1H, 15N and 13C assignments of Tyrosine Phosphatase related to Biofilm formation A (TpbA) of Pseudomonas aeruginosa


    Koveal, Dorothy; Jayasundera, Thusitha B.; Wood, Thomas K.; Peti, Wolfgang; Page, Rebecca


    The backbone and side chain resonance assignments of the Tyrosine Phosphatase related to Biofilm formation A (TpbA) of Pseudomonas aeruginosa have been determined based on triple-resonance experiments using uniformly [13C,15N]-labeled protein. This assignment is the first step towards the determination of the 3-dimensional structure of TpbA.

  20. Organocatalytic and enantioselective Michael reaction between α-nitroesters and nitroalkenes. Syn/anti-selectivity control using catalysts with the same absolute backbone chirality. (United States)

    Martínez, Jose I; Uria, Uxue; Muñiz, Maria; Reyes, Efraím; Carrillo, Luisa; Vicario, Jose L


    The asymmetric and catalytic Michael reaction between α-nitroesters and nitroalkenes has been studied in the presence of two bifunctional catalysts both containing the same absolute chirality at the carbon backbone. The reaction performed in similar conditions allows us to control the syn or anti selectivity of the Michael adduct obtaining good yields and high enantiocontrol in all cases. PMID:26734103

  1. Analyze Of Interrelation Between Knowledge Management And Organizatıonal Structure Of Organization


    MLÁDKOVÁ, Ludmila


    The aim of the article is to discuss interrelation between knowledge management and organizational structure of organization. Organizational structure is a backbone of the organization. Type of organizational structure used has strong impact on everyday life of organization and influences all its activities, including knowledge management. From the point of view of knowledge management, three basic groups of organizational structures can be identified in organizations; top down structures, bo...

  2. Peptide backbone orientation and dynamics in spider dragline silk and two-photon excitation in nuclear magnetic and quadrupole resonance

    International Nuclear Information System (INIS)

    In the first part of the dissertation, spider dragline silk is studied by solid state NMR techniques. The dependence of NMR frequency on molecular orientation is exploited using the DECODER experiment to determine the orientation of the protein backbone within the silk fibre. Practical experimental considerations require that the silk fibres be wound about a cylindrical axis perpendicular to the external magnetic field, complicating the reconstruction of the underlying orientation distribution and necessitating the development of numerical techniques for this purpose. A two-component model of silk incorporating static b-sheets and polyglycine II helices adequately fits the NMR data and suggests that the b-sheets are well aligned along the silk axis (20 FWHM) while the helices are poorly aligned (68 FWHM). The effects of fibre strain, draw rate and hydration on orientation are measured. Measurements of the time-scale for peptide backbone motion indicate that when wet, a strain-dependent fraction of the poorly aligned component becomes mobile. This suggests a mechanism for the supercontraction of silk involving latent entropic springs that undergo a local strain-dependent phase transition, driving supercontraction. In the second part of this dissertation a novel method is developed for exciting NMR and nuclear quadrupole resonance (NQR) by rf irradiation at multiple frequencies that sum to (or differ by) the resonance frequency. This is fundamentally different than traditional NMR experiments where irradiation is applied on-resonance. With excitation outside the detection bandwidth, two-photon excitation allows for detection of free induction signals during excitation, completely eliminating receiver dead-time. A theoretical approach to describing two-photon excitation is developed based on average Hamiltonian theory. An intuition for two-photon excitation is gained by analogy to the coherent absorption of multiple photons requiring conservation of total energy and

  3. Effects of ion binding on the backbone dynamics of calbindin D9k determined by 15N NMR relaxation. (United States)

    Akke, M; Skelton, N J; Kördel, J; Palmer, A G; Chazin, W J


    The backbone dynamics of apo- and (Cd2+)1-calbindin D9k have been characterized by 15N nuclear magnetic resonance spectroscopy. Spin-lattice and spin-spin relaxation rate constants and steady-state [1H]-15N nuclear Overhauser effects were measured at a magnetic field strength of 11.74 T by two-dimensional, proton-detected heteronuclear NMR experiments using 15N-enriched samples. The relaxation parameters were analyzed using a model-free formalism that characterizes the dynamics of the N-H bond vectors in terms of generalized order parameters and effective correlation times. The data for the apo and (Cd2+)1 states were compared to those for the (Ca2+)2 state [Kördel, J., Skelton, N. J., Akke, M., Palmer, A. G., & Chazin, W. J. (1992) Biochemistry 31, 4856-4866] to ascertain the effects on ion ligation on the backbone dynamics of calbindin D9k. The two binding loops respond differently to ligation by metal ions: high-frequency (10(9)-10(12) s-1) fluctuations of the N-terminal ion-binding loop are not affected by ion binding, whereas residues G57, D58, G59, and E60 in the C-terminal ion-binding loop have significantly lower order parameters in the apo state than in the metal-bound states. The dynamical responses of the four helices to binding of ions are much smaller than that for the C-terminal binding loop, with the strongest effect on helix III, which is located between the linker loop and binding site II. Significant fluctuations on slower time scales also were detected in the unoccupied N-terminal ion-binding loop of the apo and (Cd2+)1 states; the apparent rates were greater for the (Cd2+)1 state. These results on the dynamical response to ion binding in calbindin D9k provide insights into the molecular details of the binding process and qualitative evidence for entropic contributions to the cooperative phenomenon of calcium binding for the pathway in which the ion binds first in the C-terminal site. PMID:8373781

  4. NMR characterization of structure, backbone dynamics, and glutathione binding of the human macrophage migration inhibitory factor (MIF). (United States)

    Mühlhahn, P; Bernhagen, J; Czisch, M; Georgescu, J; Renner, C; Ross, A; Bucala, R; Holak, T A


    Human macrophage migration inhibitory factor is a 114 amino acid protein that belongs to the family of immunologic cytokines. Assignments of 1H, 15N, and 13C resonances have enabled the determination of the secondary structure of the protein, which consists of two alpha-helices (residues 18-31 and 89-72) and a central four-stranded beta-sheet. In the beta-sheet, two parallel beta-sheets are connected in an antiparallel sense. From the total of three cysteines present in the primary structure of MIF, none was found to form disulfide bridges. 1H-15N heteronuclear T1, T2, and steady-state NOE measurements indicate that the backbone of MIF exists in a rigid structure of limited conformational flexibility (on the nanosecond to picosecond time scale). Several residues located in the loop regions and at the N termini of two helices exhibit internal motions on the 1-3 ns time scale. The capacity to bind glutathione was investigated by titration of a uniform 15N-labeled sample and led us to conclude that MIF has, at best, very low affinity for glutathione. PMID:8897610

  5. High resolution 4D HPCH experiment for sequential assignment of 13C-labeled RNAs via phosphodiester backbone

    International Nuclear Information System (INIS)

    The three-dimensional structure determination of RNAs by NMR spectroscopy requires sequential resonance assignment, often hampered by assignment ambiguities and limited dispersion of 1H and 13C chemical shifts, especially of C4′/H4′. Here we present a novel through-bond 4D HPCH NMR experiment involving phosphate backbone where C4′–H4′ correlations are resolved along the 1H3′–31P spectral planes. The experiment provides high peak resolution and effectively removes ambiguities encountered during assignments. Enhanced peak dispersion is provided by the inclusion of additional 31P and 1H3′ dimensions and constant-time evolution of chemical shifts. High spectral resolution is obtained by using non-uniform sampling in three indirect dimensions. The experiment fully utilizes the isotopic 13C-labeling with evolution of C4′ carbons. Band selective 13C inversion pulses are used to achieve selectivity and prevent signal dephasing due to the C4′–C3′ and C4′–C5′ homonuclear couplings. Multiple quantum line narrowing is employed to minimize sensitivity loses. The 4D HPCH experiment is verified and successfully applied to a non-coding 34-nt RNA consisting typical structure elements and a 14-nt RNA hairpin capped by cUUCGg tetraloop

  6. MERA: a webserver for evaluating backbone torsion angle distributions in dynamic and disordered proteins from NMR data

    Energy Technology Data Exchange (ETDEWEB)

    Mantsyzov, Alexey B. [M.V. Lomonosov Moscow State University, Faculty of Fundamental Medicine (Russian Federation); Shen, Yang; Lee, Jung Ho [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States); Hummer, Gerhard [Max Planck Institute of Biophysics (Germany); Bax, Ad, E-mail: [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)


    MERA (Maximum Entropy Ramachandran map Analysis from NMR data) is a new webserver that generates residue-by-residue Ramachandran map distributions for disordered proteins or disordered regions in proteins on the basis of experimental NMR parameters. As input data, the program currently utilizes up to 12 different parameters. These include three different types of short-range NOEs, three types of backbone chemical shifts ({sup 15}N, {sup 13}C{sup α}, and {sup 13}C′), six types of J couplings ({sup 3}J{sub HNHα}, {sup 3}J{sub C′C′}, {sup 3}J{sub C′Hα}, {sup 1}J{sub HαCα}, {sup 2}J{sub CαN} and {sup 1}J{sub CαN}), as well as the {sup 15}N-relaxation derived J(0) spectral density. The Ramachandran map distributions are reported in terms of populations of their 15° × 15° voxels, and an adjustable maximum entropy weight factor is available to ensure that the obtained distributions will not deviate more from a newly derived coil library distribution than required to account for the experimental data. MERA output includes the agreement between each input parameter and its distribution-derived value. As an application, we demonstrate performance of the program for several residues in the intrinsically disordered protein α-synuclein, as well as for several static and dynamic residues in the folded protein GB3.

  7. Dialkylaluminium-, -gallium-, and -indium-based poly-Lewis acids with a 1,8-diethynylanthracene backbone. (United States)

    Chmiel, Jasmin; Neumann, Beate; Stammler, Hans-Georg; Mitzel, Norbert W


    Potential host systems based on a rigid 1,8-diethynylanthracendiyl backbone were synthesised by treatment of 1,8-diethynylanthracene with the Group 13 trialkyls AlMe(3), GaMe(3), InMe(3), AlEt(3) and GaEt(3). The resulting products were characterised by IR and multinuclear NMR spectroscopy, elemental analyses and determination of their crystal structures by X-ray diffraction. The compounds are dimeric in the solid state and comprise two M(2)C(2) heterocycles. Depending on the steric demand of the alkyl substituents at the metal atom, different types of binding modes were observed, which can be classified to lie between the ideals of side-on coordination with almost linear primary M-C≡C units and the 3c-2e coordination with symmetrically bridging alkynyl units in M-C-M bonds. As a solution in THF the dimers are broken into monomers and some are found to undergo ligand scrambling reactions. PMID:20827789

  8. Synthesis and in vitro antioxidant functions of protein hydrolysate from backbones of Rastrelliger kanagurta by proteolytic enzymes. (United States)

    Sheriff, Sheik Abdulazeez; Sundaram, Balasubramanian; Ramamoorthy, Baranitharan; Ponnusamy, Ponmurugan


    Every year, a huge quantity of fishery wastes and by-products are generated by fish processing industries. These wastes are either underutilized to produce low market value products or dumped leading to environmental issues. Complete utilization of fishery wastes for recovering value added products would be beneficial to the society and individual. The fish protein hydrolysates and derived peptides of fishery resources are widely used as nutritional supplements, functional ingredients, and flavor enhancers in food, beverage and pharmaceutical industries. Antioxidants from fishery resources have attracted the attention of researchers as they are cheaper in cost, easy to derive, and do not have side effects. Thus the present investigation was designed to produce protein hydrolysate by pepsin and papain digestion from the backbones of Rastrelliger kanagurta (Indian mackerel) and evaluate its antioxidant properties through various in vitro assays. The results reveal that both hydrolysates are potent antioxidants, capable of scavenging 46% and 36% of DPPH (1,1-diphenyl-2 picrylhydrazyl) and 58.5% and 37.54% of superoxide radicals respectively. The hydrolysates exhibit significant (p hydrolysates produced, pepsin derived fraction is superior than papain derived fraction in terms of yield, DH (Degree of hydrolysis), and antioxidant activity. PMID:24596496

  9. Pressure dependence of backbone chemical shifts in the model peptides Ac-Gly-Gly-Xxx-Ala-NH2. (United States)

    Erlach, Markus Beck; Koehler, Joerg; Crusca, Edson; Kremer, Werner; Munte, Claudia E; Kalbitzer, Hans Robert


    For a better understanding of nuclear magnetic resonance (NMR) detected pressure responses of folded as well as unstructured proteins the availability of data from well-defined model systems are indispensable. In this work we report the pressure dependence of chemical shifts of the backbone atoms (1)H(α), (13)C(α) and (13)C' in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH2 (Xxx one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of these nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The polynomial pressure coefficients B 1 and B 2 are dependent on the type of amino acid studied. The coefficients of a given nucleus show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure are also weakly correlated. PMID:27335085

  10. Three-Dimensional Protein Fold Determination from Backbone Amide Pseudocontact Shifts Generated by Lanthanide Tags at Multiple Sites

    KAUST Repository

    Yagi, Hiromasa


    Site-specific attachment of paramagnetic lanthanide ions to a protein generates pseudocontact shifts (PCS) in the nuclear magnetic resonance (NMR) spectra of the protein that are easily measured as changes in chemical shifts. By labeling the protein with lanthanide tags at four different sites, PCSs are observed for most amide protons and accurate information is obtained about their coordinates in three-dimensional space. The approach is demonstrated with the chaperone ERp29, for which large differences have been reported between X-ray and NMR structures of the C-terminal domain, ERp29-C. The results unambiguously show that the structure of rat ERp29-C in solution is similar to the crystal structure of human ERp29-C. PCSs of backbone amides were the only structural restraints required. Because these can be measured for more dilute protein solutions than other NMR restraints, the approach greatly widens the range of proteins amenable to structural studies in solution. © 2013 Elsevier Ltd. All rights reserved.

  11. Insight into a molecular interaction force supporting peptide backbones and its implication to protein loops and folding. (United States)

    Du, Qi-Shi; Chen, Dong; Xie, Neng-Zhong; Huang, Ri-Bo; Chou, Kuo-Chen


    Although not being classified as the most fundamental protein structural elements like α-helices and β-strands, the loop segment may play considerable roles for protein stability, flexibility, and dynamic activity. Meanwhile, the protein loop is also quite elusive; i.e. its interactions with the other parts of protein as well as its own shape-maintaining forces have still remained as a puzzle or at least not quite clear yet. Here, we report a molecular force, the so-called polar hydrogen-π interaction (Hp-π), which may play an important role in supporting the backbones of protein loops. By conducting the potential energy surface scanning calculations on the quasi π-plane of peptide bond unit, we have observed the following intriguing phenomena: (1) when the polar hydrogen atom of a peptide unit is perpendicularly pointing to the π-plane of other peptide bond units, a remarkable Hp-π interaction occurs; (2) the interaction is distance and orientation dependent, acting in a broad space, and belonging to the 'point-to-plane' one. The molecular force reported here may provide useful interaction concepts and insights into better understanding the loop's unique stability and flexibility feature, as well as the driving force of the protein global folding. PMID:25375237

  12. High resolution 4D HPCH experiment for sequential assignment of {sup 13}C-labeled RNAs via phosphodiester backbone

    Energy Technology Data Exchange (ETDEWEB)

    Saxena, Saurabh; Stanek, Jan [University of Warsaw, Faculty of Chemistry, Biological and Chemical Research Centre (Poland); Cevec, Mirko; Plavec, Janez [National Institute of Chemistry, Slovenian NMR Centre (Slovenia); Koźmiński, Wiktor, E-mail: [University of Warsaw, Faculty of Chemistry, Biological and Chemical Research Centre (Poland)


    The three-dimensional structure determination of RNAs by NMR spectroscopy requires sequential resonance assignment, often hampered by assignment ambiguities and limited dispersion of {sup 1}H and {sup 13}C chemical shifts, especially of C4′/H4′. Here we present a novel through-bond 4D HPCH NMR experiment involving phosphate backbone where C4′–H4′ correlations are resolved along the {sup 1}H3′–{sup 31}P spectral planes. The experiment provides high peak resolution and effectively removes ambiguities encountered during assignments. Enhanced peak dispersion is provided by the inclusion of additional {sup 31}P and {sup 1}H3′ dimensions and constant-time evolution of chemical shifts. High spectral resolution is obtained by using non-uniform sampling in three indirect dimensions. The experiment fully utilizes the isotopic {sup 13}C-labeling with evolution of C4′ carbons. Band selective {sup 13}C inversion pulses are used to achieve selectivity and prevent signal dephasing due to the C4′–C3′ and C4′–C5′ homonuclear couplings. Multiple quantum line narrowing is employed to minimize sensitivity loses. The 4D HPCH experiment is verified and successfully applied to a non-coding 34-nt RNA consisting typical structure elements and a 14-nt RNA hairpin capped by cUUCGg tetraloop.

  13. MERA: a webserver for evaluating backbone torsion angle distributions in dynamic and disordered proteins from NMR data

    International Nuclear Information System (INIS)

    MERA (Maximum Entropy Ramachandran map Analysis from NMR data) is a new webserver that generates residue-by-residue Ramachandran map distributions for disordered proteins or disordered regions in proteins on the basis of experimental NMR parameters. As input data, the program currently utilizes up to 12 different parameters. These include three different types of short-range NOEs, three types of backbone chemical shifts (15N, 13Cα, and 13C′), six types of J couplings (3JHNHα, 3JC′C′, 3JC′Hα, 1JHαCα, 2JCαN and 1JCαN), as well as the 15N-relaxation derived J(0) spectral density. The Ramachandran map distributions are reported in terms of populations of their 15° × 15° voxels, and an adjustable maximum entropy weight factor is available to ensure that the obtained distributions will not deviate more from a newly derived coil library distribution than required to account for the experimental data. MERA output includes the agreement between each input parameter and its distribution-derived value. As an application, we demonstrate performance of the program for several residues in the intrinsically disordered protein α-synuclein, as well as for several static and dynamic residues in the folded protein GB3

  14. The "Legislative Backbone" keeping the Institution upright? The Role of European Parliament Committees in the EU Policy-Making Process

    Directory of Open Access Journals (Sweden)

    Christine Neuhold


    Full Text Available Over the past five decades the European Parliament (EP has moved from being a largely consultative assembly to being a genuine co-legislature. The growth in the EPs powers was accompanied by a revaluation of its Standing Committees. It is in these committees, the legislative backbone of the EP, that scrutiny of European Union (EU legislation takes place. As in the US Congress the real work of the Parliament is done in its committees. They have become a key element in the EU policy-making process and make vital contributions to the shaping of legislation. Although these committees play such a major role in the EP, they have rarely been the subject of empirical inquiries. This paper, which is part of a wider project studying the role of committees, intends to fill this gap. In an examination of how legislative acts have been processed by such committees on the basis of interviews and documentary analysis, this paper focuses on the following main questions: 1. How do EP committees operate? 2. How do they interact with other institutions within the EU system of governance? 3. How do they affect the "link" to the EU citizen? From an analytical perspective answers to these questions are important as they help us to understand some characteristics of the EU decision-making process. From a normative perspective our research also tries to answer the question of whether EP committees help increase the EPs accountability to EU citizens.

  15. Impairment assessment of orthogonal frequency division multiplexing over dispersion-managed links in backbone and backhaul networks (United States)

    Tamilarasan, Ilavarasan; Saminathan, Brindha; Murugappan, Meenakshi


    The past decade has seen the phenomenal usage of orthogonal frequency division multiplexing (OFDM) in the wired as well as wireless communication domains, and it is also proposed in the literature as a future proof technique for the implementation of flexible resource allocation in cognitive optical networks. Fiber impairment assessment and adaptive compensation becomes critical in such implementations. A comprehensive analytical model for impairments in OFDM-based fiber links is developed. The proposed model includes the combined impact of laser phase fluctuations, fiber dispersion, self phase modulation, cross phase modulation, four-wave mixing, the nonlinear phase noise due to the interaction of amplified spontaneous emission with fiber nonlinearities, and the photodetector noises. The bit error rate expression for the proposed model is derived based on error vector magnitude estimation. The performance analysis of the proposed model is presented and compared for dispersion compensated and uncompensated backbone/backhaul links. The results suggest that OFDM would perform better for uncompensated links than the compensated links due to the negligible FWM effects and there is a need for flexible compensation. The proposed model can be employed in cognitive optical networks for accurate assessment of fiber-related impairments.

  16. Backbone.js cookbook

    CERN Document Server

    Mirgorod, Vadim


    Written in a friendly, example driven Beginner's Guide format, there are plenty of step-by-step instructions to get you started fast!Pentaho 4.0 By Example: Beginner's Guide is the ideal companion for a wide-variety of developers. Whether you are new to the world of Business Intelligence reporting, or an experienced BI analyst, this book will guide you through the creation of your first reports in Pentaho. We assume some knowledge of the SQL language and database systems.

  17. Backbone.js essentials

    CERN Document Server

    Walker, Jeremy


    If you are a developer with baseline JavaScript proficiency and are familiar with the jQuery library, then this book is ideal for you. Whether you've tried building complex web applications before and been frustrated by the challenge of doing so without the proper tools, or whether you've only built simple websites and are now looking to create full-featured web applications, this book has everything you need to get ahead of the curve.

  18. HMM-based prediction for protein structural motifs' two local properties: solvent accessibility and backbone torsion angles. (United States)

    Yu, Jianyong; Xiang, Leijun; Hong, Jiang; Zhang, Weidong


    Protein structure prediction is often assisted by predicting one-dimensional structural properties including relative solvent accessibility (RSA) surface and backbone torsion angles (BTA) of residues, and these two properties are continuously varying variables because proteins can move freely in a three-dimensional space. Instead of subdividing them into a few arbitrarily defined states that many popular approaches used, this paper proposes an integrated system for realvalue prediction of protein structural motifs' two local properties, based on the modified Hidden Markov Model that we previously presented. The model was used to capture the relevance of RSA and the dependency of BTA between adjacent residues along the local protein chain in motifs with definite probabilities. These two properties were predicted according to their own probability distribution. The method was applied to a protein fragment library. For nine different classes of motifs, real values of RSA were predicted with mean absolute error (MAE) of 0.122-0.175 and Pearson's correlation coefficient (PCC) of 0.623-0.714 between predicted and actual RSA. Meanwhile, real values of BTA were obtained with MAE of 8.5⁰-29.4⁰ for Φ angles, 11.2⁰-38.5⁰ for ψ angles and PCC of 0.601-0.716 for Φ, 0.597-0.713 for ψ. The results were compared with well-known Real-SPINE Server, and indicate the proposed method may at least serve as the foundation to obtain better local properties from structural motifs for protein structure prediction. PMID:22894152

  19. Complete resonance assignment for the polypeptide backbone of interleukin 1β using three-dimensional heteronuclear NMR spectroscopy

    International Nuclear Information System (INIS)

    The complete sequence-specific assignment of the 15N and 1H backbone resonances of the NMR spectrum of recombinant human interleukin 1β has been obtained by using primarily 15N-1H heteronuclear three-dimensional (3D) NMR techniques in combination with 15N-1H heteronuclear and 1H homonuclear two-dimensional NMR. The fingerprint region of the spectrum was analyzed by using a combination of 3D heteronuclear 1H Hartmann-Hahn 15N-1H multiple quantum coherence (3D HOHAHA-HMQC) and 3D heteronuclear 1H nuclear Overhauser 15N-1H multiple quantum coherence (3D NOESY-HMQC) spectroscopies. The authors show that the problems of amide NH and CαH chemical shift degeneracy that are prevalent for proteins of the size are readily overcome by using the 3D heteronuclear NMR technique. A doubling of some peaks in the spectrum was found to be due to N-terminal heterogeneity of the 15N-labeled protein, corresponding to a mixture of wild-type and des-Ala-1-interleukin 1β. The complete list of 15N and 1H assignments is given for all the amide NH and CαH resonances of all non-proline residues, as well as the 1H assignments for some of the amino acid side chains. This first example of the sequence-specific assignment of a protein using heteronuclear 3D NMR provides a basis for further conformational and dynamic studies of interleukin 1β

  20. Combining automated peak tracking in SAR by NMR with structure-based backbone assignment from 15N-NOESY

    KAUST Repository

    Jang, Richard


    Background: Chemical shift mapping is an important technique in NMR-based drug screening for identifying the atoms of a target protein that potentially bind to a drug molecule upon the molecule\\'s introduction in increasing concentrations. The goal is to obtain a mapping of peaks with known residue assignment from the reference spectrum of the unbound protein to peaks with unknown assignment in the target spectrum of the bound protein. Although a series of perturbed spectra help to trace a path from reference peaks to target peaks, a one-to-one mapping generally is not possible, especially for large proteins, due to errors, such as noise peaks, missing peaks, missing but then reappearing, overlapped, and new peaks not associated with any peaks in the reference. Due to these difficulties, the mapping is typically done manually or semi-automatically, which is not efficient for high-throughput drug screening.Results: We present PeakWalker, a novel peak walking algorithm for fast-exchange systems that models the errors explicitly and performs many-to-one mapping. On the proteins: hBclXL, UbcH5B, and histone H1, it achieves an average accuracy of over 95% with less than 1.5 residues predicted per target peak. Given these mappings as input, we present PeakAssigner, a novel combined structure-based backbone resonance and NOE assignment algorithm that uses just 15N-NOESY, while avoiding TOCSY experiments and 13C-labeling, to resolve the ambiguities for a one-to-one mapping. On the three proteins, it achieves an average accuracy of 94% or better.Conclusions: Our mathematical programming approach for modeling chemical shift mapping as a graph problem, while modeling the errors directly, is potentially a time- and cost-effective first step for high-throughput drug screening based on limited NMR data and homologous 3D structures. 2012 Jang et al.; licensee BioMed Central Ltd.

  1. The influence of DNA binding on the backbone dynamics of the yeast cell-cycle protein Mbp1

    International Nuclear Information System (INIS)

    Mbp1 is a transcription factor involved in the regulation of the cell cycle in yeast. The N-terminus of this protein contains a DNA binding domain that includes a winged helix-turn-helix motif. The C-terminal 24 residues of this domain (the 'tail') are disordered in the crystal state, but are important for DNA binding. We have measured 15N NMR relaxation rates at 11.75 and 14.1 T to determine the dynamics of the free protein and in its complex with a specific DNA duplex. The dynamics data were quantitatively analysed using both spectral density mapping and the Lipari-Szabo formalism including the effects of chemical exchange and rotational anisotropy. A detailed analysis has been made of the effect of anisotropy, exchange and experimental precision on the recovered motional parameters. The backbone NH relaxation is affected by motions on a variety of time scales from millisecond to tens of picoseconds. The relaxation data show a structured core of 100 residues corresponding to that observed in the crystal state. Within the core of the protein, two regions on either side of the putative recognition helix (helix B) show slow (ca. 0.2 ms) conformational exchange dynamics that are quenched upon DNA binding. The C-terminal 24 residues are generally more dynamic than in the core. However, in the free protein, a stretch of ∼8 residues in the middle of the tail show relaxation behaviour similar to that in the core, indicating a structured region. NOEs between Ala 114 in this structured part of the tail and residues in the N-terminal beta strand of the core of the protein demonstrate that the tail folds back onto the core of the protein. In the complex with DNA, the structured part of the tail extends by ca. 3 residues. These data provide a framework for understanding the biochemical data on the mechanism and specificity of DNA binding

  2. Combining ambiguous chemical shift mapping with structure-based backbone and NOE assignment from 15N-NOESY

    KAUST Repository

    Jang, Richard


    Chemical shift mapping is an important technique in NMRbased drug screening for identifying the atoms of a target protein that potentially bind to a drug molecule upon the molecule\\'s introduction in increasing concentrations. The goal is to obtain a mapping of peaks with known residue assignment from the reference spectrum of the unbound protein to peaks with unknown assignment in the target spectrum of the bound protein. Although a series of perturbed spectra help to trace a path from reference peaks to target peaks, a one-to-one mapping generally is not possible, especially for large proteins, due to errors, such as noise peaks, missing peaks, missing but then reappearing, overlapped, and new peaks not associated with any peaks in the reference. Due to these difficulties, the mapping is typically done manually or semi-automatically. However, automated methods are necessary for high-throughput drug screening. We present PeakWalker, a novel peak walking algorithm for fast-exchange systems that models the errors explicitly and performs many-to-one mapping. On the proteins: hBclXL, UbcH5B, and histone H1, it achieves an average accuracy of over 95% with less than 1.5 residues predicted per target peak. Given these mappings as input, we present PeakAssigner, a novel combined structure-based backbone resonance and NOE assignment algorithm that uses just 15N-NOESY, while avoiding TOCSY experiments and 13C- labeling, to resolve the ambiguities for a one-toone mapping. On the three proteins, it achieves an average accuracy of 94% or better. Copyright © 2011 ACM.

  3. The "Legislative Backbone" keeping the Institution upright? The Role of European Parliament Committees in the EU Policy-Making Process

    Directory of Open Access Journals (Sweden)

    Christine Neuhold


    Full Text Available Over the past five decades the European Parliament (EP has moved from being a largely consultative assembly to being a genuine co-legislature. The growth in the EP’s powers was accompanied by a revaluation of its Standing Committees. It is in these committees, the “legislative backbone” of the EP, that scrutiny of European Union (EU legislation takes place. As in the US Congress the “real” work of the Parliament is done in its committees. They have become a key element in the EU policy-making process and make vital contributions to the shaping of legislation. Although these committees play such a major role in the EP, they have rarely been the subject of empirical inquiries. This paper, which is part of a wider project studying the role of committees, intends to fill this gap. In an examination of how legislative acts have been processed by such committees on the basis of interviews and documentary analysis, this paper focuses on the following main questions: 1. How do EP committees operate? 2. How do they interact with other institutions within the EU system of governance? 3. How do they affect the "link" to the EU citizen? From an analytical perspective answers to these questions are important as they help us to understand some characteristics of the EU decision-making process. From a normative perspective our research also tries to answer the question of whether EP committees help increase the EP’s accountability to EU citizens.

  4. Sulfur-infiltrated graphene-backboned mesoporous carbon nanosheets with a conductive polymer coating for long-life lithium-sulfur batteries (United States)

    Dong, Yanfeng; Liu, Shaohong; Wang, Zhiyu; Liu, Yang; Zhao, Zongbin; Qiu, Jieshan


    Sandwich-type, two-dimensional hybrid nanosheets were fabricated by the infiltration of nanosized sulfur into graphene-backboned mesoporous carbon with a PPy nanocoating. They exhibit a high reversible capacity for as long as 400 cycles with an ultra slow decay rate of 0.05% per cycle at the high rate of 1-3 C due to the efficient immobilization of polysulfides.Sandwich-type, two-dimensional hybrid nanosheets were fabricated by the infiltration of nanosized sulfur into graphene-backboned mesoporous carbon with a PPy nanocoating. They exhibit a high reversible capacity for as long as 400 cycles with an ultra slow decay rate of 0.05% per cycle at the high rate of 1-3 C due to the efficient immobilization of polysulfides. Electronic supplementary information (ESI) available: Experimental details, BET, SEM, XPS and more electrochemical data. See DOI: 10.1039/c5nr01015b

  5. Selective Acid Hydrolysis Condition for the Composition and Linkage with a Fructofuranosyl Backbone of a Polysaccharide from Angelica sinensis (Oliv) Diels

    Institute of Scientific and Technical Information of China (English)

    Gui Yun XU; Yang CHEN; Ru Xian CHEN


    A new polysaccharide was extracted and purified from the roots of Angelica sinensis (Oliv) Diels (ASD). Its composition and linkage was elucidated by selective hydrolysis and GC/MS analysis of its derivatives. The polysaccharide was made of→1) Fruf(2→and→6) GlCp (1→as its backbone with highly branched structure. To our best knowledge, this is the first report of the fructose residue in polysaccharides from the roots of the ASD.

  6. Sulfur-infiltrated graphene-backboned mesoporous carbon nanosheets with a conductive polymer coating for long-life lithium-sulfur batteries. (United States)

    Dong, Yanfeng; Liu, Shaohong; Wang, Zhiyu; Liu, Yang; Zhao, Zongbin; Qiu, Jieshan


    Sandwich-type, two-dimensional hybrid nanosheets were fabricated by the infiltration of nanosized sulfur into graphene-backboned mesoporous carbon with a PPy nanocoating. They exhibit a high reversible capacity for as long as 400 cycles with an ultra slow decay rate of 0.05% per cycle at the high rate of 1-3 C due to the efficient immobilization of polysulfides. PMID:25832361

  7. Energies and 2 '-Hydroxyl Group Orientations of RNA Backbone Conformations. Benchmark CCSD(T)/CBS Database, Electronic Analysis, and Assessment of DFT Methods and MD Simulations

    Czech Academy of Sciences Publication Activity Database

    Mládek, Arnošt; Banáš, P.; Jurečka, P.; Otyepka, M.; Zgarbová, M.; Šponer, Jiří


    Roč. 10, č. 1 (2014), s. 463-480. ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/12/1878; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : DENSITY-FUNCTIONAL THEORY * SUGAR-PHOSPHATE BACKBONE * QUANTUM-CHEMICAL CALCULATIONS Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014

  8. Investigation of novel solid oxide fuel cell cathodes based on impregnation of SrTixFe1-xO3-δ into ceria-based backbones

    DEFF Research Database (Denmark)

    Brinch-Larsen, Mathias; Søgaard, Martin; Hjelm, Johan;


    performance is believed to originate from poor electronic conduction in the electrodes and possibly also reactions between Sr-containing compounds and CGO. To circumvent the low electronic conductivity, backbones of a composite cathode containing LaCo0.4Ni0.6O 3-δ (LCN60) and CGO were also tried infiltrated......Solid oxide fuel cell (SOFC) cathodes were prepared by impregnating the nitrates corresponding to SrTixFe1-xO3-δ (STF), x= 0; 0.1; 0.2; 0.3; 0.4 and 0.5, into a porous backbone of Ce 0.9Gd0.1O2-δ (CGO). STF was chosen as very high oxygen surface exchange rate, high ionic conductivity and...... backbone. All prepared electrodes were characterized as symmetric cells using impedance spectroscopy. Within the investigated series the infiltrate with x = 0.1 (STF10) showed the best performance with an area specific resistance (ASR) of ASR ≈ 6.4 Ω cm2 (STF10) at 600°C in air. The relatively poor...

  9. Transgene sequences free of CG dinucleotides lead to high level, long-term expression in the lung independent of plasmid backbone design. (United States)

    Bazzani, Reto P; Pringle, Ian A; Connolly, Mary M; Davies, Lee A; Sumner-Jones, Stephanie G; Schleef, Martin; Hyde, Stephen C; Gill, Deborah R


    Non-viral aerosol gene therapy offers great potential for treating chronic lung diseases of the airways such as cystic fibrosis (CF). Early clinical trials showed that transgene expression in the airways was transient whereas maximal duration of transgene expression is essential in order to minimise the frequency of aerosol treatments. Improved vector design, such as careful selection of the promoter/enhancer, can lead to more persistent levels of transgene expression, but multiple factors affect expression in vivo. Following aerosol delivery to the lungs of mice, we measured reporter gene expression from a CpG-free luciferase transgene cassette in the context of both a plasmid and minicircle vector configuration and showed that the vector backbone had no effect on expression. Transgene activity was affected by the vector backbone however, when a similar, but sub-optimal CpG-containing transgene was used, suggesting that aspects of the plasmid backbone had a negative impact on transgene expression. Similar studies were performed in Toll-like receptor-9 (TLR9) knockout mice to investigate a potential role for the TLR9 signalling pathway in detecting CpGs in the vector sequence. Even in the absence of TLR9, persistent expression could only be achieved with a CpG-free transgene. Together, these data indicate that in order to achieve high levels of persistent expression in vivo, a CpG-free transgene cassette is required. PMID:27061267

  10. In Sup35p filaments (the [PSI+] prion), the globular C-terminal domains are widely offset from the amyloid fibril backbone

    Energy Technology Data Exchange (ETDEWEB)

    Baxa, U.; Wall, J.; Keller, P. W.; Cheng, N.; Steven, A. C.


    In yeast cells infected with the [PSI+] prion, Sup35p forms aggregates and its activity in translation termination is downregulated. Transfection experiments have shown that Sup35p filaments assembled in vitro are infectious, suggesting that they reproduce or closely resemble the prion. We have used several EM techniques to study the molecular architecture of filaments, seeking clues as to the mechanism of downregulation. Sup35p has an N-terminal 'prion' domain; a highly charged middle (M-)domain; and a C-terminal domain with the translation termination activity. By negative staining, cryo-EM and scanning transmission EM (STEM), filaments of full-length Sup35p show a thin backbone fibril surrounded by a diffuse 65-nm-wide cloud of globular C-domains. In diameter ({approx}8 nm) and appearance, the backbones resemble amyloid fibrils of N-domains alone. STEM mass-per-unit-length data yield -1 subunit per 0.47 nm for N-fibrils, NM-filaments and Sup35p filaments, further supporting the fibril backbone model. The 30 nm radial span of decorating C-domains indicates that the M-domains assume highly extended conformations, offering an explanation for the residual Sup35p activity in infected cells, whereby the C-domains remain free enough to interact with ribosomes.

  11. n Silico Analysis of Envelope Dengue Virus-2 and Envelope Dengue Virus-3 Protein as the Backbone of Dengue Virus Tetravalent Vaccine by Using Homology Modeling Method

    Directory of Open Access Journals (Sweden)

    Rizky I. Taufik


    Full Text Available Problem statement: Dengue fever, which was caused by Dengue virus infection, had became a major public health problem in the tropic and subtropical countries. Dengue virus (DENV had four serotypes (DENV-1, DENV-2, DENV-3 and DENV-4, based on their immunogenic in the human body. Preventive measure will be necessary to decrease the prevalence of dengue fever, by developing modern vaccine. Approach: This research was focused on in silico study of dengue virus vaccines, by using envelope (E protein of DENV-2 and DENV-3 as their backbones. T cell epitope prediction was determined by using MULTIPRED server and B cell epitope prediction was determined by using Conformational Epitope Prediction server (CEP. Homology modeling study of E DENV-3 protein as the vaccine backbone had produced six dengue vaccine peptides (HMM Vaccine 1-6. Moreover, homology modeling study of E DENV-2 protein as vaccine backbone had produced six dengue vaccine peptides (ANN vaccine 1-6. Results: The BLAST analysis of HMM and ANN vaccines had produced 93% and 91% identity, respectively. The Ramachandran Plot of both vaccines had shown less than 15% non glycine residue in the disallowed region, therefore it showed the solid stability of the proteins. The VAST analysis of E DENV-3 backbone vaccines had determined, that HMM4 and HMM6 had the highest structure similarity with native E DENV-3. HMM4 and HMM6 had the highest VAST score of 64.5. Moreover, the VAST analysis of E DENV-2 backbone vaccines had determined, that ANN1, ANN3, ANN4, ANN5 and ANN6 had the highest structure similarity with native E DENV-2. ANN1, ANN3, ANN4, ANN5 and ANN6 have the highest VAST score of 64.7. Conclusion/Recommendation: It could be inferred from this research that HMM4; HMM6; ANN1; ANN3; ANN4; ANN5; and ANN6 were the best in silico vaccine design, based on their similarity with native E DENV Proteins. This research could be applied for the wet

  12. Orientation Preferences of Backbone Secondary Amide Functional Groups in Peptide Nucleic Acid Complexes: Quantum Chemical Calculations Reveal an Intrinsic Preference of Cationic D-Amino Acid-Based Chiral PNA Analogues for the P-form


    Topham, Christopher M.; Smith, Jeremy C.


    Geometric descriptions of nonideal interresidue hydrogen bonding and backbone-base water bridging in the minor groove are established in terms of polyamide backbone carbonyl group orientation from analyses of residue junction conformers in experimentally determined peptide nucleic acid (PNA) complexes. Two types of interresidue hydrogen bonding are identified in PNA conformers in heteroduplexes with nucleic acids that adopt A-like basepair stacking. Quantum chemical calculations on the bindin...

  13. Exopolysaccharide Biosynthesis in Lactococcus lactis NIZO B40: Functional Analysis of the Glycosyltransferase Genes Involved in Synthesis of the Polysaccharide Backbone


    Kranenburg, Richard van; van Swam, Iris I.; Marugg, Joey D.; Kleerebezem, Michiel; de Vos, Willem M.


    We used homologous and heterologous expression of the glycosyltransferase genes of the Lactococcus lactis NIZO B40 eps gene cluster to determine the activity and substrate specificities of the encoded enzymes and established the order of assembly of the trisaccharide backbone of the exopolysaccharide repeating unit. EpsD links glucose-1-phosphate from UDP-glucose to a lipid carrier, EpsE and EpsF link glucose from UDP-glucose to lipid-linked glucose, and EpsG links galactose from UDP-galactos...

  14. Effects of a vanadium post-metallocene catalyst-induced polymer backbone inhomogeneity on UV oxidative degradation of the resulting polyethylene film

    KAUST Repository

    Atiqullah, M.


    A Group 5 post-metallocene precatalyst, (ONO)VCl(THF) 2 (ONO = a bis(phenolate)pyridine LX 2 pincer ligand), activated with modified methylaluminoxane (MMAO-3A) produced a linear ethylene homopolymer (nm-HomoPE)and an unusual inhomogeneous copolymer (nm-CopolyPE) with 1-hexene having very low backbone unsaturation. The nm-CopolyPE inhomogeneity was reflected in the distributions of short chain branches, 1-hexene composition, and methylene sequence length. The 1-hexene incorporation into the polyethylene backbone strongly depended on the molecular weight of the growing polymer chain. (ONO)VCl(THF) 2, because of site diversity and easier removal of a tertiary (vs. a secondary) hydrogen, produced a skewed short chain branching (SCB) profile, incorporating 1-hexene more efficiently in the low molecular weight region than in the high molecular weight region. The significant decrease in molecular weight by 1-hexene showed that the (ONO)VCl(THF) 2 catalytic sites were also highly responsive to chain-transfer directly to 1-hexene itself, producing vinyl and trans-vinylene termini. Subsequently, the effect of backbone inhomogeneity on the UV oxidative degradation of films made from both polyethylenes was investigated. The major functional group accumulated in the branched nm-CopolyPE film was carbonyl followed by carboxyl, then vinyl/ester, whereas that in the linear nm-HomoPE film was carboxyl. However, (carbonyl, carboxyl, vinyl, and ester) nm-CopolyPE film >> (carboxyl) nm-HomoPE film). The distributions of the tertiary C-H sites and methylene sequence length in the branched nm-CopolyPE film enhanced abstraction of H, decomposition of hydroperoxide group ROOH, and generation of carbonyl compounds as compared with those in the linear nm-HomoPE film. This clearly establishes the role played by the backbone inhomogeneity. The effect of short chain branches and sequence length distributions on peak melting temperature T pm, and most probably lamellar thickness L o, was

  15. The DNA and RNA sugar-phosphate backbone emerges as the key player. An overview of quantum-chemical, structural biology and simulation studies

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Mládek, Arnošt; Šponer, Judit E.; Svozil, Daniel; Zgarbová, M.; Banáš, Pavel; Jurečka, P.; Otyepka, M.


    Roč. 14, č. 44 (2012), s. 15257-15277. ISSN 1463-9076 R&D Projects: GA ČR(CZ) GD203/09/H046; GA ČR(CZ) GAP208/10/2302; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GAP208/12/1878; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : DNA * RNA * sugar -phosphate backbone Subject RIV: BO - Biophysics Impact factor: 3.829, year: 2012

  16. Organization within Organization Studies

    DEFF Research Database (Denmark)

    Lopdrup-Hjorth, Thomas

    This paper explores how prevalent contemporary problematizations of organizations coincide with a widespread assessment that Organization Studies (OS) has run out of steam. This impasse, the paper argues, is largely due to the emergence of an organization-phobia that has come to seize several...... strands of theorizing. By attending to the wide-ranging and far-reaching history of this organization-phobia, the paper argues that OS has become increasingly incapable of speaking about its core object. I show how organizations went from being conceptualized as entities of major importance to becoming...... associated with all kinds of ills. Through this history, organizations as distinct entities have been rendered so problematic that they have gradually come to be removed from the center of OS. The costs of this have been rather significant. Besides undermining the grounds that gave OS intellectual...

  17. Knowledge Organization = Information Organization?

    DEFF Research Database (Denmark)

    Hjørland, Birger

    Are the terms ―information organization‖ (IO), ―organization of information‖ (OI) and ―information architecture‖ (IA) synonyms for knowledge organization (KO)? This study uses bibliometric methods, among others, to determine some relations between these terms and their meanings. Apparently the data...

  18. Backbone conformational flexibility of the lipid modified membrane anchor of the human N-Ras protein investigated by solid-state NMR and molecular dynamics simulation. (United States)

    Vogel, Alexander; Reuther, Guido; Roark, Matthew B; Tan, Kui-Thong; Waldmann, Herbert; Feller, Scott E; Huster, Daniel


    The lipid modified human N-Ras protein, implicated in human cancer development, is of particular interest due to its membrane anchor that determines the activity and subcellular location of the protein. Previous solid-state NMR investigations indicated that this membrane anchor is highly dynamic, which may be indicative of backbone conformational flexibility. This article aims to address if a dynamic exchange between three structural models exist that had been determined previously. We applied a combination of solid-state nuclear magnetic resonance (NMR) methods and replica exchange molecular dynamics (MD) simulations using a Ras peptide that represents the terminal seven amino acids of the human N-Ras protein. Analysis of correlations between the conformations of individual amino acids revealed that Cys 181 and Met 182 undergo collective conformational exchange. Two major structures constituting about 60% of all conformations could be identified. The two conformations found in the simulation are in rapid exchange, which gives rise to low backbone order parameters and nuclear spin relaxation as measured by experimental NMR methods. These parameters were also determined from two 300 ns conventional MD simulations, providing very good agreement with the experimental data. PMID:19819220

  19. Significant Role of DNA Backbone in Mediating the Transition Origin of Electronic Excitations of B-DNA - Implication from Long Range Corrected TDDFT and Quantified NTO Analysis

    CERN Document Server

    Li, Jian-Hao; Guo, Guang-Yu; Hayashi, Michitoshi


    We systematically investigate the possible complex transition origin of electronic excitations of giant molecular systems by using the recently proposed QNTO analysis [J.-H. Li, J.-D. Chai, G. Y. Guo and M. Hayashi, Chem. Phys. Lett., 2011, 514, 362.] combined with long-range corrected TDDFT calculations. Thymine (Thy) related excitations of biomolecule B-DNA are then studied as examples, where the model systems have been constructed extracting from the perfect or a X-ray crystal (PDB code 3BSE) B-DNA structure with at least one Thy included. In the first part, we consider the systems composed of a core molecular segment (e.g. Thy, di-Thy) and a surrounding physical/chemical environment of interest (e.g. backbone, adjacent stacking nucleobases) and examine how the excitation properties of the core vary in response to the environment. We find that the orbitals contributed from DNA backbone and surrounding nucleobases often participate in a transition of Thy-related excitations affecting their composition, abso...

  20. Molecular Data for a Biochemical Model of DNA Radiation Damage: Electron Impact Ionization and Dissociative Ionization of DNA Bases and Sugar-Phosphate Backbone (United States)

    Dateo, Christopher E.; Fletcher, Graham D.


    As part of the database for building up a biochemical model of DNA radiation damage, electron impact ionization cross sections of sugar-phosphate backbone and DNA bases have been calculated using the improved binary-encounter dipole (iBED) model. It is found that the total ionization cross sections of C3'- and C5'-deoxyribose-phospate, two conformers of the sugar-phosphate backbone, are close to each other. Furthermore, the sum of the ionization cross sections of the separate deoxyribose and phosphate fragments is in close agreement with the C3'- and C5'-deoxyribose-phospate cross sections, differing by less than 10%. Of the four DNA bases, the ionization cross section of guanine is the largest, then in decreasing order, adenine, thymine, and cytosine. The order is in accordance with the known propensity of oxidation of the bases by ionizing radiation. Dissociative ionization (DI), a process that both ionizes and dissociates a molecule, is investigated for cytosine. The DI cross section for the formation of H and (cytosine-Hl)(+), with the cytosine ion losing H at the 1 position, is also reported. The threshold of this process is calculated to be 17.1 eV. Detailed analysis of ionization products such as in DI is important to trace the sequential steps in the biochemical process of DNA damage.

  1. Nuclear magnetic resonance secondary shifts of a light-harvesting 2 complex reveal local backbone perturbations induced by its higher-order interactions. (United States)

    Pandit, Anjali; Wawrzyniak, Piotr K; van Gammeren, Adriaan J; Buda, Francesco; Ganapathy, Swapna; de Groot, Huub J M


    Protein nuclear magnetic resonance (NMR) secondary chemical shifts are widely used to predict the secondary structure, and in solid-state NMR, they are often the only unambiguous structural parameters available. However, the employed prediction methods are empirical in nature, relying on the assumption that secondary shifts are only affected by shielding effects of neighboring atoms. We analyzed the secondary shifts of a photosynthetic membrane protein with a high density of chromophores and very tight packing, the light-harvesting 2 (LH2) complex of Rhodopseudomonas acidophila. A relation was found between secondary shift anomalies and protein-protein or pigment-protein tertiary and quaternary contacts. For several residues, including the bacteriochlorophyll-coordinating histidines (alphaH31 and betaH30) and the phenylalanine alphaF41 that has strongly twisted C(b)-C(a)-C and C(a)-C-N conformations in the LH2 crystal structure, the perturbing effects on the backbone chemical shifts were tested by density functional theory (DFT) calculations. We propose that higher-order interactions in the tightly packed complex can induce localized perturbations of the backbone conformation and electronic structure, related to functional pigment-protein or protein-protein interactions. PMID:19954238

  2. Legionella pneumophila strain associated with the first evidence of person-to-person transmission of Legionnaires’ disease: a unique mosaic genetic backbone (United States)

    Borges, Vítor; Nunes, Alexandra; Sampaio, Daniel A.; Vieira, Luís; Machado, Jorge; Simões, Maria J.; Gonçalves, Paulo; Gomes, João P.


    A first strong evidence of person-to-person transmission of Legionnaires’ Disease (LD) was recently reported. Here, we characterize the genetic backbone of this case-related Legionella pneumophila strain (“PtVFX/2014”), which also caused a large outbreak of LD. PtVFX/2014 is phylogenetically divergent from the most worldwide studied outbreak-associated L. pneumophila subspecies pneumophila serogroup 1 strains. In fact, this strain is also from serogroup 1, but belongs to the L. pneumophila subspecies fraseri. Its genomic mosaic backbone reveals eight horizontally transferred regions encompassing genes, for instance, involved in lipopolysaccharide biosynthesis or encoding virulence-associated Dot/Icm type IVB secretion system (T4BSS) substrates. PtVFX/2014 also inherited a rare ~65 kb pathogenicity island carrying virulence factors and detoxifying enzymes believed to contribute to the emergence of best-fitted strains in water reservoirs and in human macrophages, as well as a inter-species transferred (from L. oakridgensis) ~37.5 kb genomic island (harboring a lvh/lvr T4ASS cluster) that had never been found intact within L. pneumophila species. PtVFX/2014 encodes another lvh/lvr cluster near to CRISPR-associated genes, which may boost L. pneumophila transition from an environmental bacterium to a human pathogen. Overall, this unique genomic make-up may impact PtVFX/2014 ability to adapt to diverse environments, and, ultimately, to be transmitted and cause human disease. PMID:27196677

  3. Legionella pneumophila strain associated with the first evidence of person-to-person transmission of Legionnaires' disease: a unique mosaic genetic backbone. (United States)

    Borges, Vítor; Nunes, Alexandra; Sampaio, Daniel A; Vieira, Luís; Machado, Jorge; Simões, Maria J; Gonçalves, Paulo; Gomes, João P


    A first strong evidence of person-to-person transmission of Legionnaires' Disease (LD) was recently reported. Here, we characterize the genetic backbone of this case-related Legionella pneumophila strain ("PtVFX/2014"), which also caused a large outbreak of LD. PtVFX/2014 is phylogenetically divergent from the most worldwide studied outbreak-associated L. pneumophila subspecies pneumophila serogroup 1 strains. In fact, this strain is also from serogroup 1, but belongs to the L. pneumophila subspecies fraseri. Its genomic mosaic backbone reveals eight horizontally transferred regions encompassing genes, for instance, involved in lipopolysaccharide biosynthesis or encoding virulence-associated Dot/Icm type IVB secretion system (T4BSS) substrates. PtVFX/2014 also inherited a rare ~65 kb pathogenicity island carrying virulence factors and detoxifying enzymes believed to contribute to the emergence of best-fitted strains in water reservoirs and in human macrophages, as well as a inter-species transferred (from L. oakridgensis) ~37.5 kb genomic island (harboring a lvh/lvr T4ASS cluster) that had never been found intact within L. pneumophila species. PtVFX/2014 encodes another lvh/lvr cluster near to CRISPR-associated genes, which may boost L. pneumophila transition from an environmental bacterium to a human pathogen. Overall, this unique genomic make-up may impact PtVFX/2014 ability to adapt to diverse environments, and, ultimately, to be transmitted and cause human disease. PMID:27196677

  4. Reduced dimensionality tailored HN(C)N experiments for facile backbone resonance assignment of proteins through unambiguous identification of sequential HSQC peaks (United States)

    Kumar, Dinesh


    Two novel reduced dimensionality (RD) tailored HN(C)N [S.C. Panchal, N.S. Bhavesh, R.V. Hosur, Improved 3D triple resonance experiments, HNN and HN(C)N, for HN and 15N sequential correlations in (13C, 15N) labeled proteins: application to unfolded proteins, J. Biomol. NMR 20 (2001) 135-147] experiments are proposed to facilitate the backbone resonance assignment of proteins both in terms of its accuracy and speed. These experiments - referred here as (4,3)D-hNCOcaNH and (4,3)D-hNcoCANH - exploit the linear combination of backbone 15N and 13C‧/13Cα chemical shifts simultaneously to achieve higher peak dispersion and randomness along their respective F1 dimensions. Simply, this has been achieved by modulating the backbone 15N(i) chemical shifts with that of 13C‧ (i - 1)/13Cα (i - 1) spins following the established reduced dimensionality NMR approach [T. Szyperski, D.C. Yeh, D.K. Sukumaran, H.N. Moseley, G.T. Montelione, Reduced-dimensionality NMR spectroscopy for high-throughput protein resonance assignment, Proc. Natl. Acad. Sci. USA 99 (2002) 8009-8014]. Though the modification is simple it has resulted an ingenious improvement of HN(C)N both in terms of peak dispersion and easiness of establishing the sequential connectivities. The increased dispersion along F1 dimension solves two purposes here: (i) resolves the ambiguities arising because of degenerate 15N chemical shifts and (ii) reduces the signal overlap in F2(15N)-F3(1H) planes (an important requisite in HN(C)N based assignment protocol for facile and unambiguous identification of sequentially connected HSQC peaks). The performance of both these experiments and the assignment protocol has been demonstrated using bovine apo Calbindin-d9k (75 aa) and urea denatured UNC60B (a 152 amino acid ADF/cofilin family protein of Caenorhabditis elegans), as representatives of folded and unfolded protein systems, respectively.

  5. To-Do with JavaScript MV* : A study into the differences between Backbone.js and AngularJS


    Runeberg, Joakim


    Arbetet undersöker skillnader mellan de två mest populära JavaScript ramverken: An-gularJS och Backbone.js. Målet med undersökningen är att se ifall det ena gränssnittet är att föredra over det andra, och vilka arkitektoniska skillnader det finns emellan de två gränssnitten. Det här sker genom att använda det öppna projektet TodoMVC, med HTML5s localStorage för att lagra information. I samband med undersökningen utveck-lades automatiserade test med hjälp av PhantomJS, ett JavaScript gränssnit...

  6. Optimization of the Redundant Route in Enterprise Backbone Network%企业骨干网链路冗余后路由的优化

    Institute of Scientific and Technical Information of China (English)



    In the network age, along with the development of the QQ, micro message, WEB browsing, online shopping, of ice network ,etc., people depend on network more and more, and the requirements of the network performance is also much higher than before. The traditional network,using a single point of access,is prone to a single point of failure. That an equipment or a port fails directly af ects the work of its lower device and host. After discussing the redundancy of enterprise backbone network in detail,this paper optimizes redundant route by using OSPF route, Cost, floating route, policy route, NAPT technology, and thus achieves the data load balancing of enterprise backbone network.%  在当代网络中,伴随着QQ、微信、WEB浏览、网络购物、网络办公等网络业务的不断发展,人们越来越依赖网络,对网络的性能要求也是越来越高,传统企业网络采用单点接入,容易出现单点故障,某台设备或某个端口出现故障,会直接影响其下联设备和主机的工作。文章重点讨论了企业骨干网链路冗余后,运用OSPF路由、接口Cost值、浮动路由、策略路由、NAPT等技术对冗余路由进行优化,实现骨干网链路上数据的负载均衡。

  7. S-Shaped Conformation of the Quaterthiophene Molecular Backbone in Two-Dimensional Bisterpyridine-Derivative Self-Assembled Nanoarchitecture. (United States)

    Kervella, Yann; Shilova, Ekaterina; Latil, Sylvain; Jousselme, Bruno; Silly, Fabien


    The conformation and the two-dimensional self-assembly of 4'-(3',4″-dihexyloxy-5,2':5',2″:5″,2‴-quaterthien-2,5‴-diyl)-bis(2,2':6',2″-terpyridine) molecules are theoretically and experimentally investigated. This molecular building block forms a hydrogen-bonded chiral supramolecular nanoarchitecture on graphite at the solid/liquid interface. Scanning tunneling microscopy (STM) shows that the molecule adopts an S-shaped conformation in this structure. DFTB+ calculations reveal that this conformation is not the lowest-energy conformation. The molecular nanoarchitecture appears to be stabilized by hydrogen bonding as well as van der Waals interactions. I-, L-, and D-shaped molecular conformations are, however, locally observed at the domain boundary, but these conformations do not self-assemble into organized 2D structures. PMID:26624809

  8. Photochemical stability of random poly(3-hexylthiophene-co-3-cyanothiophene) and its use in roll coated ITO-free organic photovoltaics

    DEFF Research Database (Denmark)

    Roth, Bérenger; Rudenko, Andrey E.; Thompson, Barry C.;


    The photochemical stability of the active layer blend for organic solar cells was explored by introducing electron withdrawing cyano groups into the backbone of poly-3-hexylthiophene (P3HT). Random copolymerization of 2-bromo-3-hexyl-5-trimethylstannylthiophene and 2-bromo-3-cyano-5-trimethylstan...

  9. 聚酰亚胺主链结构对液晶取向膜性能的影响%Properties of polyimide liquid crystal alignment layer with different backbone structure

    Institute of Scientific and Technical Information of China (English)

    刘露露; 刘明; 龚世铭; 汪映寒


    A series polyimides (PIs)were prepared by one-step method.These PIs were comprised of a functional diamine N,N-bis (4-aminophenyl )-4-(dodecylo-xy-biphenyl )-4′-amino-phenylether (C1 2 -BAAPE),one of two commercially available diamines 2,2′-Bis(trifluoromethy-l)-4,4′-diaminobiphe-nyl (TFDB),4,4′-Oxydianiline (ODA)and one of two dianhydride 4,4′-(hexafluoroisopropylidene) diphthalic anhydride (6FDA)and 4,4′-Oxydiphthalic anhydride (ODPA)in order to get different backbone structures.The structures and thermo properties of these PIs were characterized by NMR, FT-IR,DSC and TGA.Pretilt angles and alignment abilities were carried out by pretilt angle tester and polarization microscope.Solubility of PIs was tested by dissolving PIs in various organic solvents. DSC and TGA curves showed that PI-2 had higher glass transition temperature (T g )and decomposi-tion temperature (T d )than PI-1 and PI-3.Three PI films presented vertical alignment before mechan-ical rubbing and only PI-2 maintained it after rubbing process.Conformations of these PIs were simu-lated by Material Studio (MS).The vertical conformation existed in PI-2 ’s backbones improved rubbing resistance and showed vertical alignment ability after rubbing.%采用一步法,以 N,N-二(4-氨基苯基)-4-(十二烷氧基联苯基)-4’-氨基苯醚(C12-BAAPE)为控制预倾角的功能性二胺,2,2’-双三氟甲基-4,4’-联苯二胺(TFDB)或4,4’-二氨基二苯醚(ODA)为辅助二胺,分别与2,2’-双(3,4-二羧苯基)六氟丙烷四羧酸二酐(6FDA)和4,4’-联苯醚二酐(ODPA)聚合,得到三种主链结构不同的聚酰亚胺(PI-1、PI-2和PI-3)。利用 NMR、FT-IR、DSC、TGA、偏光显微镜和预倾角测试仪对聚合物的结构、热性能以及制备的液晶盒的取向性进行了表征,同时测试了3种 PI 的溶解性能。结果表明,PI-2液晶取向膜的耐摩擦性能明显优于 PI-1和 PI-3,且具有更高的玻璃化转变温度(T g )和分解温度(T d ),更好

  10. 1H, 13C, and 15N backbone and side chain resonance assignments of thermophilic Geobacillus kaustophilus cyclophilin-A

    Energy Technology Data Exchange (ETDEWEB)

    Holliday, Michael; Zhang, Fengli; Isern, Nancy G.; Armstrong, Geoffrey S.; Eisenmesser, Elan Z.


    Cyclophilins catalyze the reversible peptidyl-prolyl isomerization of their substrates and are present across all kingdoms of life from humans to bacteria. Although numerous biological roles have now been discovered for cyclophilins, their function was initially ascribed to their chaperone-like activity in protein folding where they catalyze the often rate-limiting step of proline isomerization. This chaperone-like activity may be especially important under extreme conditions where cyclophilins are often over expressed, such as in tumors for human cyclophilins {Lee, 2010 #1167}, but also in organisms that thrive under extreme conditions, such as theromophilic bacteria. Moreover, the reversible nature of the peptidyl-prolyl isomerization reaction catalyzed by cyclophilins has allowed these enzymes to serve as model systems for probing the role of conformational changes during catalytic turnover {Eisenmesser, 2002 #20;Eisenmesser, 2005 #203}. Thus, we present here the resonance assignments of a thermophilic cyclophilin from Geobacillus kaustophilus derived from deep-sea sediment {Takami, 2004 #1384}. This thermophilic cyclophilin may now be studied at a variety of temperatures to provide insight into the comparative structure, dynamics, and catalytic mechanism of cyclophilins.

  11. Mechanical reliability of porous low-k dielectrics for advanced interconnect: Study of the instability mechanisms in porous low-k dielectrics and their mediation through inert plasma induced re-polymerization of the backbone structure (United States)

    Sa, Yoonki

    catalysts for reactions that break the cross-linked backbone. Clearly, both changes in PLK chemistry and bond structure must be addressed in order for any repair method to be favorable. For this reason, Ar plasma treatment with low energy ions is employed to repair the plasma induced damage by creating the desired changes in the film matrix without a significant loss of other properties. Our approach of using inert plasma as a way for damage recovery is motivated by the realization that there is no possibility of chemical reaction with any organic species, driving the energy transfer only from the plasma species towards the respective film matrix. As results, after applying Ar plasma beam treatment followed by annealing on damaged PLK films, the resistance against thermal instability and viscoplastic deformation is found to be improved. Ball indentation depth of the films with Ar plasma process is drastically reduced at the identical condition. More noticeable is the fact that such alternation is converted towards a dehydration reaction under hydrostatic thermal pressure, which causes dielectric constant to decrease and films shrinkage to restore during reconstruction of polymer chains. It is suggested that the immediate event of an Ar plasma beam radiation is to deposit energy from the plasma species (ions, electrons) and this energy input produces the excited state species because Ar cannot chemically react with the film matrix. As a consequence, the radical sites are generated at the less stable area such as colony boundary or pore surface with the decay of the excited species, leading to the production of free radicals by an energy transfer to the bonds which are to be broken. Then, the activated sites experience chemical bond rearrangement by chain-scission, branching, or cross-linking. In our case, crosslink with C is involved with silylmethylene (Si-(CH 2)x-Si) groups and it is turned out that some of these groups are converted to methyl groups terminally bonded to

  12. Solution structure and backbone dynamics of an antigen-free heavy chain variable domain (VHH) from Llama. (United States)

    Renisio, Jean-Guillaume; Pérez, Janice; Czisch, Michael; Guenneugues, Marc; Bornet, Olivier; Frenken, Leon; Cambillau, Christian; Darbon, Hervé


    Camelids, (dromedaries, camels, and llamas) produce heavy-chains antibodies, with their antigen recognition sites composed of a single VH-like domain, referred to as VHH. The solution structure of one of these VHHs domains (VHH-H14), raised against the alpha subunit of the human chorionic gonadotropin hormone (hCG), has been determined by (15)N heteronuclear three-dimensional NMR spectroscopy. The framework is well resolved within the set of 20 best-calculated NMR structures and is close to that of classical VH domains from vertebrate antibodies, consisting of two antiparallel beta-sheets organized in a beta-barrel. Loops display a lower precision, especially the Complementarity Determining Regions (CDRs), involved in antigen recognition. Comparison of the three-dimensional VHH-H14 solution structure with its previously solved crystal structure (Spinelli et al., Nature Struct. Biol. 1996;3:752-757) reveals a high similarity to the framework, whereas significant conformational differences occur on CDRs, leading to the assumption that the antigen recognition site is a more mobile part. In order to deepen our insights into the dynamics of VHH-H14 in solution, (15)N relaxation was measured with longitudinal R1 and transverse R2 self-relaxation rates, and (15)N steady-state heteronuclear nuclear Overhauser enhancements (NOE), making it possible to probe picosecond-to-millisecond internal motions. Determination of dynamic parameters (S(2), tau(e), and Rex) through the Lipari-Szabo Model-free approach enables the identification of several regions with enhanced dynamics. Especially, the mobility measurements from NMR confirm that the antigen recognition site is the most mobile part of the VHH-H14 domain on picosecond-to-nanosecond fast time scales. Several residues belonging to the three CDRs are submitted to chemical exchange processes occurring on slow microsecond-to-millisecond time scales, suggesting that the formation of the VHH/antigen complex should be accompanied

  13. Preferred conformation and dynamics of the glycerol backbone in phospholipids. An NMR and X-ray single-crystal analysis

    International Nuclear Information System (INIS)

    The conformation of the glycerol group of a number of diacyl and monoacyl (lyso) phospholipids differing in the chemical nature of the head group was studied by 1H high-resolution NMR and X-ray crystallography. The NMR measurements were carried out with solutions or micellar dispersions of the lipids in deuteriated organic solvents or 2H2O. Both solutions, in which the lipid is present as monomers, and lipid micelles give rise to good high-resolution NMR spectra exhibiting spin coupling hyperfine interactions. From 1H spin coupling it is concluded that there are two stable conformations about the glycerol C(2)-C(3) bond of phospholipids. By comparison of NMR and single-crystal X-ray data it is obvious that both conformations are minimum free energy conformations. Rotamer A is the conformation prevailing in phospholipid single-crystal structures. The conformation of rotamer B is also found in phospholipid single-crystal structures though to a lesser extent. NMR measurements indicate that in liquid crystals the diacylglycerol part of phospholipids fluctuates between the two stable staggered conformations of rotamers A and B. The transition between rotamers A and B is fast on the NMR time scale and must be accompanied by appropriate changes in the torsion angles β1 to β4 and γ1 to γ4 of the two fatty acyl chains. It is clear from the data presented that the parallel alignment of the hydrocarbon chains or chain stacking in phospholipid aggregates such as bilayers or micelles is the fundamental principle governing the conformation of the C(2)-C(3) glycerol bond

  14. Supramolecular chemistry: from aromatic foldamers to solution-phase supramolecular organic frameworks. (United States)

    Li, Zhan-Ting


    This mini-review covers the growth, education, career, and research activities of the author. In particular, the developments of various folded, helical and extended secondary structures from aromatic backbones driven by different noncovalent forces (including hydrogen bonding, donor-acceptor, solvophobicity, and dimerization of conjugated radical cations) and solution-phase supramolecular organic frameworks driven by hydrophobically initiated aromatic stacking in the cavity of cucurbit[8]uril (CB[8]) are highlighted. PMID:26664626

  15. Orientation Preferences of Backbone Secondary Amide Functional Groups in Peptide Nucleic Acid Complexes: Quantum Chemical Calculations Reveal an Intrinsic Preference of Cationic D-Amino Acid-Based Chiral PNA Analogues for the P-form

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Jeremy C [ORNL; Topham, Christopher [University of Heidelberg


    Geometric descriptions of nonideal interresidue hydrogen bonding and backbone-base water bridging in the minor groove are established in terms of polyamide backbone carbonyl group orientation from analyses of residue junction conformers in experimentally determined peptide nucleic acid (PNA) complexes. Two types of interresidue hydrogen bonding are identified in PNA conformers in heteroduplexes with nucleic acids that adopt A-like base pair stacking. Quantum chemical calculations on the binding of a water molecule to an O2 base atom in glycine-based PNA thymine dimers indicate that junctions modeled with P-form backbone conformations are lower in energy than a dimer comprising the predominant conformation observed in A-like helices. It is further shown in model systems that PNA analogs based on D-lysine are better able to preorganize in a conformation exclusive to P-form helices than is glycine-based PNA. An intrinsic preference for this conformation is also exhibited by positively charged chiral PNA dimers carrying 3-amino-D-alanine or 4-aza-D-leucine residue units that provide for additional rigidity by side-chain hydrogen bonding to the backbone carbonyl oxygen. Structural modifications stabilizing P-form helices may obviate the need for large heterocycles to target DNA pyrimidine bases via PNADNA-PNA triplex formation. Quantum chemical modeling methods are used to propose candidate PNA Hoogsteen strand designs.

  16. Orientation preferences of backbone secondary amide functional groups in peptide nucleic acid complexes: quantum chemical calculations reveal an intrinsic preference of cationic D-amino acid-based chiral PNA analogues for the P-form. (United States)

    Topham, Christopher M; Smith, Jeremy C


    Geometric descriptions of nonideal interresidue hydrogen bonding and backbone-base water bridging in the minor groove are established in terms of polyamide backbone carbonyl group orientation from analyses of residue junction conformers in experimentally determined peptide nucleic acid (PNA) complexes. Two types of interresidue hydrogen bonding are identified in PNA conformers in heteroduplexes with nucleic acids that adopt A-like basepair stacking. Quantum chemical calculations on the binding of a water molecule to an O2 base atom in glycine-based PNA thymine dimers indicate that junctions modeled with P-form backbone conformations are lower in energy than a dimer comprising the predominant conformation observed in A-like helices. It is further shown in model systems that PNA analogs based on D-lysine are better able to preorganize in a conformation exclusive to P-form helices than is glycine-based PNA. An intrinsic preference for this conformation is also exhibited by positively charged chiral PNA dimers carrying 3-amino-D-alanine or 4-aza-D-leucine residue units that provide for additional rigidity by side-chain hydrogen bonding to the backbone carbonyl oxygen. Structural modifications stabilizing P-form helices may obviate the need for large heterocycles to target DNA pyrimidine bases via PNA.DNA-PNA triplex formation. Quantum chemical modeling methods are used to propose candidate PNA Hoogsteen strand designs. PMID:17071666

  17. Easy and unambiguous sequential assignments of intrinsically disordered proteins by correlating the backbone {sup 15}N or {sup 13}C′ chemical shifts of multiple contiguous residues in highly resolved 3D spectra

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Yuichi; Kulminskaya, Natalia V.; Mulder, Frans A. A., E-mail: [Aarhus University, Department of Chemistry and Interdisciplinary Nanoscience Center (iNANO) (Denmark)


    Sequential resonance assignment strategies are typically based on matching one or two chemical shifts of adjacent residues. However, resonance overlap often leads to ambiguity in resonance assignments in particular for intrinsically disordered proteins. We investigated the potential of establishing connectivity through the three-bond couplings between sequentially adjoining backbone carbonyl carbon nuclei, combined with semi-constant time chemical shift evolution, for resonance assignments of small folded and larger unfolded proteins. Extended sequential connectivity strongly lifts chemical shift degeneracy of the backbone nuclei in disordered proteins. We show here that 3D (H)N(COCO)NH and (HN)CO(CO)NH experiments with relaxation-optimized multiple pulse mixing correlate up to seven adjacent backbone amide nitrogen or carbonyl carbon nuclei, respectively, and connections across proline residues are also obtained straightforwardly. Multiple, recurrent long-range correlations with ultra-high resolution allow backbone {sup 1}H{sup N}, {sup 15}N{sup H}, and {sup 13}C′ resonance assignments to be completed from a single pair of 3D experiments.

  18. Organ Transplantation (United States)

    ... their death. One strategy is simply to permit organ sale by changing the National Organ Transplant Act (NOTA), the federal law that bans organ sales. Then, individuals would be free to broker contracts ...

  19. Comparison of the backbone dynamics of wild-type Hydrogenobacter thermophilus cytochrome c{sub 552} and its b-type variant

    Energy Technology Data Exchange (ETDEWEB)

    Tozawa, Kaeko; Ferguson, Stuart J.; Redfield, Christina, E-mail: [University of Oxford, Department of Biochemistry (United Kingdom); Smith, Lorna J., E-mail: [University of Oxford, Department of Chemistry (United Kingdom)


    Cytochrome c{sub 552} from the thermophilic bacterium Hydrogenobacter thermophilus is a typical c-type cytochrome which binds heme covalently via two thioether bonds between the two heme vinyl groups and two cysteine thiol groups in a CXXCH sequence motif. This protein was converted to a b-type cytochrome by substitution of the two cysteine residues by alanines (Tomlinson and Ferguson in Proc Natl Acad Sci USA 97:5156–5160, 2000a). To probe the significance of the covalent attachment of the heme in the c-type protein, {sup 15}N relaxation and hydrogen exchange studies have been performed for the wild-type and b-type proteins. The two variants share very similar backbone dynamic properties, both proteins showing high {sup 15}N order parameters in the four main helices, with reduced values in an exposed loop region (residues 18–21), and at the C-terminal residue Lys80. Some subtle changes in chemical shift and hydrogen exchange protection are seen between the wild-type and b-type variant proteins, not only for residues at and neighbouring the mutation sites, but also for some residues in the heme binding pocket. Overall, the results suggest that the main role of the covalent linkages between the heme group and the protein chain must be to increase the stability of the protein.

  20. (nBuCp)2ZrCl2-catalyzed Ethylene-4M1P Copolymerization: Copolymer Backbone Structure, Melt Behavior, and Crystallization

    KAUST Repository

    Atiqullah, Muhammad


    The judicious design of methylaluminoxane (MAO) anions expands the scope for developing industrial metallocene catalysts. Therefore, the effects of MAO anion design on the backbone structure, melt behavior, and crystallization of ethylene−4-methyl-1-pentene (E−4M1P) copolymer were investigated. Ethylene was homopolymerized, as well as copolymerized with 4M1P, using (i) MAO anion A (unsupported [MAOCl2]−) premixed with dehydroxylated silica, (nBuCp)2ZrCl2, and Me2SiCl2; and (ii) MAO anion B (Si−O−Me2Si−[MAOCl2]−) supported with (nBuCp)2ZrCl2 on Me2SiCl2-functionalized silica. Unsupported Me2SiCl2, opposite to the supported analogue, acted as a co-chain transfer agent with 4M1P. The modeling of polyethylene melting and crystallization kinetics, including critical crystallite stability, produced insightful results. This study especially illustrates how branched polyethylene can be prepared from ethylene alone using particularly one metallocene-MAO ion pair, and how a compound, that functionalizes silica as well as terminates the chain, can synthesize ethylene−α-olefin copolymers with novel structures. Hence, it unfolds prospective future research niches in polyethyne systhesis. This article is protected by copyright. All rights reserved.

  1. Robustness and backbone motif of a cancer network regulated by miR-17-92 cluster during the G1/S transition.

    Directory of Open Access Journals (Sweden)

    Lijian Yang

    Full Text Available Based on interactions among transcription factors, oncogenes, tumor suppressors and microRNAs, a Boolean model of cancer network regulated by miR-17-92 cluster is constructed, and the network is associated with the control of G1/S transition in the mammalian cell cycle. The robustness properties of this regulatory network are investigated by virtue of the Boolean network theory. It is found that, during G1/S transition in the cell cycle process, the regulatory networks are robustly constructed, and the robustness property is largely preserved with respect to small perturbations to the network. By using the unique process-based approach, the structure of this network is analyzed. It is shown that the network can be decomposed into a backbone motif which provides the main biological functions, and a remaining motif which makes the regulatory system more stable. The critical role of miR-17-92 in suppressing the G1/S cell cycle checkpoint and increasing the uncontrolled proliferation of the cancer cells by targeting a genetic network of interacting proteins is displayed with our model.

  2. A novel dengue virus serotype 1 vaccine candidate based on Japanese encephalitis virus vaccine strain SA14-14-2 as the backbone. (United States)

    Yang, Huiqiang; Li, Zhushi; Lin, Hua; Wang, Wei; Yang, Jian; Liu, Lina; Zeng, Xianwu; Wu, Yonglin; Yu, Yongxin; Li, Yuhua


    To develop a potential dengue vaccine candidate, a full-length cDNA clone of a novel chimeric virus was constructed using recombinant DNA technology, with Japanese encephalitis virus (JEV) vaccine strain SA14-14-2 as the backbone, with its premembrane (prM) and envelope (E) genes substituted by their counterparts from dengue virus type 1 (DENV1). The chimeric virus (JEV/DENV1) was successfully recovered from primary hamster kidney (PHK) cells by transfection with the in vitro transcription products of JEV/DENV1 cDNA and was identified by complete genome sequencing and immunofluorescent staining. No neuroinvasiveness of this chimeric virus was observed in mice inoculated by the subcutaneous route (s.c.) or by the intraperitoneal route (i.p.), while some neurovirulence was displayed in mice that were inoculated directly by the intracerebral route (i.c.). The chimeric virus was able to stimulate high-titer production of antibodies against DENV1 and provided protection against lethal challenge with neuroadapted dengue virus in mice. These results suggest that the chimeric virus is a promising dengue vaccine candidate. PMID:26976137

  3. Reduced Dimensionality tailored HN(C)N Pulse Sequences for Efficient Backbone Resonance Assignment of Proteins through Rapid Identification of Sequential HSQC peaks

    CERN Document Server

    Kumar, Dinesh


    Two novel reduced dimensionality (RD) experiments -(4,3)D-hNCOcaNH and (4,3)D-hNcoCANH- have been presented here to facilitate the backbone resonance assignment of proteins both in terms of its accuracy and speed. The experiments basically represent an improvisation of previously reported HN(C)N experiment [Panchal et. al., J. Biomol. NMR. (2002), 20 (2), 135-147] and exploit the simple reduced dimensionality NMR concept [Szyperski et. al. (2002), Proc. Natl. Acad. Sci. U.S.A. 99(12), 8009-8014] to achieve (a) higher dispersion and resolution along the co-evolved F1 dimension and (b) rapid identification of sequential HSQC peaks on its F2(15N)- F3(1H) planes. The current implementation is based on the fact that the linear combination of 15N and 13CO/13Ca chemical shifts offers relatively better dispersion and randomness compared to the individual chemical shifts; thus enables the assignment of crowded HSQC spectra by resolving the ambiguities generally encountered in HNCN based assignment protocol because of ...


    Institute of Scientific and Technical Information of China (English)

    Jing Zeng; Yuan Li; Jia-jing Li; Rui Wang; Bin He; Yu Nie; Xiang-lin Luo; Zhi-rong Zhang; Zhong-wei Gua


    Inclusion complexes(ICs)composed of ocyclodextrins(α-CD)and biodegradable comblike copolymers with poly(α,β-malic acid)(PMA)backbones and methylated poly(ethylene glycol)(mPEG)side chains were prepared by the host-guest reaction.Two series of ICs with mPEG750 and mPEG2000 were prepared.The stoichiometry(EG/CD)of all the ICs in mPEG2000 series was 3.1,no matter what the graft degree was.While in mPEG750 series,the stoichiometry(EG/CD)was very different;it increased with the amount of mPEG decreasing.The decomposition temperatures of the fragments in ICs were closely related to graft degrees.The stack of α-CDs in ICs was a channel-type structure.The crystal of ICs was lamellar,and it could be reorganized to well-defined supermolecular structure.

  5. Comparison of fast backbone dynamics at amide nitrogen and carbonyl sites in dematin headpiece C-terminal domain and its S74E mutant

    International Nuclear Information System (INIS)

    We perform a detailed comparison of fast backbone dynamics probed at amide nitrogen versus carbonyl carbon sites for dematin headpiece C-terminal domain (DHP) and its S74E mutant (DHPS74E). Carbonyl dynamics is probed via auto-correlated longitudinal rates and transverse C'/C'-Cα CSA/dipolar and C'/C'-N CSA/dipolar cross-correlated rates, while 15N data are taken from a previous study. Resulting values of effective order parameters and internal correlation times support the conclusion that C' relaxation reports on a different subset of fast motions compared to those probed at N-H bond vectors in the same peptide planes. 13C' order parameters are on the average 0.08 lower than 15N order parameters with the exception of the flexible loop region in DHP. The reduction of mobility in the loop region upon the S74E mutation can be seen from the 15N order parameters but not from the 13C order parameters. Internal correlation times at 13C' sites are on the average an order of magnitude longer than those at 15N sites for the well-structured C-terminal subdomains, while the more flexible N-terminal subdomains have more comparable average internal correlation times.

  6. Backbone and Ile-δ1, Leu, Val Methyl 1H, 13C and 15N NMR chemical shift assignments for human interferon-stimulated gene 15 protein

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Cuifeng; Aramini, James M.; Ma, LiChung; Cort, John R.; Swapna, G.V.T.; Krug, R. M.; Montelione, Gaetano


    Human interferon-stimulated gene 15 protein (ISG15), also called ubiquitin cross-reactive protein (UCRP), is the first identified ubiquitin-like protein containing two ubiquitin-like domains fused in tandem. The active form of ISG15 is conjugated to target proteins via the C-terminal glycine residue through an isopeptide bond in a manner similar to ubiquitin. The biological role of ISG15 is strongly associated with the modulation of cell immune function, and there is mounting evidence suggesting that many viral pathogens evade the host innate immune response by interfering with ISG15 conjugation to both host and viral proteins in a variety of ways. Here we report nearly complete backbone 1HN, 15N, 13CO, and 13Ca, as well as side chain 13Cb, methyl (Ile-d1, Leu, Val), amide (Asn, Gln), and indole NH (Trp) NMR resonance assignments for the 157-residue human ISG15 protein. These resonance assignments provide the basis for future structural and functional solution NMR studies of the biologically important human ISG15 protein.

  7. Matching Organs (United States)

    ... Donor Organs With Transplant Candidates When a deceased organ donor is identified, a transplant coordinator from an organ ... transplant candidate, you are registered on the national organ transplant waiting list. A living donor may also be identified and evaluated for living ...

  8. Fixing Beijing’s Backbone

    Institute of Scientific and Technical Information of China (English)


    Capital’s central axis will be renovated as part of World Cultural Heritage status application Whenever the layout of Beijing is mentioned,its iconic central axis will immediately come to mind.It is so important that the Beijing Government

  9. Future High Capacity Backbone Networks

    DEFF Research Database (Denmark)

    Wang, Jiayuan

    studied in details with dynamic network simulations using OPNET. Dynamic routing optimization methods are proposed. The influences of re-routing and load-balancing factors on the algorithm are evaluated with a focus on different re-routing thresholds. Results from dynamic network simulations show that re......-routing strategies can further lower CO2 emissions compared to basic energy source routing scheme, and that a lower re-routing threshold achieves more savings. The increased blocking probability brought by using rerouting schemes can be compensated by applying load balancing criteria. A trade-off between blocking...... methods and the control over QoS. In the presented case, the integrated control plane collects the network energy related information and the QoS requirements of different types of traffic. This information is used to define the routing behavior for a specific class of service. Due to the flexibility of...

  10. A Strong Backbone For Export

    Institute of Scientific and Technical Information of China (English)


    China Export & Credit Insurance Corp., founded in 2001, is the country’s only policy-oriented credit insurance company. In line with the state’s diplomatic, foreign trade and industrial policies, it supports the country’s commodity, technology and servic

  11. Study on Lyophilized Protective for Recombinant Anti - artherosclerosis Protein on the Basis of SAK Backbone%重组SRH蛋白冻干保护剂的研究

    Institute of Scientific and Technical Information of China (English)

    邹民吉; 徐涛; 刘深; 付文亮; 徐东刚


    Objective To select a lyophilized protective for recombinant anti - artherosclerosis protein on the basis of SAK backbone. Methods Mannitol, dextran 40, sucrose,and glycine in their different concentrations were selected to make up a single recipe or different complex recipes of their concentrations. After lyophilization, the thrombolytic activity and plasticity change should be examined, in the meantime, the lyophilized sample was rapidly thowed at 371 and the changes of thrombolytic activity and plasticity also should be examined. Results The protective effects on the protein of interest were not significantly different between glyceral and dextran 40 in their different concentrations. Both of them possessed better protective effect, however, that of the sucrose and glycine in different concentrations were less effective. The complex recipe of dextran 40, sucrose and glycine displayed the best protective effect on the protein of interest among the complex recipes, but the complex of gyceral, sucrose and glycine in the different concentrations had no obvious protective effect. Conclusion The dextran 40, sucrose and gycine in differet concentrations possess a significantly protective effect on the lyophilized process of the recombinant anti - artherosclerosis protein on the basis of SAK backbone.%目的 筛选并优化重组SRH蛋白的冻千保护剂,使其能够保持良好的生物学活性.方法 选择不同浓度的冻干保护剂,包括甘露醇、右旋糖酐40、蔗糖和甘氨酸等组成不同浓度的单一和复合配方,冷冻干燥后检测冻干样品的溶栓活性和成型的变化,同时,冻干样品经过37℃加速实验后,检测其溶栓活性和成型状况的改变,对比分析各组保护剂的效果.结果 不同浓度的甘露醇和右旋糖苷40对SRH蛋白的保护作用良好,没有明显差异,而不同浓度的蔗糖和甘氨酸保护效果较差.复方中以右旋糖苷40、蔗糖和甘胺酸的复合对目的蛋白的保

  12. In-depth sphingomyelin characterization using electron impact excitation of ions from organics and mass spectrometry. (United States)

    Baba, Takashi; Campbell, J Larry; Le Blanc, J C Yves; Baker, Paul R S


    Electron impact excitation of ions from organics (EIEIO), also referred to as electron-induced dissociation, was applied to singly charged SM molecular species in the gas phase. Using ESI and a quadrupole TOF mass spectrometer equipped with an electron-ion reaction device, we found that SMs fragmented sufficiently to identify their lipid class, acyl group structure, and the location of double bond(s). Using this technique, nearly 200 SM molecular species were found in four natural lipid extracts: bovine milk, porcine brain, chicken egg yolk, and bovine heart. In addition to the most common backbone, d18:1, sphingosines with a range of carbon chain lengths, sphingadienes, and some sphinganine backbones were also detected. Modifications in natural SMs were also identified, including addition of iodine/methanol across a carbon-carbon double bond. This unparalleled new approach to SM analysis using EIEIO-MS shows promise as a unique and powerful tool for structural characterization. PMID:27005317

  13. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines. (United States)

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei


    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines. PMID:25265876

  14. 3D-TROSY-based backbone and ILV-methyl resonance assignments of a 319-residue homodimer from a single protein sample

    Energy Technology Data Exchange (ETDEWEB)

    Krejcirikova, Anna; Tugarinov, Vitali, E-mail: [University of Maryland, Department of Chemistry and Biochemistry (United States)


    The feasibility of practically complete backbone and ILV methyl chemical shift assignments from a single [U-{sup 2}H,{sup 15}N,{sup 13}C; Ile{delta}1-{l_brace}{sup 13}CH{sub 3}{r_brace}; Leu,Val-{l_brace}{sup 13}CH{sub 3}/{sup 12}CD{sub 3}{r_brace}]-labeled protein sample of the truncated form of ligand-free Bst-Tyrosyl tRNA Synthetase (Bst-{Delta}YRS), a 319-residue predominantly helical homodimer, is established. Protonation of ILV residues at methyl positions does not appreciably detract from the quality of TROSY triple resonance data. The assignments are performed at 40 Degree-Sign C to improve the sensitivity of the measurements and alleviate the overlap of {sup 1}H-{sup 15}N correlations in the abundant {alpha}-helical segments of the protein. A number of auxiliary approaches are used to assist in the assignment process: (1) selection of {sup 1}H-{sup 15}N amide correlations of certain residue types (Ala, Thr/Ser) that simplifies 2D {sup 1}H-{sup 15}N TROSY spectra, (2) straightforward identification of ILV residue types from the methyl-detected 'out-and-back' HMCM(CG)CBCA experiment, and (3) strong sequential HN-HN NOE connectivities in the helical regions. The two subunits of Bst-YRS were predicted earlier to exist in two different conformations in the absence of ligands. In agreement with our earlier findings (Godoy-Ruiz in J Am Chem Soc 133:19578-195781, 2011), no evidence of dimer asymmetry has been observed in either amide- or methyl-detected experiments.

  15. Backbone dynamics of a model membrane protein: assignment of the carbonyl carbon 13C NMR resonances in detergent-solubilized M13 coat protein

    International Nuclear Information System (INIS)

    The major coat protein of the filamentous bacteriophage M13 is a 50-residue amphiphilic polypeptide which is inserted, as an integral membrane-spanning protein, in the inner membrane of the Escherichia coli host during infection. 13C was incorporated biosynthetically into a total of 23 of the peptide carbonyls using labeled amino acids (alanine, glycine, lysine, phenylalanine, and proline). The structure and dynamics of carbonyl-labeled M13 coat protein were monitored by 13C nuclear magnetic resonance (NMR) spectroscopy. Assignment of many resonances was achieved by using protease digestion, pH titration, or labeling of the peptide bond with both 13C and 15N. The carbonyl region of the natural-abundance 13C NMR spectrum of M13 coat protein in sodium dodecyl sulfate solution shows approximately eight backbone carbonyl resonances with line widths much narrower than the rest. Three of these more mobile residues correspond to assigned peaks (glycine-3, lysine-48, and alanine-49) in the individual amino acid spectra, and another almost certainly arises from glutamic acid-2. A ninth residue, alanine-1, also gives rise to a very narrow carbonyl resonance if the pH is well above or below the pK/sub a/ of the terminal amino group. These data suggest that only about four residues at either end of the protein experience large-amplitude spatial fluctuations; the rest of the molecule is essentially rigid on the time scale of the overall rotational tumbling of the protein-detergent complex. The relative exposure of different regions of detergent-bound protein was monitored by limited digestion with proteinase K. Comparable spectra and digestion patterns were obtained when the protein was solubilized in sodium deoxycholate, suggesting that the coat protein binds both amphiphiles in a similar fashion

  16. Transferring a Gene Expression Cassette Lacking the Vector Backbone Sequences of the 1Ax1 High Molecular Weight Glutenin Subunit into Two Chinese Hexaploid Wheat Genotypes

    Institute of Scientific and Technical Information of China (English)

    SHI Nong-nong; HE Guang-yuan; LI Ke-xiu; WANG Hui-zhong; CHEN Guan-ping; XU Ying


    1Ax1 high molecular weight glutenin subunit (HMW-GS) gene expression cassette (GEC) lacking vector backbone sequences together with selectable marker Bar GEC were co-transformed into Chinese hexaploid cultivars Een 1 and Emai 12 to test the feasibility and the efficiency of explant regeneration, transformation frequency and transgene expression comparing with whole vector transformation by the approaches of plasmid extraction and excision, immature embryo isolation, particle co-bombardment, tissue culture, DNA extraction, PCR amplification, southern hybridization, leaf-painting test and SDS-PAGE etc. No significant difference was shown in tissue culture response of the proportion of embryogenic calli, somatic embryogenesis and regeneration frequency between GEC and whole plasmid bombarded embryos, but both regenerated less well than non-bombarded control. Total 56 plantlets that survived PPT selection had insertion of at least the Bar gene, 18 were from the GEC treatment and 38 from the whole plasmid treatment, the escape ratio averaged 0.23. Six independent transplants f230 - f235 with GEC transformation from genotype Emai 12 presented clear PCR amplification bands of Bar and 1Ax1 gene. The transformation and co-transformation frequency were 3.51 and 100% respectively. PCR amplification using a primer-pair specific for ampicillin resistant gene indicated the existence of AmpR gene in whole vectors but the removal in GECs and transplants. Southern blot of total DNA and PCR products from transgenic plants of 1Ax1 GEC confirmed the integration of the transgene 1Ax1 and the absence of the EcoR Ⅰ recognition site at both ends of the 1Ax1 GEC when integrated. SDS-PAGE showed the expression of 1Ax1 GEC and un-expression of whole plasmid. The length of integrated fragment, the proportion of the gene of interest (GOI) and the selectable marker (MG), bombardment pressure and genotypes are vital for the expression of a transformed GEC.

  17. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    Energy Technology Data Exchange (ETDEWEB)

    Ono, A.; Kan, Lousing (Johns Hopkins Univ., Baltimore, MD (United States)); Chingnien Chen (National Inst. of Health, Bethesda, MD (United States))


    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  18. Backbone metal cyclization: Novel {sup 99m}Tc labeled GnRH analog as potential SPECT molecular imaging agent in cancer

    Energy Technology Data Exchange (ETDEWEB)

    Barda, Yaniv; Cohen, Nasi; Lev, Vered; Ben-Aroya, Nurit; Koch, Yitzhak; Mishani, Eyal; Fridkin, Mati; Gilon, Chaim E-mail:


    Gonadotropin-releasing hormone (GnRH) is a decapeptide secreted to the pituitary where it binds to specific receptors on the gonadotropes to regulate gonadotropic hormones (luteinizing hormone (LH) and follicle-stimulating hormone (FSH)) synthesis and secretion. Specific GnRH receptors are overexpressed in breast, prostatic, ovarian, and other tumors. The aim of this study was to synthesize a cyclic GnRH analog with high affinity to GnRH receptors that can be radiolabeled with {sup 99m}Tc. A precyclic GnRH analog, [Cys-Gly]{sup 1}[D-Ala]{sup 6}[N{sup {alpha}}({eta}-Cys-amino hexyl)]{sup 10}GnRH (Gn-2), containing two hemi-chelator groups was synthesized. It was cyclized applying the recently reported backbone metal cyclization (BMC) approach, to obtain cyclo(Re(O)1-10)[Cys-Gly]{sup 1}[D-Ala]{sup 6}[N{sup {alpha}}({eta}-Cys-amino hexyl)]{sup 10}GnRH (cyclo[Re(O)-Gn-2]). For comparative evaluations, Gn-2 was oxidized on-resin to yield cyclo(S-S,1-10)[Cys-Gly]{sup 1}[D-Ala]{sup 6}[N{sup {alpha}}({eta}-Cys-amino hexyl)]{sup 10}GnRH, (cyclo[S-S-Gn-2]). The binding affinity of cyclo[Re(O)-Gn-2] to rat pituitary membranes showed IC{sub 50} of 50nM, compared to IC{sub 50} = 10 nM in the native GnRH. Cyclo({sup 99m}Tc(O)1-10)[Cys-Gly]{sup 1}[D-Ala]{sup 6}[N{sup {alpha}}({eta}-Cys-amino hexyl)]{sup 10}GnRH (cyclo[{sup 99m}Tc(O)-Gn-2]) was synthesized from Gn-2 and showed similar chromatographic behavior to its rhenium surrogate.

  19. Design of HIV-1 Protease Inhibitors with Amino-bis-tetrahydrofuran Derivatives as P2-Ligands to Enhance Backbone-Binding Interactions. Synthesis, Biological Evaluation, and Protein-Ligand X-ray Studies

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Arun K.; Martyr, Cuthbert D.; Osswald, Heather L.; Sheri, Venkat Reddy; Kassekert, Luke A.; Chen, Shujing; Agniswamy, Johnson; Wang, Yuan-Fang; Hayashi, Hironori; Aoki, Manabu; Weber, Irene T.; Mitsuya, Hiroaki (GSU); (Kumamoto); (Purdue)


    Structure-based design, synthesis, and biological evaluation of a series of very potent HIV-1 protease inhibitors are described. In an effort to improve backbone ligand–binding site interactions, we have incorporated basic-amines at the C4 position of the bis-tetrahydrofuran (bis-THF) ring. We speculated that these substituents would make hydrogen bonding interactions in the flap region of HIV-1 protease. Synthesis of these inhibitors was performed diastereoselectively. A number of inhibitors displayed very potent enzyme inhibitory and antiviral activity. Inhibitors 25f, 25i, and 25j were evaluated against a number of highly-PI-resistant HIV-1 strains, and they exhibited improved antiviral activity over darunavir. Two high resolution X-ray structures of 25f- and 25g-bound HIV-1 protease revealed unique hydrogen bonding interactions with the backbone carbonyl group of Gly48 as well as with the backbone NH of Gly48 in the flap region of the enzyme active site. These ligand–binding site interactions are possibly responsible for their potent activity.

  20. Polythiophene and oligothiophene systems modified by TTF electroactive units for organic electronics. (United States)

    Kanibolotsky, Alexander L; Findlay, Neil J; Skabara, Peter J


    The aim of this review is to give an update on current progress in the synthesis, properties and applications of thiophene-based conjugated systems bearing tetrathiafulvalene (TTF) units. We focus mostly on the synthesis of poly- and oligothiophenes with TTF moieties fused to the thiophene units of the conjugated backbone either directly or via a dithiin ring. The electrochemical behaviour of these materials and structure-property relationships are discussed. The study is directed towards the development of a new type of organic semiconductors based on these hybrid materials for application in organic field effect transistors and solar cells. PMID:26664595

  1. Organic spintronics

    International Nuclear Information System (INIS)

    We review the emerging field of organic spintronics, where organic materials are applied as a medium to transport and control spin-polarized signals. The contacts for injecting and detecting spins are formed by ferromagnetic metals, oxides, or inorganic semiconductors. First, the basic concepts of spintronics and organic electronics are addressed, and phenomena which are in particular relevant for organic spintronics are highlighted. Experiments using different organic materials, including carbon nanotubes, organic thin films, self-assembled monolayers and single molecules are then reviewed. Observed magnetoresistance points toward successful spin injection and detection, but spurious magnetoresistance effects can easily be confused with spin accumulation. A few studies report long spin relaxation times and lengths, which forms a promising basis for further research. We conclude with discussing outstanding questions and problems. (topical review)

  2. Organic electroluminescence

    CERN Document Server

    Kafafi, Zakya H


    Organic light-emitting diode(OLED) technology has achieved significant penetration in the commercial market for small, low-voltage and inexpensive displays. Present and future novel technologies based on OLEDs involve rigid and flexible flat panel displays, solid-state lighting, and lasers. Display applications may range from hand-held devices to large flat panel screens that can be rolled up or hung flat on a wall or a ceiling. Organic Electroluminescence gives an overview of the on-going research in the field of organic light-emitting materials and devices, covering the principles of electroluminescence in organic thin films, as well as recent trends, current applications, and future potential uses. The book begins by giving a background of organic electroluminescence in terms of history and basic principles. It offers details on the mechanism(s) of electroluminescence in thin organic films. It presentsin-depth discussions of the parameters that control the external electroluminescence quantum efficien...

  3. Transnational Organizing

    DEFF Research Database (Denmark)

    Henriksen, Lasse Folke; Seabrooke, Leonard


    An ongoing question for institutional theory is how organizing occurs transnationally, where institution building occurs in a highly ambiguous environment. This article suggests that at the core of transnational organizing is competition and coordination within professional and organizational...... networks over who controls issues. Transnational issues are commonly organized through professional battles over how issues are treated and what tasks are involved. These professional struggles are often more important than what organization has a formal mandate over an issue. We highlight how ‘issue...... should be treated and governed by organizations. Using network and career sequences methods, we provide a case of transnational organizing through professionals who attempt issue control and network management on transnational environmental sustainability certification. The article questions how...

  4. Organic salmon

    DEFF Research Database (Denmark)

    Ankamah Yeboah, Isaac; Nielsen, Max; Nielsen, Rasmus

    The year 2016 is groundbreaking for organic aquaculture producers in EU, as it represents the deadline for implementing a full organic life cycle in the aquaculture production. Such a shift induces production costs for farmers and if it should be profitable, they must receive higher prices. This...... study identifies the price premium on organic salmon in the Danish retail sale sector using consumer panel scanner data for households by applying the hedonic price model while permitting unobserved heterogeneity between households. A premium of 20% for organic salmon is found. Since this premium is...... closer to organic labeled agriculture products than to ecolabelled capture fisheries products, it indicates that consumers value organic salmon as an agriculture product more than fisheries product....

  5. Live virus vaccines based on a yellow fever vaccine backbone: standardized template with key considerations for a risk/benefit assessment. (United States)

    Monath, Thomas P; Seligman, Stephen J; Robertson, James S; Guy, Bruno; Hayes, Edward B; Condit, Richard C; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T


    The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called "chimeric virus vaccines"). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus, Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were exchanged for the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of

  6. Organic optoelectronics

    CERN Document Server

    Hu, Wenping; Gong, Xiong; Zhan, Xiaowei; Fu, Hongbing; Bjornholm, Thomas


    Written by internationally recognized experts in the field with academic as well as industrial experience, this book concisely yet systematically covers all aspects of the topic.The monograph focuses on the optoelectronic behavior of organic solids and their application in new optoelectronic devices. It covers organic electroluminescent materials and devices, organic photonics, materials and devices, as well as organic solids in photo absorption and energy conversion. Much emphasis is laid on the preparation of functional materials and the fabrication of devices, from materials synthesis a

  7. Organic synthesis

    International Nuclear Information System (INIS)

    The 1988 progress report of the Organic Synthesis Chemistry laboratory (Polytechnic School, France), is presented. The laboratory activities are centered on the chemistry of natural products, which have a biological activity and on the development of new reactions, useful in the organic synthesis. The research works involve the following domains: the natural products chemistry which are applied in pharmacology, the plants and insects chemistry, the organic synthesis, the radical chemistry new reactions and the bio-organic physicochemistry. The published papers, the congress communications and the thesis are listed

  8. Organ Transplantation (United States)

    ... must be just and fair. Value judgments and economic considerations affect who is admitted to waiting lists and who gets available organs, calling into question the justice and fairness of the allocation system. It is essential to increase the supply of donated organs; one ...

  9. Organic Synthesis


    Romea, Pedro


    Organic Synthesis is a one-semester course of the fourth year of the Chemistry Degree at the Universitat de Barcelona. This course covers the most important transformations in Organic Chemistry, including a short introduction to the Retrosynthetic Analysis. The aim is to provide a solid knowledge of the main reactions and their mechanism, which could later be improved during Master studies.

  10. Organ Facts (United States)

    ... in certain types of transplants. Discover data and statistics for each center. Visit the OPTN's Organ DataSource now > I am looking for >> About organ allocation About UNOS Being a living donor Calculator - CPRA Calculator - KDPI Calculator - LAS Calculator - MELD ...

  11. Organ Transplantation (United States)

    ... organs that can be transplanted include Heart Intestine Kidney Liver Lung Pancreas You often have to wait a long time for an organ transplant. Doctors must match donors to recipients to reduce the risk of transplant rejection. Rejection happens when your immune system attacks the ...

  12. Organic aerosols

    International Nuclear Information System (INIS)

    Organic aerosols scatter solar radiation. They may also either enhance or decrease concentrations of cloud condensation nuclei. This paper summarizes observed concentrations of aerosols in remote continental and marine locations and provides estimates for the sources of organic aerosol matter. The anthropogenic sources of organic aerosols may be as large as the anthropogenic sources of sulfate aerosols, implying a similar magnitude of direct forcing of climate. The source estimates are highly uncertain and subject to revision in the future. A slow secondary source of organic aerosols of unknown origin may contribute to the observed oceanic concentrations. The role of organic aerosols acting as cloud condensation nuclei (CCN) is described and it is concluded that they may either enhance or decrease the ability of anthropogenic sulfate aerosols to act as CCN

  13. Model for Triplet State Engineering in Organic Light Emitting Diodes

    CERN Document Server

    Prodhan, Suryoday; Ramasesha, S


    Engineering the position of the lowest triplet state (T1) relative to the first excited singlet state (S1) is of great importance in improving the efficiencies of organic light emitting diodes and organic photovoltaic cells. We have carried out model exact calculations of substituted polyene chains to understand the factors that affect the energy gap between S1 and T1. The factors studied are backbone dimerisation, different donor-acceptor substitutions and twisted geometry. The largest system studied is an eighteen carbon polyene which spans a Hilbert space of about 991 million. We show that for reverse intersystem crossing (RISC) process, the best system involves substituting all carbon sites on one half of the polyene with donors and the other half with acceptors.

  14. Structural proteomics of minimal organisms: conservation ofprotein fold usage and evolutionary implications

    Energy Technology Data Exchange (ETDEWEB)

    Chandonia, John-Marc; Kim, Sung-Hou


    Background: Determining the complete repertoire of proteinstructures for all soluble, globular proteins in a single organism hasbeen one of the major goals of several structural genomics projects inrecent years. Results: We report that this goal has nearly been reachedfor several "minimal organisms"--parasites or symbionts with reducedgenomes--for which over 95 percent of the soluble, globular proteins maynow be assigned folds, overall 3-D backbone structures. We analyze thestructures of these proteins as they relate to cellular functions, andcompare conservation off old usage between functional categories. We alsocompare patterns in the conservation off olds among minimal organisms andthose observed between minimal organisms and other bacteria. Conclusion:We find that proteins performing essential cellular functions closelyrelated to transcription and translation exhibit a higher degree ofconservation in fold usage than proteins in other functional categories.Folds related to transcription and translation functional categories werealso over represented in minimal organisms compared to otherbacteria.

  15. Hydrogen-Bonded Organic Frameworks (HOFs): A New Class of Porous Crystalline Proton-Conducting Materials. (United States)

    Karmakar, Avishek; Illathvalappil, Rajith; Anothumakkool, Bihag; Sen, Arunabha; Samanta, Partha; Desai, Aamod V; Kurungot, Sreekumar; Ghosh, Sujit K


    Two porous hydrogen-bonded organic frameworks (HOFs) based on arene sulfonates and guanidinium ions are reported. As a result of the presence of ionic backbones appended with protonic source, the compounds exhibit ultra-high proton conduction values (σ) 0.75× 10(-2)  S cm(-1) and 1.8×10(-2)  S cm(-1) under humidified conditions. Also, they have very low activation energy values and the highest proton conductivity at ambient conditions (low humidity and at moderate temperature) among porous crystalline materials, such as metal-organic frameworks (MOFs) and covalent organic frameworks (COFs). These values are not only comparable to the conventionally used proton exchange membranes, such as Nafion used in fuel cell technologies, but is also the highest value reported in organic-based porous architectures. Notably, this report inaugurates the usage of crystalline hydrogen-bonded porous organic frameworks as solid-state proton conducting materials. PMID:27464784

  16. Multicultural organizations

    DEFF Research Database (Denmark)

    Lauring, Jakob; Selmer, Jan


    In recent years the attention towards demographic diversity has increased among academics and practitioners dealing with organization management. Finding a possible connection between diversity and group performance has been the objective of much extant research. Still, however, results are...

  17. Colloidal organization

    CERN Document Server

    Okubo, Tsuneo


    Colloidal Organization presents a chemical and physical study on colloidal organization phenomena including equilibrium systems such as colloidal crystallization, drying patterns as an example of a dissipative system and similar sized aggregation. This book outlines the fundamental science behind colloid and surface chemistry and the findings from the author's own laboratory. The text goes on to discuss in-depth colloidal crystallization, gel crystallization, drying dissipative structures of solutions, suspensions and gels, and similar-sized aggregates from nanosized particles. Special emphas

  18. Organic superconductors

    International Nuclear Information System (INIS)

    The history of superconductivity is traced and the recent discovery of the property in organic materials is discussed. It has been shown that in those organic chemicals in which flat molecules are stacked like tiles, conditions are created in which electrons can flow unhindered. It is reasonable to believe that superconductivity at 20k is now a feasible goal though the dream of resistance-less conduction at room temperature still appears a remote dream. (UK)

  19. Organic Conductors

    DEFF Research Database (Denmark)

    Andersen, Jan Rud; Jacobsen, Claus S.; Rindorf, Grethe;


    2,3,6,7-Tetramethyl-1,4,5,8-tetraselenafulvalene reacts with 2,5-dimethyl-7,7′,8,8′-tetracyano-p-quinodi-methane to give a highly conducting organic solid.......2,3,6,7-Tetramethyl-1,4,5,8-tetraselenafulvalene reacts with 2,5-dimethyl-7,7′,8,8′-tetracyano-p-quinodi-methane to give a highly conducting organic solid....

  20. Organization Design


    Milton Harris; Artur Raviv


    This paper attempts to explain organization structure based on optimal coordination of interactions among activities. The main idea is that each manager is capable of detecting and coordinating interactions only within his limited area of expertise. Only the CEO can coordinate company wide interactions. The optimal design of the organization trades off the costs and benefits of various configurations of managers. Our results consist of classifying the characteristics of activities and manager...

  1. 4-Oxalocrotonate tautomerase, a 41-kDa homohexamer: backbone and side-chain resonance assignments, solution secondary structure, and location of active site residues by heteronuclear NMR spectroscopy.


    Stivers, J T; Abeygunawardana, C; Whitman, C. P.; Mildvan, A. S.


    4-Oxalocrotonate tautomerase (4-OT), a homohexamer consisting of 62 residues per subunit, catalyzes the isomerization of unsaturated alpha-keto acids using Pro-1 as a general base (Stivers et al., 1996a, 1996b). We report the backbone and side-chain 1H, 15N, and 13C NMR assignments and the solution secondary structure for 4-OT using 2D and 3D homonuclear and heteronuclear NMR methods. The subunit secondary structure consists of an alpha-helix (residues 13-30), two beta-strands (beta 1, residu...

  2. Virtual Organizations: Beyond Network Organization

    Directory of Open Access Journals (Sweden)

    Liviu Gabriel CRETU


    Full Text Available One of the most used buzz-words in (e-business literature of the last decade is virtual organization. The term "virtual" can be identified in all sorts of combinations regarding the business world. From virtual products to virtual processes or virtual teams, everything that is “touched” by the computer’s processing power instantly becomes virtual. Moreover, most of the literature treats virtual and network organizations as being synonyms. This paper aims to draw a much more distinctive line between the two concepts. Providing a more coherent description of what virtual organization might be is also one of our intentions.

  3. Organ culture

    DEFF Research Database (Denmark)

    Alm, Rikard; Edvinsson, Lars; Malmsjö, Malin


    BACKGROUND: Endothelium dysfunction is believed to play a role in the development of cardiovascular disease. The aim of the present study was to evaluate the suitability of organ culture as a model for endothelium dysfunction. METHODS: The isometric tension was recorded in isolated segments of the...... rat mesenteric artery branch, before and after organ culture for 20 h. Vasodilatation was expressed as % of preconstriction with U46619. The acetylcholine (ACh) induced nitric oxide (NO) mediated dilatation was studied in the presence of 10 microM indomethacin, 50 nM charybdotoxin and 1 microM apamin....... Endothelium-derived hyperpolarising factor (EDHF) was studied in the presence of 0.1 mM L-NOARG and indomethacin. Prostaglandins were studied in the presence of L-NOARG, charybdotoxin and apamin. RESULTS: The ACh-induced NO and prostaglandin-mediated dilatations decreased significantly during organ culture...

  4. Organic Computing

    CERN Document Server

    Würtz, Rolf P


    Organic Computing is a research field emerging around the conviction that problems of organization in complex systems in computer science, telecommunications, neurobiology, molecular biology, ethology, and possibly even sociology can be tackled scientifically in a unified way. From the computer science point of view, the apparent ease in which living systems solve computationally difficult problems makes it inevitable to adopt strategies observed in nature for creating information processing machinery. In this book, the major ideas behind Organic Computing are delineated, together with a sparse sample of computational projects undertaken in this new field. Biological metaphors include evolution, neural networks, gene-regulatory networks, networks of brain modules, hormone system, insect swarms, and ant colonies. Applications are as diverse as system design, optimization, artificial growth, task allocation, clustering, routing, face recognition, and sign language understanding.

  5. Safety organization

    International Nuclear Information System (INIS)

    After a rapid definition of a nuclear basis installation, the national organization of nuclear safety in France is presented, as also the main organizations concerned and their functions. This report shows how the licensing procedure leading to the construction and exploitation of such installations is applied in the case of nuclear laboratories of research and development: examinations of nuclear safety problems are carried out at different levels: - centralized to define the frame out of which the installation has not to operate, - decentralized to follow in a more detailed manner its evolution

  6. Furan-Oxidation-Triggered Inducible DNA Cross-Linking: Acyclic Versus Cyclic Furan-Containing Building Blocks-On the Benefit of Restoring the Cyclic Sugar Backbone

    Czech Academy of Sciences Publication Activity Database

    Stevens, K.; Claeys, D. D.; Catak, S.; Figaroli, S.; Hocek, Michal; Tromp, J. M.; Schürch, S.; Speybroeck, V. V.; Madder, A.


    Roč. 17, č. 25 (2011), s. 6940-6953. ISSN 0947-6539 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550902 Institutional research plan: CEZ:AV0Z40550506 Keywords : bioorganic chemistry * DNA * molecular modeling * nucleosides * oxidation Subject RIV: CC - Organic Chemistry Impact factor: 5.925, year: 2011

  7. (1)H, (13)C, and (15)N backbone resonance assignments of the full-length 40 kDa S. acidocaldarius Y-family DNA polymerase, dinB homolog. (United States)

    Moro, Sean L; Cocco, Melanie J


    The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains. PMID:26154586

  8. Sugar-Based Polyamides: Self-Organization in Strong Polar Organic Solvents. (United States)

    Rosu, Cornelia; Russo, Paul S; Daly, William H; Cueto, Rafael; Pople, John A; Laine, Roger A; Negulescu, Ioan I


    Periodic patterns resembling spirals were observed to form spontaneously upon unassisted cooling of d-glucaric acid- and d-galactaric acid-based polyamide solutions in N-methyl-N-morpholine oxide (NMMO) monohydrate. Similar observations were made in d-galactaric acid-based polyamide/ionic liquid (IL) solutions. The morphologies were investigated by optical, polarized light and confocal microscopy assays to reveal pattern details. Differential scanning calorimetry was used to monitor solution thermal behavior. Small- and wide-angle X-ray scattering data reflected the complex and heterogeneous nature of the self-organized patterns. Factors such as concentration and temperature were found to influence spiral dimensions and geometry. The distance between rings followed a first-order exponential decay as a function of polymer concentration. Fourier-Transform Infrared Microspectroscopy analysis of spirals pointed to H-bonding between the solvent and the pendant hydroxyl groups of the glucose units from the polymer backbone. Tests on self-organization into spirals of ketal-protected d-galactaric acid polyamides in NMMO monohydrate confirmed the importance of the monosaccharide's pendant free hydroxyl groups on the formation of these patterns. Rheology performed on d-galactaric-based polyamides at high concentration in NMMO monohydrate solution revealed the optimum conditions necessary to process these materials as fibers by spinning. The self-organization of these sugar-based polyamides mimics certain biological materials. PMID:26270020

  9. Organizing Process

    DEFF Research Database (Denmark)

    Hull Kristensen, Peer; Bojesen, Anders

    This paper invites to discuss the processes of individualization and organizing being carried out under what we might see as an emerging regime of change. The underlying argumentation is that in certain processes of change, competence becomes questionable at all times. The hazy characteristics of...

  10. Designing Organizations

    DEFF Research Database (Denmark)

    DESIGNING ORGANIZATIONS: 21st Century Approaches er en vigtig publikation inden for organisationsdesign. Fokus ligger på nye udviklinger inden for organisationsdesign og bogen hjælper med at skabe mere reflekterende forskining og stærkere empiriske analyser inden for dette vigtige felt inden for...

  11. Organic Nanowires

    DEFF Research Database (Denmark)

    Balzer, Frank; Schiek, Manuela; Al-Shamery, Katharina;

    Single crystalline nanowires from fluorescing organic molecules like para-phenylenes or thiophenes are supposed to become key elements in future integrated optoelectronic devices [1]. For a sophisticated design of devices based on nanowires the basic principles of the nanowire formation have to be...

  12. Entangling Organizations

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille


    The chapter accounts for the process of becoming of a changed practice within the area of disability care in the Municipality of Aalborg in Denmark. Across a period of a few months in the fall of 2015 a group of employees across the organization and an action researcher from Aalborg University (the...... author) met and formed a research- practice group and across this period a revised model for cooperation emerged that – upon realization – would reconfigure the intra-play of all relevant areas of the organization involved in disability care. The model included the grasping of disability as dis/ability...... and thereby the model opened the possibility for reworking the binary of ability/disability to the benefit of restorying the citizen’s ability in the practices of changing the disability care....

  13. Entangled Organizations

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille

    The paper accounts for the process of becoming of a changed practice within the area of disability care in the Municipality of Aalborg in Denmark. Across a period of a few months in the fall of 2015 a group of employees across the organization and an action researcher from Aalborg University (the...... author) met and formed a research group and across this period a revised model for cooperation emerged that – upon realization – would reconfigure the intra-play of all relevant areas of the organization involved in disability care. The model included the grasping of disability as dis/ability and thereby...... of dis/ability care were developed over the course of the project and as a result a renewed material-discursive practice emerged as the recommended ‘modus operandi’ of dis/ability care. A recommendation entailing a ‘village-based-community of practice’ which would extend the organizational borders...

  14. Organizing Violence


    Singh, Smita; Greif, Avner; Bates, Robert


    In stateless societies, coercion is privately provided; violence is employed to engage in, and to defend against, predation. At best, violence results in mere redistribution; being destructive, it more often results in a loss of social welfare. When organized, however, violence can be socially productive; it can be employed to defend property rights, thereby strengthening the incentives to engage in productive activity. To explore how violence can be rendered a source of welfare, the authors ...


    Directory of Open Access Journals (Sweden)

    Natasa Kraleva


    Full Text Available Nowadays, each and every organization, including the tourism organizations should be learning organizations. The globalization and the competition affect the process of working of tourism organizations, where only the organizations which have knowledge, and are learning organizations can succeed. In a time of constant change, tourism organizations can have a competitive advantage only if they can do something or offer something different than their competitors. Many organizations in order to enable the learning process, should firstly undertake changes in the organization design, the organizational culture and the leadership style. The paper discusses the relevance of implementing the process of learning organizations as a concept for successful tourism organizations.



    Natasa Kraleva


    Nowadays, each and every organization, including the tourism organizations should be learning organizations. The globalization and the competition affect the process of working of tourism organizations, where only the organizations which have knowledge, and are learning organizations can succeed. In a time of constant change, tourism organizations can have a competitive advantage only if they can do something or offer something different than their competitors. Many organizations in order to ...

  17. Coordinative alignment of molecules in chiral metal-organic frameworks. (United States)

    Lee, Seungkyu; Kapustin, Eugene A; Yaghi, Omar M


    A chiral metal-organic framework, MOF-520, was used to coordinatively bind and align molecules of varying size, complexity, and functionality. The reduced motional degrees of freedom obtained with this coordinative alignment method allowed the structures of molecules to be determined by single-crystal x-ray diffraction techniques. The chirality of the MOF backbone also served as a reference in the structure solution for an unambiguous assignment of the absolute configuration of bound molecules. Sixteen molecules representing four common functional groups (primary alcohol, phenol, vicinal diol, and carboxylic acid), ranging in complexity from methanol to plant hormones (gibberellins, containing eight stereocenters), were crystallized and had their precise structure determined. We distinguished single and double bonds in gibberellins, and we enantioselectively crystallized racemic jasmonic acid, whose absolute configuration had only been inferred from derivatives. PMID:27540171

  18. Protein folding and the organization of the protein topology universe

    DEFF Research Database (Denmark)

    Lindorff-Larsen,, Kresten; Røgen, Peter; Paci, Emanuele; Vendruscolo, Michele; Dobson, Christopher M.


    The mechanism by which proteins fold to their native states has been the focus of intense research in recent years. The rate-limiting event in the folding reaction is the formation of a conformation in a set known as the transition-state ensemble. The structural features present within such...... residues and, in addition, that the topology of the transition state is closer to that of the native state than to that of any other fold in the protein universe. Here, we review the evidence for these conclusions and suggest a molecular mechanism that rationalizes these findings by presenting a view of...... protein folds that is based on the topological features of the polypeptide backbone, rather than the conventional view that depends on the arrangement of different types of secondary-structure elements. By linking the folding process to the organization of the protein structure universe, we propose an...

  19. Organic photovoltaics (United States)

    Demming, Anna; Krebs, Frederik C.; Chen, Hongzheng


    Energy inflation, the constant encouragement to economize on energy consumption and the huge investments in developing alternative energy resources might seem to suggest that there is a global shortage of energy. Far from it, the energy the Sun beams on the Earth each hour is equivalent to a year's supply, even at our increasingly ravenous rate of global energy consumption [1]. But it's not what you have got it's what you do with it. Hence the intense focus on photovoltaic research to find more efficient ways to harness energy from the Sun. Recently much of this research has centred on organic solar cells since they offer simple, low-cost, light-weight and large-area flexible photovoltaic structures. This issue with guest editors Frederik C Krebs and Hongzheng Chen focuses on some of the developments at the frontier of organic photovoltaic technology. Improving the power conversion efficiency of organic photovoltaic systems, while maintaining the inherent material, economic and fabrication benefits, has absorbed a great deal of research attention in recent years. Here significant progress has been made with reports now of organic photovoltaic devices with efficiencies of around 10%. Yet operating effectively across the electromagnetic spectrum remains a challenge. 'The trend is towards engineering low bandgap polymers with a wide optical absorption range and efficient hole/electron transport materials, so that light harvesting in the red and infrared region is enhanced and as much light of the solar spectrum as possible can be converted into an electrical current', explains Mukundan Thelakkat and colleagues in Germany, the US and UK. In this special issue they report on how charge carrier mobility and morphology of the active blend layer in thin film organic solar cells correlate with device parameters [2]. The work contributes to a better understanding of the solar-cell characteristics of polymer:fullerene blends, which form the material basis for some of the most





    In a time when virtual organizations are fast becoming a phenomenon, this paper aims to explore how IT-based approaches—and in specific the object-oriented (organic) approach—can be used to structure and facilitate the management of such virtual organizations. As with traditional organizations, a virtual organization needs a structure that is fast, reliable, adaptable and deterministic. In addition, such organizations need a time and cost-efficient structure to a...

  1. Backbone and side-chain ¹H, ¹⁵N, and ¹³C resonance assignments of the microtubule-binding domain of yeast cytoplasmic dynein in the high and low-affinity states. (United States)

    Takarada, Osamu; Nishida, Noritaka; Kikkawa, Masahide; Shimada, Ichio


    Cytoplasmic dynein is a motor protein that walks toward the minus end of microtubules (MTs) by utilizing the energy of ATP hydrolysis. The heavy chain of cytoplasmic dynein contains the microtubule-binding domain (MTBD). Switching of MTBD between high and low affinity states for MTs is crucial for processive movement of cytoplasmic dynein. Previous biochemical studies demonstrated that the affinity of MTBD is regulated by the AAA+ family ATPase domain, which is separated by 15 nm long coiled-coil helix. In order to elucidate the structural basis of the affinity switching mechanism of MTBD, we designed two MTBD constructs, termed MTBD-High and MTBD-Low, which are locked in high and low affinity state for MTs, respectively, by introducing a disulfide bond between the coiled-coil helix. Here, we established the backbone and side-chain assignments of MTBD-High and MTBD-Low for further structural analyses. PMID:23975349

  2. Detection of closed influenza virus hemagglutinin fusion peptide structures in membranes by backbone {sup 13}CO-{sup 15}N rotational-echo double-resonance solid-state NMR

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Ujjayini; Xie Li; Weliky, David P., E-mail: [Michigan State University, Department of Chemistry (United States)


    The influenza virus fusion peptide is the N-terminal {approx}20 residues of the HA2 subunit of the hemagglutinin protein and this peptide plays a key role in the fusion of the viral and endosomal membranes during initial infection of a cell. The fusion peptide adopts N-helix/turn/C-helix structure in both detergent and membranes with reports of both open and closed interhelical topologies. In the present study, backbone {sup 13}CO-{sup 15}N REDOR solid-state NMR was applied to the membrane-associated fusion peptide to detect the distribution of interhelical distances. The data clearly showed a large fraction of closed and semi-closed topologies and were best-fitted to a mixture of two structures that do not exchange. One of the earlier open structural models may have incorrect G13 dihedral angles derived from TALOS analysis of experimentally correct {sup 13}C shifts.

  3. 军队文职护理骨干护理科研培训需求调查%Investigation of the training requirements for military civilian nursing backbones in scientific nursing research

    Institute of Scientific and Technical Information of China (English)

    唐洪钦; 徐纪玲; 董琴; 何华; 欧崇阳


    Objective To investigate the training requirements of military civilian nursing backbones in scientific nursing re-search.Methods A questionnaire survey was conducted among the 93 military civilian personnel taking part in the 8t h working-post training class of military civilian nursing backbones by using the questionnaire specifically developed for the study.Results Ninety per cent of the military civilian nursing backbones held that it was absolutely necessary to conduct training on scientific nursing research. The top 3 training requirements for scientific nursing research were:scientific nursing research design (accounting for 89%),medical statistics (accounting for 83%)and thesis writing skill (accounting for 80%).The top 3 requirements of training forms were:scientific research training courses (accounting for 85%),seminars (accounting for 82%)and expert instruction (accounting for 71%).A 2 to 4-week training period was most appropriate for scientific research training.Conclusion Attention should be paid on the part of the nursing administration to the selection of appropriate scientific research training programs and training methods,as well as flexible ar-rangement of training time,so as to improve scientific research capacity of the military civilian nursing backbones.%目的:了解军队文职护理骨干护理科研培训需求情况。方法采用自制问卷表向全军第8批文职人员护理骨干任职教育培训班93名文职人员进行调查。结果90%文职护理骨干认为非常有必要开展护理科研培训,护理科研培训项目需求率前三的是:护理科研设计(89%)、医学统计学(83%)、论文写作技巧(80%);培训方式需求率排前三的是:科研培训班(85%)、专题讲座(82%)、专家指导(71%);科研培训适宜时间以2~4周为主。结论护理管理部门在文职护理骨干护理科研培训中应注重选择合适的科研培训项目和培训方式

  4. History of deceased organ donation, transplantation, and organ procurement organizations. (United States)

    Howard, Richard J; Cornell, Danielle L; Cochran, Larry


    The historical development of deceased organ donation, transplantation, and organ procurement organizations is reviewed. The concept of transplantation, taking parts from one animal or person and putting them into another animal or person, is ancient. The development of organ transplantation brought on the need for a source of organs. Although many early kidney transplants used kidneys from living donors, these donors could not satisfy the ever-growing need for organs, and extrarenal organs were recovered only from deceased donors. This need for organs to satisfy the great demand led to specialized organizations to identify deceased donors, manage them until recovery occurred, and to notify transplant centers that organs were available for their patients. The functions of these organ procurement organizations expanded to include other required functions such as education, accounting, and compliance with state and federal requirements. Because of the shortage of organs relative to the demand, lack of a unified organ allocation system, the perception that organs are a national resource and should be governed by national regulations, and to improve results of organ procurement organizations and transplant centers, the federal government has regulated virtually all phases of organ procurement and transplantation. PMID:22489438

  5. 浙江省沿海防护林泥质基干林带服务功能及价值评估%Ecosystem Services and Their Valuation of Muddy Coastal Backbone Forest Belt of Protection in Zhejiang Province

    Institute of Scientific and Technical Information of China (English)

    张骏; 江波; 沈国存; 陈崇; 焦洁洁; 高洪娣; 甘辉; 吴初平; 朱锦茹; 袁位高


    利用沿海防护林评价体系,通过典型林带调查对浙江省泥质基干林带服务功能及价值进行了评估。结果表明:2008-2012年浙江省泥质基干林带生态服务功能效益总计171.23亿元,其中保护基础设施效益88.80亿元、防灾减灾66.76亿元、涵养水源5.12亿元、固碳释氧4.80亿元、净化大气3.20亿元、红树林生态价值1.75亿元、保育土壤价值0.80亿元。%Investigations were made on typical forest belt of muddy coastal backbone forest of protection in Zhejiang province. Their ecological service and valuation was assessed by system of coastal shelter forest. The results showed that the total ecosystem service value from 2008 to 2012 of muddy coastal backbone forest of protection in Zhejiang province added up to 17.123 billion yuan RMB, of which, 8.88 billion yuan from the benefit of infrastructure protection, 6.676 billion yuan from prevention and reduction of natural disasters, 0.512 billion yuan from water conservation, 0.480 billion yuan from carbon fixation and oxygen release, 0.320 billion yuan from atmosphere purification, 0.175 billion yuan from ecological value of mangrove forest, and 0.8 billion yuan from soil conservation.

  6. Organic photovoltaics (United States)

    Demming, Anna; Krebs, Frederik C.; Chen, Hongzheng


    Energy inflation, the constant encouragement to economize on energy consumption and the huge investments in developing alternative energy resources might seem to suggest that there is a global shortage of energy. Far from it, the energy the Sun beams on the Earth each hour is equivalent to a year's supply, even at our increasingly ravenous rate of global energy consumption [1]. But it's not what you have got it's what you do with it. Hence the intense focus on photovoltaic research to find more efficient ways to harness energy from the Sun. Recently much of this research has centred on organic solar cells since they offer simple, low-cost, light-weight and large-area flexible photovoltaic structures. This issue with guest editors Frederik C Krebs and Hongzheng Chen focuses on some of the developments at the frontier of organic photovoltaic technology. Improving the power conversion efficiency of organic photovoltaic systems, while maintaining the inherent material, economic and fabrication benefits, has absorbed a great deal of research attention in recent years. Here significant progress has been made with reports now of organic photovoltaic devices with efficiencies of around 10%. Yet operating effectively across the electromagnetic spectrum remains a challenge. 'The trend is towards engineering low bandgap polymers with a wide optical absorption range and efficient hole/electron transport materials, so that light harvesting in the red and infrared region is enhanced and as much light of the solar spectrum as possible can be converted into an electrical current', explains Mukundan Thelakkat and colleagues in Germany, the US and UK. In this special issue they report on how charge carrier mobility and morphology of the active blend layer in thin film organic solar cells correlate with device parameters [2]. The work contributes to a better understanding of the solar-cell characteristics of polymer:fullerene blends, which form the material basis for some of the most

  7. Backbone and sidechain 1H, 13C and 15N resonance assignments of the human brain-type fatty acid binding protein (FABP7) in its apo form and the holo forms binding to DHA, oleic acid, linoleic acid and elaidic acid

    DEFF Research Database (Denmark)

    Oeemig, Jesper S; Jørgensen, Mathilde L; Hansen, Mikka S;


    In this manuscript, we present the backbone and side chain assignments of human brain-type fatty acid binding protein, also known as FABP7, in its apo form and in four different holo forms, bound to DHA, oleic acid, linoleic acid and elaidic acid.......In this manuscript, we present the backbone and side chain assignments of human brain-type fatty acid binding protein, also known as FABP7, in its apo form and in four different holo forms, bound to DHA, oleic acid, linoleic acid and elaidic acid....

  8. Hierarchical organization versus self-organization


    Busseniers, Evo


    In this paper we try to define the difference between hierarchical organization and self-organization. Organization is defined as a structure with a function. So we can define the difference between hierarchical organization and self-organization both on the structure as on the function. In the next two chapters these two definitions are given. For the structure we will use some existing definitions in graph theory, for the function we will use existing theory on (self-)organization. In the t...

  9. CO2 Conversion: The Potential of Porous–Organic Polymers (POPs) for the cycloaddition of CO2 and epoxides

    KAUST Repository

    Eddaoudi, Mohamed


    Novel porous organic polymers (POPs) have been synthesized using functionalized Cr and Co-salen complexes as molecular building blocks. The integration of metalosalen catalysts into the porous polymers backbone permits the successful utilization of the materials as solid-state catalysts for CO2-epoxide cycloadditions reactions with excellent catalytic performance under mild conditions of temperature and pressure. The catalyst proved to be fully recyclable and robust thus showing the potential of POPs as smart functional materials for the heterogenization of key catalytic elements.

  10. Pelvic Organ Prolapse (United States)

    ... Procedures Implants and Prosthetics Urogynecologic Surgical Mesh Implants Pelvic Organ Prolapse (POP) Share Tweet Linkedin Pin it More sharing ... Treatment Options for Pelvic Organ Prolapse? What is Pelvic Organ Prolapse? Pelvic organ prolapse (POP) occurs when the tissue ...

  11. Organic plant breeding


    Wolfe, Martin S.


    This report was presented at the UK Organic Research 2002 Conference. To a major extent, organic farming depends currently on plant and animal varieties that have been bred for non-organic farming and that are often not suited to organic production. This position is inconsistent with a holistic approach to organic agriculture. Organically-bred plant varieties are needed to develop both the potential of organic agriculture and its integrity. A first attempt at developing a concept for organic ...

  12. Localization-dependent charge separation efficiency at an organic/inorganic hybrid interface (United States)

    Foglia, Laura; Bogner, Lea; Wolf, Martin; Stähler, Julia


    By combining complementary optical techniques, photoluminescence and time-resolved excited state absorption, we achieve a comprehensive picture of the relaxation processes in the organic/inorganic hybrid system SP6/ZnO. We identify two long-lived excited states of the organic molecules of which only the lowest energy one, localized on the sexiphenyl backbone of the molecule, is found to efficiently charge separate to the ZnO conduction band or radiatively recombine. The other state, most likely localized on the spiro-linked biphenyl, relaxes only by intersystem crossing to a long-lived, probably triplet state, thus acting as a sink of the excitation and limiting the charge separation efficiency.

  13. Polyester based hybrid organic coatings (United States)

    Wang, Xiaojiang

    Polyesters are a class of polymers widely used in organic coatings applications. In this work, four types of organic coatings based on polyester polyols were prepared: UV-curable polyester/poly(meth)acrylate coatings, thermal curable polyester polyurethane-urea coatings, thermal curable non-isocyanate polyurethane coatings, and UV-curable non-isocyanate polyurethane coatings. Polyester/poly(meth)acrylate block copolymers are synthesized using a combination of polycondensation and Atom-Transfer Radical Polymerization (ATRP). All block copolymers are characterized by means of Nuclear Magnetic Resonance (NMR) and Gel Permeation Chromatography (GPC). In the case of unsaturated-polyester-based block copolymers the main chain double bond in the polyester backbone remains almost unaffected during ATRP. The unsaturated block copolymers are crosslinkable and can form networks upon photo-irradiation in the presence of a suitable photoinitiator. These copolymers might be interesting candidates for coatings with better overall properties than those based on neat polyesters. Thermal curable polyester polyol based Polyurethane-Urea (PUU) coatings were formulated using Partially Blocked HDI isocyanurate (PBH), Isophorone Diamine (IPDA), and polyester polyol. As a comparison, the polyurethane coatings (PU) without adding IPDA were also prepared. The mechanical and viscoelastic properties of the PUU and PU coating were investigated by using tensile test and Dynamic Mechanical Thermal Analyzer (DMTA). It was found that PUU coating exhibited higher crosslink density, Tg, tensile modulus and strength than the corresponding PU coating. Thermal curable non-isocyanate polyurethane coatings were prepared by using polyamine and cyclic carbonate terminated polyester. Cyclic carbonate terminated polyester was synthesized from the reaction of the carbon dioxide and epoxidized polyester which was prepared from the polyester polyol. The properties of the epoxidized and cyclic carbonate

  14. Ordered organic-organic multilayer growth

    Energy Technology Data Exchange (ETDEWEB)

    Forrest, Stephen R.; Lunt, Richard R.


    An ordered multilayer crystalline organic thin film structure is formed by depositing at least two layers of thin film crystalline organic materials successively wherein the at least two thin film layers are selected to have their surface energies within .+-.50% of each other, and preferably within .+-.15% of each other, whereby every thin film layer within the multilayer crystalline organic thin film structure exhibit a quasi-epitaxial relationship with the adjacent crystalline organic thin film.

  15. Soil organic matter studies

    International Nuclear Information System (INIS)

    The use of isotopes in soil organic matter studies is reviewed. Such studies include measuring the input of organic carbon into soils, the decomposition of isotope-labelled materials such as organic compounds and microbial and plant material in soils, the characterization of soil organic matter and the availability of nutrients released from organic residues. (U.K.)

  16. Organic waste treatment with organically modified clays

    International Nuclear Information System (INIS)

    The use of organically modified clays in hazardous waste management applications offers a significant new and untapped potential. These clays may be used in the stabilization of organic wastes and organically contaminated soils, for waste water treatment, for oil spill control, for liner systems beneath fuel oil storage tanks, and as a component within liner systems of hazardous waste storage treatment and disposal facilities. Organically modified clays (organophilic clays) may be employed in each of these systems to adsorb organic waste constituents, enhancing the performance of the applications

  17. Thiophene And Anthracene Containing Polymers In Organic Solar Cells

    International Nuclear Information System (INIS)

    Organic solar cell research has attracted worldwide attention during the last two decades. Organic semiconductors are easily processable, light weight, easy to integrate in a wide variety of devices and have chemically tunable properties. These properties describe the advantages of organic plastic solar cells over that of conventional silicon solar cells. Conjugated polymers, also known as semiconducting polymers, are distinguished by alternating single and double bonds between carbon atoms on the polymer backbone. Among π-conjugated polymers, polythiophenes are promising candidates for organic solar cell research. At present, the commonly used polythiophene derivatives, as the electron donor in polymer solar cells, are mainly poly(3-hexylthiophene)s (P3HT). In this study, we investigated the effect of solvent, annealing on the performance and morphology of novel two thiophene-[P1 (MEH-PPE1-PThV2) and P2 (MEH-PThE1-PPV2)] as well as two anthracene- containing poly (phenylene-ethynylene) family of polymers [P3 (MEH-PPE1-PAnV2) and P4 (MEH-PAnE1-PPV2)] and (1-(3-methoxycarbonyl) propyl-1-phenyl[6,6]C61) (PCBM) based organic solar cells. The devices using the blends of P2 as donor and PCBM as acceptor (1:3 weight ratio) exhibited a short circuit current of JSC = 5.2 mA/cm2, an open circuit voltage of VOC 800 mV, fill factor FF = 0.4 and resulting power conversion efficiency ηAM1.5 = 1.8 %.

  18. Exercise: The Backbone of Spine Treatment

    Medline Plus

    Full Text Available ... Treatment | View Video Back Purchase Video Struggling with Low Back Pain? Many people are surprised to learn that carefully ... physicians and therapists to help prevent and relieve low back pain. Order your own DVD copy in the NASS ...

  19. ALMA communication backbone in Chile goes optical (United States)

    Filippi, G.; Ibsen, J.; Jaque, Sandra; Liello, F.; Navarro, C.


    High-bandwidth communication has become a key factor for scientific installations as Observatories. This paper describes the technical, organizational, and operational goals and the level of completion of the ALMA Optical Link Project. The project focus is the creation and operation of an effective and sustainable communication infrastructure to connect the ALMA Observatory, located in the Atacama Desert, in the Northern region of Chile, with the point of presence in ANTOFAGASTA, about 400km away, of the EVALSO infrastructure, and from there to the Central Office in the Chilean capital, Santiago. This new infrastructure that will be operated in behalf of ALMA by REUNA, the Chilean National Research and Education Network, will use state of the art technologies, like dark fiber from newly built cables and DWDM transmission, allowing extending the reach of high capacity communication to the remote region where the Observatory is located. When completed, the end-to-end Gigabit-per-second (Gbps) capable link will provide ALMA with a modern, effective, robust, communication infrastructure capable to cope with present and future demands, like those coming from fast growing data transfer to rapid response mode, from remote monitoring and engineering to virtual presence.

  20. Polyphosphazenes - New polymers with inorganic backbone atoms (United States)

    Allcock, H. R.


    Unique and useful properties of the class of nonhydrocarbon, nonhalocarbon, nonsilicone polymers known as polyphosphazenes are discussed at length. These polymers, with molecular weights to 4 million (degree of polymerization 15,000), can be fabricated as tubes, fibers, woven fabrics, flexible films, or plates, and many variants are stable to attack by water, bases, aqueous acids, jet fuels, oils, hydraulic fluids, gasoline, or other hydrocarbons. Rubbery polymers with these properties can be fashioned into flexible hose, fuel hose, gaskets, or O-rings. Since they do not provoke clotting reactions in blood, and reveal no carcinogenic effects to date, they are considered for internal prosthetic applications (replacement bone, temporary skin, heart valves), as biodegradable suturing material, as carriers for slow release of drugs, and as carriers for chemotherapeutic agents against cancers.

  1. Core Backbone Convergence Mechanisms and Microloops Analysis

    Directory of Open Access Journals (Sweden)

    Abdelali Ala


    Full Text Available In this article we study approaches that can be used to minimise the convergence time, we also make a focus on microloops phenomenon, analysis and means to mitigate them. The convergence time reflects the time required by a network to react to a failure of a link or a router failure itself. When all nodes (routers have updated their respective routing and forwarding databases, we can say the network has converged. This study will help in building real-time and resilient network infrastructure, the goal is to make any evenement in the core network, as transparent as possible to any sensitive and real-time flows. This study is also, a deepening of earlier works presented in [10] and [11].

  2. Cervical Exercise: The Backbone of Spine Treatment (United States)

    ... and hips as much as you comfortably can. Spending 5-10 minutes in this position, perhaps every ... to your posture. Most of us have a habit of slouching and letting our head protrude forward ( ...

  3. The orientational preferences of backbones of proteins

    Institute of Scientific and Technical Information of China (English)

    CHEN Ying; WANG Jun; XUE Bin; WANG Wei


    The orientation between the backboneresidues of proteins is defined based on the local configurations and the corresponding preferences are analyzed by statistics. It is found that all the residue pairs have some specific preferences of orientations. The statistical analysis is mainly concentrated in the orientational distributions for two kinds of groupings of residues based on the hydrophobicity and secondary structural features. The statistics for such two types of groupings shows different orientational preferences. It is found that for the former grouping the orientational preference is rather weak,while for the later a kind of strong orientational preferences. This suggests that the formation of local structures and of secondary structures are highly related to the orientational preferences.

  4. Local backbone structure prediction of proteins. (United States)

    de Brevern, Alexandre G; Benros, Cristina; Gautier, Romain; Valadié, Héléne; Hazout, Serge; Etchebest, Catherine


    A statistical analysis of the PDB structures has led us to define a new set of small 3D structural prototypes called Protein Blocks (PBs). This structural alphabet includes 16 PBs, each one is defined by the (phi, psi) dihedral angles of 5 consecutive residues. The amino acid distributions observed in sequence windows encompassing these PBs are used to predict by a Bayesian approach the local 3D structure of proteins from the sole knowledge of their sequences. LocPred is a software which allows the users to submit a protein sequence and performs a prediction in terms of PBs. The prediction results are given both textually and graphically. PMID:15724288

  5. The backbone of the climate network

    CERN Document Server

    Donges, Jonathan F; Marwan, Norbert; Kurths, Juergen; 10.1209/0295-5075/87/48007


    We propose a method to reconstruct and analyze a complex network from data generated by a spatio-temporal dynamical system, relying on the nonlinear mutual information of time series analysis and betweenness centrality of complex network theory. We show, that this approach reveals a rich internal structure in complex climate networks constructed from reanalysis and model surface air temperature data. Our novel method uncovers peculiar wave-like structures of high energy flow, that we relate to global surface ocean currents. This points to a major role of the oceanic surface circulation in coupling and stabilizing the global temperature field in the long term mean (140 years for the model run and 60 years for reanalysis data). We find that these results cannot be obtained using classical linear methods of multivariate data analysis, and have ensured their robustness by intensive significance testing.

  6. Volatile Organic Compounds (VOCs) (United States)

    ... Organic Compounds' Impact on Indoor Air Quality Volatile Organic Compounds' Impact on Indoor Air Quality On this page: ... Exposure Standards or Guidelines Additional Resources Introduction Volatile organic compounds (VOCs) are emitted as gases from certain solids ...

  7. Ashes for organic farming


    Kousa, T.; Heinonen, M; Suoniitty, T.; Peltonen, K


    Nowadays only eight percent of the cultivated field area is used for organic farming. The Ministry of Agriculture and Forestry has published the guidelines for the program of organic farming to diversify the supply and the consumption of organic food. The aim is to increase organically arable land to 20% by the year 2020.The demand of organic fertilizer products is strongly increasing. Interest in forestry by-products (ash, bark, zero fiber, etc.) for use in organic production has recently be...

  8. Organic Viticulture in Europe


    Willer, Helga; Häseli, Andreas; Levite, Dominique; Tamm, Lucius


    Introduction Organic agriculture is a thriving sector in Europe, and in some countries 10 % of the agricultural area is organic. Not so, however, for organic viticulture: the percentage of organic viticulture land compared to all vineyards is lower than for organic agriculture. This is due to several constraints in the sector of production techniques, in marketing, legislation and state support. Material and Methods So far no official data on the current status of organic viticultur...

  9. Blue emitting organic semiconductors under high pressure: status and outlook (United States)

    Knaapila, Matti; Guha, Suchismita


    This review describes essential optical and emerging structural experiments that use high GPa range hydrostatic pressure to probe physical phenomena in blue-emitting organic semiconductors including π-conjugated polyfluorene and related compounds. The work emphasizes molecular structure and intermolecular self-organization that typically determine transport and optical emission in π-conjugated oligomers and polymers. In this context, hydrostatic pressure through diamond anvil cells has proven to be an elegant tool to control structure and interactions without chemical intervention. This has been highlighted by high pressure optical spectroscopy whilst analogous x-ray diffraction experiments remain less frequent. By focusing on a class of blue-emitting π-conjugated polymers, polyfluorenes, this article reviews optical spectroscopic studies under hydrostatic pressure, addressing the impact of molecular and intermolecular interactions on optical excitations, electron-phonon interaction, and changes in backbone conformations. This picture is connected to the optical high pressure studies of other π-conjugated systems and emerging x-ray scattering experiments from polyfluorenes which provides a structure-property map of pressure-driven intra- and interchain interactions. Key obstacles to obtain further advances are identified and experimental methods to resolve them are suggested.

  10. Toward an experimental synthesis of the chondritic insoluble organic matter (United States)

    Biron, Kasia; Derenne, Sylvie; Robert, FrançOis; Rouzaud, Jean-NoëL.


    Based on the statistical model proposed for the molecular structure of the insoluble organic matter (IOM) isolated from the Murchison meteorite, it was recently proposed that, in the solar T-Tauri disk regions where (photo)dissociation of gaseous molecules takes place, aromatics result from the cyclization/aromatization of short aliphatics. This hypothesis is tested in this study, with n-alkanes being submitted to high-frequency discharge at low pressure. The contamination issue was eliminated using deuterated precursor. IOM was formed and studied using solid-state nuclear magnetic resonance, pyrolysis coupled to gas chromatography and mass spectrometry, RuO4 oxidation, and high-resolution transmission electron microscopy. It exhibits numerous similarities at the molecular level with the hydrocarbon backbone of the natural IOM, reinforcing the idea that the initial precursors of the IOM were originally chains in the gas. Moreover, a fine comparison between the chemical structure of several meteorite IOM suggests either that (i) the meteorite IOMs share a common precursor standing for the synthetic IOM or that (ii) the slight differences between the meteorite IOMs reflect differences in their environment at the time of their formation i.e., related to plasma temperature that, in turn, dictates the dissociation-recombination rates of organic fragments.

  11. Organic brain syndrome (United States)

    OBS; Organic mental disorder (OMS); Chronic organic brain syndrome ... Listed below are disorders associated with OBS. Brain injury caused by ... the brain ( subarachnoid hemorrhage ) Blood clot inside the ...

  12. Synthesis, biophysical, and pharmacological evaluation of the melanocortin agonist AST3-88: modifications of peptide backbone at Trp 7 position lead to a potent, selective, and stable ligand of the melanocortin 4 receptor (MC4R). (United States)

    Singh, Anamika; Dirain, Marvin L; Wilczynski, Andrzej; Chen, Chi; Gosnell, Blake A; Levine, Allen S; Edison, Arthur S; Haskell-Luevano, Carrie


    The melanocortin-3 (MC3R) and melanocortin-4 (MC4R) receptors are expressed in the brain and are implicated in the regulation of food intake and energy homeostasis. The endogenous agonist ligands for these receptors (α-, β-, γ-MSH and ACTH) are linear peptides with limited receptor subtype selectivity and metabolic stability, thus minimizing their use as probes to characterize the overlapping pharmacological and physiological functions of the melanocortin receptor subtypes. In the present study, an engineered template, in which the peptide backbone was modified by a heterocyclic reverse turn mimetic at the Trp(7) residue, was synthesized using solid phase peptide synthesis and characterized by a β-galactosidase cAMP based reporter gene assay. The functional assay identified a ∼5 nM mouse MC4R agonist (AST3-88) with more than 50-fold selectivity over the mMC3R. Biophysical studies (2D (1)H NMR spectroscopy and molecular dynamics) of AST3-88 identified a type VIII β-turn secondary structure spanning the pharmacophore domain stabilized by the intramolecular interactions between the side chains of the His and Trp residues. Enzymatic studies of AST3-88 revealed enhanced stability of AST3-88 over the α-MSH endogenous peptide in rat serum. Upon central administration of AST3-88 into rats, a decreased food intake response was observed. This is the first study to probe the in vivo physiological activity of this engineered peptide-heterocycle template. These findings advance the present knowledge of pharmacophore design for potent, selective, and metabolically stable melanocortin ligands. PMID:25141170

  13. Survey on self-assessment of training effect for the of backbone army civilian nurses%文职护理骨干任职培训效果自我评价研究

    Institute of Scientific and Technical Information of China (English)

    史瑞洁; 刘喜文; 画妍; 邵佩; 尼春萍


    目的:研究文职护理骨干对任职培训效果的自我评价,为完善培训体系和培训模式提供参考依据。方法:以方便抽样法,采用自行设计的任职培训效果自我评价调查表,对参加3期全军文职护理骨干培训班共228名文职护士进行调查。结果:8项整体评价均在85.50%以上,其中认为培训班有必要和对培训师资队伍满意2项评价均为100%。任职培训内容31个项目中,提高程度位于前5位的是医疗护理法律知识(78.95%)、伤病员现场一线的病情观察与分类(78.07%)、护士职业生涯规划(77.63%)、护士职业礼仪规范(77.19%)、战创伤救治与护理(76.75%),位于后5位的是护理论文写作(53.07%)、军事训练伤的防护(52.63%)、文献检索能力(52.20%)、军队常见精神障碍的防护(51.32%)、健康教育知识和能力(50.88%)。结论:文职护理骨干对任职培训效果整体评价较好,在人文素养与临床管理、军事护理技能方面部分知识提升较大,培训效果提升较小的均为实践性较强的内容,提示在任职培训中需进一步完善实践教学模式、内容和方法。%Objective:To survey on self-assessment of training effect for civilian backbone nurses and to provide the scientific evidence for improving the training system and mode. Methods:A total of 228 nurses from the army civilian backbone nurses training with three items were investigated with the self-designed "Self-assessment of Training Effect Questionnaire" by using the cluster sampling method. Results:The 8 overall evaluation were more than 85. 50%,which was necessary and satisfied of the training teachers were 100%. In the 31 training items,the top five items with improvement were legal knowledge of medical care(78. 95%),the observation and classification of the wound in battlefield(78. 07%),professional career programming (77. 63%),professional etiquette norms(77. 19%),the first techniques of battle

  14. Inserting CO2 into Aryl C-H Bonds of Metal-Organic Frameworks: CO2 Utilization for Direct Heterogeneous C-H Activation. (United States)

    Gao, Wen-Yang; Wu, Haifan; Leng, Kunyue; Sun, Yinyong; Ma, Shengqian


    Described for the first time is that carbon dioxide (CO2 ) can be successfully inserted into aryl C-H bonds of the backbone of a metal-organic framework (MOF) to generate free carboxylate groups, which serve as Brønsted acid sites for efficiently catalyzing the methanolysis of epoxides. The work delineates the very first example of utilizing CO2 for heterogeneous C-H activation and carboxylation reactions on MOFs, and opens a new avenue for CO2 chemical transformations under mild reaction conditions. PMID:27080057

  15. Enhanced binding affinity, remarkable selectivity, and high capacity of CO 2 by dual functionalization of a rht-type metal-organic framework

    KAUST Repository

    Li, Baiyan


    Open and friendly: The smallest member of the rht-type metal-organic frameworks (MOFs, see picture) constructed by a hexacarboxylate ligand with a nitrogen-rich imino triazine backbone shows a significantly enhanced gas binding affinity relative to all other isoreticular rht-type MOFs. The high adsorption capacity and remarkable selectivity of CO 2 are attributed to the high density of open metal and Lewis basic sites in the framework. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Why won’t talents return home? : a case study of contract breach by graduates of the Program of Training High-Caliber Backbone Personnel from the Ethnic Minorities = ¿Por qué el talento no vuelve a casa? : un estudio de caso sobre la brecha contractual entre graduados de Grupos Minoritarios del Programa para la Formación de Alto Nivel de Personal Backbone

    Directory of Open Access Journals (Sweden)

    Zhiyong Zhu


    Full Text Available In 2004, the Ministry of Education, National Development and Reform Commission, State Ethnic Affairs Commission, Ministry of Finance, Ministry of Human Resources and Social Security jointly released a special document On Training High-Caliber Backbone Personnel from the Ethnic Minorities, as a supporting measure for the strategy of human resources in western development of China. The central government takes it as an important force in thriving and developing the western region, especially the region where ethnic minority groups reside in the west. However, more and more graduates through the Program have breached or intend to break the contract of the Program. Why do they not abide by the contract and return to their hometown province for the work after they have enjoyed the preferential Program? This case study focused on three graduates who broke the employment contract through the Program, traced the origin and development of their minds and action, and demonstrated more about what hid behind the phenomenon. According to the deep interaction with these ethnic minority students, the research found that the social background under which high education policies for the ethnic minorities had greatly changed. The changes have challenged the implementation of the Program. Furthermore, under the socialistic market economy system, the employment contract of the Program couldn’t be processed and secured as the involved actors have expected. Last but not the least, the graduates benefited from the Program have become more and more individualistic and diversified in their career development due to different micro and macro reasons.En el año 2004 y de manera conjunta, el Ministerio de Educación, la Comisión Nacional para el Desarrollo y las Reformas, la Comisión Estatal de Asuntos Étnicos, el Ministerio de Economía, el Ministerio de Recursos Humanos y la Seguridad Social, publicaron una normativa especial para la Formación de Alto Nivel de

  17. “少数民族高层次骨干人才计划”毕业生违约原因分析--基于理性选择制度主义的视角%The Cause of Contract Breaches by Graduates of Program of Training High-Caliber Backbone Personnel from the Ethnic Minorities:An Analysis Based on Rational Choice Institutionalism

    Institute of Scientific and Technical Information of China (English)



    少数民族高层次骨干人才计划对于改善西部少数民族地区人才结构,提升人才水平具有重要的现实意义。然而,近年来,该计划毕业生违约现象日益突出,对政策的目标达成产生不利影响。文章借鉴理性选择制度主义的分析框架,通过政策文本梳理和对违约毕业生的深度访谈,对该计划就业政策实施过程中的制度、行动者、社会因素三方面进行深入分析。研究发现,制度规定功能性缺失、相关行动者利益冲突以及生源地经济发展状况社会因素是造成违约现象出现的主要原因。%The Program of Training High-Caliber Backbone Personnel from the Ethnic Minorities is of great significance to improve talent structure and talents’ capability. In recent years, however, the number of the graduates who breach contract seems to increase, which impinges the goal attainment of this policy. In this paper, institutions, actors and social factors in the executing process of the policy are analyzed by means of organizing policy discourse and interviewing defaulters on the basis of rational choice institutionalism. Research found that the main causes of this phenomenon are: functional deficiencies of the institution, conflicts of interest among relevant actors and social factors of the region that the students come from.

  18. Progress in organic spintronics

    International Nuclear Information System (INIS)

    Recent progress in organic spintronics is given an informative overview, covering spin injection, detection, and transport in organic spin valve devices, and the magnetic field effect in organic semiconductors (OSCs). In particular, we focus on our own recent work in spin injection and the organic magnetic field effect (OMFE). (topical review - magnetism, magnetic materials, and interdisciplinary research)

  19. Deceased Organ Donation. (United States)

    Israni, A K; Zaun, D; Bolch, C; Rosendale, J D; Snyder, J J; Kasiske, B L


    SRTR uses data collected by OPTN to calculate metrics such as donation/conversion rate, organ yield, and rate of organs recovered for transplant but not transplanted. In 2014, 9252 eligible deaths were reported by organ procurement organizations, a slight increase from 8944 in 2012, and the donation/conversation rate was 73.4 eligible donors per 100 eligible deaths, a slight increase from 71.3 in 2013. Some metrics show variation across organ procurement organizations, suggesting that sharing best practices could lead to gains in efficiency and organ retrieval. PMID:26755269

  20. The committed organic consumer


    Geen, Natalie; Firth, Chris


    Abstract - UK committed organic consumers are reported to be about 23 per cent of consumers and account for 84 per cent of organic sales. This paper compares the committed organic consumer who is also a member of the UK’s national charity for organic growing (HDRA), to committed organic consumers in the wider UK population. Broad parallels were found between these two groups of consumers although there were differences in purchasing drivers as environmental issues were relatively more impor...

  1. On Structure and Organization: An Organizing Principle


    Baas, Nils A.


    We discuss the nature of structure and organization, and the process of making new Things. Hyperstructures are introduced as binding and organizing principles, and we show how they can transfer from one situation to another. A guiding example is the hyperstructure of higher order Brunnian rings and similarly structured many-body systems.

  2. Cyclic peptides-assisted trans- port of metal ions across liquid-organic membrane

    Institute of Scientific and Technical Information of China (English)


    The formation of alkali and alkaline-earth metal picrate complexes with cyclo(Pro-Gly)n ionophores (1, n = 3; 2, n = 4) can facilitate the migration of metal ions across a bulk liquid CH2Cl2 membrane. The migration behavior was studied by measuring the solution absorption at 356 nm, using a UV/Vis spectrophotometer, and the rates can be determined by comparing the initial absorption of donor solutions with the absorption of the corresponding receiver solutions as the function of time. It was found that cyclic peptide 1 shows higher transport activity for the studied alkali and alkaline-earth metal ions than compound 2, which is related to the backbone flexibility of the cyclic peptides. The findings in this work suggest that the rate of ionophore-facilitated ion transport depends not only on the ability of complex forma-tion in aqueous phase, but also on the ability of complex dissociation in organic phase.

  3. Growing Self-organized Design of Efficient and Robust Complex Networks

    CERN Document Server

    Hayashi, Yukio


    A self-organization of efficient and robust networks is important for a future design of communication or transportation systems, however both characteristics are incompatible in many real networks. Recently, it has been found that the robustness of onion-like structure with positive degree-degree correlations is optimal against intentional attacks. We show that, by biologically inspired copying, an onion-like network emerges in the incremental growth with functions of proxy access and reinforced connectivity on a space. The proposed network consists of the backbone of tree-like structure by copyings and the periphery by adding shortcut links between low degree nodes to enhance the connectivity. It has the fine properties of the statistically self-averaging unlike the conventional duplication-divergence model, exponential-like degree distribution without overloaded hubs, strong robustness against both malicious attacks and random failures, and the efficiency with short paths counted by the number of hops as m...

  4. Cofolding organizes alfalfa mosaic virus RNA and coat protein for replication. (United States)

    Guogas, Laura M; Filman, David J; Hogle, James M; Gehrke, Lee


    Alfalfa mosaic virus genomic RNAs are infectious only when the viral coat protein binds to the RNA 3' termini. The crystal structure of an alfalfa mosaic virus RNA-peptide complex reveals that conserved AUGC repeats and Pro-Thr-x-Arg-Ser-x-x-Tyr coat protein amino acids cofold upon interacting. Alternating AUGC residues have opposite orientation, and they base pair in different adjacent duplexes. Localized RNA backbone reversals stabilized by arginine-guanine interactions place the adenosines and guanines in reverse order in the duplex. The results suggest that a uniform, organized 3' conformation, similar to that found on viral RNAs with transfer RNA-like ends, may be essential for replication. PMID:15604410

  5. Influence of Backbone Rigidness on the Performance of Sulfonated Polyether Sulfone Electrolyte Membranes%主链刚性对磺化聚芳醚砜电解质膜性能的影响

    Institute of Scientific and Technical Information of China (English)

    刘健美; 胡朝霞; 陈珊珊; 荣艺; 王明东; 魏松波; 陈守文


    以六氟双酚A(HFBPA)、9,9′-双(4-羟苯基)芴(BHPF)、4,4′-二氟二苯砜及3,3′-二磺酸钠-4,4′-二氟二苯砜为原料,经高温缩聚成功合成了一系列磺化聚芳醚砜(SPAES),并通过改变BHPF及HFBPA的比例来调节聚合物主链的刚性。结果表明,随刚性组分BHPF含量的增加,SPAES膜吸水率及质子导电率降低、但在水中的稳定性增加。在BHPF与HFBPA的比例为1∶1及磺化度为50%(SPAES50-50)条件下,膜在60℃水中平面和厚度方向的尺寸变化分别为0.12和0.13,电导率达到0.137 S/cm,而经130℃高温水处理200 h后的失重率仅为7%,表明其有望在高温燃料电池中得到应用。%A series of novel sulfonated poly (arylene ether sulfone) (SPAES) copolymers were successfully synthesized from 6F-bisphenol A (HFBPA), 9,9'-bis (4-hydroxyphenyl) fluorine (BHPF), 4,4'-difluorodiphenyl sulfone (DFDPS) and 3, 3'-disulfonate-4, 4'-difluorodiphenyl sulfone (SDFDPS) via high temperature copolymerization. The rigidness in the polymer backbone was controlled by the ratio of BHPF to HFBPA. As the increase in the ratio of BHPF, the SPAF~S membranes display increased stability towards water but lower water uptake and proton conductivity. The membrane of SPAESS0-50 (BHPF/HFBPA 50/50 in molar ratio and 50% sulfonation degree) exhibits dimensional change of 0.12 and 0.13 in the plane and thickness direction, respectively, and proton conductivity of 0. 137 S/cm in water and at 60 ℃, as well as mass loss of 7 % after aging treatment for 200 h in water at 130 ℃, suggesting their potential application in the high temperature fuel cell field.

  6. Soil organic matter studies

    International Nuclear Information System (INIS)

    A total of 77 papers were presented and discussed during this symposium, 37 are included in this Volume II. The topics covered in this volume include: biochemical transformation of organic matter in soils; bitumens in soil organic matter; characterization of humic acids; carbon dating of organic matter in soils; use of modern techniques in soil organic matter research; use of municipal sludge with special reference to heavy metals constituents, soil nitrogen, and physical and chemical properties of soils; relationship of soil organic matter and plant metabolism; interaction between agrochemicals and organic matter; and peat. Separate entries have been prepared for those 20 papers which discuss the use of nuclear techniques in these studies

  7. Entrepreneurship and Organizations' Development

    Institute of Scientific and Technical Information of China (English)



    In modern society, the competition has become increasingly fierce. Organizations pay close attention to their manage-ment in order to gain the priority. Under this context, entrepreneurship has been attached great importance to. Entrepreneurship has played an indispensable role in organizations. Compare to those short-lived companies, powerful organizations, such as Google, IBM and P&G has gain great progress in the last decades. Therefore, it is essential to study how the powerful organiza-tion could always be innovative. This paper aims to study the role that entrepreneurship plays in the organizations and take Google as an example. It provides some previous lessons that Chinese organizations could draw from.

  8. The Visual Dimension in Organizing, Organization, and Organization Research

    DEFF Research Database (Denmark)

    Meyer, Renate E.; Höllerer, Markus A.; Jancsary, Dennis;


    With the unprecedented rise in the use of visuals, and its undeniable omnipresence in organizational contexts, as well as in the individual's everyday life, organization and management science has recently started to pay closer attention to the to date under-theorized “visual mode” of discourse and...... meaning construction. Building primarily on insights from the phenomenological tradition in organization theory and from social semiotics, this article sets out to consolidate previous scholarly efforts and to sketch a fertile future research agenda. After briefly exploring the workings of visuals, we...... introduce the methodological and theoretical “roots” of visual studies in a number of disciplines that have a long-standing tradition of incorporating the visual. We then continue by extensively reviewing work in the field of organization and management studies: More specifically, we present five distinct...

  9. Understanding Identity and Organizations

    DEFF Research Database (Denmark)

    Christensen, Lars Thøger


    The article reviews the book "Understanding Identity and Organizations," by Kate Kenny, Andrea Whitle, and Hugh Wilmott.......The article reviews the book "Understanding Identity and Organizations," by Kate Kenny, Andrea Whitle, and Hugh Wilmott....

  10. Organization of Financial Accounting


    Шпак, Валентин Аркадійович


    Organization of financial accounting that is grounded on principles of financial reporting has been considered. The relation between accounting objects and accounts has been researched. Approaches towards solving problems of organization of financial accounting have been described.

  11. Soil Organic Carbon Stock (United States)

    U.S. Geological Survey, Department of the Interior — Soil organic carbon (SOC) is the carbon held within soil organic constituents (i.e., products produced as dead plants and animals decompose and the soil microbial...

  12. Organic Pesticide Ingredients (United States)

    ... Control a pest Integrated Pest Management What are pesticides? Herbicides Disinfectants Fungicides Insecticides Natural and Biological Pesticides ... Other types of pesticides Disponible en español Organic Pesticide Ingredients Organic foods are not necessarily pesticide-free. ...

  13. Organizing design work

    DEFF Research Database (Denmark)

    Scheuer, John Damm


    The aim of this paper is to demonstrate the importance of the kind of understanding of organizing that is implied by design theories for project managers' understanding and organizing of design work. Five theories and their organizing consequences for project managers organizing of design work are...... analyzed. The paper contributes to design research and organization studies by putting the organizing of design projects on the research agenda. It also contributes by demonstrating the importance of being aware of the ontological and epistemological assumptions and organizing consequences of different...... design theories. The selected theories of design thus represent different views on what design is, address different design areas and are based on different ontological and epistemological assumptions that influence their views on how design processes should be organized....

  14. Organic Solvent Tropical Report

    International Nuclear Information System (INIS)

    This report provides the basis for closing the organic solvent safety issue. Sufficient information is presented to conclude that risk posed by an unmitigated organic solvent fire is within risk evaluation guidelines

  15. Organ Donation: The Process (United States)

    ... Español Search Register with your state as an Organ Donor Home Why Donate Becoming a Donor About Donation & ... Plan Your Finances After Your Transplant Contact Your Donor Family Organ Donation: The Process Enrolling as a Donor : The ...

  16. Organics in radwaste

    International Nuclear Information System (INIS)

    Seventeen papers, each processed separately cover the types of organic materials in radioactive wastes, their effect on repository performance and destruction of organics, including incineration, peroxide and wet oxidation and acid and biological digestion. (U.K.)

  17. Organization theory. Analyzing health care organizations. (United States)

    Cors, W K


    Organization theory (OT) is a tool that can be applied to analyze and understand health care organizations. Transaction cost theory is used to explain, in a unifying fashion, the myriad changes being undertaken by different groups of constituencies in health care. Agency theory is applied to aligning economic incentives needed to ensure Integrated Delivery System (IDS) success. By using tools such as OT, a clearer understanding of organizational changes is possible. PMID:10164970

  18. The Matrix Organization Revisited

    DEFF Research Database (Denmark)

    Gattiker, Urs E.; Ulhøi, John Parm


    This paper gives a short overview of matrix structure and technology management. It outlines some of the characteristics and also points out that many organizations may actualy be hybrids (i.e. mix several ways of organizing to allocate resorces effectively).......This paper gives a short overview of matrix structure and technology management. It outlines some of the characteristics and also points out that many organizations may actualy be hybrids (i.e. mix several ways of organizing to allocate resorces effectively)....



    Ketut Yoga Mira Pratiwi; I Gede Mega Putra


    Pelvic organ prolapse (POP) is defined as a decrease in abnormal or herniation of the pelvic organs out of place attached to its normal position or in the pelvic cavity. As for the anatomy of the pelvic organs consists of bones, muscles, and nerves. The presence of damage to the pelvic connective tissue and visceral attachment pelvic organs the cause occurs. The symptoms that appear in patients POP not specific to distinguish prolapse of some compartments but can reflect the degree of prolaps...

  20. Deconstructing the organic movement


    Frost, David


    This report was presented at the UK Organic Research 2002 Conference. Organic agriculture has sought to establish its scientific validity and its origins. Conford (2001) claims that these can be traced to the 1920s, and that Anglican Christianity is pivotal to its history. However, organic agriculture takes many forms and the role of religion in society has changed. In the UK, a new incarnation of organic farming occurred in the late twentieth century as part of a wider response to environmen...

  1. Organic for the future


    Rebsdorf, Simon Olling


    Organic research and innovation moves the organic food sector from a niche to a general reference model for sustainable agriculture. Europe faces major challenges to conserve biodiversity, secure soil, and promote animal welfare and there is an urgent need to ensure global food security. Organic food and farming paves the way to meet these challenges; but to succeed a further development of organic food and farming is key.

  2. Transparency in Organizing

    DEFF Research Database (Denmark)

    Albu, Oana Brindusa

    This dissertation provides a critical analysis of transparency in the context of organizing. The empirical material is based on qualitative studies of international cooperative organizations. The dissertation seeks to contribute to transparency and organizing scholarship by adopting a communication...... being a solution for efficiency and democratic organizing, is a communicatively contested process which may lead to unintended consequences. The dissertation shows that transparency is performative: it can impact authority by de/legitimating action, shape the processes of organizational identity co...

  3. Behaviour in an Organization


    Klímová, Kateřina


    Diploma thesis "The behavior in the organization" at a practical level, integrates the knowledge of psychology, sociology and management. It explains bahavior of people in the organization, which seeks to use this knowledge for the benefit of the organizaton and its management. It focuses on individual differences among people in the organization, organizational culture, relationships between people in workplace, organizational structure, communication within the organization, motivation, dev...

  4. Organization/Administration. (United States)

    Chaffee, Ellen Earle

    Patterns that emerged from reviewing 26 syllabi for courses on organization and administration in higher education are discussed, and six sample syllabi are presented. The syllabi focused more on organization than administration. Of the 26 syllabi, 19 dealt with organization and administration generally; 5 with administration in a specific…

  5. Multiple organ procurement

    Directory of Open Access Journals (Sweden)

    Vuković Milivoje


    Full Text Available Introduction. Liver transplantation is the most demanding of all solid organ transplantations. It requires perfect organization and motivation of health care professionals, patients and their families. This article deals with the procedure for multiple organ procurement, reviews criteria for organ donation and describes the surgical technique for multiple organ procurement. Discussion. Adequate selection and evaluation of cadaveric donors and of organs for transplantation should include early identification of potential donors, and early diagnosis of brain death. The procurement of the highest number of viable organs for transplantation requires excellence in each of the phases. Early and aggressive physiologic support in the maintenance of potential donors can reduce organ donor loss due to irreversible asystole or multiorgan failure (it is almost always possible to maintain organ perfusion pressure and increase the number of organs without increasing post-transplant morbidity or mortality. The ideal donor is a young, previously healthy, brain dead, victim of an accident. Conclusion. The surgical procedure for multiple organ procurement from brain death donors must be performed without intraopertive organ damage. .

  6. Organic herbicide update (United States)

    Weed research is the top research priority among organic producers. Very few chemical weed control options are approved for organic use (corn gluten meal, vinegar, clove oil, and most recently ammonium pelargonate ), but additional compounds are under investigation and pursuing organic approval. C...

  7. Organic chemistry in space (United States)

    Johnson, R. D.


    Organic cosmochemistry, organic materials in space exploration, and biochemistry of man in space are briefly surveyed. A model of Jupiter's atmosphere is considered, and the search for organic molecules in the solar system and in interstellar space is discussed. Materials and analytical techniques relevant to space exploration are indicated, and the blood and urine analyses performed on Skylab are described.

  8. Values in Organic Farming

    DEFF Research Database (Denmark)

    Kjærgård, Bente; Pedersen, Kirsten Bransholm; Land, Birgit

    The study focuses on the recent debate about what is, or what constitutes, organic farming and what is the right path for organic farming in the future. The study is based on a critical discourse analysis of the controversy about suspending the private standard for organic farming adopted by the ...

  9. Theology and Organization

    DEFF Research Database (Denmark)

    Meier Sørensen, Bent; Spoelstra, Sverre; Höpfl, Heather;


    This Introduction argues for the importance of theology for the study of organization. It also draws the contours of a possible ‘theology of organization’. Theology of organization, as we use it here, does not refer to a study of organization that is rooted in faith, nor does it refer to a study ...

  10. Organ mass measurements

    International Nuclear Information System (INIS)

    The term, anatomical measurements, in the context of this Co-ordinated Research Programme refers to measurements of masses of internal organs, although the human body is composed of internal organs and tissues such as skeleton, muscle, skin and adipose. The mass of an organ containing a radionuclide (source organ), and the mass of a target organ which absorbs energy of the radiation, are essential parameters in the ICRP dosimetric model derived from the MIRD method. Twelve specific organs of interest were proposed at the Coordinated Research Programme Project Formulation Meeting (PFM) in 1988. A slightly different set of thirteen organs with potential significance for radiation protection were selected for study at the Research Co-ordination Meeting held at the Bhabha Atomic Research Centre in 1991. The dimensions of the organs could also be useful information, but were considered unimportant for internal dose assessment. Due to the strong concern about the unified method for collecting organ mass data at the PFM, a guide-line was established stressing the need for organ data from subjects that were healthy and normal, at least until shortly before death, or from sudden death cases, following the Japanese experience. In this report, masses of nine to thirteen organs are presented from seven participating countries. Three participants have also reported the organ masses as fractions of the total body mass



    Marian NÃSTASE; Alexandru ROJA


    Current economic circumstances, very dynamic and characterized by uncertainty, require organizations to identify new sources of competitive advantage to remain competitive. Collaboration between organizations in collaborative networks are forms and environments in which organizations can use their distinctive potential. Capitalization of organizational potential in isolated manner, will not generate competitive advantage.Also important, the globalization and relocation of business, and integr...

  12. Nanostructured Organic Solar Cells

    DEFF Research Database (Denmark)

    Radziwon, Michal Jędrzej; Rubahn, Horst-Günter; Madsen, Morten

    Recent forecasts for alternative energy generation predict emerging importance of supporting state of art photovoltaic solar cells with their organic equivalents. Despite their significantly lower efficiency, number of application niches are suitable for organic solar cells. This work reveals...... the principles of bulk heterojunction organic solar cells fabrication as well as summarises major differences in physics of their operation....

  13. Organ Harvesting and Transplants (United States)

    Baskette, Kimberly G.; Ritz, John M.


    Humans and animals need healthy organs to live. Due to medical conditions and accidents, some organs fail to function properly. For these reasons, the medical community has experimented and can now perform successful organ transplants, allowing patients to continue to live their lives. Many countries have medical programs where individuals can…

  14. Organic production in Norway


    Wibe, Atle


    Present status of the Norwegian organic sector: -Official target of 10% organic production in 2010. -Organic production receives public subsidies -Marketing and production of plant products successful and growing -Marketing of livestock products successful and growing -Large portion of ecological products are sold unmarked together with other products

  15. Topology and structural self-organization in folded proteins (United States)

    Lundgren, M.; Krokhotin, Andrey; Niemi, Antti J.


    Topological methods are indispensable in theoretical studies of particle physics, condensed matter physics, and gravity. These powerful techniques have also been applied to biological physics. For example, knowledge of DNA topology is pivotal to the understanding as to how living cells function. Here, the biophysical repertoire of topological methods is extended, with the aim to understand and characterize the global structure of a folded protein. For this, the elementary concept of winding number of a vector field on a plane is utilized to introduce a topological quantity called the folding index of a crystallographic protein. It is observed that in the case of high resolution protein crystals, the folding index, when evaluated over the entire length of the crystallized protein backbone, has a very clear and strong propensity towards integer values. The observation proposes that the way how a protein folds into its biologically active conformation is a structural self-organization process with a topological facet that relates to the concept of solitons. It is proposed that the folding index has a potential to become a useful tool for the global, topological characterization of the folding pathways.

  16. Development of Polymer Acceptors for Organic Photovoltaic Cells

    Directory of Open Access Journals (Sweden)

    Yujeong Kim


    Full Text Available This review provides a current status report of the various n-type polymer acceptors for use as active materials in organic photovoltaic cells (OPVs. The polymer acceptors are divided into four categories. The first section of this review focuses on rylene diimide-based polymers, including perylene diimide, naphthalene diimide, and dithienocoronene diimide-based polymers. The high electron mobility and good stability of rylene diimides make them suitable for use as polymer acceptors in OPVs. The second section deals with fluorene and benzothiadiazole-based polymers such as poly(9,9’-dioctylfluorene-co-benzothiadiazole, and the ensuing section focuses on the cyano-substituted polymer acceptors. Cyano-poly(phenylenevinylene and poly(3-cyano-4-hexylthiophene have been used as acceptors in OPVs and exhibit high electron affinity arising from the electron-withdrawing cyano groups in the vinylene group of poly(phenylenevinylene or the thiophene ring of polythiophene. Lastly, a number of other electron-deficient groups such as thiazole, diketopyrrolopyrrole, and oxadiazole have also been introduced onto polymer backbones to induce n-type characteristics in the polymer. Since the first report on all-polymer solar cells in 1995, the best power conversion efficiency obtained with these devices to date has been 3.45%. The overall trend in the development of n-type polymer acceptors is presented in this review.

  17. The Visual Dimension in Organizing, Organization and Organization Research

    DEFF Research Database (Denmark)

    van Leeuwen, Theo; Meyer, Renate; Hollerer, Markus;


    With the unprecedented rise in the use of visuals, and its undeniable omnipresence in organizational contexts, as well as in the individual's everyday life, organization and management science has recently started to pay closer attention to the to date under-theorized "visual mode" of discourse...

  18. Feed and organic matter

    DEFF Research Database (Denmark)

    Dalsgaard, Anne Johanne Tang


    Organic waste from fish production is conventionally measured as BOD5 (biological oxygen demand measured during 5 days) and COD (chemical oxygen demand (includes BOD5)). Organic waste is of particular concern for several reasons. The easily degradable part (BOD5) may have an immediate, negative...... was opposite for BOD5. A BOD5/COD ratio of 0.5 was derived, indicating that unsedimented organic waste is characterized by easily degradable organic matter. In comparison, a solid BOD5/COD ratio of 0.2 indicated that this waste fraction contains high amounts of hard-to-degrade organic matter. The...

  19. Soil organic matter studies

    International Nuclear Information System (INIS)

    The dependence of plant production and humus formation, the interaction of soil organic matter with the mineral part of soil for plant nutrition and some physical and chemical properties of soil were discussed, as were the significance of climatic and hydrological data in that context. Isotope techniques (14C and 15N) were utilized in various studies. Papers were presented on the turnover of plant residues, mineralization of organic compounds, nitrogen economy, biodegradation and biochemical transformations of soil organic matter, contributions to the formation of humic substances, soil organic matter and plant metabolism, and the interaction between agrochemicals and organic matter. The use of municipal sludge on agricultural land was also considered

  20. Challenges in organ transplantation. (United States)

    Beyar, Rafael


    Organ transplantation has progressed tremendously with improvements in surgical methods, organ preservation, and pharmaco-immunologic therapies and has become a critical pathway in the management of severe organ failure worldwide. The major sources of organs are deceased donors after brain death; however, a substantial number of organs come from live donations, and a significant number can also be obtained from non-heart-beating donors. Yet, despite progress in medical, pharmacologic, and surgical techniques, the shortage of organs is a worldwide problem that needs to be addressed internationally at the highest possible levels. This particular field involves medical ethics, religion, and society behavior and beliefs. Some of the critical ethical issues that require aggressive interference are organ trafficking, payments for organs, and the delicate balance in live donations between the benefit to the recipient and the possible harm to the donor and others. A major issue in organ transplantation is the definition of death and particularly brain death. Another major critical factor is the internal tendency of a specific society to donate organs. In the review below, we will discuss the various challenges that face organ donation worldwide, and particularly in Israel, and some proposed mechanisms to overcome this difficulty. PMID:23908807

  1. Challenges in Organ Transplantation

    Directory of Open Access Journals (Sweden)

    Rafael Beyar


    Full Text Available Organ transplantation has progressed tremendously with improvements in surgical methods, organ preservation, and pharmaco-immunologic therapies and has become a critical pathway in the management of severe organ failure worldwide. The major sources of organs are deceased donors after brain death; however, a substantial number of organs come from live donations, and a significant number can also be obtained from non-heart-beating donors. Yet, despite progress in medical, pharmacologic, and surgical techniques, the shortage of organs is a worldwide problem that needs to be addressed internationally at the highest possible levels. This particular field involves medical ethics, religion, and society behavior and beliefs. Some of the critical ethical issues that require aggressive interference are organ trafficking, payments for organs, and the delicate balance in live donations between the benefit to the recipient and the possible harm to the donor and others. A major issue in organ transplantation is the definition of death and particularly brain death. Another major critical factor is the internal tendency of a specific society to donate organs. In the review below, we will discuss the various challenges that face organ donation worldwide, and particularly in Israel, and some proposed mechanisms to overcome this difficulty.

  2. Organic 'Plastic' Optoelectronic Devices

    International Nuclear Information System (INIS)

    Recent developments on conjugated polymer based photovoltaic diodes and photoactive organic field effect transistors (photOFETs) are discussed. The photophysics of such devices is based on the photoinduced charge transfer from donor type semiconducting conjugated polymers onto acceptor type conjugated polymers or acceptor molecules such as Buckminsterfullerene, C60. Potentially interesting applications include sensitization of the photoconductivity and photovoltaic phenomena as well as photoresponsive organic field effect transistors (photOFETs). Furthermore, organic polymeric/inorganic nanoparticle based 'hybrid' solar cells will be discussed. This talk gives an overview of materials' aspect, charge-transport, and device physics of organic diodes and field-effect transistors. Furthermore, due to the compatibility of carbon/hydrogen based organic semiconductors with organic biomolecules and living cells there can be a great opportunity to integrate such organic semiconductor devices (biOFETs) with the living organisms. In general the largely independent bio/lifesciences and information technology of today, can be thus bridged in an advanced cybernetic approach using organic semiconductor devices embedded in bio-lifesciences. This field of bio-organic electronic devices is proposed to be an important mission of organic semiconductor devices

  3. Immunity of international organizations

    CERN Document Server

    Schrijver, Nico


    Immunity rules are part and parcel of the law of international organizations. It has long been accepted that international organizations and their staff need to enjoy immunity from the jurisdiction of national courts. However, it is the application of these rules in practice that increasingly causes controversy. Claims against international organizations are brought before national courts by those who allegedly suffer from their activities. These can be both natural and legal persons such as companies. National courts, in particular lower courts, have often been less willing to recognize the immunity of the organization concerned than the organization s founding fathers. Likewise, public opinion and legal writings frequently criticize international organizations for invoking their immunity and for the lack of adequate means of redress for claimants. It is against this background that an international conference was organized at Leiden University in June 2013. A number of highly qualified academics and practit...

  4. Feed and organic matter

    DEFF Research Database (Denmark)

    Dalsgaard, Anne Johanne Tang


    distribution between particulate and unsedimented (suspended and dissolved) organic waste. Quantifying aquaculture waste, including organic matter, nitrogen (N) and phosphorus (P), into different waste fractions (particulate and unsedimented) is essential for optimising the design of different treatment setups...... was opposite for BOD5. A BOD5/COD ratio of 0.5 was derived, indicating that unsedimented organic waste is characterized by easily degradable organic matter. In comparison, a solid BOD5/COD ratio of 0.2 indicated that this waste fraction contains high amounts of hard-to-degrade organic matter. The......Organic waste from fish production is conventionally measured as BOD5 (biological oxygen demand measured during 5 days) and COD (chemical oxygen demand (includes BOD5)). Organic waste is of particular concern for several reasons. The easily degradable part (BOD5) may have an immediate, negative...

  5. Do Education Organizations Show Learning Organizations Charecterics?

    Directory of Open Access Journals (Sweden)

    Sedat Yumusak,

    Full Text Available Learning, an important element in terms of affecting the change of individual, organizational and social structures, will occur more effectively when the institutions in social structure turn into learning organizations. Senge (1993 concept of learning organization, constantly changing, evolving and renewing itself described as a dynamic structure. This concept has an important place in all institutions is also a separate meaning for educational institutions. In this context, schools training the human resources, appropriate for the aim of being information society, as individuals have taken continuous learning as their principles, teachers providing educational and supporting services and their perceptions of learning organization are of the great importance. In Balıkesir, the study was conducted virtue of this importance has been serving the state and private institutions serving 848 elementary teachers, perceptions of the learning organization and organizational barriers that prevent it is to be determined through a comparative analysis. As a result of the survey, in the framework of the bases in literature, it has been found out that the state primary schools don’t have the features of learning organization, contrary to the private primary schools.

  6. Focus on Organic Conductors

    Directory of Open Access Journals (Sweden)

    Shinya Uji, Takehiko Mori and Toshihiro Takahashi


    Full Text Available Organic materials are usually thought of as electrical insulators. Progress in chemical synthesis, however, has brought us a rich variety of conducting organic materials, which can be classified into conducting polymers and molecular crystals. Researchers can realize highly conducting molecular crystals in charge-transfer complexes, where suitable combinations of organic electron donor or acceptor molecules with counter ions or other organic molecules provide charge carriers. By means of a kind of chemical doping, the charge-transfer complexes exhibit high electrical conductivity and, thanks to their highly crystalline nature, even superconductivity has been observed. This focus issue of Science and Technology of Advanced Materials is devoted to the research into such 'organic conductors'The first organic metal was (TTF(TCNQ, which was found in 1973 to have high conductivity at room temperature and a metal–insulator transition at low temperatures. The first organic superconductor was (TMTSF2PF6, whose superconductivity under high pressures was reported by J´erome in 1980. After these findings, the research on organic conductors exploded. Hundreds of organic conductors have been reported, among which more than one hundred exhibit superconductivity. Recently, a single-component organic conductor has been found with metallic conductivity down to low temperatures.In these organic conductors, in spite of their simple electronic structures, much new physics has arisen from the low dimensionality. Examples are charge and spin density waves, characteristic metal–insulator transitions, charge order, unconventional superconductivity, superconductor–insulator transitions, and zero-gap conductors with Dirac cones. The discovery of this new physics is undoubtedly derived from the development of many intriguing novel organic conductors. High quality single crystals are indispensable to the precise measurement of electronic states.This focus issue

  7. Nonlinear organic plasmonics

    CERN Document Server

    Fainberg, B D


    Purely organic materials with negative and near-zero dielectric permittivity can be easily fabricated. Here we develop a theory of nonlinear non-steady-state organic plasmonics with strong laser pulses. The bistability response of the electron-vibrational model of organic materials in the condensed phase has been demonstrated. Non-steady-state organic plasmonics enable us to obtain near-zero dielectric permittivity during a short time. We have proposed to use non-steady-state organic plasmonics for the enhancement of intersite dipolar energy-transfer interaction in the quantum dot wire that influences on electron transport through nanojunctions. Such interactions can compensate Coulomb repulsions for particular conditions. We propose the exciton control of Coulomb blocking in the quantum dot wire based on the non-steady-state near-zero dielectric permittivity of the organic host medium.

  8. Organic photosensitive devices (United States)

    Peumans, Peter; Forrest, Stephen R.


    A photoactive device is provided. The device includes a first electrode, a second electrode, and a photoactive region disposed between and electrically connected to the first and second electrodes. The photoactive region further includes an organic donor layer and an organic acceptor layer that form a donor-acceptor heterojunction. The mobility of holes in the organic donor region and the mobility of electrons in the organic acceptor region are different by a factor of at least 100, and more preferably a factor of at least 1000. At least one of the mobility of holes in the organic donor region and the mobility of electrons in the organic acceptor region is greater than 0.001 cm.sup.2/V-sec, and more preferably greater than 1 cm.sup.2/V-sec. The heterojunction may be of various types, including a planar heterojunction, a bulk heterojunction, a mixed heterojunction, and a hybrid planar-mixed heterojunction.

  9. Evolving Procurement Organizations

    DEFF Research Database (Denmark)

    Bals, Lydia; Laiho, Aki; Laine, Jari

    Procurement has to find further levers and advance its contribution to corporate goals continuously. This places pressure on its organization in order to facilitate its performance. Therefore, Procurement organizations constantly have to evolve in order to match these demands. A conceptual model is...... presented and results of a first case study discussed. The findings highlight the importance of taking a contingency perspective on Procurement organization, understanding the internal and internal contingency factors. From a theoretical perspective, it opens up insights that can be furthermore leveraged in...... future studies in the fields of hybrid procurement organizations, global sourcing organizations as well as international procurement offices (IPOs). From a practical standpoint, an assessment of external and internal contingencies provides the opportunity to consciously match organization to its...

  10. Organic food processing

    DEFF Research Database (Denmark)

    Kahl, Johannes; Alborzi, Farnaz; Beck, Alexander;


    In 2007 EU Regulation (EC) 834/2007 introduced principles and criteria for organic food processing. These regulations have been analysed and discussed in several scientific publications and research project reports. Recently, organic food quality was described by principles, aspects and criteria...... product identity as the underlying paradigm and a holistic quality view connected to naturalness as consumers' perception of organic food quality. In a European study, the quality concept was applied to the organic food chain, resulting in a problem, namely that clear principles and related criteria were...... food as well as on organic processing. The proposed definition connects organic processing to related systems such as minimal, sustainable and careful, gentle processing, and describes clear principles and related criteria. Based on food examples, such as milk with different heat treatments, the...

  11. Public Sector Organizations

    DEFF Research Database (Denmark)

    Meyer, Renate; Leixnering, Stephan


    and private sectors as well as the boundaries of single organizations. In addition, the complexity of the interlocking arrangements and relationships in this public organizational landscape has resulted in considerable governance problems with serious implications for coordination and policy coherence.......New public management-inspired reforms created numerous autonomous units with many different faces and labels. This variety of organizations and organizational forms precludes a straightforward definition of what constitutes a public sector organization and blurs the boundaries between the public...

  12. Organic Molecular Solids

    CERN Document Server

    Schwoerer, Marcus


    This is the first comprehensive textbook on the physical aspects of organic solids. All phenomena which are necessary in order to understand modern technical applications are being dealt with in a way which makes the concepts of the topics accessible for students. The chapters - from the basics, production and characterization of organic solids and layers to organic semiconductors, superconductors and opto-electronical applications - have been arranged in a logical and well thought-out order.

  13. Attribute coordination in organizations


    Yingyi Qian; Gerard Roland; Chenggang Xu


    We study coordination in organizations with a variety of organizational forms. Coordination in organization is modeled as the adjustment of attributes and capacities of tasks when facing external shocks. An M-form (U-form) organization groups complementary (substitutable) tasks together in one unit. In the presence of only attribute shocks, particularly when gains from specialization are small, communication is poor, or shocks are more likely, the expected payoff of the decentralized M-form i...

  14. Fostering values in organizations


    Argandoña, Antonio


    Today, values hold a prominent place both in business ethics and in organization theory. However, there persists considerable confusion about what these values are and what role they play in these theories and, therefore, how they can be developed both within the individual and within the organization. Therefore, this paper seeks to define a conception of values based on a theory of human action that can provide a basis for an organization theory, and to propose a series of ideas about how pe...

  15. Stress Management in Organizations


    Roxana Capotescu


    Employee stress has increasingly become a concern for many organizations. Although it is not possible to eliminate stress entirely, people can learn to manage it. Many organizations have adopted occupational stress management programs to try and reduce the stress levels of their workforce. The high cost of work stress related problems highlights the need to spend more time evaluating work stress interventions and publishing the findings so that other organizations can gain insight into progra...

  16. Organizations and Markets

    DEFF Research Database (Denmark)

    Foss, Nicolai Juul; Klein, Peter G.; Linder, Stefan

    Austrian economics focuses on markets, but has much to say about organizations. In particular, Austrian insights on the structure of production, the heterogeneity and subjectivity of resources, the nature of uncertainty, the role of monetary calculation, and the function of the entrepreneur provide...... solid foundations for a distinctly Austrian theory of organizations. We review these insights, discuss recent literature on Austrian economics and the theory of the firm, and suggest new directions for developing and extending an Austrian approach to organizations....

  17. Organ Donation in China

    Institute of Scientific and Technical Information of China (English)

    Maya; Reid


    CHINA’S first voluntary organ donation system is in the midst of its trial run. The program is being tested in 11 pilot regions around the country, having harvested organs from more than 100 donors in this inaugural year. Overseen by the Red Cross Society of China and the country’s Ministry of Health, the system follows cardiac death standards in organ donation

  18. The organization of thanatology. (United States)

    Doka, Kenneth J; Heflin-Wells, E Neil; Martin, Terry L; Redmond, Lula M; Schachter, Sherry R


    This article explores, using Wilensky's Model of Professionalization, the emergence of professional organizations within the thanatology. The authors review the history of four organizations--The Foundation of Thanatology, Ars Moriendi, The Forum for Death Education and Counseling (now the Association for Death Education and Counseling: A Thanatology Organization [ADEC]), and The International Work Group on Death, Dying, and Bereavement (IWG). The authors speculate on some of the reasons that the first two failed while IWG and ADEC remain viable-while noting challenges that these remaining thanatological organizations will experience as they seek to continue to stay relevant. PMID:21842661

  19. Organizing marginalized workers. (United States)

    Taylor, A K


    Figures from the U.S. Department of Labor show that low-wage or marginalized workers are more likely to be injured on the job and suffer more work-related medical conditions than better-paid workers. Despite an increasingly hostile organizing climate, market globalization, and corporate downsizing, significant progress has been made in organizing marginalized workers. A multifaceted, comprehensive organizing strategy, incorporating union-building strategies that include (but are not limited to) safety and health, must be used by unions to successfully organize marginalized workers and obtain the first contract. PMID:10378982

  20. Management of information organizations

    CERN Document Server

    Afzal, Waseem


    This book is a significant step towards developing a body of management knowledge pertinent to the context of Library Information Science (LIS) and provides a succinct but deep account of management and information organizations. Management of Information Organizations presents a broad view of the information organizations and the nature of management in these organizations, and how information professionals are affected by such management systems. The book equips the reader with the knowledge that will enable them to develop a strong intellectual foundation relating to management and its mani

  1. Organic food and farming

    DEFF Research Database (Denmark)

    Kledal, Paul Rye

    The paper is based on research conducted for DARCOF II (Danish Research Centre for Organic Farming, The aim of the research project is to analyze the future development of the Danish organic food sector through focusing on two agro-commodities: vegetables and pork. Emphasis is...... placed on identification of economic forces within the supply chains. The main conclusions of the paper – being the results from the organic vegetable chain – are that the rules and regulations, and the development of alternative transaction processes in organic food and farming have so far been founded...

  2. Physics of Organic Semiconductors

    CERN Document Server

    Brütting, Wolfgang


    Filling the gap in the literature currently available, this book presents an overview of our knowledge of the physics behind organic semiconductor devices. Contributions from 18 international research groups cover various aspects of this field, ranging from the growth of organic layers and crystals, their electronic properties at interfaces, their photophysics and electrical transport properties to the application of these materials in such different devices as organic field-effect transistors, photovoltaic cells and organic light-emitting diodes. From the contents:. * Excitation Dynamics in O

  3. Titan's organic chemistry (United States)

    Sagan, C.; Thompson, W. R.; Khare, B. N.


    Voyager discovered nine simple organic molecules in the atmosphere of Titan. Complex organic solids, called tholins, produced by irradiation of the simulated Titanian atmosphere, are consistent with measured properties of Titan from ultraviolet to microwave frequencies and are the likely main constituents of the observed red aerosols. The tholins contain many of the organic building blocks central to life on earth. At least 100-m, and possibly kms thicknesses of complex organics have been produced on Titan during the age of the solar system, and may exist today as submarine deposits beneath an extensive ocean of simple hydrocarbons.

  4. The MDT Barrel Organ

    CERN Multimedia

    Claudia Marcelloni de Oliveira

    Have you ever looked for an interesting use for the spare detector parts once the construction phase was finished? Henk Tiecke, with the help of Oscar van Petten and Marco Kraan, all from NIKHEF, came up with a great idea for leftover MDT tubes. They simply built a pipe organ! See the MDT Barrel Organ in action, as recorded during a party thrown on the occasion of the first shipment of MDT chambers from NIKHEF to CERN. Want to know more about the organ? Please contact Henk Tiecke. Henk Tiecke playing the MDT Barrel Organ.

  5. Organizations in Time

    DEFF Research Database (Denmark)

    This book brings together leading organization scholars and business historians to examine the opportunities and challenges of incorporating historical research into the study of firms and markets. It examines the reasons for the growing interest in historically grounded research in management...... section, Sources and Methods, the contributors explicate historical methodologies within the context of other approaches to studying organizations and provide concrete suggestions for researchers in the field. The introduction places these issues within the broader context of developments in the fields of...... business history and organization studies, and orients readers to the ‘future of the past in management and organization studies.’...

  6. Organic Molecules in Meteorites (United States)

    Martins, Zita


    Carbonaceous meteorites are primitive samples from the asteroid belt, containing 3-5wt% organic carbon. The exogenous delivery of organic matter by carbonaceous meteorites may have contributed to the organic inventory of the early Earth. The majority (>70%) of the meteoritic organic material consist of insoluble organic matter (IOM) [1]. The remaining meteoritic organic material (Haber-Bosch type gas-grain reactions after the meteorite parent body cooled to lower temperatures [13, 14].The analysis of the abundances and distribution of the organic molecules present in meteorites helps to determine the physical and chemical conditions of the early solar system, and the prebiotic organic compounds available on the early Earth.[1] Cody and Alexander (2005) GCA 69, 1085. [2] Cronin and Chang (1993) in: The Chemistry of Life’s Origin. pp. 209-258. [3] Martins and Sephton (2009) in: Amino acids, peptides and proteins in organic chemistry. pp. 1-42. [4] Martins (2011) Elements 7, 35. [5] Botta et al. (2007) MAPS 42, 81. [6] Martins et al. (2015) MAPS, in press. [7] Cooper and Cronin (1995) GCA 59, 1003. [8] Glavin et al. (2006) MAPS. 41, 889. [9] Glavin et al. (2011) MAPS 45, 1948. [10] Elsila et al. (2005) GCA 5, 1349. [11] Glavin and Dworkin (2009) PNAS 106, 5487. [12] Pizzarello et al. (2003) GCA 67, 1589. [13] Chan et al. (2012) MAPS. 47, 1502. [14] Burton et al. (2011) MAPS 46, 1703.

  7. Innovative Mechanism of Rural Organization Based on Self-Organization


    Wang, Xing jin; Gao, Bing


    The paper analyzes the basic situation for the formation of innovative rural organizations with the form of self-organization; revels the features of self-organization, including the four aspects of openness of rural organization, innovation of rural organization is far away from equilibrium, the non-linear response mechanism of rural organization innovation and the random rise and fall of rural organization innovation. The evolution mechanism of rural organization innovation is reveled accor...

  8. Scratch, wear and corrosion resistant organic inorganic hybrid materials for metals protection and barrier

    International Nuclear Information System (INIS)

    Highlights: • Polysiloxane coatings as protective barriers to delay erosion/corrosion of Fe 430 B metal substrates. • Methyl groups feature a very small steric hindrance and confer ductility to the Si–O–Si backbone. • Phenyl groups feature a larger steric hindrance, but they ensure stability and high chemical inertness. • Remarkable adhesion to the substrate, good scratch resistance and high wear endurance. • Innovative ways to design of long lasting protective barriers against corrosion and aggressive chemicals. - Abstract: Polysiloxanes are widely used as protective barriers to delay erosion/corrosion and increase chemical inertness of metal substrates. In the present work, a high molecular weight methyl phenyl polysiloxane resin was designed to manufacture a protective coating for Fe 430 B structural steel. Methyl groups feature very small steric hindrance and confer ductility to the Si–O–Si backbone of the organic inorganic hybrid resin, thus allowing the achievement of high thickness. Phenyl groups feature larger steric hindrance, but they ensure stability and high chemical inertness. Visual appearance and morphology of the coatings were studied by field emission scanning electron microscopy and contact gauge surface profilometry. Micro-mechanical response of the coatings was analyzed by instrumented progressive load scratch, while wear resistance by dry sliding linear reciprocating tribological tests. Lastly, chemical inertness and corrosion endurance of the coatings were evaluated by linear sweep voltammetry and chronoamperometry in aggressive acid environment. The resulting resins yielded protective materials, which feature remarkable adhesion to the substrate, good scratch resistance and high wear endurance, thus laying the foundations to manufacture long lasting protective barriers against corrosion and, more in general, against aggressive chemicals

  9. Organ Procurement and Transplantation Network (United States)

    U.S. Department of Health & Human Services — The Organ Procurement Organizations and Organ Transplant Programs Locator tool is designed to help users find information about the Organ Procurement and...

  10. Organ Type and Waiting Time (United States)

    ... for an organ due to the shortage of donor organs. Because each candidate's situation is unique, waiting times ... distance between donor and recipient size of the donor organ in relation to the recipient type of organ ...


    Concern over the bioavailability of toxic organics that can occur in municipal sludges threatens routine land application of sludge. vailable data, however, show that concentrations of priority organics in normal sludges are low. ludges applied at agronomic rates yield chemical c...

  12. Are Learning Organizations Pragmatic? (United States)

    Cavaleri, Steven A.


    Purpose: The purpose of this paper is to evaluate the future prospects of the popular concept known as the learning organization; to trace the influence of philosophical pragmatism on the learning organization and to consider its potential impact on the future; and to emphasize how pragmatic theories have shaped the development of Deming's total…

  13. Sustainable Learning Organizations (United States)

    Velazquez, Luis E.; Esquer, Javier; Munguia, Nora E.; Moure-Eraso, Rafael


    Purpose: The purpose of this paper is to debate how companies may better become a sustainable learning organization by offering the most used and insightful concepts of sustainability. Design/methodology/approach: Through literature review, learning organization and sustainability perspectives are explored and compared. Findings: Learning…

  14. Mintzberg on organizations

    Directory of Open Access Journals (Sweden)

    Prof. Ph.D. Sorin-George Toma


    Full Text Available Henry Mintzberg is considered as one of the most representative writers in management.Until now,he has written more than 140 monographs and articles, and 13 books,mostly in the management field. On the basis of his research findings, Mintzberg proposed a typology of organizations. Taking into account their structure, he discovered seven major types of organizations

  15. High reliability organizations

    NARCIS (Netherlands)

    Gallis, R.; Zwetsloot, G.I.J.M.


    High Reliability Organizations (HRO’s) are organizations that constantly face serious and complex (safety) risks yet succeed in realising an excellent safety performance. In such situations acceptable levels of safety cannot be achieved by traditional safety management only. HRO’s manage safety risk

  16. Sugarcane Pernicious Organisms Hunan

    Institute of Scientific and Technical Information of China (English)


    @@ There are more than 2000 species of sugarcane pernicious organisms in the world, and over 400species axe in China. In order to make sure the sugarcane pernicious organisms in Hunan, we had a detailed investiga tion in several main sugarcane - producing regions during 1996- 1998.

  17. Organ Facts: Pancreas (United States)

    ... in certain types of transplants. Discover data and statistics for each center. Visit the OPTN's Organ DataSource now > I am looking for >> About organ allocation About UNOS Being a living donor Calculator - CPRA Calculator - KDPI Calculator - LAS Calculator - MELD ...

  18. Organ Facts: Kidney / Pancreas (United States)

    ... in certain types of transplants. Discover data and statistics for each center. Visit the OPTN's Organ DataSource now > I am looking for >> About organ allocation About UNOS Being a living donor Calculator - CPRA Calculator - KDPI Calculator - LAS Calculator - MELD ...

  19. Neurology and international organizations


    Mateen, Farrah J.


    A growing number of international stakeholders are engaged with neurologic diseases. This article provides a brief overview of important international stakeholders in the practice of neurology, including global disease-specific programs, United Nations agencies, governmental agencies with international influence, nongovernmental organizations, international professional organizations, large private donors, private–public partnerships, commercial interests, armed forces, and universities and c...

  20. The Expressive Organization

    DEFF Research Database (Denmark)

    This text challenges beliefs about organizational identity, reputation, and branding. It contains a wealth of new ideas for finding the elusive answers to questions troubling contemporary organizations. How does an organization create a strong reputation? What are the implications of corporate...... postgraduate students of management, business strategy, accounting, marketing, and communication studies; MBA students; Managers and consultants....

  1. Organic Agriculture in Austria


    Vogl, C. R.; Darnhofer, I.


    Organic farming has a long history in Austria, not least due to the fact that Rudolf Steiner, the founder of the bio-dynamic farming movement, was an Austrian. Currently approximately 10% of Austrian farms are certified organic, the highest percentage in the EU.

  2. Organic chemistry of astatine

    International Nuclear Information System (INIS)

    The paper surveys the investigations on the chemical behaviour of astatine in organic systems and deals with the preparation and identification of its organic compounds. A discussion is given on some of the physico-chemical properties of these compounds determined by extrapolation techniques as well as by direct measurement. The biomedical importance of 211At-labelled compounds is briefly referred to. (authors)

  3. Organizing Core Tasks

    DEFF Research Database (Denmark)

    Boll, Karen

    has remained much the same within the last 10 years. However, how the core task has been organized has changed considerable under the influence of various “organizing devices”. The paper focusses on how organizing devices such as risk assessment, output-focus, effect orientation, and treatment...... projects influence the organization of core tasks within the tax administration. The paper shows that the organizational transformations based on the use of these devices have had consequences both for the overall collection of revenue and for the employees’ feeling of “making a difference”. All in all......, the paper is an investigation into how various (mundane) organizing devices interact with, influence, and shape particular organizational practices which are assumed to perform the well-functioning welfare state....

  4. Stability of Organic Nanowires

    DEFF Research Database (Denmark)

    Balzer, F.; Schiek, M.; Wallmann, I.;


    The morphological stability of organic nanowires over time and under thermal load is of major importance for their use in any device. In this study the growth and stability of organic nanowires from a naphthyl end-capped thiophene grown by organic molecular beam deposition is investigated via...... atomic force microscopy (AFM). Aging experiments under ambient conditions already show substantial morphological changes. Nanoscopic organic clusters, which initially coexist with the nanowires, vanish within hours. Thermal annealing of nanowire samples leads to even more pronounced morphology changes......, such as a strong decrease in nanowire number density, a strong increase in nanowire height, and the formation of new types of crystallites. This happens even before sublimation of organic material starts. These experiments also shine new light on the formation process of the nanowires....

  5. Organ donations after death

    Directory of Open Access Journals (Sweden)

    Bernarda Logar


    Full Text Available The paper discusses public opinion on post-mortem organ donation, especially the difference between high support of public opinion to transplant activity, its general readiness to donate organs and the low number of signed organ donor cards. Through different approaches the article tries to point out possible factors relevant to the decision to donate organs. Early studies showed demographic variables and information as significant factors when deciding to donate organs after death. As there was not enough evidence that long-term effect through these factors is significant, the need for new investigation has grown. Social cognition theories helped understanding the difference mentioned above. It seems that the use of this approach might contribute to the understanding the problem and to delimit most useful factors when working with public.

  6. Cellular organization by self-organization


    Howard, Martin; Kruse, Karsten


    We use the oscillating Min proteins of Escherichia coli as a prototype system to illustrate the current state and potential of modeling protein dynamics in space and time. We demonstrate how a theoretical approach has led to striking new insights into the mechanisms of self-organization in bacterial cells and indicate how these ideas may be applicable to more complex structure formation in eukaryotic cells.

  7. A review of modelling the interaction between natural organic matter and metal cations

    International Nuclear Information System (INIS)

    This report reviews techniques available to model the interaction between natural organic matter (mainly fulvic and humic acids) and protons and metal cations. A concise definition of natural organic matter is given and their properties are outlined. These materials are macromolecules which exhibit a polyelectrolyte character owing to numerous dissociable functional groups which are attached to their carbon backbone or from integral parts of the structure. The polyelectrolyte character is thought to be responsible for their conformation, hydrogen bonding or bridging by metal cations between subunits being important mechanisms. Environmental parameters like pH and ionic strength thus will have profound effects on the conformation of natural organic matter, the properties of which can change from being a flexible polymer to being a rigid gel. Binding mechanisms and binding strengh are discussed and an overview of relevant techniques of investigation is given. This work is part of the Commission's Mirage project - Phase 2, research area Geochemistry of actinides and fission products in natural aquifer systems

  8. Molecular Packing and Arrangement Govern the Photo-Oxidative Stability of Organic Photovoltaic Materials

    KAUST Repository

    Mateker, William R.


    For long-term performance chemically robust materials are desired for organic solar cells (OSCs). Illuminating neat films of OSC materials in air and tracking the rate of absorption loss, or photobleaching, can quickly screen a material’s photo-chemical stability. In this report, we photobleach neat films of OSC materials including polymers, solution-processed oligomers, solution-processed small molecules, and vacuum-deposited small molecules. Across the materials we test, we observe photobleaching rates that span seven orders of magnitude. Furthermore, we find that the film morphology of any particular material impacts the observed photobleaching rate, and that amorphous films photobleach faster than crystalline ones. In an extreme case, films of amorphous rubrene photobleach at a rate 2500 times faster than polycrystalline films. When we compare density to photobleaching rate, we find that stability increases with density. We also investigate the relationship between backbone planarity and chemical reactivity. The polymer PBDTTPD is more photostable than it’s more twisted and less ordered furan derivitative, PBDFTPD. Finally, we relate our work to what is known about the chemical stability of structural polymers, organic pigments, and organic light emitting diode materials. For the highest chemical stability, planar materials that form dense, crystalline film morphologies should be designed for OSCs.

  9. Present Situation and Demand of Diploma Education for Primary Backbone Doctors in Less Developed Regions of Guangdong Province%广东省欠发达地区全科医师骨干培训班学员的学历教育现状及需求分析

    Institute of Scientific and Technical Information of China (English)

    黄婉霞; 徐庆锋; 苏慧萍; 涂正杰; 王心旺; 张立威; 王家骥


    Objective To know the present situation and demand of deploma education for primary backbone doctors in less developed regions of Guangdong Province so as to provide an evidence for construction of primary health personnel.Methods A self - designed questionnaire survey was conducted among 194 students from the training program for backbone general practitioners in Guangdong Province.Results Among 194 surveyed primary backbone doctors, there were 63.9% of the respondents who had participated or were being in the program of in - service diploma education.The main form of diploma education was on the part time basis, accounting for 79.0%.Some 86.1 % of the respondents had a demand for diploma education, and there were significant differences in demand among the primary backbone doctors with different professional titles and in different professional fields ( P <0.05 ).The respondents with primary titles or below had a higher demand than those with intermediate titles or above; and the respondents on the regular payroll had a higher demand than those not on the regular pay-roll.Conclusion Primary backbone doctors have a larger demand for diploma education.The government and related institutions should increase investment for construction of primary health personnel, formulate effective policies and measures, and encourage primary care doctors to participate in diploma education, in order to substantially raise the level of primary health care.%目的 了解我省欠发达地区基层骨干医生的学历教育现状及需求情况,为基层卫生人才队伍建设提供依据.方法 采用自行设计的调查问卷,对广东省全科医师骨干培训班的194名学员进行现场自填式问卷调查.结果 被调查的194名基层骨干医生中,参加过或正在参加在职学历教育者占63.9%;参加的学历教育形式以半脱产学习为主,占79.0%.有86.1%的被调查者对学历教育有需求,不同职称和类别的

  10. A core-shell structured inorganic-organic hybrid nanocomposite for Hg(II) sensing and removal. (United States)

    Jiqu, Han; Qixia, Yang


    In the present paper, a core-shell structured inorganic-organic hybrid nanocomposite for Hg(II) sensing and removal was designed and fabricated, where the core was composed of superparamagnetic Fe3O4 and the shell consisted of molecular silica sieve MCM-41. A rhodamine derived probe was grafted onto the backbone of MCM-41 through a silane coupling reagent to control its loading content. This probe functionalized core-shell structure was confirmed and characterized by XRD analysis, electron microscopy images, IR spectra, thermogravimetry and N2 adsorption/desorption isotherms. It was found that the emission of this composite increased with increasing Hg(II) concentrations but was immune to other metal ions, showing good selectivity and high sensitivity towards Hg(II) ions. A linear Stern-Volmer curve was observed with short response time. In addition, this composite possessed good Hg(II)-removing and recycling performance. PMID:25978016

  11. Connecting defects and amorphization in UiO-66 and MIL-140 metal-organic frameworks: a combined experimental and computational study (United States)

    Bennett, Thomas D.; Todorova, Tanya K.; Baxter, Emma F.; Reid, David G.; Gervais, Christel; Bueken, Bart; Van de Voorde, B.; De Vos, Dirk; Keen, David A.; Mellot-Draznieks, Caroline

    The mechanism and products of the structural collapse of the metal-organic frameworks (MOFs) UiO-66, MIL-140B and MIL-140C upon ball-milling are investigated through solid state 13C NMR and pair distribution function (PDF) studies, finding amorphization to proceed by the breaking of a fraction of metal-ligand bonding in each case. The amorphous products contain inorganic-organic bonding motifs reminiscent of the crystalline phases. Whilst the inorganic Zr6O4(OH)4 clusters of UiO-66 remain intact upon structural collapse, the ZrO backbone of the MIL-140 frameworks undergoes substantial distortion. Density functional theory calculations have been performed to investigate defective models of MIL-140B and show, through comparison of calculated and experimental 13C NMR spectra, that amorphization and defects in the materials are linked.

  12. Self-Organizing Robots

    CERN Document Server

    Murata, Satoshi


    It is man’s ongoing hope that a machine could somehow adapt to its environment by reorganizing itself. This is what the notion of self-organizing robots is based on. The theme of this book is to examine the feasibility of creating such robots within the limitations of current mechanical engineering. The topics comprise the following aspects of such a pursuit: the philosophy of design of self-organizing mechanical systems; self-organization in biological systems; the history of self-organizing mechanical systems; a case study of a self-assembling/self-repairing system as an autonomous distributed system; a self-organizing robot that can create its own shape and robotic motion; implementation and instrumentation of self-organizing robots; and the future of self-organizing robots. All topics are illustrated with many up-to-date examples, including those from the authors’ own work. The book does not require advanced knowledge of mathematics to be understood, and will be of great benefit to students in the rob...

  13. The discipline of organizing

    CERN Document Server


    Organizing is such a common activity that we often do it without thinking much about it. In our daily lives we organize physical things--books on shelves, cutlery in kitchen drawers--and digital things--Web pages, MP3 files, scientific datasets. Millions of people create and browse Web sites, blog, tag, tweet, and upload and download content of all media types without thinking "I'm organizing now" or "I'm retrieving now." This book offers a framework for the theory and practice of organizing that integrates information organization (IO) and information retrieval (IR), bridging the disciplinary chasms between Library and Information Science and Computer Science, each of which views and teaches IO and IR as separate topics and in substantially different ways. It introduces the unifying concept of an Organizing System--an intentionally arranged collection of resources and the interactions they support--and then explains the key concepts and challenges in the design and deployment of Organizing Systems in many do...

  14. Organic Separation Test Results

    Energy Technology Data Exchange (ETDEWEB)

    Russell, Renee L.; Rinehart, Donald E.; Peterson, Reid A.


    Separable organics have been defined as “those organic compounds of very limited solubility in the bulk waste and that can form a separate liquid phase or layer” (Smalley and Nguyen 2013), and result from three main solvent extraction processes: U Plant Uranium Recovery Process, B Plant Waste Fractionation Process, and Plutonium Uranium Extraction (PUREX) Process. The primary organic solvents associated with tank solids are TBP, D2EHPA, and NPH. There is concern that, while this organic material is bound to the sludge particles as it is stored in the tanks, waste feed delivery activities, specifically transfer pump and mixer pump operations, could cause the organics to form a separated layer in the tank farms feed tank. Therefore, Washington River Protection Solutions (WRPS) is experimentally evaluating the potential of organic solvents separating from the tank solids (sludge) during waste feed delivery activities, specifically the waste mixing and transfer processes. Given the Hanford Tank Waste Treatment and Immobilization Plant (WTP) waste acceptance criteria per the Waste Feed Acceptance Criteria document (24590-WTP-RPT-MGT-11-014) that there is to be “no visible layer” of separable organics in the waste feed, this would result in the batch being unacceptable to transfer to WTP. This study is of particular importance to WRPS because of these WTP requirements.

  15. Organic Compounds in Stardust (United States)

    McKay, David S.; Clemett. Simon J.; Sandford, Scott A.; Nakamura-Messenger, Keiko; Hoerz, Fredrich


    The successful return of the STARDUST spacecraft provides a unique opportunity to investigate the nature and distribution of organic matter in cometary dust particles collected from Comet 81P/Wild-2. Analysis of individual cometary impact tracks in silica aerogel using the technique of two-step laser mass spectrometry (L2MS) demonstrates the presence of complex aromatic organic matter. While concerns remain as to the organic purity of the aerogel collection medium and the thermal effects associated with hypervelocity capture, the majority of the observed organic species appear indigenous to the impacting particles and are hence of cometary origin. While the aromatic fraction of the total organic matter present is believed to be small, it is notable in that it appears to be N-rich. Spectral analysis in combination with instrumental detection sensitivities suggest that N is incorporated predominantly in the form of aromatic nitriles (R-C N). While organic species in the STARDUST samples do share some similarities with those present in the matrices of carbonaceous chondrites, the closest match is found with stratospherically collected interplanetary dust particles. These findings are consistent with the notion that a fraction of interplanetary dust is of cometary origin. The presence of complex organic N-containing species in comets has astrobiological implications since comets are likely to have contributed to the prebiotic chemical inventory of both the Earth and Mars.

  16. Evolving Procurement Organizations

    DEFF Research Database (Denmark)

    Bals, Lydia; Laine, Jari; Mugurusi, Godfrey

    putting the structural elements in focus is derived from the analysis of two case companies, which extends the existing literature and opens new avenues for future research. The findings highlight the importance of taking a contingency perspective on procurement organization, understanding the internal......Procurement has to find further levers and advance its contribution to corporate goals continuously. This places pressure on its organization in order to facilitate its performance. Therefore, procurement organizations constantly have to evolve in order to match these demands. A conceptual model...

  17. Autopoiesis in Virtual Organizations


    Malgorzata PAMKOWSKA


    Virtual organizations continuously gain popularity because of the benefits created by them. Generally, they are defined as temporal adhocracies, project oriented, knowledge-based network organizations. The goal of this paper is to present the hypothesis that knowledge system developed by virtual organization is an autopoietic system. The term “autopoiesis†was introduced by Maturana for self-productive systems. In this paper, Wikipedia is described as an example of an autopoietic sys...

  18. Soil organic matter studies

    International Nuclear Information System (INIS)

    A total of 77 papers were presented and discussed during this symposium, 40 are included in Volume I. A number of papers deal with the behaviour and functions of organic matter and make a contribution to increasing agricultural production by proposing improved management practices. Other papers discuss turnover of plant residues, release of plant nutrients through biodegradation of organic compounds, and nitrogen economy and the dynamics of transformation of organic forms of nitrogen. Separate entries have been prepared for those 8 papers which discuss the use of tracer techniques in soil studies

  19. soil organic matter fractionation (United States)

    Osat, Maryam; Heidari, Ahmad


    Carbon is essential for plant growth, due to its effects on other soil properties like aggregation. Knowledge of dynamics of organic matter in different locations in the soil matrix can provide valuable information which affects carbon sequestration and soil the other soil properties. Extraction of soil organic matter (SOM) fractions has been a long standing approach to elucidating the roles of soil organic matter in soil processes. Several kind fractionation methods are used and all provide information on soil organic matter function. Physical fractionation capture the effects on SOM dynamics of the spatial arrangement of primary and secondary organomineral particles in soil while chemical fractionation can not consider the spatial arrangement but their organic fractions are suitable for advanced chemical characterization. Three method of physical separation of soil have been used, sieving, sedimentation and densitometry. The distribution of organic matter within physical fractions of the soil can be assessed by sieving. Sieving separates soil particles based strictly on size. The study area is located on north central Iran, between 35° 41'- 36° 01' N and 50° 42'- 51° 14' E. Mean annual precipitation about 243.8 mm and mean annual air temperature is about 14.95 °C. The soil moisture and temperature regime vary between aridic-thermic in lower altitudes to xeric-mesic in upper altitudes. More than 36 surface soil samples (0-20 cm) were collected according to land-use map units. After preliminary analyzing of samples 10 samples were selected for further analyses in five size fractions and three different time intervals in September, January and April 2008. Fractionation carried out by dry sieving in five classes, 1-2 mm, 0.5-1 mm, 270 μm-0.5mm, 53-270 μm and soil organic matter to humic acid and fulvic acid shows that there is a better correlation between humic acid contents and soil organic matter (R2 = 0.86) than fulvic acid and organic matter (R2=0.5). The

  20. Organizing Internet Resources

    Directory of Open Access Journals (Sweden)

    Hsueh-Hua Chen


    Full Text Available Many approaches have been taken by different groups to organize electronic resources on Internet. Some of them purport to index the electronic resources automatically. Search engines are typical in this category. Another category is the traditional library cataloging approach. For example, modified MARC formats are used to catalog the Internet resources. Besides these two, there are also some other ways to organize Internet resources, such as classification number schemes, subject heading systems, and other manual subject guides to provide a central access point for value-added topical guides. This paper introduces different approaches to organize Internet resources and focuses mainly on librarians' efforts.[Article content in Chinese