WorldWideScience

Sample records for una red sudamericana

  1. Ideas e intelectuales en la formación de una red sudamericana antifascista

    Adrián Celentano

    2006-01-01

    Full Text Available Presentar la experiencia del antifascismo intelectual es una forma de pensar el lazo entre cultura y política en la gran conflagración del siglo XX: la segunda guerra mundial. Desarrollamos aquí las prácticas de agrupamientos culturales que en Argentina, Chile, Uruguay y Brasil se inscribieron en ese combate de escala universal, así nos aproximamos a la forma que tomó la práctica de asociación intelectual mas importante después de la Reforma Universitaria. Reconstruimos aquí la experiencia de una red intelectual durante el período 1935-1943, la Asociación de Intelectuales, Artistas, Periodistas y Escritores (AIAPE, fundada en Argentina por Aníbal Ponce, junto a un conglomerado de intelectuales de izquierda, comunistas, liberales, socialistas y demócratas progresistas. Abordaremos la definición del trabajo intelectual propugnado por esa red y el enfoque de la situación política latinoamericana, la relación con el desarrollo del fascismo, el análisis de la cultura en Argentina, qué problemas, escritores, poetas y pintores se insertan en la red, cuáles son sus interlocutores. Estas son ejes que recorremos a través de sus revistas Unidad, Nueva Gaceta y otros emprendimientos como "Ediciones AIAPE" y "Cuadernos de AIAPE"Introducing the experience of intellectual antifascism is a way of thinking about the bond between culture and politics within the great construct of the 20th century: World War II. Here we develop the practice of cultural grouping where Argentina, Chile, Uruguay and Brazil joined this worldwide scale combat. This way, we get closer to the development of the most important practice of intellectual association ranked right below the University Reform. We rebuild the experience of an intellectual network during the 1935-1943 period, which is the Asociación de Intelectuales, Artistas, Periodistas y Escritores (AIAPE, founded in Argentina by Aníbal Ponce, together with a group of leftist intellectuals, communists

  2. El retorno de la geopolítica: una perspectiva sudamericana

    Rivarola Puntigliano, Andrés

    2013-01-01

    Un punto de partida de este trabajo es que hay una suerte de ‘retorno a la geografía’ en los estudios de Relaciones Internacionales (RI). Desde el realismo, el geopolítico estadounidense Robert Kaplan, habla de ‘la venganza de la geografía’, planteando la necesidad de volver a una comprensión del mundo que tome en cuenta los mapas. Según Kaplan, hay que reconocer la existencia de fuerzas que están más allá de nuestro control, limitando la acción humana. Esto lo lleva a lo que, “para los reali...

  3. Primera Red Sudamericana de Biomedicina: Investigación, educación y biotecnología aplicadas a la salud

    Marcelo J. Perone

    2013-02-01

    Full Text Available Se da a conocer la creación del primer programa de integración regional de una red de Institutos de Investigación en Biomedicina pertenecientes a países miembros del MERCOSUR. Se analizan las bases que dieron sustento a su creación y sus objetivos en el mediano y largo plazo. Además, se estima el potencial de los resultados de este programa en los campos de la investigación médica aplicada, educación y biotecnología.

  4. Compromiso y aporte de sanitarios europeos a la protección de la salud y a la causa de la independencia sudamericana. Una referencia a Venezuela

    Vannini De Gerulewicz, Marisa

    2010-01-01

    Desde comienzos del siglo XIX, contemporáneamente con el aparecer de los primeros movimientos independentistas, recrudeció en Venezuela la malaria o paludismo, considerada la más frecuente y devastadora endemia. Fuertes brotes de la enfermedad tuvieron lugar desde 1808 hasta 1811, propagándose de una región central (Valles de Aragua) hacia una oriental (Barcelona). La situación fue enfrentada particularmente por dos médicos europeos, uno formado en el Colegio de Medicina y Cirugía de Cádiz, o...

  5. Una red para la gente

    Raúl Trejo Delarbre

    2004-02-01

    Full Text Available La próxima Cumbre Mundial de la Sociedad de la Información ha revitalizado, en numerosos países, el debate acerca de las nuevas tecnologías de la comunicación y los usos que pueden tener. Lamentablemente en México hemos estado casi del todo ajenos a esa intensa, extensa y en otras latitudes fructífera discusión. Ni los especialistas interesados en estos temas, ni la sociedad que es a la postre beneficiaria o damnificada según sea el empleo de tales tecnologías, ni los organismos del Estado a cargo de tales asuntos, han propiciado la reflexión colectiva que nos podría permitir tanto afinar las posiciones de nuestro país rumbo a la cumbre de Ginebra y Túnez como deliberar, en ese contexto, acerca de lo mucho que nos falta para tener un país auténticamente imbricado en la construcción de una auténtica Sociedad de la Información.

  6. Proyectos de integración regional sudamericana: hacia una teoría de convergencia regional | South American regional integration projects. Towards a theory of regional convergence

    Gian Luca GARDINI

    2010-10-01

    Full Text Available Está surgiendo una nueva unidad regional, Sudamérica. En contraposición con Latinoamérica, es un concepto geoestratégico más definible e independiente. Pero, ¿esto hace que la integración regional sea más sencilla? Este artículo adopta una posición escéptica. No es solamente que Sudamérica se caracterice por sus numerosos esquemas de integración regional que compiten entre sí, sino que además los tres más destacados – Mercosur, ALBA y Unasur - presentan respuestas divergentes ante las preguntas fundamentales que han caracterizado históricamente los intentos de regionalismo en América Latina. Éstas son: la relación con la potencia líder en el plano internacional, Estados Unidos; el papel que juega el líder regional o paymaster, Brasil; y el modelo económico y de desarrollo que debe ser adoptado. A modo de conclusión, el autor conclusión propone una incipiente teoría de convergencia regional para alcanzar la cohesión regional como estímulo para futuras investigaciones y comprobaciones.A new regional unit - South America - is emerging. This is a more definable and self-contained geostrategic concept as opposed to Latin America. But does this make regional integration any easier? This article adopts a sceptical view. Not only South America is characterised by numerous and competing schemes of regional integration but the three most prominent of them, MERCOSUR, ALBA, and UNASUR offer divergent responses to the fundamental questions that have historically characterised attempts at regionalism in Latin America: The relation towards the international leading power, the United States; the role of the regional leader or paymaster, Brazil; and the economic and development model to be adopted. The conclusion proposes an infant theory of regional convergence to achieve regional cohesion as a suggestion for further research and testing.

  7. Desarrollo de una red inalámbrica en Bogarra

    León Manzano, Miguel

    2012-01-01

    Implementación de una red inalámbrica en una zona extensa de tipo rural, formada por una red de transporte y una red de puntos de acceso. En ella se utiliza una combinación de las tecnologías WiMAX y WiFi. Mientras que los usuarios pueden hacer uso de dos zonas de cobertura según estándares 802.11 y 802.16. Implementació d'una xarxa sense fils en una zona extensa de tipus rural, formada per una xarxa de transport i una xarxa de punts d'accés. En ella s'utilitza una combinació de les tecnol...

  8. Una red neuronal de expansión

    García Güemes, A.

    1998-01-01

    Full Text Available La red de expansión presentada por A. Hussain y otros (1997, presenta el problema del gran número de nodos de entrada que se generan a poco elevado que sea el número de variables explicativas. En esta comunicación, se presenta una nueva red, que tiene la ventaja de utilizar menos funciones de expansión, lo que permite introducir más variables explicativas. Se presentan las funciones con que se realiza la expansión. Se realiza una prueba con una serie temporal multivariante, utilizando esta nueva red de expansión con una capa oculta y la sigmoide simétrica como función de transferencia.

  9. Transición de una red no gestionada a una red segura basada en dispositivos gestionables

    Romero Díaz, Emilio José

    2013-01-01

    Este proyecto surge ante la necesidad de modernización de la infraestructura de comunicaciones del Instituto Andaluz para la Tercera Edad (IATE) de la Junta de Andalucía. El objeto del proyecto es buscar posibles mejoras a los problemas detectados en la red y la puesta en marcha de una gestión de las comunicaciones con una electrónica de red de altas prestaciones, con el fin de aumentar el rendimiento y seguridad de la red. El presente proyecto fin de carrera abarca todos los trabajos realiza...

  10. La red de monitoreo glacio-hidrologico de ORSTOM y de sus contrapartes en Bolivia, Peru y Ecuador : une herramienta para el estudio del recalentamiento global y de sus consecuencias en los tropicos

    Pouyaud, Bernard; Francou, Bernard; Ribstein, Pierre

    1995-01-01

    Desde hace algunos años, junto con sus contrapartes sudamericanas de Bolivia, Peru y Ecuador, ORSTOM mantiene una red de mediciones en algunos glaciares representativos de estos 3 paises. Los glaciares tropicales son, en efecto, objetos hidrologicos que integran particularmente bien los efectos de un cambio climatico. Es asi que los primeros resultados evidenciaron la influencia de los acontecimientos ENSO sobre la hidrologia glaciar, con efectos contrastados en la Cordillera Real de Bolivia ...

  11. Implantación de una red tranviaria en Valladolid

    García Morchón, Alberto

    2011-01-01

    El trabajo utiliza Sistemas de Información Geográfica para el diseño de una red de tranvía en la ciudad de Valladolid, usando análisis ráster para identificar las zonas de mayor demanda potencial y análisis redes para introducir los trazados finales.

  12. Red tecnoparque sena: una puerta tangible a la nanotecnologia

    Gaviria, Maria I.; Montoya, Carolina M.; Gutierrez, Johana A.

    2014-01-01

    La Red Tecnoparque es un programa de Innovación del Servicio Nacional de Aprendizaje-SENA que  permite a todos los Colombianos involucrarse de manera significativa en el desarrollo de proyectos en ciencia y  tecnología a través de la generación de prototipos con potencial innovador, soportados en diversas áreas del conocimiento incluyendo la nanotecnología; esta disciplina se está consolidando como una importante alternativa para el desarrollo y competitividad de los sectores productivos de n...

  13. Planificación y dimensionado de una red LTE

    Fernández López, Ignacio

    2014-01-01

    Metodología de diseño de una red LTE con la herramienta profesional ATOLL. [ANGLÈS] Long Term Evolution (LTE) is the latest broadband wireless technology, commercially referred to as a 4th generation mobile communication system (4G). It is the latest commercially available 3rd Generation Partnership Project (3GPP) standard for mobile networks. 3GPP previously developed GSM/GPRS/EDGE (2G) and UMTS/HSPA (3G), and later developed Long Term Evolution Advanced (LTE-A). Although LTE is commercia...

  14. Evaluar el funcionamiento de una red. La red de apoyo a la gestión educativa, RedAGE

    Gairín Sallán, Joaquín; Rodríguez-Gómez, David; Muñoz Moreno, José Luís

    2012-01-01

    La creación de redes interinstitucionales se vislumbra como una estrategia excelente para impulsar la investigación y la práctica de la gestión educativa en el contexto iberoamericano, como una de las disciplinas claves para la mejora educativa, ante la tendencia descentralizadora de los sistemas educativos, la extensión de la participación en los centros educativos y la complejidad inherente al fenómeno educativo. La presente aportación presenta el diseño de evaluación de la Red de Apoyo a l...

  15. Diseño e implantación de una red multiservicios de comunicaciones para una entidad financiera

    Sáez Hernández, Ricardo

    2011-01-01

    En este proyecto nos centramos en el estudio concreto de una empresa cliente que realiza una migración de su sistema de telefonía tradicional analógica hacia una convergencia entre la nueva red de telefonía IP que se implementará y su red de datos actual. Analizaremos la situación inicial del cliente, sus motivaciones de cambio, recogeremos las especificaciones particulares y diseñaremos y presentaremos una solución. Este documento contiene los resultados obtenidos al realizar ...

  16. Una experiencia educativa: conocemos la red Natura 2000

    Marta Vázquez Torre

    2009-11-01

    Full Text Available En la actualidad es necesaria una conciencia medioambiental para tratar de prevenir los daños que continuamente sufre nuestra Naturaleza. Con este proyecto educativo se pretende que niños y niñas valoren aquello que los rodea, lo cual les ayudará a respetarlo, cuidarlo y protegerlo. En él se da a conocer a discentes de 3º ciclo de Primaria un programa de protección del medio natural, ciertos hábitats y seres vivos, los de la Red Natura 2000. Nos centramos en los espacios protegidos por esta iniciativa en O Salnés, lugar en donde se ejecutó el citado proyecto.

  17. La inmigración sudamericana en Italia: Efectos sobre el mercado de trabajo Southamerican Migration in Italy: Labour Market Effects

    María Andrea Grasso

    2010-05-01

    Full Text Available Las migraciones sudamericanas no son las más numerosas ni las más preocupantes para el gobierno italiano y, quizás por ese motivo, no son las más estudiadas. Sin embargo, desde la década de 1970, las economías sudamericanas, en su mayoría, pasaron de ser receptoras de inmigrantes a expulsoras de su propia fuerza de trabajo, siendo Italia uno de los principales destinos elegidos. En qué trabajan los inmigrantes sudamericanos, cómo y en qué contribuyen a la economía italiana es uno de los interrogantes que busca elucidar este trabajo. El disparador para desarrollarlo fue un afiche de la campaña de gobierno del 2008 de la Liga Nord. En la gráfica se veía un indio Sioux y el texto rezaba: "ellos sufrieron la inmigración primero", haciendo alusión a los efectos negativos de la inmigración. Fue mi interés analizar estos efectos en lo económico y en lo social, restringiéndolo a la población de nuestro subcontinente. El artículo se basa en una experiencia personal de un año de residencia en el país como investigadora, trabajadora flexibilizada, italiana de segunda generación y partícipe de una red de contactos informales que movilizaron este análisis. Se identifica la coexistencia de una división del mercado laboral mediante una complementariedad de trabajos utilizando diferentes formas de acceso, trayectorias, y características en general. Para el segmento que ocupan los nativos se imponen barreras explícitas o no, que se traducen en exclusión. Éstas, se configuran en función de una tipificación que se hace del "otro", en particular los inmigrantes, como no apto, incapaz de realizar esa tarea, o poco "presentable".South American are neither the most numerous nor preoccupant migrations for the Italian government. Maybe that is the reason why they are not the most studied ones. However, since the seventy decade, South American economies- one day mainly receptives of inmigrants-, turned into emigration countries, being

  18. Monitoreo del estado de una red HFC utilizando datos reportados por cable módems

    Andrés Escobar Mejía

    2007-01-01

    Full Text Available Una red de telecomunicaciones por cable que combina la fibra óptica y el cable coaxial como soporte de la distribución de las señales es llamada Red HFC (Hybrid Fibre Coaxial, dicha red es empleada para ofrecer servicios de Banda Ancha. Este artículo trata sobre un sistema de monitoreo en una red HFC, que permitirá estimar la ubicación de fallas en la red troncal y de distribución, mediante la recopilación de información de fallas en los terminales, instalados en los clientes llamados Cable Módems.

  19. Implementación de una red neural para estilos cognitivos y de aprendizaje: implicaciones educativas

    Víctor Manuel Padilla Montemayor; Ernesto Octavio López Ramírez

    2006-01-01

    Se obtuvieron los indicadores de estilos cognitivo y de aprendizaje de 67 estudiantes universitarios con el propósito de entrenar una red neural de propagación hacia atrás que predijera dichos estilos. Se aplicaron cinco inventarios de estilos cognitivos y de aprendizaje para analizar si la red neural podía convergir en una solución única. La información obtenida se utilizó para alimentar una red neural de tres capas de procesamiento con diferente cantidad de neuronas. Se en...

  20. La trata de persona en la agenda políca sudamericana sobre migraciones: la securitización del debate migratorio

    Magliano, María José; Clavijo, Janneth

    2011-01-01

    Este trabajo procura poner en discusión, desde una perspectiva crítica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda política sobre migraciones en la región sudamericana, y las implicancias políticas e ideológicas de esa incorporación. Partimos del supuesto que las formas de concebir a la trata de personas en la esfera política migratoria regional no se alejan de los postulados de control y seguridad que subyacen a la construcción de esa agenda, reconfiguran...

  1. La trata de personas en la agenda política sudamericana sobre migraciones: la securitización del debate migratorio

    Magliano, María José; Clavijo, Janneth

    2011-01-01

    Este trabajo procura poner en discusión, desde una perspectiva crítica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda política sobre migraciones en la región sudamericana, y las implicancias políticas e ideológicas de esa incorporación. Partimos del supuesto que las formas de concebir la trata de personas en la esfera política migratoria regional no se aleja de los postulados de control y seguridad que subyacen a la construcción de esa agenda, reconfigurando ...

  2. Una universidad que aprende: formación y evaluación docente en red

    Chacón Ramírez, Silvia; Badilla Saxe, Eleonora; Francis Salazar, Susan

    2012-01-01

    Resumen: El presente artículo ofrece, por parte de su Comité Ejecutivo una sistematización sobre la evolución de la Red Institucional de Formación y Evaluación Docente (RIFED). Esta Red es una iniciativa de la Vicerrectoría de Docencia de la Universidad de Costa Rica que ha sido conceptualizada y desarrollada con el fin de apoyar al profesorado universitario para que asuma una nueva mirada a la docencia universitaria en el siglo XXI. Se ofrece un marco contextual y conceptual que intenta resp...

  3. Desarrollo de una red social de consumo colaborativo

    Fernández Roca, Alfonso

    2013-01-01

    Este proyecto consiste en el desarrollo de una plataforma de consumo colaborativo enfocada al mundo universitario. La plataforma utiliza servicios de geolocalización para ubicar a los usuarios y los artículos. Se ha desarrollado una interfaz multidispositivo mediante Responsive Design y se ha desplegado toda la infraestructura del servidor sobre servicios en la nube, en este caso, Amazon Web Services. Como ejercicio práctico se han utilizado diversos frameworks y librerías t...

  4. Desarrollo de una red social para el aprendizaje

    Cumbreras Tirado, Edgar

    2015-01-01

    En este trabajo de fin de grado se ha desarrollado una plataforma online que promociona y promueve el aprendizaje de nuevas tecnologías. La plataforma ha sido enteramente creada haciendo uso de JavaScript, con tecnologías como Node.js y Angular.js. En aquest treball de fi de grau s'ha desenvolupat una plataforma online que promociona i promou l'aprenentatge de noves tecnologies. La plataforma ha estat enterament creada fent ús de JavaScript, amb tecnologies com Node.js i Angular.js. Bac...

  5. Planificación y dimensionado de una red LTE

    Zamora López, Albert

    2015-01-01

    Objectius d'aprenentatge: Coneixement en detall de la tecnologia d'accés LTE Coneixement pràctic i detallat de la eina de drive test Qualipoc i una eina de post-processat de mesures (ROMES o NETQUAL) Adquisició d'experiència en la determinació, recollida i anàlisi de mesures i indicadors (KPIs) per caracteritzar el funcionament d'una xarxa mòbil amb eines de drive tests Long Term Evolution (LTE) is the most recent technology, commercially referred to as a 4th generation mobile communicatio...

  6. Internet: ¿una red para capturar rehenes?

    Dr. Raymond Colle

    2002-01-01

    Full Text Available En el año 2000 y durante el 2001, Microsoft ha hecho noticia especialmente en función de los juicios que se le siguen en Estados Unidos y Europa por prácticas monopólicas. Pero, al revisar las noticias, también encontramos muchos datos que revelan una importante política expansionista y tendencia a explotar cada vez más a sus clientes. No repasaremos aquí lo ocurrido con los juicios, pero sí nos proponemos poner en evidencia como un empresa cuyo poder descansa en la presencia de su sistema operativo en millones de ordenadores personales ha ido expandiendo sus pretensiones y desarrollado una estrategia que pretende llegar a un control casi absoluto de Internet y de sus usuarios.

  7. Uso de GPUs en la administración del rendimiento de una red de computadoras

    Barrionuevo, Mercedes; Lopresti, Mariela; Miranda, Natalia; Piccoli, María Fabiana

    2014-01-01

    Este trabajo presenta las líneas de trabajo a seguir para lograr una buena administración de una red utilizando Computación de Alto Desempeño en GPU. Los problemas a tratar considerando dicho objetivo están relacionados al análisis de tráfico de redes y al tratamiento de datos masivos.

  8. Proyecto de despliegue de una red inalámbrica para el acceso gratuito a Internet

    Ramos Gisbert, Carlos

    2014-01-01

    Creación de una red que ofrece cobertura inalámbrica a diferentes áreas geográficamente dispersas, utilizando tecnología WiMAX y Wi-Fi. Creació d'una xarxa que ofereix cobertura sense fil a diferents àrees geogràficament disperses, utilitzant tecnologia WiMAX i Wi-Fi. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  9. Conservación y Manejo de Humedales Costeros de la Comuna de Coquimbo, Chile: experiencias y aprendizajes de un modelo de intervención en la Costa Pacífico Sudamericana

    Luna Quevedo, D.; Tabilo Valdivieso, E.; Tabilo Valdivieso, L.

    2006-01-01

    El Sistema de Humedales Costeros de la Comuna de Coquimbo configura una zona clave para la Costa Pacífico Sudamericana, albergando zonas húmedas de singular biodiversidad que cumplen una importante función como lugar de descanso y alimentación para numerosas especies, siendo destacadas como áreas de invernada de aves migratorias neotropicales. La importancia individual de los humedales de esta zona de Chile, y de su recurso hídrico asociado, se incrementa si se considera que son part...

  10. Gestión de dispositivos integrados en una Arquitectura de la Red de las Cosas

    Andrés Espinal, Lidia

    2015-01-01

    La Arquitectura de la Red de las Cosas (IoT) hace referencia a una red de objetos cotidianos interconectados digitalmente. Gracias a IoT, no sólo podemos almacenar, analizar e intercambiar información y datos con dichos objetos, sino que además ellos pueden tener la capacidad de interactuar entre ellos de forma autónoma. Para ellos, los objetos cotidianos disponen de actuadores y sensores que permiten modificar su comportamiento y conocer su estado y propiedades, respectivamente. La gestió...

  11. Control y Monitorización de Plantas Mediante Una Red CAN

    Yong Qiang Zhen, Yu

    2011-01-01

    Castellano: Proyecto de final de carrera de la Ingeniería Técnica en Sistemas Informmáticos, tiene como objetivo la implantación de un sistema informático de control y monitorización de una red CAN. Está basado en las especificaciones del protocolo CAN para la implantación de la red y, en las tecnologías de la información para el sistema informático de control y monitorización, extendiendo su uso, a través de internet.

  12. Uso de una red inalámbrica de sensores para estimar riesgo de incendio

    Campo Vos, Cristian

    2015-01-01

    Una red inalámbrica de sensores (Wireless Sensor Network, WSN) constituye un sistema de comunicación de datos flexible utilizado como alternativa a las redes cableadas o como extensión de éstas y está compuesta por elementos de cómputo, medición y comunicación, que permiten al administrador instrumentar, observar y reaccionar a eventos y fenómenos en un ambiente específico. Una de las aplicaciones de estas redes es su uso en sistemas de predicción y prevención de incendios en áreas n...

  13. Contribuciones al establecimiento de una red global de sensores inalámbricos interconectados

    Sosa, Eduardo Omar

    2011-01-01

    El objetivo práctico de este trabajo es el desarrollo, prueba, configuración y puesta en marcha de una infraestructura de red de sensores inalámbricos. Esta infraestructura a nivel piloto, debería ser utilizada en primer lugar para fines de investigación, apuntando a una visión interdisciplinaria que abarca los aspectos del hardware, software, algoritmos y datos. Se pretende demostrar que la heterogeneidad de dispositivos de pequeñas dimensiones y instalaciones piloto (testbeds) existentes...

  14. Microsatélites, distancias genéticas y estructura de poblaciones nativas sudamericanas

    Demarchi, Darío Alfredo

    2009-01-01

    Full Text Available En este trabajo se investigaron las relaciones genéticas entre 17 poblaciones nativas sudamericanas en relación a 15 microsatélites (STRs autosómicos, utilizando 3 distancias genéticas- DST, DAy (δu2-que se ajustan a diferentes postulados teóricos. A través de diferentes técnicas de análisis (escalamiento multidimensional, correlación y correlación parcial de matrices se puso a prueba si las distancias genéticas reflejaban las relaciones interpoblacionales esperadas a partir de la distribución geográfica o de relaciones lingüísticas entre las poblaciones. Además, se estimó en que grado las distintas medidas de distancias genéticas eran influenciadas por la diversidad (He de cada población. Los mapas genéticos muestran, principalmente para DST y DA, que las poblaciones aisladas y con bajo tamaño efectivo (Ne aparecen como outliers, mientras que las poblaciones con alto Ne y mayor flujo génico ocupan una posición central a bajos valores de distancia unas de otras y sin un patrón definido de agrupamiento. La falta de asociación entre distancias genéticas y lingüísticas o geográficas y por otra parte, la alta correlación negativa entre He y distancias génicas promedio por población confiman ese patrón, demostrando que la mayor parte de la variación interpoblacional puede ser explicada en función del grado de diversidad intrapoblacional. Es decir, las distancias genéticas no reflejan relaciones filogenéticas, lingüísticas o geográficas, sino más bien eventos demográficos recientes tales como cuellos de botella genético, efecto fundador o migración externa masiva. Este hecho puede ser comprobado por medio de otra metodología analítica, el modelo de Harpending y Ward.

  15. La trata de persona en la agenda políca sudamericana sobre migraciones: La securitización del debate migratorio Human trafficking in the sout american migratory legal agenda: Securitization of the migratory debate.

    María José Magliano; Janneth Clavijo

    2011-01-01

    Este trabajo procura poner en discusión, desde una perspectiva crítica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda política sobre migraciones en la región sudamericana, y las implicancias políticas e ideológicas de esa incorporación. Partimos del supuesto que las formas de concebir a la trata de personas en la esfera política migratoria regional no se alejan de los postulados de control y seguridad que subyacen a la construcción de esa agenda, reconfiguran...

  16. Propuesta de arquitectura para una Red Móvil de Nueva Generación

    Omaira Parada

    2006-01-01

    Full Text Available El paradigma actual de las comunicaciones espera que un usuario sea capaz de acceder a sus servicios independientemente de su localización de una manera transparente. La terminal del usuario podría ser capaz de elegir la mejor tecnología de acceso (Ad hoc, Ethernet, Celulares, etc. en su ubicación actual y utilizar esta tecnología de una manera transparente para la provisión del servicio deseado. Esta homogeneidad, alta velocidad, seguridad, multi-servicio, redes multi-operador, está siendo desarrollada en el contexto de las redes de nueva generación. Actualmente, se están desplegando los sistemas móviles de tercera generación (3G y la comunidad investigadora está empezando a definir una arquitectura para las redes de cuarta generación (4G. La principal característica de diseño de las redes de 4G, es la integración de la tecnología IP dentro de las redes móviles celulares con el objetivo de construir una red All-IP. Este artículo presenta el estado del arte de las redes móviles y propone una arquitectura escalable para las redes móviles de nueva generación

  17. Una universidad que aprende: formación y evaluación docente en red

    Chacón Ramírez, Silvia

    2012-02-01

    Full Text Available Resumen: El presente artículo ofrece, por parte de su Comité Ejecutivo una sistematización sobre la evolución de la Red Institucional de Formación y Evaluación Docente (RIFED. Esta Red es una iniciativa de la Vicerrectoría de Docencia de la Universidad de Costa Rica que ha sido conceptualizada y desarrollada con el fin de apoyar al profesorado universitario para que asuma una nueva mirada a la docencia universitaria en el siglo XXI. Se ofrece un marco contextual y conceptual que intenta responder las interrogantes: ¿por qué una red y no un centro? ¿Para qué evaluar en la UCR? ¿Para qué formar al personal docente la UCR? Entre los logros de la sistematización, se destaca la ruta de aprendizaje de RIFED, una reconceptualización de funciones, así como de los términos formación y evaluación, para finalmente ofrecer una visión prospectiva para RIFED, bajo el título ¿Cómo se mira RIFED en el horizonte?Abstract: This article presents, by its Executive Committee, a systematization of the Institutional Network for Higher Teacher Education and Evaluation RIFED, at the University of Costa Rica UCR, an initiative that is part of the Academic VicePresident´s office. RIFED has been conceptualized and implemented with the objective of supporting faculty on assuming a new vision on Higher Education Teaching and Evaluation, relevant to the XXI Century. A conceptual framework aims to answer these questions: Why a network instead of a Center? Why evaluate faculty at UCR? Why educate faculty at UCR? Amongst RIFED´s learning path some of its achievements are highlighted: a re-conceptualization of its functions as well as of the terms education and evaluation. Finally it offers a prospective vision of RIFED under the sub-title: How does RIFED appear in the Horizon?

  18. Una experiencia en formación inicial del profesorado utilizando la red social ELGG

    Francisco Javier Álvarez Lires

    2015-01-01

    Full Text Available Una experiencia de investigación-innovación educativa en forma- ción inicial del profesorado de Grados universitarios en Educación In- fantil, Primaria y Máster de Educación Secundaria y Formación Profe- sional, sobre las posibilidades que ofrece la red social de comunidad de aprendizaje ELGG, utilizando una metodología docente focalizada en el alumnado, hacia un aprendizaje colaborativo y cooperativo. Los resulta - dos muestran amplia participación, percepción de beneficios de aprendi - zaje, por parte del alumnado, coordinación entre docentes de áreas dife - rentes y cumplimiento de objetivos en cuanto a promoción de espacios y formas de aprendizaje que rompen con modelos tradicionales aprove - chando las posibilidades educativas de las TIC.

  19. Redescription of some South American species of Belonuchus (Coleoptera: Staphylinidae, with a checklist of the southern South American species of the genus Redescripción de algunas especies sudamericanas de Belonuchus (Coleoptera: Staphylinidae, con una lista de las especies del género del sur de América del Sur

    Mariana Chani-Posse

    2011-12-01

    Full Text Available Six species of Belonuchus Nordmann, 1837 from South America are redescribed and illustrated: B. aluticollis (Bernhauer, 1921, B. castaneus Chani-Posse, 2006, B. flavicoxis (Bernhauer, 1912, B. multipunctatus (Coiffait, 1981, B. richteri (Bernhauer, 1912 and B. weiserianus (Bernhauer, 1921. A checklist of the 23 species of Belonuchus currently known from southern South America is appended. A lectotype is designated for B. richteri Bernhauer, 1922.Seis especies de Belonuchus Nordmann, 1837, de América del Sur se redescriben e ilustran: B. aluticollis (Bernhauer, 1921, B. castaneus Chani-Posse 2006, B. flavicoxis (Bernhauer, 1912, B. multipunctatus (Coiffait, 1981, B. richteri (Bernhauer, 1912 y B. weiserianus (Bernhauer, 1921. Se provee una lista de las 23 especies actualmente conocidas del sur de América del Sur. Se designa el lectotipo de B. richteri Bernhauer, 1922.

  20. Efecto del desprendimiento de las biopelículas formadas en una red de acueducto sobre la calidad del agua

    Juan Camilo Rueda Ariza; Aida Juliana Martínez; Diana Carolina Calvo

    2013-01-01

    El objetivo de esta investigación fue determinar el efecto del desprendimiento de las biopelículas formadas en una red de distribución de agua potable sobre la calidad del agua que llega a los hogares, ya que esta puede afectar la calidad de vida y la salud de las personas. Se realizaron análisis de pH, turbiedad, concentración de metales y microbiológicos en una red de acueducto para evaluar el efecto de las biopelículas sobre la calidad del agua, encontrando altos niveles de aluminio y de m...

  1. Diseño e implementación de una red de comunicaciones entre subestaciones eléctricas

    Margarit Villarrubia, Albert; Romero Espín, Alberto

    2009-01-01

    El propósito de este proyecto es el diseño y la implementación de una red de comunicaciones entre nueve subestaciones eléctricas. Antes de adentrarnos en el diseño de la red tendremos que conocer la estructura de la red eléctrica además de los elementos más importantes que la componen. Asimismo profundizaremos en las tecnologías existentes de comunicación entre subestaciones que se utilizan actualmente (SDH, PDH, PLC, etc.), describiendo sus características e incluyendo las ...

  2. Hewlett-Packard trabaja en un proyecto de almacenamiento de informacion En ruta una red de impacto mundial

    Matias, W I

    2004-01-01

    "...La compania invertira $5 millones en la planta de Aguadilla, para producir parte de la infraestructura que formara esta primera red de computacion mundial, la cual solucionara los problemas actuales de transmision de informacion en asuntos cientificos. El proyecto surge como parte de una alianza con la CERN" (1 page)

  3. El programa ConRed, una práctica basada en la evidencia

    Rosario del Rey Alamillo

    2012-10-01

    Full Text Available La vertiginosa incorporación de las TIC a la sociedad y los consecuentes riesgos a los que los menores se enfrentan en Internet y las redes sociales han dejado en evidencia la necesidad de incorporar en el currículum escolar el dominio de los entornos virtuales. En cambio, son escasas las iniciativas en esta dirección y más aún programas rigurosamente evaluados, de modo que sirvan de fundamento para el diseño de las líneas de acción educativa. El programa ConRed está basado en la teoría del comportamiento social normativo y persigue los objetivos de mejorar y reducir problemas como el cyberbullying, la dependencia a Internet y la desajustada percepción del control de la información en las redes sociales, para así potenciar el uso beneficioso de éstas. La evaluación del ConRed se ha desarrollado mediante una metodología cuasi experimental, con un grupo experimental (N=595 y uno cuasi-control (N=298. Del total de los 893 estudiantes, el 45,9% eran chicas y la edad media 13,80 años (DT=1,47. Los resultados positivos de reducción de problemas en el grupo experimental y la ausencia de cambio en el grupo control son muestra de su validez y demuestran que trabajando con toda la comunidad educativa y en colaboración con ella es posible mejorar la calidad de la vida virtual y, por tanto, real de los adolescentes.

  4. La prueba PISA: una mirada alternativa desde la Teoría del Actor-Red

    Paola Paredes Suzarte

    2015-07-01

    Full Text Available En el marco de la proliferación de las evaluaciones estandarizadas, inscritas en lo que ha sido conceptualizado por la literatura como políticas de accountability o de rendición de cuentas, se ofrece por medio de este artículo una línea de pensamiento y discusión alternativa sobre la prueba PISA. Utilizando como enfoque la Teoría del Actor-Red (TAR de Bruno Latour, se presentan ejercicios de traslación epistémica de la prueba PISA desde un modelo de pensamiento positivista moderno, a uno materialista pragmático en el que se privilegia una descripción constructivista y analítica de los componentes que la constituyen. En base al seguimiento y análisis de noticias sobre la prueba PISA desplegadas en diarios electrónicos en Chile y Argentina, más la revisión de fuentes secundarias, se exponen algunas de las controversias suscitadas en torno a la evaluación y se discute sobre su posible impacto en nuestras percepciones sobre educación y calidad. También se problematiza el carácter neutral y objetivo de la prueba, y se levanta la pregunta acerca de su posible agencia en la cristalización de las relaciones de centro-periferia entre países que, en el marco del enfoque de la TAR, tiene sentido explorar. 

  5. Inestabilidad del desarrollo en estructuras craneofaciales de poblaciones humanas sudamericanas

    Lotto, Federico P.

    2013-12-01

    Full Text Available Diversos factores genéticos y ambientales pueden actuar sobre los mecanismos que amortiguan el efecto de perturbaciones aleatorias durante el desarrollo, resultando en un aumento de la inestabilidad del desarrollo (ID y de la variación a nivel individual. El objetivo de este trabajo es analizar el grado y el patrón de asimetría fluctuante (AF en el cráneo, como una medida de ID, en poblaciones con distinto tipo de subsistencia. Asimismo, se evalúa la existencia de diferencias entre la base, la bóveda y el esqueleto facial. Se relevaron landmarks tridimensionales sagitales y bilaterales en 109 cráneos de Chubut, San Juan y SO de Pampa. El método de Superposición Procrustes Generalizado fue usado para extraer los componentes simétrico y asimétrico de la forma. Los análisis preliminares indicaron que el error de medición y la asimetría direccional dan cuenta de un porcentaje reducido de la variación total, mientras que la AF explica entre el 10 y el 15% de la misma. La magnitud de AF –estimada como la distancia Procrustes entre las configuraciones originales y sus imágenes reflejadas– de la bóveda y la región facial resultó mayor en San Juan, mientras que la base no presentó diferencias entre las muestras. Los patrones de forma del componente asimétrico indican que la muestra de Chubut se diferencia en la base y la cara, mientras que la de San Juan se diferencia en la bóveda. En resumen, los resultados obtenidos sugieren variación modular en la ID del cráneo y diferencias entre las muestras analizadas.

  6. Guía práctica para participar activamente en una red social y educativa digital

    Jubany i Vila, Jordi

    2009-01-01

    La web 2.0. nos permite utilizar todo tipo de herramientas digitales de manera más intuitiva y participativa. Herramientas y entornos como la red social nos ayudan a la comunicación personal, el intercambio de informaciones y la construcción de conocimiento. Cómo nos registramos en una? Vemos el ejemplo de la red social con finalidad educativa Didáctica y Multimedia - DIM Aplicamos las TIC en educación. Y veamos también unos consejos para conocer cómo funciona este entorno digital y las herra...

  7. DIAGNÓSTICO Y PROPUESTA PARA UNA GESTIÓN INTEGRAL DEL RIESGO EN EL VALLE DE ABURRA: RED RIESGOS

    ARISTIZÁBAL EDIER; VARGAS RICHARD

    2010-01-01

    A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gest...

  8. Implementación de QoS en la parte de acceso WLAN en una red 4G

    Rodelas Delgado, Miguel Ángel

    2007-01-01

    En la actualidad están apareciendo en el mercado un gran número de terminales que implementan varias interfaces de diferentes tecnologías radio, tales como 3G y WLAN, entre otras. Sin embargo, el escenario de las telecomunicaciones presenta hoy en día una topología muy compleja a la vista del usuario. Resulta interesante pensar en una nueva infraestructura más flexible, en la que no existan fronteras entre redes heterogéneas, aprovechando las ventajas y características de cada red que se encu...

  9. Las competencias del bibliotecario en una red de bibliotecas escolares para el estado de Santa Catarina, Brasil

    Garcéz, Eliane Fioravante; Vieira Da Cunha, Miriam

    2015-01-01

    A partir de un trabajo que resultó de la aprobación, en 2010, de una Ley Federal brasileña que obliga todas las escuelas a tener una biblioteca, los bibliotecarios del estado de Santa Catarina crearan un modelo de gestión para atender las bibliotecas escolares de la red pública. A partir de ese modelo ese artículo busca ampliar la discusión sobre el rol del bibliotecario con la perspectiva de la apertura y de la aumentación de puestos de trabajo en las escuelas brasileñas. Este cuadro nos lle...

  10. Programación y reprogramación energética de una micro-red aislada en una estrategia de control por horizonte deslizante

    Marietta Sciara, Pablo Martín

    2014-01-01

    Premi al millor Projecte de Fi de Carrera presentat durant l'any 2014 en l'àmbit d'Optimització de Recursos que atorga DOW CHEMICAL IBÉRICA En este proyecto se propone el diseño y construcción de un software para el control energético de una micro-red eléctrica que opera de forma aislada de la red de distribución principal. El software propuesto se integra físicamente a un Sistema Centralizado de Gestión de la Energía (SCGE) desde el cual se administra la generación y la demanda energética...

  11. Música en el cine: Una propuesta de trabajo cooperativo en base a una red social educativa en un curso de 4º de la E.S.O

    Nidia Fernández Varela

    2011-01-01

    Full Text Available El proyecto que se describirá a continuación se llevó a cabo con alumnos de cuarto de la E.S.O. del Colegio Ártica del PAU de Carabanchel, sito en la C.C.A.A de Madrid en el año 2010. En este artículo se expondrá el trabajo realizado sobre un tema en concreto del currículum oficial de 4º de la ESO en el aula de música que fue trabajado en grupos cooperativos utilizando una red social. Así mismo, se puntualizarán los objetivos que guiaron la acción, se hará una breve descripción de las herramientas utilizadas, se comentarán las ventajas y desventajas observadas y finalmente se ofrecerán las conclusiones pertinentes.

  12. Música en el cine: Una propuesta de trabajo cooperativo en base a una red social educativa en un curso de 4º de la E.S.O

    Nidia Fernández Varela

    2011-01-01

    El proyecto que se describirá a continuación se llevó a cabo con alumnos de cuarto de la E.S.O. del Colegio Ártica del PAU de Carabanchel, sito en la C.C.A.A de Madrid en el año 2010. En este artículo se expondrá el trabajo realizado sobre un tema en concreto del currículum oficial de 4º de la ESO en el aula de música que fue trabajado en grupos cooperativos utilizando una red social. Así mismo, se puntualizarán los objetivos que guiaron la acción, se hará una breve descripción de las herrami...

  13. Alfabetización para una cultura social, digital, mediática y en red

    González Fernández-Villavicencio, Nieves

    2012-07-01

    Full Text Available Technologies are changing the concept of literacy and of the basic skills necessary to be considered literate in a digital and networked culture. New critical, technological and social skills redefine the need to be literate and, as such, for information literacy. This requires a new term, such as Digital Literacy, in order to include the new skills and to focus more on the training of individuals rather than on the professional groups involved in the training. Several examples are presented, both within our country and beyond, of initiatives undertaken by libraries in digital literacy and in the generation of local digital content.

    Las tecnologías están cambiando el concepto de alfabetización y las competencias básicas necesarias para considerarse alfabetizado en una cultura digital y en red. Nuevas competencias mediáticas, críticas, tecnológicas, sociales, vienen a redefinir la propia necesidad de estar alfabetizado y por ende, en información, hasta el punto de exigir un término como Alfabetización digital, que aglutine las nuevas competencias, y centre más su objetivo en la formación que necesitan los individuos y menos en los colectivos profesionales implicados en esa formación. Se presentan diversos ejemplos, dentro y fuera de nuestro país, de iniciativas llevadas a cabo preferentemente por bibliotecas, en los campos de la alfabetización digital y la generación de contenidos digitales locales.

  14. Dimensionamiento de una red DVB-S2/DVB-RCS2 basado en un sistema O3b

    El Mesbahi El Bakkali, Nora

    2015-01-01

    El primer objetivo de este trabajo es realizar una comparación de las prestaciones de un nuevo sistema de comunicaciones llamado O3b y el resto de sistemas convencionales. Esta comparación se hará según una serie de parámetros: la altura de los satélites, la banda de frecuencia usada, la latencia de los enlaces, la potencia transmitida y las pérdidas de propagación de la señal. El segundo propósito del trabajo es el dimensionado de una red que use los estándares abiertos de comunicación po...

  15. DIAGNÓSTICO Y PROPUESTA PARA UNA GESTIÓN INTEGRAL DEL RIESGO EN EL VALLE DE ABURRA: RED RIESGOS

    ARISTIZÁBAL EDIER

    2010-05-01

    Full Text Available A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gestión del Riesgo en el Valle de Aburrá, Red Riesgos. Red Riesgos es un sistema organizacional abierto de carácter interinstitucional para orientar y coordinar las políticas y acciones de análisis y reducción de riesgos, preparación y ejecución de la respuesta y recuperación en casos de desastre y emergencias en el Valle de Aburrá. Como instrumento estratégico de la Red, se formuló el Plan Regional para la Gestión del Riesgo en el Valle de Aburrá que contiene las acciones que se deben ejecutar para la reducción de desastres y el manejo óptimo de los mismos y se diseñó el Sistema Integrado de Información para dar soporte a los diferentes procesos de gestión de la Red.

  16. Política social focalizada y construcción de una red social. Lecciones de la experiencia argentina

    Alejandro del Valle

    2008-01-01

    Full Text Available Aquí se analiza la evolución y las características que posee la política social en Argentina desde el proceso de reforma hasta la actualidad. Para ello se analizan las principales transformaciones que se produjeron durante el periodo de reformas estructurales. Se describe la estructura y evolución del gasto social y del gasto social focalizado, así como los principales programas focalizados que se desenvolvieron desde el inicio del proceso de reformas hasta la actualidad. Concluimos con una serie de reflexiones sobre las características que posee el régimen de bienestar y los límites para el desarrollo de una red universal de protección social que hoy resulta insuficiente para garantizar una ciudadanía plena ya que su evolución se encuentra determinada, precisamente, por la evolución del ciclo económico. Palabras clave: focalización, política social, red social, gasto social.

  17. Los Guardianes de Semillas : una red de agroecología

    Oliver Torres

    2013-09-01

    Full Text Available Fundada en noviembre del 2002, la Red de Guardianes de Semillas arrancó con el esfuerzo de un pequeño grupo de productores orgánicos del valle de Tumbaco, en el Ecuador. Desde entonces, la Red ha crecido incluyendo miembros de la costa, la sierra, el oriente del Ecuador y del sur de Colombia.

  18. Diseño e implementación de una red social para animales de compañía

    MIFSUD MENGUAL, DAVID

    2015-01-01

    [ES] El siguiente Proyecto consiste en desarrollar una red social con la temática de los animales de compañía, centrándose en las funciones de comunicación entre usuarios mediante el uso de publicaciones y mensajes. Se ha usado como lenguaje de programación PHP, HTML, CSS y AJAX. Algunas de las funciones de las que está dotada la red social son: solicitud de amistad, notificaciones, mensajes y publicaciones. Mifsud Mengual, D. (2015). Diseño e implementación de una red social p...

  19. Inequidades en la atención odontológica en una red de salud en cali, colombia

    Rengifo-Reina, Herney A.; Corchuelo-Ojeda, Jairo

    2013-01-01

    Objetivo Evaluar la presencia de inequidades en la atención odontológica en una red de salud en Cali–Colombia.Materiales y Métodos Se realizó un estudio descriptivo retrospectivo. La zona de estudio fue el área de influencia de la red de servicios de salud más grande de Cali (cerca  del 70 % de la extensión geográfica de Cali);  La población de estudio fue la población pobre vulnerable distribuida en población asegurada y No asegurada. Se realizó un análisis tipo sobrevida para determinar las...

  20. Educar en Internet : una propuesta para la construcción democrática de la red

    Rodríguez Prieto, Rafael

    2013-01-01

    Internet puede ser un lugar oscuro y peligroso o una herramienta brillante y educativa para niños y adolescentes. A menudo consideramos que podemos medir sus peligros –la propaganda racista, la pornografía, el acoso cibernético o el chantaje sexual–. No obstante, deberíamos ir más allá las amenazas o de perspectivas idealistas sobre Internet. Necesitamos mejorar nuestro conocimiento sobre Internet. Deberíamos estimular un debate público sobre el futuro de la red. Las admi...

  1. Aspectos clínicos de la Blastomicosis sudamericana (Paracoccidioidomicosis en el Perú

    Zuño Burstein Alva

    2002-01-01

    Full Text Available En esta revisión se presentan las características más notorias del cuadro clínico de la Blastomicosis Sudamericana en el Perú, tomando como fuente informativa nuestro trabajo del año 1971 (VII Congreso Ibero Latinoamericano de Dermatología, realizado en Caracas, Venezuela que presentó la mayor casuística publicada hasta la actualidad en nuestro medio totalizando 111 casos al recopilar la información de Pesce H., desde el año 1937 hasta 1965, con 71 casos, y la nuestra con 40 casos nuevos del Servicio Académico Asistencial de Dermatología de la Universidad Nacional Mayor de San Marcos en el Hospital Dos de Mayo de Lima, estudiados hasta el año 1971. Con esta casuística se analizan la distribución geográfica, edad, sexo, ocupación, evolución clínica, aspectos y formas clínicas de esta enfermedad.

  2. Medición y cálculo de una red geodésica en el parc mediterrani de la tecnologia

    Yagüe García, Sara

    2010-01-01

    El objetivo de este estudio es establecer una red geodésica, con la mayor precisión posible, para poder ser usada como red de apoyo en posteriores pruebas, ensayos o trabajos topográficos que se realicen en la zona del PMT. La red consta de 10 bases, materializadas con clavos de acero sobre el terreno. A las que se ha dotado de coordenadas UTM en el sistema de referencia oficial ETRS 89. Se ha elaborado un trabajo de campo en el que se han realizado medidas de la red con est...

  3. Estudio para la instalación de un generador solar fotovoltaico conectado a red sobre la cubierta de una nave industrial

    Bilbao Larrauri, Javier

    2013-01-01

    En el presente proyecto se pretende realizar el diseño y estudio de un parque solar fotovoltaico de 54,39 kWp con conexión a red montado sobre la cubierta de una nave industrial y ensamblada a ésta a través de una estructura de aluminio que confiere una inclinación fija a los paneles solares de 28º con respecto a la horizontal y una orientación Sur (azimut de 6º) con respecto a los meridianos. La nave se encuentra situada en el término municipal de Arganda Del Rey en la prov...

  4. La inmigración sudamericana en Italia: Efectos sobre el mercado de trabajo Southamerican Migration in Italy: Labour Market Effects

    María Andrea Grasso

    2010-01-01

    Las migraciones sudamericanas no son las más numerosas ni las más preocupantes para el gobierno italiano y, quizás por ese motivo, no son las más estudiadas. Sin embargo, desde la década de 1970, las economías sudamericanas, en su mayoría, pasaron de ser receptoras de inmigrantes a expulsoras de su propia fuerza de trabajo, siendo Italia uno de los principales destinos elegidos. En qué trabajan los inmigrantes sudamericanos, cómo y en qué contribuyen a la economía italiana es uno de los inter...

  5. Diseño y planificación de una red inteligente de videovigilancia

    Relanzón Camino, Jorge

    2009-01-01

    El presente proyecto está basado en una oferta presentada por la empresa COSINSA, en la cual he trabajado como alumno de prácticas durante el año 2008, para participar en un concurso público convocado por una sociedad de refinería de petróleo que solicita el estudio, diseño, fabricación, entrega y puesta en funcionamiento de un sistema de videovigilancia que garantice la cobertura durante el día y la noche de una terminal petrolífera y refinería. La solución adoptada consiste en un sistema de...

  6. Red neuronal artificial como modelo predictivo en una unidad de patología cervical

    Viñas Aparicio, Olga

    2015-01-01

    El cáncer de Cuello Uterino es a nivel mundial la 3ª neoplasia más frecuente en mujeres. Ocupando en nuestro país la 3º causa de muerte en mujeres entre 15 y 44 años. Su incidencia está íntimamente relacionada con el nivel de desarrollo de una población. A pesar de que en España la incidencia es baja, no podemos obviar que afecta a mujeres jóvenes, dando lugar a una morbimortalidad innecesariamente prematura y sanitariamente evitable. Es importante destacar que la persistencia de infección po...

  7. Propuesta de arquitectura para una Red Móvil de Nueva Generación

    Omaira Parada; Marco A. Hernández; Arturo López; Leticia Betts; Uriel Berdeja; Luis Martínez

    2006-01-01

    El paradigma actual de las comunicaciones espera que un usuario sea capaz de acceder a sus servicios independientemente de su localización de una manera transparente. La terminal del usuario podría ser capaz de elegir la mejor tecnología de acceso (Ad hoc, Ethernet, Celulares, etc.) en su ubicación actual y utilizar esta tecnología de una manera transparente para la provisión del servicio deseado. Esta homogeneidad, alta velocidad, seguridad, multi-servicio, redes multi-operador, está siendo ...

  8. Desarrollo e implementación de una red social para motoristas

    Piñas Matesanz, Joan

    2013-01-01

    [CASTELLÀ] Este proyecto pretende unir los conceptos de geolocalización y red social para aplicarlos a la comunidad de motoristas. Para que puedan gestionar sus eventos y seguirlos en directo a través de la web y el smartphone ubicando a cada motorista dentro del evento.

  9. Diseño de una cubierta solar fotovoltaica conectada a la red eléctrica e integrada en un edificio industrial

    Clemente Alfonso, Raquel

    2006-01-01

    El presente proyecto tiene por objeto llevar a cabo el diseño de una cubierta solar fotovoltaica conectada a la red eléctrica e integrada en un edificio auxiliar para taller, localizado en el recinto de las cocheras de autobuses del Polígono Industrial “Les Hortes” de Mataró. El fin perseguido es diseñar una cubierta solar fotovoltaica que genere el máximo de energía eléctrica posible con objeto de volcarla a la Red Eléctrica y obtener el consecuente beneficio económico por su ven...

  10. Desarrollo de una red inalámbrica en el municipio de Hoya Gonzalo y pedanías próximas

    Crespo Nuñez, Antonio

    2013-01-01

    El documento desarrolla la implantación de una red inalámbrica usando tecnologías WiMAX y WiFi en el ámbito rural. El document desenvolupa la implantació d'una xarxa sense fils utilitzant tecnologies WiMAX i WiFi en l'àmbit rural. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  11. Diseño de una red telemática para dar acceso a internet mediante redes WiMAX/Wi-Fi

    González Martínez, Juan

    2012-01-01

    Diseño de una red mediante tecnología WiMAX y Wi-Fi para dar acceso a Internet en la localidad de Mocejón (Toledo). Disseny d'una xarxa mitjançant tecnologia WiMAX i Wi-Fi per donar accés a Internet a la localitat de Mocejón (Toledo). Bachelor thesis for the Telecommunication Technologies program on Telematics.

  12. Proyecto para la instalación de una red Wi-Fi en el término municipal de Mollina

    Pozo Quiles, Javier

    2013-01-01

    Trabajo Final de Carrera que versa sobre la instalación de una red Wi-Fi en el término municipal de Mollina (Málaga). Treball Final de Carrera que versa sobre la instal·lació d'una xarxa Wi-Fi al terme municipal de Mollina (Màlaga). Bachelor thesis for the Telecommunication Technologies program on Telematics.

  13. Estudio de los principales CMS para la creación de una red social

    Zavala Gamarra, Giancarlo

    2014-01-01

    Actualmente las redes sociales son muy utilizadas en todo el mundo, existen diferentes tipos de redes sociales con las que podemos conectar con amigos, ampliar nuestra red de contactos profesionales, aprender cosas nuevas, etc. Su elevado uso las ha convertido en uno de los negocios más rentables en internet generando fortunas para sus creadores, principalmente, a través de la publicidad. Muchas redes sociales son creadas por empresas que cuentan con un equipo experto, pero otras muchas han s...

  14. Análisis de las competencias directivas de una red de salud pública

    Huerta-Riveros, Patricia C.; Leyton-Pavez, Carolina E.; Saldia-Barahona, Héctor

    2009-01-01

    Objetivos Realizar un análisis sobre la efectividad de la metodología de formaciónacción, para el desarrollo y fortalecimiento de las competencias requeridas por los directivos de establecimientos de redes asistenciales de salud pública.Métodos Se realizó un estudio evaluativo de un programa educativo, con evaluación pre y post aplicado en el marco y condiciones del programa, sin condiciones controladas, a 37 directivos de la red asistencial del Servicio de Salud Talcahuano, que participaron ...

  15. Educaci??n y cultura-red: potencias y contradicciones para una transformaci??n necesaria

    Zafra, Remedios

    2015-01-01

    Este art??culo parte de la siguiente hip??tesis: la transformaci??n que Internet opera en el mundo acent??a la necesidad de una gran transformaci??n educativa. La inercia de la tradici??n y el posicionamiento de sus viejas formas de conocimiento parecen reforzar un profundo desajuste entre lo que la sociedad requiere y lo que la educaci??n proporciona; un desajuste que Internet contribuye a acelerar. Sin embargo, lo que nos interesar?? aqu?? no ser??n las cuestiones instrumentales...

  16. Equilibrio de Tráfico en una red de transmisión de datos

    Gemayqzel Bouza Allende

    2002-01-01

    En las últimas décadas, la transmisión de datos a través de redes se ha extendido alrededor de todo el mundo. Por lo tanto surge el problema de obtener un recorrido racional en política . En este problema propondremos el equilibrio del usuario como una estrategia de recorrido Además presentamos un algoritmo heurístico para informatizar un equilibrio de usuario utilizando la formulación de desigualdad variable.

  17. Una experiencia docente universitaria a través de la red social Facebook

    Alonso Vargas, María Ángeles; Moreno Compañ, Joaquín; Terrones Contreras, Alejandro; Agulló Brotons, Jonás César; Juan Gallardo, Ana Isabel

    2013-01-01

    La comunicación en las redes sociales es un fenómeno muy extendido, entre otras cosas, gracias a una mayor disponibilidad de internet, así como a la gran proliferación de dispositivos móviles. Entre los alumnos universitarios, este tipo de redes de comunicación desempeñan un papel muy importante. La necesidad de incorporar estas herramientas en la enseñanza universitaria, pasa por el hecho de no crear grandes abismos educativos entre la metodología docente y las generaciones que se etiquetan ...

  18. Diseño de una red local en el núcleo del municipio de Móra d'Ebre

    Linares Guerrero, Isaac

    2013-01-01

    Este proyecto nace por la necesidad del municipio de Móra d'Ebre de tener una red geodésica, coherente y enlazada con la red del Institut Cartogràfic de Catalunya, con la que poder desarrollar futuros proyectos.El municipio contaba con dos vértices de la red utilitaria del ICC, pero debido a obras para la mejora de las vías uno de ellos ha desaparecido. Este hecho junto al actual crecimiento y mejoras de infraestructuras que se está produciendo en el municipio y pueblos cercanos, motiva a la ...

  19. Historia, Sociedad, Tecnología y Crecimiento de la Red. Una aproximación divulgativa a la realidad más desconocida de Internet

    Veà i Baró, Andreu, 1969-

    2002-01-01

    Historia, Sociedad, Tecnología y Crecimiento de la Red. Una aproximación divulgativa a la realidad más desconocida de InternetEl contenido de esta tesis abarca el estudio pormenorizado de los hechos que llevaron al diseño y posterior desarrollo de la tecnología que soporta Internet.En ella se realiza a través de una recopilación exhaustiva de documentos (en muchos casos inéditos)1, una descripción histórica de los principales hitos de Internet. Y un análisis comparativo de las distintas tecno...

  20. Arquitectura de una red de sensores inalámbrica para la monitorización de la laguna costera del Mar Menor

    Albaladejo Pérez, Cristina; Soto Vallés, Fulgencio; López Riquelme, Juan Antonio; Iborra García, Andrés José

    2010-01-01

    En el presente trabajo se propone una red de sensores inalámbrica cuyo objetivo es la monitorización de la laguna costera del Mar Menor situada al sureste de la Península Ibérica, en la Región de Murcia, frente a las aguas próximas adyacentes del Mar Mediterráneo. Una vez que dicha red de sensores sea desplegada en los próximos meses formará parte del Observatorio Oceanográfico Costero de la Región de Murcia (OOCMur). Este trabajo describe la red de sensores inalámbrica propuesta esp...

  1. Una mirada "escapista" de la sociología convencional aplicada al derecho: la Teoría del Actor Red y el mundo jurídico

    Marichal, María Eugenia

    2010-01-01

    Este trabajo ensaya la utilización de una novedosa teoría nacida en los estudios de la Ciencia y Tecnología, la Teoría del Actor Red (TAR) para el estudio de un caso concreto de regulación socio jurídica: la rotulación de aceites alimenticios en la década de 1940. Trazando el mapa de las controversias entabladas, se describe la red configurada por investigadores-funcionarios de la provincia de Santa Fe en su lucha por imponer la obligación de rotular discriminadamente los aceites. Se identifi...

  2. Efectos no lineales y su relación con los parámetros de transmisión de una red WDM

    José Giovanny López Perafán

    2012-05-01

    Full Text Available Se analizan las degradaciones ópticas en una red de Multiplexación por División de Longitud de Onda (WDM –Wavelength Division Multiplexing– y se estudia el impacto de los parámetros de transmisión en los efectos no lineales; además, se determinan las variaciones que se deben llevar a cabo en dichos parámetros, con la finalidad de minimizar este tipo de degradaciones y optimizar el desempeño de la red.

  3. Diseño de una red de corredores ecológicos para carnívoros forestales en la Comunidad Valenciana

    Terrones Contreras, Beatriz; Bonet Jornet, Andreu

    2014-01-01

    El presente trabajo pretende sentar las bases para la creación de una red de corredores ecológicos entre las áreas de la Red Natura 2000 en la Comunidad Valenciana. Con este objetivo se han desarrollado modelos de conectividad ecológica para la creación de corredores destinados a un grupo funcional específico formado por carnívoros forestales presentes en la Comunidad Valenciana, como el zorro rojo Vulpes vulpes, la garduña Martes foina, la gineta Genetta genetta y el gato montés europeo Feli...

  4. Sistema de control de acceso, uso y monitorización de una red inalámbrica mediante un netappliance basado en FreeBSD

    López Mateos, Sergio

    2011-01-01

    Actualmente, en casi todas las universidades se ofrece la posibilidad de disfrutar gratuitamente de Internet gracias a las redes inalámbricas wifi. Normalmente se ofrece una red wifi libre para invitados (no usuarios de la universidad), y otra privada con autenticación para estudiantes, profesorado y personal. Sin embargo este sistema de acceso a la red inalámbrica, suele pedirte constantemente el usuario y la contraseña. Debido a esta incomodidad, se ha diseñado un sistema de acceso a la ...

  5. Diagnóstico y propuesta para una gestión integral del riesgo en el Valle de Aburrá: red riesgos.

    Aristizábal, Edier; VARGAS, RICHARD; Mesa Sánchez, Óscar José

    2008-01-01

    A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gest...

  6. Método para caracterizar la congestión aeroportuaria en una red de tráfico aéreo

    José J. Ramasco; Martínez Eguiluz, Víctor; Fleurquin, Pablo

    2012-01-01

    Método para pronosticar la congestión aeroportuaria en una red de tráfico aéreo que combina tanto un algoritmo basado en colas de espera, como las relaciones entre vuelos propias de la planificación de cada aerolínea y que se caracteriza porque establece una simulación basada en la rotación de cada aeronave, los vuelos en conexión, congestión aeroportuaria y retrasos aleatorios; y donde un quinto factor simula las perturbaciones externas; y donde además se ...

  7. Diagnóstico y propuesta para una gestión integral del riesgo en el valle de aburra: red riesgos

    ARISTIZÁBAL, EDIER; VARGAS, RICHARD

    2010-01-01

    A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gest...

  8. MODELADO DEL PRECIO SPOT DE LA ELECTRICIDAD EN BRASIL USANDO UNA RED NEURONAL AUTORREGRESIVA ELECTRICITY SPOT PRICE MODELLING IN BRASIL USING AN AUTOREGRESSIVE NEURAL NETWORK

    Juan D. Velásquez; Isaac Dyner; Reinaldo C. Souza

    2008-01-01

    Una red neuronal autorregresiva es estimada para el precio mensual brasileño de corto plazo de la electricidad, la cual describe mejor la dinámica de los precios que un modelo lineal autorregresivo y que un perceptrón multicapa clásico que usan las mismas entradas y neuronas en la capa oculta. El modelo propuesto es especificado usando un procedimiento estadístico basado en el contraste del radio de verosimilitud. El modelo pasa una batería de pruebas de diagnóstico. El procedimiento de espec...

  9. ANÁLISIS DE UNA RED DE COOPERACIÓN DE PyMEs EN MISIONES, ARGENTINA: BENEFICIOS Y CARENCIAS PARA EL DESARROLLO LOCAL SOSTENIBLE

    Juan Carlos, Michalus; Gilberto, Hernández Pérez

    2012-01-01

    Se presenta un estudio de caso de una red de cooperación existente en la provincia de Misiones, Argentina, integrada por una Pequeña y Mediana Empresa (PyME) elaboradora de té negro y un grupo de PyMEs de aserrado de madera, constituida a partir de la iniciativa particular del empresario tealero. El objetivo es identificar los beneficios del trabajo en cooperación y a su vez, poner en evidencia las carencias que existen cuando estos procesos no se realizan de manera planificada y orientada al...

  10. Failed Presidencies: Identifying and Explaining a South American Anomaly Presidencias fallidas: identificando y explicando una anomalía sudamericana

    Kathryn Hochstetler

    2009-07-01

    Full Text Available Are presidential democracies inherently unstable and prone to breakdown? Recent work on Latin America suggests that the region has seen the emergence of a new kind of instability, where individual presidents do not manage to stay in office to the end of their terms, but the regime itself continues. This article places the Latin American experiences in a global context, and finds that the Latin American literature helps to predict the fates of presidents in other regions. The first stage of a selection model shows that presidents who are personally corrupt and preside over economic decline in contexts where democracy is paired with lower levels of GDP/capita are more likely to face challenges to their remaining in office for their entire terms. For the challenged presidents in this set, the risk of early termination increases when they use lethal force against their challengers, but decreases if they are corrupt. These factors help account for the disproportionately large number of South American presidents who have actually been forced from office, the “South American anomaly” of the title. ¿Son las democracias presidenciales intrínsecamente inestables ypropensas a los quiebres? Los estudios recientes sobre América Latina sugierenque la región ha visto el surgimiento de un nuevo tipo de inestabilidad,donde presidentes no cumplen sus mandatos, pero el régimen mismocontinua. Este artículo coloca las experiencias latinoamericanas en un contextoglobal, y encuentra que la literatura latinoamericana ayuda a predecirlos destinos de los presidentes en otras regiones. La primera etapa de unmodelo de selección demuestra que es más probable que los presidentesquienes son personalmente corruptos y que presiden sobre un decliveeconómico en un contexto donde la democracia es acompañada de nivelesbajos de PIB per cápita sean enfrentados con esfuerzos de desbancarlos delcargo antes del fin del mandato. Para los presidentes desafiados en estegrupo, el riesgo de un termino temprano de sus mandatos aumenta cuandoellos utilizan fuerza letal contra sus desafiadores, pero disminuye si los presidentes son corruptos. Estos factores ayudan a explicar el número desproporcionadamente alto de presidentes sudamericanos quienes han sido forzados a dejar sus cargos, la “anomalía sudamericana” del título.

  11. Rediseño de una red de distribución con variabilidad de demanda usando la metodología de escenarios

    John Wilmer Escobar

    2013-02-01

    Full Text Available Este artículo presenta el problema del diseño de una red de distribución de gran escala con variabilidad en la demanda. Se parte de una estructura de red establecida,cuya problemática central radica en la determinación de las decisiones de cierre o apertura de los centros de distribución. El problema se ha solucionado utilizando lametodología de optimización mediante escenarios;dicha metodología usa un esquema de optimización basado en la generación de múltiples escenarios de los parámetros críticos de la red. El modelo está basado en el caso de una compañía multinacional de alimentos que abastece todo el territorio colombiano y varios mercados internacionales. Los resultados obtenidos reflejan la importancia y eficiencia de la metodología propuesta para el tratamiento de la variabilidad en la demanda, en el diseño de redes de distribución.

  12. Rediseño de una red de distribución con variabilidad de demanda usando la metodología de escenarios

    John Willmer Escobar

    2012-06-01

    Full Text Available Este artículo presenta el problema del diseño de una red de distribución de gran escala con variabilidad en la demanda. Se parte de una estructura de red establecida,cuya problemática central radica en la determinación de las decisiones de cierre o apertura de los centros de distribución. El problema se ha solucionado utilizando la metodología de optimización mediante escenarios;dicha metodología usa un esquema de optimización basado en la generación de múltiples escenarios de los parámetros críticos de la red. El modelo está basado en el caso de una compañía multinacional de alimentos que abastecetodo el territorio colombiano y varios mercados internacionales. Los resultados obtenidos reflejan la importancia y eficiencia de la metodología propuesta para el tratamiento de la variabilidad en la demanda,en el diseño de redes de distribución.

  13. Predicción de los precios de contratos de electricidad usando una red neuronal con arquitectura dinámica

    Juan David Velásquez Henao

    2010-04-01

    Full Text Available Los contratos en los mercados liberalizados de electricidad constituyen una herramienta para proteger a los agentes de la volatilidad; en este contexto, los pronósticos de los precios son una entrada clave para la toma de decisiones estratégicas y operativas de los agentes. En este artículo, se pronostican los precios promedios de los contratos despachados en el mercado eléctrico colombiano, usando una red neuronal con arquitectura dinámica conocida como DAN2. El modelo desarrollado es capaz de capturar la dinámica intrínseca de la serie de precios y de pronosticar el precio para el siguiente mes con más precisión que la metodología ARIMA clásica, para horizontes de predicción de 12 y 24 meses

  14. ENFERMEDAD DE VOGT KOYANAGI HARADA EN UNA SERIE CLINICA DE PACIENTES. EN RED DE SALUD UC: CLASIFICACION Y EVOLUCION CLINICA.

    Enzo Castiglione A.

    2007-12-01

    Full Text Available La enfermedad de Vogt - Koyanagi - Harada (VKH es una panuveítisgranulomatosa bilateral con compromiso extraocular enel sistema auditivo, meníngeo y piel (1. Clínicamente se puedepresentar por ojo rojo profundo, bilateral, dolor ocular o compromisode la agudeza visual. Los hallazgos del examen clínicodependerán del estadío clínico de la enfermedad. Hay manifestacionestempranas como coroiditis (con o sin uveítis anterior o hiperemiadel disco óptico o desprendimientos retinales serosos,como también manifestaciones de enfermedad tardías: despigmentaciónocular, cicatrices coriorretinales o uveítis recurrente.Los tratamientos propuestos son múltiples: desde la observaciónhasta la corticoterapia por distintas vías de administración,inmunomoduladores, antimetabolitos o agentes alquilantes,dado que es desconocido el tratamiento más efectivo con lasmenores complicaciones a largo plazo. El diagnóstico diferencialincluye formas graves de retinopatía central serosa, traumaocular penetrante (quirúrgico o accidental y diversas causas deuveítis posterior y pan uveítis. Con el fin de definir poblacioneshomogéneas de pacientes con VKH para comenzar a desarrollarestudios clínicos y establecer de mejor manera su diagnóstico,tratamiento y pronóstico, en el año 2001 fueron replanteadoslos criterios diagnósticos de VKH por un comité internacional,determinando categorías de la enfermedad (2. Así, la enfermedadde VKH puede clasificarse como completa (enfermedad ocularmás compromiso de tegumentos y neurológicos, incompleta(enfermedad ocular más compromiso de tegumentos o compromisoneurológico y probable (enfermedad ocular pura.Nuestro objetivo fue clasificar a los pacientes con VKH evaluadosen la Red de Salud UC según los criterios del Comité Internacionalpara el estudio de la Enfermedad de VKH y evaluar susrespuestas a tratamiento y desarrollo de complicaciones.

  15. Proyecto de red para ONG

    Ruiz López, David

    2013-01-01

    Proyecto de una red de comunicaciones para una ONG en la Comunidad de Madrid. Projecte d'una xarxa de comunicacions per a una ONG a la Comunidad de Madrid. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  16. La Red de Apoyo a la Gestión Educativa (Red AGE) : una experiencia de cooperación educativa entre países iberoamericanos

    Gairín Sallán, Joaquín; Barrera Corominas, Aleix; Fernández de Álava, Miren

    2013-01-01

    El diseño y desarrollo de redes de profesionales conforman una estrategia para el diálogo horizontal, impulsora de la creación y gestión del conocimiento que redunda en el beneficio mutuo de las organizaciones participantes. Al respecto, este artículo presenta una experiencia que tiene dos objetivos; por un lado, favorecer el intercambio de prácticas y recursos para la profesionalización de administradores y directivos de instituciones educativas en el ámbito iberoamericano, y, por el otro, c...

  17. M??sica en el cine: Una propuesta de trabajo cooperativo en base a una red social educativa en un curso de 4?? de la E.S.O

    Fern??ndez Varela, Nidia

    2011-01-01

    El proyecto que se describir?? a continuaci??n se llev?? a cabo con alumnos de cuarto de la E.S.O. del Colegio ??rtica del PAU de Carabanchel, sito en la C.C.A.A de Madrid en el a??o 2010. En este art??culo se expondr?? el trabajo realizado sobre un tema en concreto del curr??culum oficial de 4?? de la ESO en el aula de m??sica que fue trabajado en grupos cooperativos utilizando una red social. As?? mismo, se puntualizar??n los objetivos que guiaron la acci??n, se har?...

  18. "Situación de inmigración" de mujeres sudamericanas en chile: hacia un modelo comprensivo

    Leyla Méndez Caro

    2012-01-01

    Full Text Available El objetivo de esta investigación fue conocer la situación de inmigración de mujeres sudamericanas en la región de Antofagasta (Chile y construir un modelo teórico para su análisis. Las participantes de este estudio fueron 19 mujeres de entre 18 y 50 años, residentes en la ciudad de Antofagasta y provenientes de Perú, Bolivia y Colombia. Los principales hallazgos sugirieron un modelo dinámico, en el que se tensiona la identidad social y de género de las mujeres inmigrantes ante la búsqueda de coherencia dentro de sus espacios vitales. Advertimos en la interacción con la sociedad receptora, la imposición de nuevas categorías sociales a cambio de integración basada en la asimilación. No obstante, también se observan formas de resistencia frente a dicho proceso.

  19. Instalación eléctrica mediante energías renovables en una quesería de D.O. Idiázabal aislada de red en Salvatierra

    Santamaría Cabodevilla, Daniel

    2011-01-01

    El presente proyecto tiene como objetivo el estudio de las alternativas para realizar una instalación eléctrica mediante el uso de energías renovables, en una quesería de DO Idiazabal aislada de red eléctrica, situada en Salvatierra/Agurain (Álava). Tras analizar las ventajas y desventajas de las alternativas planteadas, se ha optado por realizar una instalación solar fotovoltaica aislada de red sobre cubierta con generación auxiliar. A continuación se ha procedido a real...

  20. Procedimiento para estimar el extractable del níquel con una red neuronal artificial, en sustitución de los modelos estadísticos tradicionales

    Francisco Viada Aguilera

    2010-01-01

    Full Text Available Las Redes Neuronales Artificiales se aplican en la estimación o predicción de los sistemas de detección de fallas de equipos, logrando con ellas las mismas funciones que el modelo estadístico tradicional. Se argumentó un método para sustituir los algoritmos de selección y el conjunto de modelos que normalmente se utilizan en sistemas de control predictivo de procesos complejos, los que están determinados por un conjunto de variables, con un amplio rango de variación de cada una de ellas, como es el caso del extractable del níquel obtenido en los hornos de reducción de la fábrica, por una Red Neuronal.

  1. Estudio y diseño de una red WiMAX para dar cobertura de banda ancha en un entorno rural.

    CALVILLO TERIBIA, AINHOA

    2013-01-01

    Actualmente en la mayoría de los hogares españoles, se tiene acceso a internet de banda ancha, lo que ha generado una ¿dependencia¿ de éste servicio. Además la existencia de dispositivos móviles en el mercado, hace necesario utilizar redes inalámbricas para facilitar el servicio. La red inalámbrica de mayor cobertura es la conocida como WiMax (World Wide Interoperability for Microsoft Access). Está basada en el protocolo, el 802.16, y lo que le diferencia de las redes WiFi e...

  2. Plan de viabilidad de una empresa dedicada a la generación de Energía Solar Fotovoltaica y posterior venta a red

    Taboada Villagrasa, Núria

    2009-01-01

    Este proyecto trata sobre estudiar la viabilidad de una empresa en un sector en auge debido a la explosión de la energía fotovoltaica en Catalunya y España, aprovechando las ayudas y subvenciones del gobierno y la concienciación de la sociedad con respecto al cambio climático y a la energía verde. Mediante el estudio de la empresa con la cual pretendemos cubrir este proyecto, venderemos la energía obtenida del sol a la red eléctrica alquilando los espacios desaprovechados ap...

  3. Diseño e implementación de una red de emuladores para recrear escenarios clínicos del sistema respiratorio de pacientes neonatales

    Edward Julián Ramos Ballesteros

    2016-06-01

    Full Text Available Contexto/Objetivo: El objetivo es diseñar e implementar una red de emuladores para realizar a futuro un taller práctico con los estudiantes del área de la salud, colocando a prueba sus conocimientos y aprender de lo vivenciado antes de ejercer su vida profesional.Método: La red está compuesta por un Módulo de Control Central (MC, que permite al docente crear escenarios clínicos, y tres Emuladores para los estudiantes. Una vez creados los escenarios, son transmitidos hasta un Emulador que es escogido mediante una interfaz gráfica, con el fin de que el estudiante en práctica observe los valores y señales de los signos vitales tanto en la parte física (ME: Maniquí del Emulador como en la parte gráfica (IE: Interfaz del Emulador, y realice acciones dependiendo de los conocimientos adquiridos en sus estudios. Luego se genera un proceso de respuesta que le muestra al docente los resultados de las acciones. Finalmente el docente evalúa a los estudiantes comparando el escenario clínico con la respuesta y así también estimula el aprendizaje de los mismos.Resultados: Las características de implementación después de realizar un conjunto de pruebas son las siguientes: la distancia máxima de los componentes con respecto al MC, sin perder el óptimo funcionamiento de la red, es de 8 metros para el IE y 12 metros para el ME. Además con las técnicas implementadas se reduce en 13.28% el tiempo de ejecución cuando se programa el escenario clínico y en 21.78% el tiempo de ejecución del proceso de respuesta, estableciéndolos en 8,42 y 4,99 segundos respectivamente.Conclusiones: Teniendo en cuenta la distancia máxima y los tiempos de ejecución, se construye una red de emuladores con las características necesarias para implementar a futuro el taller práctico teniendo en cuenta las especificaciones técnicas, condiciones de tráfico, dimensiones de los salones, los usuarios en paralelo y la periodicidad con que se va a utilizar

  4. Análisis de la conectividad de usuarios en una red de campus 802.11

    Rodríguez Blanco, Mario

    2015-01-01

    A lo largo de estos últimos años, el desarrollo de las redes de telecomunicaciones ha sufrido un fuerte crecimiento. Dichas redes disponen de una gran variedad de técnicas de acceso. Una de las técnicas de más éxito es mediante comunicación inalámbrica. Debido a que nos hemos convertido en una sociedad cada vez más móvil, la demanda de redes inalámbricas por parte de los usuarios está incrementando exponencialmente, gracias a la movilidad que permiten. Otros de los motivos de dicho increme...

  5. Una red neuronal binaria para la identificación de mecanismos isomorfos. // A binary Neural network for identifying isomorphic mechanisms.

    G. Galán Marín

    2002-05-01

    Full Text Available Un problema de importancia primordial en el diseño mecánico es identificar los mecanismos isomorfos, puesto que los isomorfismos nodetectados generan soluciones duplicadas y por tanto suponen un esfuerzo innecesario en el proceso de diseño. Desde 1960, una grancantidad de métodos han sido propuestos para la detección de mecanismos isomorfos. Sin embargo, diversos trabajos han mostrado queaunque pueden existir algoritmos eficaces para casos particulares, en el caso general los métodos tradicionales para la detección deisomorfismos en cadenas cinemáticas no proporcionan usualmente soluciones eficientes para este problema, que ha sido clasificado comoNP-duro. Un eficaz método alternativo para la resolución de problemas NP-duros ha surgido recientemente con las redes neuronales. Eneste trabajo proponemos un nuevo modelo de red neuronal binaria diseñado para la resolución del problema de detección de mecanismosisomorfos. El modelo propuesto se halla basado en unas dinámicas discretas que garantizan una rápida y correcta convergencia de la redhacia soluciones aceptables. Las simulaciones numéricas muestran en los mecanismos analizados que la red neuronal propuestaproporciona excelentes resultados, mostrándose además muy superior a la red de Hopfield continua tradicional en lo que respecta al tiempode computación y en la facilidad de su implementación.Palabras claves: Mecanismos isomorfos, síntesis de mecanismos, isomorfismo de grafos, red neuronal binaria,redes de Hopfield.____________________________________________________________________________AbstractAn important step in the kinematic mechanism synthesis process is to identify graph isomorphism whilegenerating new mechanisms. Undetected isomorphisms result in duplicate solutions and unnecessary effort.Since 1960, a lot of methods have been proposed for the graph isomorphism identification. Some authors haveconcluded that, in the general case, the traditional methods of

  6. Diseño de una red integrada de infraestructuras de transportes para el Vallés

    Herce Vallejo, Manuel; Mayorga Cárdenas, Miguel Yuri

    2013-01-01

    Herce y Magrinyà desmenuzan aquí los distintos aspectos que comprende el espacio público de la movilidad. Así, nos presentan un panorama sobre la forma en que la red vial le da estructura a nuestras ciudades. Por eso, señalan, no se puede hacer abstracción del tipo de red al que pertenece cada calle. Por eso también los parámetros de diseño son más amplios que las condiciones geométricas a considerar.

  7. Entrenamiento de una red neuronal multicapa para la tasa de cambio euro - dólar (eur/usd)

    Villamil Torres, Jaime Alberto; Delgado Rivera, Jesús Alberto

    2010-01-01

    Tanto para los inversionistas como para las autoridades económicas es necesario que se desarrolle una herramienta matemática que logre dar cuenta de la dirección de una variable como el tipo de cambio (el precio relativo entre dos monedas). Muchos de los mecanismos usados actualmente están basados en el uso de técnicas estadísticas, en particular series de tiempo lineales. Las redes neuronales artificiales (RNA) son modelos matemáticos que pretenden emular el funcionamiento del cerebro humano...

  8. IMPLEMENTACIÓN Y ACTUALIZACIÓN EN LA INFRAESTRUCTURA DE SEGURIDAD DE UNA RED INFORMÁTICA

    Nancy Yaneth Gelvez García; Miguel Andrés Flórez Vianchá; Victor Daniel Angulo Morales

    2012-01-01

    En éste artículo se evidencia la importancia de la seguridad en las redes informáticas dentro de cualquier organización y muestra los resultados encontrados al actualizar la infraestructura de seguridad de una organización e incluir mejoras de diseño (desde el punto de vista del hardware y software) que cuenta con varias sucursales en el País. Será implementado un nuevo cortafuegos en la sucursal de zona franca así como la creación de una VPN site to site con la sede principal. Se realizará l...

  9. Regionalismo y Seguridad Sudamericana: ¿son relevantes el Mercosur y la Unasur?

    Augusto Wagner Menezes Teixeira

    2010-09-01

    Full Text Available El artículo discute el papel del Mercosur en la construcción de un amplio régimen de seguridad en América del Sur; para lo cual se utiliza, apoyándose en la Escuela de Copenhague, un concepto ampliado y profundizado de seguridad, donde el sector político gana relevancia explicativa. Después de desarrollar la discusión teórica sobre las relaciones entre integración regional y seguridad, se realiza una evaluación sobre cómo el Mercosur y la Unasur avanzan en la construcción de un macro-régimen de seguridad regional. Este análisis nos lleva a sostener que la región todavía no está en vías de constituir una comunidad de seguridad, sin embargo, la creación del Consejo de Seguridad-Unasur alude a un posible avance en la cooperación en asuntos estratégicos, inaugurando un momento nuevo en el regionalismo suramericano. AbstractThis article offers an analysis of Mercosur’s role in the construction of a broad security regime in South America. To that end, based on the Copenhagen School, I use a broadened and deepened concept of security in which the political sector gains explanatory relevance. After developing the theoretical discussion on the relationship between regional integration and security, I evaluate how Mercosur and Unasur proceed in the construction of a macro-regime of regional security. This analysis brings us to maintain that the region is not yet on the way to constructing a security community. However, the creation of the Unasur Security Council suggests possible progress in cooperation on strategic matters, opening the way to a new moment in South American regionalism.

  10. Pasado, presente y futuro de la epidemiología. Una perspective latinoamericana

    Morabia, Alfredo

    2015-01-01

    Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los “objetos oscuros del deseo” epidemiológico? PMID:25124247

  11. Planificación en entornos urbanos y rurales de una red de cuarta generación móvil LTE en la Región de Murcia

    Agustín Cánovas, Fidel

    2015-01-01

    La tecnología móvil LTE de cuarta generación (4G) es el sistema de comunicaciones más avanzado en la actualidad. En España se han desplegado diversas redes de LTE, especialmente en entornos urbanos. La planificación de la red LTE es fundamental para que los servicios ofrecidos por dicha red alcancen una calidad óptima. En el presente proyecto se llevará a cabo la planificación de una red LTE en un entorno urbano y en un entorno rural de la Región de Murcia. La planificación de la red LT...

  12. SUBNET informática y eléctrica en una red escolar. Caso práctico

    Juan Carlos Reyes Alvarado

    2013-01-01

    Esta investigación se centra en la parte de la Subnet del Laboratorio de cómputo Escolar y toca aspecto del Área Local de la Organización Escolar en cuanto a la topología bus estrella que se emplea y se observa la problemática que se vive en forma cotidiana en la atenuación sobre todo del acceso a Internet y de los servicios de Red, así como la parte de la red eléctrica que en su momento a finales del siglo pasado respondió a la carga que se demandaba en ese entonces con un numero de nodos ac...

  13. Diseño de una red troncal WiMAX que soporte los servicios de telefonía, internet y televisión en el municipio de Llucmajor

    Vidal Villamide, David

    2012-01-01

    Diseño de una red inalámbrica utilizando el protocolo de comunicaciones WiMAX para dar cobertura al municipio de Llucmajor, en Mallorca. La red debe soportar el tráfico de internet, VoIP e IPTV de cada usuario. Disseny d'una xarxa sense fils utilitzant el protocol de comunicacions WiMAX per donar cobertura al municipi de Llucmajor, a Mallorca. La xarxa ha de suportar el trànsit d'internet, VoIP i IPTV de cada usuari.

  14. Contribuciones a una propuesta para la gestión de la red de servicios de salud y las acciones del SUS, en base a los resultados

    Hesio Cordeiro et al

    2009-01-01

    Full Text Available El trabajo se refiere a las innovaciones que se deben poner en pratica por el Ministerio de Salud para lograr la superación de dificultades de la gestión del Sistema Único de Salud que comprometen la calidad y la resolubilidad de los cuidados de salud. Se realiza una revisión de la experiencia internacional en relación a los sistemas y elementos de gestión de la red de servicios tomando en cuenta el territorio, las politicas de regulación e los instrumentos de regulación. En la situación de Brasil se hace la revisión del Pacto por la Salud que ha generado resultados positivos en la concepción del SUS de forma semejante a los paises de Europa.

  15. ANÁLISIS DE UNA RED DE COOPERACIÓN DE PyMEs EN MISIONES, ARGENTINA: BENEFICIOS Y CARENCIAS PARA EL DESARROLLO LOCAL SOSTENIBLE

    Juan Carlos, Michalus

    2012-06-01

    Full Text Available Se presenta un estudio de caso de una red de cooperación existente en la provincia de Misiones, Argentina, integrada por una Pequeña y Mediana Empresa (PyME elaboradora de té negro y un grupo de PyMEs de aserrado de madera, constituida a partir de la iniciativa particular del empresario tealero. El objetivo es identificar los beneficios del trabajo en cooperación y a su vez, poner en evidencia las carencias que existen cuando estos procesos no se realizan de manera planificada y orientada al desarrollo local sostenible.El estudio de caso que se expone constituye un caso único, contemporáneo; con relevamiento de datos en los establecimientos pertenecientes a la red de cooperación, entrevistas a empresarios y encargados de producción, que permitieron constatar los beneficios de la cooperación, entre los que figuran: aprovechamiento de residuos, generación de lazos de confianza entre empresarios y contribución al cuidado del medio ambiente. También se constataron las principales deficiencias que impiden la obtención de beneficios mayores, derivados de la carencia de un instrumental metodológico adecuado para implementar este tipo de emprendimientos cooperativos, entre los que se destaca: escaso aprovechamiento de recursos ociosos, ausencia de mejoras en procesos mediante innovaciones conjuntas, falta de participación de actores fundamentales y de orientación sistemática hacia el desarrollo local sostenible.

  16. Implementación de multicast IP y enrutamiento dinámico en una red universitaria

    Pérez España, Manuel

    2009-01-01

    La configuración del multicast IP (Internet Protocol) en la red universitaria de ESADE y la optimización del encaminamiento unicast IP, es un punto básico para la mejora de los servicios a los usuarios. Hoy en día, los avances tecnológicos derivados del paso de la televisión analógica a la televisión digital y la demanda de información a tiempo real de alta calidad, han propiciado la implantación del multicast IP en la escuela universitaria de ESADE para uso de estudiantes y personal...

  17. Desarrollo y análisis de una red ad-hoc con sensores inalámbricos.

    Amell Espulgas, Eulàlia; Vilarnau Salán, Anna

    2007-01-01

    Las comunicaciones inalámbricas han sido en los últimos años objeto importante de investigación debido a sus ventajas y a su bajo coste. Las redes inalámbricas permiten trabajar con dispositivos que pueden cambiar de posición independientemente, según la necesidad de cada momento. También han sido un importante objeto de investigación las redes Ad-Hoc. Redes constituidas por nodos que se pueden conectar entre ellos de forma arbitraria, sin la necesidad de disponer de una infraestructura ni de...

  18. Diseño e implementación de una micro red basada en energías renovables

    Cervero Borque, Hector

    2011-01-01

    El present projecte realitzarà una explicació breu dels conceptes tècnics de les diferents energies renovables que utilitzem en el projecte. Posteriorment, es fa un estudi meteorològic del lloc d’emplaçament del projecte, obtenim la radiació solar i força eòlica de la ubicació. A continuació, es realitza el dimensionat de la instal·lació mitjançant el consum necessari, segons les necessitats del client i posteriorment la implementació de la micro xarxa elèctrica per donar autonomia a un secto...

  19. Educación y Cultura-red. Potencias y contradicciones para una transformación necesaria

    Zafra Alcaraz, Remedios

    2015-01-01

    Este artículo parte de la siguiente hipótesis: la transformación que Internet opera en el mundo acentúa la necesidad de una gran transformación educativa. La inercia de la tradición y el posicionamiento de sus viejas formas de conocimiento parecen reforzar un profundo desajuste entre lo que la sociedad requiere y lo que la educación proporciona; un desajuste que Internet contribuye a acelerar. Sin embargo, lo que nos interesará aquí no serán las cuestiones instrumentales que se ...

  20. Diversificación craneofacial e integración evolutiva en poblaciones sudamericanas

    Pérez, Sergio Iván

    2007-01-01

    Full Text Available El estudio de la integración morfológica tiene gran importancia para comprender los patrones y procesos de evolución morfológica. Las poblaciones del sur de Sudamerica representan un interesante caso para el estudio de la integración evolutiva debido a que las mismas han alcanzado una gran diversidad morfológica. El objetivo de esta ponencia es presentar los resultados del análisis de la variación craneofacial y la integración evolutiva en poblaciones humanas de esta región. Se definieron componentes morfogenéticos los cuales fueron descriptos mediante landmarks y semilandmarks. Los patrones de integración entre componentes fueron comparados con modelos basados en información del desarrollo, función y origen embriológico de los componentes, con el fin de estimar la importancia de estos factores en la integración craneofacial. Nuestros resultados muestran que en el nivel intra-poblacional los componentes del esqueleto facial y la calota presentan mayor integración y se encuentran relativamente disociados de los de la base, como es esperado por el tipo de osificación del cráneo. En cambio, la integración en elnivel inter-poblacional difiere de la del nivel intra-poblacional y se ajusta al patrón de crecimiento del cráneo. En conjunto estos resultados muestran que la integración entre componentes es flexible y que diferentes factores pueden modificar el patrón de integración.

  1. Development and implementation of a pilot network for continuous monitoring of electric energy; Desarrollo e implantacion de una red piloto de monitoreo continuo de energia electrica

    Sanchez Cifuentes, A.; Cortes Eslava, A. [Facultad de Ingenieria, UNAM, Mexico, D. F. (Mexico)

    1997-12-31

    analizarse para poder mejorarse, ya que se debe tener presente que aquello que no pueda medirse no se puede mejorar. A este fin, el PUE esta desarrollando una red piloto de monitoreo continuo de energia electrica con acceso local y remoto, y de un sistema automatizado de medicion. Se experimentan dos esquemas de monitoreo; uno con equipo de medicion comercial y otro con equipo de medicion de tecnologia propia. El presente trabajo describe las caracteristicas de los esquemas de monitoreo propuestos.

  2. El proceso de la reconstrucción de la red personal de los inmigrantes: una descripción longitudinal

    Miranda J. Lubbers

    2013-01-01

    Full Text Available estudios anteriores han mostrado que la red personal puede ser una fuente de apoyo social para inmigrantes, pero no es una entidad estática. en este ar- tículo describimos un estudio longitudinal sobre el cambio en las redes perso- nales de inmigrantes, realizado entre 2004-2008 en cuatro colectivos de inmi- grantes relativamente recientes en Cataluña (en total n = 70. las redes se han medido en dos oleadas, ambas post-migratorias, con un intervalo de tiempo de 1-3,3 años. Comparando las redes en los dos momentos, analizamos el grado de renovación en las redes, las tendencias generales del cambio en términos de su composición e investigamos las diferencias en estas tendencias en base de género, grupo étnico y años de residencia. los resultados indican que las redes son poco estables en general, pero que a pesar de ello, la composición media de las redes no cambia apenas, salvo por lo que se refiere a un ligero aumento del número de compatriotas residentes en españa y un descenso del número de personas residiendo en el país de origen. en general, no observamos un aumento significante del número de españoles en las redes personales de los inmigrantes.

  3. Generación eléctrica mediante un sistema híbrido hidráulico-fotovoltaico aislado de la red para una pequeña población rural

    Visiga Delgado, Daniel

    2009-01-01

    El objeto del proyecto es el diseño de un sistema, factible tecnológicamente, híbrido hidráulicofotovoltaico, aislado de la red para una pequeña población rural. Este sistema está dimensionado a partir de un río tipo y recibe el apoyo de un sistema fotovoltaico y un tanque de baterías. Por otro lado, el proyecto tiene la finalidad de crear una demanda escalable unitaria base para una vivienda rural tipo y, a partir de la cual, obtener la demanda de la población.

  4. SUBNET informática y eléctrica en una red escolar. Caso práctico

    Juan Carlos Reyes Alvarado

    2013-11-01

    Full Text Available Esta investigación se centra en la parte de la Subnet del Laboratorio de cómputo Escolar y toca aspecto del Área Local de la Organización Escolar en cuanto a la topología bus estrella que se emplea y se observa la problemática que se vive en forma cotidiana en la atenuación sobre todo del acceso a Internet y de los servicios de Red, así como la parte de la red eléctrica que en su momento a finales del siglo pasado respondió a la carga que se demandaba en ese entonces con un numero de nodos activos menor a los que se tienen actualmente y la demanda de energía ha subido por las mismas necesidades de la organización, de la misma forma las necesidades informáticas en cuanto a su demanda en el acceso a voz, datos, en multimedia, video conferencia etc. Han subido de tal forma que se tocan estos aspectos en este artículo de investigación.

  5. IMPLEMENTACIÓN Y ACTUALIZACIÓN EN LA INFRAESTRUCTURA DE SEGURIDAD DE UNA RED INFORMÁTICA

    Nancy Yaneth Gelvez García

    2012-05-01

    Full Text Available En éste artículo se evidencia la importancia de la seguridad en las redes informáticas dentro de cualquier organización y muestra los resultados encontrados al actualizar la infraestructura de seguridad de una organización e incluir mejoras de diseño (desde el punto de vista del hardware y software que cuenta con varias sucursales en el País. Será implementado un nuevo cortafuegos en la sucursal de zona franca así como la creación de una VPN site to site con la sede principal. Se realizará la integración de todos los firewalls con la sede principal y la reconfiguración de rutas estáticas por mala configuración y por cambio de proveedor ISP.El aporte académico del proyecto consiste en brindar lineamientos clave en cualquier implementación así como conceptos en seguridad de la información y firewalls.

  6. MODELADO DEL PRECIO SPOT DE LA ELECTRICIDAD EN BRASIL USANDO UNA RED NEURONAL AUTORREGRESIVA ELECTRICITY SPOT PRICE MODELLING IN BRASIL USING AN AUTOREGRESSIVE NEURAL NETWORK

    Juan D Velásquez

    2008-12-01

    Full Text Available Una red neuronal autorregresiva es estimada para el precio mensual brasileño de corto plazo de la electricidad, la cual describe mejor la dinámica de los precios que un modelo lineal autorregresivo y que un perceptrón multicapa clásico que usan las mismas entradas y neuronas en la capa oculta. El modelo propuesto es especificado usando un procedimiento estadístico basado en el contraste del radio de verosimilitud. El modelo pasa una batería de pruebas de diagnóstico. El procedimiento de especificación propuesto permite seleccionar el número de unidades en la capa oculta y las entradas a la red neuronal, usando pruebas estadísticas que tienen en cuenta la cantidad de los datos y el ajuste del modelo a la serie de precios. La especificación del modelo final demuestra que el precio para el próximo mes es una función no lineal del precio actual, de la energía afluente actual y de la energía almacenada en el embalse equivalente en el mes actual y dos meses atrás.An autoregressive neural network model is estimated for the monthly Brazilian electricity spot price, which describes the prices dynamics better than a linear autoregressive model and a classical multilayer perceptron using the same input and neurons in the hidden layer. The proposed model is specified using a statistical procedure based on a likelihood ratio test. The model passes a battery of diagnostic tests. The proposed specification procedure allows us to select the number of units in hidden layer and the inputs to the neural network based on statistical tests, taking into account the number of data and the model fitting to the price time series. The final model specification demonstrates that the price for the next month is a nonlinear function of the current price, the current energy inflow, and the energy saved in the equivalent reservoir in the current month and two months ago.

  7. Diseño de la Red de Comunicaciones de una Célula de Automatización Industrial

    Robles Martínez, Marta

    2011-01-01

    Este proyecto fin de carrera forma parte de un plan de mejora de una planta industrial cuyos objetivos son la finalización de la automatización de la línea de producción y la renovación de los sistemas de información. El proceso de automatización supone transferir las tareas de producción a sistemas mecánicos, electrónicos y computacionales para evitar la intervención humana. El uso de máquinas y dispositivos de control comunicados entre sí y funcionando de manera automatizada provoca un a...

  8. Telemedicina, una red social médica de ayuda humanitaria entre España y Camerún

    David Pérez-Manchón

    2015-01-01

    La aplicación de las tecnologías de la información y de la comunicación en la asistencia sanitaria de los países del sur es un recurso que puede mejorar la salud de millones de personas en situación de pobreza y sin acceso a servicios de salud de calidad. Concretamente, la telemedicina no sincronizada con plataformas en Internet es una opción muy eficiente para proyectos de cooperación internacional. El proyecto Salud 2.0: profesionales de África-España conectados, de la organización española...

  9. La firma digital: una tecnología para la intercomunicación en la sociedad-red

    Salvador Ayestarán, Ignacio

    2001-03-01

    Full Text Available An analysis of the technologies of digital signature is achieved within the European Union from three different angles: technique, official standard and I+D support. Firstly, a description of the nature and the bringing into operation of the digital signature is made, together with certificates,Trusted Third Parties, key management and its legal problems. Secondly, a historical analysis of the research support and the development of the European Community is also provided (European Trustworthy Services Programme, previous to the European Council directive about digital signature. Finally, the Electronic Data Interchange (EDI is considered within the policies of IDA Programme (Interchange Data Administration and the projection of the future European administrative intercommunication.

    Se lleva a cabo un análisis de las tecnologías de firma electrónica, en el contexto de la Unión Europea, desde una triple perspectiva: técnica, normativa y de soporte I+D. Para ello se realiza una descripción de la naturaleza y funcionamiento de la firma digital, los certificados y las autoridades de certificación, la gestión de claves y sus problemas legales y regulatorios. Se efectúa un análisis histórico del soporte de investigación y desarrollo de la comunidad europea (Programa de Servicios Confiables Europeos, previo a la Directiva del Consejo Europeo sobre Firma Electrónica. Por último, se considera el Intercambio Electrónico de Documentos (EDI, en el marco de las políticas del Programa IDA (Intercambio de Datos entre Administraciones, y la proyección de la intercomunicación administrativa europea en el futuro.

  10. Incorporación de la metodología geoestadística a la vigilancia de la gripe en una red centinela

    Abellán J.J.

    2002-01-01

    Full Text Available Objetivo: Valorar la descripción geoestadística realizada de los datos de gripe recogidos a través de la Red Centinela Sanitaria de la Comunidad Valenciana (RCSCV mediante la utilización del método kriging con la finalidad de evaluar la posibilidad de su incorporación a la vigilancia rutinaria Método: Se han utilizado los datos de vigilancia de gripe de la RCSCV en tres temporadas gripales (1997-1998, 1998-1999 y 1999-2000, construyéndose una matriz de datos de incidencia de gripe geocodificada. La distribución geográfica fue estudiada mediante la técnica geoestadística kriging, que permite estimar la incidencia de la enfermedad en cualquier punto del territorio, a partir de la incidencia observada en unos pocos puntos estratégicamente distribuidos. Se elaboraron mapas de curvas de isoincidencia de gripe para cada semana. La valoración de la técnica se realizó mediante validación cruzada. Resultados: En la mayoría de las semanas, los valores tanto de la desviación estándar (DE reducida, como de la media reducida estuvieron cercanos a los valores considerados óptimos (0 o 1, respectivamente, y sólo en la última temporada se obtuvieron valores de la DE reducida alejados de los considerados como de buen ajuste en 12 de las 20 semanas. La estimación de tasas en todas las temporadas demostró una coherencia en su distribución espacial. También se observó coherencia en la evolución temporal. Conclusiones: En la mayoría de las situaciones los resultados pueden considerarse aceptables, no requiere recursos informáticos extraordinarios ni un empleo de tiempo excesivo, y necesita tan sólo una adaptación anual. Su facilidad de uso lo hace apto para su utilización como una técnica de rutina, pese a que puede mejorarse la precisión de las estimaciones, incrementando la complejidad del modelo.

  11. La energía en la política sudamericana: características de las relaciones entre Brasil y Venezuela

    Paulo César Manduca

    2012-01-01

    La premisa inicial de este trabajo es que la energía es el factor principal en el posicionamiento de los países en la economía y en la política internacional. En este contexto, se analizan dos aspectos de este escenario y cómo ello afecta la política sudamericana. El primero de ellos tiene que ver con el petróleo y las proyecciones de su industria; el segundo se relaciona con la búsqueda de alternativas energéticas, de nuevos criterios de producción y de consumo de energía. Asimismo, se anali...

  12. Unidos por la red, separados por el Estado. Una lectura sobre la inclusión digital en Colombia

    Patricia Martinez Coral

    2014-12-01

    Full Text Available El presente artículo se propone contribuir al debate teórico sobre la naturaleza institucional de la difusión tecnológica, a la luz de la evidencia encontrada en el desarrollo de las iniciativas de acceso universal a Internet en Colombia, las cuales se enmarcan en la política de telecomunicaciones sociales, vigente desde 1995. Una vez introducidos los fundamentos que orientan la discusión teórica, y su aplicación concreta en el campo de las Tecnologías de la Información y la Comunicación (TIC, se exponen las lecciones más relevantes acerca de los condicionamientos institucionales que se desprenden de la interacción entre Estado y mercado, diseño de intervenciones públicas, y elecciones técnicas, para las oportunidades de acceso a Internet en las zonas rurales del país; en razón de la pertinencia que tiene actualmente la búsqueda de alternativas para viabilizar la vida en el campo, con ocasión de las proyecciones sobre los escenarios de pos-conflicto. Por último se esbozan las conclusiones que permiten desvirtuar algunos paradigmas que revisten las decisiones de acción pública, de las que surge el afianzamiento de la exclusión digital en el país. 

  13. Nuevo “rol” y paradigmas del Aprendizaje, en una Sociedad Global en RED y Compleja: la Era del Conocimiento y el Aprendizaje

    Rubio Royo, Enrique

    2009-09-01

    la Gestión de la Complejidad, que nos proporciona una adecuada aproximación sistémica, a muchos y diferentes problemas. En nuestro caso, desde el ámbito académico y en el proceso de adaptación al Espacio Europeo de Enseñanza Superior (EEES, se requerirá desarrollar una nueva visión, y estrategia explícita de Gestión del Conocimiento (KM, como adecuación al nuevo entorno y a la incipiente economía del conocimiento asociada. Partiendo de la convergencia emergente de los ámbitos profesional y académico, se observa no sólo la semejanza de los paradigmas tradicionales de la KM y de la LM, sino también la incapacidad de los mismos para asumir los nuevos requerimientos asociados al nuevo entorno en RED. Una nueva reconceptualización del Conocimiento y el Aprendizaje como procesos basados en conexiones (“networking”, nos proporcionará el nuevo “rol” y paradigmas del Aprendizaje: Modelo Adaptativo de Aprendizaje en Entornos Complejos. Como estrategia de adecuación personal al nuevo entorno, y en particular al EEES, se propone un “Proceso de desarrollo de la Identidad Digital” y del “Aprendizaje en RED”, junto con el diseño del correspondiente “Espacio Personal, y Corporativo, de Trabajo y Aprendizaje” (PLWE/CLWE. Presentación del “PLWE-Suricata”*, basado en iniciativas abiertas.

  14. Des-bordes del conurbano: m7red y una arquitectura sociológica de la Cuenca Matanza Riachuelo

    Syd Krochmalny

    2010-07-01

    Full Text Available Este artículo expone algunas formas de pensar lo urbano a través del estudio de trabajos transdisciplinarios cuyo objeto de investigación es la Cuenca Matanza Riachuelo. Se examinan las trayectorias intelectuales de un grupo de arquitectos que producen proyectos híbridos -sociología, arquitectura, arte y urbanismo- deconstruyendo la noción de “espacio social”. Este concepto teórico metodológico analiza los procesos sociales inscriptos en un espacio determinado o la trama significativa de la ciudad. Es una crítica que estructura la investigación a partir de un grupo de variables controlables analíticamente. Este régimen de conocimiento compartimenta la realidad en diferentes atributos de los cuales el social es el explicativo. En lugar de concebir a la sociedad como el contexto “en el que” todo está enmarcado, estos proyectos consideran “lo social” como uno de los muchos elementos de conexión de las asociaciones heterogéneas. Por lo tanto, la Cuenca Matanza Riachuelo está compuesta por un mapa de actores, situaciones, tópicos, recursos en el que se rastrea las trazas que iluminan las conexiones. En ese sentido, la cuenca no es un territorio continuo, es un ensamblaje de redes heterogéneas donde los lugares de conexión son construidos, no están dados, son inestables.

  15. Cosmografía y astrología en Manila: una red intelectual en el mundo colonial ibérico

    Ana Cecilia Ávalos Flores

    2009-12-01

    Full Text Available The following article will aim at reconstructing an intellectual network of people interested in both astrology and cosmography in seventeenth-century New Spain. This study will trace a particular means of transmission and dissemination of knowledge, namely the exchange of books on astrology, in order to identify a network of astrologers and cosmographers who shared a similar educational background and who had similar motivations to get interested in the so-called occult sciences. By doing so, this research will reflect on the problem of disciplinary boundaries during the early modern-period, and on the question of transmission of knowledge in the Iberian World.//El presente artículo tiene como objeto de estudio dos campos del conocimiento que estuvieron estrechamente relacionados durante el período moderno: la astrología y la cosmografía. Al estudiar algunos casos inquisitoriales contra ciertos cosmógrafos en Filipinas, acusados de practicar astrología juidiciaria, pretende reconstruir una red intelectual de estudiosos que compartían una tradición educativa y perseguían intereses profesionales similares. En su intento por rastrear esta microcomunidad intelectual, el presente estudio subraya la importancia de la transmisión y circulación del conocimiento, tanto a un nivel abstracto como material, no sólo entre el reino español y sus colonias en el Nuevo Mundo, sino también al interior de las colonias mismas.

  16. Una sorprendente victoria: Menem y su red de apoyo en las elecciones internas del peronismo de 1988

    Joaquín Baeza Belda

    2010-11-01

    Full Text Available 1989 supuso para Argentina la llegada a la presidencia del justicialista Carlos Menem y el inicio de un sorprendente giro, dados los antecedentes de su partido, hacia políticas neoliberales. Como paso previo, sin embargo, Menem debió vencer en unas elecciones internas en las que partía, en principio, en clara desventaja ante el favorito Antonio Cafiero, gobernador de la provincia de Buenos Aires y líder de la llamada Renovación peronista. La sorprendente victoria de Menem en 1988 ha sido explicada comúnmente como fruto de la reacción de la sociedad a la clase política, en el contexto de crisis que atravesaba el país, o bien como producto de los límites e insuficiencias de la línea cafierista. Sin desconocer estos enfoques, en este texto abordamos el problema desde la perspectiva interna del peronismo y del propio Menem, describiendo su labor de acumulación y reestructuración de los sectores más ortodoxos del partido, apartados por el avance de la Renovación. El estudio de estas elecciones internas sirve así para explorar las continuidades y rupturas de la Argentina que abre un nuevo ciclo en 1989.Palabras clave: Argentina, peronismo, Menem, Renovación, elecciones, 1988___________________________ABSTRACT:1989 marked the arrival to the Argentinian presidency of the PJ Carlos Menem and the beginning of a surprising twist, considering the history of his party, towards neoliberal policies. As a preliminary step, however, Menem had to overcome in a primary election, in which he was disadvantaged compared to the favorite Antonio Cafiero, Governor of Province of Buenos Aires and leader of the so called “Peronist Renovation”. Menem's stunning victory in 1988 has been commonly explained as the result of society's reaction to the political class, in the context of crisis of the country, or as a result of the limits and shortcomings of the Cafiero’s political line. Without ignoring these approaches, in this paper we approach the

  17. Del MERCOSUR a la Unión Sudamericana (apreciación geopolítica del futuro regional)

    Koutoudjian, Adolfo

    2002-01-01

    Como resultado de las Guerras Mundiales del Siglo XX el Siglo XXI asoma con solo una gran superpotencia planetaria: los EE.UU. No resulta arriesgado plantear que la actual configuración geopolítica mundial tiene fuertes parecidos civilizatorios con el Mundo Romano. En efecto una potencia militar hegemónica, una economía “locomotora” del resto del mundo y, fundamentalmente, una cultura, valores y lenguajes con pretensiones universales. Pero, al igual que Roma, los EEUU no tienen el monopolio d...

  18. Establecimiento de una red de equilibrios biológicos en ecosistemas con presencia de pinsapo (Abies pinsapo Boiss. en Andalucía.

    Navarro Cerrillo, R. M.

    2004-12-01

    Full Text Available In 2001, the Consejería de Medio Ambiente of the Junta de Andalucía established a Monitoring Network on ecosystems of Abies pinsapo Boiss.for evaluating the phytosanitary state in the natural range areas of A. pinsapo in the Iberian Península: Sierra de las Nieves (Málaga, Spain, Sierra de Grazalema (Cadiz, Spain and Los Reales de Sierra Bermeja (Málaga, Spain. This network is based on a 1 x 1 Km grid established throughout the forest stands where Abies pinsapo is present, given by the Mapa Forestal de España (Spanish land cover map, RUIZ DE LA TORRE, 1990. The Network has been constructed from 35 sample plots, which will be visited annually (in summer in order to assess the state of trees. This article describes the network design process and the main results from the first campaign of sampling.

    [fr]
    En mai 2001, la Consejería de Medio Ambiente-Junta de Andalucía a mis sur pied un Réseau pour la surveillance systématique et multitemporelle de l'état de santé et vitalité des forets de Abies pinsapo Boiss. dans ses aires de répartition naturelle dans la Péninsule Ibérique: Sierra de las Nieves (Málaga, Espagne, Sierra de Grazalema (Cádiz, Espagne et Los Reales de Sierra Bermeja (Málaga, Espagne. Cet inventaire a été réalisé à partir d'un réseau d'échantillonnage systématique selon un maillage de 1 x 1 kilomètres couvrant la surface des forêts avec présence de Abies pinsapo, d'après la Mapa Forestal de España (Carte Forestière Espagnole, RUIZ DE LA TORRE, 1990. Après Rétablissement, l'inventaire a été constitué par 35 parcelles d'observation, qui seront visitées annuellement (en été pour évaluer l'état des arbres. Cette note présente le dessin de ce réseau et les résultats de la première campagne de terrain.
    [es]
    En la primavera del año 2001, la Consejería de Medio Ambiente de la Junta de Andalucía estableció una Red de Equilibrios Biol

  19. Simulación de una red Grid con máquinas virtuales para crear un entorno de aprendizaje de la computación de alto desempeño

    Edwin Eduardo Millán-Rojas

    2016-01-01

    Full Text Available Presenta una metodología de construcción de una plataforma para simular una red Grid con máquinas virtuales, con el objetivo de crear entornos virtuales que contribuyan a los procesos de aprendizaje. El diseño utilizado para el desarrollo está basado en un prototipo que contribuye a generar un entorno de simulación de bajo costo a través de la computación de alto desempeño. Como resultado de la investigación se obtuvo un conjunto de máquinas virtuales que pueden ser desplegadas en cualquier equipo de cómputo para simular un entorno Grid; además, se presenta la forma de la configuración de esta red para ser parte integral de la construcción y ejecución de la plataforma como instrumento válido para la enseñanza de la computación de alto desempeño a un bajo coste de hardware y la simulación de los servicios Grid sobre la plataforma.

  20. Usos y tendencias adictivas de una muestra de estudiantes universitarios españoles a la red social Tuenti: la actitud positiva hacia la presencia de la madre en la red como factor protector

    Mercedes Durán

    2015-01-01

    Full Text Available El objetivo de este trabajo fue estudiar, desde el paradigma de usos y gratificaciones, el uso que los estudiantes universitarios españoles (N = 221 hacen de la red social Tuenti, y en qué medida estos usos se asocian con sus niveles de adicción a dicha red social. Además se analizó el papel que los progenitores tienen como facilitadores o inhibidores de dichas tendencias adictivas y el impacto del género. Los resultados muestran cuatro categorías de usos de la red Tuenti: entretenimiento, comunicación a través del muro, comunicación a nivel privado e información social. Además, la actitud positiva hacia la presencia de la madre en la red Tuenti se muestra como un factor de protección de las tendencias adictivas a la red. Por último, se han encontrado diferencias estadísticamente significativas en función del género, tanto en los usos que realizan chicos y chicas, como en sus patrones de adicción a la red Tuenti, de tal manera que los chicos informan de niveles de adicción superiores a los informados por las chicas en el uso de esta red social.

  1. Incidencia de la localización en el precio de la vivienda a través de un modelo de red neuronal artificial. Una aplicación a la ciudad de Valencia

    Fernandez-Duran, Laura; Llorca Ponce, Alicia; Valero Cubas, Soledad; Botti Navarro, Vicente Juan

    2012-01-01

    PROMETEO 2008/051 PROMETEO TIN2008-04446/TIN CONSOLIDER INGENIO 2010 CSD2007-00022 Fernandez-Duran, L.; Llorca Ponce, A.; Valero Cubas, S.; Botti Navarro, VJ. (2012). Incidencia de la localización en el precio de la vivienda a través de un modelo de red neuronal artificial. Una aplicación a la ciudad de Valencia. CT. Catastro. Revista de la Dirección General del Catastro. Abril(74):7-25. http://hdl.handle.net/10251/55336. Senia 7 25 Abril 74

  2. Cuidar del mundo. Labor, trabajo y acción «en una compleja red de sostenimiento de la vida»

    Muñoz Terrón, José María

    2012-12-01

    Full Text Available The text proposes a confrontation between Hannah Arendt's phenomenology of vita activa and the ethics of care. On the one hand, it intends to apply Arendtian distinctions between public and private sphere, and between labor, work and action, to the activity of caring, in order to reaffirm its relevance. On the other hand, the article considers the concept of «world» as key to the definition of care and it attempts a critical reinterpretation of Arendt’s concepts, based on some feminists analysis and a responsive and corporeal phenomenology, to raise a nuanced vindication of public implications of caring, according to proposals of passage from ethics to «politics of care».El texto propone una confrontación entre la fenomenología de la vita activa de Hannah Arendt y la ética del cuidado. Se trata, por una parte, de aplicar las distinciones arendtianas entre esferas pública y privada, y entre labor, trabajo y acción, a la actividad de cuidar, para reafirmar su relevancia; por otra parte, tomando el concepto de «mundo» como clave de la definición de cuidado, se ensaya una reinterpretación crítica de los conceptos de Arendt a partir de algunos análisis feministas y de una fenomenología responsiva y del cuerpo, a fin de plantear una reivindicación matizada de las implicaciones públicas del cuidar, en línea con las propuestas de paso de una ética a una «política del cuidado».

  3. Diseño de una instalación fotovoltaica de conexión a red de 105 kw

    Iglesia Corcuera, David

    2009-01-01

    El objetivo principal del presente documento es realizar el documento técnico para la realización de una central de generación fotovoltaica de 105 KW, sobre una bodega de vinos dispuesta en estructura fija a 30º, para la venta de la producción obtenida a la compañía suministradora ENDESA, así como analizar la viabilidad de la implantación de un sistema de generación de electricidad de éstas características. Además se pretende alcanzar otro tipo de objetivos secundarios como son: fomentar la e...

  4. Optimización de los recursos de red de una organización mediante el uso de un servidor dedicado basado en software libre

    Martín Goyeneche, Víctor

    2012-01-01

    Estudio de optimización de recursos de red basado en la utilización de un servidor dedicado gestionado mediante software libre. Estudi d'optimització de recursos de xarxa basat en la utilització d'un servidor dedicat gestionat mitjançant programari lliure.

  5. Diseño de una instalación fotovoltaica de venta a red con monitorización de energía

    Crego Villarroel, Rubén

    2013-01-01

    Este proyecto nace de la necesidad que hoy en día hay por apostar por las energías renovables, ya que, cada vez más, se invierte en mejorar el rendimiento y así obtener una total independencia de éstas frente a las energías convencionales. Tras hacer una introducción de las energías renovables, más en concreto la energía solar fotovoltaica, el primer punto que se plantea es la ubicación de la instalación, además de los mapas característicos de la zona. En este proyecto se ha elegido el tér...

  6. La red perinatal del sur-oriente D.C. una estrategia para mejorar la atención de la madre y el niño

    Monterrosa Esperanza de

    1996-06-01

    Full Text Available Con el objeto de argumentar el tema y a la vez justificar la creación de la red perinatal en el sur-oriente de Santafé de Bogotá, es necesario acudir a indicadores que describan así sea de manera general la situación materno infantil, en el contexto nacional y específicamente en el distrito capital.

  7. Diseño e implementación de una herramienta para la verificación de cobertura de la red SIGFOX. Estudio de conectividad en una zona geográfica de orografía compleja

    Cárdenes Tacoronte, Daniel

    2016-01-01

    Entre los diferentes actores que están permitiendo que el Internet de las cosas sea finalmente una realidad, los operadores de redes inalámbricas de largo alcance y bajo consumo, especializados en proveer servicios de conexión a millones de dispositivos, están jugando un papel fundamental. Por otro lado, la capacidad de proporcionar ubicuidad a todos esos dispositivos está supeditada a los niveles de cobertura que dichos operadores sean capaces de dar, siendo necesaria, en la mayoría de los c...

  8. El modelo hrv para la expansión óptima de redes de transmisión. Una aplicación a la red eléctrica de Ontario

    Juan Rosellón; Juan Tregear; Eric Zenón

    2012-01-01

    Este documento presenta la aplicación de un mecanismo que provee incentivos para la inversión en expansión de redes en el sistema eléctrico de la provincia de Ontario, Canadá. Tal mecanismo combina tanto un enfoque de mercado como uno regulatorio. Se basa en el rebalanceo de una tarifa en dos partes dentro de un contexto de mercado eléctrico mayorista, a la par de la fijación de precios nodales. La expansión de la red se lleva a cabo a través de subastas de derechos financieros de transmisión...

  9. Gestión de red

    Barba Martí, Antonio

    1999-01-01

    Esta obra pretende introducir al lector en el mundo de la gestión de red dando una visión general de las arquitecturas y entornos de gestión existentes. Últimamente, aspectos como el control, la gestión de red o la gestión de servicios están obteniendo una mayor importancia para los operadores de red. Una de las razones fundamentales estriba en que los clientes cada vez más exigen una mayor calidad de servicio a un menor precio. De esta forma, se ha desatado una competencia entre operadores p...

  10. GeoSteamNet: A computer code to simulate geothermal steam flow in a pipeline network; GeoSteamNet: Programa de computo para simular el flujo de vapor geotermico de una red de vaporductos

    Verma P., Mahendra; Aragon A., Alfonso [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)]. E-mail: mahendra@iie.org.mx; Ruiz L., Alejando; Mendoza C., Alfredo [Comision Federal de Electricidad, Campo Geotermico Los Azufres, Campamento Agua Fria, Michoacan (Mexico)

    2011-07-15

    transporte del flujo de vapor en una red de vaporductos de un campo geotermico. El movimiento del fluido se rige por los siguientes principios basicos: la conservacion de la masa, el principio de movimiento lineal (segunda ley de Newton o las ecuaciones de Navier Stokes) y la primera y segunda leyes de la termodinamica. La segunda ley de la termodinamica permite definir la direccion de un proceso espontaneo, que esta indirectamente validado en el algoritmo, debido a que el vapor fluye de alta a baja presion y el calor fluye de alta a baja temperatura. Las ecuaciones no lineales se resuelven con el metodo de Newton-Raphson. Utilizando el componente ActiveX OrificeMeter, se realizo el balance de masa para el flujo de vapor en las unidades de generacion U-15 y U-16 del campo geotermico de Los Azufres, Mich., en febrero de 2009. La U-15 fue alimentada por los pozos productores AZ-04, Z-28, Z-30, AZ-65D, y AZ-66, mientras que los pozos AZ-28A, AZ-45, Z-56, Z-67 y AZ- 69D estaban conectados a la U-16. La diferencia entre la cantidad de vapor recibida en las unidades y producida por los pozos respectivos esta dentro de {+-}4%, lo cual es aceptable para fines practicos para el suministro de vapor, tomando en cuenta las incertidumbres en varios parametros tales como la presion, la temperatura, la fluctuacion de la presion en el cabezal del pozo, entre otros. Los resultados de la simulacion de una red hipotetica de vaporductos de un sistema geotermico con dos pozos productores y una planta de generacion de energia electrica ilustran la funcionalidad de GeoSteamNet, mostrando varios puntos importantes a destacar. Para una geometria especifica de las redes de vaporductos solo hay una cierta cantidad de masa (vapor) que puede ser transportado a una presion dada de los pozos y de la planta generadora. La construccion y modificacion de una red de vaporductos son muy costosas y la produccion de pozos geotermicos responde a los factores de su naturaleza, por lo tanto, hay necesidad de

  11. Modelado y simulación orientada al análisis de una micro-red eléctrica con generación fotovoltaica

    Ruiz Allende, Felipe

    2010-01-01

    El objetivo principal de este proyecto se centra en el estudio de armónicos en un micro-red, con generación fotovoltaica en un entorno residencial sub-urbano. En particular este estudio pretende: Predecir y evidenciar los efectos de los amónicos en los sistemas de generación distribuida con generación fotovoltaica. Estudiar el efecto de los lazos de control de los inversores fotovoltaicos. Estudiar los efectos de la distorsión armónica producto del control de los inversores....

  12. Ambientes Inteligentes: middleware de soporte para la captura, almacenamiento y publicación de datos de una red de sensores inalámbricos

    Godoy, Diego Alberto; Sosa, Eduardo Omar; Neis, Raúl; Díaz Redondo, Rebeca

    2014-01-01

    En este trabajo se presenta un middleware para la captura, almacenamiento y publicación de datos obtenidos de redes de sensores inalámbricos para su utilización en aplicaciones de Ambientes Inteligentes e Internet de las Cosas. Se ha desarrollado un framework para abstraer las tareas de captura, almacenamiento y Publicación. Se han llevado a cabo pruebas de la utilización del framework en cuanto a su funcionalidad y versatilidad de consultas de los distintos datos generados por la red de sens...

  13. Prevención de los menores ante los peligros de la Red: una propuesta de formación a las familias

    Martínez-Antolino, María Teresa

    2014-01-01

    Los menores crecen de la mano de las nuevas tecnologías. Necesitan de guías que puedan educarlos en la protección de los posibles peligros que derivan del uso de éstas. Este trabajo, pretende analizar la importancia que tiene crear un entorno seguro en la Red para los menores y plantear un taller de formación en el que los padres de alumnos de Educación Primaria comprendan, entiendan y aprendan a trasmitir a sus hijos, los posibles peligros que derivan del uso de Internet. Como metodología, s...

  14. Despliegue y análisis de la cobertura de una red WiMAX basada en IEEE 802.16-2004

    Anglès Vázquez, Albert

    2008-01-01

    Aquest projecte tracta de l'estudi de la cobertura WiMAX basada en la variant 802.16-2004 en la que opera a 3.5 GHz en diferents escenaris d'un campus universitari. Primerament es realitza una introducció general a WiMAX i es defineixen els equips utilitzats. Posteriorment es comença a dur a terme un estudi de la cobertura WiMAX en diferents escenaris: indoor y outdoor per tal de poder extreure models empírics simplificats de path loss a partir de mesures realitzades amb els terminals WiMAX. ...

  15. Estudio de viabilidad de evacuación a la red de transporte de una central solar térmica

    González Collados, Francisco Javier

    2009-01-01

    En los últimos años la demanda de energía eléctrica por todo el mundo ha tenido un crecimiento espectacular. Particularmente en España este aumento se ha podido notar tanto en el ámbito doméstico como en el industrial. Puesto que el consumo de energía es uno de los grandes medidores del progreso y bienestar de una sociedad, es ahora cuando se especula con el concepto de crisis energética debido a que las fuentes de energía de las que se abastece la sociedad se agotan paulatinamente. Un modelo...

  16. La Webquest: una metodología apoyada en la red para renovar la docencia en Educación Superior

    Roig Vila, Rosabel; Flores Lueg, Carolina; Álvarez Teruel, José Daniel; Blasco Mira, Josefa Eugenia; Grau Company, Salvador; Guarinos Navarro, Ignacio; Lledó Carreres, Asunción; López Meneses, Eloy; Lorenzo Lledó, Gonzalo; Martínez Almira, María Magdalena; Mengual Andrés, Santiago; Mulero González, Julio; Perandones González, Teresa María; Segura Abad, Lorena; Suárez Guerrero, Cristóbal

    2014-01-01

    La WebQuest responde a una estrategia didáctica basada en la incorporación de las TIC en el aula, cuyo sustento teórico está en las corrientes constructivistas y el aprendizaje colaborativo, siendo de este modo pertinente a las directrices del EEES. En virtud de ello, nos hemos propuesto enfocar nuestras prácticas docentes aprovechando dicha estrategia didáctica y los recursos disponibles en la Web 2.0. Ahora bien, consideramos que como paso previo a la implementación de cualquier recurso TIC...

  17. Trabajo cooperativo en matemáticas: Enseñanza de sistemas de ecuaciones a alumnos de 4º de ESO mediante una red social

    Álvarez-Santonja, Oscar

    2013-01-01

    Este trabajo se ha centrado en estudiar la enseñanza de la asignatura de matemáticas, a través del uso de las redes sociales como medio para configurar un aprendizaje cooperativo de los contenidos seleccionados. Comienza con la realización de una investigación para fundamentar la base teórica de la parte relacionada con el trabajo cooperativo, el uso de las TIC y de la correspondiente a los contenidos curriculares seleccionados. Seguidamente, se presenta un trabajo de campo med...

  18. Red de sensores inalámbricos para el monitoreo de alertas tempranas en minas subterráneas: una solución a la problemática de atmósferas explosivas en la minería de carbón en Colombia

    Álvaro Romero Acero; Alejandro Marín Cano; Jovani Alberto Jiménez Builes

    2013-01-01

    En este artículo se presenta una alternativa de automatización y control en el monitoreo de alertas tempranas de atmosferas explosivas, mediante el protocolo ZigBee. El propósito es diseñar una red de sensores ina- lámbricos inteligentes para recopilar la información, de forma rápida y confiable, sobre las concentraciones de gases que generan una amenaza de atmósferas explosivas en minas subterráneas. De forma remota se pueden determinar los límites de alerta de acuerdo a los datos suministra...

  19. El concepto de mediación tecnológica en Bruno Latour : una aproximación a la Teoría del Actor Red.

    Gonzalo Matías Correa-Moreira.

    2012-01-01

    La Teoría de Actor Red (TAR) se constituye en un valioso repertorio de herramientas conceptuales y metodológicas para el estudio de los fenómenos de características socio-técnicas. En el presente artículo se presenta la noción de mediación tecnológica elaborada por Bruno Latour en tanto uno de los principales elementos de esta teoría. A la vez se explica la emergencia de la TAR en los estudios sociales sobre ciencia y tecnología y se concluye en su aplicabilidad sobre fenómenos complejos de r...

  20. Diseño y desarrollo de una red BAN Bluetooth para la monitorización en enfermos de parkinson

    Rica Escriche, Adrià

    2013-01-01

    Este trabajo final de grado se ha desarrollado en el Centre Tecnològic de Recerca per a la Dependència i la Vida Autònoma (CETpD). El CETpD es un centro de investigación, cuyo objetivo es ayudar a personas con dependencia a través de tecnologías que incrementen su calidad de vida. Una de sus líneas de investigación se centra en el análisis del movimiento humano, concretamente en las alteraciones de la marcha como en el caso de pacientes con la enfermedad de Parkinson (EP). Por ello, el CETpD ...

  1. Inteligencia de red

    Barba Martí, Antonio; Hesselbach Serra, Xavier

    2002-01-01

    Bibliografia Actualmente existe una necesidad cada vez mayor de ofrecer servicios de red avanzados, que proporcionen un alto valor añadido al cliente. Eso es ya posible gracias a las nuevas capacidades de computación añadidas a los nodos de red, que proporcionan inteligencia y facilitan la gestión de red a los operadores y proveedores de servicios. En este texto, se presentan las nuevas redes inteligentes basadas en señalización número 7, los nuevos servicios sobre Internet (voz sobre IP, ...

  2. Conceptualización de una red social educativa que integre de forma colaborativa las aplicaciones e-learning de la Universidad de las Ciencias Informáticas

    Yusel Arias Guerra

    2012-03-01

    Full Text Available Las Tecnologías de la Información y las Comunicaciones desempeñan un papel esencial en el proceso de aprendizaje. Actualmente, ha tenido un gran impacto incorporar elementos de la web 2.0 en los procesos formativos, lo cual constituye un potente medio para construir el conocimiento de forma colaborativa. En la Universidad de las Ciencias Informáticas se utilizan aplicaciones e-learning como apoyo al proceso docente, entre ellas se encuentran el Repositorio de Objetos de Aprendizaje RHODA, la Herramienta de Autor para la Creación de Objetos de Aprendizaje de forma colaborativa CRODA, y la plataforma de gestión del aprendizaje EVA. Estas herramientas poseen una organización muy centralizada y poca interrelación entre los grupos docentes. Con la puesta en marcha de un nuevo modelo de formación en la Universidad que vincula el estudio con la producción e investigación, y el auge que ha tenido la web 2.0 en la formación, se evidencia la necesidad de incentivar el uso colaborativo de las aplicaciones e-learning de la universidad, conscientes de la importancia y ventajas que esto pudiera aportar al proceso de enseñanza-aprendizaje. Esta investigación está enfocada a propiciar los elementos necesarios para integrar de forma colaborativa las aplicaciones e-learning de la Universidad, en la cual se definen las principales funcionalidades que debe incorporar una Red Social Educativa que integre estas aplicaciones. Además, se validan estas funcionalidades poniéndolas a consideración de un conjunto de expertos con el objetivo de valorar el nivel de aceptación que tendría la propuesta de solución.

  3. A sampling design for a Sentinel General Practitioner Network Diseño de selección de muestra para una red de medicos centinela

    Napoleón Pérez-Farinós

    2009-06-01

    ón sobre los médicos de Atención Primaria y la población atendida procede del Instituto Madrileño de Salud para 2005. La unidad geográfica de referencia fue la Zona Básica de Salud. Partiendo de variables demográficas, socioculturales y sociolaborales, se realizó un análisis factorial. Se hizo un análisis de clusters para agrupar las 247 Zonas Básicas de Salud en estratos homogéneos. Como comprobación se realizó un análisis discriminante. Se seleccionaron los médicos necesarios en cada estrato mediante muestreo aleatorio simple. Se estudió la representatividad de la población vigilada con respecto a la población de Madrid. Resultados: Se extrajeron 5 factores mediante análisis factorial. Se obtuvieron 14 estratos, que el análisis discriminante demostró homogéneos y distintos entre sí. Se determinó que era necesario vigilar una población mínima de 146.946 adultos y 24.518 niños, distribuidos proporcionalmente en cada estrato. Se seleccionaron 88 médicos de familia y 32 pediatras, que cubrían unas poblaciones de 154.610 y 31.336 personas, representativas de la población general. Conclusiones: La obtención de muestras con un adecuado diseño asegura la validez de la información generada por redes centinelas sanitarias en la vigilancia epidemiológica. Debe buscarse la representatividad de la población estudiada con respecto a la población general. El análisis de clusters y el muestreo aleatorio simple son métodos que responden a esta necesidad. La selección de médicos mediante métodos probabilísticos permite conocer la precisión de las estimaciones.

  4. una experiencia en Mauritania

    J. M. Fernández-Palacios

    2008-01-01

    Full Text Available El macizo del Tagant, en la República Islámica de Mauritania, alberga, a lo largo de una red interconectada de humedales, las últimas poblaciones de cocodrilo del desierto Crocodylus niloticus suchus, que hasta muy poco tiempo se consideraban extintas. Estas poblaciones han sido capaces de resistir la desertización del Sahara ocurrida en el Holoceno gracias a la existencia de una serie de pozas (gueltas en árabe, que se forman tras las lluvias monzónicas y que están conectadas entre sí a través de una red de cauces efímeros o permanentes que forman la Cuenca endorreica del Lago Gabou. Estos humedales, carentes de protección en la actualidad, forman además la base económica de los más de cuarenta mil habitantes del macizo, basada en la ganadería y en una precaria agricultura. Conocedor del potencial naturalístico de la zona, el Gobierno de la RIM encargó a nuestra ONG la preparación de una memoria para dar a conocer y conseguir laproteccióninternacional de la zona en el marco de la Convención Ramsar de protección de humedales (UNESCO. El presente trabajo narra como lautilización de una especie focal, el cocodrilo del desierto, para proteger estos valiosos humedales podría ser compatible con el desarrollo de una actividad turística sostenible, basado en el turismo naturalístico y científico, que posibilite un mayor desarrollo a los habitantes del Tagant.

  5. Relevamiento de potenciales clientes finales alternativos a Expofrut del producto uvas de mesa Black Seedless, Imperial Seedless, Red Globe y Flame Seedless, para una PyME radicada en San Juan y exportarlas a aquellos destinos en donde se localicen los potenciales clientes

    Conti Persino, Paula

    2011-01-01

    En el presente trabajo se relevan los potenciales clientes finales alternativos a Expofrut del producto uvas de mesa Black Seedless, Imperial Seedless, Red Globe y Flame Seedless, para una Pyme radicada en San Juan, para luego poder definir la forma más redituable de exportarlas a aquellos destinos en donde se localicen los potenciales clientes. Se decidió desarrollar el presente trabajo de manera tal de poder confirmar o descartar la hipótesis de una mayor obtención de ganancia por exportaci...

  6. Configuración y puesta en marcha de una red de autómatas programables basada en PROFIBUS, MPI GSM para el control y monitorización de módulos de fabricación flexible

    Menchón Ruiz, Francisco José

    2008-01-01

    El trabajo ha sido realizado en el Departamento de Ingeniería de Sistemas y Automática de la Universidad Politécnica de Cartagena, y el objetivo principal es el estudio y posterior implementación de una red de comunicación industrial basada en tecnologías actuales de comunicación que permita la interconexión de diferentes autómatas programables. En concreto, se desarrollará una aplicación que permita, de forma remota, controlar y monitorizar dos procesos industriales (“módulos de fabricación ...

  7. Diseño de instalación eléctrica para acometida e instalación interior de una Planta de Valorización y Reciclaje de Baterías de Plomo-Acido con apoyo de instalación solar fotovoltaica conectada a red

    Céspedes Lasheras, José Juan

    2015-01-01

    El presente proyecto pretende describir y justificar las instalaciones eléctricas tanto de baja como de alta tensión, de una planta industrial dedicada a la Valorización y Reciclaje de Baterías de Plomo-Acido. Igualmente se describirá y justificará la instalación solar fotovoltaica conectada a red, instalada sobre parte de las cubiertas de los edificios que conforman la planta.

  8. Red DirCom

    Joan Costa

    2007-01-01

    Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  9. Red DirCom

    Joan Costa

    2007-01-01

    Full Text Available Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  10. CONSTRUCCIÓN DE UNA RED INSTITUCIONAL DE APOYO PARA LA POBLACIÓN HABITANTE DE LA CALLE: TEJIENDO REDES Construction of an institutional network for homeless support: weaving networks

    Zulma Giraldo Rátiva

    2007-06-01

    Full Text Available Antecedentes. La problemática de la habitancia en calle es un factor que se incrementa diariamente como efecto de situaciones de tipo socioeconómico, político e ideológico. Los antecedentes investigativos demuestran que el abordaje desde la terapia ocupacional y otras disciplinas en cuanto a la habitancia en calle, redes sociales e inclusión social a la luz de los derechos humanos no ha sido ampliamente desarrollados por lo que se hace necesario profundizar esta temática. Objetivos. Abordar la problemática de la habitancia en calle a la luz del modelo de los derechos humanos y la relevancia de las redes institucionales en el proceso de inclusión social de esta población. Fortalecer una red de apoyo institucional ofreciendo una opción de participación social para el habitante y ex-habitante de calle. Material y métodos. Esta investigación aborda a la población habitante y ex-habitante de calle en Bogotá. Las instituciones partícipes de este proceso de fortalecimiento de la red se encuentran ubicadas dentro de Bogotá. Resultados. De las 43 instituciones detectadas, 29 brindaron información, siendo 14 instituciones a las que no se pudo tener acceso, por motivos como: cambio de residencia, números telefónicos incorrectos y ausencia del personal encargado que suministrara información. Conclusión. Dentro de las instituciones detectadas existen diferentes niveles de atención para la población infantil y adulta habitante y ex-habitante de calle , (prevención, promoción, rehabilitación además de acompañamiento y seguimiento por dichas instituciones dentro del sector público y privado.Antecedents. The problematic of homeless a factor that is increased daily as effect of socioeconomic, political and ideological circumstances. The antecedents demonstrate that the boarding from occupational therapy and other social disciplines as far as the homeless, networks and social inclusion to the light of the human rights widely has not

  11. Modelo de red segura en una PYME

    RODRÍGUEZ I SANTONJA, HÈCTOR

    2015-01-01

    Desde el principio de la era digital, la informática ha contribuido en gran medida a la evolución y revolución en el ámbito empresarial, teniendo un papel fundamental en estos procesos. Las ventajas que aporta, así como las comodidades son innumerables: control de maquinaria, sistemas 24x7, software de gestión, comunicación global, servicios web, etc. No obstante, toda esta evolución tecnológica lleva consigo un nuevo paradigma, la seguridad informática y como está afecta directamente a la em...

  12. Eye redness

    Bloodshot eyes; Red eyes; Scleral infection; Conjunctival infection ... There are many causes of a red eye or eyes. Some are medical emergencies and some are a cause for concern, but not an emergency. Others are nothing to worry about. ...

  13. sujetos a Efectos de Red

    José Luis Arroyo Barrigüete

    2005-01-01

    Full Text Available El objetivo del presente artículo es analizar una de las principales características de la Economía Digital: las Externalidades de Red. Dichas Externalidades inducen en los mercados una realimentación positiva que lleva en muchos casos a situaciones prácticamente monopolísticas. Se identificarán aquellas capacidades internas de las empresas que resultan críticas para lograr el éxito en presencia de Efectos de Red así como las principales estrategias que es posible desarrollar en este contexto.

  14. INDICADORES ESTRUCTURALES Y CONGLOMERADOS DE ACTORES EN LA RED SOCIAL DE UNA SUBCULTURA URBANA/STRUCTURAL INDICATORS AND CLUSTERS OF ACTORS IN THE SOCIAL NETWORK OF AN URBAN SUBCULTURE/ INDICADORES ESTRUTURAIS E CONGLOMERADOS DE ATORES NA REDE SOCIAL DE UMA SUBCULTURA URBANA

    José Hernando Ávila-Toscano

    2011-12-01

    Full Text Available Este estudio buscó identificar la estructura de socialización de una subcultura urbana con la medición de indicadores estructurales de su red social e identificación de subagrupaciones. Se empleó el instrumento Arizona Social Support Interview Schedule (ISSIS con 11 miembros de la subcultura roqueros. Se procesaron los datos mediante el análisis de redes sociales (ARS con el software Ucinet, para detectar conjuntos de actores con el procedimiento de conglomerados jerárquicos; y los gráficos de la red se crearon con NetDraw. Se identificaron niveles moderados de indicadores estructurales y las agrupaciones presentaron un número amplio de actores según el criterio de atracción por similaridad. Los subgrupos en la red fueron escasos, lo que muestra a la subcultura como una unidad social cuya integración se da por vinculaciones estrechas entre sus miembros.

  15. Construyendo una Red Chilena para Estudios Socioecológicos a Largo Plazo: Avances, enfoques y relevancia Building a Chilean Network for Long-Term Socio-Ecological Research: Advances, perspectives and relevance

    CHRISTOPHER B ANDERSON

    2010-03-01

    Full Text Available Desde su inicio formal en 1980, los programas de investigación ecológica a largo plazo (LTER por su sigla en inglés han servido como un exitoso marco organizacional para crear agendas de investigación y mecanismos de financiamiento que permiten a los científicos abordar fenómenos ecológicos significativos a las escalas en que ellos ocurren. En sus 30 años de existencia, LTER ha expandido su rango geográfico (actualmente la red Internacional de LTER tiene más de 40 países miembros con sitios de estudios en cada uno de los continentes y focos disciplinarios (principalmente abarcando las ciencias naturales y sociales, llevando a algunos a pedir un cambio de nombre a estudios de investigación socioecológica de largo plazo - LTSER por su sigla en inglés. No obstante, los biomas templados y subantárticos del sur de Sudamérica han carecido de sitios y redes formales de investigación a largo plazo. Sin embargo, numerosos esfuerzos de investigación a largo plazo han existido en Chile y Argentina sin coordinación entre sí. Particularmente, en 2008, el Instituto de Ecología y Biodiversidad puso en marcha el primer esfuerzo sistemático para articular tres sitios existentes (Parque Nacional Fray Jorge - 33° S, Estación Biológica Senda Darwin - 43° S, y Parque Etnobotánico Omora - 55° S. Aquí presentamos un número especial de la Revista Chilena de Historia Natural, dedicado a LTSER, con el objetivo de 1 dar una síntesis de algunos de los casos más emblemáticos casos de investigación socioecológica a largo plazo en Chile; 2 demostrar el valor de estos esfuerzos para la integración de la investigación y educación con resultados y procesos sociales, tales como aquellos relacionados con la toma de decisiones; y 3 ofrecer la perspectiva de una amplia gama de participantes involucrados en estas iniciativas, incluyendo a estudiantes de postgrado y programas asociados desde Iberoamérica y Norteamérica. Es nuestro deseo que

  16. una desgracia en una oportunidad

    Antonio Pont Amenós

    2005-01-01

    Full Text Available Cada vez es más importante para un directivo el gestionar las crisis que puedan presentarse tanto en el terreno económico como social. El incendio que se produjo en la planta de Reus del Grupo Borges es una experiencia de la que se derivaron muchas lecciones y en la que se tuvieron que tomar muchas decisiones sobre la marcha que implicaron liderazgo, relaciones públicas y gestión de empresa en la que se consiguió convertir una desgracia en una oportunidad.

  17. Estudio y diseño de una planta de generación de energía solar fotovoltaica de 1,5 mw, con conexión a la red eléctrica de distribución

    Suárez Martínez, Carlos

    2012-01-01

    El objeto de este proyecto fin de carrera denominado "Estudio y diseño de una planta de generación de energía solar fotovoltaica de 1,5 mw, con conexión a la red eléctrica de distribución", situado en el Campo de Cartagena, en término municipal de Fuente Alamo, en la provincia de Murcia. Para ello se definen todas las características técnicas necesarias que permitan la definición de las infraestructuras para la implantación de la planta fotovoltaica de conexión a red, con estructura fija, de ...

  18. Effect of Californian Red Worm (Eisenia foetida on the Nutrient Dynamics of a Mixture of Semicomposted Materials Efecto de la Lombriz Roja Californiana (Eisenia foetida en la Dinámica de Nutrientes de una Mezcla de Materiales Semicompostados

    Hugo Castillo

    2010-09-01

    Full Text Available The efficiency of composting processes with and without the addition of Californian red worms (Eisenia foetida was evaluated, using manure of dairy cows to generate organic fertilizer. Several parameters were assessed as physio-chemical indicators of maturity, such as temperature, pH, C/N ratio, phytotoxicity and macro and micronutrients at 25 and 54 ws (mature and stored products, respectively. A linear model was used in the statistical analysis, with four replicates that included as fixed effects, the composting systems and time. At 25 wk, both systems reduced the C/N ratio to values of 15.5 in vermicompost and 17.1 in semi-compost. The content of total N, N-NO3, Ca and some micronutrients also increased. K and Na concentrations were higher in the compost than in the vermicompost. The mean of pH presented differences in the two systems of decomposition. The germination index, using lettuce seeds (Lactuca sativa L. var. Grandes Lagos in vitro, of the decomposition products increased in week 25, indicating the degree of maturity reached. The effect of storage was greater stability of the products by reducing the C/N ratio to 8.13 for vermicompost and 7.05 for compost, as well as an increase in available N content in the form of N-NO3 in the case of compost and in the content of Ca, Mg, Na, Zn, Mn and Cu in both systems.Se evaluó la eficiencia de los procesos de compostaje con y sin la adición de lombriz roja californiana (Eisenia foetida usando estiércol de vacas lecheras para la generación de abonos orgánicos. Como indicadores de madurez se evaluaron varios parámetros fisicoquímicos tales como temperatura, pH, relación C/N, fitotoxicidad y macro y micronutrientes durante 25 y 54 semanas (productos maduros y almacenados, respectivamente. En el análisis estadístico se usó un modelo lineal con cuatro repeticiones que incluyó como efectos fijos los sistemas de compostaje y el tiempo. Se realizó análisis de varianza y comparación de

  19. Red de sensores SIPIA

    Mercado, Gustavo; Ortiz Uriburu, Gisela; Diedrichs, Ana; Borgo, Roberto; Gonzalez Antivilo, Francisco; Tromer, Sebastián; Ledezma, Nicolás; Aguirre, Matías; Panella, Cristian; Tabacchi, Germán; Martí, Juan; Grünwaldt, Guillermo; Rigoni, Ignacio; Antón, Gabriel; Chamorro, Fernando

    2012-01-01

    El proyecto consiste en el análisis, implementación y evaluación de una red de sensores inalámbricos basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de tanto ingenieros electrónicos e informáticos como de ingenieros e investigadores agrónomos, Se propone entonces el estudio de estas tecnologías en el contexto de un grupo de investigaciones que permita: • La colaboración interinstitucional e interdisciplinaria en...

  20. una experiencia no formal

    Peter J. Scott

    2008-01-01

    Full Text Available En este documento presentamos parte de un estudio en el que se ha analizado un proceso de aprendizaje desarrollado por estudiantes en interacción directa a través de un entorno de videoconferencia. El estudio cubre un periodo de 6 meses de interacción de un grupo de estudiantes de animación gráfica en diferentes países, quienes han llevado a cabo un total de 99 reuniones. Cada una de estas reuniones ha sido organizada y manejada por la propia comunidad de estudiantes. Al final, los integrantes de la comunidad aparecen como sus propios mentores naturales, y el grupo muestra una enorme capacidad de apoyo mutuo y de asunción de roles de facilitación mutua en el contexto de dicho intercambio. En este estudio podemos ver cómo los estudiantes pueden apoyarse mutuamente de manera eficiente en un contexto de colaboración no formal y además podemos observar cómo sistemas de videoconferencia en red pueden ayudar a facilitar y transformar una comunidad de aprendizaje, incluso sin la intervención formal de aulas o profesores.

  1. Proyecto básico de mejora de la red de saneamiento de Vilamarín (Ourense).

    NÓVOA GONZÁLEZ, DAVID

    2016-01-01

    [ES] Debido a que Galicia es una región con una gran frecuencia en lluvias y con el fin de evitar el tratamiento de aguas pluviales en una E.D.A.R., obteniendo beneficios a nivel económico, ecológico y social. Por ello se propone realizar una mejora de la red de saneamiento de la población de Vilamarín. Para tal fin se prevé sustituir la actual red unitaria de saneamiento y disponer una red separativa de pluviales y residuales, para ello se calculará una nueva red para aguas pluviales, dejand...

  2. Incidencia de la resucitación cardiopulmonar hospitalaria. Análisis de los registros del CMBD de la red hospitalaria de una región española durante 13 años

    Bouchotrouch, Houssein

    2016-01-01

    OBJETIVOS: El objetivo primario de este estudio fue el de analizar la incidencia y la supervivencia de los casos de parada cardíaca intrahospitalaria (PCIH) registrados en la base de datos de altas hospitalarias de la red hospitalaria de Castilla y León y comprobar si a lo largo del tiempo se produjeron cambios epidemiológicos y de resultados en este proceso. Otros objetivos fueron el de analizar la utilidad del registro administrativo CMBD de altas hospitalarias de la red hospitalaria de Cas...

  3. Generación de un prototipo de externalización de gestión de conocimiento que implemente una red social para el departamento de investigación en la escuela colombiana de carreras industriales ECCI

    Ángel-Rodríguez, Alba Dalila

    2013-01-01

    La Gestión de Conocimiento es una metodología que consiste en administrar los datos e información de cualquier organización donde el apoyo de las nuevas tecnologías facilita este proceso dándole un sentido social y cultural al mismo. Dentro de este marco las industrias han venido presenciando la necesidad de gestionar la información ya que sus sistemas de información y comunidad empresarial necesitan de una comunicación constante no solo dentro de la operatividad sino de la experticia de los ...

  4. Implementación de un esquema criptográfico para gestionar de forma segura las historias médicas de los pacientes a través de una red de comunicaciones

    Cáncer Giner, Fran

    2007-01-01

    En aquest projecte de final de carrera s'ha dissenyat, implementat i provat un sistema que utilitzant criptografia de clau pública, garanteix la correcta utilització de les dades en un procés de consulta i complimentació d'una història clínica informatitzada consultada a distància.

  5. Disseny i instal·lació d'una xarxa Wi-Fi empresarial

    Jara Ortega, Antonio

    2013-01-01

    Instal·lació d'una xarxa Wi-Fi que serveix per cobrir les deficiències quant a instal·lacions i cobertura de xarxa d'una empresa química. Instalación de una red Wi-Fi que sirve para cubrir las deficiencias en cuanto a instalaciones y cobertura de red de una empresa química. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  6. Red Sirius

    A hypothesis is proposed explaining the assumption that Sirius changes its colour from red in the second century to pale blue in the tenth century A.D. The hypothesis is based on the possibility of transformation of a Sirius satellite (Sirius B) from a red giant in the past to a white dwarf in the present. Such a transformation would have been accompanied by an explosion of Sirius B, which is clearly visible from the Earth. The fact that the increase in Sirius brightness by 4-5 units is not reflected in historical chronicles is attributed to the degradation of sciences in Europe in 4-10 centuries

  7. PROTOTIPO PARA EL ANÁLISIS DEL RENDIMIENTO EN EL TRÁFICO DE UN SERVICIO BROADCAST UTILIZANDO LOS PROTOCOLOS HTTP Y RTP SOBRE IPV6 EN UNA RED ACADÉMICA DE TECNOLOGÍA AVANZADA

    Roberto Ferro

    2011-08-01

    Full Text Available En el presente artículo se condensan los resultados obtenidos de la implementación y modelado de un Prototipo de Servicio Streaming sobre el Sistema Operativo Fedora 13 con el Programa VLC en la Red de Investigación y  Tecnología Avanzada de la Universidad Distrital RITA-UD sobre IPV6 utilizando como cliente la Universidad Minuto de Dios vía RUMBO mediante un Tunel 6a4.

  8. Detecting and classifying faults on transmission systems using a backpropagation neural network; Deteccion y clasificacion de fallas en sistemas de transmision empleando una red neuronal con retropropagacion del error

    Rosas Ortiz, German

    2000-01-01

    Fault detection and diagnosis on transmission systems is an interesting area of investigation to Artificial Intelligence (AI) based systems. Neurocomputing is one of fastest growing areas of research in the fields of AI and pattern recognition. This work explores the possible suitability of pattern recognition approach of neural networks for fault detection and classification on power systems. The conventional detection techniques in modern relays are based in digital processing of signals and it need some time (around 1 cycle) to send a tripping signal, also they are likely to make incorrect decisions if the signals are noisy. It's desirable to develop a fast, accurate and robust approach that perform accurately for changing system conditions (like load variations and fault resistance). The aim of this work is to develop a novel technique based on Artificial Neural Networks (ANN), which explores the suitability of a pattern classification approach for fault detection and diagnosis. The suggested approach is based in the fact that when a fault occurs, a change in the system impedance take place and, as a consequence changes in amplitude and phase of line voltage and current signals take place. The ANN-based fault discriminator is trained to detect this changes as indicators of the instant of fault inception. This detector uses instantaneous values of these signals to make decisions. Suitability of using neural network as pattern classifiers for transmission systems fault diagnosis is described in detail a neural network design and simulation environment for real-time is presented. Results showing the performance of this approach are presented and indicate that it is fast, secure and exact enough, and it can be used in high speed fault detection and classification schemes. [Spanish] El diagnostico y la deteccion de fallas en sistemas de transmision es una area de interes en investigacion para sistemas basados en Inteligencia Artificial (IA). El calculo neuronal

  9. Tecnologías semánticas para la evaluación en red: análisis de una experiencia con la herramienta OeLE

    Sánchez Vera, María del Mar; Prendes Espinosa, Mª Paz; Fernández Breis, Jesualdo Tomás

    2013-01-01

     No cuestionamos ya el importante papel que tienen las Tecnologías de la Información y la Comunicación (TIC) en nuestra realidad universitaria actual. El rápido devenir de estas herramientas ha supuesto la configuración de nuevos espacios de enseñanza-aprendizaje dentro de las distintas modalidades de enseñanza universitaria actuales. En este artículo se presentan los resultados de una investigación realizada tras la incorporación de un programa que permite realizar y corregir pruebas de eval...

  10. Diseño de una nano-red de generación y distribución de energía eléctrica para embarcaciones de recreo

    Cortés Quintana, Carlos; Salvador Lucenilla, Juan Carlos

    2012-01-01

    En el present projecte es realitza una proposta d’arquitectura de l’ instal lació elèctrica per a embarcacions d’esbarjo amb eslora compresa entre 15 y 24 m, junt amb el seu protocol de dimensionat. Degut al gran avanç de la tecnologia dels últims anys, la potència y els receptors elèctrics instal lats en aquest tipus d’embarcacions han experimentat un augment considerable. Contràriament, l’ instal lació elèctrica s’ha quedat estancada en el temps sense patir grans modificac...

  11. Uso de algoritmos genéticos para resolver el modelo determinista y estocástico para el diseño de una red de recogida de residuos

    Ortega Mier, Miguel Angel; Delgado Hipólito, Joaquín; García Sánchez, Álvaro

    2008-01-01

    Unos de los problemas que aparecen en la gestión de las cadenas de suministro inversas es el de las decisiones relativas a la localización de plantas de tratamiento, centros de recogida y de transferencia. En esta comunicación se presentan un modelo determinista MIP y el modelo estocástico derivado para ayudar a la decisión relativa a la localización de una planta de tratamiento y los centros de transferencias necesarios para reducir los costes totales de funcionamiento de un sistema de recog...

  12. Lectums: red social para amantes de la lectura

    Hernández Trueba, Alexandre

    2011-01-01

    “Lectums, red social para amantes de la lectura” es un proyecto de fin de carrera con el que se pretende hacer un prototipo para Lectums, una red social dedicada a gente a la que le gusta la lectura y quiere compartir su afición y sus gustos literarios. Para ello se necesita crear una parte pública en la que los usuari...

  13. "mbigoo!", la red social para foodies.

    García Pumar, Javier

    2016-01-01

    Este trabajo fin de grado consiste en la elaboración de la web de una red social para aficionados a la gastronomía, englobando todo el ciclo de procesos de creación y siguiendo los principios del diseño centrado en el usuario (DCU), para obtener un primer prototipo con unas funcionalidades mínimas, que sea flexible y ampliable en el futuro, y que represente una opción de negocio. A partir de analizar las tendencias actuales, surge la gastronomía como un campo en plena ebullición, ...

  14. Estudio de la viabilidad de la energía mini-eólica para el abastecimiento de una casa aislada de la red eléctrica

    Matanzo Senra, Alejandro

    2009-01-01

    El objetivo principal de este proyecto realizado en Italia, en la “universittà polittecnica degli studi di cassino (Roma)”, fue el estudio de viabilidad tanto en materia tecnológica como económica de la aplicación de la energía eólica a pequeña escala en lugares aislados de la red eléctrica. Para el estudio se contó con un trabajo sobre el diseño de las piezas de montaje de un pequeño aerogenerador ya realizado anteriormente por el departamento de energías renovables de la univ...

  15. Red Alive

    Reynaldo Thompson Lopez

    2010-01-01

    Full Text Available Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  16. Red Alive

    Reynaldo Thompson Lopez

    2010-01-01

    Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  17. Las bibliotecas AECID. Una propuesta

    Prieto Gutiérrez, Juan José; Moreno Cámara, Alicia

    2008-01-01

    La Agencia Española de Cooperación Internacional para el Desarrollo (AECID) a través de sus Centros Culturales y Centros de Formación en Iberoamérica y África es poseedora de 22 bibliotecas repartidas en sendos continentes. Son espacios culturales, informativos, educativos y lúdicos, abiertos a todos los sectores sociales en el que los libros han dejado de ser la única fuente de información. La creación de una red bibliotecaria que las cubra y proteja se hace necesaria para su crecimiento y p...

  18. Convergencia débil de una sucesión de grafos aleatorios radiales de Bernoulli

    Leon A. Valencia

    2016-01-01

    Full Text Available En este artículo se introduce una colección de trayectorias aleatorias radiales coalescentes definidas sobre una región del plano, y se probará que, en una escala difusiva, dicha colección converge en distribución, mediante homeomorfismo, a una restricción de la Red Browniana.

  19. Una red para promover sistemas de salud basados en la atención primaria de salud en la Región de las Américas A network to promote health systems based on primary health care in the Region of the Americas

    María Magdalena Herrera Vázquez

    2007-05-01

    Full Text Available OBJETIVOS: Identificar los componentes relacionales de una red internacional de organizaciones de cooperación técnica y financiera que promueva el desarrollo de sistemas de salud basados en la atención primaria de salud (APS en los países de la Región; analizar los vínculos de acción social para la cooperación en salud entre los socios colaboradores de la Organización Panamericana de la Salud (OPS; y determinar los elementos teóricos básicos que pueden contribuir a desarrollar estrategias de acción que respalden la abogacía en red. MÉTODOS: Estudio transversal cualitativo y cuantitativo basado en la identificación de informantes clave y el análisis de redes sociales. Se colectó información etnográfica y relacional de 46 organizaciones internacionales mediante un cuestionario semiestructurado autoaplicado. Participaron 29 tomadores de decisión pertenecientes a 29 organizaciones de cooperación internacional en salud (tasa de respuesta: 63,0%. La estructura y solidez de la red se evaluó mediante la densidad, la distancia, la transitividad y la centralización de los nodos. El análisis estadístico se realizó mediante los programas informáticos UCINET, PAJEK y MS Access, entre otros. RESULTADOS: Se identificó una red teórica estructuralmente centralizada, cuyos nodos aglutinados en cuatro subgrupos centrales se vincularon en una visión compartida. El liderazgo, la influencia y los intereses políticos reflejaron los vínculos cooperativos de tipo formal y técnico y el apoyo formal a favor de la propuesta, con el predominio del flujo de recursos técnicos sobre los financieros. CONCLUSIONES: Los componentes relacionales interorganizacionales y los vínculos de acción social identificados pueden influir positivamente en la conformación y consolidación de una red temática de abogacía y gestión para la cooperación técnica y financiera en apoyo a la APS en la Región de las Américas. Los vínculos de acci

  20. Seeing Red

    2008-01-01

    This New Horizons image of Jupiter's volcanic moon Io was taken at 13:05 Universal Time during the spacecraft's Jupiter flyby on February 28, 2007. It shows the reddish color of the deposits from the giant volcanic eruption at the volcano Tvashtar, near the top of the sunlit crescent, as well as the bluish plume itself and the orange glow of the hot lava at its source. The relatively unprocessed image on the left provides the best view of the volcanic glow and the plume deposits, while the version on the right has been brightened to show the much fainter plume, and the Jupiter-lit night side of Io. New Horizons' color imaging of Io's sunlit side was generally overexposed because the spacecraft's color camera, the super-sensitive Multispectral Visible Imaging Camera (MVIC), was designed for the much dimmer illumination at Pluto. However, two of MVIC's four color filters, the blue and 'methane' filter (a special filter designed to map methane frost on the surface of Pluto at an infrared wavelength of 0.89 microns), are less sensitive than the others, and thus obtained some well-exposed views of the surface when illumination conditions were favorable. Because only two color filters are used, rather than the usual three, and because one filter uses infrared light, the color is only a rough approximation to what the human eye would see. The red color of the Tvashtar plume fallout is typical of Io's largest volcanic plumes, including the previous eruption of Tvashtar seen by the Galileo and Cassini spacecraft in 2000, and the long-lived Pele plume on the opposite side of Io. The color likely results from the creation of reddish three-atom and four-atom sulfur molecules (S3 and S4) from plume gases rich in two-atom sulfur molecules (S2 After a few months or years, the S3 and S4 molecules recombine into the more stable and familiar yellowish form of sulfur consisting of eight-atom molecules (S8), so these red deposits are only seen around recently-active Io volcanos

  1. Incunables de la Red de Bibliotecas y Archivos del CSIC

    López Monjón, Juan Pedro

    2014-01-01

    El Grupo de Trabajo de Patrimonio Bibliográfico de Rebiun está elaborando una Guía de Incunables en las Bibliotecas Universitarias. Como parte de la preparación de la misma realizó una encuesta en la que participó la Red de Bibliotecas y Archivos del CSIC y que ha servido para realizar una primera toma de contacto con los incunables que custodian las bibliotecas de la Red siguiendo el mismo esquema de la encuesta.

  2. Educación en medios en Turquía: hacia una red de actores múltiples Media Education in Turkey: Toward a Multi-Stakeholder Framework

    E. Nezih Orhon

    2009-03-01

    Full Text Available A partir de los noventa, los canales privados de radio y televisión pusieron las bases de la nueva estructura mediática turca. No hubo en este momento interés alguno por la alfabetización mediática ni por la educación popular sobre los medios de comunicación social, ni siquiera en la juventud. Hasta 2006 no comienzan en Turquía los primeros pasos para una alfabetización y educación mediáticas con un acuerdo entre el Ministerio de Educación y el Consejo Supremo de Radio y Televisión (RTÜK. La agenda de la alfabetización mediática ha de incluir importantes temas, co mo democracia, ciudadanía, derechos humanos, libertad de expresión, identidad, necesidades especiales, cuestiones de discriminación de género… Mediante un enfoque crítico, se reflexiona sobre lo que hasta ahora se ha hecho en Turquía en términos de alfabetización y educación en medios, y lo que se quiere lograr en el futuro. Starting with the 1990s, private radios and televisions were the primary steps in Turkish media’s new structure. At that time, there was no interest in media literacy or media education for people, especially for children. In the past, the emphasis of media literacy education was to protect children and young people from possible harmful effects of media, followed by the critical thinking and development of media messages production skills. This contribution emphasizes the political, social, and economic implications of media messages and stresses the importance of using media effectively. Media literacy and education in Turkey has started with an agreement between the Ministry of National Education and The Radio and Television Supreme Council (RTÜK in 2006/07 school period.This study uses a critical approach to reflect on what has been done so far in Turkey in terms of media literacy and media education, and what needs to be accomplished in the future.

  3. Una herramienta imprescindible: el analizador de protocolos

    Mayordomo Pérez, Samuel

    2003-01-01

    Un analizador de protocolos es un equipo de telecomunicaciones capaz de monitorizar el tráfico que pasa por una red e interpretarlo mediante unas reglas establecidas (protocolos). Bajo esta definición simplista se esconden unos equipos tecnológicamente muy avanzados, que han desempeñado y desempeñan un papel fundamental en el desarrollo de las telecomunicaciones. Cuando hablamos de redes de telecomunicaciones, tenemos la certeza de que los analizadores de protocolos han participado en al...

  4. Comparación de la Evaluación Tradicional del Desarrollo Psicomotor versus una Prueba Autoadministrada Comparison of Traditional Psychomotor Development Evaluation versus a Self-Administe-red Test?

    LUISA SCHONHAUT B

    2010-12-01

    Full Text Available Introducción: El propósito del estudio fue evaluar la aplicabilidad de un cuestionario de autoreporte para el screening del desarrollo psicomotor (DSM en atención primaria de salud (APS. Para ello se analizó el grado de acuerdo entre el cuestionario Ages and Stages (ASQ y la Escala de Evaluación del Desarrollo Psicomotor (EEDP, que es el método empleado de rutina en APS. Además, se exploraron las percepciones y valoraciones comparativas de profesionales que participaron en la aplicación de dichos test. Metodología: Estudio cuanti-cualitativo, realizado entre noviembre 2008 y diciembre 2009. En 2 centros de Salud de la Región Metropolitana de Chile se reclutó lactantes nacidos de término, que acudieron a control sano. A los 8 y 18 meses se les solicitó a los padres o cuidadores principales completar el ASQ y un profesional de APS aplicó el EEDP. Se midió la correlación y concordancia entre ambos test. Se aplicaron entrevistas individuales y mini focus groups a los profesionales participantes en las evaluaciones. Resultados: Fueron reclutados 330 lactantes. La frecuencia de déficit del DSM fue 8,79% en EEDP y 12,73% en ASQ (p0,05. Hubo correlación entre ambas evaluaciones (r 0,5 y la concordancia en la pesquisa de déficit de DSM fue buena (kappa 0.576. En el análisis cualitativo destacó la valoración positiva del ASQ, tanto como instrumento de medición, como guía para promover el DSM. Para suplir las debilidades del ASQ, relacionadas con la modalidad de autoreporte, en grupos de mayor riesgo socio cultural o educacional, los centros de salud adoptaron diferentes estrategias. Conclusiones: El ASQ pesquisó significativamente más déficits del DSM que el EEDP, mientras que la correlación y concordancia entre ambas pruebas fueron adecuadas. Considerando las ventajas comparativas del ASQ en opinión de los profesionales, se propone que los centros de APS que deseen implementar ASQ, tomen una estrategia progresiva basada en la

  5. Bicentenarios digitales: celebraciones en la red

    Alvar De la Llosa

    2011-01-01

    Si  la celebración del primer centenario de las independencias de los países americanos se valió de las innovaciones de los medios de comunicación de su época, en particular del cine, hoy en día los gobiernos han asaltado la Red y se han apoderado del media para difundir una versión oficial. Conviene por lo tanto ver cómo los diferentes países latinoamericanos construyen este Bicentenario siempre de modo nacional y unilateral y nunca transnacional, en el marco de unas fronteras modernas a pes...

  6. Portal de compraventa con red social

    Montero Vegas, Toni

    2010-01-01

    Este proyecto ha sido diseñado con la intención de añadir una aplicación a la red en la que un usuario que disponga de una necesidad, ya sea de compra o de venta, de un articulo pueda disponer de un medio más para vender en el que además, pueda hacer amistad con otros usuarios y que pueda interaccionar con todos estos usuarios, tanto amigo como simples usuarios bajo su punto de vista. Para poder realizar el proyecto, se han utilizado frameworks existentes como por ejemplo Ibatis, para la c...

  7. Proceso de formación de una red regional: Región turística de las Agulhas Negras - RJ - Brasil The Process of Construction of Tourism Regional networks: The Tourist Region of Agulhas Negras-RJ, Brazil

    Aguinaldo Cesar Fratucci

    2011-12-01

    Full Text Available Este artículo se propone analizar el proceso de constitución de las redes regionales de turismo establecidas a partir de la estructuración de territorios-redes a escala regional. Basándose en las categorías de territorio-red y redes regionales y en la región turística de las Agulhas Negras-RJ, Brasil, como objeto empírico de observación, este estudio propone que la consolidación de redes regionales de turismo puede estructurar nuevas instancias público-privadas de gestión del ordenamiento del desarrollo turístico; como es el caso del CONRETUR de las Agulhas Negras. Se realizó una investigación estructurada principalmente a partir de la técnica de la observación participante, además de entrevistas personales y por medios electrónicos.This article aims at analyzing the process of constitution of tourism regional networks established from the structuring of networks-territories in regional scale. Having as theoretical basis territory-network and regional network basis as well as the tourist region of Agulhas Negras-RJ as empirical object, this text proposes that the consolidation of tourism regional networks may structure new public-private instances of tourist development reordering, as in the case of CONRETUR Agulhas Negras - RJ. In order to do that, structured researches have been used, mainly from the technique of participant observation, besides personal interviews and electronic means.

  8. Rede social de apoio à família de crianças internadas em uma unidade de terapia intensiva pediátrica Red social de apoyo a la familia de niños internados en una unidad de cuidados intensivos pediátrica Support netwrok to the families of children admitted in a pediatric intensive care unit

    Liliane Yukie Hayakawa

    2010-06-01

    Full Text Available No intuito de compreender como se compõem a rede social/apoio das famílias de crianças internadas na UTIP e a importância delas na vida desses familiares, realizou-se um estudo descritivo, com abordagem qualitativa, junto a 21 pais de crianças internadas em um hospital escola de Maringá, norte do Paraná. Observou-se que, a rede social/apoio à família constituía-se em um misto de afetividade, fé e solidariedade, enquanto componentes fundamentais para o alivio do sofrimento e suporte extra-hospitalar. O estudo demonstrou ainda, que o trabalho com famílias deve ser permeado pela especial atenção às peculiaridades que cercam cada contexto familiar e suas relações, o que ratifica a importância da atuação mais global da enfermagem, compreendendo melhor as múltiplas influências das diferentes configurações de rede de apoio familiar e social sobre a qualidade e efetividade das intervenções implementadas.Con la meta de comprender cómo se compone la red social/apoyo de las familias de niños internados en la UCIP y la importancia de ellos en la vida de esos familiares, se realizó un estudio descriptivo, con abordaje cualitativo, junto a 21 padres de niños internados en un hospital escuela de Maringá, norte de Paraná. Se observó que, la red social/apoyo a la familia se constituía en una mezcla de afectividad, fe y solidariedad, en cuanto componentes fundamentales para el alivio del sufrimiento y soporte extra-hospitalario. El estudio demostró aun, que el trabajo con familias debe ser permeado por la especial atención a las peculiaridades que cercan cada contexto familiar y sus relaciones, lo que ratifica la importancia de la actuación más global de la enfermería, comprendiendo mejor las múltiplas influencias de las diferentes configuraciones de red de apoyo familiar y social sobre la calidad y efectividad de las intervenciones implementadas.With the intention of understanding how the support network of the families of

  9. weego: Una red social turística

    Mac Adden, Patricio

    2011-01-01

    La tecnología avanza velozmente y todos los aspectos de nuestra vida se ven afectados por los avances tecnológicos. En la actualidad es común que al realizar viajes utilicemos dispositivos GPS (Global Positioning System), que no sólo nos permite consultarlo a modo de mapa sino que además nos da indicaciones acerca de qué ruta utilizar para llegar a un sitio de la manera más rápida (en tiempo), más corta (en distancia) o incluso más económica. La evolución del hardware se ve estrechamente liga...

  10. Marcadores sociales, una herramienta para organizar la Red, setiembre 2008

    Padrós Rodríguez, Joan

    2008-01-01

    Un dels fenòmens que més popularitat ha assolit és el de l'etiquetatge social. Tradicionalment, professionals especialitzats classificaven els objectes. Actualment, qualsevol usuari d'Internet pot realitzar la seva pròpia classificació dels recursos presents a la Xarxa mitjançant l'ús de paraules clau anomenades etiquetes o tags. De fet, a Internet proliferen aplicacions que permeten aquestes pràctiques com YouTube o Flickr. Un cas particular de l'etiquetatge socials són els marcadors soci...

  11. Reconocimiento de caracteres por medio de una red neuronal artificial

    Cesar Rivera-Ordoñez

    2009-01-01

    Full Text Available In this project we develop a characters recognition system implemented in a general purpose FPGA card. First, The characters classification is executed by a neural network model called feed-forward backpropagation. The Matlab toobox, NNTool used for neural networks is used to create, training and simulate this kind of Artificial Neural Network (ANN with five different patterns of training. For the implementation the ANN computer model is realizes as hardware system, which is described in a block diagram using both Matlab/ Simulink and Xilinx System Generator (XSG. Subsequently, the bitstream configuration file -necessary for the FPGA programming- is generated by XSG for implementing with Xilinx ISE foundation.

  12. Planificación de una red 4G

    Martín Cubero, Rubén

    2015-01-01

    La intensa evolución tecnológica que está experimentando nuestra sociedad en las últimas décadas hace que se estén desarrollando continuamente nuevas tecnologías que proporcionan mejoras tanto en la calidad como en la seguridad del servicio, este es el caso del 4G. A día de hoy, en España, la cuarta generación de comunicaciones móviles se ve encabezada por LTE, mientras que LTE-Advanced sólo se está implantando en las principales ciudades de nuestro país durante los últimos meses. Por este mo...

  13. Cluster Web a traves de una Red de Area Extensa

    Moreno Ramirez, Alberto

    2010-01-01

    INTRODUCCIÓN Hasta ahora todos los esfuerzos e implantaciones de soluciones tecnológicas para implementar alta disponibilidad y además calidad en el servicio han ido encaminados a balancear servidores y/o soluciones de clúster activo/pasivo como función de producción/backup, y todo ello dentro de la misma LAN. Cuando se trata de acceder a servidores en modo lectura (por ejemplo un servidor web) se implementa lo que se llama balanceo de carga. Y cuando se trata de acceso a servidores en ...

  14. A new species of Mathevotaenia (Cestoda, Anoplocephalidae parasitizing Tropidurus spinulosus (Reptilia, Squamata from northeastern Argentina Una especie nueva de Mathevotaenia (Cestoda, Anoplocephalidae parásita de Tropidurus spinulosus (Reptilia, Squamata del noreste de Argentina

    Lía Inés Lunaschi

    2012-09-01

    Full Text Available Mathevotaenia chaquensis n. sp. (Cestoda, Anoplocephalidae, Linstowiinae from a Spiny Lava Lizard, Tropidurus spinulosus, collected in Chaco Province, Argentina, is described. This is the second species of Mathevotaenia described from Neotropical reptiles. The new species is mainly characterized by having a relatively small strobila, 24 mm in total length, with about 100 craspedote proglottids, and 19-24 testes per proglottid. Among the South American species of Mathevotaenia, M. argentinensis is most similar to the new species by having similar body length and number of testes, but the major differences between both species include the size of suckers, neck, proglottids, testes and egg capsules, and the shape of the genital atrium and ovary (with 10-13 lobules on each side in M. argentinensis,, and 4-7 lobules in M. chaquensis n. sp.. A key to the species of the South American members of the Mathevotaenia Akumyan, 1946 is presented.Mathevotaenia chaquensis n. sp. (Cestoda, Anoplocephalidae, Linstowiinae es descrita parasitando al lagarto de los quebrachales, Tropidurus spinulosus, procedente de la Provincia del Chaco, Argentina. Esta es la segunda especie de Mathevotaenia descrita parasitando reptiles Neotropicales. La nueva especie está caracterizada principalmente por tener un estróbilo relativamente pequeño, 24 mm de largo, con aproximadamente 100 proglótides craspedotas y 19-24 testículos por proglótide. Entre las especies sudamericanas de Mathevotaenia, M. argentinensis es la más semejante a la nueva especie por presentar similar longitud del cuerpo y número de testículos, pero difieren en el tamaño de las ventosas, cuello, proglótides, testículos y huevos. Además difieren en la forma del atrio genital y del ovario (10-13 lóbulos a cada lado enM. argentinensis vs. 4-7 lóbulos en M. chaquensis n. sp.. Se presenta una clave para la determinación de las especies sudamericanas de Mathevotaenia Akumyan, 1946.

  15. Red Bull Crisis

    2009-01-01

    Additives make Red Bull the first company to test China’s new Food Safety Law "Drink Red Bull when you feel sleepy or tired" is a famous advertising slogan well-known to Chinese. But a recent German

  16. American Red Cross

    ... to Help Sand Fire Evacuees » 90% of the Red Cross Workforce are Volunteers Learn More. Search for ... Volunteer» Digital Advocates» SEARCH FOR OPENINGS Shop the Red Cross Store Be Prepared and Ready to Respond ...

  17. Red Wine Over China

    2007-01-01

    The color red dominates Chinese life and now growing interest in red wine maintains that trend and ushers in a new fashionable addition to local culture There was a time when trying to find a good red wine in China was a difficult affair. But as with all

  18. Cultura de seguridad del paciente y factores asociados en una red de hospitales públicos españoles Cultura de segurança do paciente e fatores associados em uma rede de hospitais públicos espanhóis Patient safety culture and related factors in a network of Spanish public hospitals

    Zenewton André da Silva Gama

    2013-02-01

    Full Text Available Este estudio objetivó describir la Cultura de Seguridad del Paciente (CSP en una red de hospitales públicos, según las percepciones de los profesionales sanitarios, y analizar la asociación de factores sociolaborales. Se realizó una encuesta a 1.113 profesionales de ocho hospitales españoles, a través de un cuestionario con 12 dimensiones de la CSP. Las percepciones se describen mediante los Porcentajes de Respuestas Positivas (PRP y Negativas (PRN a cada dimensión, y se analiza la asociación de factores con regresión lineal múltiple. La dimensión "trabajo en equipo en la unidad" se destacó con el mayor PRP (73,5 y "dotación de personal" con el mayor PRN (61. Los factores más asociados a la CSP (p O estudo teve como objetivo descrever a Cultura de Segurança do Paciente (CSP em uma rede de hospitais públicos, na percepção dos profissionais da saúde, e analisar a associação de fatores sociolaborais. Foi realizada uma pesquisa junto a 1.113 profissionais de oito hospitais espanhóis, através de um questionário com 12 dimensões da CSP. As percepções são descritas através dos porcentuais de respostas positivas (PRP e negativas (PRN, em cada dimensão, e é analisada a associação de fatores com regressão linear múltipla. A dimensão "trabalho em equipe na unidade" se destacou, com o maior PRP (73,5 e "dotação em pessoal" com o maior PRN (61. Os fatores mais associados à CSP (p The objectives were to describe Patient Safety Culture (PSC in a regional network of public hospitals, according to the perceptions of health professionals, and analyze the influence of socio-professional factors. A survey was conducted with 1,113 professionals from eight Spanish hospitals, using a questionnaire that explores 12 dimensions of PSC. Perceptions were described through the Percentage of Positive (PPR and Negative Responses (PNR by dimension, and the association of factors was analyzed using multivariate linear regression. The

  19. Criptosporidiosis: una zoonosis parasitaria

    Claudia Vergara; Joaquín Quílez

    2004-01-01

    La criptosporidiosis es una enfermedad parasitaria producida por protozoos coccidios pertenecientes al género Cryptosporidium . Su importancia se puso de manifiesto a comienzos de los años 1980 por lo que puede considerarse una patología de conocimiento relativamente reciente, aunque actualmente se ha demostrado que es una de las infecciones entéricas más frecuentes en humanos y animales y un problema de salud pública en todo el mundo (Casemore et al. 1997). La especie de mayor interés ...

  20. Construyendo una nueva ciudad

    Ariza, Jaison Fernando; Ferro, Edwin David

    2012-01-01

    La presente propuesta está fundamentada en una serie de actividades estructuradas en un proyecto de aula llamado Construyendo una nueva ciudad, gestionado en un Instituto Educativo Distrital, con el fin de potenciar el pensamiento geométrico y los sistemas de medidas en estudiantes de grado cuarto, a partir de la planeación y elaboración de una maqueta que implican el uso de sistemas de coordenadas, la noción de área, perímetro, la aplicación de proporcionalidad, entre otros aspectos.

  1. EDUAGORA. Una visión colaborativa de las TIC en la educación

    Sánchez Vera, Fulgencio

    2007-01-01

    El presente artículo pretende dar a conocer Eduagora (www.eduagora.com) y su concreción en CERM (Comunidad Educativa de la Región de Murcia). Una nueva propuesta de plataforma educativa creada por profesores de informática a partir de un análisis profundo de la tecnología disponible y de la realidad educativa. La plataforma se diseña para albergar una red extensa de centros educativos de primaria y secundaria. Se fundamenta en los principios de la Web 2.0, implementa una visión propia de red ...

  2. INSTRUMENTO PARA EL FORTALECIMIENTO AL SISTEMA DE EMPRENDIMIENTO DE RISARALDA: "RED RISARALDA EMPRENDE"

    JAIME OSORIO G; YAIR FRANCISCO GRANDAS; CARLOS ANDRES BOTERO G

    2010-01-01

    En éste documento se muestran algunos elementos conceptuales sobre redes de emprendimiento como instrumentos para fomentar la innovación y el desarrollo económico y social de una región y el proceso de fortalecimiento de la Red Departamental para el Emprendimiento "Red Risaralda Emprende".

  3. Posthumanismo(s) y ciencias sociales: una introducción Posthumanismo(s) y ciencias sociales: una introducción

    Fernando J García Selgas

    2009-01-01

    El humanismo ha sido una pieza fundacional en la construcción y el desarrollo de las ciencias sociales modernas. Sin embargo, una serie de acontecimientos históricos y de movimientos teoréticos, tales como la teoría del Actor-Red o el actual desarrollo de culturas y formas de vidas tecnológicas, han impulsado una visión de la sociedad humana como dependiendo también de actores no-humanos. Tras hacer una breve presentación de esta transformación radical en nuestra mirada, se introducen los pri...

  4. Inquiring into Red/Red Inquiring

    Ken Gale

    2013-05-01

    Full Text Available This layered account of an inquiry into ‘red’ emerged out of a collective biography workshop. In the middle of the Wiltshire countryside, an international and interdisciplinary group of scholars gathered together to write and make other things and marks on paper that asked questions of, and into, the spaces between words, people, things and their environments. We did not set out to workshop or write into or paint ‘red’ but, rather, it was red that slipped in, uninvited, and painted and wrote us. Red arose as a blush or a stain seeping amongst us that became referenced obliquely by material objects, metaphors and fairytales. The stain spread, became noticeable through our weekend together and beyond it, creating another (bright red artery vein of connection to write with.

  5. Las estrategias de afrontamiento y la red social de los enfermos crónicos, según género, edad y nivel sociocultural

    Azzollini, Susana Celeste; Bail Pupko, Vera; Benvenuto, Analía

    2009-01-01

    La red social es el conjunto de individuos que prestan apoyo social, Speck la define como “un grupo de personas, miembros de la familia, amigos y otra personas, capaces de aportar una ayuda y un apoyo tan reales como duraderos a un individuo o a una familia” (1989:31). La red social de apoyo protege la salud del individuo y la salud mantiene la red social, en lo que se denomina “círculo virtuoso”, a su vez que la presencia de una enfermedad crónica afecta la red social de apoyo de esa persona...

  6. Experimental information: 1096 [RED

    Full Text Available 1000_24_4_3 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  7. Experimental information: 1083 [RED

    Full Text Available 1000_22_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  8. Experimental information: 1079 [RED

    Full Text Available 1000_21_12_11 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  9. Experimental information: 1101 [RED

    Full Text Available 1000_24_14_13 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  10. Experimental information: 1091 [RED

    Full Text Available 1000_23_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  11. Experimental information: 1092 [RED

    Full Text Available 1000_23_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  12. Experimental information: 1077 [RED

    Full Text Available 1000_21_8_7 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  13. Experimental information: 1082 [RED

    Full Text Available 1000_22_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  14. Experimental information: 1097 [RED

    Full Text Available 1000_24_6_5 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  15. Experimental information: 1100 [RED

    Full Text Available 1000_24_12_11 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  16. Experimental information: 1085 [RED

    Full Text Available 1000_22_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  17. Experimental information: 1088 [RED

    Full Text Available 1000_23_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  18. Experimental information: 1090 [RED

    Full Text Available 1000_23_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  19. Experimental information: 1076 [RED

    Full Text Available 1000_21_6_5 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  20. Experimental information: 1099 [RED

    Full Text Available 1000_24_10_9 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  1. Experimental information: 1084 [RED

    Full Text Available 1000_22_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  2. Experimental information: 1087 [RED

    Full Text Available 1000_22_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  3. Experimental information: 1094 [RED

    Full Text Available 1000_23_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  4. Experimental information: 1089 [RED

    Full Text Available 1000_23_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  5. Experimental information: 1075 [RED

    Full Text Available 1000_21_4_3 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  6. Experimental information: 1080 [RED

    Full Text Available 1000_21_14_13 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  7. Experimental information: 1098 [RED

    Full Text Available 1000_24_8_7 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  8. Experimental information: 1095 [RED

    Full Text Available 1000_24_2_1 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  9. Experimental information: 1086 [RED

    Full Text Available 1000_22_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  10. Experimental information: 1078 [RED

    Full Text Available 1000_21_10_9 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  11. Experimental information: 1081 [RED

    Full Text Available 1000_22_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  12. Experimental information: 1074 [RED

    Full Text Available 1000_21_2_1 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  13. Experimental information: 1093 [RED

    Full Text Available 1000_23_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  14. Probe data: 5652 [RED

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. Red GNSS de InlandGEO en la Comunidad de Madrid: Aplicaciones en Tiempo Real

    Prieto Morin, Juan Francisco; Velasco Gomez, Jesus; López-Cuervo Medina, Serafín; Rodríguez-Solano Suárez, Roberto; Blas, Alejandro de; Verdú Vázquez, Amparo; Sánchez, Juan Ignacio; Villegas, José Manuel

    2008-01-01

    Se exponen aquí los desarrollos llevados a cabo para instalar y hacer operativa una red de Estaciones Permanentes GNSS, en la Comunidad de Madrid, con el fin de generalizar la disponibilidad pública, en todo el ámbito geográfico de la CAM, de las correcciones diferenciales de GNSS, contribuir a la densificación del Marco de Referencia ETRS89, y disponer de una Red GPS de altas prestaciones (GPS, GLONASS y la paulatina entrada GALILEO) con una idónea geometría, para proyectos de investigación ...

  16. Implementación de red WiMAX/WiFi en el municipio de Llançà

    Martínez Campo, José

    2013-01-01

    Diseño de una red telemática. Implementación de una red WiMAX/WiFi de acceso público en localizaciones turísticas en el municipio de Llançà. Disseny d'una xarxa telemàtica. Implementació d'una xarxa WiMAX/WiFi d'accés públic en localitzacions turístiques en el municipi de Llançà. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  17. Rede de Prevenção de Acidentes de Trabalho: uma estratégia de ensino a distância Red de Prevención de Accidentes deTrabajo: una estrategia para enseñanza a la distancia Network Prevention of Accidents at Work: a strategy for distance education

    Maria Helena Marziale

    2010-04-01

    Full Text Available Estudo quase-experimental cujo objetivo foi avaliar o treinamento interativo proposto, como estratégia de mudança no comportamento de trabalhadores para o adequado uso de luvas na administração de medicamentos endovenosos. O treinamento, estruturado no Modelo de Promoção da Saúde de Pender, foi realizado a distância pelo web site da Rede de Prevenção de Acidentes de Trabalho (REPAT, disponível em: http://repat.eerp.usp.br/estrategia/index.php e aplicado a 60 trabalhadores de enfermagem de dois hospitais estado de São Paulo. Antes do treinamento 58,3% dos trabalhadores usavam luvas para administrar medicamentos endovenosos na semana que antecedeu o treinamento e 83,3% trabalhadores informaram intenção do uso de luvas após o treinamento. Conclusão: a ferramenta interativa facilitou a aplicação da estratégia educativa no trabalho e pode auxiliar a mudança do comportamento do uso de luvas.Estudio casi-experimental cuyo objetivo fue evaluar el proyecto de formación interactiva, como una estrategia para el cambio en el comportamiento de los trabajadores, buscando el uso apropiado de guantes en la administración de drogas por vía intravenosa. La capacitación interactiva se estructuró en el Modelo de Promoción de la Salud de Pender, se llevó a cabo a través del acceso al sitio Web de la Red de Prevención de Accidentes de Trqabajo (REPAT, disponible en: http://repat.eerp.usp.br/estrategia/index.php y se aplicó en 60 trabajadores enfermería de dos hospital en el estado de Sao Paulo. En la semana antes del entrenamiento 58,3% de los trabajadores usaron guantes en la administración de drogas por vía intravenosa y, después del entrenamiento, 83,3% de los trabajadores informaron intención de usar guantes. Conclusión: la herramienta interactiva facilitado la aplicación de la estrategia educativa para la Promoción de la Salud en el Trabajo permitir que los trabajadores participen en las diferentes realidades de la vida y el

  18. Desarrollo de una aplicación Android para las citas en grupo

    Saboori Vaziri, Alireza

    2013-01-01

    El objetivo final de este proyecto es el de desarrollar una aplicación para la plataforma Android. Una vez terminada la implementación y el desarrollo de la aplicación, será puesta en venta para su uso por parte de todo tipo de usuarios. Es una aplicación multiusuario, es decir, se requiere identificación para poder acceder a la plataforma. También incluye funciones parecidas a la de una red social. Además, la aplicación dispondrá de funcionalidades de geolocalización, las cuales permit...

  19. Next generation red teaming

    Dalziel, Henry

    2015-01-01

    Red Teaming is can be described as a type of wargaming.In private business, penetration testers audit and test organization security, often in a secretive setting. The entire point of the Red Team is to see how weak or otherwise the organization's security posture is. This course is particularly suited to CISO's and CTO's that need to learn how to build a successful Red Team, as well as budding cyber security professionals who would like to learn more about the world of information security. Teaches readers how to dentify systemic security issues based on the analysis of vulnerability and con

  20. Los nuevos entornos educativos: desafios cognitivos para una inteligencia colectiva

    Navarro, María G.

    2009-01-01

    Comprender las tecnologías de la comunicación a la luz de las redes con que se comunican y entran en cooperación las personas ha sido una constante en autores que no han disociado su visión acerca del significado de las tecnologías respecto a los nuevos movimientos sociales. Este artículo sostiene que las TIC no son sólo una red a la que se suman los individuos, sino que actúan como tecnologías sociales cuyo perfeccionamiento depende tanto de la diversidad de sus funciones (socio-políticas, c...

  1. Los invitados a una boda: una aproximación a las redes de sociabilidad de la pareja.

    Maillochon, F.

    2009-06-01

    Full Text Available Este artículo describe lo que está en juego en la elaboración de la lista de invitados a las ceremonias de matrimonio. Esta circunstancia ofrece al sociólogo una oportunidad excepcional para observar unared de sociabilidad” objetivada por los actores mismos. Al poner en relación el contenido concreto de estas listas con los discursos de las parejas sobre las lógicas y las dudas que preceden a la selección, permite matizar el carácter substancialista que se atribuye generalmente a las “redes”. Invitar a alguien al propio matrimonio no es una simple enumeración/mirada de sus relaciones amicales, sino una acción performativa que permite construirlas y proyectarlas al futuro. La invitación al matrimonio parece también fuertemente condicionada por las posiciones sociales respectivas de las personas involucradas, de manera tal que el reconocimiento afectivo y el reconocimiento social resultan a menudo indisociables en la elaboración de esta relación. Los invitados al matrimonio no representan solamente un estado de hecho de la “red amical”, producto de la historia de la pareja e inscrito en el pasado de cada uno, sino también una promesa sobre la posible evolución de la proyección afectiva, y también social, de dicha pareja.

  2. ECONOMÍAS INFORMALES EN LA CIUDAD DE MÉXICO LA RED DE LA BASURA

    SALVIANI DE BOSECK SOFÍA; GONZÁLEZ GABRIEL

    2010-01-01

    La ciudad de México es una de las ciudades más grandes del mundo y una de las áreas metropolitanas de más rápida expansión suburbana difusa, lo cual genera diversos problemas. La red de recolección de residuos sólidos en México DF es una simbiosis entre la economía formal e informal y una manifestación de la estructura sociopolítica de México, que refleja también otros problemas. Las formas que presenta el paisaje urbano, revelan la estructura oculta de una compleja red mixta de r...

  3. Experimental information: 225 [RED

    Full Text Available 2202_21_1_2 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  4. Experimental information: 226 [RED

    Full Text Available 2202_21_1_3 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  5. Probe data: 2827 [RED

    Full Text Available R06-035040-2AR RED C72992 AU101214 E02619 EB2619 >(P35339) EXOPOLYGALACTURONASE PRECURSOR (EC 3. ... 2.1.67) (EXOPG) (PECTINASE ) (GALACTURAN 1,4-ALPHA-GALACTURONIDASE). &S30067(S ...

  6. Probe data: 6229 [RED

    Full Text Available R03-061580-1AR RED AU108708 C96917 C50119 CG0119 >(P52424) PHOSPHORIBOSYLFORMYLGLYCINAMIDINE CYC ... LO-LIGASE PRECURSOR (EC 6.3.3.1) (AIR S) (PHOSPHORIBOSYL-AMINOIMIDAZOLE SYNTHETASE) (AIR ...

  7. Experimental information: 1043 [RED

    Full Text Available 2112_21_11_12 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo ... Nutrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  8. Experimental information: 1038 [RED

    Full Text Available 2112_21_1_2 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  9. Experimental information: 1040 [RED

    Full Text Available 2112_21_5_6 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  10. Experimental information: 1042 [RED

    Full Text Available 2112_21_9_10 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo N ... utrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  11. Experimental information: 1039 [RED

    Full Text Available 2112_21_3_4 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  12. Experimental information: 1041 [RED

    Full Text Available 2112_21_7_8 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  13. Los invitados a una boda: una aproximación a las redes de sociabilidad de la pareja.

    Maillochon, F.

    2009-01-01

    Este artículo describe lo que está en juego en la elaboración de la lista de invitados a las ceremonias de matrimonio. Esta circunstancia ofrece al sociólogo una oportunidad excepcional para observar unared de sociabilidad” objetivada por los actores mismos. Al poner en relación el contenido concreto de estas listas con los discursos de las parejas sobre las lógicas y las dudas que preceden a la selección, permite matizar el carácter substancialista que se atribuye generalmente a las “redes...

  14. Una sombra que sobrevive

    Alexander Cifuentes

    2014-01-01

    Alma en boca y huesos en costal. Una aproximación a los contrastes socio-económicos de la esclavitud. Santafé, Mariquita y Mompox 1610-1660. Carlos Eduardo Valencia Villa, Instituto Colombiano de Antropología e Historia, colección Cuadernos Coloniales, Bogotá, 2003, 215 págs, ilustrado.

  15. Probe data: 3426 [RED

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  16. Probe data: 779 [RED

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  17. Probe data: 3773 [RED

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  18. Desarrollo de una interfaz en google wave para un robot conversacional de una plataforma publicitaria

    Osa Barriga, Fátima Montaña de la

    2011-01-01

    Las nuevas necesidades del mercado hacen que los usuarios que se conectan a Internet usen las redes sociales como principal canal de comunicación con sus amigos. La búsqueda de nuevos espacios publicitarios da origen a crear una aplicación que aproveche las capacidades de la red de un operador, para ofrecer al usuario interacciones útiles como el envío de SMS o MMS gratuitos a cambio de la recepción de publicidad. En Telefónica I+D ya existe un robot capaz de mantener conversaciones con los u...

  19. UNA EXPERIENCIA EN CUBA

    Lucy Martin

    2003-01-01

    Full Text Available Este artículo examina, desde una perspectiva so- cial, las experiencias de trabajo que un equipo multidisciplinario del INCA lleva a cabo en tres cooperativas de producción agropecuaria (CPA del sur de La Habana y en una cooperati- va de créditos y servicios (CCS de La Palma, Pinar del Río, con el objetivo de encontrar vías complementarias del fitomejoramiento formal por la vía participativa, se pretende destacar cómo en una experiencia de fitomejoramiento con la participación de los productores, se va operando una movili- zación de cambio no solo técnico sino también social, pero que a su vez reclama, para su éxito, de un movimiento en dos direcciones: participación y descentralización. Importantes lec- turas de esta experiencia son, en primer lugar, la posibilidad de construcción de conocimiento nuevo rompiendo mitos, a tra- vés de un diálogo de saberes y con la participación de los productores al tiempo que se producen cambios no solo de alcance técnico, en el ámbito de las semillas y las variedades, sino también de carácter social. En segundo lugar, revela las posibilidades de una experiencia de esta naturaleza, como ver- tiente del desarrollo sostenible y como vía de reconstrucción desde la base de nuestro proyecto social, al posibilitar el forta- lecimiento de los productores y la articulación entre actores sociales protagónicos en el sistema de semilla y en la vida comunitaria en torno a intereses comunes.

  20. Diseño de una instalación domótica con tecnología LONWORKS

    Guerrero Meseguer, José Antonio

    2010-01-01

    Utilizando la tecnología LONWORKS, diseñar, optimizar, implementar y probar una red domótica para una vivienda unifamiliar. Todos los equipos Hardware serán instalados en un panel para que facilite la visualización y manejo de los mismos.

  1. Instalación solar fotovoltaica -20 Kw para conexión a red

    Sacristán Benito, Silvia

    2014-01-01

    Este TFG trata sobre el diseño de una instalación de generación eléctrica de una potencia nominal de 20 kW mediante paneles fotovoltaicos. Estos paneles se situarán sobre la cubierta de una nave industrial en la localidad de Soria. Toda la energía producida será vertida a la red eléctrica de baja tensión, abasteciendo al entorno cercano. Se describe, el funcionamiento de una instalación de este tipo, en la cual el componente más destacado es el panel fotovoltaico, que genera...

  2. Galaxy Zoo: Passive Red Spirals

    Masters, Karen L; Romer, A Kathy; Nichol, Robert C; Bamford, Steven P; Schawinski, Kevin; Lintott, Chris J; Andreescu, Dan; Campbell, Heather C; Crowcroft, Ben; Doyle, Isabelle; Edmondson, Edward M; Murray, Phil; Raddick, M Jordan; Slosar, Anze; Szalay, Alexander S; Vandenberg, Jan

    2009-01-01

    We study the spectroscopic properties and environments of red spiral galaxies found by the Galaxy Zoo project. By carefully selecting face-on, disk dominated spirals we construct a sample of truly passive disks (not dust reddened, nor dominated by old stellar populations in a bulge). As such, our red spirals represent an interesting set of possible transition objects between normal blue spirals and red early types. We use SDSS data to investigate the physical processes which could have turned these objects red without disturbing their morphology. Red spirals prefer intermediate density regimes, however there are no obvious correlations between red spiral properties and environment - environment alone is not sufficient to determine if a galaxy will become a red spiral. Red spirals are a small fraction of spirals at low masses, but dominate at large stellar masses - massive galaxies are red independent of morphology. We confirm that red spirals have older stellar populations and less recent star formation than ...

  3. La red del Comercio Justo y sus principales actores

    Brisa Ceccon Rocha

    2010-01-01

    Full Text Available Este artículo trata de una descripción concisa del fenómeno del comercio justo y su participación en el comercio mundial. Al mismo tiempo, examina el papel de los diferentes actores que participan en la red del comercio justo, desde los productores hasta los consumidores. Finalmente, evalúa las relaciones entre estos actores y los retos que enfrentan para perfeccionar el sistema y mejorar las condiciones de participación de los productores, elementos fundamentales de esta red.

  4. Internet: la red en España

    Dr. Fernando R. Contreras

    2001-01-01

    No es nada original comenzar un artículo sobre Internet introduciendo un poco de la historia de la red mayor de nuestro planeta. También es verdad que supone una gran ayuda las aproximaciones introductorias para situar un punto inicial antes de emprender el recorrido que nos lleve al punto final. Por ello, deseamos que esta introducción a Internet presente aspectos que motive el interés del lector y no le conduzca al tedio y a la desesperación de una lectura nada novedosa.

  5. Internet: la red en España

    Dr. Fernando R. Contreras

    2001-01-01

    Full Text Available No es nada original comenzar un artículo sobre Internet introduciendo un poco de la historia de la red mayor de nuestro planeta. También es verdad que supone una gran ayuda las aproximaciones introductorias para situar un punto inicial antes de emprender el recorrido que nos lleve al punto final. Por ello, deseamos que esta introducción a Internet presente aspectos que motive el interés del lector y no le conduzca al tedio y a la desesperación de una lectura nada novedosa.

  6. Red de sensores y el Internet de las cosas

    GONZÁLEZ DAZA, ENRIQUE

    2015-01-01

    [ES] Este proyecto consiste en el estudio y realización de una red de sensores conectados de forma permanente a internet, los cuales nos ofrecerán una serie de servicios como puede ser lecturas de diversos sensores ofreciéndonos dichos datos para poder procesarlos de la manera deseada o permitirnos el uso de actuadores para poder interactuar de forma remota con el mundo real. Esto sería muy útil, por ejemplo en entornos industriales donde podríamos disponer de datos referent...

  7. El trabajo en red en salud mental infantojuvenil.

    Joana Alegret; Elisenda Castanys; Susana Ochoa

    2005-01-01

    Las autoras exponen en este artículo los resultados de una investigación realizada en dos centros de Salud Mental Infantojuvenil de Cataluña, sobre la realización de trabajo en red profesional en las consultas ambulatorias. El estudio recoge las actuaciones efectuadas en los casos seleccionados, haciendo una distinción entre el trabajo de atención directo con el paciente y su familia y el trabajo indirecto con los profesionales. Se pretende estudiar el tipo de relación entre la cantidad de tr...

  8. Videojuegos: La apariencias ¿engañan? : Jóvenes usuarios de juegos de Red. Prácticas, relaciones e interacciones de los jóvenes usuarios de juegos en red

    Blanco, María Betina; Jauregui, Karina Beatriz

    2009-01-01

    Esta tesis se propone una aproximación al análisis de las relaciones interpersonales, interacciones comunicativas y prácticas sociales que establecen los jóvenes usuarios de una de las aplicaciones de las nuevas tecnologías: los juegos en red.

  9. Red giant seismology: Observations

    Mosser B.

    2013-03-01

    Full Text Available The CoRoT and Kepler missions provide us with thousands of red-giant light curves that allow a very precise asteroseismic study of these objects. Before CoRoT and Kepler, the red-giant oscillation patterns remained obscure. Now, these spectra are much more clear and unveil many crucial interior structure properties. For thousands of red giants, we can derive from seismic data precise estimates of the stellar mass and radius, the evolutionary status of the giants (with a clear difference between clump and RGB stars, the internal differential rotation, the mass loss, the distance of the stars... Analyzing this amount of information is made easy by the identification of the largely homologous red-giant oscillation patterns. For the first time, both pressure and mixed mode oscillation patterns can be precisely depicted. The mixed-mode analysis allows us, for instance, to probe directly the stellar core. Fine details completing the red-giant oscillation pattern then provide further information on the interior structure, including differential rotation.

  10. LA MIGRACIÓN: UNA INSTITUCIÓN

    María de Lourdes Jacobo Albarrán

    2010-01-01

    Full Text Available El presente artículo propone retomar la perspectiva del concepto de institución, de Cornelius Castoriadis, para comprender y elucidar el circuito de la migración hacia Estados Unidos. Esta concepción se revela sumamente fructífera para evitar la reducción de la comprensión del fenómeno migratorio a una esfera estrictamente económica. Al contrario, una multiplicidad de testimonios, de los cuales se recogen algunos, muestra que el fenómeno migratorio es rico en su producción imaginaria, llena de símbolos, y constituye en sí mismo una red simbólica. Así, es patente cómo en este fenómeno se establece una confrontación ética, una prueba que remite a la catadura ética y humana del migrante, un sacrificio cuyo costo es espiritual. Cabe añadir que es en este sentido que va creando una cultura y generando en las comunidades expulsoras ciertas tradiciones y pedagogías.

  11. Trichinellosis una zoonosis vigente

    Elsa Gabriela Chávez Guajardo

    2006-06-01

    Full Text Available .- En la presente revisión presentamos una panorámica de la Trichinellosis enfermedad parasitaria cosmopolita y de distribución mundial que afecta prácticamente a todos los mamíferos que su gravedad depende de la carga parasitaria, pero en sus huéspedes aunque no les cause la muerte si disminuye su calidad de vida que desafortunadamente, sigue siendo vigente en este nuevo siglo XXI.

  12. una sociedad emergente

    Derlisiret Rincón M.

    2006-01-01

    Full Text Available Este trabajo busca reflexionar por una parte acerca del papel de la ciencia, la tecnología y la educación, como factores de desarrollo de las naciones e intenta responder la interrogante en torno al cómo estas variables contribuirán a la transformación de la realidad social venezolana. Los planteamientos expuestos en este artículo forman parte de una investigación cualitativa que se sustenta en una revisión teórica cuyos resultados indican que existe la posibilidad cierta de construir y alcanzar una Venezuela virtual en los próximos años; es decir, se vislumbra un país interconectado y funcionando a través de redes cuyos individuos estarían capacitados y entrenados en el uso y usufructo de las nuevas tecnologías. Esta visión de país, se basa en la premisa de que la oportuna implementación de la Planificación de Ciencia y Tecnología resultaría instrumento de vinculación de las variables tecnológicas, educativas y científicas, que permiten obtener conocimientos especializados y orientados a la solución de problemas de creciente dimensión global. Tales conocimientos, pudieran generar los cambios sustanciales necesarios en el contexto nacional, para lograr modificar o disminuir el sentido de crecimiento de la brecha o divisoria digital en este entorno

  13. Hacia una vejez útil

    Hernández Amparo

    1992-12-01

    Full Text Available

    Con lleva un interés bien particular encontrarnos con una población tan heterogénea en cuanto a caracterización se refiere, ya porque miremos en ella sus hábitos, sus costumbres, procedencia, nivel socio-cultural, etc., dicha comunidad de ancianos plantea, de inmediato la necesidad de ponerse en un contacto generacional que rompiera y dejara atrás la rutina y la monotonía, propia de su cotidianidad, es entonces cuando tres profesionales altamente motivadas en el trabajo comunitario, inician un proceso vivo y dinámico con el anciano institucionalizado a fin de que ellos recobraran el protagonismo, elevaran su autoestima, tomaran parte en la toma de decisiones frente a su vida, y volvieran a sentirse en capacidad de dar respuesta a sus conflictos, buscando alternativas de solución en una tarea mancomunada que exigió madurez, diálogo y comunicación permanente entre cada una de las partes involucradas en dicho proceso.

  14. Catálogo de autoridades de la Red de Bibliotecas del CSIC: nueva interfaz de consulta

    Cottereau, Mario

    2002-01-01

    Desde la puesta en marcha del catálogo colectivo de la Red de Bibliotecas del CSIC el control de autoridades ha sido fundamental para mantener la coherencia de los distintos tipos de encabezamientos en un entorno de trabajo descentralizado donde cada una de las bibliotecas que forman la Red es independiente a la hora de catalogar.

  15. Little Red Riding Hood

    胡蓉

    2011-01-01

    你一定看过并知道小红帽(Little Red Riding Hood)的故事吧!下面是英语版的小红帽,你看过吗? Once upon a time,people liked a little girl very much.Her red hood(头巾 ) fit her, so people called her Little Red Riding Hood. One day,her mother said, "Take a piece of cake and a bottle ofwine to your grandmother.She is ill and weak.These will do her good.Donot run off the road,or you may fall and break the bottle,and then yourgrandmother will get nothing.OK! Go at once."

  16. Las relaciones empresariales: una tipología de redes

    José Luis Galán

    2010-12-01

    Full Text Available El conjunto de redes en las que participan las empresas son consideradas como un recurso para las mismas. Cada empresa participa en redes diferentes y su posición en cada red la hace diferente a las demás. Las relaciones de una empresa se comportan como un recurso que está en la base de la heterogeneidad que le permite ser soporte de una ventaja competitiva sostenible. Sin embargo, el análisis de las redes empresariales es complejo. Este trabajo pretende disminuir esa complejidad analizando las redes empresariales a un nivel inferior (el de las subredes y elaborando una tipología de redes y subredes que faciliten el estudio de las relaciones inter-organizativas. En un distrito industrial se comprueba cómo las características estructurales de cada tipo de redes o subredes son diferentes.

  17. Probe data: 5037 [RED

    Full Text Available R12-044780-1AR RED AU173063 AU173064 RA0155 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  18. Probe data: 5576 [RED

    Full Text Available R03-047910-1AR RED AU174190 AU174191 ST1070 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  19. Probe data: 6197 [RED

    Full Text Available R07-048110-1AR RED D22267 C96749 C10642 CB0642 >TAU87163_1(U87163|pid:g2306768) Triticum aestivu ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  20. Probe data: 2895 [RED

    Full Text Available R03-021800-1AR RED C19773 AU101326 E10917 EC0917 >TAU87163_1(U87163|pid:g2306768) Triticum aesti ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  1. Probe data: 5564 [RED

    Full Text Available R02-057040-1AR RED D39512 AU174175 ST0896 >SPAC19A8_12(Z98974|pid:g2388911) S.pombe chromosome I ... ar eg. to YNL118C, PSU1_YEAST, P53550, involved in respiration , (970aa), fasta scores, opt:776, E():0, (29.1% ide ...

  2. Probe data: 5495 [RED

    Full Text Available R09-031940-1R RED D48735 AU174075 SS5125 >SPBC215_13(AL033534|pid:g3873550) S.pombe chromosome I ... 932 aa), fasta scores: opt: 694, E():8e-27, (41.8% identity ... in 457 aa). ...

  3. Probe data: 2587 [RED

    Full Text Available R11-011010-4R RED AU062718 AU100766 C30311 CE0311 >AE000959_10(AE000959|pid:g2648442) Archaeoglo ... similar to GB:X79560 SP:P46464 PID:517390 percent identity : 61.98; identified by sequence similarity; putativ ...

  4. Probe data: 3857 [RED

    Full Text Available R06-042830-1AR RED AU064223 AU164111 ED0143 >AE001019_19(AE001019|pid:g2649345) Archaeoglobus fu ... similar to GB:L77117 SP:Q60179 PID:1591690 percent identity : 39.38; identified by sequence similarity; putativ ...

  5. Probe data: 3925 [RED

    Full Text Available R03-019390-1AR RED AU164858 AU164859 EH1645 >AP000005_67(AP000005|pid:g3257577) Pyrococcus horik ... position (5/7); similar to owl:HPAE0006332 percent identity :27.451 in 212aa; Swiss_Prot:P44659 percent identit ...

  6. Probe data: 3184 [RED

    Full Text Available R05-006300-1AR RED D48993 AU101824 S15595 SS5595 >AE001130_3(AE001130|pid:g2688094) Borrelia bur ... SP:P17580 GB:M24503 PID:290500 PID:551840 percent identity : 38.99; identified by sequence similarity; putativ ...

  7. Probe data: 5521 [RED

    Full Text Available R03-030160-1AR RED AU174105 AU174106 SS6038 >ATNAP16KD_1(Z96936|pid:g2765837) Arabidopsis thalia ... ociated protein NAP16kDa; pos. 112 to 116 sequence identity ... to nitrilase isoform 1 and 2. ...

  8. Probe data: 5482 [RED

    Full Text Available R02-017290-1AR RED AU174055 AU174056 SS4954 >AE000956_15(AE000956|pid:g2648379) Archaeoglobus fu ... e genome; similar to PID:1045016 SP:Q51790 percent identity : 31.21; identified by sequence similarity; putativ ...

  9. Probe data: 364 [RED

    Full Text Available R02-031580-1AR RED AU075434 AU031062 E60705 EH0705 >AF036618_1(AF036618|pid:g2708624) Arabidopsi ... thaliana acetyl-CoA synthetase mRNA, complete cds; identity ... based on similarity to known acetyl-CoA synthetase ...

  10. Probe data: 252 [RED

    Full Text Available R09-033840-1AR RED AU162299 AU030444 E51070 EG1070 >AE000968_9(AE000968|pid:g2648586) Archaeoglo ... similar to GB:L77117 SP:Q57665 PID:1498988 percent identity : 60.92; identified by sequence similarity; putativ ...

  11. Probe data: 4505 [RED

    Full Text Available R01-017940-1AR RED AU166950 AU166951 CH0192 >AE001265_11(AE001265|pid:g3323304) Treponema pallid ... the complete genome; similar to GP:606359 percent identity : 29.47; identified by sequence similarity; putativ ...

  12. Probe data: 1244 [RED

    Full Text Available R02-038610-1AR RED AU057404 AU057405 S21415 SA1415 >SPAC57A7_5(Z95396|pid:g2104440) S.pombe chro ... 5 aa), fasta scores: opt: 199, E():0.00029, (20.5% identity ... in 366 aa). ...

  13. Probe data: 5087 [RED

    Full Text Available R07-015750-1AR RED D24254 AU173174 RA1586 >AE001048_5(AE001048|pid:g2649798) Archaeoglobus fulgi ... e genome; similar to GB:L77117 PID:1591676 percent identity : 48.77; identified by sequence similarity; putativ ...

  14. Probe data: 1808 [RED

    Full Text Available R01-015680-1AR RED C72327 AU078752 EB1437 >AE000949_5(AE000949|pid:g2648274) Archaeoglobus fulgi ... of 172 of the complete genome; similar to percent identity : 28.02; identified by sequence similarity; putativ ...

  15. Probe data: 5456 [RED

    Full Text Available R08-023200-1AR RED D47972 AU174021 SS3803 >AE001011_18(AE001011|pid:g2649239) Archaeoglobus fulg ... the complete genome; similar to SP:P24297 percent identity : 67.92; identified by sequence similarity; putativ ...

  16. Probe data: 4990 [RED

    Full Text Available R12-008240-1AR RED AU064916 AU172911 EF0791 >AF052429_1(AF052429|pid:g2981214) Zea mays photosys ... tem I complex PsaN subunit precursor (psaN) mRNA, nuclear ... gene encoding chloroplast protein, partial cds; nu ...

  17. Probe data: 581 [RED

    Full Text Available R02-011070-2AR RED AU031849 AU031850 R02164 RA2164 >XLU69669_1(U69669|pid:g1850344) Xenopus laev ... is nuclear ... pore complex-associated protein TPR (tpr) mRNA, pa ... rtial cds; nuclear ... pore complex-associated protein; translocated prom ...

  18. Probe data: 6247 [RED

    Full Text Available R02-008440-1AR RED C26839 C96955 C50194 CG0194 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis th ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  19. Probe data: 5314 [RED

    Full Text Available R03-013800-1AR RED AU065355 AU173508 RA3452 >DOG01_1(D43756|pid:g1304047) Dog gene for fibrinoge ... n A-alpha-chain, partial cds (C-terminal region ); carboxy-terminal region . ...

  20. Probe data: 5984 [RED

    Full Text Available RED AU174977 AU174976 FL0119 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  1. Probe data: 5952 [RED

    Full Text Available RED AU174907 AU174908 FL0036 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  2. Probe data: 991 [RED

    Full Text Available R06-046410-1AR RED AU162658 AU056152 S20333 SA0333 >CAN012165_1(AJ012165|pid:g3808101) Capsicum ... for chloroplast protease (CACP)from the AAA atpase family ; AAA atpase family . ...

  3. Probe data: 2696 [RED

    Full Text Available R07-042870-1AR RED AU101001 AU101000 C62681 CH2681 >AF078103_1(AF078103|pid:g4218945) Homo sapie ... ns developmentally regulated GTP-binding protein (DRG ) mRNA, complete cds. &HSA005940_1(AJ005940|pid:g41 ...

  4. Probe data: 2995 [RED

    Full Text Available R11-007900-2AR RED AU030559 AU101484 E51237 EG1237 >AF020193_1(AF020193|pid:g2895198) Glycine ma ... x DNA ... polymerase delta (Pol delta) mRNA, complete cds; D ... NA-dependent DNA ... polymerase. ...

  5. Probe data: 3754 [RED

    Full Text Available R02-042000-1AR RED D48054 AU162984 SS3984 >CELZC13_4(U67953|pid:g1519683) Caenorhabditis elegans ... ity to EGF-like domain cysteine pattern signature (PS :PS 00022); coded for by C. elegans cDNA yk70d5.3; c ...

  6. Probe data: 4083 [RED

    Full Text Available R08-045490-1AR RED AU077699 AU166249 E50587 EG0587 >MEU72662_12(U72662|pid:g2160684) Methylobact ... tative ABC transporter ATP-binding subunit (abcC), methanol ... dyhydrogenase large subunit homolog (mxaF'), cytoc ...

  7. Probe data: 4655 [RED

    Full Text Available R03-018670-1AR RED C72142 AU172460 EB1070 >TDU89271_1(U89271|pid:g1877482) Tripsacum dactyloides ... short-chain alcohol dehydrogenase (gynomonoecious sex ... form 1) gene, allele gsf1, complete cds; similar t ...

  8. Probe data: 5077 [RED

    Full Text Available R02-043650-1AR RED AU173162 AU173163 RA1507 >AF057183_1(AF057183|pid:g3264596) Zea mays putative ... nscript 1 (HIT1); induced by submergence, hypoxia, mechanical ... impedence, and 40% O2 conditions. ...

  9. Probe data: 487 [RED

    Full Text Available R05-018490-1AR RED D23861 AU031673 R00448 RA0448 >OSU30479_1(U30479|pid:g1041712) Oryza sativa e ... 3 (Os-EXP3) mRNA, complete cds; induces extension (creep ) in plant cell walls; former gene name RiExD. ...

  10. Probe data: 3148 [RED

    Full Text Available R12-043420-1AR RED D47342 AU101752 S12658 SS2658 >(P38076) CYSTEINE SYNTHASE (EC 4.2.99.8) (O -AC ... ETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &JS0762(JS076 ...

  11. Probe data: 3928 [RED

    Full Text Available R03-053360-1AR RED AU164935 AU164936 E61827 EH1827 >(Q43317) CYSTEINE SYNTHASE (EC 4.2.99.8) (O - ... ACETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &CNAPCCS7_1(D ...

  12. Probe data: 4200 [RED

    Full Text Available R03-028920-1AR RED AU062597 AU166443 CB2410 >EBV_10(V01555|pid:g1334843) Epstein-Barr virus (EBV ... stoid cell line immortalized with human EBV from a mononucleosis ... patient; BWRF1 reading frame 8; Protein sequence i ...

  13. Probe data: 4637 [RED

    Full Text Available R02-008940-1AR RED C71953 AU172434 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thalian ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  14. Probe data: 6350 [RED

    Full Text Available R11-026990-1AR RED C97557 C97558 C60385 CH0385 >HTU32872_1(U32872|pid:g1463038) Human T-cell lym ... photropic virus type 2 rex and tax ... genes, partial cds, clone SP2; putative. &HTU32875 ...

  15. Probe data: 2820 [RED

    Full Text Available R03-000280-1AR RED C72958 AU101205 E02550 EB2550 >S39445(S39445;A42119) DNA-directed RNA polymer ... ase (EC 2.7.7.6) II chain 9, 15K - fruit fly ... (Drosophila melanogaster) &S66940_1(S66940|pid:g45 ...

  16. Probe data: 3103 [RED

    Full Text Available R09-032390-1AR RED D39322 AU101671 R03330 RA3330 >ATT5C23_17(AL049500|pid:g4539465) Arabidopsis ... e 4, BAC clone T5C23 (ESSA project); similarity to Fly ... Fas-associated factor (FFAF), Drosophila melanogas ...

  17. Probe data: 3422 [RED

    Full Text Available R02-049940-1AR RED C96862 AU108608 C12691 CB2691 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  18. Probe data: 1384 [RED

    Full Text Available R02-049940-1AR RED AU068083 AU068084 C11828 CB1828 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  19. Probe data: 5862 [RED

    Full Text Available R06-016110-1AR RED AU174691 AU174690 FE0214 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cytoplas ... m male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  20. Probe data: 635 [RED

    Full Text Available R01-039520-1AR RED D39230 AU031992 R03072 RA3072 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  1. Probe data: 2296 [RED

    Full Text Available R02-049940-1AR RED C19367 AU094406 E10314 EC0314 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  2. Probe data: 3192 [RED

    Full Text Available R06-016110-1AR RED AU101840 AU101841 S15881 SS5881 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  3. Probe data: 1631 [RED

    Full Text Available R01-039510-1AR RED AU075853 AU075854 S20436 SA0436 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  4. Probe data: 2872 [RED

    Full Text Available R04-052870-1AR RED C73509 AU101290 E04274 EB4274 >AF023159_1(AF023159|pid:g3057120) Zea mays starch ... ULL1 (dull1) mRNA, complete cds; similar to potato starch ... synthase SSIII; likely to be the maize starch ... synt ...

  5. Probe data: 173 [RED

    Full Text Available R04-032560-4R RED AU030096 AU030097 E50621 EG0621 >ZMU65948_1(U65948|pid:g2340108) Zea mays starch ... ch branching enzyme IIa (Sbe2a) mRNA, partial cds; starch ... branching enzyme isozyme SBEIIa. ...

  6. Probe data: 3220 [RED

    Full Text Available R09-025420-1AR RED AU032971 AU101898 S00086 ST0086 >D88434_1(D88434|pid:g4519507) Malus domestic ... a mRNA for protein abundantly expressed during apple ... fruit development, complete cds; similar to Garden ...

  7. Probe data: 4872 [RED

    Full Text Available R03-007550-2AR RED AU172766 AU172767 EE0037 >F9D12_1(AF077407|pid:g3319342) Arabidopsis thaliana ... BAC F9D12; similar to mit ochondrial carrier proteins (Pfam: mit _carr.hmm, sc ...

  8. Probe data: 1918 [RED

    Full Text Available R06-001500-1AR RED AU031498 AU082419 E61744 EH1744 >ATU20347_1(U20347|pid:g790583) Arabidopsis t ... responding to this gene accumulates in response to ozone ... stress and pathogen (bacterial) infection; putativ ...

  9. Probe data: 1601 [RED

    Full Text Available R06-043000-1AR RED C26746 AU075577 C12957 CB2957 >HSU49082_1(U49082|pid:g1840045) Human transpor ... ter protein (g17) mRNA, complete cds; member of a new ... family of transporter protein genes; resides in th ...

  10. Probe data: 3050 [RED

    Full Text Available R05-046640-1AR RED AU031556 AU101584 E61844 EH1844 >HS1119A7_2(AL022313|pid:g4200328) Human DNA ... iation factor EIF3-P66 subunit, EST, GSS, STS, CpG island , complete sequence; &HSU54558_1(U54558|pid:g235137 ...

  11. Probe data: 3094 [RED

    Full Text Available R12-040640-1AR RED D24605 AU101660 R02241 RA2241 >AF099082_1(AF099082|pid:g4176766) Homo sapiens ... xenotropic and polytropic murine retrovirus ... receptor (XPR1) mRNA, complete cds; related to yea ...

  12. EST data: 8680 [RED

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  13. EST data: 8002 [RED

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  14. EST data: 8329 [RED

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. Probe data: 66 [RED

    Full Text Available R07-032820-1AR RED AU166075 AU029521 EE1034 >AF020814_1(AF020814|pid:g2997591) Pisum sativum glu ... cose-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  16. Probe data: 6267 [RED

    Full Text Available R08-034590-1AR RED AU108817 C97061 C51323 CG1323 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  17. Probe data: 783 [RED

    Full Text Available R08-034590-1AR RED D48732 AU032835 S15122 SS5122 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  18. Probe data: 3500 [RED

    Full Text Available R04-059760-1AR RED C27462 AU160841 CG1937 >AF020814_1(AF020814|pid:g2997591) Pisum sativum gluco ... se-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  19. Canadian Red Cross.

    Lavender, Colleen

    2008-01-01

    The Canadian Red Cross is guided by its Fundamental Principles--humanity, impartiality, neutrality, independence, voluntary service, unity, and universality--and organized in a traditional geographic hierarchical structure. Among the characteristics that have contributed to its success are a budgeting process that starts at the local level, measurement of program outcomes, and coordinated fundraising activities at the regional level. PMID:18551842

  20. Probe data: 1164 [RED

    Full Text Available R06-003380-1AR RED AU078263 AU056903 S20966 SA0966 >HVSCOAT_1(L37299|pid:g609504) Helicoverpa ar ... tics, makes tube-like structures when expressed in bacteria , unstable when expressed in baculovirus, start cod ...

  1. Probe data: 5088 [RED

    Full Text Available R10-035910-1AR RED D24257 AU173175 RA1590 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  2. Probe data: 5473 [RED

    Full Text Available R10-035910-1AR RED D48171 AU174043 SS4246 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  3. Probe data: 4686 [RED

    Full Text Available R04-036560-1AR RED AU063886 AU172500 EB1608 >F9D12_15(AF077407|pid:g3319354) Arabidopsis thalian ... a BAC F9D12; contains similarity to sugar ... transporters (Pfam: sugar _tr.hmm, score: 395.39); ...

  4. Sample information: 2201 [RED

    Full Text Available 2201 2 T Cell cycle Oryza sativa (rice) C5924 (Ghaiya) Rice cell (Oc cells from rice root) culture ... red in AA medium 0 Root t 30 min culture ... (cell cycle)|Rice Oc cells were transferred to a n ... ew culture ... medium and collected after 30min ...

  5. Probe data: 2199 [RED

    Full Text Available R01-053030-1AR RED C27281 AU092509 C51502 CG1502 >(P29677) MITOCHONDRIAL PROCESSING PEPTIDASE AL ... PHA SUBUNIT PREC URSOR (EC ... 3.4.24.64) (ALPHA-MPP) (UBIQUINOL-CYTOCHR ... OME C ... REDUCTASE SUBUNIT II) (EC ... 1.10.2.2). &S23558(S235 ...

  6. Probe data: 438 [RED

    Full Text Available R02-055920-1AR RED AU095379 AU031455 E61595 EH1595 >(Q42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC UR ... SOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) (LEUCYL A ... MINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  7. Probe data: 621 [RED

    Full Text Available R11-008840-1AR RED D39164 AU031950 R02794 RA2794 >(P52588) PROTEIN DISULFIDE ISOMERASE PREC URSOR ... (PDI) (EC ... 5.3.4.1) / DOLICHYL- DIPHOSPHOOLIGOSACCHARIDE-PROT ... EIN GLYCOTRANSFERASE (EC ... 2.4.1.119) (GLYCOSYLATION SITE-BINDING CHAIN) (GSB ...

  8. Probe data: 4096 [RED

    Full Text Available R12-025080-1AR RED AU166273 AU166274 CB0250 >(P07814) MULTIFUNCTIONAL AMINOACYL-TRNA SYNTHETASE ... (CONTAINS: GLUTAMYL-TRNA SYNTHETASE (EC ... 6.1.1.17) (GLUTAMATE--TRNA LIGASE), AND PROLYL-TRN ... A SYNTHETASE (EC ... 6.1.1.15) (PROLINE--TRNA LIGASE)). &HSGTS_1(X54326 ...

  9. Probe data: 6356 [RED

    Full Text Available R01-072960-1AR RED C28243 C97586 C60441 CH0441 >(Q42942) URIDINE 5'-MONOPHOSPHATE SYNTHASE (UMP ... SYNTHASE) (OROTATE PHOSPHORIBOSYLTRANSFERASE (EC ... 2.4.2.10) AND OROTIDINE 5'-PHOSPHATE DEC ARBOXYLASE ... (EC ... 4.1.1.23)) (FRAGMENT). &NTU22260_1(U22260|pid:g747 ...

  10. Probe data: 1484 [RED

    Full Text Available R02-005160-1AR RED AU068643 AU068642 C30624 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  11. Probe data: 450 [RED

    Full Text Available R02-005160-1AR RED AU031552 AU031553 E61840 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  12. Probe data: 539 [RED

    Full Text Available R06-015880-1AR RED D24296 AU031777 R01679 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  13. Probe data: 67 [RED

    Full Text Available R08-035600-3AR RED AU029523 AU029522 EE1035 >F6N15_22(AF069299|pid:g3193320) Arabidopsis thalian ... tains similarity to the subtilase family of serine proteases ... (Pfam: subtilase.hmm, score: 47.57); strong simila ...

  14. Probe data: 2573 [RED

    Full Text Available R02-050030-1AR RED C26608 AU100748 C12680 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  15. Probe data: 4726 [RED

    Full Text Available R03-005800-1AR RED C72916 AU172547 EB2461 >ATT25K17_14(AL049171|pid:g4539429) Arabidopsis thalia ... e, Arabidopsis thaliana, AF055848; Contains Serine proteases , subtilase family, active sites [GTSMSCPHVAG]. ...

  16. Probe data: 629 [RED

    Full Text Available R05-000860-1AR RED D39203 AU031981 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thalian ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  17. Probe data: 3935 [RED

    Full Text Available R04-031750-1AR RED AU165241 AU165240 C62825 CH2825 >(P49727) UBIQUINOL-CYTOCHROME C REDUCTASE IRON ... ON-SULFUR SUBUNIT PRECURSOR (EC 1.10.2.2) (RIESKE IRON -SULFUR PROTEIN) (RISP). &A41607(A41607) &MZERFESPA ...

  18. Probe data: 1697 [RED

    Full Text Available R10-029050-2AR RED AU077497 AU077496 C51971 CG1971 >(P48600) EUKARYOTIC TRANSLATION INITIATION F ... (EIF-4E) (EIF4E) (MRNA CAP-BINDING PROTEIN) (EIF-(ISO )4F 25 KD SUBUNIT) (EIF-(ISO )4F P28 SUBUNIT). &JC53 ...

  19. Probe data: 6548 [RED

    Full Text Available R02-004920-4AR RED C73633 C99436 E20022 ED0022 >S72415_5(S72415|pid:g632873) putative protein ki ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(518-52 ...

  20. Probe data: 5046 [RED

    Full Text Available R06-046030-1AR RED AU173086 AU173087 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  1. Probe data: 4866 [RED

    Full Text Available R07-030880-3AR RED C91611 AU172758 ED0945 >S62928_1(S62928|pid:g386431) PRB1M=PRB1 medium length ... equence comes from Fig. 3A. Protein sequence is in conflict ... with the conceptual translation; mismatch(177[R- & ...

  2. Probe data: 3457 [RED

    Full Text Available R03-022440-3AR RED C27097 AU108766 CG0974 >S58544_1(S58544|pid:g299703) 75 kda infertility-relat ... sequence comes from Fig. 4. Protein sequence is in conflict ... with the conceptual translation; mismatches(46[R- ...

  3. Probe data: 1379 [RED

    Full Text Available R11-043720-4R RED AU166370 AU068062 C11732 CB1732 >AMTAM1TR_1(X57297|pid:g1345502) A. majus TAM1 ... gene for TNP1 and TNP2; Protein sequence is in conflict ... with the conceptual translation; no ATG start codo ...

  4. Probe data: 988 [RED

    Full Text Available R01-019390-1AR RED AU056143 AU056144 S20327 SA0327 >HSPM5_1(X57398|pid:g1335273) Human mRNA for ... pM5 protein; Protein sequence is in conflict ... with the conceptual translation.. &S21977(S21977) ...

  5. Probe data: 1072 [RED

    Full Text Available R01-066870-1AR RED AU162697 AU056522 S20655 SA0655 >ATATAF1_1(X74755|pid:g1345506) A.thaliana AT ... AF1 mRNA; Protein sequence is in conflict ... with the conceptual translation.. &S37101(S37101) ...

  6. Probe data: 4820 [RED

    Full Text Available R05-004160-1AR RED C19333 AU172698 EC0269 >S72926_1(S72926|pid:g633890) Hordeum vulgare glucose ... sequence comes from Fig. 1. Protein sequence is in conflict ... with the conceptual translation.. ...

  7. Probe data: 5707 [RED

    Full Text Available R09-000620-2R RED AU161807 AU174368 ST5674 >S81497_1(S81497|pid:g1336726) lysosomal acid lipase= ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(82[G- ...

  8. Probe data: 2355 [RED

    Full Text Available R06-046030-1AR RED AU065261 AU095249 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  9. Probe data: 862 [RED

    Full Text Available R03-008820-1AR RED AU055750 AU055751 S20035 SA0035 >S75487_1(S75487|pid:g913445) adh3a=alcohol d ... rom Fig. 2. Map location 4. Protein sequence is in conflict ... with the conceptual translation; mismatch(46[R- &V ...

  10. Probe data: 3193 [RED

    Full Text Available R04-033600-2AR RED C24862 AU101846 S16003 SS6003 >IT U51741_1(U51741|pid:g1272351) Ipomoea trifid ... eceptor protein kinase 2 (IRK2) mRNA, partial cds; it ... is unknown whether kinase domain is translated; ge ...

  11. Probe data: 3966 [RED

    Full Text Available R09-031370-1AR RED C72012 AU165393 EB0781 >AC002329_15(AC002329|pid:g2262170) DNA sequence of Ar ... 9); glycosyl hydrolase family I signature found at residues ... 329 to 337 [SLLLENGAA]. ...

  12. Probe data: 3897 [RED

    Full Text Available R06-022230-4R RED D23831 AU164531 RA0286 >AC002329_18(AC002329|pid:g2262173) DNA sequence of Ara ... nucleotide-disulphide oxidoreductases located from residues ... 197 to 219 [CAVCD...IGGGD]. ...

  13. Evaluación de un sistema de información para mejorar la red de ventas

    Macías Ruiz, Antonio

    2008-01-01

    El presente proyecto analiza la situación existente en la red de ventas de una empresa con el objetivo de mejorar su funcionamiento mediante el uso de las tecnologías de la información y comunicación, la gestión del conocimiento, y los miembros de la propia red de ventas. A partir de la situación existente se propone una solución para mejorar la red de ventas mediante la implantación de dos aplicativos en la intranet de la empresa. Se define el papel que tienen las tecnologías ...

  14. Red Neuronal Creciente Usando Perturbación Simultánea Growing Cell Neural Network using Simultaneous Perturbation

    Sánchez, G.; Pérez, H; Nakano, M

    2004-01-01

    Este artículo propone una red neuronal de tipo perceptron multicapas (MLP) que optimiza tanto su matriz de pesos como el número de neuronas ocultas. Inicialmente el sistema propuesto usa un número reducido de neuronas ocultas, optimizándose la matriz de pesos mediante un algoritmo de perturbación simultánea. Una vez que la red converge se analiza su funcionamiento y si este no es el esperado se agrega una neurona oculta. Este proceso se repite hasta obtener el funcionamiento deseado. Los resu...

  15. Incesto: una plaga silenciada

    Yamileth Ramírez Rodríguez

    2003-01-01

    Los costarricenses, hemos sido omisos ante los hechos incestuosos. Aun hoyes un tema tabú que suele silenciamos y por ende a veces quedan impunes. Cuando de investigación se trata, la cruda realidad es que la información es escueta, por lo que nos vimos obligados a acudir a la razón y a la experiencia de la humanidad en dicho campo, así como de nuestros despachos judiciales. El incesto es un crimen y constituye un abuso real en una relación de poder. De esta manera se dirá que el perpetrador ...

  16. Hacia una publicidad solidaria

    Barcala Calvo, Ignacio; Matilla, Concepción

    2000-01-01

    Podemos decir que actualmente los medios de comunicación ejercen una enorme influencia sobre nosotros. Los informativos definen lo que es la realidad para buena parte de la población y la publicidad marca hábitos de consumo y crea actitudes ante la vida. Esta reflexión pretende analizar críticamente el modelo educativo que nos ofrece la publicidad, encaminado hacia la rentabilidad, la utilidad y el éxito de la sociedad de mercado, como valores primordiales que debemos mantener y proponer, des...

  17. una propuesta de indicadores

    Noemí Luján Ponce

    2007-01-01

    Full Text Available La tecnología reviste características de neutralidad, eficiencia, transparencia y regularidad. Factores que hoy día resultan relevantes para realizar procesos electorales confiables. Las redistritaciones electorales en México 1996 y 2005 resultan casos paradigmáticos en relación a la cristalización de la tecnología como una mediación para la construcción de acuerdos entre los partidos y las autoridades electorales. Se ofrecen cinco indicadores para comparar ambos procesos de distritación.

  18. Una estudiante ejemplar

    Esnaola Echaniz, Igor

    2012-01-01

    Duración (en horas): De 31 a 40 horas. Destinatario: Estudiante y Docente A finales de febrero de 2010, el tutor y profesor del grupo de Diversificación Curricular, Josu, tenía que decidir qué hacer para que una de sus alumnas, Amaia, mejorase en su rendimiento académico y comportamental, ya que la evaluación fue negativa; no tenía motivación para estudiar, su comportamiento era inadecuado para el aprendizaje y sus hábitos de ocio tampoco eran el mejor ejemplo para que su rendimiento acadé...

  19. Hacia una vejez útil

    Hernández Amparo; Díaz María I.; Luna T. Leonor

    2010-01-01

    Con lleva un interés bien particular encontrarnos con una población tan heterogénea en cuanto a caracterización se refiere, ya porque miremos en ella sus hábitos, sus costumbres, procedencia, nivel socio-cultural, etc., dicha comunidad de ancianos plantea, de inmediato la necesidad de ponerse en un contacto generacional que rompiera y dejara atrás la rutina y la monotonía, propia de su cotidianidad, es entonces cuando tres profesionales altamente motivadas en el trabajo comunitario, ...

  20. Ecuador: una democracia inestable

    Juan J. Paz y Miño Cepeda

    2009-01-01

    En 1979, tras una década de dictaduras militares, se inició la fase constitucional más larga en la historia del Ecuador. Ésta se levantó sobre las herencias del pasado y se caracterizó, de manera fundamental, por el tránsito desde un modelo estatal-desarrollista hacia uno de tipo empresarial, por el aparecimiento de nuevos agentes sociales, el multipartidismo político, la regionalización nacional, la presencia multicultural y la inserción del país en nuevas relaciones internacionales. Pero es...

  1. ECONOMÍAS INFORMALES EN LA CIUDAD DE MÉXICO LA RED DE LA BASURA

    SALVIANI DE BOSECK SOFÍA

    2010-05-01

    Full Text Available La ciudad de México es una de las ciudades más grandes del mundo y una de las áreas metropolitanas de más rápida expansión suburbana difusa, lo cual genera diversos problemas. La red de recolección de residuos sólidos en México DF es una simbiosis entre la economía formal e informal y una manifestación de la estructura sociopolítica de México, que refleja también otros problemas. Las formas que presenta el paisaje urbano, revelan la estructura oculta de una compleja red mixta de recolección de basura formal e informal. La relación de poderes dentro de esta red provoca un impacto socioeconómico relevante, debido a que los trabajadores se encuentran en el rango más bajo de esta estructura. Éstos, conocidos como pepenadores, están atrapados en un sistema en el cual dependen de la clase más alta que no presta atención en mejorar sus condiciones vitales básicas. Aunque la red de recolección de residuos urbanos de la ciudad de México cuenta con ganancias multimillonarias, ellos siguen siendo pobres y dependientes de la red. ¿Cuáles son las causas para que éste hecho se produzca y cuáles serían las soluciones posibles? ¿Sería posible formalizar la red? ¿Tendría este cambio un efecto positivo en las condiciones básicas vitales del sector inferior de la red?

  2. Una finestra sul polo

    Graziella Busso

    2015-07-01

    Full Text Available Rabbia, dolore, incredulità si mescolano in un turbinio di emozioni quando, dalle affissioni che quasi quotidianamente si danno il cambio, si legge il necrologio di un “qualcuno” che sappiamo ucciso dal cancro. E pensiamo che, ancora e forse per tanto tempo, potremmo essere più fortunati. E non c’è pace, non c’è consolazione per quei giorni di vita vissuta, strappata, stropicciata, rubata da un mostro che non sempre è possibile sconfiggere finché non subentra la stanchezza, la rassegnazione, la secchezza delle ghiandole lacrimali. Unico strumento per cercare di “cambiare le cose”, per quanto difficile possa sembrare farlo, è combattere, perché la lotta per un ambiente più vivibile sarà una conquista per noi e per i nostri figli, un’eredità che non ha prezzo. La voglia di “gridare” la sofferenza di chi vive la realtà di uno sviluppo insostenibile si è da tempo trasformata ad Augusta in una battaglia di sensibilizzazione alla ormai annosa problematica e nel profondo desiderio di raccontare, far conoscere, testimoniare emozioni, desideri, sogni di chi vive in prima persona o ha vissuto la malattia di un proprio caro perché tutto questo possa servire a spingere verso quel mutamento culturale, storico, ambientale a cui tutti noi agogniamo.

  3. Una Colombia imaginada

    Miguel A. Ramiro Avilés

    2014-01-01

    Full Text Available José Antonio Osorio Lizarazo, José Félix Fuenmayor y Manuel Francisco Sliger Vergara escribieron, respectivamente, Barranquilla 2132, Una triste aventura de 14 sabios y Viajes interplanetarios en Zepelines que tendrán lugar el año 2009. Se trata de tres novelas de ciencia ficción que fueron publicadas en Colombia en la década de 1930. En estas obras se perfila una Colombia imaginada, muchas veces deseada y, por suerte o desgracia, nunca alcanzada. El objetivo de este texto es presentar las propuestas de reforma política anunciadas por estos tres autores en sus obras de ciencia ficción, centrando la atención en la obra de José Antonio Osorio Lizarazo por ser la más compleja y elaborada de las tres, así como por estar directamente ligada al pensamiento político de Jorge Eliécer Gaitán.

  4. Una Colombia imaginada

    Miguel A. Ramiro Avilés

    2013-12-01

    Full Text Available José Antonio Osorio Lizarazo, José Félix Fuenmayor y Manuel Francisco Sliger Vergara escribieron, respectivamente, Barranquilla 2132, Una triste aventura de 14 sabios y Viajes interplanetarios en Zepelines que tendrán lugar el año 2009. Se trata de tres novelas de ciencia ficción que fueron publicadas en Colombia en la década de 1930. En estas obras se perfila una Colombia imaginada, muchas veces deseada y, por suerte o desgracia, nunca alcanzada. El objetivo de este texto es presentar las propuestas de reforma política anunciadas por estos tres autores en sus obras de ciencia ficción, centrando la atención en la obra de José Antonio Osorio Lizarazo por ser la más compleja y elaborada de las tres, así como por estar directamente ligada al pensamiento político de Jorge Eliécer Gaitán.

  5. Infra-red material structures

    A process for modifying properties of infra-red materials in or for use in infra-red windows and other structures, in which the infra-red material is subjected to ion implantation whereby ions of an elemental dopant are implanted into the infra-red material under vacuum conditions. Heat diffusion may improve the depth of ion penetration. Specified materials are germanium, zinc sulphide, cadmium mercury telluride, calcium lanthanum sulphide and zinc selenide; specified dopants are boron, carbon and silicon. (author)

  6. Registration of 'Red Ruby' Wheat

    Red Ruby’ soft red winter wheat (Triticum aestivum L.) was developed by the Michigan Agricultural Experiment Station and released in 2007 via an exclusive licensing agreement through Michigan State University (MSU) Technologies. Red Ruby was selected from the cross Pioneer ‘2552’/Pioneer ‘2737W’ ma...

  7. Una vita per il design

    Malcovati, Silvia

    2008-01-01

    Recensione della mostra "Scoprire il design. La collezione Alexander von Vegesack", Pinacoteca Agnelli, Torino, 20 marzo - 6 luglio 2008. L'esposizione è prima ancora che una mostra sul design, una mostra sul collezionismo, sulle sue ragioni, sulle scelte e sul senso dell'esporre. La collezione von Vegesack è, infatti, una collezione particolare, che si potrebbe definire "biografica", o "esistenziale", nella misura in cui non è classificabile se non in stretta relazione con il suo proprietari...

  8. Una propuesta de gimnasia funcional

    Pagola, Laura

    2011-01-01

    Este trabajo se propone mostrar una clase de Gimnasia, considerando a esta como una práctica corporal, socialmente significativa, con principios que la caracterizan como su intencionalidad, la que fue variando a lo largo de la historia, y una sistematicidad que le permite conseguir objetivos puntuales para ajustar la actuación corporal a situaciones diversas y cambiantes. Teniendo en cuenta, especialmente las particularidades del sujeto con su historia, que va a determinar la forma de mov...

  9. Mucormicosis: Una micosis emergente

    Iris Tiraboschi

    2012-02-01

    Full Text Available El objetivo de este trabajo es presentar la incidencia, frecuencia, características clínicas y evolución de los pacientes con mucormicosis atendidos en el Hospital de Clínicas José de San Martín, Universidad de Buenos Aires, entre los años 1982 y 2010. Durante ese período se diagnosticaron 10 casos de mucormicosis. Los tres primeros entre 1982 y 2004 y los últimos 7 entre 2005 y 2010. La incidencia y frecuencia de esta enfermedad, para el período 1980-2004 fue 0.13 pacientes/año y 0.1 casos/10 000 egresos (IC 95%: 0.00 a 0.3 respectivamente. En el período 2005-2010 la incidencia fue 0.86 pacientes/año y la frecuencia de 1.1 casos/10 000 egresos (IC 95%: 0.5 a 2.4. Hubo nueve casos de mucormicosis rinosinuso-orbitaria, siete en pacientes con diabetes mellitus, uno en una paciente con una hemopatía maligna y neutropenia, y el restante en un paciente con HIV/sida que además estaba neutropénico y con un síndrome hemofagocítico. En una paciente se realizó el diagnóstico post mortem de mucormicosis pulmonar. El diagnóstico se efectuó por la observación de filamentos cenocíticos en los diez casos. Hubo desarrollo de mucorales en los cultivos de 8/9 pacientes; cinco Rhizopus spp y tres Mucor spp. Todos los pacientes recibieron un tratamiento inicial con anfotericina B deoxicolato, que en tres de ellos fue continuado con anfotericina B liposomal, y cirugía. Tres enfermos recibieron además un tratamiento adyuvante con oxigeno hiperbárico. La mortalidad fue 30%.

  10. Human red cell acetyltransferase

    Acetyltransferase was isolated by histone-Sepharose affinity chromatography from human cord blood red cells. The enzyme was detected only in very young red cells. The semipurified enzyme and [14C]acetyl-CoA were used to acetylate isolated Hb F tetramer and α and γ subunits. The in vitro acetylated products were characterized by globin chain separation by CM-cellulose chromatography and tryptic peptide analysis by reverse-phase HPLC. Acetylation of both the γ-chains and the α-chains could occur within the Hb F tetramer. Acetylation also could take place on intact subunits. It appears that some Hb F/sub Ic/ could be formed in the cells by utilizing Hb F or free γ-chains as acetylation substrate

  11. Convergencia débil de una sucesión de grafos aleatorios radiales de Bernoulli

    Leon A. Valencia

    2016-05-01

    Full Text Available En este artículo se introduce una colección de trayectorias aleatorias radiales coalescentes definidas sobre una región del plano, y se probará que, en una escala difusiva, dicha colección converge en distribución, mediante homeomorfismo, a una restricción de la Red Browniana. Abstract. This article introduce a collection of coalescing random paths defined on a radial plane region. It will proved that, in a diffusive scale, this collection converges in distribution, via homeomorphism, to a restriction of Brownian Web.

  12. Auditoría de las redes LAN y WAN de las distintas sedes de una empresa

    Sebastián Pino, Fernando

    2008-01-01

    Este documento, contiene los resultados obtenidos al realizar una auditoria de redes LAN y WAN de las diferentes sedes de una empresa. Durante el documento, se explicarán los métodos utilizados para la obtención de datos tanto a nivel LAN como WAN, los esquemas de las topologías de red estudiadas, así como los resultados obtenidos para cada una de las delegaciones y entornos estudiados. Una vez mostrados los resultados del estudio, se intentarán aportar soluciones que puedan mejorar e...

  13. Probe data: 2561 [RED

    Full Text Available R08-000680-1AR RED C26504 AU100736 CB2477 >SPAC4F8_3(Z98530|pid:g2330820) S.pombe chromosome I c ... orf, (250aa), fasta scores, opt:691, E():0, (47.2% identity ... in 246 aa overlap), also similar to C.elegans Q232 ... 6E11, (258aa), fasta scores, opt:632,E():0, (40.2% identity ... in 249 aa overlap). ...

  14. Probe data: 2942 [RED

    Full Text Available R01-031330-1AR RED C74139 AU101397 E30485 EE0485 >SPBC3B9_12(AL022070|pid:g2950478) S.pombe chro ... (219aa), fasta scores, opt:182, E():1e-29, (29.8% identity ... in 215 aa overlap), also similar eg. to C. elegans ... 224aa), fasta scores, opt:303, E():1.2e-26, (41.4% identity ... in 111 aa overlap). ...

  15. Probe data: 5856 [RED

    Full Text Available R10-024200-4R RED AU174678 AU174679 FE0202 >AP000002_62(AP000002|pid:g3256770) Pyrococcus horiko ... nt. position (2/7); similar to PIR:S44960 percent identity :40.645 in 320aa; PIR:S69807 percent identity :41.10 ... 0 in 319aa; owl:MTY13D1217 percent identity :39.171 in 224aa. &H71145(H71145) ...

  16. Probe data: 5450 [RED

    Full Text Available R04-032550-1AR RED D47635 AU174014 SS3251 >AC002534_10(AC002534|pid:g2392772) Arabidopsis thalia ... products; the lack of similarity in the N-terminal region ... between T32N15.11 and bacterial PheA gene products ... re located from residue 279 to 301 [YNLQI..RFLML] (region ... includes a conserved threonine found to be essenti ...

  17. Probe data: 1459 [RED

    Full Text Available R09-012590-1AR RED AU166582 AU068404 CE0184 >DMSEG0007_4(AL033125|pid:g4185888) Drosophila melan ... e.; 2-match_species=Drosophila melanogaster (fruit fly ); 2-method=blastn;1.4.9; 2-method_score=2580.00; 2 ... e.; 3-match_species=Drosophila melanogaster (fruit fly ); 3-method=blastn;1.4.9; 3-method_score=3101.00; 4 ...

  18. EST data: 731 [RED

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  19. Hacia una sociedad hipertextual

    Mireya Barón Pulido

    2013-03-01

    Full Text Available El presente artículo de revisión analiza y relaciona los resultados de varias investigaciones que toman como objeto de estudio los elementos que incursionan en el contexto de la comunicación desde la red: hiperdocumento, macronavegación y micronavegación. Dimensiones y procesos que afectan y transforman los mismos niveles de interacción al interior de las sociedades; hoy día reco- nocidas como sociedades digitales. El lector encontrará referencia a algunos estudios locales e internacionales haciendo referencia a corpus multimediáticos del periodismo y de la publicidad que permiten evidenciar dichos elementos y que sugieren la transformación y, en algunos casos, la construcción de nuevos patrones de interacción social entre lectores y perceptores.

  20. Una historia muy simple

    Miha Mazzini

    2009-01-01

    Voy a contarles una historia muy simple. Probablemente no les parecerá nada espe- cial y no quiero robarles tiempo, así que voy a tratar de hacerlo lo más rápido posible. Me inscribí en psicología porque eso hizo mi mejor amiga. Éramos compañeras desde jardín de infantes y siempre la seguí en todo. En tercer año de facultad conoció a su novio y continuó sus estudios en otro país; por primera vez no podía seguirla. Cuando rendí todos los exámenes, el profesor me preguntó si estaba interesa...

  1. Una crisis financiera estructural

    Pierre Salama

    2010-01-01

    Full Text Available El autor sostiene que la crisis económica que estalló a mediados del 2008 en los países industrializa-dos y que rápidamente contagió a todas las economías del mundo, no tiene un origen exclusivo en las desregulaciones del mercado financiero. Aunque estas sin duda han precipitado y amplificado la crisis, es fundamental considerar la globalización financiera y comercial que ha marcado los regíme-nes de crecimiento económico. Es esta globalización la que ha provocada la deslocalización de la producción –a favor de China– y una consecuente pérdida de empleos y atonía de los salarios. Des-de esta perspectiva terminar la crisis requerirá más que una restructuración de la arquitectura financiera, será necesario modificar la desregularización financiera y comercial.The author maintains that the economic crisis that broke out in mid-2008 in industrialized countries and quickly spread to economies throughout the world does not have its origins solely in deregula-tion of the financial market. Though this clearly precipitated and has broadened the crisis, it is essential to consider the financial and commercial globalization that has marked regimes of economic growth. This is the globalization that has provoked the dislocation of production – in favor of China – and the consequent loss of jobs and stagnation of salaries. From this perspective, an end to the crisis will require more than a restructuring of financial architecture; what will be needed is change in financial and commercial deregulation.

  2. Una agenda para educadores

    Robert O. McClintock

    2007-01-01

    Full Text Available Las instituciones educativas constituyen los principales factores en la construcción social de un nuevo sistema educativo. Las escuelas y los educadores controlan y producen propiedad intelectual de una extraordinaria profundidad y amplitud. Los cambios producidos por las tecnologías digitales están consiguiendo que el acceso y la producción de conocimiento sea más accesible y universal. Lo que es, a la vez, un gran logro de apertura curricular, pero también un grave peligro de perder la perspectiva eminentemente “educativa” de la transmisión del conocimiento en la escuela. Los nuevos recursos permiten a los educadores romper el ciclo de reproducción en los logros educativos, acercarse al medio y a la familia y transformar la escuela. Los educadores y las escuelas deben asumir el reto de constituir comunidades de aprendizaje. Así como de atreverse a producir y difundir ese conocimiento con soporte digital. Lo contrario sería una terrible abdicación. El artículo traza un recorrido histórico sobre esta función de la escuela y su adaptación a los medios y recursos de cada época. Tras lo cual, aboga por asumir el desafío actual de las TICs, para renovar el vínculo progresista con la posteridad y construir un mejor futuro. Los nuevos recursos permiten a los educadores romper el ciclo de reproducción en los logros educativos, acercarse al medio y a la familia y transformar la escuela.

  3. FOG: Una solución código libre para clonar PCs

    Capablo Lardies, Antonio

    2015-01-01

    El objetivo de este proyecto es diseñar un sistema barato, sencillo y rápido para poder crear y restaurar imágenes de sistemas operativos en diferentes PCs, dentro de una misma red de área local (LAN).

  4. ReHuNa- La Red por la Humanización del Parto y Nacimiento

    Daphne RATTNER; Marcos Leite dos SANTOS; Heloisa LESSA; Simone Grilo DINIZ

    2010-01-01

    La ReHuNa - Red por la Humanización del Parto y Nacimiento - es una organización de la sociedad civil que actúa desde 1993 en forma de red de asociados en el Brasil. Su principal objetivo es la divulgación de la asistencia y cuidados perinatales con base en evidencias científicas y de acuerdo a las recomendaciones de la Organización Mundial de la Salud. Esta red tuvo un papel fundamental en la estructura de un movimiento que hoy se denomina “humanización de la asistencia al parto y nacimiento...

  5. Red de sensores pervasiva para el bienestar basada en RaspberryPi

    Vilches, Ruben; Oller Arcas, Antonio; Bajet Mena, Marc Antoni; Alcober Segura, Jesús Ángel

    2013-01-01

    Las redes de sensores “pervasivas” permiten convivir con los usuarios ofreciendo servicios de manera transparente y sin la necesidad que los usuarios interactúen de manera directa. Este trabajo define una arquitectura que permite la creación de productos y servicios para ofrecer funcionalidades domóticas a un gran sector de la población. Se ha diseñado una plataforma, sobre un dispositivo de bajo coste y alta capacidad de computación, como base de una red de sensores transparente e indisti...

  6. Aplicación Android: Red social de búsqueda de aparcamiento

    COMPANY SOLER, MIGUEL

    2015-01-01

    [ES] El presente Trabajo Fin de Grado consiste en la creación de una ap icación móvil desarrollada para sistemas operativos Android. Se trata de una red social de búsqueda de aparcamiento para coches, que utiliza un sistema de puntuaciones basado en el buen o mal comportamiento de los usuarios. Estos pueden promocionar sus puntuaciones mediante el buen uso de la aplicación, y así obtener una visualización completa de aparcamientos libres cerca de su destino. En cambio, los usuarios que no ten...

  7. Desenvolupament d'una xarxa Wi-Fi de darrera generació per al municipi de Sant Joan de Labritja (Eivissa)

    Roig Torres, Antonio

    2015-01-01

    Desenvolupament i parametrització d'una xarxa Wi-Fi de darrera generació per al municipi de Sant Joan de Labritja a Eivissa. Desarrollo y parametrización de una red Wi-Fi de última generación para el municipio de San Juan de Labritja en Ibiza. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  8. Red social y salud del adulto mayor en perspectiva comparada: Costa Rica, España e Inglaterra

    Castro, Teresa de; Rosero-Bixby, Luis; Glaser, Karen; Puga, Dolores

    2007-01-01

    En el presente trabajo se explora la relación entre la red social más próxima al adulto mayor, los vínculos establecidos con otros miembros del hogar y con los hijos, y las condiciones de salud en la vejez, desde una perspectiva internacional comparada. Para ello se cuenta con evidencias empíricas de una sociedad latinoamericana (costarricense), una sociedad latino-europea (española) y una sociedad anglosajona (británica). Los adultos mayores de los tres países analizados han mostrado modelos...

  9. Una revista distinta: Ellas

    Requena Hidalgo, Cora

    2014-06-01

    Full Text Available This article focuses on the women’s magazine Ellas, published in the mid-nineteenth century in Madrid, and discusses its relationship with other approximately contemporary magazines and newspapers in order to contribute to a reconstruction of the history of women’s publications in the Spanish press. The approach is based on an analysis of the text of each issue of the magazine and comparison with other publications, where applicable. Key features of the article include a reflection on the social rights of women, an attempt to analyse the main differences between women and men and defining features of sexual gender, the need for women’s education, etc. Studying the magazine’s content clearly reveals a continual tension between progressive and conservative ideas typical of the historical context in which gender studies emerged in Spain.Este artículo centra su atención en la revista para mujeres Ellas, publicada a mediados del siglo XIX en Madrid. Analiza, asimismo, la relación de esta publicación con algunas otras revistas y periódicos de su contexto histórico próximo, con el fin de contribuir a la reconstrucción de una Historia de las publicaciones para mujeres en la prensa española. Para ello se utiliza el análisis de textos que forman parte de los números que componen la revista, así como el análisis comparativo entre publicaciones, cuando es pertinente. Entre los aspectos de mayor interés que el artículo pone de relieve se encuentra la reflexión sobre los derechos sociales de las mujeres, el intento de análisis de las principales diferencias entre mujeres y hombres y de los rasgos definitorios de los géneros sexuales, la necesidad de educación de las mujeres, entre otros. El estudio del contenido de la publicación revela claramente una tensión contradictoria continua entre las ideas progresistas y las ideas conservadoras propias del momento histórico que dieron origen en España al nacimiento de los estudios de género.

  10. Bicentenarios digitales: celebraciones en la red

    Alvar de la Llosa

    2011-06-01

    Full Text Available Si  la celebración del primer centenario de las independencias de los países americanos se valió de las innovaciones de los medios de comunicación de su época, en particular del cine, hoy en día los gobiernos han asaltado la Red y se han apoderado del media para difundir una versión oficial. Conviene por lo tanto ver cómo los diferentes países latinoamericanos construyen este Bicentenario siempre de modo nacional y unilateral y nunca transnacional, en el marco de unas fronteras modernas a pesar de un pasado común entre varias naciones.Palabras clave: Internet, bicentenario, Latinoamérica.___________________________Abstract:The celebration of the first centenary of independence of american countries used the innovations of the mass media of it time, particulary the movie world. Today, the governements stormed Internet and taked possession of the media to spread an official version. It´s necesary, consequently, to analyse how the different latin american countries build this Centenary, always national, never like a transnational perspective, in the context of the modern frontiers and the common past.Keywords: Internet, bicentenary, Latin America

  11. Deep Red (Profondo Rosso)

    Cine Club

    2015-01-01

    Wednesday 29 April 2015 at 20:00 CERN Council Chamber    Deep Red (Profondo Rosso) Directed by Dario Argento (Italy, 1975) 126 minutes A psychic who can read minds picks up the thoughts of a murderer in the audience and soon becomes a victim. An English pianist gets involved in solving the murders, but finds many of his avenues of inquiry cut off by new murders, and he begins to wonder how the murderer can track his movements so closely. Original version Italian; English subtitles

  12. Probe data: 305 [RED

    Full Text Available R08-039710-1AR RED AU030739 AU030740 EH0171 >PTU27116_1(U27116|pid:g857578) Po pulus tremulo ides ... caffeo yl-Co A 3-O -methyltransferase mRNA, co mplete cds; S- ... adenyo syl-methio nine caffeo yl-Co A 3-O -methyltransferase; ... similar to ... Swiss-Pro t Accessio n Number P28034; similar to ... pro ... teins enco ded by GenBank accessio n Numbers U20736, U13151, an ...

  13. Big Red Telephone, Gone

    Toni Piech

    2006-01-01

    @@ The Chinese big red telephones looked exactly as Iimagined the ones servicing the direct emergen line between the Kreml and the White House duing the cold-war era would have look like. But here in China, every kio seemed to have such a device in t1990s, and anyone could use it for ju 0.2 yuan. The government did not juinstall public phones on street corner but they let small-business owners pa ticipate in telecommunication. Supply and demand were juggled by a kind of Hutong capitalism.

  14. Alaistaitokartoitus, Red Events Oy

    Latva, Mariikka

    2013-01-01

    Tämän tutkimuksellisen opinnäytetyön tarkoituksena oli kartoittaa tapahtuma-alan yrityksen Red Events Oy:n vuokratyöntekijöiden mielipiteitä heidän omista alaistaidoistaan. Työn tavoitteena oli saada kartoituksen tulosten pohjalta mahdollisia kehittämisehdotuksia. Opinnäytetyön tietoperusta muodostui alaistaidoista ja psykologisesta sopimuksesta. Psykologisen sopimuksen osa-alueista esiteltiin työn kannalta merkittävimmät, joita olivat vuorovaikutus, palautteen antaminen ja vastaanottam...

  15. Probe data: 5759 [RED

    Full Text Available R10-026870-1AR RED AU174436 AU174437 EA0016 >C ELC 46G7_4(U97593|pid:g1946975) C aenorhabditis eleg ... ans c osmid C 46G7; weak similarity to human ataxin-1 X792 ... 04 (NID:g529662); c oded for by C . elegans c DNA yk153d2.5; c oded for by ... C . elegans c DNA yk95h11.5; c oded for by C . elegans c ... DNA yk5a4.5; c oded for by C . elegans c DNA yk11g5.5; c oded for by ...

  16. Probe data: 331 [RED

    Full Text Available R04-032990-1AR RED AU030864 AU030865 E60359 EH0359 >C ELB0546_1(AF038604|pid:g2702370) C aenorhabd ... itis elegans c osmid B0546; c ontains similarity to Drosophila ovar ... ian tumor loc us protein (GB:X13693); c oded for by C . elegans c DN ... A yk389b1.5; c oded for by C . elegans c DNA yk332a1.5; c oded for by ... C . elegans c DNA yk314b10.5; c oded for by C . elegans ...

  17. Probe data: 739 [RED

    Full Text Available R05-012910-1AR RED C 23575 AU032457 SS0091 >C ELH17B01_3(AF040646|pid:g2746826) C aenorhabditis ele ... gans c osmid H17B01; c oded for by C . elegans c DNA yk169c 10 ... .3; c oded for by C . elegans c DNA yk125b6.3; c oded for by ... C . elegans c DNA yk71e8.3; c oded for by C . elegans c D ... NA C EESD11FB; c oded for by C . elegans c DNA C EESD11F; c o ...

  18. HACIA UNA ORGANIZACIÓN QUE APRENDE: UNA EXPERIENCIA CUBANA

    Armando Cuesta Santos

    2004-01-01

    Se enuncian principios y atributos relativos a la organización que aprende, haciéndose consideraciones sobre su aplicación al adoptarse una definición y arribar a una conducción metodológica buscando hacerla viable en la practica empresarial cubana. Ofrecer una reseña sobre tal viabilidad con las experiencias adquiridas reflejando peculiaridades, constituye el objetivo central de este trabajo, reali...

  19. de una lengua extranjera

    Félix Mendoza Martínez

    2006-01-01

    Full Text Available La enseñanza de las lenguas extranjeras atraviesa hoy por lo que consideramos una “nueva crisis del desarrollo”. Nos referimos al hecho de que, no obstante los avances experimentados en el campo de la psicopedagogía, los resultados del proceso de enseñanza-aprendizaje de dichas lenguas, en términos tanto de eficiencia terminal como de calidad del dominio de habilidades comunicativas, distan mucho de ser satisfactorios. La utilización del enfoque comunicativo y la adopción de un abordaje constructivista de este proceso parecen no estar aún en condiciones de resolver esta “crisis”. En este trabajo se trata de analizar esta situación a la luz de la concepción vygotskiana, y más concretamente, de la teoría de la dirección de la asimilación de P. Y. Galperin (1959, 1966, y se propone un modelo de intervención pedagógica que podría coadyuvar a resolver esta problemática.

  20. Analysis of RED ONE Digital Cinema Camera and RED Workflow

    Foroughi Mobarakeh, Taraneh

    2009-01-01

    RED Digital Cinema is a rather new company that has developed a camera that has shaken the world of the film industry, the RED One camera. RED One is a digital cinema camera with the characteristics of a 35mm film camera. With a custom made 12 megapixel CMOS sensor it offers images with a filmic look that cannot be achieved with many other digital cinema cameras. With a new camera comes a new set of media files to work with, which brings new software applications supporting them. RED Digital ...

  1. Se lanza Red Nacional de Estudios Clínicos del NCI

    El Instituto Nacional del Cáncer (NCI) puso en marcha una nueva red de investigación de estudios clínicos con el objetivo de mejorar el tratamiento de más de 1,6 millones de estadounidenses que reciben un diagnóstico de cáncer cada año.

  2. Red Tape, Corruption and Finance

    Keith Blackburn; Rashmi Sarmah

    2006-01-01

    We study the effects of red tape and corruption in a model of occupational choice, entry regulation and imperfect capital markets. Red tape is the set of rules and regulations that private agents are obliged to comply with in order to engage in entrepreneurial activity. Corruption is the payment of bribes to public officials for the purpose of circumventing red tape. Capital market imperfections are the asymmetries of information between borrowers and lenders about the returns to entrepreneur...

  3. Una visita en Sud America

    1982-09-01

    Oisfrute de una estadfa en el Hotel La Silla, el mejor hotel de Sud America con su tan unica atmosfera extraterrestre! Los espera su calificado personal de experimentados hoteleros, jefes de cocina, etc., ansiosos todos de satisfacer sus deseos hasta el mas mfnimo detalle. Naturalmente nuestro espacioso restaurant de tres estrellas ofrece un completo surtido de exquisitas comidas y deliciosos tragos (conocedores usualmente eligen "Oelicia Orion" 0 "Centauro Especial"). EI servicio cempleto durante 24 horas incluye nuestra ya mundialmente famosa "Cena de medianoche para los miradores de estrellas", por eso - no olvide: No pierda la oportunidad de una estadfa en EL HOTEL LA SILLA - una experiencia maravillosa!

  4. una perspectiva poskeynesiana

    Carlos Guerrero de Lizardi

    2006-01-01

    Full Text Available Para analizar el crecimiento económico de nuestro país entre 1929 y 2003 proponemos dos modelos de inspiración poskeynesiana. El primero enfatiza el papel de las elasticidades ingreso de las exportaciones e importaciones y la dinámica económica del resto del mundo. El segundo adiciona las elasticidades precio de las exportaciones e importaciones, los flujos netos de capital y los términos de intercambio. El documento está orientado a la estimación econométrica de los muchos parámetros en cuestión. Algunos resultados son los siguientes. En primer lugar la dinámica económica observada a lo largo del período estudiado y distintos subperíodos es repetidamente inferior al crecimiento económico consistente con una cuenta corriente cero. Como consecuencia, se espera que la proporción entre el crecimiento económico de México y Estados Unidos disminuirá en los próximos años. En segundo lugar, la economía mexicana valida la condición Marshall-Lerner por lo que, según nuestra segunda especificación, el efecto del tipo de cambio real sobre el nivel de actividad productiva es definitivamente positivo. Por último, sólo a partir de 1996 encontramos un reducido efecto positivo de los influjos de capital sobre la evolución del producto interno bruto (PIB.

  5. Incesto: una plaga silenciada

    Yamileth Ramírez Rodríguez

    2003-03-01

    Full Text Available Los costarricenses, hemos sido omisos ante los hechos incestuosos. Aun hoyes un tema tabú que suele silenciamos y por ende a veces quedan impunes. Cuando de investigación se trata, la cruda realidad es que la información es escueta, por lo que nos vimos obligados a acudir a la razón y a la experiencia de la humanidad en dicho campo, así como de nuestros despachos judiciales. El incesto es un crimen y constituye un abuso real en una relación de poder. De esta manera se dirá que el perpetrador puede ser un padre, padrastro, madre, abuelo, tío, hermanos, primos, sobrinos, etc. Pero se pretenderá dejar las bases para que esta terminología se pueda ampliar mas allá de la existencia del parentesco en línea directa.In Costa Rica, we have been omitted before acts of incest. For example, today it is still a taboo issue that keeps us in silence and that is part of the reason why this crime is still without punishment. When we investigate this topic, we find a hard reality: we do not have statistics; which is why we have to use the experiences of other people and our experience in the judicial bureau. Incest is a crime and a definite abuse in a relationship of power. In this manner, we are going to say that the perpetrator could be the father, stepfather, mother, grandpa, uncle, brothers, cousins, nephews, etc. In this essay we give the guidelines to extend this terminology and extend it to the existing familiar line of direct relatives.

  6. Hacia una nueva generación de repositorios

    Rodrigues, Eloy

    2016-01-01

    El crecimiento del número de repositorios en la última década ha sido impresionante. Hoy existen repositorios en casi todas las principales instituciones de investigación y educación superior en el mundo, y eso puede ser la base para una infraestructura global, distribuida y en red para la comunicación académica. Sin embargo, las plataformas de repositorios siguen utilizando tecnologías y protocolos diseñados hace casi veinte años, antes del boom de la web, del dominio de Google, de las redes...

  7. Diseño de una estructura metálica para una plaza cubierta con introducción de energías renovables

    Mateos Ramírez, Rubén

    2013-01-01

    El objeto de este proyecto es el diseño de una plaza cubierta para albergar diversas actividades relacionadas con la ciudad, como pueden ser mercados semanales, conciertos, actividades bajo cubierto, etc. Dotar a la ciudad de un punto de generación de energía eléctrica fotovoltaica para conexión a la red y dotar de suministro de energía renovable al entorno urbano de la ciudad. Aportar un lugar de reparo para la gente de la ciudad en una plaza amplia y abierta e impulsar la actividad ec...

  8. Probe data: 1422 [RED

    Full Text Available R05-049390-1AR RED AU068280 AU068281 C 12919 C B2919 >C ELR148_1(AF025467|pid:g2429509) C aenorhabdi ... tis elegans c osmid R148; c ontains similarity to drosophila DNA-b ... inding protein K10 (NID:g8148); c oded for by C . elegans c DNA yk118e11.5; c oded for b ... y C . elegans c DNA yk64h11.5; c oded for by C . elegans c ... DNA yk172f2.5; c oded for by C . elegans c DNA yk79b6.5; c oded for by ...

  9. Probe data: 6469 [RED

    Full Text Available R07-038020-1AR RED C 99062 C 99063 E04404 EB4404 >C ELC 35E7_7(AF067216|pid:g3158466) C aenorhabditis ... elegans c osmid C 35E7; c oded for by C . elegans c DNA yk109g4.5 ... ; c oded for by C . elegans c DNA yk399b8.5; c oded for by ... C . elegans c DNA yk394b7.5; c oded for by C . elegans c ... DNA yk476g9.5; c oded for by C . elegans c DNA yk290c 12.5; c oded for b ...

  10. Implementación de una VPN (Virtual Private Network) usando el estándar IPSEC

    CALDERÓN RODRÍGUEZ, CALIXTO

    2013-01-01

    El término VPN, ha llegado a ser utilizado de manera imprudente en la industria del networking para describir un amplio conjunto de problemas y soluciones, donde los objetivos no siempre han sido explicados claramente. Este uso ha llevado a una situación donde todo el entorno relacionado con las tecnologías de red usan el término VPN como un referente para un conjunto diverso de tecnologías. La idea consiste en crear una red privada - confidencial- (vía tunneling y/o encr...

  11. Redes neuronales artificiales para el análisis de componentes principales. La red de OJA

    Piedad Tolmos Rodríguez-Piñero

    2000-01-01

    Full Text Available El análisis de componentes principales es una herramienta estadísticomatemática de gran utilidad en multitud de campos, especialmente en el de la compresión de datos. En este artículo se estudia el proceso de la extracción de componentes principales, y se detalla una Red Neuronal Artificial, la red de Oja, diseñada específicamente para el cálculo de la primera componente principal de la matriz de momentos de segundo orden asociada al vector de datos. Se concluye exponiendo algunas redes que generalizan la red de Oja, y permiten extraer el número deseado de componentes principales. Finalmente se explican algunas aplicaciones, fundamentalmente la del procesamiento de imágenes, y la compresión de datos.

  12. The Red and the Yellow

    QiuJianghong

    2004-01-01

    THE China film market is based on the so-called battle of the yellow, green and red.Yellow is American Kodak,green Japanese Fuji color, and red China's Lucky film, local counterweight to the two world-famous foreigners.

  13. Presentación de REICESMA - Red Española de Investigación en Cuidados de Enfermería de Salud Mental y Adicciones

    Lluch Canut, Ma. Teresa; Roldán Merino, Juan Francisco; Cuesta Lozano, Daniel

    2013-01-01

    La Red Española de Investigación en Cuidados de Enfermería de Salud Mental y Adicciones (REICESMA) es una estructura formada por grupos enfermeros de investigación que desarrollan su actividad científica en el ámbito de los cuidados de la enfermería de salud mental y adicciones. REICESMA es un proyecto de larga evolución: como es sabido, no se puede crear una red de forma espontánea sino que se requieren unas bases y unos requisitos previos imprescindibles. Si revisamos esos requisitos en pla...

  14. Red de calidad del aire: arquitectura empresarial orientada a la predicción de series temporales de contaminantes atmosféricos

    Khalil Gómez, Omar

    2015-01-01

    [Este proyecto] tratará de mejorar la evaluación de los niveles de contaminación. Para ello, iniciaremos representando una Red de Calidad del Aire utilizando Arquitectura Empresarial. Esta representación hará que conozcamos cómo se realiza la evaluación de los niveles de contaminación actualmente, principal tarea de cualquier Red de Calidad del Aire a nivel europeo. Una vez que conocemos la manera de evaluar los niveles de contaminación, se propondrá una evolución del proceso actual. Esta ...

  15. Inventario de deslizamientos en la red vial colombiana

    Juan Montero O.

    2011-02-01

    Full Text Available El Ministerio de Obres Públicas y Transporte solicitó en 1985 a la Facultad de Ingeniería de la Universidad Nacional de Colombia en Bogotá, la realización de una investigación piloto sobre los deslizamientos que afectan la red vial nacional, en desarrollo de la cual se efectuó un inventario de los deslizamientos y movimientos de masa más importantes. Con base en los resultados obtenidos se propone la división del territorio nacional en ocho regiones, cada una con características similares desde el punto de vista de la estabilidad de los taludes, y se comentan los resultados y perspectivas de mayor interés.

  16. Desarrollo de una aplicación para una red de sensores inalámbricos (WSN) mediante Contiki

    Ibarzabal Euba, Endika

    2014-01-01

    Durante los últimos años hemos venido observando la tendencia a incorporar capacidad de proce- samiento y comunicación a dispositivos que hasta entonces se utilizaban de modo independiente. La evolución de los móviles a smartphones es un claro ejemplo de dicha tendencia, aunque también cabe mencionar otros ejemplos, como es el caso de los denominados hogares inteligentes, en los que elementos del hogar se encuentran interconectados y pueden actuar de modo conjunto. Esta ten- dencia no s...

  17. Romantic red: red enhances men's attraction to women.

    Elliot, Andrew J; Niesta, Daniela

    2008-11-01

    In many nonhuman primates, the color red enhances males' attraction to females. In 5 experiments, the authors demonstrate a parallel effect in humans: Red, relative to other achromatic and chromatic colors, leads men to view women as more attractive and more sexually desirable. Men seem unaware of this red effect, and red does not influence women's perceptions of the attractiveness of other women, nor men's perceptions of women's overall likeability, kindness, or intelligence. The findings have clear practical implications for men and women in the mating game and, perhaps, for fashion consultants, product designers, and marketers. Furthermore, the findings document the value of extending research on signal coloration to humans and of considering color as something of a common language, both within and across species. PMID:18954199

  18. RED SIPIA: Red de Sensores Inalámbricos para Investigación Agronómica

    Mercado, Gustavo; Borgo, Roberto; Gonzalez Antivilo, Francisco; Ortiz Uriburu, Gisela; Diedrichs, Ana; Farreras, Pablo; Aguirre, Matías; Battaglia, Fernando; Tabacchi, Germán; Tromer, Sebastián

    2011-01-01

    El proyecto consiste en el análisis y evaluación de una red de sensores inalámbricos basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de ingenieros e investigadores agrónomos dedicados al tema. Gracias a los desarrollos que se han producido en las redes de sensores inalámbricos en los últimos años, especialmente la miniaturización de los dispositivos, han surgido nuevas tendencias en el sector agrícola como la llama...

  19. Red meat and colorectal cancer

    Nuri Faruk Aykan

    2015-12-01

    Full Text Available Colorectal cancer (CRC is the third most common cancer in men and the second in women worldwide. More than half of cases occur in more developed countries. The consumption of red meat (beef, pork, lamb, veal, mutton is high in developed countries and accumulated evidence until today demonstrated a convincing association between the intake of red meat and especially processed meat and CRC risk. In this review, meta-analyses of prospective epidemiological studies addressed to this association, observed link of some subtypes of red meat with CRC risk, potential carcinogenic compounds, their mechanisms and actual recommendations of international guidelines are presented.

  20. The Analysis of A Red,Red Rose

    姬丽霞

    2009-01-01

    A Red, Red Rose was written by the great farmer poet of Scotland, Robert Burns. This love poem has been recited by people for more than two centuries. The poet praised his lover's beauty and expressed his love to her with enthusiasm. This paper will analyze this immortal love song from the points of phonological patterns, figure of speech and cohesion to help readers know it better.

  1. Cultura digital y memoria en red

    Echeverría, Javier

    2009-06-01

    Full Text Available The technological system ICT (Information and Communication Technologies generates the electronic space, digital objects and a distributed memory. The development of the Information Society carries out the problem of preservation of digital memory, and mainly of objects “born digital”, which only exist on line. This paper analyses the principles promoted by the UNESCO in its Charter for the Preservation of Digital Heritage (2003 and states that public heritage should be preserved using free software, in order to provide an open and universal access to those new cultural goods. The problem of the sustainability of digital heritage is also analysed, because of the strong rhythm of technological change of the system ICT. That problem implies a new modality of digital divide, the mnemonic divide.El sistema tecnológico TIC (tecnologías de la información y la comunicación genera el espacio electrónico, los objetos digitales y una memoria distribuida. El desarrollo en la sociedad de la información implica el problema estructural de preservar esa memoria digital, en particular los objetos “de origen digital”, que sólo existen en red. Se analizan los principios promovidos por la UNESCO en su carta para la preservación de la memoria digital (2003 y se afirma que el patrimonio público debería ser conservado en software libre, garantizando el acceso abierto y universal a esos nuevos bienes culturales. Asimismo se analiza el problema de la sostenibilidad del patrimonio digital, que corre el riesgo de desaparecer a causa del veloz ritmo de cambio tecnológico del sistema TIC. Ello da lugar a una nueva modalidad de brecha digital, la brecha mnemónica.

  2. An Overview of the Main Quaternary Deformation of South America Una perspectiva sobre las principales deformaciones cuaternarias de América del Sur

    C.H. Costa

    2006-12-01

    placas, constituyendo muchos de estos rasgos estructurales los límites entre las mismas. A lo largo de la costa Caribe las principales estructuras con actividad durante el cuaternario exhiben principalmente una orientación E-O y régimen transcurrente. Entre los Andes venezolanos y el golfo de Guayaquil predominan estructuras con orientación NE y una cinemática variable entre regimenes transcurrentes, transpresivos y compresivos. En los Andes Centrales (4ºS-46º30'S la mayoría de las deformaciones cuaternarias resulta de una compleja distribución y partición de esfuerzos en el interior de la placa Sudamericana, reactivando discontinuidades preexistentes. La expresión superficial de este tipo de deformaciones está mejor representada en la pendiente oriental andina y sectores adyacentes del antepaís. Aquí, la geometría actual de la subducción de la placa de Nazca representa el principal control respecto a la distribución y características de las deformaciones cuaternarias. La principal estructura con actividad cuaternaria en el sector andino austral, está representada por un borde transformante con componente sinestral en Tierra del Fuego, resultante de la interacción entre las placas de Sudamerica y de Scotia.

  3. Una mirada a la juventud

    Boza Carreño, Ángel

    2009-01-01

    ¿Qué es la juventud? ¿En qué consiste ser joven? Este trabajo pretende realizar un acercamiento a la realidad de la juventud andaluza y española desde una perspectiva social y educativa. Para ello hemos definido una serie de tópicos que creemos que definen a la juventud y los hemos ido analizando. Mitificación, hedonismo, ocio, cambio social, contestación, participación, valores, subculturas,transición, educación, trabajo, subordinación-emancipación, identidad, botellón y diversidad ...

  4. Una mirada sobre la interactividad

    Capparelli, María Isabel; Dávila, Analía

    2009-01-01

    Los centros interactivos actualmente se han convertido en centros de aprendizaje público, donde se plantea una nueva forma de interrelación entre el objeto de conocimiento y el individuo. Abremate, es el centro Interactivo de Ciencia y Tecnología, de la Universidad Nacional de Lanús, es comparable a un museo de ciencias porque, a pesar de que no guarda objetos del pasado con valor histórico o artístico, sí guarda una historia que recrea el uso de herramientas y descubrimientos científicos con...

  5. Maternidad tras una muerte perinatal

    Rozas García, M. Rosa; Francés Ribera, Lidia

    2001-01-01

    La nueva gestación tras una muerte perinatal está llena de dudas, miedos e inseguridades, y es una situación que va a suponer un desgaste físico y emocional para la familia, especialmente para la mujer. Esta gestación se caracteriza por un aumento de la ansiedad, que puede continuar después del nacimiento y manifestarse mediante conductas de sobreprotección del nuevo hijo. Las matronas deben conocer las posibles respuestas emocionales de la mujer y proporcionar cuidados y apoyo específicos du...

  6. Atenção domiciliária e direito à saúde: uma experiência na rede pública brasileira La atención domiciliaria y el derecho a la salud: una experiencia en la red pública brasileña Home care assistance and the right to health: an experience in the Brazilian net

    Nalú Pereira da Costa Kerber

    2010-04-01

    Full Text Available OBJETIVO: Refletir de que forma a atenção domiciliária tem contribuído para a saúde da população. MÉTODOS: Processou-se por meio de observação, de entrevistas individuais com 7 usuários, 22 trabalhadores e 2 gestores 3 representantes do Conselho Local de Saúde e de pesquisa documental, entre março e julho de 2006, em uma unidade de atenção primária à saúde de Porto Alegre - RS. RESULTADOS: Os resultados foram sistematizados a partir de indicadores formulados e mostraram que os trabalhadores e gestores têm compreensão da atenção domiciliária como relevante para a saúde da comunidade, porém, não objetivam essa compreensão na sua prática de trabalho. CONCLUSÃO: A atenção domiciliária tem sido realizada com foco na doença, tem como objeto de trabalho um sujeito individual, enfatiza o cuidado curativo e não desenvolve ações intersetoriais. Porém, busca resolutividade no primeiro contato, presta atenção contínua e longitudinal, tem território definido, promove as relações interpessoais (trabalhadores e usuários e atua visando um cuidado humanizado.OBJETIVO: Reflexionar de qué forma la atención domiciliaria ha contribuido para la salud de la población. MÉTODOS: Se procesó por medio de observación de entrevistas (con: 7 usuarios, 22 trabajadores, 2 administradores y 3 representantes del Consejo Local de Salud y de investigación documental, entre marzo y julio de 2006, en una unidad de atención primaria de salud de Porto Alegre, RS. RESULTADOS: Los resultados fueron sistematizados a partir de indicadores formulados y mostraron que los trabajadores y administradores entienden la atención domiciliaria como relevante para la salud de la comunidad, sin embargo, no aplican esa comprensión en su práctica de trabajo. CONCLUSIÓN: La atención domiciliaria se ha realizado enfocando en la enfermedad, tiene como objeto de trabajo un sujeto individual, enfatiza el cuidado curativo y no desarrolla acciones

  7. Conservación y cooperación al desarrollo: una experiencia en Mauritania

    J. M. Fernández-Palacios; J.L. Tellería; H. El Mamy Ghaillani; Bartolomé, J.; E. Montiano

    2008-01-01

    El macizo del Tagant, en la República Islámica de Mauritania, alberga, a lo largo de una red interconectada de humedales, las últimas poblaciones de cocodrilo del desierto Crocodylus niloticus suchus), que hasta muy poco tiempo se consideraban extintas. Estas poblaciones han sido capaces de resistir la desertización del Sahara ocurrida en el Holoceno gracias a la existencia de una serie de pozas (gueltas en árabe), que se forman tras las lluvias monzónicas y que están conectadas entre sí a t...

  8. Conservación y cooperación al desarrollo: una experiencia en Mauritania

    Fernández Palacios, José María; Tellería Jorge, José Luis; El Mamy Ghaillani, Hamoud; Bartolomé Martín, Juan; Montiano Jorge, Emilio

    2008-01-01

    El macizo del Tagant, en la República Islámica de Mauritania, alberga, a lo largo de una red interconectada de humedales, las últimas poblaciones de cocodrilo del desierto Crocodylus niloticus suchus), que hasta muy poco tiempo se consideraban extintas. Estas poblaciones han sido capaces de resistir la desertización del Sahara ocurrida en el Holoceno gracias a la existencia de una serie de pozas (gueltas en árabe), que se forman tras las lluvias monzónicas y que están conectadas e...

  9. Los nuevos entornos educativos : desafíos cognitivos para una inteligencia colectiva

    González Navarro, María

    2009-01-01

    Comprender las tecnologías de la comunicación a la luz de las redes con que se comunican y entran en cooperación las personas ha sido una constante en autores que no han disociado su visión acerca del significado de las tecnologías respecto a los nuevos movimientos sociales. Este artículo sostiene que las TIC no son sólo una red a la que se suman los individuos, sino que actúan como tecnologías sociales cuyo perfeccionamiento depende tanto de la diversidad de sus funciones (socio-políticas, c...

  10. Ventanilla Única: Una herramienta para mejorar la competitividad y el control fronterizo

    Banco Interamericano de Desarrollo (BID)

    2010-01-01

    Ventanilla Única (VU) establece una red de interoperabilidad entre todas las Agencias estatales y los operadores privados que participan en las transacciones de comercio internacional, convirtiéndose en una herramienta que reduce el costo transaccional y a la vez en un centro información integrada que alimenta el análisis de riesgo y mejora el control sobre el comercio exterior. Asimismo, el documento da a conocer el apoyo del BID en la aplicación de Ventanilla Única en algunos países de Amér...

  11. Tripear por San Salvador de Jujuy : La ciudad mirada desde una web de turistas y viajeros

    Gaona, Melina

    2014-01-01

    Este artículo se inscribe en una investigación mayor que reflexiona acerca de las disputas de poder que se producen en torno a los sentidos de la ciudad de San Salvador de Jujuy. En el marco de este avance queremos considerar la manera en que se constituyen relatos acerca de la ciudad a partir de los comentarios elaborados por turistas y viajantes en TripAdvisor, una web de viajes que funciona como red social o comunidad on-line que incluye información turística a modo de foros virtuales. ...

  12. Optimización del proceso de aprovisionamiento en una planta JIT

    Gracia Estrada, Marc

    2012-01-01

    Una empresa dedicada al ensamblaje de asientos de automoción dispone en la actualidad de una red logística de aprovisionamiento diseñada acorde al volumen y tipo de producto hecho hasta el momento. Tras la adjudicación del ensamblaje de los asientos de dos nuevos modelos de automóvil por parte de su cliente con unos requerimientos a nivel logístico más complejos, la empresa ve incrementadas sus necesidades de control y gestión de aprovisionamiento de componentes. El objet...

  13. Red Blood Cell Antibody Identification

    ... limited. Home Visit Global Sites Search Help? RBC Antibody Identification Share this page: Was this page helpful? Also known as: Alloantibody Identification; Antibody ID, RBC; RBC Ab ID Formal name: Red ...

  14. Less red tape; Weniger Bremskloetze

    Ristau, Oliver

    2011-07-01

    Since July 2009, the PV Legal initiative funded by the European Commission has brought greater transparency and less red tape to photovoltaic projects in Europe. The remaining obstacles will be resolved by the new initiative, PV Grid.

  15. Red meat and colorectal cancer

    Nuri Faruk Aykan

    2015-01-01

    Colorectal cancer (CRC) is the third most common cancer in men and the second in women worldwide. More than half of cases occur in more developed countries. The consumption of red meat (beef, pork, lamb, veal, mutton) is high in developed countries and accumulated evidence until today demonstrated a convincing association between the intake of red meat and especially processed meat and CRC risk. In this review, meta-analyses of prospective epidemiological studies addressed to this association...

  16. Red Tide off Texas Coast

    2002-01-01

    Red tides (algae) bloomed late this summer along a 300-mile stretch of Texas' Gulf Coast, killing millions of fish and shellfish as well as making some people sick. State officials are calling this the worst red tide bloom in 14 years. The algae produces a poison that paralyzes fish and prevents them from breathing. There is concern that the deadly algae could impact or even wipe out this year's oyster harvest in Texas, which usually peaks during the Thanksgiving and Christmas holidays. The red tides were first observed off the Texas coast in mid-August and have been growing steadily in size ever since. Red tides tend to bloom and subside rapidly, depending upon changes in wind speed and direction, water temperature, salinity, and rainfall patterns (as the algae doesn't do as well in fresher water). This true-color image of the Texas Gulf Coast was acquired on September 29, 2000, by the Moderate-resolution Imaging Spectroradiometer (MODIS) flying aboard NASA's Terra spacecraft. The red tide can be seen as the dark reddish discoloration in the ocean running southwest to northeast along the coast. In this scene, the bloom appears to be concentrated north and east of Corpus Christi, just off Matagorda Island. The image was made at 500-meter resolution using a combination of MODIS' visible bands 1 (red), 4 (green), and 3 (blue). The city of Houston can be seen clearly as the large, greyish cluster of pixels to the north and west of Galveston Bay, which is about mid-way up the coastline in this image. Also visible in this image are plumes of smoke, perhaps wildfires, both to the north and northeast of Houston. For more information about red tides, refer to the Texas Red Tide Web site. Image courtesy Andrey Savtchenko, MODIS Data Support Team, and the MODIS Ocean Team, NASA's Goddard Space Flight Center

  17. alumnos de una sola cultura?

    Siegfried Boehm

    2006-01-01

    Full Text Available Dado que en la actualidad hay mayores posibilidades para practicar una lengua extranjera en su contexto natural con nativohablantes, es imprescindible poseer una cierta competencia intercultural a fin de que este diálogo pueda llevarse a cabo exitosamente. Sin embargo, los libros de texto convencionales editados en el país de origen de la lengua estudiada difícilmente pueden cubrir este requisito, puesto que las particularidades culturales de una sociedad sólo se vuelven interculturales al compararlas con la cultura de los alumnos. En el artículo presente se proponen varios ejercicios enfocados al aprendizaje intercultural en donde no sólo se aprenden las normas, reglas y actitudes de la cultura meta, en este caso de Alemania, Austria y Suiza, sino que también se estimula la reflexión sobre las de la cultura propia. Esta sensibilización cultural es indispensable para lograr una comunicación equitativa entre personas de diferentes culturas.

  18. Recuerdos de una noche norteamericana

    Giardinelli, Mempo

    2015-01-01

    Tal vez porque la ausencia de una amistad que supo forjarse en el encuentro entre Tandil y Chaco, San Lorenzo y Vélez, Europa y México siempre resulta inverosímil, Mempo Giardinelli vuelve a compartir las sensaciones que lo atravesaron cuando, hace dos años, se cumplió un nuevo aniversario de la muerte de Soriano.

  19. Educar para gestionar conflictos en una sociedad fragmentada. Una propuesta educativa para una Cultura de Paz.

    Cruz Artunduaga, Fernando

    2008-01-01

    El texto reconstruye una iniciativa de desarrollo de Cultura de Paz en Caquetá, Amazonía colombiana, con epicentro en Florencia, su capital. El trabajo comprende una etapa inicial de sensibilización a través de la experiencia, producida por la inmersión en el mundo de la vida. Luego se pasa a la observación de la forma en la que se tratan los conflictos en diferentes escenarios de socialización: la familia, la escuela, la comunidad y la sociedad. La mirada se posa más en la escuela. Después v...

  20. El niño como parte de una familia, una comunidad y una sociedad

    Míguez Gómez, Patricia

    2011-01-01

    Actualmente, para comprender qué quiere decir la atención temprana es necesario pensar en el niño como parte de un sistema familiar,de una comunidad y de una sociedad, elementos imprescindibles en cualquier intervención. Es necesario considerar la globalidad del niño, y ser planificadas por un equipo de profesionales que tenga en cuenta todas las áreas del desarrollo del pequeño. Es por eso que no hay dos tipos de intervención iguales.

  1. ¿Una corporeidad disimulante y una interioridad disimulada?

    Rovaletti, María Lucreci

    1999-01-01

    La psicología y, con ella, la psico(pato)logía y la psiquiatría están cargadas de la lógica de la separación y de la disyunción, que opone una psique, o conciencia clara y evidente, a un cuerpo cárcel-mera extensión. En qué medida, nos preguntamos, el pensamiento psicológico puede evitar el dualismo sujeto-objeto, y sus aporías consecutivas de interioridad-exterioridad. Ya W. Wundt consideraba a la conciencia como una realidad interior que el cuerpo normalmente disimula. Pero esta interiorida...

  2. INTERMAT III (red de investigación INTERdisciplinar en MATeriales)

    Molina Jordá, José Miguel

    2015-01-01

    La red INTERMAT III nace de la voluntad de continuidad de la serie de redes INTERMAT, que han venido desarrollándose desde la creación de su primera red en el año 2011. El acrónimo INTERMAT viene de “investigación INTERdisciplinar en MATeriales” y el objetivo de cada una de estas redes ha sido la investigación sobre las prácticas docentes en el área de la Ciencia de los Materiales. Esta investigación se ha planteado como un trabajo de equipo con carácter colaborativo e interdisciplinar. Para ...

  3. RED INALÁMBRICA PARA FLEXIBILIZAR OPERACIONES DE MANEJO DE CRUDO

    Pablo J. D. Rosales C

    2004-01-01

    En esta investigación se realizó una evaluación de los sistemas de redes inalámbricas, a fin de determinar cual estándar es más adecuado a aplicar en el desarrollo de una red con estas características, además se evalúan distintos fabricantes de este tipo de redes a fin de obtener el mejor de los productos, garantizando robustez, movilidad y seguridad, de igual manera se evaluaron los aspectos legales de las mismas, para este tipo de aplicación. La presente investigación se define como un proy...

  4. La maternidad en la red: el caso de las madres solteras por elección

    Moncó Rebollo, Beatriz

    2009-01-01

    Este texto se basa en una investigación cualitativa sobre las mujeres que deciden ser madres solteras, bien mediante la adopción, bien a través de Técnicas de Reproducción Asistida. En él se describen y analizan, de un modo diferencial y desde una perspectiva de género, la presencia e importancia que la maternidad y el proceso de consecución de la misma tienen en estas mujeres, y cómo se visibilizan y coordinan en aquellos espacios de la Red (foros principalmente) que han habilitado para sí m...

  5. Memoria del proyecto de la red de diseño curricular 3001 TRADAL 5

    Serrano Bertos, Elena

    2015-01-01

    El principal cometido de la red Tradal 5 ha sido el de contribuir a la mejora de la calidad del proceso de enseñanza-aprendizaje en el seno de la comunidad universitaria y al diseño de buenas prácticas docentes mediante el análisis, la reflexión y el intercambio de experiencias entre algunos profesores del área de alemán del Departamento de Traducción e Interpretación de la Universidad de Alicante. El resultado ha sido plasmado en una especificación más detallada del programa, una mayor comun...

  6. Escuelas-red y medio rural, ¿un dúo quimérico?

    Morales Romo, Noelia

    2010-01-01

    El presente artículo expone los principales resultados de una investigación realizada con el objeto de analizar las escuelas en entornos rurales desde un enfoque muy concreto: el de la sociología de las organizaciones partiendo del modelo de las escuelas-red. Para ello abordamos estas instituciones estudiando las relaciones existentes entre sus distintos agentes sociales: profesores, profesores y padres, profesores y alumnos y, desde una perspectiva más global, nos interesamos por las r...

  7. El concepto del Baby Café como red internacional de apoyo a la lactancia materna

    Baño Piñero, Isabel; Carrillo García, César; Thambidurai, Uma; Martínez Roche, María Emilia

    2015-01-01

    El objetivo general de este trabajo consiste, en reflexionar sobre el fenómeno del Baby Café como recurso novedoso y conveniente dentro del mundo de la promoción, protección y apoyo a la lactancia materna a nivel internacional. El Baby Café es una iniciativa de apoyo a la lactancia materna, que coordina una red internacional de centros en los que se combina el apoyo formal proveniente de los profesionales sanitarios especializados en lactancia y el apoyo informal propio de los grupos o redes ...

  8. Implantación de red pública Wi-Fi en el municipio de Begur

    Fernández Nevado, Raúl

    2013-01-01

    El proyecto contempla la instalación de una red WiFi de uso público para el municipio ampurdanés de Begur. Se ha empleado tecnología Radwin, Aruba, Netgear y Fortinet y software de emulación R-Planner y Ekahau.

  9. Una mirada humana a la calidad

    Tamarit, Javier

    2010-01-01

    La calidad en nuestro sector deja de ser una cuestión de decisión organizacional para pasar a ser una exigencia ética, pues tenemos el deber ético de proporcionar excelentes apoyos a cada persona para que pueda desarrollar su proyecto singular de buena vida, de una vida de calidad, una vida que se perciba como significativa y valorada.

  10. Una minga para el posdesarrollo

    Arturo Escobar

    2011-01-01

    Full Text Available El artículo sintetiza algunas conclusiones a las que han llegado movimientos sociales y académicos en las últimas dos décadas al reflexionar sobre la globalización y sus implicaciones; el modelo dominante, basado en las nociones de "desarrollo" y "modernidad", ha entrado en crisis. Por lo tanto, se hace necesario avanzar en una transición cultural que se pueda comprender como un cambio de época y no sólo como una época de cambios. Para llevar a cabo esta transformación, se deben resolver las con-tradicciones existentes entre el neodesarrollismo y el postdesarrollo, por supuesto, a favor de éste último.

  11. Una experiencia con los kuna

    Villalobos, Leonor Cristina de

    1996-01-01

    Me encuentro en la difícil tarea de materializar en palabras una experiencia única. De transmitir sensaciones y vivencias cargadas de magia que desestructuraron en gran medida lo que hasta ese momento formaba parte de mi vida. Es así como puedo definir mi experiencia con los indios Kuna. Tuve la oportunidad de convivir con ellos dos meses, invitada por investigadores de la Universidad de Miami, para realizar estudios sobre ectoparasitosis que afectan a esta comunidad india.

  12. entorno virtual de red académica

    CLAUDIA JIMÉNEZ

    2007-01-01

    Full Text Available Este trabajo presenta un modelo conceptual para el armado de cursos flexibles, donde al estudiante se le permite realizar diferentes actividades para cumplir con los objetivos educativos de los mismos. El caso de estudio es la plataforma virtual de la red académica FORHUM (acrónimo de FORmación HUMana. Dicha plataforma fue concebida para facilitar el intercambio de conocimiento y la colaboración entre los miembros de una red de instituciones de Perú, Ecuador, Bolivia y Colombia que trabajan en temáticas del Hábitat. El modelo propuesto surgió de la evaluación del diseño de la central de ensamblaje de cursos en la plataforma virtual, en su primera versión, y del estudio de este proceso en otros entornos virtuales para la educación. El modelo de ensamblaje de cursos, aquí propuesto, permite la personalización de los mismos según diferentes estilos de aprendizaje, transferir el control del aprendizaje al estudiante y facilita la reutilización de objetos de aprendizaje creados por otros miembros de la red.

  13. Sevilla, una encrucijada de caminos

    Manuel Martín Martin

    2009-01-01

    Full Text Available El mundo del flamenco, tan acostumbrado a contemplar la historia del género como una sucesión de nombres distinguidos que, por su significación expresiva o por su carácter de maestría incontestable, simbolizan una época, olvida con frecuencia el universo en que esa constelación de estrellas irradia su luminosidad más intensa, esto es, relega a un rol de menor importancia el ámbito en que se desarrollaron unos talentos especiales que, a lapostre, describirían situaciones y formas que el tiempo estimaría de verdadera trascendencia. Sin ánimo de caer en un determinismo localista demasiado forzoso, justo es decir que uno de los más grandes milagros de la música flamenca, se llama Sevilla, su barrio de Triana y muchos pueblos de la provincia. Una unidad demográfica que ofrece en grado sumo el origen de la complacencia en los goces de los sentidos.

  14. Betelgeuse and the red supergiants

    van Loon, Jacco Th

    2013-01-01

    Betelgeuse is one of the most magnificent stars in the sky, and one of the nearest red supergiants. Astronomers gathered in Paris in the Autumn of 2012 to decide what we know about its structure, behaviour, and past and future evolution, and how to place this in the general context of the class of red supergiants. Here I reflect on the discussions and propose a synthesis of the presented evidence. I believe that, in those four days, we have achieved to solve a few riddles.

  15. Aplicaciones de Internet de las Cosas SIPIA6 - Red de Sensores Inalámbricos con IPv6

    Mercado, Gustavo; Borgo, Roberto; Gonzalez Antivilo, Francisco; Taffernaberry, Juan Carlos; Diedrichs, Ana; Aguirre, Matías; Robles, María Inés; Grünwaldt, Guillermo; Tabacchi, Germán; Tromer, Sebastián; Pecchia, Matías

    2013-01-01

    El proyecto consiste en el diseño y validación del comportamiento de una red de sensores inalámbricos en la adquisición de parámetros ambientales de parcelas agrícolas, con acceso de forma nativa a Internet, denominada SIPIA6. Se trata de la continuación de Red SIPIA, actualmente implementada en una parcela agrícola de prueba. La red SIPIA está basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de ingenieros e inve...

  16. Abordaje de una celotipia desde una perspectiva conductual.

    Marcos López Hernández-Ardieta

    2010-01-01

    Full Text Available En el presente trabajo se pretende mostrar el análisis psicológico y la intervención psicoterapéutica realizada de una paciente con problemática celotípica. Dicho análisis e intervención se enmarcan en la óptica conductista radical, de modo que se pone el énfasis en los componentes claves del análisis funcional realizado y las estrategias propias de la Terapia de Aceptación y Compromiso empleadas

  17. Una correcta usabilidad para una app de smartphone

    Romero Serrano, Ismael

    2014-01-01

    En el desarrollo de este TFG se ha hecho un especial hincapié en la aplicación de las técnicas de DCU, pues estaba interesado en la adaptación de esta metodología que se ha mostrado especialmente útil en el proceso de desarrollo de aplicaciones y sistemas informáticos complejos, al desarrollo de una app como la mía, en principio mucho más sencilla y pensada para ser utilizada de manera individual y en dispositivos móviles. En este sentido, he querido aplicar diversas técnicas de DCU durant...

  18. CO2NET: Red Europea del Dióxido de Carbono

    A. Arenillas

    2006-03-01

    Full Text Available CO2NET es una red temática Europea constituida por distintas Instituciones, entros de Investigación y Desarrollo y empresas involucradas en tecnologías para la itigación del CO2. Entre sus actividades se encuentra facilitar la colaboración entre sus miembros en el marco de proyectos europeos sobre captura y almacenamiento de CO2.

  19. White Wedding and Red Wedding

    李梦遥

    2010-01-01

    @@ The most obvious difference between western wedding and Chinese wedding tradition lies in the main color of the ceremony.Western wedding is known as the white wedding in some sense,for its main color is white from bride's gown(礼服)to the decoration of the wedding hall.While,traditional Chinese wedding ceremony is full of the color of red.

  20. The Temperatures of Red Supergiants

    Davies, Ben; Kudritzki, Rolf-Peter; Plez, Bertrand; Trager, Scott; Lançon, Ariane; Gazak, Zach; Bergemann, Maria; Evans, Chris; Chiavassa, Andrea

    2013-01-01

    We present a re-appraisal of the temperatures of red supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the sp