WorldWideScience

Sample records for una red sudamericana

  1. Sanguisuga, un género nuevo neotropical de cytinaceae y una conexión sudamericana en la familia

    FERNÁNDEZ-ALONSO JOSE LUIS; Cuadros-Villalobos Hermes

    2012-01-01

    Se describe e ilustra a Sanguisuga caesarea, un género nuevo y una especie nueva deCytinaceae de Colombia y el primer registro de esta familia en Sudamérica. El géneronuevo es afín a Bdallophytum pero se diferencia por presentar andromonoecia, conlas flores masculinas en la base de la inflorescencia, flores zigomorfas comprimidasdorsiventralmente, semicerradas, con los tépalos arqueados e incurvos; tépalo inferiormediosigmoide-lingüiforme y nectarífero y las semillas más alargadas, obpiriform...

  2. Primera Red Sudamericana de Biomedicina: Investigación, educación y biotecnología aplicadas a la salud

    Marcelo J. Perone

    2013-02-01

    Full Text Available Se da a conocer la creación del primer programa de integración regional de una red de Institutos de Investigación en Biomedicina pertenecientes a países miembros del MERCOSUR. Se analizan las bases que dieron sustento a su creación y sus objetivos en el mediano y largo plazo. Además, se estima el potencial de los resultados de este programa en los campos de la investigación médica aplicada, educación y biotecnología.

  3. Una red para la gente

    Raúl Trejo Delarbre

    2004-02-01

    Full Text Available La próxima Cumbre Mundial de la Sociedad de la Información ha revitalizado, en numerosos países, el debate acerca de las nuevas tecnologías de la comunicación y los usos que pueden tener. Lamentablemente en México hemos estado casi del todo ajenos a esa intensa, extensa y en otras latitudes fructífera discusión. Ni los especialistas interesados en estos temas, ni la sociedad que es a la postre beneficiaria o damnificada según sea el empleo de tales tecnologías, ni los organismos del Estado a cargo de tales asuntos, han propiciado la reflexión colectiva que nos podría permitir tanto afinar las posiciones de nuestro país rumbo a la cumbre de Ginebra y Túnez como deliberar, en ese contexto, acerca de lo mucho que nos falta para tener un país auténticamente imbricado en la construcción de una auténtica Sociedad de la Información.

  4. Proyectos de integración regional sudamericana: hacia una teoría de convergencia regional | South American regional integration projects. Towards a theory of regional convergence

    Gian Luca GARDINI

    2010-10-01

    Full Text Available Está surgiendo una nueva unidad regional, Sudamérica. En contraposición con Latinoamérica, es un concepto geoestratégico más definible e independiente. Pero, ¿esto hace que la integración regional sea más sencilla? Este artículo adopta una posición escéptica. No es solamente que Sudamérica se caracterice por sus numerosos esquemas de integración regional que compiten entre sí, sino que además los tres más destacados – Mercosur, ALBA y Unasur - presentan respuestas divergentes ante las preguntas fundamentales que han caracterizado históricamente los intentos de regionalismo en América Latina. Éstas son: la relación con la potencia líder en el plano internacional, Estados Unidos; el papel que juega el líder regional o paymaster, Brasil; y el modelo económico y de desarrollo que debe ser adoptado. A modo de conclusión, el autor conclusión propone una incipiente teoría de convergencia regional para alcanzar la cohesión regional como estímulo para futuras investigaciones y comprobaciones.A new regional unit - South America - is emerging. This is a more definable and self-contained geostrategic concept as opposed to Latin America. But does this make regional integration any easier? This article adopts a sceptical view. Not only South America is characterised by numerous and competing schemes of regional integration but the three most prominent of them, MERCOSUR, ALBA, and UNASUR offer divergent responses to the fundamental questions that have historically characterised attempts at regionalism in Latin America: The relation towards the international leading power, the United States; the role of the regional leader or paymaster, Brazil; and the economic and development model to be adopted. The conclusion proposes an infant theory of regional convergence to achieve regional cohesion as a suggestion for further research and testing.

  5. Ecologa de una gran serpiente sudamericana, Hydrodynastes gigas (Serpentes: Dipsadidae) / Ecology of the large South American snake, Hydrodynastes gigas (Serpentes: Dipsadidae)

    Alejandro R., Giraudo; Vanesa, Arzamendia; Gisela P., Bellini; Carla A., Bessa; Mara Beln, Costanzo.

    Full Text Available Analizamos la ecologa de Hydrodynastes gigas, una de las serpientes de mayor tamao en Sudamrica. Estudiamos 342 ejemplares obtenidos durante 21 aos de muestreos en rutas, bsquedas intensivas y capturas ocasionales. Las hembras maduraron sexualmente con mayor tamao corporal que los machos, adic [...] ionalmente fueron ms largas, tuvieron cabezas ms grandes y ms escamas ventrales. Los machos tuvieron mayor longitud de cola y ms escamas subcaudales. Este dimorfismo sexual, comn en serpientes, puede estar relacionado con el aumento del potencial reproductivo. El ciclo reproductivo fue estacional y anual en hembras, mientras que fue continuo y anual en machos. El potencial reproductivo fue alto, 16.3 huevos/hembra/ao, con una tendencia a ser mayor en hembras ms grandes. Hydrodynastes gigas es diurna y se alimenta de todo tipo de vertebrados frecuentes en los humedales que habita, incluyendo anfibios, reptiles, peces, mamferos y aves, en orden de importancia. Los individuos se mantuvieron activos todo el ao, siendo una de las 4 especies de serpientes ms abundantes en las planicies de inundacin de grandes ros sudamericanos. Su abundancia, dieta generalista, gran tamao y capacidad reproductiva sugieren que esta especie es un importante depredador en los ecosistemas acuticos de Sudamrica. Abstract in english We analyzed the ecology of Hydrodynastes gigas, one of the largest snakes of South America, studying 342 specimens obtained during 21 years of field sampling including road sampling, intensive searches and opportunistic encounter methods. Females attained sexual maturity at larger relative body size [...] than males, and were largest, had biggest heads and more ventral scales. Males had larger tails and more subcaudal scales than females. This sexual dimorphism, common among snakes, would be related to an increment in its reproductive potential. The females' reproductive cycle was seasonal and annual; while in males it was continuous and annual. The reproductive potential was high, 16.3 eggs/female/year, with a clear tendency to be higher in larger females. Hydrodynastes gigas is a diurnal snake and preys on all kinds of common vertebrates in wetlands habitats, including amphibians, reptiles, fish, mammals and birds, in order of importance. Individuals were active throughout the year, being one of the 4 most abundant species of snakes in the floodplains of large South American rivers. Due to its abundance, generalist diet, higher size and reproductive potential, we suggest that this species is an important predator in South America's aquatic ecosystems.

  6. Transición de una red no gestionada a una red segura basada en dispositivos gestionables

    Romero Díaz, Emilio José

    2013-01-01

    Este proyecto surge ante la necesidad de modernización de la infraestructura de comunicaciones del Instituto Andaluz para la Tercera Edad (IATE) de la Junta de Andalucía. El objeto del proyecto es buscar posibles mejoras a los problemas detectados en la red y la puesta en marcha de una gestión de las comunicaciones con una electrónica de red de altas prestaciones, con el fin de aumentar el rendimiento y seguridad de la red. El presente proyecto fin de carrera abarca todos los trabajos realiza...

  7. Internet: una red para capturar rehenes?

    Dr. Raymond Colle

    2002-01-01

    Full Text Available En el ao 2000 y durante el 2001, Microsoft ha hecho noticia especialmente en funcin de los juicios que se le siguen en Estados Unidos y Europa por prcticas monoplicas. Pero, al revisar las noticias, tambin encontramos muchos datos que revelan una importante poltica expansionista y tendencia a explotar cada vez ms a sus clientes. No repasaremos aqu lo ocurrido con los juicios, pero s nos proponemos poner en evidencia como un empresa cuyo poder descansa en la presencia de su sistema operativo en millones de ordenadores personales ha ido expandiendo sus pretensiones y desarrollado una estrategia que pretende llegar a un control casi absoluto de Internet y de sus usuarios.

  8. Anlisis de una red de transporte de gas

    Eduardo Tarifa, Enrique; Erdmann, Eleonora; Humana, Demetrio; Vicente, Mara Soledad; Cari, Luis Rodolfo; Mercado Fuentes, Lorgio

    2010-01-01

    La creciente demanda de gas natural hace necesario el aumento de la capacidad de las redes de transporte. Esto puede lograrse ampliando la capacidad instalada y optimizando las condiciones de operacin. En ambos casos es necesario contar con un conocimiento profundo del proceso involucrado. Tal conocimiento puede alcanzarse aplicando el mtodo que se describe en el presente trabajo. El mtodo propuesto est diseado para analizar una red de gas utilizando herramientas de simulacin, y fue uti...

  9. Una experiencia educativa: conocemos la red Natura 2000

    Marta Vzquez Torre

    2009-11-01

    Full Text Available En la actualidad es necesaria una conciencia medioambiental para tratar de prevenir los daos que continuamente sufre nuestra Naturaleza. Con este proyecto educativo se pretende que nios y nias valoren aquello que los rodea, lo cual les ayudar a respetarlo, cuidarlo y protegerlo. En l se da a conocer a discentes de 3 ciclo de Primaria un programa de proteccin del medio natural, ciertos hbitats y seres vivos, los de la Red Natura 2000. Nos centramos en los espacios protegidos por esta iniciativa en O Salns, lugar en donde se ejecut el citado proyecto.

  10. Red tecnoparque sena: una puerta tangible a la nanotecnologia

    Gaviria, Maria I.; Montoya, Carolina M.; Gutierrez, Johana A.

    2014-01-01

    La Red Tecnoparque es un programa de Innovación del Servicio Nacional de Aprendizaje-SENA que  permite a todos los Colombianos involucrarse de manera significativa en el desarrollo de proyectos en ciencia y  tecnología a través de la generación de prototipos con potencial innovador, soportados en diversas áreas del conocimiento incluyendo la nanotecnología; esta disciplina se está consolidando como una importante alternativa para el desarrollo y competitividad de los sectores productivos de n...

  11. Monitoreo del estado de una red HFC utilizando datos reportados por cable módems

    Andrés Escobar Mejía

    2007-01-01

    Full Text Available Una red de telecomunicaciones por cable que combina la fibra óptica y el cable coaxial como soporte de la distribución de las señales es llamada Red HFC (Hybrid Fibre Coaxial, dicha red es empleada para ofrecer servicios de Banda Ancha. Este artículo trata sobre un sistema de monitoreo en una red HFC, que permitirá estimar la ubicación de fallas en la red troncal y de distribución, mediante la recopilación de información de fallas en los terminales, instalados en los clientes llamados Cable Módems.

  12. Desarrollo de plano de gestión para una red MPLS

    García Duarte, Gabriel J.

    2005-01-01

    Para la mejora de la gestión de la calidad de servicio (QoS) de una red MPLS, se diseñó una herramienta dividida en capas para el plano de gestión, que aportase una estabilidad mayor ante los eventos que pudieran alterar la comunicación dentro de esta red. Localizando este proyecto como parte de uno más complejo para el desarrollo de esta red, el ámbito de este trabajo muestra el diseño realizado para el denominado NEM (Network Element Management). Este nuevo elemento apo...

  13. La inmigración sudamericana en Italia: Efectos sobre el mercado de trabajo Southamerican Migration in Italy: Labour Market Effects

    María Andrea Grasso

    2010-05-01

    Full Text Available Las migraciones sudamericanas no son las más numerosas ni las más preocupantes para el gobierno italiano y, quizás por ese motivo, no son las más estudiadas. Sin embargo, desde la década de 1970, las economías sudamericanas, en su mayoría, pasaron de ser receptoras de inmigrantes a expulsoras de su propia fuerza de trabajo, siendo Italia uno de los principales destinos elegidos. En qué trabajan los inmigrantes sudamericanos, cómo y en qué contribuyen a la economía italiana es uno de los interrogantes que busca elucidar este trabajo. El disparador para desarrollarlo fue un afiche de la campaña de gobierno del 2008 de la Liga Nord. En la gráfica se veía un indio Sioux y el texto rezaba: "ellos sufrieron la inmigración primero", haciendo alusión a los efectos negativos de la inmigración. Fue mi interés analizar estos efectos en lo económico y en lo social, restringiéndolo a la población de nuestro subcontinente. El artículo se basa en una experiencia personal de un año de residencia en el país como investigadora, trabajadora flexibilizada, italiana de segunda generación y partícipe de una red de contactos informales que movilizaron este análisis. Se identifica la coexistencia de una división del mercado laboral mediante una complementariedad de trabajos utilizando diferentes formas de acceso, trayectorias, y características en general. Para el segmento que ocupan los nativos se imponen barreras explícitas o no, que se traducen en exclusión. Éstas, se configuran en función de una tipificación que se hace del "otro", en particular los inmigrantes, como no apto, incapaz de realizar esa tarea, o poco "presentable".South American are neither the most numerous nor preoccupant migrations for the Italian government. Maybe that is the reason why they are not the most studied ones. However, since the seventy decade, South American economies- one day mainly receptives of inmigrants-, turned into emigration countries, being Italy one of the first chosen destiny to live. This work try to find out what kind of work the immigrants do, in what way they do it, and which contribution they do for Italian economy . The developing of this work was triggered by the Nord Ligue advertisement for 2008 political elections. In this advice, there was a Sioux Indian and the text said: "they suffered immigration before", in reference to the immigration negative effects. My interest was to analyze these socio economic effects, limited to our subcontinent population. This investigation is based on a personal experience of one year as a researcher, a flexi-worker, an Italian of second generation, and a person involved who was in an informal net of contacts. It is identified the existence of complementary effects in the labour market which include different types of market entrance, labour trajectories and characteristics of work. For the principal segment it is identified different entrance barriers related to the process of typification of " the other" that inevitably leads to exclusion.

  14. Construcción de una red de aprendizaje

    Luis Facundo Maldonado Granados; Edel Serrano Iglesias

    2008-01-01

    Este documento analiza el proceso de la red de aprendizaje generada por el proyecto “Simas y Coolmodes en el desarrollo de competencias básicas”, desde los referentes teóricos proporcionados por la teoría de grafos y la teoría de las redes complejas, aplicados a redes de conocimiento. Se pretende identificar la estructura y la dinámica de la red y las conexiones preferenciales ocurridas. Así mismo, describir el efecto que en la complejidad de la red tiene estrategias adoptadas por el grupo pa...

  15. Desarrollo de una red social de consumo colaborativo

    Fernández Roca, Alfonso

    2013-01-01

    Este proyecto consiste en el desarrollo de una plataforma de consumo colaborativo enfocada al mundo universitario. La plataforma utiliza servicios de geolocalización para ubicar a los usuarios y los artículos. Se ha desarrollado una interfaz multidispositivo mediante Responsive Design y se ha desplegado toda la infraestructura del servidor sobre servicios en la nube, en este caso, Amazon Web Services. Como ejercicio práctico se han utilizado diversos frameworks y librerías t...

  16. Notas para una interpretacin educativa des espacio-tiempo social en la Red.

    Antonio Vctor Martn; Jos Manuel Muoz; ngel Garca del Dujo; Mara Cruz Snchez

    2011-01-01

    Basado en el inters que despiertan las caractersticas de la sociedad infocomunicacional y la Red en el mundo de la Educacin Social presentamos el resultado de una investigacin cuyo objetivo ha sido mostrar la dimensionalidad espacio-temporal en la Red. Los autores, previa exposicin de lo que a su juicio son la contingencia infocomunicacional y tecnocultural del espacio y del tiempo, as como del discurso terico y dialctico que...

  17. Visiones sobre los tránsitos socio-técnicos hacia patrones de consumo sustentable en agua y energía en la minería sudamericana - dos controversias argentinas

    Gloria Baigorrotegui; Cristian Parker; Fernando Estenssoro

    2014-01-01

    Este trabajo aborda el problema del consumo de agua y energía en la minería sudamericana desde una arista menos explorada: el consumo sustentable. A partir de la sociología y los estudios sociales de la ciencia y la tecnología exponemos esta problemática presentando tres patrones de consumo distintos: convencional, alternativo y progresista. A partir de fuentes secundarias y entrevistas semi-estructuradas hemos rastrea...

  18. La trata de persona en la agenda políca sudamericana sobre migraciones: la securitización del debate migratorio

    Magliano, María José; Clavijo, Janneth

    2011-01-01

    Este trabajo procura poner en discusión, desde una perspectiva crítica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda política sobre migraciones en la región sudamericana, y las implicancias políticas e ideológicas de esa incorporación. Partimos del supuesto que las formas de concebir a la trata de personas en la esfera política migratoria regional no se alejan de los postulados de control y seguridad que subyacen a la construcción de esa agenda, reconfiguran...

  19. La trata de personas en la agenda política sudamericana sobre migraciones: la securitización del debate migratorio

    Magliano, María José; Clavijo, Janneth

    2011-01-01

    Este trabajo procura poner en discusión, desde una perspectiva crítica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda política sobre migraciones en la región sudamericana, y las implicancias políticas e ideológicas de esa incorporación. Partimos del supuesto que las formas de concebir la trata de personas en la esfera política migratoria regional no se aleja de los postulados de control y seguridad que subyacen a la construcción de esa agenda, reconfigurando ...

  20. Jess Ibez: Hacia una red de resistencia profunda

    Mayra Paula Espina Prieto

    2007-01-01

    Full Text Available Par tien do de la ins pi ra cin que ofre ce Je - ss Ib ez a ca tor ce aos de su muer te -con su so - cio lo ga cr ti ca de la vida co ti dia na ur ba na, su re - fle xi vis mo ra di cal, que hizo ?re gre sar? de fi ni ti - va men te al su je to, y sus pro pues tas en el cam po de la me to do lo ga de `so cioa n li sis- para los que se ini cian en el pen sa mien to com ple jo, los que se de sem pe an en el rea del pen sa mien to so cial, los in te re sa dos en los de ba tes epis te mo l gi cos y en una pers pec ti va in te gra do ra de la re la cin su - je to-ob je to, esta `en tre vis ta vir tual (en rea li dad lo de can ta do en ml ti ples con ver sa cio nes ha ba - ne ras y ma dri le as sos te ni das con l en tre 1990 y 1992 se aden tra en sus vi sio nes so bre te mas como los de la au to poie sis y su sig ni fi ca do es pe - c fi co en los sis te mas so cia les; la re fle xi vi dad en su con tra pun teo con el su pues to ob je ti vis ta; su in sis ten cia en los mr ge nes como pun tos pri vi le - gia dos e im pres cin di bles de ob ser va cin; y el cam bio y la re vo lu cin so cial en tiem pos de la pos mo der ni dad.

  1. MODELO PARA UNA RED HIBRIDA ÓPTICA INALÁMBRICA

    Luis Alejandro Quiroz

    2012-08-01

    Full Text Available Este artículo propone un modelo de red hibrida óptica - inalámbrica mediante la tecnología free space optics (FSO para el desarrollo de una red de acceso de nueva generación, que represente una solución a los proveedores para diferenciación de servicios, ofrecimiento de ancho de banda bajo demanda y uso compartido de infraestructura con otros  proveedores de servicios. Se describe el principio de funcionamiento y las características técnicas de la tecnología FSO, se expone y analiza la arquitectura y el algoritmo de reconfiguración  propuesto.

  2. Modelo matemático del transporte de una toxina en una red trófica marina

    Daniel Arbelaez A.

    2014-12-01

    Full Text Available Algunos casos de intoxicación por consumo de peces contaminados, como la intoxicación por ciguatera, ocurren inesperadamente y no son fáciles de detectar previamente, dado que los peces que portan la toxina no presentan aspecto y/o síntomas de enfermos. En este trabajo proponemos un modelo matemático para el transporte y acumulación de una toxina a través de una cadena alimentaria. El modelo se plantea mediante un sistema rígido de ecuaciones diferenciales que describen la dinámica. Se analiza la estabilidad local de la solución de equilibrio. Se discuten diferentes escenarios de aparición de brotes de una toxina a partir de simulaciones numéricas obtenidas mediante un esquema de discretización que combina un método de Runge-Kutta de tercer orden y la regla del trapecio, evitando la rigidez del sistema. Los resultados muestran que el tiempo que tarda en desaparecer la toxina en la red trófica depende del estado en que se encuentra la dinámica poblacional al momento del brote. Esta información puede emplearse para establecer un tiempo de veda en la pesca de tal manera que la toxina se reduzca a niveles inocuos para la salud humana.

  3. Conservación y Manejo de Humedales Costeros de la Comuna de Coquimbo, Chile: experiencias y aprendizajes de un modelo de intervención en la Costa Pacífico Sudamericana

    Luna Quevedo, D.; Tabilo Valdivieso, E.; Tabilo Valdivieso, L.

    2006-01-01

    El Sistema de Humedales Costeros de la Comuna de Coquimbo configura una zona clave para la Costa Pacífico Sudamericana, albergando zonas húmedas de singular biodiversidad que cumplen una importante función como lugar de descanso y alimentación para numerosas especies, siendo destacadas como áreas de invernada de aves migratorias neotropicales. La importancia individual de los humedales de esta zona de Chile, y de su recurso hídrico asociado, se incrementa si se considera que son part...

  4. Propuesta de arquitectura para una Red Móvil de Nueva Generación

    Omaira Parada

    2006-01-01

    Full Text Available El paradigma actual de las comunicaciones espera que un usuario sea capaz de acceder a sus servicios independientemente de su localización de una manera transparente. La terminal del usuario podría ser capaz de elegir la mejor tecnología de acceso (Ad hoc, Ethernet, Celulares, etc. en su ubicación actual y utilizar esta tecnología de una manera transparente para la provisión del servicio deseado. Esta homogeneidad, alta velocidad, seguridad, multi-servicio, redes multi-operador, está siendo desarrollada en el contexto de las redes de nueva generación. Actualmente, se están desplegando los sistemas móviles de tercera generación (3G y la comunidad investigadora está empezando a definir una arquitectura para las redes de cuarta generación (4G. La principal característica de diseño de las redes de 4G, es la integración de la tecnología IP dentro de las redes móviles celulares con el objetivo de construir una red All-IP. Este artículo presenta el estado del arte de las redes móviles y propone una arquitectura escalable para las redes móviles de nueva generación

  5. La sociedad civil y la gobernabilidad de las migraciones en la agenda política sudamericana: el refugio en los derechos humanos

    María José Magliano

    2011-01-01

    Full Text Available El objetivo es analizar el ¿decir¿ de las principales organizaciones de la sociedad civil que intervienen en la discusión política sobre migraciones en la región sudamericana. A través de una estrategia metodológica cualitativa, sustentada fundamentalmente en el análisis documental, se examina el modo en que estas organizaciones cuestionan los sentidos y la definición de la agenda política sobre migraciones y en qué medida se convierten en una alternativa frente al discurso hegemónico. Para esto, se identifican las rupturas y continuidades que se establecen entre los posicionamientos de las organizaciones de la sociedad civil y de la agenda política promovida por determinadas agencias internacionales y actores políticos regionales

  6. Una universidad que aprende: formación y evaluación docente en red

    Chacón Ramírez, Silvia

    2012-02-01

    Full Text Available Resumen: El presente artículo ofrece, por parte de su Comité Ejecutivo una sistematización sobre la evolución de la Red Institucional de Formación y Evaluación Docente (RIFED. Esta Red es una iniciativa de la Vicerrectoría de Docencia de la Universidad de Costa Rica que ha sido conceptualizada y desarrollada con el fin de apoyar al profesorado universitario para que asuma una nueva mirada a la docencia universitaria en el siglo XXI. Se ofrece un marco contextual y conceptual que intenta responder las interrogantes: ¿por qué una red y no un centro? ¿Para qué evaluar en la UCR? ¿Para qué formar al personal docente la UCR? Entre los logros de la sistematización, se destaca la ruta de aprendizaje de RIFED, una reconceptualización de funciones, así como de los términos formación y evaluación, para finalmente ofrecer una visión prospectiva para RIFED, bajo el título ¿Cómo se mira RIFED en el horizonte?Abstract: This article presents, by its Executive Committee, a systematization of the Institutional Network for Higher Teacher Education and Evaluation RIFED, at the University of Costa Rica UCR, an initiative that is part of the Academic VicePresident´s office. RIFED has been conceptualized and implemented with the objective of supporting faculty on assuming a new vision on Higher Education Teaching and Evaluation, relevant to the XXI Century. A conceptual framework aims to answer these questions: Why a network instead of a Center? Why evaluate faculty at UCR? Why educate faculty at UCR? Amongst RIFED´s learning path some of its achievements are highlighted: a re-conceptualization of its functions as well as of the terms education and evaluation. Finally it offers a prospective vision of RIFED under the sub-title: How does RIFED appear in the Horizon?

  7. La prueba PISA: una mirada alternativa desde la Teoría del Actor-Red

    Paola Paredes Suzarte

    2015-01-01

    En el marco de la proliferación de las evaluaciones estandarizadas, inscritas en lo que ha sido conceptualizado por la literatura como políticas de accountability o de rendición de cuentas, se ofrece por medio de este artículo una línea de pensamiento y discusión alternativa sobre la prueba PISA. Utilizando como enfoque la Teoría del Actor-Red (TAR) de Bruno Latour, se presentan ejercicios de traslación epistémica de la prueba PISA desde un modelo de pensamiento positivista moderno, a uno mat...

  8. Microsatélites, distancias genéticas y estructura de poblaciones nativas sudamericanas

    Demarchi, Darío Alfredo

    2009-01-01

    Full Text Available En este trabajo se investigaron las relaciones genéticas entre 17 poblaciones nativas sudamericanas en relación a 15 microsatélites (STRs autosómicos, utilizando 3 distancias genéticas- DST, DAy (δu2-que se ajustan a diferentes postulados teóricos. A través de diferentes técnicas de análisis (escalamiento multidimensional, correlación y correlación parcial de matrices se puso a prueba si las distancias genéticas reflejaban las relaciones interpoblacionales esperadas a partir de la distribución geográfica o de relaciones lingüísticas entre las poblaciones. Además, se estimó en que grado las distintas medidas de distancias genéticas eran influenciadas por la diversidad (He de cada población. Los mapas genéticos muestran, principalmente para DST y DA, que las poblaciones aisladas y con bajo tamaño efectivo (Ne aparecen como outliers, mientras que las poblaciones con alto Ne y mayor flujo génico ocupan una posición central a bajos valores de distancia unas de otras y sin un patrón definido de agrupamiento. La falta de asociación entre distancias genéticas y lingüísticas o geográficas y por otra parte, la alta correlación negativa entre He y distancias génicas promedio por población confiman ese patrón, demostrando que la mayor parte de la variación interpoblacional puede ser explicada en función del grado de diversidad intrapoblacional. Es decir, las distancias genéticas no reflejan relaciones filogenéticas, lingüísticas o geográficas, sino más bien eventos demográficos recientes tales como cuellos de botella genético, efecto fundador o migración externa masiva. Este hecho puede ser comprobado por medio de otra metodología analítica, el modelo de Harpending y Ward.

  9. La trata de persona en la agenda políca sudamericana sobre migraciones: La securitización del debate migratorio Human trafficking in the sout american migratory legal agenda: Securitization of the migratory debate.

    María José Magliano; Janneth Clavijo

    2011-01-01

    Este trabajo procura poner en discusión, desde una perspectiva crítica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda política sobre migraciones en la región sudamericana, y las implicancias políticas e ideológicas de esa incorporación. Partimos del supuesto que las formas de concebir a la trata de personas en la esfera política migratoria regional no se alejan de los postulados de control y seguridad que subyacen a la construcción de esa agenda, reconfiguran...

  10. Efecto del desprendimiento de las biopelculas formadas en una red de acueducto sobre la calidad del agua

    Juan Camilo Rueda Ariza

    2013-12-01

    Full Text Available El objetivo de esta investigacin fue determinar el efecto del desprendimiento de las biopelculas formadas en una red de distribucin de agua potable sobre la calidad del agua que llega a los hogares, ya que esta puede afectar la calidad de vida y la salud de las personas. Se realizaron anlisis de pH, turbiedad, concentracin de metales y microbiolgicos en una red de acueducto para evaluar el efecto de las biopelculas sobre la calidad del agua, encontrando altos niveles de aluminio y de microorganismos esporulados que dificultan su control y representan un potencial problema de salud para la poblacin.

  11. PODER VIRTUAL Y FORMAS DE TRATAMIENTO EN EL DISCURSO MEDIADO POR COMPUTADORA: EXPLORACIN EN UNA RED COMUNICATIVA VIRTUAL

    Violeta Cautn-Epifani

    2015-01-01

    Full Text Available El presente artculo tiene por objetivo presentar resultados de una investigacin sobre el uso de las formas de tratamiento en el discurso mediado por computadora (DMC desde y hacia los usuarios que ostentan mayor poder virtual dentro de una red comunicativa en la que interactan. Luego del anlisis de un corpus de 324 interacciones producidas a travs de Facebook por sujetos chilenos, universitarios, compaeros de clase, se concluy que en la red comunicativa virtual analizada prevalece el tratamiento solidario, simtrico. Esto, debido a que en el contexto citado prima el esquema de tratamiento establecido previamente con base en las relaciones de los usuarios fuera del medio virtual.

  12. Hewlett-Packard trabaja en un proyecto de almacenamiento de informacion En ruta una red de impacto mundial

    Matias, W I

    2004-01-01

    "...La compania invertira $5 millones en la planta de Aguadilla, para producir parte de la infraestructura que formara esta primera red de computacion mundial, la cual solucionara los problemas actuales de transmision de informacion en asuntos cientificos. El proyecto surge como parte de una alianza con la CERN" (1 page)

  13. Redescription of some South American species of Belonuchus (Coleoptera: Staphylinidae, with a checklist of the southern South American species of the genus Redescripción de algunas especies sudamericanas de Belonuchus (Coleoptera: Staphylinidae, con una lista de las especies del género del sur de América del Sur

    Mariana Chani-Posse

    2011-12-01

    Full Text Available Six species of Belonuchus Nordmann, 1837 from South America are redescribed and illustrated: B. aluticollis (Bernhauer, 1921, B. castaneus Chani-Posse, 2006, B. flavicoxis (Bernhauer, 1912, B. multipunctatus (Coiffait, 1981, B. richteri (Bernhauer, 1912 and B. weiserianus (Bernhauer, 1921. A checklist of the 23 species of Belonuchus currently known from southern South America is appended. A lectotype is designated for B. richteri Bernhauer, 1922.Seis especies de Belonuchus Nordmann, 1837, de América del Sur se redescriben e ilustran: B. aluticollis (Bernhauer, 1921, B. castaneus Chani-Posse 2006, B. flavicoxis (Bernhauer, 1912, B. multipunctatus (Coiffait, 1981, B. richteri (Bernhauer, 1912 y B. weiserianus (Bernhauer, 1921. Se provee una lista de las 23 especies actualmente conocidas del sur de América del Sur. Se designa el lectotipo de B. richteri Bernhauer, 1922.

  14. El programa ConRed, una práctica basada en la evidencia

    Rosario del Rey Alamillo

    2012-10-01

    Full Text Available La vertiginosa incorporación de las TIC a la sociedad y los consecuentes riesgos a los que los menores se enfrentan en Internet y las redes sociales han dejado en evidencia la necesidad de incorporar en el currículum escolar el dominio de los entornos virtuales. En cambio, son escasas las iniciativas en esta dirección y más aún programas rigurosamente evaluados, de modo que sirvan de fundamento para el diseño de las líneas de acción educativa. El programa ConRed está basado en la teoría del comportamiento social normativo y persigue los objetivos de mejorar y reducir problemas como el cyberbullying, la dependencia a Internet y la desajustada percepción del control de la información en las redes sociales, para así potenciar el uso beneficioso de éstas. La evaluación del ConRed se ha desarrollado mediante una metodología cuasi experimental, con un grupo experimental (N=595 y uno cuasi-control (N=298. Del total de los 893 estudiantes, el 45,9% eran chicas y la edad media 13,80 años (DT=1,47. Los resultados positivos de reducción de problemas en el grupo experimental y la ausencia de cambio en el grupo control son muestra de su validez y demuestran que trabajando con toda la comunidad educativa y en colaboración con ella es posible mejorar la calidad de la vida virtual y, por tanto, real de los adolescentes.

  15. La prueba PISA: una mirada alternativa desde la Teoría del Actor-Red

    Paola Paredes Suzarte

    2015-07-01

    Full Text Available En el marco de la proliferación de las evaluaciones estandarizadas, inscritas en lo que ha sido conceptualizado por la literatura como políticas de accountability o de rendición de cuentas, se ofrece por medio de este artículo una línea de pensamiento y discusión alternativa sobre la prueba PISA. Utilizando como enfoque la Teoría del Actor-Red (TAR de Bruno Latour, se presentan ejercicios de traslación epistémica de la prueba PISA desde un modelo de pensamiento positivista moderno, a uno materialista pragmático en el que se privilegia una descripción constructivista y analítica de los componentes que la constituyen. En base al seguimiento y análisis de noticias sobre la prueba PISA desplegadas en diarios electrónicos en Chile y Argentina, más la revisión de fuentes secundarias, se exponen algunas de las controversias suscitadas en torno a la evaluación y se discute sobre su posible impacto en nuestras percepciones sobre educación y calidad. También se problematiza el carácter neutral y objetivo de la prueba, y se levanta la pregunta acerca de su posible agencia en la cristalización de las relaciones de centro-periferia entre países que, en el marco del enfoque de la TAR, tiene sentido explorar. 

  16. Diseo de una red neuronal artificial para asistir la automatizacin en un taller de mecanizado

    Ricaurte Ospina Lpez

    2007-01-01

    Full Text Available El manejo de la informacin y la resolucin de problemas, presentes en la fabricacin de piezas por arranque de viruta, estn destinados casi que exclusivamente a los operarios de las mquinas herramientas. Lo anterior representa problemas a la hora de abordar tareas cambiantes, donde la informacin se presenta masiva, imprecisa y distorsionada. Para solucionar esos problemas, se propone un modelo alternativo que consiste en la utilizacin de redes neuronales que sirvan como modelos de procesamiento, de control y que ayuden en la toma de decisiones respecto de nuevas piezas a mecanizar que lleguen a un taller. Las redes neuronales mediante un estilo de computacin paralelo, distribuido y adaptativo, son capaces de aprender a partir de ejemplos. Una red neuronal artificial puede simularse mediante un programa de computador, o bien realizarse en circuitos electrnicos especficos. Esta tecnologa permite incorporar un cierto tipo de sistema experto que emule la capacidad humana para la toma de decisiones o para la resolucin de problemas en la industria del mecanizado de piezas por arranque de viruta.

  17. Estudios de Futuros: El Mercosur: ¿alternativa eficaz de integración sudamericana?

    Eduardo Becerra Contreras; Sonia Opazo Rodríguez

    2008-01-01

    Este artículo se enmarca dentro de un análisis de prospectiva histórica mediante proyecciones de integración sudamericana, tomando como eje integrador el MERCOSUR. Para esto presentamos un marco teórico que analiza históricamente temas claves para cualquier proceso de integración. De lo anterior se desprenden tres ejes: a) avance de los gobiernos socialistas, b) hegemonía de Estados Unidos, c) relaciones como bloque entre el MERCOSUR y la Unión Europea. Esto nos permitirá plantear ocho proyec...

  18. Alfabetización para una cultura social, digital, mediática y en red

    González Fernández-Villavicencio, Nieves

    2012-07-01

    Full Text Available Technologies are changing the concept of literacy and of the basic skills necessary to be considered literate in a digital and networked culture. New critical, technological and social skills redefine the need to be literate and, as such, for information literacy. This requires a new term, such as Digital Literacy, in order to include the new skills and to focus more on the training of individuals rather than on the professional groups involved in the training. Several examples are presented, both within our country and beyond, of initiatives undertaken by libraries in digital literacy and in the generation of local digital content.

    Las tecnologías están cambiando el concepto de alfabetización y las competencias básicas necesarias para considerarse alfabetizado en una cultura digital y en red. Nuevas competencias mediáticas, críticas, tecnológicas, sociales, vienen a redefinir la propia necesidad de estar alfabetizado y por ende, en información, hasta el punto de exigir un término como Alfabetización digital, que aglutine las nuevas competencias, y centre más su objetivo en la formación que necesitan los individuos y menos en los colectivos profesionales implicados en esa formación. Se presentan diversos ejemplos, dentro y fuera de nuestro país, de iniciativas llevadas a cabo preferentemente por bibliotecas, en los campos de la alfabetización digital y la generación de contenidos digitales locales.

  19. Música en el cine: Una propuesta de trabajo cooperativo en base a una red social educativa en un curso de 4º de la E.S.O

    Nidia Fernández Varela

    2011-01-01

    Full Text Available El proyecto que se describirá a continuación se llevó a cabo con alumnos de cuarto de la E.S.O. del Colegio Ártica del PAU de Carabanchel, sito en la C.C.A.A de Madrid en el año 2010. En este artículo se expondrá el trabajo realizado sobre un tema en concreto del currículum oficial de 4º de la ESO en el aula de música que fue trabajado en grupos cooperativos utilizando una red social. Así mismo, se puntualizarán los objetivos que guiaron la acción, se hará una breve descripción de las herramientas utilizadas, se comentarán las ventajas y desventajas observadas y finalmente se ofrecerán las conclusiones pertinentes.

  20. Música en el cine: Una propuesta de trabajo cooperativo en base a una red social educativa en un curso de 4º de la E.S.O

    Nidia Fernández Varela

    2011-01-01

    El proyecto que se describirá a continuación se llevó a cabo con alumnos de cuarto de la E.S.O. del Colegio Ártica del PAU de Carabanchel, sito en la C.C.A.A de Madrid en el año 2010. En este artículo se expondrá el trabajo realizado sobre un tema en concreto del currículum oficial de 4º de la ESO en el aula de música que fue trabajado en grupos cooperativos utilizando una red social. Así mismo, se puntualizarán los objetivos que guiaron la acción, se hará una breve descripción de las herrami...

  1. Editorial: una llamada al cuerpo mdico. - la unin de la familia mdica sudamericana

    Luque, Manuel Jos

    2011-01-01

    Con frecuencia y gentileza que no sabremos agradecer lo bastante, casi la totalidad de los pueblos de la Amrica Latina nos invitan a Asambleas y Congresos Mdicos. Quieren nuestras ideas, eperan las iniciativas colombianas tanto en la esfera cientfica como en cualquiera otra que lleve a un acercamiento franco y leal, sincero y efectivo, en mira al bienestar comn.

  2. La organización en red del poder corporativo. Una tipología de redes corporativas

    Cárdenas, Julián

    2012-04-01

    Full Text Available This research arises from the interest in understanding how power is organized around the world. We study the corporate power structure or corporate network when firms share directors (interlocking directorates. We analyze corporate interlock networks in various countries to empirically derive a typology of corporate networks that suggest different theories of the organization of power. We identify an “elitist” corporate network based on unity, centralization and control; and a “pluralist” corporate network based on members’ autonomy, decentralization and communication ties. The results suggest avenues of research to find out how networks are configured and what impacts have on society.

    Esta investigación surge de la inquietud por conocer cómo se organizan en red las grandes corporaciones del mundo. Estudiamos la estructura de poder corporativo o red formada por las corporaciones cuando comparten élites económicas (interlocking directorates. Analizamos las redes corporativas, mediante interlocking directorates, en diversos países del mundo para derivar empíricamente una tipología de redes corporativas que apunta a diferentes teorías de la organización del poder. Identificamos una red corporativa “elitista” basada en la unidad, centralización y control; y una red corporativa “pluralista”, basada en la autonomía de las empresas, descentralización y enlaces de comunicación. Los resultados sugieren vías de investigación para averiguar cómo se configuran las redes y qué impactos tienen en la sociedad.

  3. Inestabilidad del desarrollo en estructuras craneofaciales de poblaciones humanas sudamericanas

    Lotto, Federico P.

    2013-12-01

    Full Text Available Diversos factores genéticos y ambientales pueden actuar sobre los mecanismos que amortiguan el efecto de perturbaciones aleatorias durante el desarrollo, resultando en un aumento de la inestabilidad del desarrollo (ID y de la variación a nivel individual. El objetivo de este trabajo es analizar el grado y el patrón de asimetría fluctuante (AF en el cráneo, como una medida de ID, en poblaciones con distinto tipo de subsistencia. Asimismo, se evalúa la existencia de diferencias entre la base, la bóveda y el esqueleto facial. Se relevaron landmarks tridimensionales sagitales y bilaterales en 109 cráneos de Chubut, San Juan y SO de Pampa. El método de Superposición Procrustes Generalizado fue usado para extraer los componentes simétrico y asimétrico de la forma. Los análisis preliminares indicaron que el error de medición y la asimetría direccional dan cuenta de un porcentaje reducido de la variación total, mientras que la AF explica entre el 10 y el 15% de la misma. La magnitud de AF –estimada como la distancia Procrustes entre las configuraciones originales y sus imágenes reflejadas– de la bóveda y la región facial resultó mayor en San Juan, mientras que la base no presentó diferencias entre las muestras. Los patrones de forma del componente asimétrico indican que la muestra de Chubut se diferencia en la base y la cara, mientras que la de San Juan se diferencia en la bóveda. En resumen, los resultados obtenidos sugieren variación modular en la ID del cráneo y diferencias entre las muestras analizadas.

  4. DIAGNÓSTICO Y PROPUESTA PARA UNA GESTIÓN INTEGRAL DEL RIESGO EN EL VALLE DE ABURRA: RED RIESGOS

    ARISTIZÁBAL EDIER

    2010-05-01

    Full Text Available A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gestión del Riesgo en el Valle de Aburrá, Red Riesgos. Red Riesgos es un sistema organizacional abierto de carácter interinstitucional para orientar y coordinar las políticas y acciones de análisis y reducción de riesgos, preparación y ejecución de la respuesta y recuperación en casos de desastre y emergencias en el Valle de Aburrá. Como instrumento estratégico de la Red, se formuló el Plan Regional para la Gestión del Riesgo en el Valle de Aburrá que contiene las acciones que se deben ejecutar para la reducción de desastres y el manejo óptimo de los mismos y se diseñó el Sistema Integrado de Información para dar soporte a los diferentes procesos de gestión de la Red.

  5. Implementación de una red neuronal para la medición indirecta de posición

    Rairán Antolines, José Danilo; Pérez Ramírez, Juan Daniel; Osorio, John Eduard

    2011-01-01

    En este artículo se presenta una alternativa al uso de un sensor óptico para la medición del entrehierro en el proceso de levitación magnética. Esta consiste en utilizar la relación no lineal entre el voltaje y la corriente en la bobina, con el valor de entrehierro, par a medir este último de manera indirecta. Se presentan los resultados con respecto al diseño y entrenamiento de la red neuronal seleccionada, la cual aprende el patrón entre las variables mencionadas. Además se explica el campo...

  6. Construccin de una red acadmica de alta velocidad la experiencia radar

    Eduardo Duque

    2007-01-01

    Full Text Available Este artculo es resultado del avance del proyecto de implementacin ?RADAR, Red Acadmica de Alta Velocidad Regional?, trabajo del grupo de investigacin TICER conformado por integrantes del grupo Campus virtual y algunas IES de Caldas. El articulo presenta la experiencia en la creacin de redes regionales acadmicas de alta velocidad y especficamente la experiencia derivada de la red RADAR, conformada por once instituciones de educacin superior de Caldas, Risaralda y por Cenicaf. Este recurso tecnolgico pretende ser la principal infraestructura de TIC?s que sirva como apoyo a la docencia y la investigacin de las universidades del occidente de Colombia.

  7. Pasado, presente y futuro de la epidemiologa. Una perspectiva latinoamericana

    Alfredo Moravia

    2013-09-01

    Full Text Available RESUMEN Este artculo intenta contestar tres preguntas. Sobre el pasado: Por qu no existi una epidemiologa precolombina? Sobre el presente: Cules son los orgenes de la epidemiologa moderna, incluyendo sus races sudamericanas? Y sobre el futuro, escog un ttulo surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: Por qu fenmenos complejos son los "objetos oscuros del deseo" epidemiolgico?

  8. Anlisis de las competencias directivas de una red de salud pblica Analysing a public health service network's managerial competence

    Patricia C Huerta-Riveros

    2009-12-01

    Full Text Available Objetivos Realizar un anlisis sobre la efectividad de la metodologa de formacinaccin, para el desarrollo y fortalecimiento de las competencias requeridas por los directivos de establecimientos de redes asistenciales de salud pblica. Mtodos Se realiz un estudio evaluativo de un programa educativo, con evaluacin pre y post aplicado en el marco y condiciones del programa, sin condiciones controladas, a 37 directivos de la red asistencial del Servicio de Salud Talcahuano, que participaron del programa de Formacin de Equipos Directivos de la Red Asistencial de Salud Pblica los aos 2007 y 2008, realizado por la Facultad de Ciencias Empresariales de la Universidad del Bo-Bo en Chile. En este estudio se aplic en dos ocasiones un instrumento de autoevaluacin por competencias. Resultados Los resultados del estudio demuestran que existe una carencia y necesidad de formacin en las competencias de gestin de los equipos directivos de la red asistencial y la metodologa de formacin-accin empleada provoca el fortalecimiento y desarrollo de las competencias directivas requeridas en la red. Conclusin Estas competencias permitirn brindar una atencin usuaria de calidad, a travs de una mejor gestin de los establecimientos de salud pblica.Objective Analysing the effectiveness of training-action methodology in developing and strengthening the skills required by public health network managerial staff. Methods The study evaluated an educational programme (pre- and post- evaluation being applied within the programme's framework and conditions, without controlled conditions in which 37 managerial staff from the Talcahuano Health Service Network (forming part of the Public Health Assistance Network participated in the Managerial Team Training programme, 2007 and 2008, run by the Bo-Bo University's Entrepreneurial Science Faculty in Chile. A skill-based self-evaluation instrument was applied on two different occasions. Results The results revealed a lack of management skills-based training in network managerial teams and the need for it through training-action methodology which stimulates such needed managerial skills. Conclusions Acquiring these skills will lead to providing users with a quality service through better management practice in public health establishments.

  9. Desarrollo e implementación de una red social para motoristas

    Piñas Matesanz, Joan

    2013-01-01

    [CASTELLÀ] Este proyecto pretende unir los conceptos de geolocalización y red social para aplicarlos a la comunidad de motoristas. Para que puedan gestionar sus eventos y seguirlos en directo a través de la web y el smartphone ubicando a cada motorista dentro del evento.

  10. Análisis de las competencias directivas de una red de salud pública

    Patricia C Huerta-Riveros; Leyton-Pavez, Carolina E.; Saldia-Barahona, Héctor

    2009-01-01

    Objetivos Realizar un análisis sobre la efectividad de la metodología de formaciónacción, para el desarrollo y fortalecimiento de las competencias requeridas por los directivos de establecimientos de redes asistenciales de salud pública.Métodos Se realizó un estudio evaluativo de un programa educativo, con evaluación pre y post aplicado en el marco y condiciones del programa, sin condiciones controladas, a 37 directivos de la red asistencial del Servicio de Salud Talcahuano, que participaron ...

  11. Estudio de los principales CMS para la creación de una red social

    Zavala Gamarra, Giancarlo

    2014-01-01

    Actualmente las redes sociales son muy utilizadas en todo el mundo, existen diferentes tipos de redes sociales con las que podemos conectar con amigos, ampliar nuestra red de contactos profesionales, aprender cosas nuevas, etc. Su elevado uso las ha convertido en uno de los negocios más rentables en internet generando fortunas para sus creadores, principalmente, a través de la publicidad. Muchas redes sociales son creadas por empresas que cuentan con un equipo experto, pero otras muchas han s...

  12. La gran red: una era nueva entre la ciencia y el mito

    María del Rosario Contepomi

    2007-03-01

    Full Text Available El propósito del trabajo es relacionar concepciones en torno al concepto red adoptadas por el movimiento espiritualista "Nueva Era" de la ciudad de Posadas, Misiones, Argentina, con aquellas planteadas por teóricos de la "Era de la Información y Comunicación" en el campo de las ciencias sociales. Dadas la complejidad y amplitud que se atribuye a esta noción, hemos denominado la Gran Red a esa construcción fáctica y virtual a la que se le asignan múltiples denominaciones: interconexión, interrelación, articulación. Estos complejos y heterogéneos vínculos se desarrollan entre elementos, dimensiones y niveles diferentes, tales como materialidad y espiritualidad, hombre y naturaleza, sociedad e individuo. Conforme a ello, nos preguntamos respecto a las creencias religiosas, creaciones ideológicas, producciones científicas o construcciones mitológicas que conforman el mundo-red de la cosmovisión la Nueva Era y la cultura-red de los enfoques socio-antropológicos.The purpose of this work is to relate conceptions around the concept of net adopted by the spiritualist movement "New Era" from the city of Posadas, Misiones, Argentina, with those considered by theorists of the "Era of Information and Communication" in the field of Social Sciences. Given the complexity and range that it is attributed to this notion we have designated the Great Net to that factual and virtual construction which is assigned multiple names: interconnection, interrelation, articulation. These complex and heterogeneous links develop among elements, dimensions and different levels, such as material nature and spirituality, man and nature, society and the individual. In accordance with that we ask ourselves regarding religious beliefs, ideological creations, scientific productions or mythological constructions that constitute the world-net of the view of the world of the New Era and the culture-net of the socio-anthropological approaches.

  13. El desarrollo de aplicaciones colaborativas de alta calidad: una realidad sobre la Red Acadmica de alto desempeo (RENATA

    Jos Tiberio Hernndez

    2007-11-01

    Full Text Available Este artculo muestra las posibilidades del uso y desarrollo de aplicaciones colaborativas sobre la red acadmica de alta conectividad (RENATA, que conecta a Colombia con la red latinoamericana CLARA y a travs de sta con Europa (GEANT y con Estados Unidos (Internet2. Los prototipos presentados se desarrollaron sobre la plataforma Access Grid y muestran situaciones en donde esta infraestructura, junto con software de tele-colaboracin, puede generar alto valor para los grupos de investigacin y el sector empresarial. Los prototipos permiten compartir e interactuar sobre objetos virtuales en una teleconferencia y tambin integrar facilidades de computacin distribuida (GridComputing para clculos sobre grandes cantidades de datos./ This article shows the potential of collaborative applications over the RENATA network, the academic, high-bandwidth, Colombian communication infrastructure with access to other high-bandwidth initiatives in Latin America (CLARA network, Europe (GEANT, and USA (Internet2. Several prototypes on top of Access Grid show the added value for telecollaboration and teleoperation applications in the academic sector, and in the future for business. We show prototypes that enhance a teleconference with interaction with virtual 3D objects and the use of grid resources.

  14. Aspectos clínicos de la Blastomicosis sudamericana (Paracoccidioidomicosis en el Perú

    Zuño Burstein Alva

    2002-01-01

    Full Text Available En esta revisión se presentan las características más notorias del cuadro clínico de la Blastomicosis Sudamericana en el Perú, tomando como fuente informativa nuestro trabajo del año 1971 (VII Congreso Ibero Latinoamericano de Dermatología, realizado en Caracas, Venezuela que presentó la mayor casuística publicada hasta la actualidad en nuestro medio totalizando 111 casos al recopilar la información de Pesce H., desde el año 1937 hasta 1965, con 71 casos, y la nuestra con 40 casos nuevos del Servicio Académico Asistencial de Dermatología de la Universidad Nacional Mayor de San Marcos en el Hospital Dos de Mayo de Lima, estudiados hasta el año 1971. Con esta casuística se analizan la distribución geográfica, edad, sexo, ocupación, evolución clínica, aspectos y formas clínicas de esta enfermedad.

  15. Diseo de una red inalmbrica para aplicaciones de telemedicina / Design of wireless network for applications of telemedicine

    Rebeca, Garca; Andreina, Zambrano; Mnica, Huerta; Roger, Clotet; Lorena, Gilbert; Marilet, De Andrade.

    2010-06-01

    Full Text Available Actualmente los centros de atencin mdica primaria de los pases en desarrollo presentan deficiencias para brindar una atencin mdica adecuada a sus pacientes. Entre estas deficiencias se encuentran la ausencia de red de datos y servicio telefnico, escasez de medios de transporte para el traslado [...] de pacientes a centros de salud especializados, insuficiente personal mdico y equipos e insumos limitados. Para solventar algunas de estas deficiencias en este trabajo se dise y analiz una red inalmbrica de Telemedicina para comunicar los centros de atencin primaria con un centro de salud especializado, ubicados en los Municipios Baruta y El Hatillo del Estado Miranda, Venezuela. Para lograr los objetivos de este proyecto se analizaron las caractersticas del sistema de salud en los municipios y los componentes tecnolgicos presentes en cada centro. Tambin, se estudi el perfil topogrfico de la zona, y se analizaron las distintas tecnologas inalmbricas disponibles. En base a los resultados obtenidos, se eligi WiFi- RCP como la tecnologa ms apropiada para el diseo ya que permite tener mayor alcance y cobertura. Las herramientas utilizadas para el diseo de los enlaces y el anlisis del desempeo de la red fueron los simuladores de redes Radio Mobile versin 7.7.1 y OPNET Modeler versin 10.5 Abstract in english Primary health care centers of developing counties currently exhibit shortcomings for the adequate medical care of their patients. Among those: absence of Internet and telephone service, lack of transportation means for transferring patients to specialized health care centers and insufficient person [...] nel qualification. . In order to resolve some of these deficiencies in this work its designed and analyzed a network of Telemedicine to communicate the ambulatories with a specialized center of health, specifically in the Baruta and El Hatillo municipalities of Miranda State in Venezuela. This aims were achieved by the analysis of health system characteristics in the municipalities, as well as the technological components present at each health care center. Likewise, the topographic profile of the area was studied, and the several wireless technologies available were analyzed. Thanks to the results from this information, WiFi-RCP was chosen as the most adequate technology solution as it allows greater range and coverage due to the speed it use., The tools used were the network simulators Radio Mobile version 7.7.1 and OPNET Modeler version 10.5, for design of the network links and network performance analysis

  16. La inmigración sudamericana en Italia: Efectos sobre el mercado de trabajo Southamerican Migration in Italy: Labour Market Effects

    María Andrea Grasso

    2010-01-01

    Las migraciones sudamericanas no son las más numerosas ni las más preocupantes para el gobierno italiano y, quizás por ese motivo, no son las más estudiadas. Sin embargo, desde la década de 1970, las economías sudamericanas, en su mayoría, pasaron de ser receptoras de inmigrantes a expulsoras de su propia fuerza de trabajo, siendo Italia uno de los principales destinos elegidos. En qué trabajan los inmigrantes sudamericanos, cómo y en qué contribuyen a la economía italiana es uno de los inter...

  17. "Situación de inmigración" de mujeres sudamericanas en chile: hacia un modelo comprensivo

    Leyla Méndez Caro; Manuel Cárdenas Castro; Fabiola Gómez Ojeda; Susan Yáñez Yáñez

    2012-01-01

    El objetivo de esta investigación fue conocer la situación de inmigración de mujeres sudamericanas en la región de Antofagasta (Chile) y construir un modelo teórico para su análisis. Las participantes de este estudio fueron 19 mujeres de entre 18 y 50 años, residentes en la ciudad de Antofagasta y provenientes de Perú, Bolivia y Colombia. Los principales hallazgos sugirieron un modelo dinámico, en el que se tensiona la identidad social y de género de las mujeres inmigrantes ante la búsqueda d...

  18. Polticos y militares en los gobiernos de la nueva izquierda sudamericana / Politicians and the Military in the Governments of the New Left in South America

    Jorge, Battaglino.

    2015-06-01

    Full Text Available El objetivo del artculo es construir una tipologa explicativa de los modelos de relaciones poltico-militares en los gobiernos de la nueva izquierda sudamericana. En particular se analizan los principales modelos de interaccin as como los factores que explican sus variaciones en los casos de Arg [...] entina, Bolivia, Brasil, Chile, Ecuador y Venezuela. Las variaciones en los distintos modelos se analizarn a partir de: a) la relevancia poltica que la defensa y las fuerzas armadas han adquirido para tales gobiernos y b) el poder poltico de los militares al comienzo de tales administraciones. El principal argumento es que la creciente relevancia poltica de la defensa y los militares ha generado un espacio de convergencia de intereses entre civiles-militares que ha favorecido tanto la estabilidad del rgimen democrtico como los intereses corporativos de las fuerzas armadas. Abstract in english The goal of this article is to build an explanatory typology of the political-military relations in the governments of the new left in South America. In particular the main modes of interaction are discussed as well as the factors that explain their variations in the cases of Argentina, Bolivia, Bra [...] zil, Chile, Ecuador and Venezuela. Models are analyzed in the light of the impact of: a) the political relevance that defense and armed forces have acquired to such governments, and b) the political power of the military at the beginning of such administrations. The main argument is that the growing political relevance of defense and armed forces has generated a space of convergence of interests between civilian and the military that has favored both the stability of the democratic regime and the corporate interests of the armed forces.

  19. Distributional patterns of the South American species of Hyalella (Amphipoda: Hyalellidae Patrones de distribución de especies sudamericanas de Hyalella (Amphipoda: Hyalellidae

    Patricio De los Ríos-Escalante

    2012-01-01

    Full Text Available Distributional patterns of the South American species of the freshwater amphipod genus Hyalella were analysed using a panbiogeographic approach. Five generalized tracks were found: (1 northern Andes to Lake Titicaca (H. dielaii, H. meinerti, H. dybowskii, H.jelskii, H. lubominsky, and H. pauperocavae; (2 lake Titicaca (H. armata, H. cuprea, H. latinamus, H. lucifugax, H. montforti, H. neveulemairei, H. robusta, H. tiwanaku, H. simplex simplex, and H. solida; (3 central Andes (H. fossamancinii and H. kochi; (4 Pampas (H. bonariensis, H. caeca, H. castroi, H. longispina, H. montenegrinae, H. pampeana, H. pernix, H. pseudoazteca, and H. warmingii; and (5 Subantarctic (H. patagonica H. costera, H. curvispina, H. chiloensis, H. falklandensis, H. franciscae, H. neonoma, H. patagonica, and H. simplex. One node was found at lake Titicaca (intersection of generalized tracks 1, 2, and 3.Se estudió el patrón de distribución de especies Sudamericanas del género de anfípodo de agua dulce Hyalella mediante una aproximación panbiogeográfica. Se encontraron cinco trazos (1 Norte de los Andes al Lago Titicaca (H. dielaii, H. meinerti, H. dybowskii, H.jelskii, H. lubominsky, y H. pauperocavae; (2 Lago Titicaca (H. armata, H. cuprea, H. latinamus, H. lucifugax, H. montforti, H. neveulemairei, H. robusta, H. tiwanaku, H. simplex simplex, y H. solida; (3 Andes centrales (H. fossamancinii y H. kochi; (4 Pampas (H. bonariensis, H. caeca, H. castroi, H. longispina, H. montenegrinae, H. pampeana, H. pernix, H. pseudoazteca, y H. warmingii; y b (5 Subantártico (H. araucana, H. costera, H. curvispina, H. chiloensis, H. falklandensis, H. franciscae, H. neonoma, H. patagonica, y H. simplex. Se encontró un nodo en el lago Titicaca que correspondió a la intersección de los trazos 1; 2 y 3.

  20. Handoff Between a Wireless Local Area Network (WLAN) and a Wide Area Network (UMTS) / Traspaso entre una red inalmbrica de rea local (WLAN) y una red de cobertura amplia (UMTS)

    J, Snchez-Garca; Luis A, Villaseor-Gonzlez; Mario E, Vaquera-Flores; Ral, Aquino-Santos.

    2009-06-01

    Full Text Available Hoy en da existe una gran variedad de redes inalmbricas de datos que proporcionan coberturas variables, diferentes anchos de banda que implementan diferentes estrategias de traspaso; adicionalmente se presenta una gran demanda por parte de los usuarios mviles por utilizar libremente la cobertura [...] que proporcionan este tipo de redes. Por lo anterior, existe una necesidad de la implementacin de mecanismos de traspaso que permitan la interoperabilidad en los traspasos que se presentan en redes inalmbricas hbridas. La tendencia actual, es la de proporcionar acceso para aplicaciones multimedia utilizando redes inalmbricas de rea local (WLAN), utilizando el estndar IEEE 802. 11 para interiores; por otro lado, se estn instalando redes inalmbricas de y generacin para proporcionar cobertura en exteriores. Como resultado, los nodos mviles requieren un mecanismo de traspaso para permitir la comunicacin en ambientes WLAN y WAN; a la fecha, se han propuesto diversas estrategias en la literatura (Sattari et al., 2004 y Hyo Jin, 2007); sin embargo, ninguna de stas ha sido estandarizada. Para habilitar la interoperabilidad, el nodo mvil debe ser auto-configurable para permitir la movilidad entre las redes WLAN y WAN. En este trabajo se propone un algoritmo para permitir el traspaso de un nodo mvil dentro de una red inalmbrica de rea local (IEEE 802.11) y una estacin base WAN (UMTS), utilizando el soporte de movilidad IP. El algoritmo se implement en simulacin utilizando la herramienta Network Simulator 2. Abstract in english With the appearance of wireless data networks with variable coverage, band width and handoff strategies, in addition to the growing need of mobile nodes to freely roam among these networks, the support of an interoperable handoff strategy for hybrid wireless data networks is a requirement that needs [...] to be addressed. The current trend in wireless data networks is to offer multimedia access to mobile users by employing the wireless local area network (WLAN) standard IEEE802.11 while the user is located indoors; on the other hand, 3rd generation wireless networks (WAN) are being deployed to provide coverage while the user is located outdoors. As a result, the mobile node will require a handoff mechanism to allow the user to roam between WLAN and WAN environments; up to this date several strategies have been proposed (Sattari et al., 2004 and HyoJin, 2007) in the literature, however, none of these have been standardized to date. To support this interoperability, the mobile node must be equipped with configurable wireless inetrfaces to support the handoff between the WLAN and the WAN networks. In this work a new algorithm is proposed to allow a mobile node to roam between a wireless local area network (IEEE802.11) and a WAN base station (UMTS), while employing IP mobility support. The algorithm is implemented in simulation, using the Network Simulator 2.

  1. La trata de persona en la agenda polca sudamericana sobre migraciones: La securitizacin del debate migratorio Human trafficking in the sout american migratory legal agenda: Securitization of the migratory debate.

    Mara Jos Magliano

    2011-04-01

    Full Text Available Este trabajo procura poner en discusin, desde una perspectiva crtica, el modo en que el discurso sobre la trata de personas se incorpora en la agenda poltica sobre migraciones en la regin sudamericana, y las implicancias polticas e ideolgicas de esa incorporacin. Partimos del supuesto que las formas de concebir a la trata de personas en la esfera poltica migratoria regional no se alejan de los postulados de control y seguridad que subyacen a la construccin de esa agenda, reconfigurando y legitimando una concepcin de las migraciones como "problema" y "amenaza". Este estudio se apoya en una metodologa cualitativa basada en el anlisis de documentos elaborados por distintos actores polticos de alcance global y regional, y de intervenciones pblicas de funcionarios en eventos vinculados a las migraciones internacionales.This work procures the bringing into debate, from a critical perspective, of the way in which the talk on human trafficking becomes a part of the migratory political agenda in the South American region, and the political and ideological sequels of such involvement. We take for granted that the ways to conceive human trafficking in the regional migratory political sphere does not fall apart from the postulates of control and security underlying the design of that agenda, reconfiguring and legitimating a conception of migrations as a "problem" and "threat". This study is based on a qualitative methodology based in the analysis of documents produced by different global and regional political actors, and public participations of government officials in events related with international migrations.

  2. ANÁLISIS DE UNA RED DE COOPERACIÓN DE PyMEs EN MISIONES, ARGENTINA: BENEFICIOS Y CARENCIAS PARA EL DESARROLLO LOCAL SOSTENIBLE

    Juan Carlos, Michalus; Gilberto, Hernández Pérez

    2012-01-01

    Se presenta un estudio de caso de una red de cooperación existente en la provincia de Misiones, Argentina, integrada por una Pequeña y Mediana Empresa (PyME) elaboradora de té negro y un grupo de PyMEs de aserrado de madera, constituida a partir de la iniciativa particular del empresario tealero. El objetivo es identificar los beneficios del trabajo en cooperación y a su vez, poner en evidencia las carencias que existen cuando estos procesos no se realizan de manera planificada y orientada al...

  3. Sistema multi-agente para el apoyo a la gestion de inventarios en itil mediante el monitoreo distribuido de software y hardware en una red corporativa

    Ortiz, Sebastián; López Gallego, Cesar; Oviedo Carrascal, Ana Isabel

    2011-01-01

    Gestionar la información del inventario de software y hardware puede ser, para una organización, una tarea dispendiosa y a veces no alcanzable por la complejidad y el número de usuarios que en ella coexisten. Como un acer camiento a la solución de este problema, se plantea el diseño de un sistema multi-agente distribuido que implemente un monitor eo constante en tiempo real y usando la red corporativa, de los cambios en el software y hardware de las máquinas de los usuarios.

  4. Diagnóstico y propuesta para una gestión integral del riesgo en el valle de aburra: red riesgos

    ARISTIZÁBAL EDIER; VARGAS RICHARD

    2010-01-01

    A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gest...

  5. Diagnóstico y propuesta para una gestión integral del riesgo en el Valle de Aburrá: red riesgos.

    Aristizábal, Edier; VARGAS, RICHARD; Mesa Sánchez, Óscar José

    2008-01-01

    A partir del análisis de la situación organizacional de las diferentes instituciones en el Valle de Aburrá frente a la reducción de desastres y emergencias asociadas con los fenómenos de origen natural y antrópico, el Área Metropolitana del Valle de Aburrá, como autoridad ambiental y entidad planificadora, hace una propuesta que pretende articular todas las entidades, organizaciones e instituciones públicas y privadas hacia una gestión integral del riesgo, y la cual denominó: Red para la Gest...

  6. Una propuesta para el monitoreo de la movilidad cortical actual en la sierra Chica de Zonda (Precordillera oriental de San Juan: mediciones de gravedad en red

    S. Miranda

    2006-09-01

    Full Text Available Se detallan los requerimientos para el procedimiento de medición de redes precisas de gravedad que permitan obtener una interpretación de los cambios temporales de gravedad observados con relación a movimientos verticales en la corteza. Para Argentina, esta es la primera medición de gravedad en red realizada con fines de monitoreo cortical a escala local. Los vértices de la red prácticamente rodean a la sierra Chica de Zonda (Precordillera Oriental de San Juan caracterizada como una región de fallamiento activo. El objetivo científico del experimento es el ensayo de esta herramienta geofísica para cuantificar probables deformaciones verticales y/o cambios de masas subsuperficiales vinculados con actividad sísmica.

  7. Rediseño de una red de distribución con variabilidad de demanda usando la metodología de escenarios

    John Willmer Escobar

    2012-06-01

    Full Text Available Este artículo presenta el problema del diseño de una red de distribución de gran escala con variabilidad en la demanda. Se parte de una estructura de red establecida,cuya problemática central radica en la determinación de las decisiones de cierre o apertura de los centros de distribución. El problema se ha solucionado utilizando la metodología de optimización mediante escenarios;dicha metodología usa un esquema de optimización basado en la generación de múltiples escenarios de los parámetros críticos de la red. El modelo está basado en el caso de una compañía multinacional de alimentos que abastecetodo el territorio colombiano y varios mercados internacionales. Los resultados obtenidos reflejan la importancia y eficiencia de la metodología propuesta para el tratamiento de la variabilidad en la demanda,en el diseño de redes de distribución.

  8. Rediseño de una red de distribución con variabilidad de demanda usando la metodología de escenarios

    John Wilmer Escobar

    2013-02-01

    Full Text Available Este artículo presenta el problema del diseño de una red de distribución de gran escala con variabilidad en la demanda. Se parte de una estructura de red establecida,cuya problemática central radica en la determinación de las decisiones de cierre o apertura de los centros de distribución. El problema se ha solucionado utilizando lametodología de optimización mediante escenarios;dicha metodología usa un esquema de optimización basado en la generación de múltiples escenarios de los parámetros críticos de la red. El modelo está basado en el caso de una compañía multinacional de alimentos que abastece todo el territorio colombiano y varios mercados internacionales. Los resultados obtenidos reflejan la importancia y eficiencia de la metodología propuesta para el tratamiento de la variabilidad en la demanda, en el diseño de redes de distribución.

  9. Predicción de los precios de contratos de electricidad usando una red neuronal con arquitectura dinámica

    Juan David Velásquez Henao

    2010-04-01

    Full Text Available Los contratos en los mercados liberalizados de electricidad constituyen una herramienta para proteger a los agentes de la volatilidad; en este contexto, los pronósticos de los precios son una entrada clave para la toma de decisiones estratégicas y operativas de los agentes. En este artículo, se pronostican los precios promedios de los contratos despachados en el mercado eléctrico colombiano, usando una red neuronal con arquitectura dinámica conocida como DAN2. El modelo desarrollado es capaz de capturar la dinámica intrínseca de la serie de precios y de pronosticar el precio para el siguiente mes con más precisión que la metodología ARIMA clásica, para horizontes de predicción de 12 y 24 meses

  10. ENFERMEDAD DE VOGT KOYANAGI HARADA EN UNA SERIE CLINICA DE PACIENTES. EN RED DE SALUD UC: CLASIFICACION Y EVOLUCION CLINICA.

    Enzo Castiglione A.

    2007-12-01

    Full Text Available La enfermedad de Vogt - Koyanagi - Harada (VKH es una panuveítisgranulomatosa bilateral con compromiso extraocular enel sistema auditivo, meníngeo y piel (1. Clínicamente se puedepresentar por ojo rojo profundo, bilateral, dolor ocular o compromisode la agudeza visual. Los hallazgos del examen clínicodependerán del estadío clínico de la enfermedad. Hay manifestacionestempranas como coroiditis (con o sin uveítis anterior o hiperemiadel disco óptico o desprendimientos retinales serosos,como también manifestaciones de enfermedad tardías: despigmentaciónocular, cicatrices coriorretinales o uveítis recurrente.Los tratamientos propuestos son múltiples: desde la observaciónhasta la corticoterapia por distintas vías de administración,inmunomoduladores, antimetabolitos o agentes alquilantes,dado que es desconocido el tratamiento más efectivo con lasmenores complicaciones a largo plazo. El diagnóstico diferencialincluye formas graves de retinopatía central serosa, traumaocular penetrante (quirúrgico o accidental y diversas causas deuveítis posterior y pan uveítis. Con el fin de definir poblacioneshomogéneas de pacientes con VKH para comenzar a desarrollarestudios clínicos y establecer de mejor manera su diagnóstico,tratamiento y pronóstico, en el año 2001 fueron replanteadoslos criterios diagnósticos de VKH por un comité internacional,determinando categorías de la enfermedad (2. Así, la enfermedadde VKH puede clasificarse como completa (enfermedad ocularmás compromiso de tegumentos y neurológicos, incompleta(enfermedad ocular más compromiso de tegumentos o compromisoneurológico y probable (enfermedad ocular pura.Nuestro objetivo fue clasificar a los pacientes con VKH evaluadosen la Red de Salud UC según los criterios del Comité Internacionalpara el estudio de la Enfermedad de VKH y evaluar susrespuestas a tratamiento y desarrollo de complicaciones.

  11. M??sica en el cine: Una propuesta de trabajo cooperativo en base a una red social educativa en un curso de 4?? de la E.S.O

    Fern??ndez Varela, Nidia

    2011-01-01

    El proyecto que se describir?? a continuaci??n se llev?? a cabo con alumnos de cuarto de la E.S.O. del Colegio ??rtica del PAU de Carabanchel, sito en la C.C.A.A de Madrid en el a??o 2010. En este art??culo se expondr?? el trabajo realizado sobre un tema en concreto del curr??culum oficial de 4?? de la ESO en el aula de m??sica que fue trabajado en grupos cooperativos utilizando una red social. As?? mismo, se puntualizar??n los objetivos que guiaron la acci??n, se har?...

  12. Contribuciones a una propuesta para la gestión de la red de servicios de salud y las acciones del SUS, en base a los resultados

    Hesio Cordeiro et al

    2009-01-01

    El trabajo se refiere a las innovaciones que se deben poner en pratica por el Ministerio de Salud para lograr la superación de dificultades de la gestión del Sistema Único de Salud que comprometen la calidad y la resolubilidad de los cuidados de salud. Se realiza una revisión de la experiencia internacional en relación a los sistemas y elementos de gestión de la red de servicios tomando en cuenta el territorio, las politicas de regulación e los instrumentos de regulación. En la situación de...

  13. Plan de viabilidad de una empresa dedicada a la generación de Energía Solar Fotovoltaica y posterior venta a red

    Taboada Villagrasa, Núria

    2009-01-01

    Este proyecto trata sobre estudiar la viabilidad de una empresa en un sector en auge debido a la explosión de la energía fotovoltaica en Catalunya y España, aprovechando las ayudas y subvenciones del gobierno y la concienciación de la sociedad con respecto al cambio climático y a la energía verde. Mediante el estudio de la empresa con la cual pretendemos cubrir este proyecto, venderemos la energía obtenida del sol a la red eléctrica alquilando los espacios desaprovechados ap...

  14. Evaluación asimétrica de una red neuronal: aplicación al caso de la inflación en Colombia

    Maria Clara Aristizábal

    2006-12-01

    Full Text Available El objetivo de este trabajo es explorar la relación no lineal entre el dinero y la inflación en Colombia a través de una red neuronal artificial, utilizando información mensual de la variación del Índice de Precios al Consumidor y del agregado monetario M3, desde enero de 1982 hasta febrero de 2005. Las redes neuronales artificiales aparecen como una excelente alternativa para las autoridades monetarias de contar con los mejores modelos para pronosticar la inflación y guiar sus decisiones de política. El presente artículo incorpora algunas innovaciones en la modelación del dinero e inflación que permiten generar pronósticos más confiables, debido a que el modelo se aproxima con mayor exactitud a la realidad.

  15. Una red neuronal binaria para la identificación de mecanismos isomorfos. // A binary Neural network for identifying isomorphic mechanisms.

    G. Galán Marín

    2002-05-01

    Full Text Available Un problema de importancia primordial en el diseño mecánico es identificar los mecanismos isomorfos, puesto que los isomorfismos nodetectados generan soluciones duplicadas y por tanto suponen un esfuerzo innecesario en el proceso de diseño. Desde 1960, una grancantidad de métodos han sido propuestos para la detección de mecanismos isomorfos. Sin embargo, diversos trabajos han mostrado queaunque pueden existir algoritmos eficaces para casos particulares, en el caso general los métodos tradicionales para la detección deisomorfismos en cadenas cinemáticas no proporcionan usualmente soluciones eficientes para este problema, que ha sido clasificado comoNP-duro. Un eficaz método alternativo para la resolución de problemas NP-duros ha surgido recientemente con las redes neuronales. Eneste trabajo proponemos un nuevo modelo de red neuronal binaria diseñado para la resolución del problema de detección de mecanismosisomorfos. El modelo propuesto se halla basado en unas dinámicas discretas que garantizan una rápida y correcta convergencia de la redhacia soluciones aceptables. Las simulaciones numéricas muestran en los mecanismos analizados que la red neuronal propuestaproporciona excelentes resultados, mostrándose además muy superior a la red de Hopfield continua tradicional en lo que respecta al tiempode computación y en la facilidad de su implementación.Palabras claves: Mecanismos isomorfos, síntesis de mecanismos, isomorfismo de grafos, red neuronal binaria,redes de Hopfield.____________________________________________________________________________AbstractAn important step in the kinematic mechanism synthesis process is to identify graph isomorphism whilegenerating new mechanisms. Undetected isomorphisms result in duplicate solutions and unnecessary effort.Since 1960, a lot of methods have been proposed for the graph isomorphism identification. Some authors haveconcluded that, in the general case, the traditional methods of detecting kinematic chain isomorphism havebeen not found to be an efficient solution of the kinematic chain isomorphism problem, classified as NP-hard.This has motivated to attempt a new direction of approach based on neural networks. In this paper we presenta new binary neural network designed for solving this problem. The model is based on appropriate dynamicsfor a binary network in order to always generate fast and correct solutions. Simulation runs for the selectedmechanisms show that our network provides fast and good quality solutions and performs better than thetraditional continuous Hopfield network, because of its easier implementation and smaller computation time.Keywords: isomorphic mechanisms, synthesis of mechanisms, graph isomorphism, binary neuralnetwork, Hopfield networks.

  16. La red de las comisiones extraparlamentarias (1910-2000: auge y declive de una expresin institucional del neocorporativismo helvtico

    Frdric Rebmann

    2011-12-01

    Full Text Available Las comisiones extraparlamentarias son rganos administrativos que asumen tareas consultivas o ejecutivas para el Gobierno, pero que estn compuestas, esencialmente, por personas ajenas a la Administracin Federal. En este sentido, las comisiones estn en tensin, entre una lgica de evaluacin de competencias y una lgica de representacin. A partir de un anlisis estructural de redes, hemos podido distinguir estas dos lgicas poniendo de manifiesto, en particular, las especificidades de la segunda: as pues, hemos analizado, de acuerdo con un enfoque diacrnico que abarca cinco fechas del siglo XX (los aos 1910, 1937, 1957, 1980 y 2000, la evolucin de la morfologa de los vnculos entre comisiones y actores a partir de los cuales se operan procesos de coordinacin, de concesin y de negociacin poltica. Nuestros estudios han mostrado que estos vnculos de concordancia se intensifican de forma continua entre 1910 y 1980, con una aceleracin marcada a partir del fin de la Segunda Guerra Mundial. Estos vnculos han sido desarrollados bsicamente por las diferentes asociaciones de intereses y ataen casi exclusivamente a las polticas econmicas y sociales. Es as como las CEP aparecen por esa fecha como una de las principales instituciones neocorporativistas de concordancia. No obstante, esta evolucin se invierte considerablemente entre 1980 y 2000, con una disminucin importante de este tipo de vnculos, lo cual cuestiona la lgica de coordinacin de las comisiones. La explicacin la hallamos principalmente en los factores siguientes: el proceso de reforma del sistema comisionista que se inicia en los aos 70, el proceso de internacionalizacin que afecta a Suiza desde los aos 80, y por ltimo, un cambio de preferencias y de repertorio de accin de un cierto nmero de asociaciones econmicas y sociales, que se alejan progresivamente de los mecanismos de cooperacin transversal caractersticos de los regmenes neocorporativistas. No obstante, a pesar de esta evolucin, un ncleo de concordancia se mantiene, sobre una base ms limitada, en las asociaciones de intereses tradicionales respecto a algunas polticas econmicas y sociales.

  17. Enfermera Informtica: una contradiccin o una oportunidad para el trabajo en red? Nursing - Information Technology: Is a contradiction or an opportunity to networking?

    Niurka Vialart Vidal

    2011-06-01

    Full Text Available La informtica es una especialidad que no solo procesa datos, sino que tambin necesita de ellos y se nutre de cualquier informacin que le sea establecida para el intercambio colaborativo, por tanto es herramienta para el desarrollo de cualquier ciencia. La Enfermera desarrollada como profesin y disciplina y en su camino a posesionarse como ciencia necesita de los ltimos adelantos de la ciencia y la tcnica, de ah la importancia de describir las herramientas ms importantes de la informtica para el trabajo en redes en enfermera. Se concluye que no existen contradicciones entre la enfermera y la informtica, es cuestin de variar las conductas ante las nuevas tecnologas, para ajustarse a los tiempos y al desarrollo de la ciencia y con ello aprovechar la oportunidad que le ofrece la informtica a la enfermera en su camino a constituirse como ciencia donde el trabajo en redes debe constituir una prioridad.Information technology is a specialty that not only process data, but also need of them and provide with any information to be established for cooperative exchange, thus, it is a means for the development of any science. Nursing developed as a profession and a discipline and in its route to be placed as a science, needs of the novel advances of science and technique, thus the significance to describe the more important means of information technology for the networking in nursing. We conclude that there are not contraindications between nursing and information technology it's a question of change the behaviors in face of technologies, to fit in with the times and the science's development and thus to make use of the opportunities offering information to nursing in its promotion as a science where the networking must to be a priority.

  18. IMPLEMENTACIÓN Y ACTUALIZACIÓN EN LA INFRAESTRUCTURA DE SEGURIDAD DE UNA RED INFORMÁTICA

    Nancy Yaneth Gelvez García; Miguel Andrés Flórez Vianchá; Victor Daniel Angulo Morales

    2012-01-01

    En éste artículo se evidencia la importancia de la seguridad en las redes informáticas dentro de cualquier organización y muestra los resultados encontrados al actualizar la infraestructura de seguridad de una organización e incluir mejoras de diseño (desde el punto de vista del hardware y software) que cuenta con varias sucursales en el País. Será implementado un nuevo cortafuegos en la sucursal de zona franca así como la creación de una VPN site to site con la sede principal. Se realizará l...

  19. Entrenamiento de una red neuronal multicapa para la tasa de cambio euro - dólar (eur/usd)

    Villamil Torres, Jaime Alberto; Delgado Rivera, Jesús Alberto

    2010-01-01

    Tanto para los inversionistas como para las autoridades económicas es necesario que se desarrolle una herramienta matemática que logre dar cuenta de la dirección de una variable como el tipo de cambio (el precio relativo entre dos monedas). Muchos de los mecanismos usados actualmente están basados en el uso de técnicas estadísticas, en particular series de tiempo lineales. Las redes neuronales artificiales (RNA) son modelos matemáticos que pretenden emular el funcionamiento del cerebro humano...

  20. Desarrollo de una aplicación en JavaME que permita el intercambio de contenido multimedia usando el protocolo RTP sobre la red EGPRS-GSM

    Joswill Pájaro

    2009-01-01

    Full Text Available El desarrollo de aplicaciones móviles utilizando la plataforma Java Micro Edition se ha visto relegado a juegos y aplicaciones de ocio. Debido al auge que ha tenido la telefonía celular en el mundo, a los celulares que cada vez son más versátiles y a la convergencia lograda entre la red de telefonía celular y la Internet, se propone una solución que explora nuevos campos en la programación móvil e intenta lograr una convergencia de servicios entre la telefonía celular y redes de datos. Esta investigación brinda nuevas aplicaciones a tecnologías ya conocidas y presenta una aplicación que permite intercambiar contenido multimedia (audio y video en tiempo real desde un celular a un computador o a otro celular usando Internet, el protocolo de transporte en tiempo real y redes de telefonía celular.

  1. "Situación de inmigración" de mujeres sudamericanas en chile: hacia un modelo comprensivo

    Leyla Méndez Caro

    2012-01-01

    Full Text Available El objetivo de esta investigación fue conocer la situación de inmigración de mujeres sudamericanas en la región de Antofagasta (Chile y construir un modelo teórico para su análisis. Las participantes de este estudio fueron 19 mujeres de entre 18 y 50 años, residentes en la ciudad de Antofagasta y provenientes de Perú, Bolivia y Colombia. Los principales hallazgos sugirieron un modelo dinámico, en el que se tensiona la identidad social y de género de las mujeres inmigrantes ante la búsqueda de coherencia dentro de sus espacios vitales. Advertimos en la interacción con la sociedad receptora, la imposición de nuevas categorías sociales a cambio de integración basada en la asimilación. No obstante, también se observan formas de resistencia frente a dicho proceso.

  2. Modelo arima para pronosticar valores de tráfico en una red de datos wi-fi

    Hernández Suarez, Cesar Augusto; Salcedo Parra, Octavio José; Escobar Díaz, Andrés

    2010-01-01

    El presente artículo de investigación científica y tecnológica tiene por objetivo demostrar que las series de tiempo son una exce- lente herramienta para el modelamiento de tráfico de datos en redes Wi-Fi. Para lograr este objetivo se utilizó la metodología de Box-Jenkins, la cual se describe. El modelamiento de tráfico Wi-Fi a través de modelos correlacionados como las series de tiem- po, permiten ajustar gran parte de la dinámica del comportamiento de los datos en una ecuación y con base en...

  3. REDOCOM 2.0: Hacia una red social de documentacin en medios de comunicacin con proyeccin iberoamericana

    Rodrigo Cetina Presuel

    2010-03-01

    Full Text Available El artculo se inicia con una referencia a las actuaciones sobre enseanza e investigacin, produccin y difusin sobre documentacin informativa multimedia llevadas a cabo en los ltimos diez aos en el mbito del Servicio de Documentacin Multimedia dependiente de la Seccin Departamental de Biblioteconoma y Documentacin de la Universidad Complutense de Madrid. Se presenta a continuacin la actuacin ms reciente de dicho servicio consistente en una propuesta de establecimiento de un medio de comunicacin universitario en la Web (REDOCOM 2.0, con alusin a los antecedentes producidos en dicho mbito. Se describen sus contenidos, su estructura y sistematizacin, y las secciones correspondientes, establecindose finalmente unas conclusiones sobre su configuracin actual y la proyeccin futura de este medio de comunicacin en lnea. -- The article begins with a reference to the education, research, production and dissemination of multimedia information documentation held in the last ten years in the field of Multimedia Documentation Service Section dependent on Library and Information Science Department of the University Complutense of Madrid. Following the information service is presented; it consists of a proposal for establishment of a university media on the Web (REDOCOM 2.0, with reference to the background produced in this area. Finally, the article describes its contents, structure, systematization, and the relevant sections, finally settling conclusions on its current and future projection of this media online.

  4. ANÁLISIS DE UNA RED DE COOPERACIÓN DE PyMEs EN MISIONES, ARGENTINA: BENEFICIOS Y CARENCIAS PARA EL DESARROLLO LOCAL SOSTENIBLE

    Juan Carlos, Michalus

    2012-06-01

    Full Text Available Se presenta un estudio de caso de una red de cooperación existente en la provincia de Misiones, Argentina, integrada por una Pequeña y Mediana Empresa (PyME elaboradora de té negro y un grupo de PyMEs de aserrado de madera, constituida a partir de la iniciativa particular del empresario tealero. El objetivo es identificar los beneficios del trabajo en cooperación y a su vez, poner en evidencia las carencias que existen cuando estos procesos no se realizan de manera planificada y orientada al desarrollo local sostenible.El estudio de caso que se expone constituye un caso único, contemporáneo; con relevamiento de datos en los establecimientos pertenecientes a la red de cooperación, entrevistas a empresarios y encargados de producción, que permitieron constatar los beneficios de la cooperación, entre los que figuran: aprovechamiento de residuos, generación de lazos de confianza entre empresarios y contribución al cuidado del medio ambiente. También se constataron las principales deficiencias que impiden la obtención de beneficios mayores, derivados de la carencia de un instrumental metodológico adecuado para implementar este tipo de emprendimientos cooperativos, entre los que se destaca: escaso aprovechamiento de recursos ociosos, ausencia de mejoras en procesos mediante innovaciones conjuntas, falta de participación de actores fundamentales y de orientación sistemática hacia el desarrollo local sostenible.

  5. El proyecto INDITIC, una red social para la innovación metodológica en la UNED

    Cardona Andújar, José

    2011-01-01

    En este trabajo se presenta el informe sobre INDITIC, un proyecto de investigación en redes orientado a ofrecer a los profesores y alumnos un nuevo modelo metodológico para la enseñanza-aprendizaje que, integrando lo presencial y lo virtual (TIC), mejorara la tutoría personalizada de los primeros y el aprendizaje autónomo de los segundos en el marco de una asignatura del plan de estudios de licenciatura en Pedagogía. el objetivo esencial ha sido construir un itinerario personalizado de aprend...

  6. Unidos por la red, separados por el Estado. Una lectura sobre la inclusión digital en Colombia

    Patricia Martinez Coral

    2014-01-01

    El presente artículo se propone contribuir al debate teórico sobre la naturaleza institucional de la difusión tecnológica, a la luz de la evidencia encontrada en el desarrollo de las iniciativas de acceso universal a Internet en Colombia, las cuales se enmarcan en la política de telecomunicaciones sociales, vigente desde 1995. Una vez introducidos los fundamentos que orientan la discusión teórica, y su aplicación concreta en el campo de las Tecnologías de la Información y la Comunicación (TIC...

  7. IMPLEMENTACIÓN Y ACTUALIZACIÓN EN LA INFRAESTRUCTURA DE SEGURIDAD DE UNA RED INFORMÁTICA

    Nancy Yaneth Gelvez García

    2012-05-01

    Full Text Available En éste artículo se evidencia la importancia de la seguridad en las redes informáticas dentro de cualquier organización y muestra los resultados encontrados al actualizar la infraestructura de seguridad de una organización e incluir mejoras de diseño (desde el punto de vista del hardware y software que cuenta con varias sucursales en el País. Será implementado un nuevo cortafuegos en la sucursal de zona franca así como la creación de una VPN site to site con la sede principal. Se realizará la integración de todos los firewalls con la sede principal y la reconfiguración de rutas estáticas por mala configuración y por cambio de proveedor ISP.El aporte académico del proyecto consiste en brindar lineamientos clave en cualquier implementación así como conceptos en seguridad de la información y firewalls.

  8. La concrecin de las capitales estratgicas sudamericanas: el logro brasileo y la postergacin argentina

    Daniel Amicci

    2012-01-01

    Full Text Available En estetrabajo, el autor analiza los esfuerzos por dotar de capitales estratgicas a los dos mayores pases sudamericanos, trazando lineamientos comparativos entre la inconclusa iniciativa de Ral Alfonsn, en 1986, por trasladar hacia la Patagonia la sede nacional argentina y la meta alcanzada por Juscelino Kubistchek, en 1960, al fundar Brasilia. Se proponen una serie de factores para explicar este contraste que conjugan cuestiones de ndole econmica, poltica y social, as como las vinculadas al papel de la prensa y las construcciones simblicas. La investigacin permiti determinar, ms all de las diferencias propias de cada curso histrico, las causas principales del fracaso del plan del gobierno argentino en la puesta en marcha de una decisin claramente extempornea, ejecutada con imprudente espontaneidad en un clima de tensin social y profunda crisis econmica, producto heredado de la dictadura ms extrema que conociera el pas.

  9. Formulación y Control de la Estrategia en un Grupo de Empresas que Conforman una Red

    Merlin Patricia Grueso

    2009-12-01

    Full Text Available Las redes empresariales son parte del actual entorno de negocios y se caracterizan porque llevan a establecer fuertes interdependencias entre las empresas, sus clientes, proveedores, instituciones del gobierno y entidades de apoyo. El estudio tenía como propósito validar el grado en que las empresas consideran estos agentes en los procesos de formulación y control de la estrategia empresarial. Los resultados obtenidos indican que las empresas tienen en cuenta especialmente la interacción con sus empleados al momento de formular y realizar controles a las estrategias empresariales; el papel de las otras empresas que conforman la red en este proceso es discutible; así mismo, es limitada la importancia que las empresas le atribuyen a las universidades y entidades de fomento a la investigación.

  10. Development and implementation of a pilot network for continuous monitoring of electric energy; Desarrollo e implantacion de una red piloto de monitoreo continuo de energia electrica

    Sanchez Cifuentes, A.; Cortes Eslava, A. [Facultad de Ingenieria, UNAM, Mexico, D. F. (Mexico)

    1997-12-31

    The ``Programa Universitario de Energia (PUE)`` (University Energy Program) of the Universidad Nacional Autonoma de Mexico (UNAM) through the project ``Ecologic Control of The University Campus`` has the objective of instrumenting policies for the rational use of the electric energy in the UNAM installations. The PUE has performed a series of activities aimed at the establishment of an integral program for the electric energy management in the UNAM. This program has to consider the measures for energy saving (MES) of general kind and to promote a series of specific measures to be adequated and implemented for each one of the departments. The success in establishing a series of MES compels to quantify its effects, to register and to analyze them to be in position of enhancing them, since it must be kept in mind that something that can not be measured can not be improved. For this purpose the PUE is developing a continuous monitoring pilot network of electric energy with local and remote access and an automated metering system. Two monitoring schemes are experimented, one commercial metering equipment and another one with own metering technology. In this paper the characteristics of the proposed monitoring schemes are described. [Espanol] El Programa Universitario de Energia (PUE) de la Universidad Nacional Autonoma de Mexico (UNAM), a traves del proyecto {sup C}ontrol Ecologico del Campus Universitario{sup ,} tiene como objetivo instrumentar politicas de uso racional de la energia en las instalaciones universitarias. El PUE ha realizado una serie de actividades encaminadas a establecer un programa integral de administracion de la energia electrica en la UNAM. El programa mencionado debe considerar medidas de ahorro de energia (MAE) de tipo general y promover una serie de medidas particulares, para ser adecuadas e implantadas por cada una de las dependencias. El exito en el establecimiento de una serie de MAE, obliga a cuantificar sus efectos, registrarse y analizarse para poder mejorarse, ya que se debe tener presente que aquello que no pueda medirse no se puede mejorar. A este fin, el PUE esta desarrollando una red piloto de monitoreo continuo de energia electrica con acceso local y remoto, y de un sistema automatizado de medicion. Se experimentan dos esquemas de monitoreo; uno con equipo de medicion comercial y otro con equipo de medicion de tecnologia propia. El presente trabajo describe las caracteristicas de los esquemas de monitoreo propuestos.

  11. Abriendo las cajas negras del análisis foucaultiano: una invitación a la Teoría del Actor-Red

    Omar Pereyra

    2011-12-01

    Full Text Available En este artículo deseo hacer una introducción a la Teoría del Actor-Red (Action-Network-Theory o ANT. Como un proyecto de sociología del conocimiento y de la ciencia que se expande a otras esferas de lo social, la ANT tiene en la perspectiva foucaultiana un contrincante natural. Por ello, presentaré un contraste entre ambas perspectivas. Esta comparación se centra en las diferencias entre sus fundamentosontológicos (cuerpos y sujetos versus actantes y actores, sus distintas formas de aproximarse a estos (genealogía vs. traslado/traducción, y finalmente sus consecuentes metáforas o imágenes utilizadas para describir el mundo (instituciones o sistemas vs. redes o ensamblajes. Argumentaré que, aunque la perspectiva foucaultiana es inicialmente más ambiciosa que la ANT, al final acaba traicionándose a sí misma por tener, en la práctica, una fijación en el poder sobre el sujeto, y en consecuencia, por tener una visión más rígida de los sistemas que lleva a oscurecer los desvíos, negociaciones o accidentes que ocurren en el proceso de producción. Ilustraré mi argumento haciendo referencia a distintos trabajos que se guían por la perspectiva foucaultiana. También se señalarán algunas críticas a la ANT.

  12. An ARIMA model for forecasting Wi-Fi data network traffic values / Modelo ARIMA para pronosticar valores de trfico en una red de datos Wi-Fi

    Cesar Augusto, Hernndez Suarez; Octavio Jos, Salcedo Parra; Andrs, Escobar Daz.

    2009-08-01

    Full Text Available El presente artculo de investigacin cientfica y tecnolgica tiene por objetivo demostrar que las series de tiempo son una excelente herramienta para el modelamiento de trfico de datos en redes Wi-Fi. Para lograr este objetivo se utiliz la metodologa de Box-Jenkins, la cual se describe. El mode [...] lamiento de trfico Wi-Fi a travs de modelos correlacionados como las series de tiempo, permiten ajustar gran parte de la dinmica del comportamiento de los datos en una ecuacin y con base en esto estimar valores futuros de trfico. Lo anterior es una ventaja para la planeacin de cobertura, reservacin de recursos y la realizacin de un control ms oportuno y eficiente en forma integrada a diferentes niveles de la jerarqua funcional de la red de datos Wi-Fi. Como resultado de la investigacin se obtuvo un modelo de trfico ARIMA de orden 6, el cual realiz pronsticos de trfico con valores del error cuadrtico medio relativamente pequeos, para un periodo de 18 das. Abstract in english This present scientific and technological research was aimed at showing that time series represent an excellent tool for data traffic modelling within Wi-Fi networks. Box-Jenkins methodology (described herein) was used for this purpose. Wi-Fi traffic modelling through correlated models, such as time [...] series, allowed a great part of the data's behaviourl dynamics to be adjusted into a single equation and future traffic values to be estimated based on this. All this is advantageous when it comes to planning integrated coverage, reserving resources and performing more efficient and timely control at different levels of the Wi-Fi data network functional hierarchy. A six order ARIMA traffic model was obtained as a research outcome which predicted traffic with relatively small mean square error values for an 18-day term.

  13. MODELADO DEL PRECIO SPOT DE LA ELECTRICIDAD EN BRASIL USANDO UNA RED NEURONAL AUTORREGRESIVA ELECTRICITY SPOT PRICE MODELLING IN BRASIL USING AN AUTOREGRESSIVE NEURAL NETWORK

    Juan D Velásquez

    2008-12-01

    Full Text Available Una red neuronal autorregresiva es estimada para el precio mensual brasileño de corto plazo de la electricidad, la cual describe mejor la dinámica de los precios que un modelo lineal autorregresivo y que un perceptrón multicapa clásico que usan las mismas entradas y neuronas en la capa oculta. El modelo propuesto es especificado usando un procedimiento estadístico basado en el contraste del radio de verosimilitud. El modelo pasa una batería de pruebas de diagnóstico. El procedimiento de especificación propuesto permite seleccionar el número de unidades en la capa oculta y las entradas a la red neuronal, usando pruebas estadísticas que tienen en cuenta la cantidad de los datos y el ajuste del modelo a la serie de precios. La especificación del modelo final demuestra que el precio para el próximo mes es una función no lineal del precio actual, de la energía afluente actual y de la energía almacenada en el embalse equivalente en el mes actual y dos meses atrás.An autoregressive neural network model is estimated for the monthly Brazilian electricity spot price, which describes the prices dynamics better than a linear autoregressive model and a classical multilayer perceptron using the same input and neurons in the hidden layer. The proposed model is specified using a statistical procedure based on a likelihood ratio test. The model passes a battery of diagnostic tests. The proposed specification procedure allows us to select the number of units in hidden layer and the inputs to the neural network based on statistical tests, taking into account the number of data and the model fitting to the price time series. The final model specification demonstrates that the price for the next month is a nonlinear function of the current price, the current energy inflow, and the energy saved in the equivalent reservoir in the current month and two months ago.

  14. La firma digital: una tecnología para la intercomunicación en la sociedad-red

    Salvador Ayestarán, Ignacio

    2001-03-01

    Full Text Available An analysis of the technologies of digital signature is achieved within the European Union from three different angles: technique, official standard and I+D support. Firstly, a description of the nature and the bringing into operation of the digital signature is made, together with certificates,Trusted Third Parties, key management and its legal problems. Secondly, a historical analysis of the research support and the development of the European Community is also provided (European Trustworthy Services Programme, previous to the European Council directive about digital signature. Finally, the Electronic Data Interchange (EDI is considered within the policies of IDA Programme (Interchange Data Administration and the projection of the future European administrative intercommunication.

    Se lleva a cabo un análisis de las tecnologías de firma electrónica, en el contexto de la Unión Europea, desde una triple perspectiva: técnica, normativa y de soporte I+D. Para ello se realiza una descripción de la naturaleza y funcionamiento de la firma digital, los certificados y las autoridades de certificación, la gestión de claves y sus problemas legales y regulatorios. Se efectúa un análisis histórico del soporte de investigación y desarrollo de la comunidad europea (Programa de Servicios Confiables Europeos, previo a la Directiva del Consejo Europeo sobre Firma Electrónica. Por último, se considera el Intercambio Electrónico de Documentos (EDI, en el marco de las políticas del Programa IDA (Intercambio de Datos entre Administraciones, y la proyección de la intercomunicación administrativa europea en el futuro.

  15. Diseño de una red telemática orientada a grupos sociales como plataforma para el desarrollo de su red social: Parte II. Diseño de la una red telemática en una institución nacional Designing a telematic network oriented to social groups as a platform for the development of their social network: Part II. Designing a telematic network in a national institution

    Néstor Mena Díaz

    2007-11-01

    Full Text Available Se expone el diseño de una red telemática capaz de conectar todas las filiales de la institución utilizada como base para la implementación del modelo de plataforma informática propuesto, que se utiliza para la interconexión de las distintas redes sociales que conforman la institución. La plataforma creada permite de modo individual o grupal: la creación y edición de blogs a nivel corporativo, el chat corporativo, la creación, control, seguimiento de proyectos y la gerencia de actividades grupales e individuales; la creación del centro de enseñanza virtual de la institución, como un medio para potenciar el sistema de enseñaza-aprendizaje institucional; así como recopilar, indizar, publicar y recuperar información digital extraída desde Internet o creada por los grupos e individuos miembros de la red.The design of a telematic network capable of connecting all the branches of the institution used as a basis for the implementation of the proposed informatic platform model is exposed. This is used for interconnecting the different social networks being part of the the institution. The created platform allows, individually or in groups, the creation and edition of blogs at corporative level, the corporative chat, the creation, control and follow-up of projects, the management of individual and group activities, the creation of the virtual teaching center of the institution as a means to improve the institutional teaching-learning system, and to gather, index, publish and retreive digital information extracted from internet or created by the individuals and groups members of the network.

  16. Unidos por la red, separados por el Estado. Una lectura sobre la inclusión digital en Colombia

    Patricia Martinez Coral

    2014-12-01

    Full Text Available El presente artículo se propone contribuir al debate teórico sobre la naturaleza institucional de la difusión tecnológica, a la luz de la evidencia encontrada en el desarrollo de las iniciativas de acceso universal a Internet en Colombia, las cuales se enmarcan en la política de telecomunicaciones sociales, vigente desde 1995. Una vez introducidos los fundamentos que orientan la discusión teórica, y su aplicación concreta en el campo de las Tecnologías de la Información y la Comunicación (TIC, se exponen las lecciones más relevantes acerca de los condicionamientos institucionales que se desprenden de la interacción entre Estado y mercado, diseño de intervenciones públicas, y elecciones técnicas, para las oportunidades de acceso a Internet en las zonas rurales del país; en razón de la pertinencia que tiene actualmente la búsqueda de alternativas para viabilizar la vida en el campo, con ocasión de las proyecciones sobre los escenarios de pos-conflicto. Por último se esbozan las conclusiones que permiten desvirtuar algunos paradigmas que revisten las decisiones de acción pública, de las que surge el afianzamiento de la exclusión digital en el país. 

  17. Incorporación de la metodología geoestadística a la vigilancia de la gripe en una red centinela

    Abellán J.J.

    2002-01-01

    Full Text Available Objetivo: Valorar la descripción geoestadística realizada de los datos de gripe recogidos a través de la Red Centinela Sanitaria de la Comunidad Valenciana (RCSCV mediante la utilización del método kriging con la finalidad de evaluar la posibilidad de su incorporación a la vigilancia rutinaria Método: Se han utilizado los datos de vigilancia de gripe de la RCSCV en tres temporadas gripales (1997-1998, 1998-1999 y 1999-2000, construyéndose una matriz de datos de incidencia de gripe geocodificada. La distribución geográfica fue estudiada mediante la técnica geoestadística kriging, que permite estimar la incidencia de la enfermedad en cualquier punto del territorio, a partir de la incidencia observada en unos pocos puntos estratégicamente distribuidos. Se elaboraron mapas de curvas de isoincidencia de gripe para cada semana. La valoración de la técnica se realizó mediante validación cruzada. Resultados: En la mayoría de las semanas, los valores tanto de la desviación estándar (DE reducida, como de la media reducida estuvieron cercanos a los valores considerados óptimos (0 o 1, respectivamente, y sólo en la última temporada se obtuvieron valores de la DE reducida alejados de los considerados como de buen ajuste en 12 de las 20 semanas. La estimación de tasas en todas las temporadas demostró una coherencia en su distribución espacial. También se observó coherencia en la evolución temporal. Conclusiones: En la mayoría de las situaciones los resultados pueden considerarse aceptables, no requiere recursos informáticos extraordinarios ni un empleo de tiempo excesivo, y necesita tan sólo una adaptación anual. Su facilidad de uso lo hace apto para su utilización como una técnica de rutina, pese a que puede mejorarse la precisión de las estimaciones, incrementando la complejidad del modelo.

  18. Pasado, presente y futuro de la epidemiología. Una perspective latinoamericana

    Morabia, Alfredo

    2015-01-01

    Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los “objetos oscuros del deseo” epidemiológico? PMID:25124247

  19. Pasado, presente y futuro de la epidemiología. Una perspective latinoamericana

    Morabia, Alfredo

    2013-01-01

    Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los “objetos oscuros del deseo” epidemiológico?

  20. Pasado, presente y futuro de la epidemiología. una perspectiva latinoamericana

    Alfredo Moravia

    2013-01-01

    RESUMEN Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los "objetos oscuros del deseo" epidemiológico?

  1. Nuevo “rol” y paradigmas del Aprendizaje, en una Sociedad Global en RED y Compleja: la Era del Conocimiento y el Aprendizaje

    Rubio Royo, Enrique

    2009-09-01

    Full Text Available In the current global, networked and complex environment some essential things are changing the field of Knowledge (K. A very important one is the qualitative transformation of the process of creating and sharing “K” (e-Knowledge, which impact is affecting all aspects concerning Knowledge Management and Learning. For that Networked Environment it is required a new methodology, based on the Management of Complexity, using a systemic approach suitable for many different problems. In our case, in the academic world, shipped in the process of adaptation to the European Higher Education Area (EHEA it will be required to develop a new vision and an explicit strategy for Knowledge Management (KM, in order to cope with the new scenario of an emerging knowledge-based economy. On the convergence of emerging professional and academic fields, it is observed not just the similarity among the traditional paradigms of KM and LM, but also the inability of them to assume the requirements which the new Networked Environment demands. A reconceptualization of Knowledge and Learning processes must be accomplished, based on Connections (Networking. They should include the new “role” and new Paradigms of Learning: An Adaptive Learning Model in Complex Environments. As a strategy for personal adaptation, specially to the EHEA, throughout this paper it is proposed a “Digital Identity and Networked Learning process of development”, in addition to the already published model Suricata, based on Open Initiatives – “People and Corporate, Labor and Learning” .En el ámbito de un entorno global, en RED, y Complejo, algo sustancial está cambiando en el ámbito del Conocimiento (K, en particular la transformación cualitativa del proceso de creación y compartición del “K” (e-Conocimiento, cuyo impacto está afectando a todo lo concerniente a la Gestión del Conocimiento y al Aprendizaje. Para dicho entorno en RED, se requiere un nuevo enfoque, basado en la Gestión de la Complejidad, que nos proporciona una adecuada aproximación sistémica, a muchos y diferentes problemas. En nuestro caso, desde el ámbito académico y en el proceso de adaptación al Espacio Europeo de Enseñanza Superior (EEES, se requerirá desarrollar una nueva visión, y estrategia explícita de Gestión del Conocimiento (KM, como adecuación al nuevo entorno y a la incipiente economía del conocimiento asociada. Partiendo de la convergencia emergente de los ámbitos profesional y académico, se observa no sólo la semejanza de los paradigmas tradicionales de la KM y de la LM, sino también la incapacidad de los mismos para asumir los nuevos requerimientos asociados al nuevo entorno en RED. Una nueva reconceptualización del Conocimiento y el Aprendizaje como procesos basados en conexiones (“networking”, nos proporcionará el nuevo “rol” y paradigmas del Aprendizaje: Modelo Adaptativo de Aprendizaje en Entornos Complejos. Como estrategia de adecuación personal al nuevo entorno, y en particular al EEES, se propone un “Proceso de desarrollo de la Identidad Digital” y del “Aprendizaje en RED”, junto con el diseño del correspondiente “Espacio Personal, y Corporativo, de Trabajo y Aprendizaje” (PLWE/CLWE. Presentación del “PLWE-Suricata”*, basado en iniciativas abiertas.

  2. Des-bordes del conurbano: m7red y una arquitectura sociológica de la Cuenca Matanza Riachuelo

    Syd Krochmalny

    2010-07-01

    Full Text Available Este artículo expone algunas formas de pensar lo urbano a través del estudio de trabajos transdisciplinarios cuyo objeto de investigación es la Cuenca Matanza Riachuelo. Se examinan las trayectorias intelectuales de un grupo de arquitectos que producen proyectos híbridos -sociología, arquitectura, arte y urbanismo- deconstruyendo la noción de “espacio social”. Este concepto teórico metodológico analiza los procesos sociales inscriptos en un espacio determinado o la trama significativa de la ciudad. Es una crítica que estructura la investigación a partir de un grupo de variables controlables analíticamente. Este régimen de conocimiento compartimenta la realidad en diferentes atributos de los cuales el social es el explicativo. En lugar de concebir a la sociedad como el contexto “en el que” todo está enmarcado, estos proyectos consideran “lo social” como uno de los muchos elementos de conexión de las asociaciones heterogéneas. Por lo tanto, la Cuenca Matanza Riachuelo está compuesta por un mapa de actores, situaciones, tópicos, recursos en el que se rastrea las trazas que iluminan las conexiones. En ese sentido, la cuenca no es un territorio continuo, es un ensamblaje de redes heterogéneas donde los lugares de conexión son construidos, no están dados, son inestables.

  3. Regionalismo y Seguridad Sudamericana: ¿son relevantes el Mercosur y la Unasur?

    Augusto Wagner Menezes Teixeira

    2010-09-01

    Full Text Available El artículo discute el papel del Mercosur en la construcción de un amplio régimen de seguridad en América del Sur; para lo cual se utiliza, apoyándose en la Escuela de Copenhague, un concepto ampliado y profundizado de seguridad, donde el sector político gana relevancia explicativa. Después de desarrollar la discusión teórica sobre las relaciones entre integración regional y seguridad, se realiza una evaluación sobre cómo el Mercosur y la Unasur avanzan en la construcción de un macro-régimen de seguridad regional. Este análisis nos lleva a sostener que la región todavía no está en vías de constituir una comunidad de seguridad, sin embargo, la creación del Consejo de Seguridad-Unasur alude a un posible avance en la cooperación en asuntos estratégicos, inaugurando un momento nuevo en el regionalismo suramericano. AbstractThis article offers an analysis of Mercosur’s role in the construction of a broad security regime in South America. To that end, based on the Copenhagen School, I use a broadened and deepened concept of security in which the political sector gains explanatory relevance. After developing the theoretical discussion on the relationship between regional integration and security, I evaluate how Mercosur and Unasur proceed in the construction of a macro-regime of regional security. This analysis brings us to maintain that the region is not yet on the way to constructing a security community. However, the creation of the Unasur Security Council suggests possible progress in cooperation on strategic matters, opening the way to a new moment in South American regionalism.

  4. Una sorprendente victoria: Menem y su red de apoyo en las elecciones internas del peronismo de 1988

    Joaquín Baeza Belda

    2010-11-01

    Full Text Available 1989 supuso para Argentina la llegada a la presidencia del justicialista Carlos Menem y el inicio de un sorprendente giro, dados los antecedentes de su partido, hacia políticas neoliberales. Como paso previo, sin embargo, Menem debió vencer en unas elecciones internas en las que partía, en principio, en clara desventaja ante el favorito Antonio Cafiero, gobernador de la provincia de Buenos Aires y líder de la llamada Renovación peronista. La sorprendente victoria de Menem en 1988 ha sido explicada comúnmente como fruto de la reacción de la sociedad a la clase política, en el contexto de crisis que atravesaba el país, o bien como producto de los límites e insuficiencias de la línea cafierista. Sin desconocer estos enfoques, en este texto abordamos el problema desde la perspectiva interna del peronismo y del propio Menem, describiendo su labor de acumulación y reestructuración de los sectores más ortodoxos del partido, apartados por el avance de la Renovación. El estudio de estas elecciones internas sirve así para explorar las continuidades y rupturas de la Argentina que abre un nuevo ciclo en 1989.Palabras clave: Argentina, peronismo, Menem, Renovación, elecciones, 1988___________________________ABSTRACT:1989 marked the arrival to the Argentinian presidency of the PJ Carlos Menem and the beginning of a surprising twist, considering the history of his party, towards neoliberal policies. As a preliminary step, however, Menem had to overcome in a primary election, in which he was disadvantaged compared to the favorite Antonio Cafiero, Governor of Province of Buenos Aires and leader of the so called “Peronist Renovation”. Menem's stunning victory in 1988 has been commonly explained as the result of society's reaction to the political class, in the context of crisis of the country, or as a result of the limits and shortcomings of the Cafiero’s political line. Without ignoring these approaches, in this paper we approach the problem from an internal perspective and also the one of Menem himself, describing his work of accumulation and restructuration of the more orthodox sectors of the party, excluded by the progress of the “Renovation”. The study of these internal elections is good to explore the continuities and ruptures of the Argentina which open itself to a new cycle in 1989.Keywords:Argentina, Peronism, Menem, Renovation, elections, 1988

  5. Cosmografía y astrología en Manila: una red intelectual en el mundo colonial ibérico

    Ana Cecilia Ávalos Flores

    2009-12-01

    Full Text Available The following article will aim at reconstructing an intellectual network of people interested in both astrology and cosmography in seventeenth-century New Spain. This study will trace a particular means of transmission and dissemination of knowledge, namely the exchange of books on astrology, in order to identify a network of astrologers and cosmographers who shared a similar educational background and who had similar motivations to get interested in the so-called occult sciences. By doing so, this research will reflect on the problem of disciplinary boundaries during the early modern-period, and on the question of transmission of knowledge in the Iberian World.//El presente artículo tiene como objeto de estudio dos campos del conocimiento que estuvieron estrechamente relacionados durante el período moderno: la astrología y la cosmografía. Al estudiar algunos casos inquisitoriales contra ciertos cosmógrafos en Filipinas, acusados de practicar astrología juidiciaria, pretende reconstruir una red intelectual de estudiosos que compartían una tradición educativa y perseguían intereses profesionales similares. En su intento por rastrear esta microcomunidad intelectual, el presente estudio subraya la importancia de la transmisión y circulación del conocimiento, tanto a un nivel abstracto como material, no sólo entre el reino español y sus colonias en el Nuevo Mundo, sino también al interior de las colonias mismas.

  6. Diversificación craneofacial e integración evolutiva en poblaciones sudamericanas

    Pérez, Sergio Iván

    2007-01-01

    Full Text Available El estudio de la integración morfológica tiene gran importancia para comprender los patrones y procesos de evolución morfológica. Las poblaciones del sur de Sudamerica representan un interesante caso para el estudio de la integración evolutiva debido a que las mismas han alcanzado una gran diversidad morfológica. El objetivo de esta ponencia es presentar los resultados del análisis de la variación craneofacial y la integración evolutiva en poblaciones humanas de esta región. Se definieron componentes morfogenéticos los cuales fueron descriptos mediante landmarks y semilandmarks. Los patrones de integración entre componentes fueron comparados con modelos basados en información del desarrollo, función y origen embriológico de los componentes, con el fin de estimar la importancia de estos factores en la integración craneofacial. Nuestros resultados muestran que en el nivel intra-poblacional los componentes del esqueleto facial y la calota presentan mayor integración y se encuentran relativamente disociados de los de la base, como es esperado por el tipo de osificación del cráneo. En cambio, la integración en elnivel inter-poblacional difiere de la del nivel intra-poblacional y se ajusta al patrón de crecimiento del cráneo. En conjunto estos resultados muestran que la integración entre componentes es flexible y que diferentes factores pueden modificar el patrón de integración.

  7. Automatizacin del laboratorio de ingeniera electrnica G-204 de la ECI a travs de una red inmtica / Networking automation of ECIs G-204 electronic engineering laboratory

    Hernn, Paz Penagos; Germn Daro, Castellanos Tache; Ronald Ferney, Alarcn Ballesteros; Viviana Lucia, Weiss Velandia; ngela Roco, Laverde Can; Juan Carlos, Rodrguez Caldern; Leonel Andrs, Rincn Fosca.

    2006-12-01

    Full Text Available El aumento de usuarios (estudiantes y profesores) de los laboratorios de ingeniera electrnica de la Escuela Colombiana de Ingeniera JULIO GARAVITO en el ltimo ao ha congestionado el acceso a dichos laboratorios, razn por la cual el Centro de Estudios de Electrnica Aplicada, Grupo de Investiga [...] cin Ecitrnica8 del programa de ingeniera electrnica de la escuela, propuso, dise y desarroll un proyecto de investigacin que aprovecha el tendido de distribucin elctrica del edificio G para ofrecer facilidades de acceso, control de equipos de laboratorio, ahorro de energa y mejoramiento de la calidad de servicio. El sistema de la red inmtica para el laboratorio G-204 estar constituida con los siguientes subsistemas: a. Un control de acceso con una arquitectura cliente - servidor; en este ltimo reposa una base de datos de los usuarios, horarios, equipos y mesas de trabajo; el usuario se conecta desde cualquier computador (cliente) al servidor a travs de Internet para separar el turno de su prctica de laboratorio; en esa operacin selecciona el horario, los equipos, la mesa, el tipo de red que requiere (monofsica o trifsica) y registra a sus compaeros de trabajo. El acceso al laboratorio G-204, en el da y la hora de su prctica, se realiza mediante un lector de tarjetas inteligentes. b. Control de informacin de un aviso publicitario y de un reloj electrnico: desde el servidor se genera y controla el envo de informacin de inters a un aviso publicitario conformado por tres pantallas LCD ubicadas en una de las paredes del segundo piso del edificio G; as mismo, se actualiza continuamente la hora y se informa sobre la temperatura del laboratorio G-204. c. Habilitacin o deshabilitacin de los bancos de trabajo: mediante un control on-off, con mando desde el servidor, se energizan (al inicio de la prctica) o desenergizan (al final de la prctica o ante eventualidades) los bancos de trabajo para proteger los equipos, ahorrar energa y facilitar a los monitores la logstica de supervisin del estado de los equipos, al final de cada prctica. Para la ejecucin del proyecto, el equipo de investigacin se organiz en dos subgrupos de trabajo: lnea de transmisin y subgrupo de "aplicaciones". El grupo de investigacin aplica la tecnologa Power Line Communications PLC y sus investigadores exploran diferentes alternativas de modulacin digital, codificacin y deteccin de errores, acoples, protocolos de transmisin de datos y nuevas aplicaciones; todo esto basado sobre la estimacin del canal (tendido elctrico) como medio de transmisin. Abstract in english Increased use (by students and teachers) of the Escuela Colombiana de Ingeniera Julio Garavito Electronic Engineering laboratories during the last year has congested access to these laboratories; the Schools Electronic Engineering (Ecitronica) programmes applied Electronic studies centre resea [...] rch group thus proposed, designed and developed a research project taking advantage of G buildings electrical distribution to offer access facilities, laboratory equipment control, energy saving and improved service quality. The G-204 laboratorys network system will have an access control subsystem with client-main computer architecture. The latter consists of a user, schedule, group and work-bank database; the user is connected from any computer (client) to the main computer through Internet to reserve his/her turn at laboratory practice by selecting the schedule, group, work-bank, network type required (1? or 3?) and registering co-workers. Access to the G-204 laboratory on the day and time of practice is made by means of an intelligent card reader. Information of public interest produced and controlled by the main computer is displayed on three LCD screens located on one of G buildings second floor walls, as is an electronic clock. The G-204 laboratory temperature and time are continually updated. Work-banks are enabled or disabled by

  8. SISTEMA PORTÁTIL PARA MEDICIÓN Y REGISTRO DE ENERGÍA ELÉCTRICA TOLERANTE A FALLOS EN UNA RED DE DISTRIBUCIÓN MONOFÁSICA

    OMAR ENRIQUE CASTRO HERNÁNDEZ

    2010-01-01

    Full Text Available Se presenta el diseño de un sistema electrónico digital de gran exactitud para la medición y almacenamiento de la energía eléctrica en una carga monofásica bifilar. El sistema posee una alta estabilidad en condiciones ambientales extremas y la tolerancia a fallas en la red eléctrica permitiendo continuar registrando datos durante una eventual falla. El sistema ofrece una gran utilidad en el análisis del consumo y calidad de la energía eléctrica, además de tener un bajo costo de implementación. El sistema diseñado hace parte de uno de los proyectos del grupo de investigación ROBÓTICA APLICADA de la Universidad Tecnológica de Pereira en el aprovechamiento y uso de la energía solar.

  9. La integración sudamericana en los umbrales del siglo XXI

    Alejandro D. Jacobo

    2015-06-01

    Full Text Available En marzo de 2006 el Mercado Común del Sur (MERCOSUR celebró el aniversario número quince de la firma del Tratado de Asunción. En estos quince años, el bloque comercial ha sido exitoso en reducir las barreras arancelarias y no arancelarias, y en incrementar el comercio intra bloque. Además, entre otros logros, ha reducido también las barreras al comercio con países fuera del MERCOSUR y se ha movido hacia una unión aduanera gracias a la negociación e implementación de un gran porcentaje de aranceles externos comunes. A la par de estos avances, el MERCOSUR ha experimentado varios retrocesos. Mientras algunas de estas dificultades son un tanto comunes a cualquier proceso de integración, otras resultan consecuencia directa de las particularidades propias de la región; y también las hay motivadas por fenómenos diferentes producto de la globalización, mencionando en este último caso a la crisis asiática, la devaluación de la moneda brasileña y, más cerca en el tiempo, a la crisis económica de la Argentina. Este trabajo discute algunas de estas cuestiones y se organiza como sigue. La sección 1 comenta el estado actual del MERCOSUR, resaltando algunas características que lo diferencian de otros procesos de integración económica. La sección 2 sintetiza los principales logros en sus quince años de vida; mientras que la sección 3 hace lo propio con las dificultades por las que ha atravesado. Finalmente, la sección 4 ensaya algunas reflexiones que contribuyen a delinear las perspectivas de la integración en Sudamérica en los umbrales de este siglo.Palabras clave: Mercosur, Integración Económica, logros y dificultades de la integración 

  10. Establecimiento de una red de equilibrios biológicos en ecosistemas con presencia de pinsapo (Abies pinsapo Boiss. en Andalucía.

    Navarro Cerrillo, R. M.

    2004-12-01

    Full Text Available In 2001, the Consejería de Medio Ambiente of the Junta de Andalucía established a Monitoring Network on ecosystems of Abies pinsapo Boiss.for evaluating the phytosanitary state in the natural range areas of A. pinsapo in the Iberian Península: Sierra de las Nieves (Málaga, Spain, Sierra de Grazalema (Cadiz, Spain and Los Reales de Sierra Bermeja (Málaga, Spain. This network is based on a 1 x 1 Km grid established throughout the forest stands where Abies pinsapo is present, given by the Mapa Forestal de España (Spanish land cover map, RUIZ DE LA TORRE, 1990. The Network has been constructed from 35 sample plots, which will be visited annually (in summer in order to assess the state of trees. This article describes the network design process and the main results from the first campaign of sampling.

    [fr]
    En mai 2001, la Consejería de Medio Ambiente-Junta de Andalucía a mis sur pied un Réseau pour la surveillance systématique et multitemporelle de l'état de santé et vitalité des forets de Abies pinsapo Boiss. dans ses aires de répartition naturelle dans la Péninsule Ibérique: Sierra de las Nieves (Málaga, Espagne, Sierra de Grazalema (Cádiz, Espagne et Los Reales de Sierra Bermeja (Málaga, Espagne. Cet inventaire a été réalisé à partir d'un réseau d'échantillonnage systématique selon un maillage de 1 x 1 kilomètres couvrant la surface des forêts avec présence de Abies pinsapo, d'après la Mapa Forestal de España (Carte Forestière Espagnole, RUIZ DE LA TORRE, 1990. Après Rétablissement, l'inventaire a été constitué par 35 parcelles d'observation, qui seront visitées annuellement (en été pour évaluer l'état des arbres. Cette note présente le dessin de ce réseau et les résultats de la première campagne de terrain.
    [es]
    En la primavera del año 2001, la Consejería de Medio Ambiente de la Junta de Andalucía estableció una Red de Equilibrios Biológicos en ecosistemas con presencia de Abies pinsapo Boiss. para la prospección sistemática y midtitemporal del estado fitosanitario de los pinsapares dentro de sus tres áreas de distribución natural en la Península Ibérica: Parque Natural Sierra de las Nieves (Málaga, Parque Natural Sierra de Grazalema (Cádiz y Paraje Natural Los Reales de Sierra Bermeja. Esta Red fitosanitaria réponde a una malla de muestreo cuadrada de 1 Km de lado, establecida sobre las masas con presencia de pinsapo dadas por el Mapa Forestal de España (RUIZ DE LA TORRE, 1990. Tras su instalación en el campo, la Red ha quedado constituida por 35 puntos de muestreo permanentes, que serán visitados con una periodicidad anual, en verano, para evaluación del estado de sus pies de A. pinsapo constituyentes. El presente artículo recoge los principios del diseño de la Red, así como los resultados de la primera campaña de muestreo de la misma.

  11. Un proceso de construcción participada del perfil docente en una red de Instituciones de Educación Superior de América Latina

    Pier Giuseppe Ellerani

    2012-08-01

    Full Text Available En este texto se presenta la experiencia realizada por un red de instituciones de educación superior (IUS que operan en seis estados de Sudamérica. Para alcanzar el objetivo de pasar de una docencia centrada en la enseñanza a un estilo docente cuyo compromiso básico es el de propiciar un aprendizaje de calidad en los estudiantes, las universidades han definido un nuevo perfil del docente universitario. Esta acción tiene tres características, que se describen en el texto: la primera se refiere al perfil como el "producto" de una comunidad de pensamiento; la segunda, al "proceso participativo" de trabajo que ha permitido la construcción del perfil con los docentes, el personal administrativo y los referentes de los recursos humanos de cada universidad; la tercera se relaciona con los instrumentos y las tecnologías, utilizadas de manera integrada durante el proceso (el Ambiente Virtual de Aprendizaje Colaborativo basado en el web 2.0, el Human Resource Management, la video investigación, el e- portafolio. El proyecto - desarrollado a través de la R-A - ha tenido como finalidad la de definir una idea compartida de calidad de la enseñanza, de autoevaluación y de monitorear la calidad con planes de mejora continua. La experiencia es un resultado de una de investigación promovida por la Fundación Edulife Onlus. ABSTRACTA participatory process to build the competence profile of teachers in a network of Higher Education Institutions in the Latin America context.This paper presents the experience carried out by a confederation of Higher Education Institution (IUS operating in six states of Latin America. To achieve the goal of new model of teaching and learning based on “learning process” and shift the paradigm of learning as “centered teaching”, the Higher Education Institution have defined a new profile of the university teachers. This action expresses three characteristics presented in this paper: the first refers at the profile as "product" of a Community of Thought; the second refers to "participated process", a working model that allowed the co-construction of the profile with the teachers, the administrative and the human resources staff of the universities; the third  presents the  tools  and  technologies used  in integrated way  (Virtual Collaborative Learning Environment based on Web 2.0, the human resource Management, video-research, e-portfolio.The project - developed by action-research - has defined a shared idea of teaching´ quality, research- based and supported by tools that allow self-assessment of every teachers, to monitor the quality of universities, to develop plans of continuous improvement building a community of learning. There are presented some qualitative and quantitative data of research.

  12. Incorporacin de la metodologa geoestadstica a la vigilancia de la gripe en una red centinela Incorporation of geostatistical methodology for influenza surveillance in a sentinel network

    J.J. Abelln

    2002-08-01

    Full Text Available Objetivo: Valorar la descripcin geoestadstica realizada de los datos de gripe recogidos a travs de la Red Centinela Sanitaria de la Comunidad Valenciana (RCSCV mediante la utilizacin del mtodo kriging con la finalidad de evaluar la posibilidad de su incorporacin a la vigilancia rutinaria Mtodo: Se han utilizado los datos de vigilancia de gripe de la RCSCV en tres temporadas gripales (1997-1998, 1998-1999 y 1999-2000, construyndose una matriz de datos de incidencia de gripe geocodificada. La distribucin geogrfica fue estudiada mediante la tcnica geoestadstica kriging, que permite estimar la incidencia de la enfermedad en cualquier punto del territorio, a partir de la incidencia observada en unos pocos puntos estratgicamente distribuidos. Se elaboraron mapas de curvas de isoincidencia de gripe para cada semana. La valoracin de la tcnica se realiz mediante validacin cruzada. Resultados: En la mayora de las semanas, los valores tanto de la desviacin estndar (DE reducida, como de la media reducida estuvieron cercanos a los valores considerados ptimos (0 o 1, respectivamente, y slo en la ltima temporada se obtuvieron valores de la DE reducida alejados de los considerados como de buen ajuste en 12 de las 20 semanas. La estimacin de tasas en todas las temporadas demostr una coherencia en su distribucin espacial. Tambin se observ coherencia en la evolucin temporal. Conclusiones: En la mayora de las situaciones los resultados pueden considerarse aceptables, no requiere recursos informticos extraordinarios ni un empleo de tiempo excesivo, y necesita tan slo una adaptacin anual. Su facilidad de uso lo hace apto para su utilizacin como una tcnica de rutina, pese a que puede mejorarse la precisin de las estimaciones, incrementando la complejidad del modelo.Objectives: To evaluate geostatistical description of influenza data from the Valencian Sentinel Network (VSN in Spain using the kriging method and to assess the possibility of incorporating this method into routine surveillance. Methods: We use influenza surveillance data on three influenza seasons (1997-1998, 1998-1999 and 1999-2000 from the VSN to construct a geocodified data matrix of the incidence of this disease. The geographic distribution was studied using the kriging method, which enables estimation of the incidence in a few strategically distributed points. Influenza isoincidence maps for each week were plotted. Cross validation was used to evaluate the method. Results: In most of the weeks, the values of reduced standard deviation and reduced mean were close to the optimal values (0 and 1, respectively. Out of range reduced standard deviation values were found in 12 of 20 weeks in the last season only. The estimation of rates in all three seasons showed coherence in spatial distribution and temporal evolution. Conclusions: In most situations the results were acceptable. The method does not requiere extra computer resources or an excessive amount of time and requires only annual adaptation. Becauseit is easy to use, the technique is appropriate for routine use but the accuracy of estimations could be improved by increasing the complexity of the model.

  13. Modelo de deteccin de fraude basado en el descubrimiento simblico de reglas de clasificacin extradas de una red neuronal / Fraud detection model based on the discovery symbolic classification rules extracted from a neural network

    Santamara Ruz, Wilfredy

    2010-01-01

    El presente proyecto presenta un modelo de deteccin de fraude empleando tcnicas de minera de datos tales como redes neuronales y extraccin simblica de reglas de clasificacin a partir de la red neuronal entrenada. La propuesta de este modelo surge del inters de disear y desarrollar una herramienta de deteccin de fraude, con el fin de ayudar a los expertos del negocio a examinar y verificar ms fcilmente los resultados obtenidos para apoyar la toma de decisiones. Se eligen las tcnica...

  14. Una mirada a GIDEON, la red global de epidemiología de las enfermedades infecciosas A look to GIDEON, the global network of the infectious diseases epidemiology

    María del C Hinojosa Álvarez

    2010-08-01

    Full Text Available Se aborda el proyecto GIDEON, la red global de la epidemiología de las enfermedades infecciosas, el cual es una aplicación interactiva de fácil utilización, validada por equipos multidisciplinarios de expertos, que ayuda al profesional de la salud a elaborar y/o rectificar un diagnóstico, a seleccionar el mejor tratamiento, a conocer el desarrollo histórico y la evolución de enfermedades transmisibles y especialmente es muy útil en el proceso docente educativo en los campos de la Medicina, la Clínica, la Salud Pública y la Microbiología. Este proyecto es un buen ejemplo de aplicaciones respaldadas por equipos multidisciplinarios de profesionales e instituciones de alto rigor científico que vienen a paliar los problemas de baja calidad, volumen y dispersión de la información que, sobre temas de salud, existe en Internet.It is an approach of GIDEON, the global network of infectious diseases epidemiology, which is a interactive application of easy use, validated by multidisciplinary expert staff helping to health professional to create and/or to improve a diagnosis, to select the better treatment, to know the historical development and the course of communicable diseases and specially it is very useful in the teaching-educational process in the fields of Medicine, Clinic, Public Health and the Microbiology. This project is a good example of applications supported by multidisciplinary staff of professionals and institutions of high strictness to overcome the problems related to the low quality, the volume and the dissemination of the information on health matters available in Internet.

  15. Vehicular traffic monitoring in V2I systems using a wireless sensor network / Monitoreo de tr fico vehicular en sistemas V2I mediante el uso de una red inalmbrica de sensores

    Mario A, Ramrez Reyna; Mario E, Rivero Angeles; Iclia, Villordo Jimenez.

    2014-06-01

    Full Text Available En un futuro cercano la mayora de los sistemas automotores confiarn fuertemente en el intercambio de informacin entre veh culos o a la infraestructura, para mejorar las condiciones de manejo, incrementar la seguridad o simplemente intercambiar informacin entre los usuarios. Esta es la razn por [...] la cual hoy en da la investigacin y desarrollo de una Red Ad-Hoc Vehicular es muy importante. En este documento se presenta un diseo y anlisis de una Red Ad-Hoc Vehicular (VANET) con la asistencia de una Red Inalmbrica de Sensores (WSN) activada por eventos para el monitoreo de trfico en una autopista. La WSN mencionada est basada en el protocolo LEACH, sin embargo, una modificacin clave es propuesta con el propsito de incrementar el tiempo de vida de la red para aplicaciones sobre VANETs. La idea bsica es reducir al mnimo la superposicin de reas entre grupos vecinos y de esta manera disminuir la redundancia y contar con una mejor cobertura de supervisin en la autopista, con un menor costo de transmisin. Adicionalmente, se proponen dos mtodos diferentes para el reporte de eventos. En el primero, la informacin del tr fico es transmitida exclusivamente entre los nodos en la WSN, mientras que el segundo mtodo hace uso de los vehculos para retransmitir la informacin al concentrador. Los mtodos propuestos son analizados en trminos del consumo de energa y retardo promedio de reporte. Abstract in english In the near future the majority of the automotive systems will strongly rely on the exchange of information among vehicles or infrastructure to improve the driving conditions, increment security or simply have access to internet and entertainment services. This is the reason why the research and dev [...] elopment of Vehicular Ad-Hoc Networks is very important nowadays. In this paper, a design and analysis of a Vehicular Ad-Hoc Network (VANET) assisted by an event driven Wireless Sensor Network (WSN) for traffic monitoring in a highway is presented. The aforementioned WSN is based on the well- known LEACH protocol. However, a key modification is proposed in order to increase the network lifetime for applications on VANETs. The basic idea is to minimize the overlapping areas among neighboring clusters in order to reduce redundancy and to have a better coverage of the supervised highway with a lower transmission cost. Additionally, two different methods for the event reporting are proposed. In the first one, the traffic information is transmitted exclusively among the WSN nodes, while the second method makes use of the vehicles in order to relay the information to the sink. The proposed methods are analyzed in terms of energy consumption and average report delay.

  16. Making the case: an actor-network approach to rhetoric in agricultural development / Construyendo el caso: una aproximacin actor-red a la retrica del desarrollo agrcola

    Middendorf, Gerad.

    2013-07-15

    Full Text Available El presente documento examina los cambios en el lenguaje, asociados con el ascenso y descenso de modelos de desarrollo dominantes. Se apoya en los aportes de Bruno Latour a la retrica, para analizar cmo utilizan el lenguaje, de modo estratgico, los actores en polticas de desarrollo, con el fin d [...] e persuadir otros actores de que sus narrativas de desarrollo son las ms plausibles posible. Este estudio se enfoca en un perodo particular de tiempo (1980 - 1990) en el cual vimos la transicin del modelo neoliberal. Primero, los reportes anuales del Banco Inter-Americano de Desarrollo, as como otros actores son sistemticamente analizados para comprender el cambio en el lenguaje asociado con los modelos de desarrollo. De este modo, el anlisis de datos de entrevistas muestra cmo los actores individuales interpretan y traducen los cambios de polticas en el lenguaje cotidiano. Lo que emerge es un proceso de circulacin en el que el lenguaje del desarrollo es apropiado por actores en redes de polticas y reestructurados para ayudar a cada actor a "llegar al punto", a fin de avanzar en sus intereses. Una fortaleza de la aproximacin de Latour es que nos ayuda a revelar las prcticas discursivas estratgicas de los autores (cientficos, hacedores de polticas, investigadores). El artculo intenta extender el anlisis de actor-red ms all de los estudios cientficos, en donde ha sido desarrollado principalmente, hacia estudios de desarrollo en donde ha recibido, hasta ahora, menor atencin. Abstract in english This paper examines the shifts in language associated with the rise and decline of dominant development models. It draws on Bruno Latour's approach to rhetoric to analyze how actors in development policy networks use language strategically in order to persuade other actors that their development nar [...] rative is the most plausible narrative possible. This study focuses on a particular time period - the 1980s-1990s - in which we saw the transition to the neoliberal model. First, the annual reports of the Inter-American Development Bank and other key actors are systematically analyzed to understand the shift in language associated with development models. Then, analysis of interview data shows how individual actors interpret and translate policy change in everyday language. What emerges is a circulation process, in which development language is appropriated by actors in policy networks and refashioned to help each actor "make the case" in order to advance their interests. A strength of the Latourian approach is that it helps us to reveal the strategic discursive practices of authors (scientists, policy makers, researchers). The paper attempts to extend actor-network analysis beyond science studies, where it has been most fully developed, into development studies where it has thus far received relatively less attention.

  17. PERSPECTIVA DEL ECOTURISMO EN EL ALTIPLANO CUNDIBOYACENSE PARA CONFORMAR UNA RED LOCAL PERSPECTIVE OF ECOTOURISM IN THE CUNDIBOYACENSE HIGHLANDS TO FORM A LOCAL NETWORK

    Jairo Alberto Vsquez Bernal

    2010-06-01

    Full Text Available El desarrollo del turismo a gran escala ha permitido la sub-clasificacin del sector en categoras, tales como el ecoturismo. En Colombia tiene un importante potencial, especialmente, por la existencia de sus innumerables recursos naturales, los que representan atractivos ecotursticos. Siendo el ecoturismo un concepto relativamente nuevo, con frecuencia las actividades desarrolladas no corresponden a lo normatizado o definido y, adems, est asociado con otros trminos, lo hizo necesario indagar y contrastar acerca de lo que realmente significa y la manera de implementarse en los municipios del altiplano Cundiboyacense, en Colombia. Este proceso incluy la revisin bibliogrfica, la identificacin de la poblacin, la seleccin de unidades objetivo del estudio, la comunidad, los turistas, los empresarios y las autoridades municipales y, la aplicacin de un instrumento para la obtencin de datos, del registro y posterior anlisis de los mismos. Esto permiti, por una parte, establecer que los habitantes y los turistas no tienen claro lo que es ecoturismo, por lo cual, se lleg a una definicin, cuyos aspectos fundamentales corresponden a lo que buscan los usuarios, las actividades que realizan, el propsito por la preservacin de los atractivos naturales y los beneficios para las comunidades y, por otra, para la implementacin, se estructur un esquema de redes, entendiendo que las empresas, los turistas, la comunidad, el atractivo natural, las autoridades municipales y ambientales, se interrelacionan por medio de las actividades ecotursticas, creando un sistema complejo de servicios, posibilitando a las organizaciones, que componen la red, el crecimiento y el desarrollo sostenible.Tourism development has allowed large-scale sub-sector classification in categories such as ecotourism. This category has in Colombia a significant potential, especially, because of the existence of innumerable natural resources, representing eco-touristic attractions. Since ecotourism is a relatively new concept, its activities often do not correspond to normed or defined points of view, and is also associated with other terms; therefore it became necessary to investigate and contrast it means and how to be implemented in the municipalities of the altiplano Cundiboyacense in Colombia. This process included a literature review, the identification of the population, the selection of target and study units, community, tourists, businessmen and city officials; besides the application of an instrument for data collection, registration and subsequent data analysis was carried out. This allowed, initially, to establish that residents and tourists do not have a clear concept about what is ecotourism, which had as result the proposal of a definition, based on what potential users look for, the activities they accomplish, the purpose of preserving the natural attractions and the benefits for the involved communities. On the other hand, to implement these aspects, a network scheme was constructed, taking into account, that businesses, tourists, community, natural beauty, municipal and environmental authorities are interrelated through ecotourism activities, developing a complex system of services, enabling the organizations that comprise the network, a sustainable growth and development.

  18. PERSPECTIVA DEL ECOTURISMO EN EL ALTIPLANO CUNDIBOYACENSE PARA CONFORMAR UNA RED LOCAL / PERSPECTIVE OF ECOTOURISM IN THE CUNDIBOYACENSE HIGHLANDS TO FORM A LOCAL NETWORK

    Jairo Alberto, Vsquez Bernal; Adriana, Posada Arrubla; Pedro, Laytn Coy.

    2010-06-01

    Full Text Available El desarrollo del turismo a gran escala ha permitido la sub-clasificacin del sector en categoras, tales como el ecoturismo. En Colombia tiene un importante potencial, especialmente, por la existencia de sus innumerables recursos naturales, los que representan atractivos ecotursticos. Siendo el ec [...] oturismo un concepto relativamente nuevo, con frecuencia las actividades desarrolladas no corresponden a lo normatizado o definido y, adems, est asociado con otros trminos, lo hizo necesario indagar y contrastar acerca de lo que realmente significa y la manera de implementarse en los municipios del altiplano Cundiboyacense, en Colombia. Este proceso incluy la revisin bibliogrfica, la identificacin de la poblacin, la seleccin de unidades objetivo del estudio, la comunidad, los turistas, los empresarios y las autoridades municipales y, la aplicacin de un instrumento para la obtencin de datos, del registro y posterior anlisis de los mismos. Esto permiti, por una parte, establecer que los habitantes y los turistas no tienen claro lo que es ecoturismo, por lo cual, se lleg a una definicin, cuyos aspectos fundamentales corresponden a lo que buscan los usuarios, las actividades que realizan, el propsito por la preservacin de los atractivos naturales y los beneficios para las comunidades y, por otra, para la implementacin, se estructur un esquema de redes, entendiendo que las empresas, los turistas, la comunidad, el atractivo natural, las autoridades municipales y ambientales, se interrelacionan por medio de las actividades ecotursticas, creando un sistema complejo de servicios, posibilitando a las organizaciones, que componen la red, el crecimiento y el desarrollo sostenible. Abstract in english Tourism development has allowed large-scale sub-sector classification in categories such as ecotourism. This category has in Colombia a significant potential, especially, because of the existence of innumerable natural resources, representing eco-touristic attractions. Since ecotourism is a relative [...] ly new concept, its activities often do not correspond to normed or defined points of view, and is also associated with other terms; therefore it became necessary to investigate and contrast it means and how to be implemented in the municipalities of the altiplano Cundiboyacense in Colombia. This process included a literature review, the identification of the population, the selection of target and study units, community, tourists, businessmen and city officials; besides the application of an instrument for data collection, registration and subsequent data analysis was carried out. This allowed, initially, to establish that residents and tourists do not have a clear concept about what is ecotourism, which had as result the proposal of a definition, based on what potential users look for, the activities they accomplish, the purpose of preserving the natural attractions and the benefits for the involved communities. On the other hand, to implement these aspects, a network scheme was constructed, taking into account, that businesses, tourists, community, natural beauty, municipal and environmental authorities are interrelated through ecotourism activities, developing a complex system of services, enabling the organizations that comprise the network, a sustainable growth and development.

  19. La red de bibliotecas de la Universidad de La Habana: camino a una nueva filosofa de trabajo / Universidad de La Havana's (University) Library Network: On The Road to a New Philosophy for Work

    Edgar, Bisset Alvarez; Mara del Carmen, Villardefrancos Alvarez; Silvana Aparecida, Borsetti Gregorio Vidotti.

    2015-08-01

    Full Text Available Se presenta una breve aproximacin a la evolucin de la biblioteca universitaria para un nuevo modelo de biblioteca denominada ''Centro de Recursos para el Aprendizaje y la Investigacin'' (CRAI). Aqu, se presentan los resultados obtenidos en el diagnstico realizado a la Red de Bibliotecas de la U [...] niversidad de La Habana; se propone una serie de lneas estratgicas de trabajo y acciones para transformar esta red en un CRAI y finalmente se propone un modelo de CRAI para la Universidad de La Habana. Abstract in english This paper presents a brief look at the evolution of university libraries and a change to a new library model named ''Learning and Research Resource Center - CRAI (in Spanish, Centro de Recursos para el Aprendizaje y la Investigacin''). Here, the paper shows the results obtained on a diagnosis cond [...] ucted in Universidad de la Havana's library network ( in Spanish, Red de Bibliotecas de la Universidad de La Habana); we propose a series of strategic lines to work and actions to transform this network into a CRAI, and finally, the paper proposes a CRAI model for Universidad de La Habana.

  20. Optimización de una red de distribución con parámetros estocásticos usando la metodología de aproximación por promedios muestrales

    John Willmer Escobar

    2013-01-01

    Full Text Available Este artículo presenta el problema del diseño de una red de distribución de gran escala con parámetros estocásticos. La problemática central radica en la determinación de las decisiones de expansión o contracción de algunos de los eslabones de una red, teniendo en cuenta la variabilidad de la demanda. El problema se ha formulado como un modelo estocástico de dos etapas. Las decisiones de la primera etapa son de tipo estratégico; mientras que las decisiones de la segunda etapa son de tipo táctico. El modelo está basado en el caso de una compañía multinacional de alimentos que abastece a todo el territorio colombiano y varios mercados internacionales, dentro de los que se destacan Venezuela, Ecuador, Chile y algunos países de Centroamérica. La estrategia de solución adoptada es conocida como Sample Average Approximation (SAA. Dicha estrategia usa un esquema de aproximación por promedios muestrales para la solución de problemas estocásticos. Se presentan experimentos computacionales con diferentes tamaños de muestra. Los resultados obtenidos reflejan la importancia y eficiencia de la metodología propuesta como alternativa para el tratamiento de la variabilidad para redes de suministro de gran escala.

  1. Indicadores estructurales y conglomerados de actores en la red social de una subcultura urbana/structural indicators and clusters of actors in the social network of an urban subculture

    Ávila-Toscano, José Hernando; Gutiérrez Vega, Bernard; Pérez Soto, Jhonatan

    2011-01-01

    Este estudio buscó identificar la estructura de socialización de una subcultura urbana con la medición de indicadores estructurales de su red social e identificación de subagrupaciones. Se empleó el instrumento Arizona Social Support Interview Schedule (ISSIS) con 11 miembros de la subcultura roqueros. Se procesaron los datos mediante el análisis de redes sociales (ARS) con el software Ucinet, para detectar conjuntos de actores con el procedimiento de conglomerados jerárquicos; y los gráficos...

  2. Esquema de Difusión de Señalización de Trama para una Red Local Inalámbrica Frame Signaling Broadcast Scheme for a Wireless Local Area Network

    J.A. Abad

    2004-01-01

    Full Text Available Este articulo presenta una propuesta de protocolo de Control de Acceso al Medio (MAC que emplea el esquema de Acceso Múltiple por División de Tiempo, con Duplex en Tiempo (TDMA/TDD, para distribuir el ancho de banda disponible entre los usuarios de una red inalámbrica. Se pone especial atención al proceso de señalización del protocolo, que indica a las terminales remotas la configuración de cada una de las tramas, así como el estado del sistema. Para medir la eficiencia del esquema, se tomaron parámetros como retardo y caudal eficaz. El análisis mostró que para los servicios sensibles al tiempo el retardo para el establecimiento del servicio es pequeño. De los resultados obtenidos se concluye que este protocolo podría ser implementado en una red local inalámbrica proporcionando los mismos compromisos de calidad que los sistemas alambradosThis paper presents a Medium Access Control (MAC protocol proposal, based on a Time Division Multiple Access/Time Division Duplex scheme (TDMA/TDD, to manage the distribution of available bandwidth among wireless network users. Special attention is given to the signalling process of the protocol, that informs the remote terminals about the next frame configuration, as well as the system status. In order to measure the efficiency of the scheme, parameters like delay and throughput were taken. The analysis showed that for time sensitive services the service establishing delay is small. With the results obtained, it is concluded that this protocol could be implemented in a wireless local network, providing the same quality as that of wired systems

  3. Cuidar del mundo. Labor, trabajo y acción «en una compleja red de sostenimiento de la vida»

    Muñoz Terrón, José María

    2012-12-01

    Full Text Available The text proposes a confrontation between Hannah Arendt's phenomenology of vita activa and the ethics of care. On the one hand, it intends to apply Arendtian distinctions between public and private sphere, and between labor, work and action, to the activity of caring, in order to reaffirm its relevance. On the other hand, the article considers the concept of «world» as key to the definition of care and it attempts a critical reinterpretation of Arendt’s concepts, based on some feminists analysis and a responsive and corporeal phenomenology, to raise a nuanced vindication of public implications of caring, according to proposals of passage from ethics to «politics of care».El texto propone una confrontación entre la fenomenología de la vita activa de Hannah Arendt y la ética del cuidado. Se trata, por una parte, de aplicar las distinciones arendtianas entre esferas pública y privada, y entre labor, trabajo y acción, a la actividad de cuidar, para reafirmar su relevancia; por otra parte, tomando el concepto de «mundo» como clave de la definición de cuidado, se ensaya una reinterpretación crítica de los conceptos de Arendt a partir de algunos análisis feministas y de una fenomenología responsiva y del cuerpo, a fin de plantear una reivindicación matizada de las implicaciones públicas del cuidar, en línea con las propuestas de paso de una ética a una «política del cuidado».

  4. NOVEDADES SUDAMERICANAS EN ACAULIMALVA Y GAYA (MALVACEAEMALVEAE South American novelties in Acaulimalva and Gaya (Malvaceae-Malveae

    Antonio Krapovickas

    2010-08-01

    Full Text Available

    Se describe una especie nueva de Acaulimalva de Per: A. glandulifera, tres especies nuevas
    de Gaya de Bolivia, G. Cardenasii, G. pilocarpa y G. Woodii, y una de Argentina, G. purpurea.
    Gaya albiflora se cita por primera vez para Argentina
    One new species of Acaulimalva from Per: A. glandulifera, three new species of Gaya from
    Bolivia: G. Cardenasii, G. pilocarpa and G. Woodii, and one from Argentina: G. purpurea, are
    described. Gaya albiflora is reported for the first time for Argentina

  5. Entrenamiento de una red neuronal multicapa para la tasa de cambio euro - dlar (EUR/USD) / Training a multilayer neural network for the Euro-dollar (EUR/USD) exchange rate

    Jaime Alberto, Villamil Torres; Jess Alberto, Delgado Rivera.

    2007-12-01

    Full Text Available Tanto para los inversionistas como para las autoridades econmicas es necesario que se desarrolle una herramienta matemtica que logre dar cuenta de la direccin de una variable como el tipo de cambio (el precio relativo entre dos monedas). Muchos de los mecanismos usados actualmente estn basados e [...] n el uso de tcnicas estadsticas, en particular series de tiempo lineales. Las redes neuronales artificiales (RNA) son modelos matemticos que pretenden emular el funcionamiento del cerebro humano, su aplicacin en economa e ingeniera surge a finales de los aos ochenta con buenos resultados. Las RNA se presentan como una alternativa para simular el comportamiento de variables financieras que, por lo general, tienden a parecerse a un paseo aleatorio. En este trabajo se muestran los resultados del entrenamiento de una red neuronal para negociacin de la tasa de cambio EUR/USD y las bondades del algoritmo de entrenamiento chemotaxis, que permite entrenar redes que maximicen una funcin objetivo que relacione aciertos en la prediccin con las ganancias de un trader. Abstract in english A mathematical tool or model for predicting how an economic variable like the exchange rate (relative price between two currencies) will respond is a very important need for investors and policy-makers. Most current techniques are based on statistics, particularly linear time series theory. Artifici [...] al neural networks (ANNs) are mathematical models which try to emulate biological neural networks parallelism and nonlinearity; these models have been successfully applied in Economics and Engineering since the 1980s. ANNs appear to be an alternative for modelling the behaviour of financial variables which resemble (as first approximation) a random walk. This paper reports the results of using ANNs for Euro/USD exchange rate trading and the usefulness of the algorithm for chemotaxis leading to training networks thereby maximising an objective function re predicting a traders profits. JEL: F310, C450.

  6. La red perinatal del sur-oriente D.C. una estrategia para mejorar la atención de la madre y el niño

    Monterrosa Esperanza de

    1996-06-01

    Full Text Available Con el objeto de argumentar el tema y a la vez justificar la creación de la red perinatal en el sur-oriente de Santafé de Bogotá, es necesario acudir a indicadores que describan así sea de manera general la situación materno infantil, en el contexto nacional y específicamente en el distrito capital.

  7. DISEÑO DE UNA RED DE TELEVIGILANCIA INALÁMBRICA PARA LOS EQUIPOS QUE CONFORMAN EL, SISTEMA DE AYUDAS A LA NAVEGACIÓN AÉREA EN EL AEROPUERTO PALONEGRO DE BUCARAMANGA

    Herly Johanna Herrera Lizcano

    2006-04-01

    Full Text Available RESUMEN Este trabajo surge de la necesidad de monitorizar en tiempo real los equipos de ayudas a la navegación aérea en el Aeropuerto Palonegro de Bucaramanga, para mantener un control constante de cada uno de ellos. Ante esta problemática, este artículo se concentra en la Televigilancia, la cual es un servicio de tiempo real que proporciona una gran variedad de posibles aplicaciones combinando la interactividad y la multimedia. El término Televigilancia se define como un conjunto de sistemas que permiten la supervisión y el control desde una central de monitoreo, de una o varias instalaciones técnicamente aisladas o distribuidas geográficamente. Para incorporar este servicio en el Aeropuerto Palonegro de Bucaramanga se realizó un estudio previo de la infraestructura física y tecnológica y sus capacidades, se analizó el entorno de trabajo y las tecnologías de transmisión. En este artículo se describe el diseño de la red inalámbrica de televigilancia, indicando claramente los pasos a seguir por la Aerocivil, para instalar este servicio aprovechando la infraestructura actual y permitiendo, al mismo tiempo, una proyección a futuro. Igualmente se sientan las bases para determinar los elementos y parámetros de red necesarios para definir estrategias a la hora de implementar este servicio. ABSTRACT This work arises of the necessity of monitoring in real time the teams of helps to the air sailing in the Airport Palonegro of Bucaramanga, to maintain a constant control of each one of them. Befare this problem the article concentrates since on the Televigilancia it is a service of real time that provides a great variety of possible applications that they combine the interactive and the multimedia services. The term Televigilancia is defined as a group of systems that they allow the supervision and the control from a monitoring power station, of a several technically isolated facilities or distributed geographically. To incorporate this service in the Airport Palonegro of Bucaramanga it was carried out a previous study of the physical and technological infrastructure and their capacities, it was analyzed the work environment and the transmission technologies. This article described the design and the bases to determine the elements and necessary net parameters to define strategies when implementing the service of Televigilancia taking advantage ofthe current infrastructure and allowing, at the same time, a projection to future. This design indicated the steps c1early to continue for the Aerocivil, to install this service.

  8. Evaluación de prestaciones de una red híbrida vehicular y de sensores para mejorar la seguridad vial

    Tripp Barba, Carolina; Ornelas, Karen; Díaz Delgado, Guillermo; Aguilar Igartua, Mónica

    2010-01-01

    En los últimos años las redes inalámbricas se han convertido en una tecnología de comunicación ampliamente difundida así como en un reto en cuanto a investigación se refiere. Se han presentado muchas contribuciones sobre redes ad hoc, tales como redes inalámbricas de sensores (WSN, Wireless Sensor Networks) y redes vehiculares (VANET, Vehicular Ad hoc Networks). Recientemente, la cantidad de coches que transitan en nuestras calles, carreteras y autopistas ha ido en aumento, dando pie a un gra...

  9. Reconstrucción de objetos de forma libre a partir de imágenes de rango empleando una red de parches nurbs

    Branch Bedoya, John Willian

    2007-01-01

    Resumen: La reconstrucción 3-D es el proceso mediante el cual, objetos reales, son reproducidos en la memoria de un computador, manteniendo sus características físicas (dimensiones, volumen y forma). El problema de la representación y reconstrucción de formas tridimensionales ha recibido un enorme atención en investigaciones de visión en la última década. El interés surge debido a que la teoría de forma tiene aplicaciones en una amplia variedad de campos, a saber: diseño geométrico asist...

  10. GeoSteamNet: A computer code to simulate geothermal steam flow in a pipeline network; GeoSteamNet: Programa de computo para simular el flujo de vapor geotermico de una red de vaporductos

    Verma P., Mahendra; Aragon A., Alfonso [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)]. E-mail: mahendra@iie.org.mx; Ruiz L., Alejando; Mendoza C., Alfredo [Comision Federal de Electricidad, Campo Geotermico Los Azufres, Campamento Agua Fria, Michoacan (Mexico)

    2011-07-15

    A computer package, GeoSteamNet, was developed to simulate steam transport in a pipeline network of a geothermal field. The fluid motion is governed by the following basic principles: conservation of mass, linear momentum principle (Newton's second law or the Navier Stokes equations), and the first and second laws of thermodynamics. The second law of thermodynamics defines the direction of a spontaneous process, which is indirectly validated in the algorithm as vapor flows from high-to-low pressure, and heat flows from high-to-low temperatures. The nonlinear equations are solved with the Newton-Raphson method. Using the ActiveX component OrificeMeter, the steam-flow balance was calculated for power plants U-15 and U-16 in Los Azufres Geothermal Field, Mich., in February 2009. U-15 was fed by the production wells AZ-04, AZ-28, AZ-30, AZ-65D, and AZ-66, whereas wells AZ-28A, AZ-45, AZ-56, AZ-67, AZ-69D were connected to U-16. The analytical error is within {+-}4%, which is acceptable for practical purposes for steam-supply management, considering the uncertainties in parameters, such as pressure, temperature, pressure fluctuation at the wellhead, etc. The steam simulation results by GeoSteamNet for a hypothetical-pipeline network in a geothermal system with two production wells and a power plant illustrate its functionality. Several points need to be emphasized. For a specific geometry-pipeline network, there is only a certain amount of mass (vapor) that can be transported at a given pressure at the wellheads and the power plant. The construction and modification of a pipeline network is very expensive and the production of geothermal wells depends on many natural factors; therefore, there is need to conduct a tolerance study for each component of the network. A simulation study of the virtual-pipeline network for the design of a geothermal power plant can save money, effort, and time. [Spanish] Se desarrollo un paquete de computo, GeoSteamNet, para simular el transporte del flujo de vapor en una red de vaporductos de un campo geotermico. El movimiento del fluido se rige por los siguientes principios basicos: la conservacion de la masa, el principio de movimiento lineal (segunda ley de Newton o las ecuaciones de Navier Stokes) y la primera y segunda leyes de la termodinamica. La segunda ley de la termodinamica permite definir la direccion de un proceso espontaneo, que esta indirectamente validado en el algoritmo, debido a que el vapor fluye de alta a baja presion y el calor fluye de alta a baja temperatura. Las ecuaciones no lineales se resuelven con el metodo de Newton-Raphson. Utilizando el componente ActiveX OrificeMeter, se realizo el balance de masa para el flujo de vapor en las unidades de generacion U-15 y U-16 del campo geotermico de Los Azufres, Mich., en febrero de 2009. La U-15 fue alimentada por los pozos productores AZ-04, Z-28, Z-30, AZ-65D, y AZ-66, mientras que los pozos AZ-28A, AZ-45, Z-56, Z-67 y AZ- 69D estaban conectados a la U-16. La diferencia entre la cantidad de vapor recibida en las unidades y producida por los pozos respectivos esta dentro de {+-}4%, lo cual es aceptable para fines practicos para el suministro de vapor, tomando en cuenta las incertidumbres en varios parametros tales como la presion, la temperatura, la fluctuacion de la presion en el cabezal del pozo, entre otros. Los resultados de la simulacion de una red hipotetica de vaporductos de un sistema geotermico con dos pozos productores y una planta de generacion de energia electrica ilustran la funcionalidad de GeoSteamNet, mostrando varios puntos importantes a destacar. Para una geometria especifica de las redes de vaporductos solo hay una cierta cantidad de masa (vapor) que puede ser transportado a una presion dada de los pozos y de la planta generadora. La construccion y modificacion de una red de vaporductos son muy costosas y la produccion de pozos geotermicos responde a los factores de su naturaleza, por lo tanto, hay necesidad de realizar un estudio de tolerancia de cada componente de la red. Un estudio de simulacion de la red de tuberias virtuales durante el diseno de la planta energia geotermica puede ahorrar dinero, esfuerzo y tiempo.

  11. Desarrollo y síntesis de una red de área local de datos dedicada para tele- medición

    Fernando Murillo

    2011-05-01

    Full Text Available En el siguiente trabajo se confirma la viabilidad del uso de los circuitos seleccionados, como canal eléctrico de telecomunicaciones, mediante pruebas de campo: análisis espectral de la respuesta del medio con señales de RF acopladas de forma electromagnética en los conductores eléctricos de los circuitos de potencia y cubriendo el espectro de utilización (2 - 34 MHz. Se presentan los resultados de las pruebas de transporte de datos con un sistema de gestión portátil a fin de verificar la interconexión de los dispositivos de red mediante chequeo de los parámetros de red de datos: velocidad alcanzada por el canal eléctrico de telecomunicaciones, respuesta al comando PING, eficiencia del canal: bit por Hz, relación de señal a ruido (SNR. Finalmente se presenta la topología de red sugerida para el transporte de la tele-medición de datos de contadores de energía de las subestaciones de Distribución previamente mencionadas hasta los centros de procesamiento de datos del cliente interno.  The viability of the use of the circuits selected is confirmed, as electric channel of telecommunications by means of field trials: espectral analysis of the answer of the media to RF ( radio frequency signals electromagnetically coupled in the electric conductors of power circuits and covering the spectrum of utilization (2 - 34 MHz. The results of the data transportation simulation tests made with a portable management system are presented in order to verify the interconnection of the devices of network by means of checking network parameters data: Velocity reached by the electric telecommunications channel, answer to the PING command, the channel efficiency: Bit per Hz, Signal to Noise relation (SNR. Finally the topology of network suggested for the energy meter data transportation from Distribution Sub-Stations to the data processing centers ( internal clients is presented.

  12. ADAPTACIÓN DEL ALGORITMO GENÉTICO PARA LA CREACIÓN DE ÁRBOLES DE ENRUTAMIENTO EN UNA RED DE SENSORES INALÁMBRICA

    Ángela María Rodríguez-Vivas

    2013-07-01

    Full Text Available Las redes de sensores inalámbricas usadas para monitorear cultivos en países en vía de desarrollo tienen características particulares como: el despliegue de nodos sensores es escaso, los recorridos de los paquetes de datos son extensos, y su ciclo de vida debe alcanzar por lo menos seis meses. Teniendo en cuenta que estas redes tienen capacidades limitadas (en términos de procesamiento, memoria, etc. y que el principal consumidor de potencia en los nodos es el módulo de radiofrecuencia, el requerimiento de los seis meses de longevidad se convierte en un objetivo de diseño. En este artículo se propone una técnica de enrutamiento que tiene en cuenta los parámetros que afectan la transmisión de datos en una WSN desplegada en un campo de cultivo, adaptando con base en ellos el algoritmo genético. Para esto se comparan, en términos de tiempo de ejecución, dos métodos de selección del algoritmo.

  13. Pensar la ciudad en red

    Fábio Duarte

    2006-01-01

    Full Text Available El paradigma de la sociedad contemporánea es la red, como afirma Manuel Castells (1999 cuándo propone este concepto para que se piense el mundo frente a las tecnologías de información y comunicación. ¿Más como pensar la ciudad en red? Cuándo vemos una imagen aérea de una ciudad, con sus rutas que articulan puntos y regiones, tenemos una imagen perfecta de una red. Pero la evidencia absoluta entre la forma geométrica de una red no puede nos dejar iludirnos: esto no presupone el entendimiento de la sociedad urbana como red. El matemático Nikos Salingaros (2003 argumentó que “las fuerzas que hacen que la ciudad funcione son generadas por la diversidad y necesidad de cambio de información entre diferentes tipos de nodos”, y Gabriel Dupuy (1985 escribió que “si buscamos localizar partes de un sistema, debemos hacerlo en espacios abstractos, espacios topológicos, espacios de n dimensiones, inhabituales en el planeamiento y que no corresponden a la percepción inmediata de la ‘redes clásicas’. Así, las redes son, más que nada, una manera de pensar. Una manera de leer el mundo, una manera de actuar en el mundo.

  14. El concepto de mediación tecnológica en Bruno Latour : una aproximación a la Teoría del Actor Red.

    Gonzalo Matías Correa-Moreira.

    2012-05-01

    Full Text Available La Teoría de Actor Red (TAR se constituye en un valioso repertorio de herramientas conceptuales y metodológicas para el estudio de los fenómenos de características socio-técnicas. En el presente artículo se presenta la noción de mediación tecnológica elaborada por Bruno Latour en tanto uno de los principales elementos de esta teoría. A la vez se explica la emergencia de la TAR en los estudios sociales sobre ciencia y tecnología y se concluye en su aplicabilidad sobre fenómenos complejos de reformas y participación ciudadana que involucran a actores humanos y no humanos.

  15. LA RED PATRE-MANES: UNA EXPERIENCIA DE INTEGRACIÓN DE BASES DE DATOS Y BIBLIOTECAS VIRTUALES DE MANUALES ESCOLARES EUROPEOS Y LATINOAMERICANOS

    GABRIELA OSSENBACH

    2005-09-01

    Full Text Available Este artículo reseña el desarrollo y avances que ha tenido en los últimos años el ProyectoAlfa Patre-Manes, el cual tiene como objetivo censar, catalogar y digitalizar los manualesescolares más representativos de cada uno de los países miembros de la red.PALABRAS CLAVES:Programa Alfa, Manuales escolares, Proyecto Manes, Base de datos, biblioteca virtualABSTRACTThis article describes the development and progress of Patre-Manes project in thisrecent years to classify, catalog and digitalize the most representative textbooks in eachcountry concerning this project.KEY WORDS:Alpha program, textbooks, Project Manes, database, virtual librarry

  16. Simulacin del proceso de biodegradacin de aguas residuales de la industria de carne mediante una red neuronal artificial perceptrn multicapa / Simulation of biodegradation process of wastewater from meat industry by means of a multilayer perceptron artificial neural network

    Jos C, Crvelo Santana; Sidnei A, de Arajo; Joana P, M. Biazus; Roberto R, de Souza.

    2015-04-01

    Full Text Available En este trabajo se propone utilizar una Red Neuronal Artificial (RNA) Perceptrn Multicapa (PMC) para simular la variacin de la concentracin de protena de acuerdo con el tiempo y tambin para determinar la hora final del procedimiento, adems de los parmetros ptimos del proceso de biodegradaci [...] n de las protenas de un efluente de matadero. Para eso, han sido utilizadas las papanas, presentes en el ltex de la papaya (Carica papaya) con el objetivo de disminuir la concentracin de protenas de un efluente de matadero a pH (5 y 7) con una temperatura de (25 y 30 C) controlada. Los resultados mostraron que las papanas redujeron de 82% a 91% la concentracin de protena en 30 y 40 h de proceso. Las simulaciones con la RNA apuntaron que las condiciones perfectas fueron obtenidas a pH 5, con 30 C y en 35 h, en el cual se ha alcanzado una reduccin de 91% de la concentracin de protenas. Abstract in english In this paper, the use of a multilayer perceptron (MLP) artificial neural network (ANN) is proposed to simulate the variation of protein concentration according to the time and also to determine the end and optimal conditions of the biodegradation process of wastewater from meat industry. To reduce [...] the protein concentration, papains from Carica papaya latex have been used at controlled condition of pH (5 and 7) and temperature (25 and 30 C). Results showed that a reduction of 82 to 91% of protein concentration by the action of papains for 30 to 40 h of process time. Simulations showed that the best condition of the process occurred at pH 5, 30 C and 35 h, in which a maximum biodegradation of 91% was obtained.

  17. Red de sensores inalámbricos para el monitoreo de alertas tempranas en minas subterráneas: una solución a la problemática de atmósferas explosivas en la minería de carbón en Colombia

    Álvaro Romero Acero; Alejandro Marín Cano; Jovani Alberto Jiménez Builes

    2013-01-01

    En este artículo se presenta una alternativa de automatización y control en el monitoreo de alertas tempranas de atmosferas explosivas, mediante el protocolo ZigBee. El propósito es diseñar una red de sensores ina- lámbricos inteligentes para recopilar la información, de forma rápida y confiable, sobre las concentraciones de gases que generan una amenaza de atmósferas explosivas en minas subterráneas. De forma remota se pueden determinar los límites de alerta de acuerdo a los datos suministra...

  18. ESTUDIO Y CONFIGURACIN DE CALIDAD DE SERVICIO PARA PROTOCOLOS IPV4 E IPV6 EN UNA RED DE FIBRA PTICA WDM

    Sebastin Andrs, lvarez Moraga; Agustn Jos, Gonzlez Valenzuela.

    2005-12-01

    Full Text Available En el presente escrito se aborda el tema de Calidad de Servicio para redes IP en las versiones 4 y 6, presentando una gama de herramientas existentes desarrolladas principalmente por Cisco, para los equipos Cisco Catalyst 3550 y Cisco Catalyst 2651. Se resumen las caractersticas de cada mecanismo e [...] studiado y se presentan resultados obtenidos en la utilizacin de stos al momento de otorgar diferenciacin a trficos sensibles a parmetros presentes en las redes IP, tales como el ancho de banda y retardos de propagacin. Abstract in english This work presents the subject of Quality of Service for IP networks in versions 4 and 6. It presents a range of existing tools, developed mainly by Cisco, for the Cisco Catalyst 3550 and Cisco Catalyst 2651 devices. We summarize the characteristics of each studied mechanism, and the experimental re [...] sults obtained in the use of these at the time of granting differentiation to traffics sensible to existing IP networks parameters, such as bandwidth and the propagation delays.

  19. ESTUDIO Y CONFIGURACIÓN DE CALIDAD DE SERVICIO PARA PROTOCOLOS IPV4 E IPV6 EN UNA RED DE FIBRA ÓPTICA WDM

    Sebastián Andrés Álvarez Moraga

    2005-12-01

    Full Text Available En el presente escrito se aborda el tema de Calidad de Servicio para redes IP en las versiones 4 y 6, presentando una gama de herramientas existentes desarrolladas principalmente por Cisco, para los equipos Cisco Catalyst 3550 y Cisco Catalyst 2651. Se resumen las características de cada mecanismo estudiado y se presentan resultados obtenidos en la utilización de éstos al momento de otorgar diferenciación a tráficos sensibles a parámetros presentes en las redes IP, tales como el ancho de banda y retardos de propagación.This work presents the subject of Quality of Service for IP networks in versions 4 and 6. It presents a range of existing tools, developed mainly by Cisco, for the Cisco Catalyst 3550 and Cisco Catalyst 2651 devices. We summarize the characteristics of each studied mechanism, and the experimental results obtained in the use of these at the time of granting differentiation to traffics sensible to existing IP networks parameters, such as bandwidth and the propagation delays.

  20. Resultados de la vigilancia de susceptibilidad antimicrobiana en Chile: Consolidando una red Results of antimicrobial susceptibility surveillance in Chile: Consolidating a network

    Francisco Silva O

    2011-02-01

    Full Text Available La resistencia antimicrobiana es un problema de salud pblica en aumento. La generacin de redes de vigilancia es una necesidad para la correcta comprensin y seguimiento de este fenmeno, adems de ayudar a orientar las medidas para el control de su aparicin y diseminacin. En Chile, desde el ao 2007 se constituy un grupo colaborativo de resistencia antimicrobiana de centros de salud de varias regiones, que ha generado informacin respecto a la frecuencia de resistencia antimicrobiana de distintas especies bacterianas. En este artculo se presentan los resultados de la vigilancia del ao 2009, con nfasis en su interpretacin, limitaciones y perspectivas a futuro.Antimicrobial resistance is an increasing public health issue. Creation of surveillance networks is a matter of major importance for antimicrobial resistance understanding and monitoring. Also, they contribute to design actions for controlling its appearance and dissemination. In 2007 a colaborative group in antimicrobial resistance was formed, representing several health institutions across the country. In this paper we report the results of 2009 surveillance with emphasis in its interpretation, limitations and future perspectives.

  1. INDICADORES ESTRUCTURALES Y CONGLOMERADOS DE ACTORES EN LA RED SOCIAL DE UNA SUBCULTURA URBANA/STRUCTURAL INDICATORS AND CLUSTERS OF ACTORS IN THE SOCIAL NETWORK OF AN URBAN SUBCULTURE/ INDICADORES ESTRUTURAIS E CONGLOMERADOS DE ATORES NA REDE SOCIAL DE UMA SUBCULTURA URBANA

    Jos Hernando vila-Toscano

    2011-12-01

    Full Text Available Este estudio busc identificar la estructura de socializacin de una subcultura urbana con la medicin de indicadores estructurales de su red social e identificacin de subagrupaciones. Se emple el instrumento Arizona Social Support Interview Schedule (ISSIS con 11 miembros de la subcultura roqueros. Se procesaron los datos mediante el anlisis de redes sociales (ARS con el software Ucinet, para detectar conjuntos de actores con el procedimiento de conglomerados jerrquicos; y los grficos de la red se crearon con NetDraw. Se identificaron niveles moderados de indicadores estructurales y las agrupaciones presentaron un nmero amplio de actores segn el criterio de atraccin por similaridad. Los subgrupos en la red fueron escasos, lo que muestra a la subcultura como una unidad social cuya integracin se da por vinculaciones estrechas entre sus miembros.

  2. Transferencia de sedimentos de una microcuenca a la red de drenaje urbano / Sediment Transfer from a Microbasin to an Urban Drainage Network

    Guillermo Jos, Mndez; Carlos Alberto, Depettris; Jorge Vctor, Pilar; Oscar, Orfeo; Alejandro Ricardo, Ruberto.

    2014-10-01

    Full Text Available Los datos referentes a las tasas de generacin y movilizacin de sedimentos en reas urbanas son exiguos. Esto se debe a la complejidad del fenmeno y, especialmente, a su variabilidad. En este artculo se abordan tres aspectos: (1) la tasa anual de sedimento que genera una microcuenca durante tres [...] aos; (2) qu precipitaciones provocan mayores valores, y (3) cmo afectan las condiciones hidrolgicas antecedentes de la cuenca en la carga de lavado de la escorrenta. Se monitore un microcuenca de la ciudad de Resistencia, Chaco, Argentina, de 4.76 ha y uso residencial, desde septiembre de 2009 hasta marzo de 2010. Se calibr un modelo hidrolgico bajo el programa SWMM 5.0 y se trazaron curvas claves de sedimentos. Con esto y con las precipitaciones diarias de los aos 2007/08; 2008/09 y 2009/10 se pudo obtener la carga anual de sedimentos trasportados por la escorrenta urbana durante el periodo de anlisis. Las cargas anuales de sedimentos transportadas oscilaron entre 0.8 y 1.40 t/ha. Los mayores valores se registraron en el periodo de septiembre a diciembre de cada ao, en el que se transporta el 60% del total anual. Se concluye que existe una fuerte incidencia de los volmenes de escurrimiento en las cargas de sedimentos, donde las reas ms impermeables son capaces de generar importantes caudales lquidos y, por tanto, mayores cargas de sedimentos que las zonas permeables. Los resultados obtenidos fueron coherentes con las mediciones, por tanto es factible cuantificar el aporte de sedimentos de cuencas urbanas al drenaje pluvial. Abstract in english Little data exists on sediment generation and transport rates in urban areas. This is due to the complexity of the phenomenon and, in particular, its variability. Three factors are investigated in this article: (1) annual sediment rate generated in a micro-basin over three years, (2) determination o [...] f the precipitations resulting in the highest values and (3) how prior hydrological conditions in the basin affect the sediment load in runoff. A basin in the city of Resistencia, in Chaco, Argentina, was monitored (4.76 ha with residential use) from September 2009 to March 2010. A hydrological model was calibrated with the SWMM program 5.0 and the primary sediment curves were drawn. With this and daily precipitation data for the years 2007/2008, 2008/2009 and 2009/2010 the annual sediment load transported by urban runoff was obtained for the analysis period. These ranged from 0.8 to 1.40 t/ha. The highest values documented occurred from September to December of each year, during which 60% of the load was trasnported. It is concluded that there is a strong incidence of volume runoff of sediment loads, where the most impermeable areas generate large flows and, therefore, higher sediment loads than permeable areas. The results obtained were consistent with the measurements and, therefore, quantification of sediments in pluvial drainage in urban basins is feasible.

  3. Un estudio socioepistemolgico de lo logartmico: la construccin de una red de modelos / A socioepistemological study of logarithms: the construction of a network of models

    Marcela, Ferrari; Rosa Mara, Farfn.

    Full Text Available Do ponto de vista socioepistemolgico, a rede de prticas sociais e de representaes que as mesmas geram, estabelecem um dilogo distinto do discurso escolar vigente. Neste artigo, reflectiremos sobre os argumentos que os alunos da licenciatura em matemtica utilizaram, perante a construo geomtr [...] ica das funes quadrtica e logartmica utilizando o ambiente de geometria dinmica, para reconhecer e descrever as funes mencionadas. Este trabalho desenvolveu-se utilizando a engenharia didctica como metodologia de investigao, portanto inclumos algumas reflexes a partir do discurso matemtico escolar, da epistemologia da funo logaritmo e um breve estado da arte destas noes. Abstract in spanish Desde una visin socioepistemolgica, el entramado de prcticas sociales y representaciones sociales que las mismas generan, establecen un dilogo diferente al discurso escolar imperante. En este reporte, reflexionaremos sobre los argumentos que los alumnos de licenciatura en matemticas utilizaron, [...] ante la construccin geomtrica de las funciones cuadrtica y logartmica utilizando el ambiente de geometra dinmica, para reconocer y describir las funciones mencionadas. Este trabajo se ha desarrollado utilizando la ingeniera didctica como metodologa de investigacin por tanto incluimos algunas reflexiones desde el discurso matemtico escolar, desde la epistemologa de la funcin logaritmo y un breve estado de arte de estas nociones. Abstract in english From a socioepistomological view, the intertwined social practices and self-generated social representations, establish a dialog different from the prevailing school discourse. In this report, we reflect about mathematics majors' argumentations about the geometric construction of the quadratic and l [...] ogarithm functions using a geometric dynamic system. This work has been developed using the engineering didactic as a research method hence we include some reflections from the mathematical school discourse, from the epistemology of the logarithm function, and a brief state of the art about these notions.

  4. Anlisis de una Red de Cooperacin de PyMEs en Misiones, Argentina: Beneficios y Carencias para el Desarrollo Local Sostenible / Analysis of a Network of Cooperation in Misiones, Argentina: Benefits and Lacks for Local Sustainable Development

    Juan Carlos, Michalus; Gilberto, Hernndez Prez.

    2012-06-01

    Full Text Available Se presenta un estudio de caso de una red de cooperacin existente en la provincia de Misiones, Argentina, integrada por una Pequea y Mediana Empresa (PyME) elaboradora de t negro y un grupo de PyMEs de aserrado de madera, constituida a partir de la iniciativa particular del empresario tealero. El [...] objetivo es identificar los beneficios del trabajo en cooperacin y a su vez, poner en evidencia las carencias que existen cuando estos procesos no se realizan de manera planificada y orientada al desarrollo local sostenible. El estudio de caso que se expone constituye un caso nico, contemporneo; con relevamiento de datos en los establecimientos pertenecientes a la red de cooperacin, entrevistas a empresarios y encargados de produccin, que permitieron constatar los beneficios de la cooperacin, entre los que figuran: aprovechamiento de residuos, generacin de lazos de confianza entre empresarios y contribucin al cuidado del medio ambiente. Tambin se constataron las principales deficiencias que impiden la obtencin de beneficios mayores, derivados de la carencia de un instrumental metodolgico adecuado para implementar este tipo de emprendimientos cooperativos, entre los que se destaca: escaso aprovechamiento de recursos ociosos, ausencia de mejoras en procesos mediante innovaciones conjuntas, falta de participacin de actores fundamentales y de orientacin sistemtica hacia el desarrollo local sostenible. Abstract in english We present a case study of a network of existing cooperation in the province of Misiones, Argentina, composed of Small and Medium Enterprises (SMEs) Elaboration of black tea and a group of SMEs from sawn wood, formed from the particular initiative of the tea entrepreneur. The aim is to identify the [...] benefits of working in cooperation and, in turn, highlight the lacks when these processes are not performed in a planned and sustainable local oriented development. The case study that is exposed is a unique, contemporary data survey with establishments belonging to the cooperative network, interviews with entrepreneurs and managers of production, which led to evidence the benefits of cooperation, which include: use of waste, generation of trust between employers and contribution to environmental stewardship. There were also major shortcomings that prevent greater profit derived from the lack of an appropriate methodological instrument to implement this type of cooperative enterprises, among which stands out: poor use of idle resources, lack of process improvements through innovations joint, non-participation of major players and systematic orientation towards the local sustainable development.

  5. Conceptualización de una red social educativa que integre de forma colaborativa las aplicaciones e-learning de la Universidad de las Ciencias Informáticas

    Yusel Arias Guerra

    2012-03-01

    Full Text Available Las Tecnologías de la Información y las Comunicaciones desempeñan un papel esencial en el proceso de aprendizaje. Actualmente, ha tenido un gran impacto incorporar elementos de la web 2.0 en los procesos formativos, lo cual constituye un potente medio para construir el conocimiento de forma colaborativa. En la Universidad de las Ciencias Informáticas se utilizan aplicaciones e-learning como apoyo al proceso docente, entre ellas se encuentran el Repositorio de Objetos de Aprendizaje RHODA, la Herramienta de Autor para la Creación de Objetos de Aprendizaje de forma colaborativa CRODA, y la plataforma de gestión del aprendizaje EVA. Estas herramientas poseen una organización muy centralizada y poca interrelación entre los grupos docentes. Con la puesta en marcha de un nuevo modelo de formación en la Universidad que vincula el estudio con la producción e investigación, y el auge que ha tenido la web 2.0 en la formación, se evidencia la necesidad de incentivar el uso colaborativo de las aplicaciones e-learning de la universidad, conscientes de la importancia y ventajas que esto pudiera aportar al proceso de enseñanza-aprendizaje. Esta investigación está enfocada a propiciar los elementos necesarios para integrar de forma colaborativa las aplicaciones e-learning de la Universidad, en la cual se definen las principales funcionalidades que debe incorporar una Red Social Educativa que integre estas aplicaciones. Además, se validan estas funcionalidades poniéndolas a consideración de un conjunto de expertos con el objetivo de valorar el nivel de aceptación que tendría la propuesta de solución.

  6. Red de estaciones de observacin atmosfrica en la Antrtica, una colaboracin internacional para la investigacin del cambio climtico Stations network for atmospheric observation in Antarctica, an international collaboration for climate change research

    Jorge F Carrasco

    2012-01-01

    Full Text Available El Sistema Mundial de Observacin del Clima fue establecido en 1992 por la Organizacin Meteorolgica Mundial, el Programa Medioambiental de Naciones Unidas, la Comisin Oceanogrfica Intergubernamental y el Concejo Internacional para la Ciencia. Esto como respuesta a la Decisin 11/ CP.9 de la Quinta Conferencia de las Partes de la Convencin Marco sobre Cambio Climtico de las Naciones Unidas. El SMOC se basa en el compromiso de los pases en mantener en funcionamiento las estaciones de monitoreo y de proveer los datos observados. Con esto el SMOC cumple con el objetivo de proveer a la comunidad cientfica con una red bsica de observacin y los datos necesarios para el monitoreo del sistema climtico que permitan detectar los cambios y respuestas de todos los componentes del sistema. La Antrtica es una de las regiones en la cual el SMOC ha sido esencial para la observacin y la investigacin del cambio climtico.The Global Climate Observing System (GCOS was established in 1992 by the World Meteorological Organization, the United Nation Environmental Program, the International Oceanography Commission and the International Council Scientific Union. This is as result of the Decision 11/CP.9 of the Fifth Con-ference of Parties of the Framework Convention for Climate Change of United Nation. GCOS is based on the compromise of the countries in maintaining the observing stations and providing the data. With this, GCOS accomplishes the goal of providing to the research community with a basic observing network for monitoring the climate system that will allow detecting the changes and responses of all components of the system. Antarctica is one of the regions for which GCOS has been essential for the observation and climate change research.

  7. A sampling design for a Sentinel General Practitioner Network Diseño de selección de muestra para una red de medicos centinela

    Napoleón Pérez-Farinós

    2009-06-01

    Full Text Available Objective: To construct a design for probabilistic sampling of reporting physicians in sentinel networks. Methods: We performed a multi-stage sample selection study. Data on primary care physicians and their patients were obtained from the Madrid Health Institute for 2005. The geographical unit of reference was the basic health area. A factorial analysis was performed on the basis of demographic, socio-cultural and socio-occupational variables. A cluster analysis was conducted to group the 247 basic health areas into homogeneous strata, which were then tested using a discriminant analysis. The general practitioners and pediatricians needed in each stratum were selected by simple random sampling. The representativeness of the population monitored by the selected physicians was studied with respect to the population of Madrid. Results: Factorial analysis yielded five factors. Using these, 14 strata were obtained, which were shown to be homogeneous and mutually different by discriminant analysis. The minimum population that needed to be monitored consisted of 146,946 adults and 24,518 children, proportionally distributed among the respective strata. Eighty-eight general practitioners and 32 pediatricians were selected, who respectively covered populations of 154,610 and 31,336 persons representative of the general population. Conclusions: Obtaining samples through suitable designs improves the accuracy of the information gathered by health sentinel networks in epidemiologic surveillance. Ensuring the representativeness of the study population vis-à-vis the general population is essential; cluster analysis and simple random sampling are methods that meet this need. Selecting physicians by means of probabilistic methods enables the accuracy of estimates to be ascertained.Objetivo: Elaborar un diseño de muestreo probabilístico de los médicos notificadores en redes centinelas sanitarias. Métodos: Estudio de muestreo multietápico. La información sobre los médicos de Atención Primaria y la población atendida procede del Instituto Madrileño de Salud para 2005. La unidad geográfica de referencia fue la Zona Básica de Salud. Partiendo de variables demográficas, socioculturales y sociolaborales, se realizó un análisis factorial. Se hizo un análisis de clusters para agrupar las 247 Zonas Básicas de Salud en estratos homogéneos. Como comprobación se realizó un análisis discriminante. Se seleccionaron los médicos necesarios en cada estrato mediante muestreo aleatorio simple. Se estudió la representatividad de la población vigilada con respecto a la población de Madrid. Resultados: Se extrajeron 5 factores mediante análisis factorial. Se obtuvieron 14 estratos, que el análisis discriminante demostró homogéneos y distintos entre sí. Se determinó que era necesario vigilar una población mínima de 146.946 adultos y 24.518 niños, distribuidos proporcionalmente en cada estrato. Se seleccionaron 88 médicos de familia y 32 pediatras, que cubrían unas poblaciones de 154.610 y 31.336 personas, representativas de la población general. Conclusiones: La obtención de muestras con un adecuado diseño asegura la validez de la información generada por redes centinelas sanitarias en la vigilancia epidemiológica. Debe buscarse la representatividad de la población estudiada con respecto a la población general. El análisis de clusters y el muestreo aleatorio simple son métodos que responden a esta necesidad. La selección de médicos mediante métodos probabilísticos permite conocer la precisión de las estimaciones.

  8. La Red Latinoamericana de Información Científico-Técnica en Vacunas: una alternativa para la región The Latin American Network for Scientific and Technical Information on Vaccines: an alternative for the region

    Maria V Guzmán Sánchez

    2005-10-01

    Full Text Available Las vacunas representan hoy la intervención inmunológica más empleada en medicina. A pesar de ello, sólo existen vacunas para 13 de las 28 enfermedades que requieren desarrollarse con vistas a paliar situaciones de epidemia a escala mundial. Unido a esto, prevalecen mitos, difundidos por grupos no acreditados. Esta falta de información o desinformación afectan a la población y al desarrollo de nuevos proyectos en esta área. Todo ello ha contribuido al desarrollo del proyecto titulado "Red Latinoamericana de Información Científico-Técnica en Vacunas (Red-CiTeVa. Dicha red se concibe con un nodo central en la Biblioteca Virtual en Vacunas y el Aula Virtual en Vacunología. Sus usuarios potenciales son los especialistas que laboran en esta área del conocimiento, los investigadores comprometidos en el descubrimiento de nuevas vacunas y gran parte del personal del sector de la salud. Para asegurar el acceso, el sitio se alojará en Infomed; ello permitirá su uso por parte de hospitales, policlínicos, bibliotecas y universidades médicas, entre otras instituciones en Cuba y Latinoamérica. La Biblioteca Virtual en Vacunas facilitará no sólo el acceso a la información sino que ofrecerá además, una serie de servicios en línea como consulta a expertos, análisis de proyectos, entre otros.Vaccines represent the most frequent immunological intervention used in medicine today. However, there are only vaccines for 13 of the 28 diseases that require to be developed to palliate world epidemic situations. In addition to this, there exist myths spread by non-accredited groups. This lack of information or misinformation affects the population and the development of new projects in this area. All of it has contributed to the development of the project called "Latin American Network for Scientific and Technical Information on Vaccines" (Red-CiTeVa, in Spanish. This network is created with a central node in the Vaccines Virtual Library (VVL and the Virtual Classroom on Vaccinology. Its potential users are the specialists working in this area of knowledge, researchers engaged in the discovery of new vaccines and a great number of the health sector personnel. To guarantee the access, the site will be in Infomed, which will allow its use by hospitals, polyclinics, libraries and medical universities, among other institutions in Cuba and Latin America. The VVL will not only make possible the access to information, but it will offer a series of online services as the consultation to experts and the analysis of projects, among others.

  9. Cultura de seguridad del paciente y factores asociados en una red de hospitales públicos españoles Cultura de segurança do paciente e fatores associados em uma rede de hospitais públicos espanhóis Patient safety culture and related factors in a network of Spanish public hospitals

    Zenewton André da Silva Gama; Adriana Catarina De Souza Oliveira; Pedro Jesus Saturno Hernández

    2013-01-01

    Este estudio objetivó describir la Cultura de Seguridad del Paciente (CSP) en una red de hospitales públicos, según las percepciones de los profesionales sanitarios, y analizar la asociación de factores sociolaborales. Se realizó una encuesta a 1.113 profesionales de ocho hospitales españoles, a través de un cuestionario con 12 dimensiones de la CSP. Las percepciones se describen mediante los Porcentajes de Respuestas Positivas (PRP) y Negativas (PRN) a cada dimensión, y se analiza la asociac...

  10. Configuración y puesta en marcha de una red de autómatas programables basada en PROFIBUS, MPI GSM para el control y monitorización de módulos de fabricación flexible

    Menchón Ruiz, Francisco José

    2008-01-01

    El trabajo ha sido realizado en el Departamento de Ingeniería de Sistemas y Automática de la Universidad Politécnica de Cartagena, y el objetivo principal es el estudio y posterior implementación de una red de comunicación industrial basada en tecnologías actuales de comunicación que permita la interconexión de diferentes autómatas programables. En concreto, se desarrollará una aplicación que permita, de forma remota, controlar y monitorizar dos procesos industriales (“módulos de fabricación ...

  11. Red DirCom

    Joan Costa

    2007-01-01

    Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  12. Red DirCom

    Joan Costa

    2007-01-01

    Full Text Available Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  13. Penetración eólica con diferentes tecnologías de aerogeneradores en presencia de una red débil; Wind Penetration with different wind turbine technologies in a weak grid

    Ariel Santos Fuentefria

    2012-07-01

    Full Text Available La integración de la energía eólica en los sistemas eléctricos puede ocasionar problemas de estabilidad ligados fundamentalmente a la variación aleatoria del viento, lo que provoca que la tensión en el nodo de conexión varíe. Si el sistema al que se conecta es débil esta variación tiene una mayor influencia. Otro factor importante es el tipo de tecnología utilizada, ya que losaerogeneradores de velocidad fija conectados directamente a la red tienen un gran consumo de potencia reactiva, esta puede ser compensada utilizando diferentes dispositivos (banco de condensadores, SVC o STATCOM. Los aerogeneradores de velocidad variable poseen un convertidor que controla el consumo de reactivo para mantener la tensión en el nodo de conexión lomás estable posible. En este trabajo se hace una comparación entre los diferentes tipos de tecnologías de aerogeneradores utilizadas y su impacto en el límite de generación eólica cuando el sistema se va debilitando. The insertion of wind energy into electric network may provoke stability problems due to stochastic character of wind. The variation in the wind causes voltage variation in the Point of Common Coupling (PCC. In a weakest system that variation is high. Another important factor is wind turbine technology. The use of grid-connected fixed speed wind generator introduces a great consumption of reactive power that can be compensated using different devices as capacitors bank or static var compensator (SVC or STATCOM. In the other hand the variable speed wind turbine have anelectronic converter to control the reactive consumption to maintain the PCC voltage more stable. In this paper a comparison between the different types of wind turbines technology is show. It’s analyzing the impact in wind power limit for different wind turbine technologies in a weak system.

  14. una experiencia en Mauritania

    J. M. Fernández-Palacios

    2008-01-01

    Full Text Available El macizo del Tagant, en la República Islámica de Mauritania, alberga, a lo largo de una red interconectada de humedales, las últimas poblaciones de cocodrilo del desierto Crocodylus niloticus suchus, que hasta muy poco tiempo se consideraban extintas. Estas poblaciones han sido capaces de resistir la desertización del Sahara ocurrida en el Holoceno gracias a la existencia de una serie de pozas (gueltas en árabe, que se forman tras las lluvias monzónicas y que están conectadas entre sí a través de una red de cauces efímeros o permanentes que forman la Cuenca endorreica del Lago Gabou. Estos humedales, carentes de protección en la actualidad, forman además la base económica de los más de cuarenta mil habitantes del macizo, basada en la ganadería y en una precaria agricultura. Conocedor del potencial naturalístico de la zona, el Gobierno de la RIM encargó a nuestra ONG la preparación de una memoria para dar a conocer y conseguir laproteccióninternacional de la zona en el marco de la Convención Ramsar de protección de humedales (UNESCO. El presente trabajo narra como lautilización de una especie focal, el cocodrilo del desierto, para proteger estos valiosos humedales podría ser compatible con el desarrollo de una actividad turística sostenible, basado en el turismo naturalístico y científico, que posibilite un mayor desarrollo a los habitantes del Tagant.

  15. Diseño de instalación eléctrica para acometida e instalación interior de una Planta de Valorización y Reciclaje de Baterías de Plomo-Acido con apoyo de instalación solar fotovoltaica conectada a red

    Céspedes Lasheras, José Juan

    2015-01-01

    El presente proyecto pretende describir y justificar las instalaciones eléctricas tanto de baja como de alta tensión, de una planta industrial dedicada a la Valorización y Reciclaje de Baterías de Plomo-Acido. Igualmente se describirá y justificará la instalación solar fotovoltaica conectada a red, instalada sobre parte de las cubiertas de los edificios que conforman la planta.

  16. Modelo de red segura en una PYME

    RODRÍGUEZ I SANTONJA, HÈCTOR

    2015-01-01

    Desde el principio de la era digital, la informática ha contribuido en gran medida a la evolución y revolución en el ámbito empresarial, teniendo un papel fundamental en estos procesos. Las ventajas que aporta, así como las comodidades son innumerables: control de maquinaria, sistemas 24x7, software de gestión, comunicación global, servicios web, etc. No obstante, toda esta evolución tecnológica lleva consigo un nuevo paradigma, la seguridad informática y como está afecta directamente a la em...

  17. Construyendo una Red Chilena para Estudios Socioecolgicos a Largo Plazo: Avances, enfoques y relevancia / Building a Chilean Network for Long-Term Socio-Ecological Research: Advances, perspectives and relevance

    CHRISTOPHER B, ANDERSON; RICARDO, ROZZI; JUAN J, ARMESTO; JULIO R, GUTIRREZ.

    2010-03-01

    Full Text Available Desde su inicio formal en 1980, los programas de investigacin ecolgica a largo plazo (LTER por su sigla en ingls) han servido como un exitoso marco organizacional para crear agendas de investigacin y mecanismos de financiamiento que permiten a los cientficos abordar fenmenos ecolgicos signifi [...] cativos a las escalas en que ellos ocurren. En sus 30 aos de existencia, LTER ha expandido su rango geogrfico (actualmente la red Internacional de LTER tiene ms de 40 pases miembros con sitios de estudios en cada uno de los continentes) y focos disciplinarios (principalmente abarcando las ciencias naturales y sociales, llevando a algunos a pedir un cambio de nombre a estudios de investigacin socioecolgica de largo plazo - LTSER por su sigla en ingls). No obstante, los biomas templados y subantrticos del sur de Sudamrica han carecido de sitios y redes formales de investigacin a largo plazo. Sin embargo, numerosos esfuerzos de investigacin a largo plazo han existido en Chile y Argentina sin coordinacin entre s. Particularmente, en 2008, el Instituto de Ecologa y Biodiversidad puso en marcha el primer esfuerzo sistemtico para articular tres sitios existentes (Parque Nacional Fray Jorge - 33 S, Estacin Biolgica Senda Darwin - 43 S, y Parque Etnobotnico Omora - 55 S). Aqu presentamos un nmero especial de la Revista Chilena de Historia Natural, dedicado a LTSER, con el objetivo de 1) dar una sntesis de algunos de los casos ms emblemticos casos de investigacin socioecolgica a largo plazo en Chile; 2) demostrar el valor de estos esfuerzos para la integracin de la investigacin y educacin con resultados y procesos sociales, tales como aquellos relacionados con la toma de decisiones; y 3) ofrecer la perspectiva de una amplia gama de participantes involucrados en estas iniciativas, incluyendo a estudiantes de postgrado y programas asociados desde Iberoamrica y Norteamrica. Es nuestro deseo que estos trabajos compilados contribuyan a la consolidacin de la aproximacin de LTSER en el sur de Sudamrica dentro de la comunidad acadmica y tambin para una mayor integracin entre la academia y la sociedad. Abstract in english Since their formal inception in 1980, long-term ecological research (LTER) programs have served as a successful organizing framework to create research agendas and funding mechanisms that allow scientists to address meaningful ecological phenomena at the scales they occur. In its 30 years of existen [...] ce, LTER has expanded its geographic range (currently the International LTER network has more than 40 country members with sites on every continent) and disciplinary foci (principally encompassing the natural and social sciences and leading some to call for a name change to long-term socio-ecological research - LTSER). Nonetheless, the temperate and subantarctic biomes of southern South America have lacked formalized long-term research sites and networks. Yet, at the same time, numerous uncoordinated long-term research efforts exist in both Chile and Argentina, and in 2008, the Institute of Ecology and Biodiversity launched Chiles first concerted effort to link three existing sites (Fray Jorge Forest National Park - 33 S, Senda Darwin Biological Station - 43 S, and Omora Ethnobotanical Park - 55 S). Here, we present a special feature of the Revista Chilena de Historia Natural, dedicated to LTSER, with the aim of 1) providing a synthesis of some of the most emblematic cases of long-term socio-ecological research in Chile; 2) demonstrating the value of these efforts for the integration of research, education and social outcomes, such as decision making; and 3) offering the perspective of a broad array of participants involved in these initiatives, including graduate students and associated programs from Ibero-America and North America. It is our hope that these compiled works will contribute to the consolidation of the LTSER approach in southern South America both within the academic community and also to bett

  18. Una arquitectura y mapa de ruta para un método de detección de debris flows y fenómenos similares en ríos, mediante una red de sensores inalámbricos An architecture and a roadmap for a detection method for debris flows and similar phenomena in rivers, using a wireless sensor network

    Oscar Vargas Fallas

    2013-03-01

    Full Text Available Los debris flows y flujos hiperconcentrados, conocidos popularmente como cabezas de agua, aluviones o avenidas de lodo, son fenómenos muy destructivos que afectan a poblaciones ubicadas en márgenes de ríos. Los sistemas utilizados para detectar este tipo de eventos se basan en instrumentación fija en puntos determinados del río o a través de mediciones remotas e indirectas, por lo cual los datos que suministran son limitados: no brindan información en tiempo real sobre la posición o velocidad del evento más allá de los puntos de monitoreo. En este artículo se propone una arquitectura para la detección de debris flows y flujos hiperconcentrados en cuencas de ríos, por medio de una red inalámbrica de sensores móviles. La arquitectura propuesta es distribuida y descentralizada, pues no depende de un ente coordinador central para decidir sobre la presencia o ausencia del fenómeno. También se plantea un mapa de ruta de los problemas que deben superarse, con el fin de hacer posible la implementación de esta arquitectura en un sistema de detección concreto para los ríos.Debris flows and hiperconcentrated flows are very destructive phenomena that cause damage, injures and deaths to property and persons that live near rivers. Existing warning systems for these phenomena are based on fixed instrumentation on certain points of the river, or on remote, indirect measurements. As a result, the information that they provide is limited, neither real-time data about the advance of the flow trough the river, nor its velocity outside the fixed monitoring points is available. In this article, an architecture for a debris flows and hiperconcentrated flows detection method based on a wireless sensor network is proposed. This architecture is distributed and decentralized, since it does not depend on a central coordinator to decide on the presence or absence of the phenomenon. A roadmap for further research is also proposed, in order to solve challenges and problems that must be overcome in order to make possible an implementation of this architecture in a real world detection system.

  19. Propuesta de procedimiento para configurar una red neuronal artificial de Base Radial con aplicaciones en el diagnstico de fallos / Proposal of a procedure for setting an artificial neural network of Radial Basis with applications in fault diagnosis.

    Egly, Barrero Viciedo; Beatriz, Fernndez Daz; Orestes, Llanes Santiago.

    2014-12-01

    Full Text Available En este artculo se presenta un procedimiento que permite la configuracin de los parmetros de una arquitectura de red neuronal artificial de Base Radial para tareas de diagnstico de fallos, luego de establecer un orden lgico para la seleccin de los mismos. Dicho procedimiento garantiza la obten [...] cin del nmero necesario de neuronas ocultas a partir de fijar el error de diagnstico deseado por los expertos para cada proceso, permitiendo tambin seleccionar el mtodo para estimar los anchos de las neuronas ocultas y la ecuacin de distancia para la propagacin del espacio de entradas. El procedimiento se aplica al proceso de prueba Tanque Reactor Continuamente Agitado para demostrar su efectividad. Como resultado de los experimentos realizados, se concluye que la eleccin de la funcin de distancia no influye sobre la seleccin del mtodo para estimar los anchos. Se comprueba que esta arquitectura, con el entrenamiento adecuado, exhibe buenas propiedades de sensibilidad y robustez para el diagnstico de fallos. Abstract in english In this article a procedure is shown up for allowing the configuration of parameters of artificial neuronal network architecture of Radial Basis for failure diagnosis tasks after stablishing a logical order for their selection. Such procedure guarantees the procurance of a necessary number of hidden [...] neurons starting from fixing the diagnosis error desired by the experts for each process, also allowing the selection of the method for esteeming the widths of the hidden neurons and the equation of distance for the propagation of the inlets vector. The procedure applies to the testing process of Reactor Tank Constantly Agitated searching to demonstrate its effectiveness. As a result of the realized experiments, it is confirmed that within the topology of the Radial Basis net, the calculation of the centers and widths of the hidden neurons intervene decisively in its execution, as well as the fixed-distance equation, but the election of the function of distance does not act on the selection of the method for esteeming the widths. It is verified that this architecture, with the adequate training, shows good properties of sensibility and robustness.

  20. Steam transport simulation in a geothermal pipeline network constrained by internally consistent thermodynamic properties of water / Simulacin del transporte de vapor en una red geotrmica de tuberas, constreida por propiedades termodinmicas del agua internamente consistentes

    Mahendra P., Verma.

    2013-04-01

    Full Text Available Un programa computacional, GeoSteamNet, para la simulacin numrica del transporte de vapor en redes de tuberas geotermales fue escrito en Visual Studio .NET. El programa considera (a) propiedades termodinmicas del agua internamente consistentes, y (b) un algoritmo nmerico basado en los principio [...] s de conservacin de masa, momento lineal (segunda ley de Newton), y energa (primera y segunda leyes de la termodinmica). Se observa inestabilidad del algoritmo como consecuenca del comportamiento como gas ideal del vapor a baja presin, lo cual se resuelve configurando el lmite inferior de la presin en 2.010(5) Pa. Un control ActiveX, SteamTablesGrid, en se emple para calcular las propiedades termodinmicas del agua. Un estudio de la interrelacin entre variables de estado termodinmicas como la temperatura, la presin, el volumen, la energa interna, etc. indica la consistencia interna de las propiedades termodinamicas slo del vapor. La aplicacin de GeoSteamNet se demuestra en el manejoy optimizacin de flujo de vapor en una planta geotrmica generadora hipottica con dos pozos y una unidad de produccin. GeoSteamNet calcula todos los parmetros como velocidad del fluido, diferentes tipos de energa como prdida de calor, energa (cintica y potencial) mecnica, energia termica, energa por friccin y energa total. De esta manera, el momento lineal y balances de energia en cada punto nodal en la red de tuberas se usan para validar el algoritmo. Adicionalmente, el programa computacional tambien puede ser usado eficientemente en el diseo y construccin de redes de tuberas geotrmicas. Abstract in english A computer program, GeoSteamNet, for the numerical simulation of steam transport in geothermal pipeline networks is written in Visual Studio .NET. The program considers (a) internally consistent thermodynamic properties of water, and (b) a numerical algorithm based on the principles of conservation [...] of mass, linear momentum (Newton's second law), and energy (the first and second laws of thermodynamics). Instability in the algorithm is observed as a consequence of ideal gas behavior of steam at low pressure, which is resolved by setting the lower limit ofpressure to 2.010(5) Pa. An ActiveX control, SteamTablesGrid, is used to calculate the thermodynamic properties of water. A study of the interrelationship among thermodynamic state variables like temperature, pressure, volume, internal energy, etc. indicates the internal consistency in the thermodynamic properties of steam only. The application of GeoSteamNet is demonstrated in the management and optimization of steam flow in a hypothetical geothermal power plant with two wells and one production unit. GeoSteamNet calculates all the parameters like fluid velocity, different types of energies such as heat loss, mechanical (kinetic and potential) energy, thermal energy, frictional energy, and total energy. Thus, the mass, linear momentum and energy balances at each nodal point in the pipeline network are used to validate the algorithm. Additionally, the computer program can also be used efficiently in the design and construction of geothermal pipeline network.

  1. Construyendo una Red Chilena para Estudios Socioecológicos a Largo Plazo: Avances, enfoques y relevancia Building a Chilean Network for Long-Term Socio-Ecological Research: Advances, perspectives and relevance

    CHRISTOPHER B ANDERSON

    2010-03-01

    Full Text Available Desde su inicio formal en 1980, los programas de investigación ecológica a largo plazo (LTER por su sigla en inglés han servido como un exitoso marco organizacional para crear agendas de investigación y mecanismos de financiamiento que permiten a los científicos abordar fenómenos ecológicos significativos a las escalas en que ellos ocurren. En sus 30 años de existencia, LTER ha expandido su rango geográfico (actualmente la red Internacional de LTER tiene más de 40 países miembros con sitios de estudios en cada uno de los continentes y focos disciplinarios (principalmente abarcando las ciencias naturales y sociales, llevando a algunos a pedir un cambio de nombre a estudios de investigación socioecológica de largo plazo - LTSER por su sigla en inglés. No obstante, los biomas templados y subantárticos del sur de Sudamérica han carecido de sitios y redes formales de investigación a largo plazo. Sin embargo, numerosos esfuerzos de investigación a largo plazo han existido en Chile y Argentina sin coordinación entre sí. Particularmente, en 2008, el Instituto de Ecología y Biodiversidad puso en marcha el primer esfuerzo sistemático para articular tres sitios existentes (Parque Nacional Fray Jorge - 33° S, Estación Biológica Senda Darwin - 43° S, y Parque Etnobotánico Omora - 55° S. Aquí presentamos un número especial de la Revista Chilena de Historia Natural, dedicado a LTSER, con el objetivo de 1 dar una síntesis de algunos de los casos más emblemáticos casos de investigación socioecológica a largo plazo en Chile; 2 demostrar el valor de estos esfuerzos para la integración de la investigación y educación con resultados y procesos sociales, tales como aquellos relacionados con la toma de decisiones; y 3 ofrecer la perspectiva de una amplia gama de participantes involucrados en estas iniciativas, incluyendo a estudiantes de postgrado y programas asociados desde Iberoamérica y Norteamérica. Es nuestro deseo que estos trabajos compilados contribuyan a la consolidación de la aproximación de LTSER en el sur de Sudamérica dentro de la comunidad académica y también para una mayor integración entre la academia y la sociedad.Since their formal inception in 1980, long-term ecological research (LTER programs have served as a successful organizing framework to create research agendas and funding mechanisms that allow scientists to address meaningful ecological phenomena at the scales they occur. In its 30 years of existence, LTER has expanded its geographic range (currently the International LTER network has more than 40 country members with sites on every continent and disciplinary foci (principally encompassing the natural and social sciences and leading some to call for a name change to long-term socio-ecological research - LTSER. Nonetheless, the temperate and subantarctic biomes of southern South America have lacked formalized long-term research sites and networks. Yet, at the same time, numerous uncoordinated long-term research efforts exist in both Chile and Argentina, and in 2008, the Institute of Ecology and Biodiversity launched Chile’s first concerted effort to link three existing sites (Fray Jorge Forest National Park - 33° S, Senda Darwin Biological Station - 43° S, and Omora Ethnobotanical Park - 55° S. Here, we present a special feature of the Revista Chilena de Historia Natural, dedicated to LTSER, with the aim of 1 providing a synthesis of some of the most emblematic cases of long-term socio-ecological research in Chile; 2 demonstrating the value of these efforts for the integration of research, education and social outcomes, such as decision making; and 3 offering the perspective of a broad array of participants involved in these initiatives, including graduate students and associated programs from Ibero-America and North America. It is our hope that these compiled works will contribute to the consolidation of the LTSER approach in southern South America both within the academic community and also to better link academia and society.

  2. Red Clover

    ... Vision Organizational Structure Director's Message Strategic Plans & Reports Budget & Legislation Advisory Council Job Opportunities All About NCCIH ... bronchitis. Currently, red clover is used as a traditional or folk remedy for menopausal symptoms, breast pain ...

  3. Una red para promover sistemas de salud basados en la atención primaria de salud en la Región de las Américas A network to promote health systems based on primary health care in the Region of the Americas

    María Magdalena Herrera Vázquez; Nuria Rodríguez Ávila; Carme Nebot Adell; Hernán Montenegro

    2007-01-01

    OBJETIVOS: Identificar los componentes relacionales de una red internacional de organizaciones de cooperación técnica y financiera que promueva el desarrollo de sistemas de salud basados en la atención primaria de salud (APS) en los países de la Región; analizar los vínculos de acción social para la cooperación en salud entre los socios colaboradores de la Organización Panamericana de la Salud (OPS); y determinar los elementos teóricos básicos que pueden contribuir a desarrollar estrategias d...

  4. Rede de Preveno de Acidentes de Trabalho: uma estratgia de ensino a distncia / Network Prevention of Accidents at Work: a strategy for distance education / Red de Prevencin de Accidentes deTrabajo: una estrategia para enseanza a la distancia

    Maria Helena, Marziale; Amanda dos Santos, Zapparoli; Vanda Elisa, Felli; Marina Hideko, Anabuki.

    2010-04-01

    Full Text Available Estudo quase-experimental cujo objetivo foi avaliar o treinamento interativo proposto, como estratgia de mudana no comportamento de trabalhadores para o adequado uso de luvas na administrao de medicamentos endovenosos. O treinamento, estruturado no Modelo de Promoo da Sade de Pender, foi real [...] izado a distncia pelo web site da Rede de Preveno de Acidentes de Trabalho (REPAT), disponvel em: http://repat.eerp.usp.br/estrategia/index.php e aplicado a 60 trabalhadores de enfermagem de dois hospitais estado de So Paulo. Antes do treinamento 58,3% dos trabalhadores usavam luvas para administrar medicamentos endovenosos na semana que antecedeu o treinamento e 83,3% trabalhadores informaram inteno do uso de luvas aps o treinamento. Concluso: a ferramenta interativa facilitou a aplicao da estratgia educativa no trabalho e pode auxiliar a mudana do comportamento do uso de luvas. Abstract in spanish Estudio casi-experimental cuyo objetivo fue evaluar el proyecto de formacin interactiva, como una estrategia para el cambio en el comportamiento de los trabajadores, buscando el uso apropiado de guantes en la administracin de drogas por va intravenosa. La capacitacin interactiva se estructur en [...] el Modelo de Promocin de la Salud de Pender, se llev a cabo a travs del acceso al sitio Web de la Red de Prevencin de Accidentes de Trqabajo (REPAT), disponible en: http://repat.eerp.usp.br/estrategia/index.php y se aplic en 60 trabajadores enfermera de dos hospital en el estado de Sao Paulo. En la semana antes del entrenamiento 58,3% de los trabajadores usaron guantes en la administracin de drogas por va intravenosa y, despus del entrenamiento, 83,3% de los trabajadores informaron intencin de usar guantes. Conclusin: la herramienta interactiva facilitado la aplicacin de la estrategia educativa para la Promocin de la Salud en el Trabajo permitir que los trabajadores participen en las diferentes realidades de la vida y el trabajo. Abstract in english Quasi-experimental study that aimed at evaluating the proposed interactive training, as a strategy for change in the behavior of workers, seeking the appropriate use of gloves in the administration of intravenous drugs. The interactive training was structured in the Model of Health Promotion of Pend [...] er, conducted through access to the web site of the Network Prevention of Accidents at Work (REPAT) available from: http://repat.eerp.usp.br/estrategia/index.php and applied in 60 workers nursing from two hospitals in the state of Sao Paulo. On the week before the training 58.3% of the workers were wearing gloves to administrate intravenous drugs and 83.3% of the workers informed the intention of wearing gloves after the training. Conclusion: the use of interactive tool facilitated the implementation of educational strategy in work and showed that training can help in changing behavior.

  5. Effect of Californian Red Worm (Eisenia foetida on the Nutrient Dynamics of a Mixture of Semicomposted Materials Efecto de la Lombriz Roja Californiana (Eisenia foetida en la Dinámica de Nutrientes de una Mezcla de Materiales Semicompostados

    Hugo Castillo

    2010-09-01

    Full Text Available The efficiency of composting processes with and without the addition of Californian red worms (Eisenia foetida was evaluated, using manure of dairy cows to generate organic fertilizer. Several parameters were assessed as physio-chemical indicators of maturity, such as temperature, pH, C/N ratio, phytotoxicity and macro and micronutrients at 25 and 54 ws (mature and stored products, respectively. A linear model was used in the statistical analysis, with four replicates that included as fixed effects, the composting systems and time. At 25 wk, both systems reduced the C/N ratio to values of 15.5 in vermicompost and 17.1 in semi-compost. The content of total N, N-NO3, Ca and some micronutrients also increased. K and Na concentrations were higher in the compost than in the vermicompost. The mean of pH presented differences in the two systems of decomposition. The germination index, using lettuce seeds (Lactuca sativa L. var. Grandes Lagos in vitro, of the decomposition products increased in week 25, indicating the degree of maturity reached. The effect of storage was greater stability of the products by reducing the C/N ratio to 8.13 for vermicompost and 7.05 for compost, as well as an increase in available N content in the form of N-NO3 in the case of compost and in the content of Ca, Mg, Na, Zn, Mn and Cu in both systems.Se evaluó la eficiencia de los procesos de compostaje con y sin la adición de lombriz roja californiana (Eisenia foetida usando estiércol de vacas lecheras para la generación de abonos orgánicos. Como indicadores de madurez se evaluaron varios parámetros fisicoquímicos tales como temperatura, pH, relación C/N, fitotoxicidad y macro y micronutrientes durante 25 y 54 semanas (productos maduros y almacenados, respectivamente. En el análisis estadístico se usó un modelo lineal con cuatro repeticiones que incluyó como efectos fijos los sistemas de compostaje y el tiempo. Se realizó análisis de varianza y comparación de medias mediante contrastes ortogonales. A las 25 semanas ambos sistemas redujeron la relación C/N a valores de 15,5 en vermicompost y de 17,1 en semi-compost, además se incrementó el contenido de N-total, N-NO3, Ca y de algunos micronutrimentos. La concentración de K, y Na fueron más altos en compost que en vermicompost. La media de pH presentó diferencia para los sistemas de descomposición. El índice de germinación usando semillas de lechuga (Lactuca sativa L. var. Grandes Lagos in vitro de los productos de descomposición se incrementó en la semana 25 indicando el grado de madurez alcanzado. El efecto del almacenamiento permitió alcanzar una mayor estabilidad de los productos al reducir la relación C/N a 8,13 para vermicompost y de 7,05 para compost, así como un incremento en el contenido de N disponible en forma de N-NO3 en el caso del compost y en el contenido de Ca, Mg, Na, Zn, Mn y Cu en ambos sistemas.

  6. Effect of Californian Red Worm (Eisenia foetida) on the Nutrient Dynamics of a Mixture of Semicomposted Materials / Efecto de la Lombriz Roja Californiana (Eisenia foetida) en la Dinmica de Nutrientes de una Mezcla de Materiales Semicompostados

    Hugo, Castillo; Adriana, Hernndez; David, Dominguez; Damaris, Ojeda.

    2010-09-01

    Full Text Available Se evalu la eficiencia de los procesos de compostaje con y sin la adicin de lombriz roja californiana (Eisenia foetida) usando estircol de vacas lecheras para la generacin de abonos orgnicos. Como indicadores de madurez se evaluaron varios parmetros fisicoqumicos tales como temperatura, pH, r [...] elacin C/N, fitotoxicidad y macro y micronutrientes durante 25 y 54 semanas (productos maduros y almacenados, respectivamente). En el anlisis estadstico se us un modelo lineal con cuatro repeticiones que incluy como efectos fijos los sistemas de compostaje y el tiempo. Se realiz anlisis de varianza y comparacin de medias mediante contrastes ortogonales. A las 25 semanas ambos sistemas redujeron la relacin C/N a valores de 15,5 en vermicompost y de 17,1 en semi-compost, adems se increment el contenido de N-total, N-NO3, Ca y de algunos micronutrimentos. La concentracin de K, y Na fueron ms altos en compost que en vermicompost. La media de pH present diferencia para los sistemas de descomposicin. El ndice de germinacin usando semillas de lechuga (Lactuca sativa L.) var. Grandes Lagos in vitro de los productos de descomposicin se increment en la semana 25 indicando el grado de madurez alcanzado. El efecto del almacenamiento permiti alcanzar una mayor estabilidad de los productos al reducir la relacin C/N a 8,13 para vermicompost y de 7,05 para compost, as como un incremento en el contenido de N disponible en forma de N-NO3 en el caso del compost y en el contenido de Ca, Mg, Na, Zn, Mn y Cu en ambos sistemas. Abstract in english The efficiency of composting processes with and without the addition of Californian red worms (Eisenia foetida) was evaluated, using manure of dairy cows to generate organic fertilizer. Several parameters were assessed as physio-chemical indicators of maturity, such as temperature, pH, C/N ratio, ph [...] ytotoxicity and macro and micronutrients at 25 and 54 ws (mature and stored products, respectively). A linear model was used in the statistical analysis, with four replicates that included as fixed effects, the composting systems and time. At 25 wk, both systems reduced the C/N ratio to values of 15.5 in vermicompost and 17.1 in semi-compost. The content of total N, N-NO3, Ca and some micronutrients also increased. K and Na concentrations were higher in the compost than in the vermicompost. The mean of pH presented differences in the two systems of decomposition. The germination index, using lettuce seeds (Lactuca sativa L.) var. Grandes Lagos in vitro, of the decomposition products increased in week 25, indicating the degree of maturity reached. The effect of storage was greater stability of the products by reducing the C/N ratio to 8.13 for vermicompost and 7.05 for compost, as well as an increase in available N content in the form of N-NO3 in the case of compost and in the content of Ca, Mg, Na, Zn, Mn and Cu in both systems.

  7. Red de sensores SIPIA

    Mercado, Gustavo; Ortiz Uriburu, Gisela; Diedrichs, Ana; Borgo, Roberto; Gonzalez Antivilo, Francisco; Tromer, Sebastián; Ledezma, Nicolás; Aguirre, Matías; Panella, Cristian; Tabacchi, Germán; Martí, Juan; Grünwaldt, Guillermo; Rigoni, Ignacio; Antón, Gabriel; Chamorro, Fernando

    2012-01-01

    El proyecto consiste en el análisis, implementación y evaluación de una red de sensores inalámbricos basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de tanto ingenieros electrónicos e informáticos como de ingenieros e investigadores agrónomos, Se propone entonces el estudio de estas tecnologías en el contexto de un grupo de investigaciones que permita: • La colaboración interinstitucional e interdisciplinaria en...

  8. Quando a cooperao falha: um estudo de caso sobre o fracasso de uma rede interorganizacional / When the cooperation fails: a case study about the failure of an interorganizational network / Cundo la cooperacin fracasa: un estudio de caso sobre el fracaso de una red interorganizacional

    Douglas, Wegner; Antonio Domingos, Padula.

    2012-02-01

    Full Text Available Os benefcios da cooperao interorganizacional tm sido pesquisados extensivamente pelos tericos organizacionais, mas poucos estudos focam casos de fracasso. Apesar do grande nmero de redes de empresas bem-sucedidas, muitas tambm enfrentam dificuldades na organizao e na gesto da cooperao, e [...] ncerrando suas atividades sem atingir os objetivos propostos. Este artigo apresenta um caso de fracasso de uma rede de empresas do segmento supermercadista, luz de estudos de Park e Ungson (2001), Jarillo (1988), Khanna, Gulati e Nohria (1998) e Brouthers, Brouthers e Wilkinson (1995) sobre as dificuldades na cooperao empresarial. Por meio de entrevistas em profundidade com a diretoria da rede, com empresrios participantes e com a consultora que apoiou a criao da rede, identificaram-se os principais fatores que contriburam para que a rede fosse encerrada sem atingir os resultados esperados. Os fatores foram divididos em dois grupos: pr-formalizao da rede, como o perfil e a escolha dos participantes, o nmero de participantes da rede e a definio do momento para lanamento da rede; e ps-formalizao da rede, que inclui aspectos como o surgimento de desajustes estratgicos, a perda de apoio do programa pblico e a falta de maturidade do grupo, que enfrentou dificuldades para gerenciar o processo de cooperao sem apoio externo. Como implicao terica, o estudo apresenta fatores pouco explorados pela literatura e que podem levar ao fracasso da cooperao, como o nmero reduzido de empresas, o momento inadequado de lanamento da rede e a imaturidade do grupo. O conjunto de elementos identificado tambm tem implicaes gerenciais: empresrios e gestores de redes devem analisar cuidadosamente o perfil e o alinhamento estratgico das empresas ao constiturem a rede, a fim de evitar que eventuais diferenas se tornem um problema depois que a rede j est constituda. Abstract in spanish Los beneficios de la cooperacin entre organizaciones han sido investigados en profundidad por los tericos de las organizaciones, pero pocos estudios se centran en los casos de fracaso. A pesar del nmero de redes de empresas exitosas, muchas de ellas tambin enfrentan dificultades en organizar y a [...] dministrar la cooperacin, cerrando sus puertas, sin lograr los objetivos propuestos. Este artculo presenta un caso de falla de una red de empresas en el segmento de supermercados, llevando en consideracin los estudios realizados por Park y Ungson (2001), Jarillo (1988), Khanna, Gulati y Nohria (1998) y Brouthers, Brouthers y Wilkinson (1995) sobre las dificultades en la cooperacin empresarial. A travs de entrevistas en profundidad con los directivos de la red, con las empresas participantes y el consultor que apoy la creacin de la red, fueron identificados los principales factores que contribuyeron con el cierre de la red sin alcanzar los resultados esperados. Los factores se dividieron en dos grupos: factores anteriores a la formalizacin de la red, tales como el perfil y la eleccin de los participantes, el nmero de participantes en la red y establecer el tiempo de despliegue de la red, y los factores posteriores a la formalizacin de la red, incluyendo aspectos tales como aparicin de desequilibrios estratgicos, la prdida de apoyo pblico para el programa y la falta de madurez del grupo, que ha luchado para gestionar el proceso de cooperacin sin apoyo externo. Como implicaciones tericas, el estudio presenta factores poco explorados en la literatura y que pueden llevar al fracaso de la cooperacin, como el pequeo nmero de empresas, un mal momento para lanzar la red y la falta de madurez del grupo. El conjunto de elementos identificados tambin tiene implicaciones en la gestin: los gerentes y administradores de red deben revisar cuidadosamente el alineamiento y el perfil estratgico de las empresas para la creacin de la red, evitando cualquier diferencia que pueda convertirse en un problema despus de que la red haya

  9. Comparacin del modelo FARIMA y SFARIMA para obtener la mejor estimacin del trfico en una red WI-FI / Comparing FARIMA and SFARIMA models in order to obtain the best traffic estimation over a WI-FI network

    Joel Caroll, Vargas; Cesar, Hernndez; Gabriel Alberto, Puerta Aponte.

    2012-04-01

    Full Text Available El presente artculo se enfoca al anlisis del trfico de la red WIFI pblica de Cha, Cundinamarca, determinando la presencia de trfico autosimilar y aplicando posteriormente los algoritmos FARIMA y SFARIMA. Los resultados determinan cul es el mejor predictor del trfico de la red. [...] Abstract in english This paper focuses on the analysis of network traffic public WIFI Chia, Cundinamarca, determining the presence of self-similar traffic and apply the algorithms SFARIMA and FARIMA. The results determine what the best predictor network traffic is. [...

  10. Una propuesta para el monitoreo de la movilidad cortical actual en la sierra Chica de Zonda (Precordillera oriental de San Juan: mediciones de gravedad en red A proposal for monitoring the present crustal mobility in Sierra Chica de Zonda (Eastern Precordillera of San Juan: Gravity measurements in a network

    S. Miranda

    2006-09-01

    Full Text Available Se detallan los requerimientos para el procedimiento de medición de redes precisas de gravedad que permitan obtener una interpretación de los cambios temporales de gravedad observados con relación a movimientos verticales en la corteza. Para Argentina, esta es la primera medición de gravedad en red realizada con fines de monitoreo cortical a escala local. Los vértices de la red prácticamente rodean a la sierra Chica de Zonda (Precordillera Oriental de San Juan caracterizada como una región de fallamiento activo. El objetivo científico del experimento es el ensayo de esta herramienta geofísica para cuantificar probables deformaciones verticales y/o cambios de masas subsuperficiales vinculados con actividad sísmica.In an attempt to obtain an interpretation of the observed temporal gravity changes related to crustal vertical motions, we describe a methodology using accurate gravity measurements within a fixed network. In Argentina, this is the first gravity survey measured in a network configuration for crustal monitoring studies at a local scale. The network contains the Sierra Chica de Zonda (San Juan Eastern Precordillera, a region of active tectonics. The main goal is to test a geophysical tool useful to quantify probable vertical ground deformations and/or subsurface mass changes associated with seismic activity.

  11. Referral and counter-referral system between secondary and tertiary care facilities in a children's hospital network of Greater Buenos Aires / Sistema de referencia-contrarreferencia entre el segundo y el tercer nivel de salud en una red hospitalaria peditrica en el conurbano bonaerense

    Pablo, Garca Munitis; Maximiliano, de Abreu; Laura, Antonietti; Mercedes, Guilln; Matas, Said; Csar, Montali; Natalia, Arrospide; Guillermo, Barbero; Diego, Cerrudo; Estela, Parodi; Cinthia, Amato; Marcelo, Pereira.

    2013-10-01

    Full Text Available Introduccin. El Hospital El Cruce es un centro de alta complejidad de una red asistencial que funciona desde julio de 2008 y abarca centros sanitarios de cinco municipios del conurbano sur bonaerense. El objetivo del estudio fue describir el sistema de referencia y contrarreferencia a la unidad de [...] cuidados intermedios peditricos del Hospital de Alta Complejidad en Red El Cruce, y secundariamente identifcar los puntos crticos que podran conspirar contra la consolidacin de la red y analizar el nivel de autoconocimiento sobre sta. Poblacin y mtodos. Estudio observacional, prospectivo, realizado en la unidad de cuidados intermedios peditricos del Hospital El Cruce, entre julio de 2008 y diciembre de 2010. Se analizaron los indicadores vinculados al ingreso y egreso del paciente. Se realiz una encuesta a todos los jefes de servicios peditricos de la red para evaluar el nivel de conocimiento sobre sta. Resultados. Se internaron 1677 pacientes; 83,9% fueron derivados desde la red. Se aceptaron 71,1% de las derivaciones solicitadas. El 9,4% (156 pacientes) fueron contrarreferidos al centro de origen. En la encuesta, 70% de las respuestas de los jefes de servicios peditricos expresaron desconocimiento del men prestacional de la red. Conclusiones. El intercambio asistencial se bas predominantemente en la aceptacin de pacientes derivados desde centros de segundo nivel de atencin hacia el Hospital El Cruce y escasa contrarreferencia hacia los centros derivadores, con una dinmica de funcionamiento radiada. Hubo escaso conocimiento de la disponibilidad de prestaciones de la red. Abstract in english Introduction. Hospital El Cruce is a tertiary care facility which is part of a healthcare network that has been operating since July 2008 and includes health centers from five municipalities of the South of Greater Buenos Aires. The objective of the study was to describe the referral and counter-ref [...] erral system at the pediatric intermediate medical care unit of the Hospital El Cruce, the tertiary level care of the network, and secondly to identify the critical points that could go against the consolidation of the network and to analyze the level of knowledge about it. Population and Methods. This was a cross-sectional, prospective study conducted at the pediatric intermediate medical care unit of Hospital El Cruce between July 2008 and December 2010. Indicators related to patient admission and discharge were analyzed. A survey was administered to all the heads of the network's pediatric departments in order to assess the level of knowledge they had about it. Results. A total of1677patients were hospitalized; 83.9% were referred from the network. Of all referrals made, 71.1% were accepted. There were 156 patients (9.4%) who were counter-referred to the referring facility. The survey results showed that 70% of heads of pediatric departments were unaware of the range of services provided by the network. Conclusions. Health care exchange was predominantly based on accepting patients referred from secondary care facilities to Hospital El Cruce and a minimum number of counter-referrals to referring facilities, with a radial pattern dynamics. There was scarce knowledge about the availability of the network health service delivery.

  12. Creación de una colección de imágenes de patología del cuello uterino para la Red RENATA / Assembly of a Cervical Pathology Image collection for the RENATA network

    Suárez Ramos, María del Pilar

    2011-01-01

    La telepatología se define como el proceso de histopatología diagnóstica a partir de imágenes digitales vistas en una pantalla, reemplazando al microscopio de luz convencional. Su aplicación ha permitido crear bases con imágenes disponibles para procesos de educación e investigación. El creciente número de colecciones de imágenes digitales, ha llevado a la necesidad de crear un sistema que facilite la búsqueda y la recuperación de las mismas a partir de una base de datos mediante el uso...

  13. Implementación de un esquema criptográfico para gestionar de forma segura las historias médicas de los pacientes a través de una red de comunicaciones

    Cáncer Giner, Fran

    2007-01-01

    En aquest projecte de final de carrera s'ha dissenyat, implementat i provat un sistema que utilitzant criptografia de clau pública, garanteix la correcta utilització de les dades en un procés de consulta i complimentació d'una història clínica informatitzada consultada a distància.

  14. The Habitus of an Expanding Network: the characteristics of the São Francisco Valley viticulture arrangementO Habitus de uma Rede em Expansão: as disposições do arranjo vitivinícola do Vale do São FranciscoEl Habitus de una Red en Expansión: disposiciones de la red vitivinícola del Valle São Francisco

    LEÃO, André Luiz Maranhão de Souza

    2013-03-01

    Full Text Available ABSTRACTOver the last few decades, fine wines have begun to be produced in the São Francisco Valley – and the activity has established itself and led to a viticulture productive arrangement in the Brazilian semi-arid region. Given the importance of this viticulture network, and as an attempt to better understand it, we took up bourdieusian theory to explain the subjective characteristics that permeate the dynamics of (interactions amongst network stakeholders. To this end, we used Pierre Bourdieu’s habitus theory as a basis. The research corpus was made up of in-depth interviews carried out with representatives from five out of six wineries located in that productive area. Interviews were analyzed through speech analysis based on categories taken from the bourdieusian theory. Our findings indicate four subjective characteristics amongst network stakeholders: the effort towards speech coherence; a “good neighbor” attitude; a belief in the role of the network towards local development; and the perception and repetition of disadvantages and prejudices. Limitations and directions for future research are considered.RESUMONas últimas décadas, teve início a produção de vinhos finos no Vale do São Francisco, atividade que se consolidou, dando origem a um arranjo produtivo vitivinícola no semiárido brasileiro. Diante da importância dessa rede de vitivinicultura, e na tentativa de melhor entendê-la, adotamos o pensamento bourdieusiano para explicitar as disposições subjetivas que permeiam a dinâmica de (interação dos agentes dessa rede. Para tal, utilizamos a teoria do habitus de Pierre Bourdieu como base teórica. O corpus da pesquisa foi constituído por entrevistas em profundidade realizadas com representantes de cinco das seis vinícolas instaladas naquele campo produtor. As entrevistas foram tratadas por meio de análise de discurso pautada em categorias da teoria bourdieusiana adotada. Nossos achados indicam quatro disposições subjetivas dos agentes dessa rede: busca por uma unidade no discurso, postura de “boa vizinhança”, crença no papel da rede para o desenvolvimento local e percepção e reprodução de desfavorecimentos e preconceitos. Limitações e indicações de futuras pesquisas são consideradas.RESUMENEn las últimas décadas se ha iniciado la producción de vinos finos en el Valle São Francisco, actividad que se ha consolidado, dando origen a una red productiva vinícola en el semiárido brasileño. Por la importancia de esta red de vitivinicultura, y en un intento de comprenderla mejor, adoptamos el pensamiento bourdieusiano para explicar las disposiciones subjetivas inherentes a la dinámica de la (interacción de los agentes de esta red. Para ello, utilizamos la teoría del habitus de Pierre Bourdieu como base teórica. El corpus de la investigación fue constituido por entrevistas en profundidad realizadas con representantes de cinco de las seis bodegas ubicadas en aquel campo productor. Las entrevistas fueron analizadas mediante el análisis del discurso guiado en las categorías de la teoría bourdieusiana adoptada. Nuestros hallazgos indican cuatro disposiciones subjetivas de los agentes de esta red: búsqueda de una unidad en el discurso, la postura de “buena vecindad”, la creencia en el papel de la red para el desarrollo local y la percepción y la reproducción de las desventajas y los perjuicios. Se consideran las limitaciones y necesidades de la investigación.

  15. PROTOTIPO PARA EL ANÁLISIS DEL RENDIMIENTO EN EL TRÁFICO DE UN SERVICIO BROADCAST UTILIZANDO LOS PROTOCOLOS HTTP Y RTP SOBRE IPV6 EN UNA RED ACADÉMICA DE TECNOLOGÍA AVANZADA

    Roberto Ferro; Ernesto A. Cortes F.; Carlos A. Martínez A.; Juan P. Barbosa

    2011-01-01

    En el presente artículo se condensan los resultados obtenidos de la implementación y modelado de un Prototipo de Servicio Streaming sobre el Sistema Operativo Fedora 13 con el Programa VLC en la Red de Investigación y  Tecnología Avanzada de la Universidad Distrital RITA-UD sobre IPV6 utilizando como cliente la Universidad Minuto de Dios vía RUMBO mediante un Tunel 6a4.

  16. Effect of Californian Red Worm (Eisenia foetida) on the Nutrient Dynamics of a Mixture of Semicomposted Materials Efecto de la Lombriz Roja Californiana (Eisenia foetida) en la Dinámica de Nutrientes de una Mezcla de Materiales Semicompostados

    Hugo Castillo; Adriana Hernández; David Dominguez; Damaris Ojeda

    2010-01-01

    The efficiency of composting processes with and without the addition of Californian red worms (Eisenia foetida) was evaluated, using manure of dairy cows to generate organic fertilizer. Several parameters were assessed as physio-chemical indicators of maturity, such as temperature, pH, C/N ratio, phytotoxicity and macro and micronutrients at 25 and 54 ws (mature and stored products, respectively). A linear model was used in the statistical analysis, with four replicates that included as fixed...

  17. PROTOTIPO PARA EL ANÁLISIS DEL RENDIMIENTO EN EL TRÁFICO DE UN SERVICIO BROADCAST UTILIZANDO LOS PROTOCOLOS HTTP Y RTP SOBRE IPV6 EN UNA RED ACADÉMICA DE TECNOLOGÍA AVANZADA

    Roberto Ferro

    2011-08-01

    Full Text Available En el presente artículo se condensan los resultados obtenidos de la implementación y modelado de un Prototipo de Servicio Streaming sobre el Sistema Operativo Fedora 13 con el Programa VLC en la Red de Investigación y  Tecnología Avanzada de la Universidad Distrital RITA-UD sobre IPV6 utilizando como cliente la Universidad Minuto de Dios vía RUMBO mediante un Tunel 6a4.

  18. Usos y tendencias adictivas de una muestra de estudiantes universitarios espaoles a la red social Tuenti: la actitud positiva hacia la presencia de la madre en la red como factor protector / Spanish university students' uses of the social network Tuenti and their addiction levels: the protective role of the positive attitude toward mothers' presence as contact

    Mercedes, Durn; Jos M., Guerra.

    2015-01-01

    Full Text Available El objetivo de este trabajo fue estudiar, desde el paradigma de usos y gratificaciones, el uso que los estudiantes universitarios espaoles (N = 221) hacen de la red social Tuenti, y en qu medida estos usos se asocian con sus niveles de adiccin a dicha red social. Adems se analiz el papel que lo [...] s progenitores tienen como facilitadores o inhibidores de dichas tendencias adictivas y el impacto del gnero. Los resultados muestran cuatro categoras de usos de la red Tuenti: entretenimiento, comunicacin a travs del muro, comunicacin a nivel privado e informacin social. Adems, la actitud positiva hacia la presencia de la madre en la red Tuenti se muestra como un factor de proteccin de las tendencias adictivas a la red. Por ltimo, se han encontrado diferencias estadsticamente significativas en funcin del gnero, tanto en los usos que realizan chicos y chicas, como en sus patrones de adiccin a la red Tuenti, de tal manera que los chicos informan de niveles de adiccin superiores a los informados por las chicas en el uso de esta red social. Abstract in english The present work aimed to study, from the uses and gratifications paradigm, the uses that Spanish university students (N = 221) do of the social networking site Tuenti, and the relationship between these uses and young's self-reported levels of addiction towards Tuenti. Also, the students' attitudes [...] towards the presence of their parents as contacts in Tuenti, and the impact of gender were analyzed. The results showed four different categories of uses: entertainment, public communication, private communication and social information. Also, young's positive attitude toward the presence of the mother in Tuenti played a protective role in their addition levels towards this social networking site. Finally, statistically significant gender differences in the uses of Tuenti and also in their addiction levels toward Tuenti were found.

  19. Aplicacin de los criterios de optimizacin de karasiov a la red hidrolgica colombiana

    DOMNGUEZ C., EFRAN A.; NIO R., RAL; VERDUGO R., NELSY

    2009-01-01

    El presente trabajo muestra la aplicacin de los criterios de optimizacin de Karasiov a la red hidrolgica Colombiana. Como resultado se ofrece una comparacin objetiva sobre las diferencias entre la red hidrolgica real y la ptima. En la introduccin y antecedentes se presenta un breve relato sobre la evolucin de la red y se discuten los pasos necesarios para el diseo ptimo de una red hidrometeorolgica

  20. Construyendo una Red Chilena para Estudios Socioecológicos a Largo Plazo: Avances, enfoques y relevancia Building a Chilean Network for Long-Term Socio-Ecological Research: Advances, perspectives and relevance

    Christopher B Anderson; RICARDO ROZZI; Armesto, Juan J.; Gutiérrez, Julio R.

    2010-01-01

    Desde su inicio formal en 1980, los programas de investigación ecológica a largo plazo (LTER por su sigla en inglés) han servido como un exitoso marco organizacional para crear agendas de investigación y mecanismos de financiamiento que permiten a los científicos abordar fenómenos ecológicos significativos a las escalas en que ellos ocurren. En sus 30 años de existencia, LTER ha expandido su rango geográfico (actualmente la red Internacional de LTER tiene más de 40 países miembros con sitios ...

  1. una comunidad

    Adriana Hernández García

    2006-01-01

    embargo, el desarrollo generó mayores desigualdades económicas entre las poblaciones urbanas y las rurales, así como efectos de contaminación del medio ambiente y escasez de los recursos naturales. En este trabajo se presentan los puntos de encuentros locales, la historia, identidad y simbolismos que mantienen una visión de la vida comunal; los desencuentros frente al desarrollo aplicado en la localidad; los cambios en los patrones de cultivo y de la pesca, así como la migración como uno de los principales efectos del cambio.

  2. Red Alive

    Reynaldo Thompson Lopez

    2010-01-01

    Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  3. Red Alive

    Reynaldo Thompson Lopez

    2010-01-01

    Full Text Available Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  4. Red Plenty

    Spufford, Francis

    2012-01-01

    Strange as it may seem, the gray, oppressive USSR was founded on a fairy tale. It was built on the twentieth-century magic called “the planned economy,” which was going to gush forth an abundance of good things that the lands of capitalism could never match. And just for a little while, in the heady years of the late 1950s, the magic seemed to be working. Red Plenty is about that moment in history, and how it came, and how it went away; about the brief era when, under the rash leadership of K...

  5. Detecting and classifying faults on transmission systems using a backpropagation neural network; Deteccion y clasificacion de fallas en sistemas de transmision empleando una red neuronal con retropropagacion del error

    Rosas Ortiz, German

    2000-01-01

    Fault detection and diagnosis on transmission systems is an interesting area of investigation to Artificial Intelligence (AI) based systems. Neurocomputing is one of fastest growing areas of research in the fields of AI and pattern recognition. This work explores the possible suitability of pattern recognition approach of neural networks for fault detection and classification on power systems. The conventional detection techniques in modern relays are based in digital processing of signals and it need some time (around 1 cycle) to send a tripping signal, also they are likely to make incorrect decisions if the signals are noisy. It's desirable to develop a fast, accurate and robust approach that perform accurately for changing system conditions (like load variations and fault resistance). The aim of this work is to develop a novel technique based on Artificial Neural Networks (ANN), which explores the suitability of a pattern classification approach for fault detection and diagnosis. The suggested approach is based in the fact that when a fault occurs, a change in the system impedance take place and, as a consequence changes in amplitude and phase of line voltage and current signals take place. The ANN-based fault discriminator is trained to detect this changes as indicators of the instant of fault inception. This detector uses instantaneous values of these signals to make decisions. Suitability of using neural network as pattern classifiers for transmission systems fault diagnosis is described in detail a neural network design and simulation environment for real-time is presented. Results showing the performance of this approach are presented and indicate that it is fast, secure and exact enough, and it can be used in high speed fault detection and classification schemes. [Spanish] El diagnostico y la deteccion de fallas en sistemas de transmision es una area de interes en investigacion para sistemas basados en Inteligencia Artificial (IA). El calculo neuronal es una de las areas de investigacion de mas rapido crecimiento en el campo de la IA y el reconocimiento de patrones. Este trabajo explora la posible aplicabilidad de una tecnica de reconocimiento de patrones basada en redes neuronales para la deteccion y la clasificacion de fallas en un SEP. Las tecnicas convencionales de deteccion en los relevadores modernos se basan en un procesamiento digital de senales y requieren de cierto tiempo (alrededor de 1 ciclo) para enviar una senal de disparo, ademas de ser propensas a tomar decisiones incorrectas si las senales se encuentran contaminadas por ruido. Es deseable entonces desarrollar tecnicas que sean rapidas, exactas y robustas y que tengan un buen desempeno ante las condiciones cambiantes del sistema (como variaciones de carga y resistencia de falla, por ejemplo). El objetivo de este trabajo es desarrollar una tecnica novedosa basada en Redes Neuronales Atificales (RNA), la cual explora la aplicabilidad de la propuesta de reconocimiento de patrones para el diagnostico y deteccion de fallas. La tecnica sugerida se basa en el hecho de que cuando ocurre una falla, toma lugar un cambio de impedancia en el sistema y como consecuencia, cambios en la amplitud y fase de las senales de voltajes y corrientes de linea toman lugar. Se desarrolla un discriminador de fallas basado en redes neuronales que es entrenado para detectar estos cambios como indicadores del instante de ocurrencia de la falla. Este detector utiliza valores instantaneos de esas senales para tomar decisiones. Se describe a detalle la aplicabilidad de las redes neuronales como clasificadores de patrones para el diagnostico de fallas en sistemas de transmision y ademas, se presenta un diseno basado en redes neuronales y su ambiente de simulacion para la deteccion y clasificacion de fallas en tiempo real. Se presentan resultados del desempeno de esta tecnica que muestran que es rapida, segura y suficientemente exacta e indican su aplicabilidad dentro de esquemas de deteccion y clasificacion de fallas a muy alta velocidad.

  6. Publicación científica: una mirada crítica al quehacer de la red de bibliotecas médicas de Santiago de Cuba

    Elaine Duperet Cabrera

    2014-01-01

    Full Text Available Se realizó una investigación observacional, descriptiva y transversal con el propósito de conocer el comportamiento de la publicación científica de los bibliotecarios de la salud en la provincia de Santiago de Cuba, desde enero de 1998 hasta agosto de 2013, para lo cual se efectuó una revisión exhaustiva de los artículos de su autoría en la revista MEDISAN y a través de los buscadores de Internet y de las revistas médicas cubanas. Los resultados revelaron que un número muy reducido de bibliotecarios publicaba como autores principales o coautores, a pesar de que existían problemas científicos identificados en sus unidades, susceptibles de ser investigados; contaban en sus bibliotecas con recursos tecnológicos y acceso a información actualizada; poseían calificación profesional y disponían en el territorio de la revista MEDISAN -- publicación de mayor producción científica en el país en materia de salud. -- Lo obtenido en este estudio pudiera estar relacionado con el poco desarrollo de la competencia investigativa, lo que evidencia la necesidad de ejecutar acciones que permitan alcanzarla, como corresponde a los bibliotecarios del siglo XXI

  7. Seeing Red

    2008-01-01

    This New Horizons image of Jupiter's volcanic moon Io was taken at 13:05 Universal Time during the spacecraft's Jupiter flyby on February 28, 2007. It shows the reddish color of the deposits from the giant volcanic eruption at the volcano Tvashtar, near the top of the sunlit crescent, as well as the bluish plume itself and the orange glow of the hot lava at its source. The relatively unprocessed image on the left provides the best view of the volcanic glow and the plume deposits, while the version on the right has been brightened to show the much fainter plume, and the Jupiter-lit night side of Io. New Horizons' color imaging of Io's sunlit side was generally overexposed because the spacecraft's color camera, the super-sensitive Multispectral Visible Imaging Camera (MVIC), was designed for the much dimmer illumination at Pluto. However, two of MVIC's four color filters, the blue and 'methane' filter (a special filter designed to map methane frost on the surface of Pluto at an infrared wavelength of 0.89 microns), are less sensitive than the others, and thus obtained some well-exposed views of the surface when illumination conditions were favorable. Because only two color filters are used, rather than the usual three, and because one filter uses infrared light, the color is only a rough approximation to what the human eye would see. The red color of the Tvashtar plume fallout is typical of Io's largest volcanic plumes, including the previous eruption of Tvashtar seen by the Galileo and Cassini spacecraft in 2000, and the long-lived Pele plume on the opposite side of Io. The color likely results from the creation of reddish three-atom and four-atom sulfur molecules (S3 and S4) from plume gases rich in two-atom sulfur molecules (S2 After a few months or years, the S3 and S4 molecules recombine into the more stable and familiar yellowish form of sulfur consisting of eight-atom molecules (S8), so these red deposits are only seen around recently-active Io volcanos. Though the plume deposits are red, the plume itself is blue, because it is composed of very tiny particles that preferentially scatter blue light, like smoke. Also faintly visible in the left image is the pale-colored Prometheus plume, almost on the edge of the disk on the equator at the 9 o'clock position. Io was 2.4 million kilometers from the spacecraft when the picture was taken, and the center of Io's disk is at 77 degrees West longitude, 5 degrees South latitude. The solar phase angle was 107 degrees.

  8. Escuela, educación y territorio. La organización en red local como estructura innovadora de atención a las necesidades socioeducativas de una comunidad

    Jordi Longás

    2008-01-01

    Full Text Available En la actualidad emergen diversas experiencias que tienen el territorio como referente de la acción socioeducativa, buscando salida a “crisis” de la escuela. En este contexto, las experiencias de trabajo en redes locales apuntan hacia un nuevo paradigma de la intervención pedagógica de gran interés por sus valores de horizontalidad, transversalidad, territorialidad y corresponsabilidad, capaces de abrir la escuela a su entorno y de aportar un notable capital social al municipio. El artículo presenta el marco teórico que las sustenta y compara diversas experiencias del ámbito catalán, infiriendo las premisas de una praxis posible y coherente para abordar los retos socioeducativos de una comunidad y favorecer su desarrollo comunitario. ---------------------------------------------------------------------------- At the present there is a great quantity of new experiences where the socieducative action is linked to the territory and the community in order to help the school to overcome its “crisis”. In this context, the experiences of work in local networks are aiming towards a new paradigm of the pedagogical intervention that is of great interest because of their values of horizontality, transversality, territoriality and coresponsibility. Thus, these experiences help the school to open itself to its environement and contribute with a significant social capital to the municipality. The article shows light to the theoretical framework that sustains these experiences and compares some of the catalan ones, inferring the premises of a possible and coherent praxis to approach the socioeducative challenges of the community and to allow its development.

  9. Una red para promover sistemas de salud basados en la atención primaria de salud en la Región de las Américas A network to promote health systems based on primary health care in the Region of the Americas

    María Magdalena Herrera Vázquez

    2007-05-01

    Full Text Available OBJETIVOS: Identificar los componentes relacionales de una red internacional de organizaciones de cooperación técnica y financiera que promueva el desarrollo de sistemas de salud basados en la atención primaria de salud (APS en los países de la Región; analizar los vínculos de acción social para la cooperación en salud entre los socios colaboradores de la Organización Panamericana de la Salud (OPS; y determinar los elementos teóricos básicos que pueden contribuir a desarrollar estrategias de acción que respalden la abogacía en red. MÉTODOS: Estudio transversal cualitativo y cuantitativo basado en la identificación de informantes clave y el análisis de redes sociales. Se colectó información etnográfica y relacional de 46 organizaciones internacionales mediante un cuestionario semiestructurado autoaplicado. Participaron 29 tomadores de decisión pertenecientes a 29 organizaciones de cooperación internacional en salud (tasa de respuesta: 63,0%. La estructura y solidez de la red se evaluó mediante la densidad, la distancia, la transitividad y la centralización de los nodos. El análisis estadístico se realizó mediante los programas informáticos UCINET, PAJEK y MS Access, entre otros. RESULTADOS: Se identificó una red teórica estructuralmente centralizada, cuyos nodos aglutinados en cuatro subgrupos centrales se vincularon en una visión compartida. El liderazgo, la influencia y los intereses políticos reflejaron los vínculos cooperativos de tipo formal y técnico y el apoyo formal a favor de la propuesta, con el predominio del flujo de recursos técnicos sobre los financieros. CONCLUSIONES: Los componentes relacionales interorganizacionales y los vínculos de acción social identificados pueden influir positivamente en la conformación y consolidación de una red temática de abogacía y gestión para la cooperación técnica y financiera en apoyo a la APS en la Región de las Américas. Los vínculos de acción identificados pueden favorecer la cooperación internacional en el desarrollo de sistemas de salud basados en la APS, una vez que la OPS formule estrategias de implementación claras y tome el liderazgo para movilizar recursos financieros y generar vínculos de acción informal e interpersonal.OBJECTIVES: To identify the relational components of an international network of organizations that provide technical and financial assistance to promote the development of health systems based on primary health care in the countries of the Region of the Americas; to analyze the linkages that would allow the collaborating partners of the Pan American Health Organization (PAHO to work together on health issues; and to determine the basic theoretical elements that can help to develop action strategies that support advocacy efforts by a network. METHODS: This was a qualitative and quantitative cross-sectional study based on identifying key informants and on analyzing social networks. Ethnographic and relational information from 46 international organizations was collected through a self-administered semistructured questionnaire. From 46 international health cooperation organizations, 29 decisionmakers from 29 organizations participated (63.0% response rate. The structure and the strength of the network was evaluated in terms of density, closeness, clustering, and centralization. The statistical analysis was done using computer programs that included UCINET, Pajek, and Microsoft Access. RESULTS: We found a structurally centralized theoretical network, whose nodes were clustered into four central subgroups linked by a shared vision. The leadership, influence, and political interests reflected the formal and technical-cooperation linkages, the formal support for health systems based on primary health care, and the flow of resources being more often technical ones than financial ones. CONCLUSIONS: The interorganizational relational components and the social-action ties that were identified could help in the development and consolidation of a thematic network for advocacy and for the management of technical and financial assistance that supports primary health care in the Americas. The linkages for joint action that were identified could advance international cooperation in developing health systems based on primary health care, once PAHO formulates clear implementation strategies and takes a leadership position in mobilizing financial resources and in creating informal and interpersonal linkages for action.

  10. VALIDACIÓN INTRALABORATORIO DE UNA METODOLOGÍA ANALÍTICA POR ESPECTROFOTOMETRÍA UV/VIS PARA EVALUAR EL POTENCIAL IRRITANTE OCULAR DE TENSOACTIVOS EN GLÓBULOS ROJOS INTRALABORATORY VALIDATION OF AN ANALYTICAL METHODOLOGY BY UV/VIS SPECTROMETRY IN ORDER TO EVALUATE THE OCULAR IRRITANT POTENTIAL OF TENSOACTIVES IN RED BLOOD CELLS

    Luz A LEGUIZAMÓN B

    2011-04-01

    Full Text Available Se presentan los resultados de la validación intralaboratorio para los parámetros de linealidad, repetibilidad y precisión intermedia del ensayo en glóbulos rojos, metodología in vitro empleada para evaluar la irritación ocular. Este ensayo evaluó los efectos nocivos de los tensoactivos sobre membranas y proteínas celulares, y constituye así una alternativa al test de Draize. A través de espectrofotometría UV/VIS a 577 nm se midió la hemoglobina liberada tras la lisis de los glóbulos rojos, estimando la concentración hemolítica 50 (CH50, que constituye un indicador del daño celular ocasionado por el tensoactivo. El ensayo también consideró la desnaturalización de hemoglobina, causada por altas concentraciones del tensoactivo, por la relación de absorbancias a 542 y 577 nm, estimando el índice de desnaturalización (ID. La relación CH50/ID es un indicador cuantitativo del potencial irritante del dodecilsulfato de sodio (SDS, surfactante con el que se validó este ensayo. Se logró la validación de los parámetros señalados y se ofrece una metodología confiable y de fácil ejecución, alternativa al uso de animales, para evaluar la irritación ocular de tensoactivos.Red blood cell assay (RBC intralaboratory validation was presented, specifically for linearity, repeatability and intermediate precision. RBC is an in vitro methodology employed for ocular irritation evaluation measuring surfactants adverse effects on cell membranes and proteins and is an alternative for Draize ocular test. Free hemoglobin after red blood cell lysis was determined through spectrometry at 577 nm in order to estimate medium hemolytic concentration (HC50 indicating cell damage by surfactant. Also hemoglobin denaturation induced by high concentrations of surfactants was considered measuring denaturation index (DI through absorbance ratio at 542 and 577 determinations. HC50 / DI is an indicator of the dodecylsulphate (SDS irritant potential, surfactant used in order to validate this assay. Parameters previously mentioned were validated and we present an easy and reliable alternative methodology for animal experimentation to assess surfactants ocular irritation for SDS.

  11. Educación en medios en Turquía: hacia una red de actores múltiples Media Education in Turkey: Toward a Multi-Stakeholder Framework

    E. Nezih Orhon

    2009-03-01

    Full Text Available A partir de los noventa, los canales privados de radio y televisión pusieron las bases de la nueva estructura mediática turca. No hubo en este momento interés alguno por la alfabetización mediática ni por la educación popular sobre los medios de comunicación social, ni siquiera en la juventud. Hasta 2006 no comienzan en Turquía los primeros pasos para una alfabetización y educación mediáticas con un acuerdo entre el Ministerio de Educación y el Consejo Supremo de Radio y Televisión (RTÜK. La agenda de la alfabetización mediática ha de incluir importantes temas, co mo democracia, ciudadanía, derechos humanos, libertad de expresión, identidad, necesidades especiales, cuestiones de discriminación de género… Mediante un enfoque crítico, se reflexiona sobre lo que hasta ahora se ha hecho en Turquía en términos de alfabetización y educación en medios, y lo que se quiere lograr en el futuro. Starting with the 1990s, private radios and televisions were the primary steps in Turkish media’s new structure. At that time, there was no interest in media literacy or media education for people, especially for children. In the past, the emphasis of media literacy education was to protect children and young people from possible harmful effects of media, followed by the critical thinking and development of media messages production skills. This contribution emphasizes the political, social, and economic implications of media messages and stresses the importance of using media effectively. Media literacy and education in Turkey has started with an agreement between the Ministry of National Education and The Radio and Television Supreme Council (RTÜK in 2006/07 school period.This study uses a critical approach to reflect on what has been done so far in Turkey in terms of media literacy and media education, and what needs to be accomplished in the future.

  12. Representao social da depresso em uma Instituio de Ensino da Rede Pblica / Depression and teenagers in a Public Education's Institution / Representacin social de la depresin en una Institucin de Enseanza de la Red Pblica

    Karla Carolina Silveira, Ribeiro; Maria da Penha de Lima, Coutinho; Emily da Silva, Nascimento.

    2010-09-01

    Full Text Available Esta pesquisa objetivou apreender as representaes sociais da depresso de adolescentes do ensino mdio, em uma escola de Joo Pessoa-PB. Participaram do estudo 276 adolescentes, de ambos os sexos e faixa etria entre 14 e 17 anos. Os instrumentos usados na pesquisa foram: o Inventrio da Depresso [...] Infantil (CDI) e a tcnica projetiva do desenho-histria com tema. Os resultados indicaram que a depresso est associada a quatro aspectos: psicoafetivos, com as subcategorias depresso como sinnimo de tristeza e desiluso amorosa; psicossocial, com a subcategoria dificuldade de relacionamento social, e idias mrbidas, com a subcategoria ideia de morte e/ou ideao suicida. Essas associaes so resultado tanto das vivncias dos adolescentes como das informaes e representaes vinculadas ao seu grupo de pertena, apontando a necessidade de prticas preventivas e educacionais nas instituies de ensino. Abstract in spanish Esta pesquisa tuvo el objetivo de aprehender las representaciones sociales de la depresin de adolescentes de la enseanza media, en una escuela de Joo Pessoa-PB. Participaron del estudio 276 adolescentes, de ambos sexos y franja de edad entre 14 y 17 aos. Los instrumentos usados en la pesquisa fu [...] eron: el Inventario de la Depresin Infantil (CDI) y la tcnica proyectiva del dibujohistoria con tema. Los resultados indicaron que la depresin est asociada a cuatro aspectos: psicoafectivos, con las sub-categoras depresin como sinnimo de tristeza y desilusin amorosa; psicosocial, con la sub-categora dificultad de relacionamiento social, e ideas mrbidas, con la sub-categora idea de muerte y/o ideacin suicida. Esas asociaciones son resultado tanto de las vivencias de los adolescentes como de las informaciones y representaciones vinculadas a su grupo de pertenencia, apuntando la necesidad de prcticas preventivas y educacionales en las instituciones de enseanza. Abstract in english This research aimed to apprehend the social representations of depression held by teenagers in a high school in Joo Pessoa, PB. The study included 276 adolescents, male and female, aged between 14 and 17 years. The instruments used in the research were the Children's Depression Inventory (CDI) and [...] the projective technique drawing-story with theme. The results indicated that depression is associated with four aspects: psychological and affective, with the subcategories depression as a synonym of sadness and loving disappointment; psychosocial, with the subcategory difficulty of social relationship; morbid ideas, with the subcategory idea of death and/or suicidal ideation. These associations are the result of the adolescents experiences, as the information and representations linked to his group of belonging, pointing the need for preventive and educational practices in the institutions of education.

  13. Establishing an early warning alert and response network following the Solomon Islands tsunami in 2013 / ???????? ??????? ??????? ?????????????? ? ???????? ??? ????? ?????? 2013 ???? ?? ??????????? ???????? / tablissement d'un rseau d'alerte et d'intervention rapides aprs le tsunami des les Salomon de 2013 / ????? ???? ??????? ?????? ????????? ??? ????? ??????? ?? ??? ??????? ??? 2013 / 2013????????????????????? / Establecer una red de alerta y respuesta temprana tras el tsunami de las Islas Salomn de 2013

    Augustine, Bilve; Francisco, Nogareda; Cynthia, Joshua; Lester, Ross; Christopher, Betcha; Kara, Durski; Juliet, Fleischl; Eric, Nilles.

    2014-11-01

    Full Text Available Resumen Situacon El 6 de febrero de 2013, un terremoto de magnitud de 8,0 dio lugar a un tsunami que azot las islas Santa Cruz, en las Islas Salomn, que caus la muerte de 10 personas y despla [...] z a ms de 4700. Enfoque Una evaluacin posterior a la catstrofe sobre el riesgo de transmisin de enfermedades epidmicas recomienda la aplicacin de una red de alerta y respuesta temprana (EWARN) a fin de detectar, evaluar y responder rpidamente a los posibles brotes de enfermedades a raz del tsunami. Marco regional La catstrofe desplaz a casi el 40% de la poblacin de las islas de Santa Cruz, la cual vive en campamentos temporales abarrotados con instalaciones sanitarias deficientes o inexistentes e insuficiente acceso al agua potable. No se dispona de un sistema de vigilancia de enfermedades para la alerta temprana. Cambios importantes El 25 de febrero, un EWARN entr en funcionamiento en cinco centros de salud que atendan al 90% de la poblacin desplazada. Cada semana se notificaron ocho enfermedades o sndromes prioritarios, por otro lado, los eventos de salud inesperados se comunicaron de inmediato. Entre el 25 de febrero y el 19 de mayo, se notificaron 1177 casos de enfermedades o sndromes diana. Se examinaron siete alertas. No se identificaron transmisiones o epidemias prolongadas. El cumplimiento de las notificaciones fue del 85%. Posteriormente, el EWARN se transfiri al sistema de vigilancia sistemtica de enfermedades para la alerta temprana de cuatro sndromes. Lecciones aprendidas Fue necesario realizar una evaluacin completa para evaluar el riesgo y el impacto posible de brotes de enfermedades infecciosas graves, as como evaluar si y cmo debe aplicarse una mejor vigilancia de enfermedades para la alerta temprana. Debe considerarse la capacidad local y los recursos disponibles en la planificacin de la ejecucin del EWARN. Un EWARN puede representar una oportunidad para establecer o reforzar la capacidad de vigilancia de enfermedades para la alerta temprana. Abstract in english Problem On 6 February 2013, an 8.0 magnitude earthquake generated a tsunami that struck the Santa Cruz Islands, Solomon Islands, killing 10 people and displacing over 4700. [...] Approach A post-disaster assessment of the risk of epidemic disease transmission recommended the implementation of an early warning alert and response network (EWARN) to rapidly detect, assess and respond to potential outbreaks in the aftermath of the tsunami. Local setting Almost 40% of the Santa Cruz Islands population were displaced by the disaster, and living in cramped temporary camps with poor or absent sanitation facilities and insufficient access to clean water. There was no early warning disease surveillance system. Relevant changes By 25 February, an EWARN was operational in five health facilities that served 90% of the displaced population. Eight priority diseases or syndromes were reported weekly; unexpected health events were reported immediately. Between 25 February and 19 May, 1177 target diseases or syndrome cases were reported. Seven alerts were investigated. No sustained transmission or epidemics were identified. Reporting compliance was 85%. The EWARN was then transitioned to the routine four-syndrome early warning disease surveillance system. Lesson learnt It was necessary to conduct a detailed assessment to evaluate the risk and potential impact of serious infectious disease outbreaks, to assess whether and how enhanced early warning disease surveillance should be implemented. Local capacities and available resources should be considered in planning EWARN implementation. An EWARN can be an opportunity to establish or strengthen early warning disease surveillance capabilities.

  14. El papel de las tarifas de interconexin en las industrias en red

    Herguera-Garca, Iigo; Jos G. AGUILAR-BARCEL

    2004-01-01

    El anlisis de las industrias en red ha tomado una fuerza inusitada durante la ltima dcada. La lnea de investigacin emprende su consolidacin y muchos resultados empiezan a tomar ya, el apelativo de clsicos. En este documento se presenta una somera descripcin acerca de las industrias que operan en red y sus particularidades, centrndose en una de las ms importantes: la interconexin entre operadores. Se comenta la intuicin econmica detrs de este concepto y las dificultades com...

  15. Comparación de la Evaluación Tradicional del Desarrollo Psicomotor versus una Prueba Autoadministrada Comparison of Traditional Psychomotor Development Evaluation versus a Self-Administe-red Test?

    LUISA SCHONHAUT B

    2010-12-01

    Full Text Available Introducción: El propósito del estudio fue evaluar la aplicabilidad de un cuestionario de autoreporte para el screening del desarrollo psicomotor (DSM en atención primaria de salud (APS. Para ello se analizó el grado de acuerdo entre el cuestionario Ages and Stages (ASQ y la Escala de Evaluación del Desarrollo Psicomotor (EEDP, que es el método empleado de rutina en APS. Además, se exploraron las percepciones y valoraciones comparativas de profesionales que participaron en la aplicación de dichos test. Metodología: Estudio cuanti-cualitativo, realizado entre noviembre 2008 y diciembre 2009. En 2 centros de Salud de la Región Metropolitana de Chile se reclutó lactantes nacidos de término, que acudieron a control sano. A los 8 y 18 meses se les solicitó a los padres o cuidadores principales completar el ASQ y un profesional de APS aplicó el EEDP. Se midió la correlación y concordancia entre ambos test. Se aplicaron entrevistas individuales y mini focus groups a los profesionales participantes en las evaluaciones. Resultados: Fueron reclutados 330 lactantes. La frecuencia de déficit del DSM fue 8,79% en EEDP y 12,73% en ASQ (p0,05. Hubo correlación entre ambas evaluaciones (r 0,5 y la concordancia en la pesquisa de déficit de DSM fue buena (kappa 0.576. En el análisis cualitativo destacó la valoración positiva del ASQ, tanto como instrumento de medición, como guía para promover el DSM. Para suplir las debilidades del ASQ, relacionadas con la modalidad de autoreporte, en grupos de mayor riesgo socio cultural o educacional, los centros de salud adoptaron diferentes estrategias. Conclusiones: El ASQ pesquisó significativamente más déficits del DSM que el EEDP, mientras que la correlación y concordancia entre ambas pruebas fueron adecuadas. Considerando las ventajas comparativas del ASQ en opinión de los profesionales, se propone que los centros de APS que deseen implementar ASQ, tomen una estrategia progresiva basada en la integración de los padres, madres y cuidadores en la observación del desarrollo de sus hijos.Introduction: The purpose of this study is to evaluate the applicability of a self-administered questionnaire in the screening of psychomotor development (PD in a primary care setting (PC. For that purpose, the degree of concordance between the Ages and Stages Questionnaire (ASQ and a Psychomotor Development Evaluation Scale (Escala de Evaluación del Desarrollo Psicomotor-EEDP currently utilized in PC was tested. In addition, perceptions and value judgment by professionals who participated in the study were explored. Methodology: This semi-quantitative study was performed between November 2008 and December 2009 in two PC centers of the Metropolitan Area of Chile on full-term newborns of the well-baby clinic. At age 8 and 18 months, parents or primary caretakers were asked to fill out the ASQ, and a PC professional completed the EEDP. Correlation and concordance between both tests was measured. Interviews and mini-focus groups were con-ducted with the participating professionals. Results: Three hundred and thirty newborns were recruited in the study. PD deficits were found on 8.79% of patients through the use of EEDP and in 12.73% through the use of ASQ (p = 0,05. Correlation between both evaluations was acceptable (r 0,5 as was concordance in deficit detection (kappa 0.576. The qualitative analysis showed appreciation of ASQ as a measuring tool as well as promoting awareness of PD. Staff of the PC settings utilized various strategies to overcome deficiencies of a self-administered test in populations of higher socio-educational and cultural risk. Conclusions: ASQ picked up significantly more PM deficits than EEDP, while correlation and concordance indices between both tests were adequate. Considering the subjective advantages expressed by staff in favor of ASQ, it is proposed that those PC centers that wish to implement the ASQ do so by progressively incorporating parents and caretakers into the observation of their children's development.

  16. Precarizao do trabalho docente numa escola de rede privada do subrbio carioca / Job insecurity for teachers in a private school of suburbs of Rio de Janeiro / Precarizacin del trabajo docente en una escuela de la red privada del suburbio de Rio de Janeiro

    Angela Cristina Fortes, Irio; Isabel Alice Oswald Monteiro, Lelis.

    2015-03-01

    Full Text Available O artigo aborda o trabalho docente a partir do recorte de uma pesquisa de mestrado realizada numa escola da rede privada do subrbio carioca, que atende nova classe mdia. Entrevistas com oito professoras do primeiro segmento do ensino fundamental da instituio e a observao do espao da sala de [...] professores foram as principais estratgias metodolgicas usadas. Investigaram-se, particularmente, as condies de trabalho das professoras e como se processa o desenvolvimento profissional. Evidenciou-se a precarizao do trabalho docente em funo dos baixos salrios, da intensificao das tarefas, da ausncia de uma poltica de formao e de uma lgica organizacional que no favorece o partilhar dos saberes entre os professores. Alm disso, essa lgica organizacional, fundada em dispositivos de regulao no cumprimento de prazos, de controle da prtica docente e orientada por manuais pedaggicos e softwares educativos, compromete a autonomia das professoras e o desenvolvimento de um clima colaborativo. Abstract in spanish El artculo aborda el trabajo docente desde el punto de vista de una investigacin de maestra realizada en una escuela de la red privada del suburbio de Rio de Janeiro, que atiende a la nueva clase media. Entrevistas con ocho maestras del primer segmento de educacin bsica de la institucin y la o [...] bservacin del espacio de la sala de profesores fueron las principales estrategias metodolgicas utilizadas. Se investigaron sobre todo las condiciones de trabajo de las profesoras y la forma en que se procesa el desarrollo profesional. Se puso de manifiesto la precarizacin del trabajo docente en funcin de los bajos salarios, de la intensificacin de las tareas, de la ausencia de una poltica de formacin y de una lgica organizativa que no favorece la puesta en comn de los saberes entre los profesores. Adems, esta lgica organizativa, que se basa en dispositivos de regulacin en el cumplimiento de plazos, de control de la prctica docente y se orienta por manuales pedaggicos y softwares educativos, compromete la autonoma de las maestras y el desarrollo de un clima colaborativo. Abstract in english This article addresses the work of teaching, based on a section of a Master's degree study performed in a school of a private network in suburban Rio de Janeiro, which serves the new middle class. Interviews with eight teachers from the first segment of elementary education of the institution, and [...] the observation of the space in the teachers' room, were the main methodological strategies used. Specifically, the working conditions of the teachers and the way in which professional development proceeds were investigated. Evidence was seen of the precariousness of teaching as a function of the low salaries, the intensifying of tasks, the lack of a professional development policy, and an organizational logic that does not facilitate the sharing of knowledge among teachers. Additionally, that organizational logic, based on devices to control the meeting of deadlines and the practice of teaching, and guided by pedagogic manuals and educational software, compromises the autonomy of the teachers and the development of a climate of collaboration.

  17. Bicentenarios digitales: celebraciones en la red

    Alvar de la Llosa

    2011-01-01

    Si  la celebración del primer centenario de las independencias de los países americanos se valió de las innovaciones de los medios de comunicación de su época, en particular del cine, hoy en día los gobiernos han asaltado la Red y se han apoderado del media para difundir una versión oficial. Conviene por lo tanto ver cómo los diferentes países latinoamericanos construyen este Bicentenario siempre de modo nacional y unilateral y nunca transnacional, en el marco de unas fronteras modernas a pes...

  18. RED-LETTER DAYS

    The word "red-letter" is an adjective meaning "of special significance." It's origin is from the practice of marking Christian holy days in red letters on calendars. The "red-letter days" to which I refer occurred while I was a graduate student of ...

  19. Proceso de formación de una red regional: Región turística de las Agulhas Negras - RJ - Brasil The Process of Construction of Tourism Regional networks: The Tourist Region of Agulhas Negras-RJ, Brazil

    Aguinaldo Cesar Fratucci

    2011-12-01

    Full Text Available Este artículo se propone analizar el proceso de constitución de las redes regionales de turismo establecidas a partir de la estructuración de territorios-redes a escala regional. Basándose en las categorías de territorio-red y redes regionales y en la región turística de las Agulhas Negras-RJ, Brasil, como objeto empírico de observación, este estudio propone que la consolidación de redes regionales de turismo puede estructurar nuevas instancias público-privadas de gestión del ordenamiento del desarrollo turístico; como es el caso del CONRETUR de las Agulhas Negras. Se realizó una investigación estructurada principalmente a partir de la técnica de la observación participante, además de entrevistas personales y por medios electrónicos.This article aims at analyzing the process of constitution of tourism regional networks established from the structuring of networks-territories in regional scale. Having as theoretical basis territory-network and regional network basis as well as the tourist region of Agulhas Negras-RJ as empirical object, this text proposes that the consolidation of tourism regional networks may structure new public-private instances of tourist development reordering, as in the case of CONRETUR Agulhas Negras - RJ. In order to do that, structured researches have been used, mainly from the technique of participant observation, besides personal interviews and electronic means.

  20. weego: Una red social turística

    Mac Adden, Patricio

    2011-01-01

    La tecnología avanza velozmente y todos los aspectos de nuestra vida se ven afectados por los avances tecnológicos. En la actualidad es común que al realizar viajes utilicemos dispositivos GPS (Global Positioning System), que no sólo nos permite consultarlo a modo de mapa sino que además nos da indicaciones acerca de qué ruta utilizar para llegar a un sitio de la manera más rápida (en tiempo), más corta (en distancia) o incluso más económica. La evolución del hardware se ve estrechamente liga...

  1. Rede social de apoio à família de crianças internadas em uma unidade de terapia intensiva pediátrica Red social de apoyo a la familia de niños internados en una unidad de cuidados intensivos pediátrica Support netwrok to the families of children admitted in a pediatric intensive care unit

    Liliane Yukie Hayakawa

    2010-06-01

    Full Text Available No intuito de compreender como se compõem a rede social/apoio das famílias de crianças internadas na UTIP e a importância delas na vida desses familiares, realizou-se um estudo descritivo, com abordagem qualitativa, junto a 21 pais de crianças internadas em um hospital escola de Maringá, norte do Paraná. Observou-se que, a rede social/apoio à família constituía-se em um misto de afetividade, fé e solidariedade, enquanto componentes fundamentais para o alivio do sofrimento e suporte extra-hospitalar. O estudo demonstrou ainda, que o trabalho com famílias deve ser permeado pela especial atenção às peculiaridades que cercam cada contexto familiar e suas relações, o que ratifica a importância da atuação mais global da enfermagem, compreendendo melhor as múltiplas influências das diferentes configurações de rede de apoio familiar e social sobre a qualidade e efetividade das intervenções implementadas.Con la meta de comprender cómo se compone la red social/apoyo de las familias de niños internados en la UCIP y la importancia de ellos en la vida de esos familiares, se realizó un estudio descriptivo, con abordaje cualitativo, junto a 21 padres de niños internados en un hospital escuela de Maringá, norte de Paraná. Se observó que, la red social/apoyo a la familia se constituía en una mezcla de afectividad, fe y solidariedad, en cuanto componentes fundamentales para el alivio del sufrimiento y soporte extra-hospitalario. El estudio demostró aun, que el trabajo con familias debe ser permeado por la especial atención a las peculiaridades que cercan cada contexto familiar y sus relaciones, lo que ratifica la importancia de la actuación más global de la enfermería, comprendiendo mejor las múltiplas influencias de las diferentes configuraciones de red de apoyo familiar y social sobre la calidad y efectividad de las intervenciones implementadas.With the intention of understanding how the support network of the families of children admitted in a hospital Pediatric Intensive Care Unit (PICU is established, and its importance in the life of their relatives, a descriptive study with qualitative approach was carried out with 21 parents of children admitted in a PICU of a University Hospital located in the northwest area of Paraná State. It was observed that, the support network to the families was made of a mixed of affectivity, faith and solidarity as the fundamental components to relieve the suffering and out-of-hospital support. The study also showed, that the work with families should be permeated by the special attention to the peculiarities that surround each family context and its relationships, what ratifies the importance of a more comprehensive performance of nursing, better understanding the multiple influences of the different configurations of the family and social support network on the quality and effectiveness of the implemented interventions.

  2. OPTIMIZACIN DE UNA RED DE TRANSPORTE COMBINADO PARA LA EXPORTACIN DEL CARBN DEL INTERIOR DE COLOMBIA / OPTIMIZATION OF A COMBINED EXPORT COAL TRANSPORT NETWORK FROM THE INTERIOR OF COLOMBIA / OTIMIZAO DE UMA REDE DE TRANSPORTE COMBINADO PARA A EXPORTAO DO CARVO DO INTERIOR DA COLMBIA

    Luis Gabriel, Mrquez.

    2011-12-01

    Full Text Available Estuda-se uma rede de transporte combinado na Colmbia, com horizonte no ano 2019, com o propsito de identificar as rotas timas do carvo desde os distritos de produo localizados no interior do pas at os portos martimos de exportao. A metodologia utilizada baseia-se na busca de soluo a um [...] problema de fluxo de mnimo custo que considera as redes de transporte rodoviria, fluvial e ferroviria, em um modelo que contm 34.000 km de rede representados em 1.864 arcos. O modelo considera novas infraestruturas ferrovirias e porturias e sugere que se devem transportar os carves do interior do pas pelo porto de Barranquilla mediante estratgias de integrao ferroviria-fluvial e rodoviria-fluvial. Ressalta-se a importncia do rio Magdalena como infraestrutura estratgica de transporte e identificam-se trs centros de transferncia de mercadorias localizados em Barrancabermeja, Bocas del Carare e Capulco, que em conjunto chegariam a manejar 18 milhes de toneladas de carvo ao ano. Abstract in spanish Se estudia una red de transporte combinado en Colombia, con horizonte en el ao 2019, con el propsito de identificar las rutas ptimas del carbn desde los distritos de produccin localizados en el interior del pas hasta los puertos martimos de exportacin. La metodologa utilizada se basa en la [...] bsqueda de solucin a un problema de flujo de mnimo costo que considera la red de transporte por carretera, la fluvial y ferroviaria, en un modelo que contiene 34.000 km de red representados en 1.864 arcos. El modelo considera nuevas infraestructuras ferroviarias y portuarias y sugiere que se deben transportar los carbones del interior del pas por el puerto de Barranquilla mediante estrategias de integracin ferroviaria-fluvial y carretera-fluvial. Se resalta la importancia del ro Magdalena como infraestructura estratgica de transporte y se identifican tres centros de transferencia de carga localizados en Barrancabermeja, Bocas del Carare y Capulco, que en conjunto llegaran a manejar 18 millones de toneladas de carbn al ao. Abstract in english A combined transport network is studied with planning perspective in 2019, in order to identify optimal routes for transporting coal from centrally located sites within Colombia to export ports. Methodology based on the solution to minimum cost flow problem is used, including transport networks: roa [...] d, river and railway, in a model composed of 34.000 km represented in 1.864 links. Both new rail and new export port infrastructure are included in the model. Model indicates centrally located coal within Colombia must be transported through the port of Barranquilla, using integration strategies, such as rail-river and road-river. The importance of the Magdalena River as strategic transport infrastructure is highlighted and three cargo transfer centers are identified near Barrancabermeja, Bocas del Carare and Capulco, which together could handle 18 million tons of coal per year.

  3. Inquiring into Red/Red Inquiring

    Ken Gale

    2013-05-01

    Full Text Available This layered account of an inquiry into ‘red’ emerged out of a collective biography workshop. In the middle of the Wiltshire countryside, an international and interdisciplinary group of scholars gathered together to write and make other things and marks on paper that asked questions of, and into, the spaces between words, people, things and their environments. We did not set out to workshop or write into or paint ‘red’ but, rather, it was red that slipped in, uninvited, and painted and wrote us. Red arose as a blush or a stain seeping amongst us that became referenced obliquely by material objects, metaphors and fairytales. The stain spread, became noticeable through our weekend together and beyond it, creating another (bright red artery vein of connection to write with.

  4. Rede social e virtual de apoio ao adolescente que convive com doena crnica: uma reviso integrativa / Social and Virtual Support Network for Teenagers Living with Chronic Disease: An Integrative Review / Red social y virtual de apoyo al adolescente que convive con enfermedad crnica: una revisin integradora

    Gabriela, Silva dos Santos; Cludia Mara, de Melo Tavares; Rejane, Eleutrio Ferreira; Cosme Sueli, de Faria Pereira.

    2015-01-01

    Full Text Available Objetivo: identificar o papel do enfermeiro na rede social e virtual de apoio aos adolescentes que convivem com o diagnstico de doena crnica. Metodologia: trata-se de uma reviso integrativa, realizada na base de dados: MEDLINE, LILACS e BDENF, no perodo de junho a novembro de 2013, com artigos [...] indexados a partir de 2008 at 2013 e os descritores: "enfermagem", "apoio social", "adolescentes", "doenas crnicas" e "rede social". Resultados: os artigos descrevem que o apoio social de forma direta aos portadores de doenas crnicas ou por meio do apoio que os pais recebem, afetar positivamente no estado de sade do portador. Concluso: o enfermeiro deve estar preparado para fornecer o apoio necessrio s famlias e ao portador de doena crnica com o objetivo de melhorar a sade do paciente. Esse apoio por meio das redes sociais virtuais um novo mtodo que vem conquistando espao e trazendo grandes benefcios para esses pacientes e seus familiares. Abstract in spanish Objetivo: identificar el rol del enfermero en la red social y virtual de apoyo a los adolescentes que conviven con el diagnstico de enfermedad crnica. Metodologa: se trata de una revisin integradora, realizada en la base de datos: MEDLINE, LILACS e BDENF, en el periodo de junio a noviembre de 20 [...] 13, con artculos indexados del 2008 hasta el 2013 y los descriptores: enfermera, apoyo social, adolescentes, enfermedades crnicas y red social. Resultados: los artculos describen que el apoyo social de forma directa a los portadores de enfermedades crnicas o por medio del apoyo que los padres reciben, afectar positivamente en el estado de salud del portador. Conclusin: el enfermero debe estar preparado para brindarles el apoyo necesario a las familias y al portador de enfermedad crnica con el objetivo de mejorar la salud del paciente. Este apoyo por medio de las redes sociales virtuales es un nuevo mtodo que ha conquistado espacio y trado grandes beneficios para dichos pacientes y sus familiares. Abstract in english Purpose: The study was intended to identify the nurse's role in social and virtual support networks for adolescents who live with a chronic disease diagnosis. Methodology: This is an integrative review conducted in several databases (MEDLINE, LILACS and BDENF) during the period from June to November [...] 2013, with articles indexed from 2008 to 2013. Nursing, social support, adolescents, chronic diseases, and social network were the descriptors used. Findings: The articles explain that social support provided directly to patients with chronic diseases, or through support the parents receive, will have a positive impact on the health of the patient with a chronic disease. Conclusion: Nurses must be prepared to provide the necessary support to patients with a chronic disease and their families, in the hope of improving the patient's health. This support provided through virtual social networks constitutes a new method that has gained space and brought considerable benefit to chronically ill patients and their families.

  5. Factores pronsticos y sobrevida a mediano plazo de una cohorte de pacientes con cncer pulmonar atendidos en la red de salud de la Universidad Catlica: Perodo 2007-2011 / Prognostic factors and short-term survival of a cohort of adult patients with lung cancer treated in a network of health, 2007-2011

    ARTURO, MORALES S; CARLOS, CALVO D; SERGIO, GONZLEZ B; ORLANDO, DAZ P; FERNANDO, SALDAS P.

    2014-12-01

    Full Text Available El cncer pulmonar es la principal causa de muerte por neoplasia a nivel mundial. En Chile se desconoce la magnitud del problema y la sobrevida asociada al diagnstico. Material y Mtodos: Se examin una cohorte de 202 pacientes adultos con cncer pulmonar confirmados histopatolgicamente en una red [...] de salud entre Enero de 2007 y Diciembre de 2011. Se accedi a las fichas clnicas y archivos de imgenes de los pacientes, registrando las variables clnicas, histolgicas, imagenolgicas y la etapificacin clnica. Se sigui prospectivamente a los pacientes hasta Diciembre de 2013 para determinar sobrevida. Resultados: La edad promedio de la cohorte fue de 68,1 11,5 aos, 53% eran varones y 86% tena historia de tabaquismo. El 82,2% de los casos presentaron sntomas al momento del diagnstico, siendo la tos el ms frecuente. La variedad histolgica preponderante fue el adenocarcinoma (42%), seguido del carcinoma escamoso (26,2%). En las mujeres la mayora de los tumores correspondieron a adenocarcinomas (56,4% del total) y en varones predominaron el adenocarcinoma (37%) y el carcinoma escamoso (33,3%). La mayora de los pacientes se diagnosticaron en estadios avanzados de la enfermedad. La sobrevida global a los 36 meses fue 46,1%. La sobrevida media por estadio clnico fue de 70,7 meses en el estadio I, 60,3 meses en estadio II, 47,1 meses en IIIA, 12,3 meses en IIIB y 11,7 meses en IV Segn histologa, la sobrevida media en meses fue de 36,6 en adenocarcinoma, 33,8 en carcinoma escamoso, 20,9 en clulas grandes, 11,9 en clulas pequeas y 19,6 en tumor no clulas pequeas indiferenciado. No hubo diferencias significativas en la sobrevida por edad y gnero. Conclusin: La variedad histolgica ms frecuente es el adenocarcinoma y la sobrevida est relacionada a la etapificacin clnica y variedad histolgica. Abstract in english Lung cancer is the leading cause of death from malignancy worldwide. In Chile the magnitude of the problem and the diagnosis-associated survival are unknown. Methods: We examined a cohort of 202 adult patients with lung cancer histologically confirmed in a single health network between January 2007 [...] and December 2011. We accessed to medical records and images files of patients, recording the clinical, histological, imaging and staging data. Patients were followed until December 2013 to assess survival. Results: The mean age of the cohort was 68.1 11.5 years, 53% were male and 86% had a smoking history. 82.2% of the cases were symptomatic at diagnosis, been cough the symptom most frequently reported. The predominant histological subtype was adenocarcinoma (42%), followed by squamous cell carcinoma (26.2%). In women, adenocarcinoma was the leading histology variety (56.4%), and in males it was adenocarcinoma (37%) and squamous cell carcinoma (33.3%). The majority of the patients were diagnosed at advanced stages of the disease. The 36-month survival rate was 46.1%. The mean survival according to clinical stage was 70.7 month in stage I, 60.3 in stage II, 47.1 in IIIA, 12.3 in IIIB and 11.7 month in stage IV. According to histological variety, the mean survival was 36.6 month in adenocarcinoma, 33.8 in squamous cell carcinoma, 20.9 in large-cell carcinoma, 11.9 in small-cell carcinoma and 19.6 month in undifferentiated non small-cell carcinoma. There were no significant differences in survival by age or gender. Conclusion: The most common histological type was adenocarcinoma and short-term survival was related to the clinical staging and histological variants.

  6. Probe data: 5652 [RED

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  7. Experimental information: 1096 [RED

    Full Text Available 1000_24_4_3 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  8. Experimental information: 1083 [RED

    Full Text Available 1000_22_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  9. Experimental information: 1079 [RED

    Full Text Available 1000_21_12_11 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  10. Experimental information: 1101 [RED

    Full Text Available 1000_24_14_13 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  11. Experimental information: 1091 [RED

    Full Text Available 1000_23_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  12. Experimental information: 1092 [RED

    Full Text Available 1000_23_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  13. Experimental information: 1077 [RED

    Full Text Available 1000_21_8_7 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  14. Experimental information: 1082 [RED

    Full Text Available 1000_22_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  15. Experimental information: 1097 [RED

    Full Text Available 1000_24_6_5 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  16. Experimental information: 1100 [RED

    Full Text Available 1000_24_12_11 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  17. Experimental information: 1085 [RED

    Full Text Available 1000_22_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  18. Experimental information: 1088 [RED

    Full Text Available 1000_23_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  19. Experimental information: 1090 [RED

    Full Text Available 1000_23_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  20. Experimental information: 1076 [RED

    Full Text Available 1000_21_6_5 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  1. Experimental information: 1099 [RED

    Full Text Available 1000_24_10_9 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  2. Experimental information: 1084 [RED

    Full Text Available 1000_22_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  3. Experimental information: 1087 [RED

    Full Text Available 1000_22_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  4. Experimental information: 1094 [RED

    Full Text Available 1000_23_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  5. Experimental information: 1089 [RED

    Full Text Available 1000_23_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  6. Experimental information: 1075 [RED

    Full Text Available 1000_21_4_3 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  7. Experimental information: 1080 [RED

    Full Text Available 1000_21_14_13 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  8. Experimental information: 1098 [RED

    Full Text Available 1000_24_8_7 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  9. Experimental information: 1095 [RED

    Full Text Available 1000_24_2_1 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  10. Experimental information: 1086 [RED

    Full Text Available 1000_22_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  11. Experimental information: 1078 [RED

    Full Text Available 1000_21_10_9 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  12. Experimental information: 1081 [RED

    Full Text Available 1000_22_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  13. Experimental information: 1074 [RED

    Full Text Available 1000_21_2_1 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  14. Experimental information: 1093 [RED

    Full Text Available 1000_23_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  15. Cobb's Red Cabbage Indicator.

    Cobb, Vicki

    1998-01-01

    Describes the use of an indicator made from the pigment in red cabbage. Cabbage is grated then soaked in water. When the water is a strong red, the cabbage is strained out. The cabbage-juice indicator is then used to test for acids and bases. Includes a list of good foods to test for acidity and alkalinity. (PVD)

  16. CO2NET: Red Europea del Dixido de Carbono

    A. Arenillas

    2006-03-01

    Full Text Available CO2NET es una red temtica Europea constituida por distintas Instituciones, entros de Investigacin y Desarrollo y empresas involucradas en tecnologas para la itigacin del CO2. Entre sus actividades se encuentra facilitar la colaboracin entre sus miembros en el marco de proyectos europeos sobre captura y almacenamiento de CO2.

  17. A new species of Mathevotaenia (Cestoda, Anoplocephalidae parasitizing Tropidurus spinulosus (Reptilia, Squamata from northeastern Argentina Una especie nueva de Mathevotaenia (Cestoda, Anoplocephalidae parásita de Tropidurus spinulosus (Reptilia, Squamata del noreste de Argentina

    Lía Inés Lunaschi

    2012-09-01

    Full Text Available Mathevotaenia chaquensis n. sp. (Cestoda, Anoplocephalidae, Linstowiinae from a Spiny Lava Lizard, Tropidurus spinulosus, collected in Chaco Province, Argentina, is described. This is the second species of Mathevotaenia described from Neotropical reptiles. The new species is mainly characterized by having a relatively small strobila, 24 mm in total length, with about 100 craspedote proglottids, and 19-24 testes per proglottid. Among the South American species of Mathevotaenia, M. argentinensis is most similar to the new species by having similar body length and number of testes, but the major differences between both species include the size of suckers, neck, proglottids, testes and egg capsules, and the shape of the genital atrium and ovary (with 10-13 lobules on each side in M. argentinensis,, and 4-7 lobules in M. chaquensis n. sp.. A key to the species of the South American members of the Mathevotaenia Akumyan, 1946 is presented.Mathevotaenia chaquensis n. sp. (Cestoda, Anoplocephalidae, Linstowiinae es descrita parasitando al lagarto de los quebrachales, Tropidurus spinulosus, procedente de la Provincia del Chaco, Argentina. Esta es la segunda especie de Mathevotaenia descrita parasitando reptiles Neotropicales. La nueva especie está caracterizada principalmente por tener un estróbilo relativamente pequeño, 24 mm de largo, con aproximadamente 100 proglótides craspedotas y 19-24 testículos por proglótide. Entre las especies sudamericanas de Mathevotaenia, M. argentinensis es la más semejante a la nueva especie por presentar similar longitud del cuerpo y número de testículos, pero difieren en el tamaño de las ventosas, cuello, proglótides, testículos y huevos. Además difieren en la forma del atrio genital y del ovario (10-13 lóbulos a cada lado enM. argentinensis vs. 4-7 lóbulos en M. chaquensis n. sp.. Se presenta una clave para la determinación de las especies sudamericanas de Mathevotaenia Akumyan, 1946.

  18. INSTRUMENTO PARA EL FORTALECIMIENTO AL SISTEMA DE EMPRENDIMIENTO DE RISARALDA: "RED RISARALDA EMPRENDE"

    JAIME OSORIO G

    2010-01-01

    Full Text Available En éste documento se muestran algunos elementos conceptuales sobre redes de emprendimiento como instrumentos para fomentar la innovación y el desarrollo económico y social de una región y el proceso de fortalecimiento de la Red Departamental para el Emprendimiento "Red Risaralda Emprende".

  19. INSTRUMENTO PARA EL FORTALECIMIENTO AL SISTEMA DE EMPRENDIMIENTO DE RISARALDA: "RED RISARALDA EMPRENDE"

    JAIME OSORIO G; YAIR FRANCISCO GRANDAS; CARLOS ANDRES BOTERO G

    2010-01-01

    En éste documento se muestran algunos elementos conceptuales sobre redes de emprendimiento como instrumentos para fomentar la innovación y el desarrollo económico y social de una región y el proceso de fortalecimiento de la Red Departamental para el Emprendimiento "Red Risaralda Emprende".

  20. Next generation red teaming

    Dalziel, Henry

    2015-01-01

    Red Teaming is can be described as a type of wargaming.In private business, penetration testers audit and test organization security, often in a secretive setting. The entire point of the Red Team is to see how weak or otherwise the organization's security posture is. This course is particularly suited to CISO's and CTO's that need to learn how to build a successful Red Team, as well as budding cyber security professionals who would like to learn more about the world of information security. Teaches readers how to dentify systemic security issues based on the analysis of vulnerability and con

  1. Ingeniería y territorio: una relación política indisoluble

    Ardila, Gerardo

    2005-01-01

    Cuando se desarrollan acciones de ingeniería, estas afectan a la naturaleza y a la sociedad de una manera que muchas veces es irreversible; ante todo, se transforma la territorialidad, en su compleja red de relaciones. Una definición del concepto de terri

  2. Probe data: 6229 [RED

    Full Text Available R03-061580-1AR RED AU108708 C96917 C50119 CG0119 >(P52424) PHOSPHORIBOSYLFORMYLGLYCINAMIDINE CYC ... LO-LIGASE PRECURSOR (EC 6.3.3.1) (AIR S) (PHOSPHORIBOSYL-AMINOIMIDAZOLE SYNTHETASE) (AIR ...

  3. Experimental information: 1044 [RED

    Full Text Available 2113_21_6_5 RED Cy3 Cy5 Masamichi Nishiguchi Ehime University Other Other Other Other Probenasol ... e,pathogen response,induced resistance,chemical ... inducer ,rice two-dye methods 20021023 3000032832 ...

  4. Experimental information: 1048 [RED

    Full Text Available 2113_21_10_4 RED Cy3 Cy5 Masamichi Nishiguchi Ehime University Other Other Other Other Probenaso ... le,pathogen response,induced resistance,chemical ... inducer ,rice two-dye methods 20030131 3000154841 ...

  5. Experimental information: 1045 [RED

    Full Text Available 2113_21_7_1 RED Cy3 Cy5 Masamichi Nishiguchi Ehime University Other Other Other Other Probenasol ... e,pathogen response,induced resistance,chemical ... inducer ,rice two-dye methods 20030131 3000154843 ...

  6. Experimental information: 1046 [RED

    Full Text Available 2113_21_8_2 RED Cy3 Cy5 Masamichi Nishiguchi Ehime University Other Other Other Other Probenasol ... e,pathogen response,induced resistance,chemical ... inducer ,rice two-dye methods 20021028 3000032830 ...

  7. Experimental information: 1047 [RED

    Full Text Available 2113_21_9_3 RED Cy3 Cy5 Masamichi Nishiguchi Ehime University Other Other Other Other Probenasol ... e,pathogen response,induced resistance,chemical ... inducer ,rice two-dye methods 20021028 3000032829 ...

  8. Probe data: 3807 [RED

    Full Text Available R12-038550-1AR RED C73409 AU163684 EB4052 >AF093244_1(AF093244|pid:g3747026) Saccharomyces cerev ... protein, complete cds; mitochondrial intermembrane space ... protein; essential for viability. ...

  9. Experimental information: 225 [RED

    Full Text Available 2202_21_1_2 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  10. Experimental information: 226 [RED

    Full Text Available 2202_21_1_3 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  11. Probe data: 2827 [RED

    Full Text Available R06-035040-2AR RED C72992 AU101214 E02619 EB2619 >(P35339) EXOPOLYGALACTURONASE PRECURSOR (EC 3. ... 2.1.67) (EXOPG) (PECTINASE ) (GALACTURAN 1,4-ALPHA-GALACTURONIDASE). &S30067(S ...

  12. Experimental information: 1043 [RED

    Full Text Available 2112_21_11_12 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo ... Nutrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  13. Experimental information: 1038 [RED

    Full Text Available 2112_21_1_2 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  14. Experimental information: 1040 [RED

    Full Text Available 2112_21_5_6 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  15. Experimental information: 1042 [RED

    Full Text Available 2112_21_9_10 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo N ... utrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  16. Experimental information: 1039 [RED

    Full Text Available 2112_21_3_4 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  17. Experimental information: 1041 [RED

    Full Text Available 2112_21_7_8 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  18. American Red Cross

    ... Relief Health and Safety Training & Education Lifesaving Blood International Services Get Assistance Types of Emergencies Be Red Cross Ready Mobile Apps Workplaces & Organizations Resources For Schools Find Open Shelters Contact & Locate Loved Ones Military ...

  19. Experimental information: 92 [RED

    Full Text Available 2133_21_3_7 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  20. Experimental information: 79 [RED

    Full Text Available 2133_21_1_6 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  1. Experimental information: 78 [RED

    Full Text Available 2133_21_1_5 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  2. Experimental information: 87 [RED

    Full Text Available 2133_21_2_8 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Nutrient Pa ... thogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  3. Experimental information: 85 [RED

    Full Text Available 2133_21_2_6 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Nutrient Pa ... thogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  4. Experimental information: 88 [RED

    Full Text Available 2133_21_2_9 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Nutrient Pa ... thogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  5. Experimental information: 93 [RED

    Full Text Available 2133_21_3_8 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  6. Experimental information: 77 [RED

    Full Text Available 2133_21_1_4 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  7. Experimental information: 91 [RED

    Full Text Available 2133_21_3_6 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  8. Experimental information: 83 [RED

    Full Text Available 2133_21_2_4 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Nutrient Pa ... thogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  9. Experimental information: 89 [RED

    Full Text Available 2133_21_3_4 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  10. Experimental information: 86 [RED

    Full Text Available 2133_21_2_7 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Nutrient Pa ... thogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  11. Experimental information: 82 [RED

    Full Text Available 2133_21_1_9 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  12. Experimental information: 81 [RED

    Full Text Available 2133_21_1_8 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  13. Experimental information: 90 [RED

    Full Text Available 2133_21_3_5 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  14. Experimental information: 94 [RED

    Full Text Available 2133_21_3_9 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  15. Experimental information: 80 [RED

    Full Text Available 2133_21_1_7 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Mutant Path ... ogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  16. Experimental information: 84 [RED

    Full Text Available 2133_21_2_5 RED Cy3 Cy3 Hideo Matsumura Iwate Biotechnology Research Center Pathogen Nutrient Pa ... thogen Mutant lesion mimic ... mutant,rice,disease resistance one-dye methods 200 ...

  17. Probe data: 3613 [RED

    Full Text Available R04-027180-3AR RED D41894 AU161689 ST4872 >ATFCA0_24(Z97335|pid:g2244771) Arabidopsis thaliana D ... protein required for centrosome separation during mitosis ). &H71402(H71402) ...

  18. Probe data: 1086 [RED

    Full Text Available R04-035570-1AR RED AU173906 AU056566 SA0688 >ATFCA0_24(Z97335|pid:g2244771) Arabidopsis thaliana ... protein required for centrosome separation during mitosis ). &H71402(H71402) ...

  19. Probe data: 3261 [RED

    Full Text Available R03-063930-1AR RED D41339 AU101982 S03802 ST3802 >(P41153) HEAT SHOCK FACTOR PROTEIN HSF8 (HEAT ... SHOCK TRANSCRIPTION ... FACTOR 8) (HSTF 8) (HEAT STRESS TRANSCRIPTION ... FACT ...

  20. Probe data: 3096 [RED

    Full Text Available R03-014430-1AR RED D24639 AU101662 R02293 RA2293 >(Q05913) TRANSCRIPTION ... INITIATION FACTOR IIF, ... ALPHA SUBUNIT (TFIIF-ALPHA) (TRANSCRIPTION ... FACTOR 5, LARGE CHAIN) (TF5A). ...

  1. Probe data: 5396 [RED

    Full Text Available R07-045930-2AR RED AU173916 AU173917 SA0786 >E70824(E70824) hypothetical glycine-rich protein Rv ... 0746 - Mycobacterium ... tuberculosis (strain H37RV) &MTV041_18(AL021958|pi ...

  2. Red man syndrome

    Sivagnanam, Soupramanien; Deleu, Dirk

    2002-01-01

    Vancomycin can cause two types of hypersensitivity reactions, the red man syndrome and anaphylaxis. Red man syndrome has often been associated with rapid infusion of the first dose of the drug and was initially attributed to impurities found in vancomycin preparations. Even after improvement in vancomycin's purity, however, reports of the syndrome persist. Other antibiotics (e.g. ciprofloxacin, amphotericinB, rifampicin and teicoplanin) or other drugs that stimulate histamine release can resu...

  3. Probe data: 3426 [RED

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. Probe data: 779 [RED

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  5. Probe data: 3773 [RED

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  6. Las estrategias de afrontamiento y la red social de los enfermos crónicos, según género, edad y nivel sociocultural

    Azzollini, Susana Celeste; Bail Pupko, Vera; Benvenuto, Analía

    2009-01-01

    La red social es el conjunto de individuos que prestan apoyo social, Speck la define como “un grupo de personas, miembros de la familia, amigos y otra personas, capaces de aportar una ayuda y un apoyo tan reales como duraderos a un individuo o a una familia” (1989:31). La red social de apoyo protege la salud del individuo y la salud mantiene la red social, en lo que se denomina “círculo virtuoso”, a su vez que la presencia de una enfermedad crónica afecta la red social de apoyo de esa persona...

  7. Enfermeira de ligação: uma estratégia de integração em rede Enfermera de comunicación: una estrategia de integración en red Liaison nurse: a strategy of network integration

    Elizabeth Bernardino

    2010-06-01

    Full Text Available Este artigo objetiva identificar a demanda e as possibilidades de atuação da enfermeira de ligação no Hospital de Clínicas da Universidade Federal do Paraná. É uma pesquisa descritiva na modalidade estudo de caso, desenvolvida de agosto de 2007 a maio de 2008 e realizada em duas etapas distintas. Primeiramente se realizou uma monitorização das altas hospitalares por meio de formulários, e em seguida, após a seleção de uma unidade de internação em que houve a atuação do papel de enfermeira de ligação junto aos usuários com alta hospitalar, foram entrevistados 10 destes, com a utilização de um roteiro semi-estruturado. Por último, foi realizada a categorização das entrevistas e submissão dos dados à análise temática. Os resultados apontam que a implantação da função enfermeira de ligação é um passo para viabilizar a integração do HC/UFPR à rede e colaborar para a integralidade da atenção.Este artículo tiene como objetivo identificar la demanda y posibilidades de acción de la enfermera de comunicación en el Hospital de Clínicas de la Universidad Federal de Paraná. Es un trabajo descriptivo en la modalidad estudio de caso, desarrollado entre agosto de 2007 y mayo de 2008, y realizado en dos etapas. Primero, se realizó un seguimiento de altas hospitalarias por medio de formularios; posteriormente fue seleccionada una unidad de internación en que hubo la acción de la Enfermera de Comunicación junto a los pacientes de alta hospitalaria y fueron realizadas entrevistas semi-estructuradas con 10 destos. Finalmente, fue realizada la categorización y envío de datos para análisis temática. Los resultados demostraron que la implantación de la función Enfermera de Comunicación es un paso para viabilizar la integración del HC/UFPR a la red y colaborar para la integralidad de la atención.This paper aims to identify the demand and potential activities of the Liaison Nurse position in the Hospital de Clínicas of the Universidade Federal do Paraná. It is a descriptive research, based on a case study, and it was carried out in two stages, within August 2007 to May 2008. In the first stage, and through the use of forms, it was made a follow-up of hospital discharges. Then, it was selected a hospital admission unit in which a Liaison Nurse treated discharged patients, and ten of them were interviewed through the use of a semi-structured questionnaire. Lastly, the interviews were categorized and the data obtained was submitted so as its content could be analyzed. The results demonstrated that the implementation of the Liaison Nurse position is an essential step in the integration of the HC/UFPR to the network and promote the medical care integrity.

  8. E-procurement in the Brazilian healthcare system: the impact of joint drug purchases by a hospital network Proceso de compras en línea en el sistema de salud brasileño: impacto de la adquisición conjunta de medicamentos por una red hospitalaria

    Fernando Sigulem

    2009-11-01

    Full Text Available OBJECTIVE: To evaluate the use of e-procurement to obtain supplies for a network of seven university hospitals with a joint purchase system. METHODS: The study was carried out between October 2003 and October 2005. We analyzed nine joint purchases of 37 pharmaceutical items. All the items were purchased in at least two-thirds of the nine occasions and/or were among the 10 items with the highest expenditure. The following aspects were recorded: price, number of suppliers providing quotes, type of supplier (distributor or manufacturer, reference value (lowest price paid per item by each hospital prior to the establishment of the joint purchase system, unit price for first purchase, and unit price for last purchase. The percent variation in price was compared in relation to the reference value, first and last purchases, and average unit price for the nine purchases. RESULTS: A decrease in price > 10% was observed in 47% of the medications analyzed. A decrease > 20% was recorded in 32% of the 37 items. Five items (midazolam 5 mg 3 mL, tramadol 100 mg 2 mL, vancocin 500 mg vial, ceftazidime 1 g vial and cefepime 1 g vial had a decrease > 50% in unit cost in the first purchase compared to the last purchase value. The unit price for 26 items (70% had an average reduction of 23%. CONCLUSIONS: E-procurement was successful in achieving real savings. The results show that the incorporation of new management technologies such as e-procurement in the healthcare setting may help overcome the management gap in the healthcare sector.OBJETIVO: Evaluar la utilización de un proceso de compras en línea para obtener suministros para una red de siete hospitales universitarios con un sistema conjunto de adquisición. MÉTODOS: Este estudio se realizó entre octubre de 2003 y octubre de 2005. Se analizaron nueve adquisiciones conjuntas de 37 productos farmacéuticos. Todos los productos se adquirieron al menos en seis de las nueve ocasiones o estaban entre los 10 productos de mayor desembolso. Se recogieron los siguientes datos: precio, número de proveedores que cotizaron productos, tipo de proveedor (distribuidor o productor, valor de referencia (menor precio pagado por producto por cada hospital antes de establecer el sistema conjunto de adquisición y precio unitario en la primera adquisición y en la última. Se calculó la variación porcentual del precio con respecto al valor de referencia y los precios unitarios, tanto de la primera adquisición y la última como del promedio de las nueve adquisiciones. RESULTADOS: El precio decreció más de 10% en 47% de los medicamentos analizados. En 32% de los 37 productos, el precio se redujo en más de 20%. En cinco productos (midazolam 5 mg, 3 mL; tramadol 100 mg, 2 mL; vancocina 500 mg, vial; ceftazidime 1 g, vial; y cefepime 1 g, vial, el costo unitario de la primera adquisición se redujo en 50% o más en comparación con el de la última adquisición. El precio unitario de 26 (70% de los productos se redujo 23% en promedio. CONCLUSIONES: Con el sistema de aprovisionamiento en línea se lograron ahorros concretos. Estos resultados demuestran que la incorporación de nuevas tecnologías de administración en instalaciones de salud, como los sistemas de aprovisionamiento en línea, puede contribuir a reducir las deficiencias administrativas en el sector salud.

  9. Computadores moleculares: una tecnologa

    Ortiz Trivio, Jorge Eduardo

    2010-01-01

    En este artculo se explican algunos detalles bsicos para la realizacin de computadores moleculares basados en ADN; describe el mtodo general para realizar programas en un computador molecular. Se concluye, que la labor de construccin e implementacin de esos computadores no es tarea exclusiva del Ingeniero de sistemas sino, y con una participacin importante, de profesionales en gentica, medicina, biologa y ciencias relacionadas. De otro lado, aunque es una tecnologa que se encuentra ...

  10. Hacia una danza educativa.

    Colombia Moya

    1995-01-01

    Full Text Available Colombia Moya aboga porque nuestro sistema educativo abrigue en sus escuelas de arte, ya sea danza, música o teatro, una danza educativa. «Una danza -dice- para educar cuerpos y mentes, abrir compuertas a la inteligencia muscular y a la percepción personal del mundo, de la vida, del lenguaje corporal con gramática propia y posibilidades de expresar lo que no dicen las palabras».

  11. Red giant seismology: Observations

    Mosser B.

    2013-03-01

    Full Text Available The CoRoT and Kepler missions provide us with thousands of red-giant light curves that allow a very precise asteroseismic study of these objects. Before CoRoT and Kepler, the red-giant oscillation patterns remained obscure. Now, these spectra are much more clear and unveil many crucial interior structure properties. For thousands of red giants, we can derive from seismic data precise estimates of the stellar mass and radius, the evolutionary status of the giants (with a clear difference between clump and RGB stars, the internal differential rotation, the mass loss, the distance of the stars... Analyzing this amount of information is made easy by the identification of the largely homologous red-giant oscillation patterns. For the first time, both pressure and mixed mode oscillation patterns can be precisely depicted. The mixed-mode analysis allows us, for instance, to probe directly the stellar core. Fine details completing the red-giant oscillation pattern then provide further information on the interior structure, including differential rotation.

  12. Alex. L. du Toit (1878-1948): semblanzas de su vida y de su aporte al conocimiento de la geologa sudamericana / Alex. l. du Toit (1878-1948): aspects of his life and contributions of the South America Geology

    Carlos A, Cingolani.

    2008-12-01

    Full Text Available Se presenta una semblanza de la actividad desarrollada por el gelogo sudafricano Alexander Logie du Toit, quien hacia 1920, se constituy en una verdadera autoridad en todo aquello referido a la glaciacin carbonfera y a partir de all naci en el la inquietud de conocer otras regiones de frica, [...] pasando a Madagascar, India, Australia y Sudamrica. Es evidente que en su interior estaba instalada la posibilidad de una antigua unin de continentes, como explicacin coherente de muchos fenmenos geolgicos que el haba observado. En 1923, apoyado por un subsidio de la Carnegie Institution de Washington, viaja a Sudamrica durante 6 meses, trabajando en el Paleozoico y Mesozoico de Argentina, Chile, Uruguay, Bolivia y Brasil. Como resultado de ello logra publicar en 1927, avalado por la institucin norteamericana, su "Comparacin Geolgica de Sudamrica con Sudfrica", ya fuertemente estimulado por la teora de la deriva de los continentes, defendida por A. Wegener. Durante su estada en Sudamrica, tuvo vinculacin con prominentes colegas de varios pases. En Buenos Aires tom contacto con el entonces Director del Servicio Geolgico Dr. Jos Maria Sobral, quien design colaboradores para que lo acompaaran al viaje de campo, que tuvo una duracin de aproximadamente dos meses. Los elegidos fueron los Dres. Franco Pastore, Augusto Tapia y Juan Jos Ngera. As fue recorriendo puntos geolgicos importantes en las provincias de Crdoba (Saldan, Capilla del Monte), San Luis (Bajo de Veliz), San Juan (en varios sectores como Marayes, Sierra de Zonda, Barreal), luego Mendoza (visitando Cacheuta, Uspallata) sigui enseguida su viaje a Valparaso, Chile, para regresar a Buenos Aires y hacer trabajos de campo en Olavarra, Sierra de la Ventana y Mar del Plata para estudiar, segn sus palabras "unidades equivalentes del Sistema Plegado del Cabo". Tambin agradece durante su visita a Argentina, la colaboracin que le prestaran los Dres. Pablo Groeber, Roberto Beder, Juan Rassmuss, Anselmo Windhausen, Ricardo Wichmann, H. Hausen y Juan Keidel del Servicio Geolgico Nacional. Asimismo reconoce el apoyo del Dr. Walther Schiller del Museo de La Plata. La histrica correspondencia personal mantenida, con ilustres colegas argentinos, especialmente con el Dr. Horacio Harrington, preservada en universidades sudafricanas, marcan claramente el conocimiento geolgico de algunas regiones del pas, logrado por el Dr. du Toit. Abstract in english This contribution deals on a biographical sketch of the main activity developed by the South African geologist Alexander Logie du Toit, who about 1920, was constituted in a geological authority in all that referred to the Gondwanan Upper Paleozoic glaciations. His geological knowledge was stimulated [...] to work in other regions of Africa, Madagascar, India, Australia and South America. It is evident that in your interior, was installed the possibility of a union of continents as coherent explanation of many geological phenomena that he had observed. In 1923 supported by a grant of the Carnegie Institution of Washington, he travels to South America for 6 months. The field trips being employed at the Palaeozoic and Mesozoic of Argentina, Chile, Uruguay, Bolivia and Brazil. As a result of this research he published in 1927 the paper on the "Geological Comparison of South America with South Africa", already strongly stimulated by the theory of the continental drift, defended for A. Wegener. During his trips in South America, he had contact prominent colleagues of several countries. In Buenos Aires he took contact with the Director at the time of the Geological Survey Dr. Jose Mara Sobral. Franco Pastor, Augusto Tapia and Juan Jos Ngera were designed by Sobral to accompanying him on the field trips, which had during two months visiting Crdoba, San Luis, San Juan, Mendoza and Buenos Aires provinces. Also du Toit is grateful during his visit in Argentina for the collaboration of Pablo Groeber, Roberto Beder, Juan Rassmuss, Anselmo W

  13. The building and working of an ego-centric web of power. The epistolar exchange of Juan Manuel de Rosas with the judges of peace of the Buenos Airesïcountryside (1829-1852 Construcción y funcionamiento de una red de poder ego-centrada: La correspondencia de Juan Manuel de Rosas con los jueces de paz de la campaña bonaerense [1829-1852

    Andrea Reguera

    2010-01-01

    Full Text Available In this article, we propose to analyze the construction and the functioning of a power ego-network centred, that of Juan Manuel de Rosas, during the period of his first one (1829-1832 and his second government (1835-1852, across the correspondence that it supported with the judges of peace of the Buenos Aires campaign across his edecanes. This puts us, fundamentally, in touch with the topic of the communication, the circulation of the information and the construction of a space of political relation.En este artículo, nos proponemos analizar la construcción y el funcionamiento de una red de poder ego-centrada, la de Juan Manuel de Rosas, durante el período de su primer (1829-1832 y segundo gobierno (1835-1852, a través de la correspondencia que mantuvo con los jueces de paz de la campaña bonaerense a través de sus edecanes. Esto nos pone, fundamentalmente, en contacto con el tema de la comunicación, la circulación de la información y la construcción de un espacio de relación política.

  14. SOUTH AMERICAN COLLABORATION IN SCIENTIFIC PUBLICATIONS ON LEISHMANIASIS: BIBLIOMETRIC ANALYSIS IN SCOPUS (2000-2011) / Colaboracin Sudamericana en publicaciones cientficas sobre leishmaniasis: anlisis bibliomtrico en SCOPUS (2000-2011)

    Charles, Huaman; Franco, Roman; Gregorio, Gonzlez-Alcaide; Miluska O., Mejia; Jos Manuel, Ramos; Manuel, Espinoza; Csar, Cabezas.

    2014-09-01

    Full Text Available Objetivos: Evaluar la produccin y la red de colaboracin de investigacin sobre leishmaniasis en Sudamrica. Mtodos: Se realiz un estudio bibliomtrico usando la base de datos SCOPUS. La unidad de anlisis fueron los artculos originales de investigacin publicados desde el ao 2000 hasta 2011, r [...] ealizados sobre leishmaniasis y que incluyeron al menos un autor sudamericano. Se obtuvieron para cada artculo: nombre de la revista, idioma, ao de publicacin, nmero de autores, instituciones, pases y otras variables. Resultados: 3174 artculos fueron publicados, 2.272 de ellos eran artculos originales. Se identificaron 1.160 firmas institucionales diferentes, 58 pases y 398 revistas cientficas. Brasil fue el pas con ms artculos (60,7%) y la Fundacin Oswaldo Cruz (FIOCRUZ) tuvo 18% de la produccin brasilea, convirtindose en el ncleo Sudamericano de la mayor red cientfica de Leishmaniasis. Conclusiones: La produccin cientfica de Sudamrica sobre Leishmaniasis publicada en revistas indexadas en SCOPUS se centra en la actividad de la investigacin brasilea. Es necesario fortalecer las redes de colaboracin, el primer paso para ello es la identificacin de las instituciones con mayor produccin con el fin de llevar a cabo la investigacin en colaboracin de acuerdo con las prioridades de cada pas. Abstract in english Objectives: Evaluate the production and the research collaborative network on Leishmaniasis in South America. Methods: A bibliometric research was carried out using SCOPUS database. The analysis unit was original research articles published from 2000 to 2011, that dealt with leishmaniasis and that i [...] ncluded at least one South American author. The following items were obtained for each article: journal name, language, year of publication, number of authors, institutions, countries, and others variables. Results: 3,174 articles were published, 2,272 of them were original articles. 1,160 different institutional signatures, 58 different countries and 398 scientific journals were identified. Brazil was the country with more articles (60.7%) and Oswaldo Cruz Foundation (FIOCRUZ) had 18% of Brazilian production, which is the South American nucleus of the major scientific network in Leishmaniasis. Conclusions: South American scientific production on Leishmaniasis published in journals indexed in SCOPUS is focused on Brazilian research activity. It is necessary to strengthen the collaboration networks. The first step is to identify the institutions with higher production, in order to perform collaborative research according to the priorities of each country.

  15. La red del Comercio Justo y sus principales actores

    Brisa Ceccon Rocha

    2010-01-01

    Full Text Available Este artículo trata de una descripción concisa del fenómeno del comercio justo y su participación en el comercio mundial. Al mismo tiempo, examina el papel de los diferentes actores que participan en la red del comercio justo, desde los productores hasta los consumidores. Finalmente, evalúa las relaciones entre estos actores y los retos que enfrentan para perfeccionar el sistema y mejorar las condiciones de participación de los productores, elementos fundamentales de esta red.

  16. Probe data: 189 [RED

    Full Text Available R06-002880-1AR RED AU030196 AU030197 E50746 EG0746 >S82451_1(S82451|pid:g1699300) latent transfo ... tor-beta-binding protein-2 [human, fibroblast cell line ... CC102, mRNA, 7017 nt]; This sequence comes from FI ...

  17. Probe data: 3389 [RED

    Full Text Available R01-037970-1AR RED D41282 AU108400 S03658 ST3658 >ATU86081_1(U86081|pid:g1839188) Arabidopsis th ... hair development in Arabidopsis thaliana; For this reason , the gene was designated Root Hair Defective3 (RHD ...

  18. Probe data: 3632 [RED

    Full Text Available R02-032970-1AR RED AU161877 AU161878 ST6157 >STU76611_1(U76611|pid:g4098250) Solanum ... tuberosum c ... i21B gene, complete cds; similar to Solanum ... tuberosum ci21A gene product encoded by the sequen ...

  19. Probe data: 6548 [RED

    Full Text Available R02-004920-4AR RED C73633 C99436 E20022 ED0022 >S72415_5(S72415|pid:g632873) putative protein ki ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(518-52 ...

  20. Probe data: 5046 [RED

    Full Text Available R06-046030-1AR RED AU173086 AU173087 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  1. Probe data: 4866 [RED

    Full Text Available R07-030880-3AR RED C91611 AU172758 ED0945 >S62928_1(S62928|pid:g386431) PRB1M=PRB1 medium length ... equence comes from Fig. 3A. Protein sequence is in conflict ... with the conceptual translation; mismatch(177[R- & ...

  2. Probe data: 3457 [RED

    Full Text Available R03-022440-3AR RED C27097 AU108766 CG0974 >S58544_1(S58544|pid:g299703) 75 kda infertility-relat ... sequence comes from Fig. 4. Protein sequence is in conflict ... with the conceptual translation; mismatches(46[R- ...

  3. Probe data: 1379 [RED

    Full Text Available R11-043720-4R RED AU166370 AU068062 C11732 CB1732 >AMTAM1TR_1(X57297|pid:g1345502) A. majus TAM1 ... gene for TNP1 and TNP2; Protein sequence is in conflict ... with the conceptual translation; no ATG start codo ...

  4. Probe data: 988 [RED

    Full Text Available R01-019390-1AR RED AU056143 AU056144 S20327 SA0327 >HSPM5_1(X57398|pid:g1335273) Human mRNA for ... pM5 protein; Protein sequence is in conflict ... with the conceptual translation.. &S21977(S21977) ...

  5. Probe data: 1072 [RED

    Full Text Available R01-066870-1AR RED AU162697 AU056522 S20655 SA0655 >ATATAF1_1(X74755|pid:g1345506) A.thaliana AT ... AF1 mRNA; Protein sequence is in conflict ... with the conceptual translation.. &S37101(S37101) ...

  6. Probe data: 4820 [RED

    Full Text Available R05-004160-1AR RED C19333 AU172698 EC0269 >S72926_1(S72926|pid:g633890) Hordeum vulgare glucose ... sequence comes from Fig. 1. Protein sequence is in conflict ... with the conceptual translation.. ...

  7. Probe data: 5707 [RED

    Full Text Available R09-000620-2R RED AU161807 AU174368 ST5674 >S81497_1(S81497|pid:g1336726) lysosomal acid lipase= ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(82[G- ...

  8. Probe data: 2355 [RED

    Full Text Available R06-046030-1AR RED AU065261 AU095249 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  9. Probe data: 862 [RED

    Full Text Available R03-008820-1AR RED AU055750 AU055751 S20035 SA0035 >S75487_1(S75487|pid:g913445) adh3a=alcohol d ... rom Fig. 2. Map location 4. Protein sequence is in conflict ... with the conceptual translation; mismatch(46[R- &V ...

  10. Probe data: 5234 [RED

    Full Text Available R07-034760-4AR RED D24745 AU173380 RA2480 >AF093537_1(AF093537|pid:g3747044) Zea mays blue ... coppe ... r protein mRNA, partial cds; similar to pea blue ... copper protein in GenBank Accession Number Z25471. ...

  11. Probe data: 1697 [RED

    Full Text Available R10-029050-2AR RED AU077497 AU077496 C51971 CG1971 >(P48600) EUKARYOTIC TRANSLATION INITIATION F ... (EIF-4E) (EIF4E) (MRNA CAP-BINDING PROTEIN) (EIF-(ISO )4F 25 KD SUBUNIT) (EIF-(ISO )4F P28 SUBUNIT). &JC53 ...

  12. Probe data: 3935 [RED

    Full Text Available R04-031750-1AR RED AU165241 AU165240 C62825 CH2825 >(P49727) UBIQUINOL-CYTOCHROME C REDUCTASE IRON ... ON-SULFUR SUBUNIT PRECURSOR (EC 1.10.2.2) (RIESKE IRON -SULFUR PROTEIN) (RISP). &A41607(A41607) &MZERFESPA ...

  13. Probe data: 878 [RED

    Full Text Available R06-036450-1AR RED AU055805 AU055806 S20064 SA0064 >AF097668_1(AF097668|pid:g4206124) Mesembryan ... crystallinum T-complex protein 1 epsilon subunit (TCP -1-EPSILON) mRNA, partial cds; TCP -1 chaperonin. ...

  14. Probe data: 2387 [RED

    Full Text Available R05-045730-1AR RED AU032454 AU095659 S10084 SS0084 >AF026166_1(AF026166|pid:g4090929) Homo sapie ... ns chaperonin-containing TCP -1 beta subunit homolog mRNA, complete cds; similar ... to mouse chaperonin-containing TCP -1 beta subunit. &AF026293_1(AF026293|pid:g2559012) ...

  15. Probe data: 5984 [RED

    Full Text Available RED AU174977 AU174976 FL0119 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  16. Probe data: 5952 [RED

    Full Text Available RED AU174907 AU174908 FL0036 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  17. Probe data: 991 [RED

    Full Text Available R06-046410-1AR RED AU162658 AU056152 S20333 SA0333 >CAN012165_1(AJ012165|pid:g3808101) Capsicum ... for chloroplast protease (CACP)from the AAA atpase family ; AAA atpase family . ...

  18. Canadian Red Cross.

    Lavender, Colleen

    2008-01-01

    The Canadian Red Cross is guided by its Fundamental Principles--humanity, impartiality, neutrality, independence, voluntary service, unity, and universality--and organized in a traditional geographic hierarchical structure. Among the characteristics that have contributed to its success are a budgeting process that starts at the local level, measurement of program outcomes, and coordinated fundraising activities at the regional level. PMID:18551842

  19. Probe data: 647 [RED

    Full Text Available R02-018520-1AR RED D25109 AU032016 R03191 RA3191 >AC002397_16(AC002397|pid:g2289907) Mouse chrom ... osome 6 BAC-284H12 (Research Genetics ... mouse BAC library) complete sequence; ...

  20. Probe data: 4660 [RED

    Full Text Available R11-005040-1AR RED AU172466 AU172467 EB1212 >AF007109_1(AF007109|pid:g3169719) Arabidopsis thali ... ana mRNA, similar to yeast ... dcp1, complete cds; similar to yeast ... dcp1. ...

  1. Red Flag Investigation

    Miller, Jennifer M; Turnwald, James; McMullen, Ken; Burman, Anna; Fahey, Sallie

    2013-01-01

    Early project-level environmental analysis can save time and money. A Red Flag Analysis reveals possible environmental issues prior to the start of the design process and adds greater certainty to the design and budgeting process. The analysis can be done as part of the long-range transportation plan or at the pre-design project level.

  2. Probe data: 4169 [RED

    Full Text Available R04-001080-4R RED AU166392 AU166393 CB1854 >BOU69694_1(U69694|pid:g1589913) Brassica oleracea ATP ... ene, complete cds; similar to Arabidopsis thaliana ATP -sulfurylase isoform (ASA1). ...

  3. Probe data: 1024 [RED

    Full Text Available R12-002190-1AR RED AU056279 AU056280 S20442 SA0442 >(P80595) APYRASE PRECURSOR (EC 3.6.1.5) (ATP ... DIPHOSPHATASE) (ADENOSINE DIPHOSPHATASE) (ADPASE) (ATP -DIPHOSPHOHYDROLASE). &JC4616(JC4616;PC4147) &STU58 ...

  4. Probe data: 6197 [RED

    Full Text Available R07-048110-1AR RED D22267 C96749 C10642 CB0642 >TAU87163_1(U87163|pid:g2306768) Triticum aestivu ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  5. Probe data: 2895 [RED

    Full Text Available R03-021800-1AR RED C19773 AU101326 E10917 EC0917 >TAU87163_1(U87163|pid:g2306768) Triticum aesti ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  6. Probe data: 5037 [RED

    Full Text Available R12-044780-1AR RED AU173063 AU173064 RA0155 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  7. Probe data: 5576 [RED

    Full Text Available R03-047910-1AR RED AU174190 AU174191 ST1070 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  8. 'Saanich' Red Raspberry

    'Saanich' is a new floricane-fruiting red raspberry (Rubus idaeus) cultivar from the breeding program at the Pacific Agri-Food Research Centre (PARC) of Agriculture and Agri-Food Canada, Agassiz, British Columbia. 'Saanich', tested as BC 89-34-41, was selected from a 1989 cross of BC 82-5-161 and BC...

  9. CHINOOK RED RASPBERRY

    'Chinook' is a new primocane fruiting red raspberry (Rubus idaeus L.) from the U.S. Department of Agriculture- Agricultural Research Service (USDA-ARS) breeding program in Corvallis, Ore. released in cooperation with the Oregon State Agricultural Experiment Station, the Washington State University A...

  10. 'Vintage' Red Raspberry

    'Vintage' is a new primocane-fruiting red raspberry (Rubus idaeus L.) from the U.S. Dept. of AgricultureAgricultural Research Service (USDAARS) breeding program in Corvallis, OR released in cooperation with the Oregon State Agricultural Experiment Station and the Washington State University Agricu...

  11. Probe data: 4039 [RED

    Full Text Available R07-005090-1AR RED AU065240 AU165946 EH0875 >AF017777_12(AF017777|pid:g3004658) Drosophila melan ... li), dodo (dod), penguin (pen), small optic lobes (sol ), innocent bystander (iby), waclaw (waw), bobby so ...

  12. Probe data: 1164 [RED

    Full Text Available R06-003380-1AR RED AU078263 AU056903 S20966 SA0966 >HVSCOAT_1(L37299|pid:g609504) Helicoverpa ar ... tics, makes tube-like structures when expressed in bacteria , unstable when expressed in baculovirus, start cod ...

  13. Sample information: 2201 [RED

    Full Text Available 2201 2 T Cell cycle Oryza sativa (rice) C5924 (Ghaiya) Rice cell (Oc cells from rice root) culture ... red in AA medium 0 Root t 30 min culture ... (cell cycle)|Rice Oc cells were transferred to a n ... ew culture ... medium and collected after 30min ...

  14. Probe data: 843 [RED

    Full Text Available R07-046570-1AR RED D41510 AU033144 S04048 ST4048 >LEU21801_1(U21801|pid:g717142) Lycopersicon es ... culentum alcohol ... dehydrogenase homolog (GAD3) mRNA, partial cds; mR ... of gibberellin; similar to nonmetallo-short-chain alcohol ... dehydrogenases, PIR Accession Number A47542. ...

  15. Probe data: 5564 [RED

    Full Text Available R02-057040-1AR RED D39512 AU174175 ST0896 >SPAC19A8_12(Z98974|pid:g2388911) S.pombe chromosome I ... ar eg. to YNL118C, PSU1_YEAST, P53550, involved in respiration , (970aa), fasta scores, opt:776, E():0, (29.1% ide ...

  16. Probe data: 769 [RED

    Full Text Available R02-039400-1AR RED D47995 AU032726 S13835 SS3835 >ATT13J8_13(AL035524|pid:g4455361) Arabidopsis ... (ESSAII project); similarity to regulator protein, Pseudomonas ... aeruginosa, AF052586; contains EST gb:H76524, H762 ...

  17. Probe data: 4093 [RED

    Full Text Available R08-004080-1AR RED D22030 AU166269 CB0208 >AC004122_6(AC004122|pid:g3540182) Arabidopsis thalian ... rotein; Location of EST gb|T46432 and gb|AA404857. Rare ... GC splice donor at position 21576 is predicted fro ...

  18. Probe data: 3314 [RED

    Full Text Available R02-009390-4R RED D22036 AU102087 CB0215 >AC003027_11(AC003027|pid:g4204293) Arabidopsis thalian ... tein phosphatase 2A regulatory subunit; Similar to human ... protein phosphatase 2A 130 kDa regulatory subunit, ... gi|190220 and human ... protein phosphatase 2A 72 kDa regulatory subunit, ...

  19. Probe data: 4569 [RED

    Full Text Available R11-042170-1AR RED C28871 AU172346 CH2632 >HSU66616_1(U66616|pid:g1549241) Human ... SWI/SNF complex ... Da subunit (BAF170) mRNA, complete cds; similar to human ... BAF155 and yeast SWI3; contains a region similar t ...

  20. Probe data: 2756 [RED

    Full Text Available R03-055110-1AR RED C72063 AU101114 EB0895 >S62929_1(S62929|pid:g433011) PRB1L=PRB1 large length ... t, 1107 nt]; basic proline rich proteins (Ps, PmF, PmS , and Pe) precursor; Method: conceptual translation ...

  1. Probe data: 539 [RED

    Full Text Available R06-015880-1AR RED D24296 AU031777 R01679 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  2. Probe data: 67 [RED

    Full Text Available R08-035600-3AR RED AU029523 AU029522 EE1035 >F6N15_22(AF069299|pid:g3193320) Arabidopsis thalian ... tains similarity to the subtilase family of serine proteases ... (Pfam: subtilase.hmm, score: 47.57); strong simila ...

  3. Probe data: 2573 [RED

    Full Text Available R02-050030-1AR RED C26608 AU100748 C12680 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  4. Probe data: 4726 [RED

    Full Text Available R03-005800-1AR RED C72916 AU172547 EB2461 >ATT25K17_14(AL049171|pid:g4539429) Arabidopsis thalia ... e, Arabidopsis thaliana, AF055848; Contains Serine proteases , subtilase family, active sites [GTSMSCPHVAG]. ...

  5. Probe data: 629 [RED

    Full Text Available R05-000860-1AR RED D39203 AU031981 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thalian ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  6. Probe data: 3094 [RED

    Full Text Available R12-040640-1AR RED D24605 AU101660 R02241 RA2241 >AF099082_1(AF099082|pid:g4176766) Homo sapiens ... xenotropic and polytropic murine retrovirus ... receptor (XPR1) mRNA, complete cds; related to yea ...

  7. Probe data: 3629 [RED

    Full Text Available R06-050070-1AR RED AU161851 AU161852 S06116 ST6116 >(P20145) PROBABLE NONSPECIFIC LIPID-TRANSFER ... ECURSOR (LTP) (ALEURON- SPECIFIC 10 KD PROTEIN) (B-FABP ). &HVALSPE_1(X15257|pid:g18893) &HVLTP2A_1(X69793| ...

  8. Probe data: 3930 [RED

    Full Text Available R01-074050-1AR RED AU031589 AU164976 EH1914 >AF039573_1(AF039573|pid:g2773154) Oryza sativa absc ... ible protein (Asr1) mRNA, complete cds; similar to tomato ... ABA- stress- and ripening-related protein ASR. ...

  9. Probe data: 3536 [RED

    Full Text Available R03-023080-1AR RED AU161113 AU161114 CG3495 >AB015431_1(AB015431|pid:g3288883) Oryza sativa mRNA ... A binding protein, partial cds; 3' portion of this coding ... sequence contains an A-rich stretch; homologous to ...

  10. Probe data: 3370 [RED

    Full Text Available R03-023080-1AR RED C26339 AU108271 CB2134 >AB015431_1(AB015431|pid:g3288883) Oryza sativa mRNA f ... A binding protein, partial cds; 3' portion of this coding ... sequence contains an A-rich stretch; homologous to ...

  11. Probe data: 1287 [RED

    Full Text Available R06-009120-1AR RED AU082746 AU057750 SA1754 >AF051240_1(AF051240|pid:g2982311) Picea mariana pro ... bable ubiquitin-conjugating enzyme ... E2 (Sb55) mRNA, complete cds; similar to Saccharom ... yces cerevisiae ubiquitin-conjugating enzyme ... Ubc6p encoded by GenBank Accession Number U18839. ...

  12. Probe data: 2102 [RED

    Full Text Available R05-008990-1AR RED C71993 AU091649 E00749 EB0749 >(P43279) MALATE OXIDOREDUCTASE, CHLOROPLAST PR ... ECURSOR (EC 1.1.1.40) (MALIC ENZYME ) (ME) (NADP-DEPENDENT MALIC ENZYME ) (NADP-ME). &RI ...

  13. Probe data: 2080 [RED

    Full Text Available R01-009100-1AR RED C25822 AU091509 C10754 CB0754 >(P43279) MALATE OXIDOREDUCTASE, CHLOROPLAST PR ... ECURSOR (EC 1.1.1.40) (MALIC ENZYME ) (ME) (NADP-DEPENDENT MALIC ENZYME ) (NADP-ME). &RI ...

  14. Probe data: 3843 [RED

    Full Text Available R05-034000-1AR RED C20214 AU163995 EC1681 >TOBPI T2C_1(D29681|pi d:g676884) Tobacco pi t2 mRNA (whi ... ch expression is induced by Pi ... starvation), complete cds; The expression is induc ... ed by Pi ... starvation.. ...

  15. Probe data: 2199 [RED

    Full Text Available R01-053030-1AR RED C27281 AU092509 C51502 CG1502 >(P29677) MITOCHONDRIAL PROCESSING PEPTIDASE AL ... PHA SUBUNIT PREC URSOR (EC ... 3.4.24.64) (ALPHA-MPP) (UBIQUINOL-CYTOCHR ... OME C ... REDUCTASE SUBUNIT II) (EC ... 1.10.2.2). &S23558(S235 ...

  16. Probe data: 438 [RED

    Full Text Available R02-055920-1AR RED AU095379 AU031455 E61595 EH1595 >(Q42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC UR ... SOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) (LEUCYL A ... MINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  17. Probe data: 621 [RED

    Full Text Available R11-008840-1AR RED D39164 AU031950 R02794 RA2794 >(P52588) PROTEIN DISULFIDE ISOMERASE PREC URSOR ... (PDI) (EC ... 5.3.4.1) / DOLICHYL- DIPHOSPHOOLIGOSACCHARIDE-PROT ... EIN GLYCOTRANSFERASE (EC ... 2.4.1.119) (GLYCOSYLATION SITE-BINDING CHAIN) (GSB ...

  18. Probe data: 4096 [RED

    Full Text Available R12-025080-1AR RED AU166273 AU166274 CB0250 >(P07814) MULTIFUNCTIONAL AMINOACYL-TRNA SYNTHETASE ... (CONTAINS: GLUTAMYL-TRNA SYNTHETASE (EC ... 6.1.1.17) (GLUTAMATE--TRNA LIGASE), AND PROLYL-TRN ... A SYNTHETASE (EC ... 6.1.1.15) (PROLINE--TRNA LIGASE)). &HSGTS_1(X54326 ...

  19. Probe data: 6356 [RED

    Full Text Available R01-072960-1AR RED C28243 C97586 C60441 CH0441 >(Q42942) URIDINE 5'-MONOPHOSPHATE SYNTHASE (UMP ... SYNTHASE) (OROTATE PHOSPHORIBOSYLTRANSFERASE (EC ... 2.4.2.10) AND OROTIDINE 5'-PHOSPHATE DEC ARBOXYLASE ... (EC ... 4.1.1.23)) (FRAGMENT). &NTU22260_1(U22260|pid:g747 ...

  20. Probe data: 1484 [RED

    Full Text Available R02-005160-1AR RED AU068643 AU068642 C30624 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  1. Probe data: 450 [RED

    Full Text Available R02-005160-1AR RED AU031552 AU031553 E61840 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  2. Probe data: 323 [RED

    Full Text Available R04-056610-1AR RED AU172996 AU030838 EH0326 >MLCB2548_8(AL023093|pid:g3097224) Mycobacterium lep ... ydrolase I, len: 205 aa; similar to many e.g. GCH1_ECOLI ... P27511 escherichia coli. gtp cyclohydrolase I (221 ...

  3. Probe data: 5262 [RED

    Full Text Available R05-044330-1AR RED AU173426 AU173427 RA3044 >S68015_1(S68015|pid:g461033) c6.1A [human, mRNA, 10 ... 20 nt]; This sequence comes from Fig. 2; Author 's stop to stop translation. ...

  4. Probe data: 3966 [RED

    Full Text Available R09-031370-1AR RED C72012 AU165393 EB0781 >AC002329_15(AC002329|pid:g2262170) DNA sequence of Ar ... 9); glycosyl hydrolase family I signature found at residues ... 329 to 337 [SLLLENGAA]. ...

  5. Probe data: 3897 [RED

    Full Text Available R06-022230-4R RED D23831 AU164531 RA0286 >AC002329_18(AC002329|pid:g2262173) DNA sequence of Ara ... nucleotide-disulphide oxidoreductases located from residues ... 197 to 219 [CAVCD...IGGGD]. ...

  6. Probe data: 2923 [RED

    Full Text Available R02-020460-1AR RED C20435 AU101364 E12019 EC2019 >S80916_1(S80916|pid:g1911492) PRB4 (PRB4M PO-) ... n {exon 3} [human, peripheral blood leukocytes, subj ect 'J .J .', Genomic Mutant, 753 nt]; salivary proli ...

  7. Probe data: 4083 [RED

    Full Text Available R08-045490-1AR RED AU077699 AU166249 E50587 EG0587 >MEU72662_12(U72662|pid:g2160684) Methylobact ... tative ABC transporter ATP-binding subunit (abcC), methanol ... dyhydrogenase large subunit homolog (mxaF'), cytoc ...

  8. Probe data: 4655 [RED

    Full Text Available R03-018670-1AR RED C72142 AU172460 EB1070 >TDU89271_1(U89271|pid:g1877482) Tripsacum dactyloides ... short-chain alcohol dehydrogenase (gynomonoecious sex ... form 1) gene, allele gsf1, complete cds; similar t ...

  9. Probe data: 3754 [RED

    Full Text Available R02-042000-1AR RED D48054 AU162984 SS3984 >CELZC13_4(U67953|pid:g1519683) Caenorhabditis elegans ... ity to EGF-like domain cysteine pattern signature (PS :PS 00022); coded for by C. elegans cDNA yk70d5.3; c ...

  10. Probe data: 6140 [RED

    Full Text Available R03-021790-1AR RED D23998 C22581 R00758 RA0758 >ATF19H22_21(AL035679|pid:g4539330) Arabidopsis t ... eceptor-like protein kinase - Catharanthus roseus (Madagascar ... periwinkle), PID:e249980; Contains Protein kinases ...

  11. Probe data: 1821 [RED

    Full Text Available R05-019080-1AR RED C71974 AU081279 E00717 EB0717 >ATF19H22_21(AL035679|pid:g4539330) Arabidopsis ... eceptor-like protein kinase - Catharanthus roseus (Madagascar ... periwinkle), PID:e249980; Contains Protein kinases ...

  12. Probe data: 2820 [RED

    Full Text Available R03-000280-1AR RED C72958 AU101205 E02550 EB2550 >S39445(S39445;A42119) DNA-directed RNA polymer ... ase (EC 2.7.7.6) II chain 9, 15K - fruit fly ... (Drosophila melanogaster) &S66940_1(S66940|pid:g45 ...

  13. Probe data: 3103 [RED

    Full Text Available R09-032390-1AR RED D39322 AU101671 R03330 RA3330 >ATT5C23_17(AL049500|pid:g4539465) Arabidopsis ... e 4, BAC clone T5C23 (ESSA project); similarity to Fly ... Fas-associated factor (FFAF), Drosophila melanogas ...

  14. Probe data: 4637 [RED

    Full Text Available R02-008940-1AR RED C71953 AU172434 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thalian ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  15. Probe data: 3422 [RED

    Full Text Available R02-049940-1AR RED C96862 AU108608 C12691 CB2691 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  16. Probe data: 1384 [RED

    Full Text Available R02-049940-1AR RED AU068083 AU068084 C11828 CB1828 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  17. Probe data: 5862 [RED

    Full Text Available R06-016110-1AR RED AU174691 AU174690 FE0214 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cytoplas ... m male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  18. Probe data: 635 [RED

    Full Text Available R01-039520-1AR RED D39230 AU031992 R03072 RA3072 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  19. Probe data: 2296 [RED

    Full Text Available R02-049940-1AR RED C19367 AU094406 E10314 EC0314 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  20. Probe data: 3192 [RED

    Full Text Available R06-016110-1AR RED AU101840 AU101841 S15881 SS5881 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  1. Probe data: 1631 [RED

    Full Text Available R01-039510-1AR RED AU075853 AU075854 S20436 SA0436 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  2. Probe data: 6350 [RED

    Full Text Available R11-026990-1AR RED C97557 C97558 C60385 CH0385 >HTU32872_1(U32872|pid:g1463038) Human T-cell lym ... photropic virus type 2 rex and tax ... genes, partial cds, clone SP2; putative. &HTU32875 ...

  3. EST data: 8680 [RED

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. EST data: 8002 [RED

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  5. EST data: 8329 [RED

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  6. Probe data: 66 [RED

    Full Text Available R07-032820-1AR RED AU166075 AU029521 EE1034 >AF020814_1(AF020814|pid:g2997591) Pisum sativum glu ... cose-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  7. Probe data: 6267 [RED

    Full Text Available R08-034590-1AR RED AU108817 C97061 C51323 CG1323 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  8. Probe data: 783 [RED

    Full Text Available R08-034590-1AR RED D48732 AU032835 S15122 SS5122 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  9. Probe data: 3500 [RED

    Full Text Available R04-059760-1AR RED C27462 AU160841 CG1937 >AF020814_1(AF020814|pid:g2997591) Pisum sativum gluco ... se-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  10. Probe data: 593 [RED

    Full Text Available R02-059660-1AR RED D24648 AU031873 R02308 RA2308 >STU60071_1(U60071|pid:g1708714) Solanum tubero ... sum disease ... resistance homolog (St123) gene, partial cds; Desc ... ription: putative plant disease ... resistance gene homolog; putative peptide. ...

  11. Probe data: 5479 [RED

    Full Text Available R04-001160-2AR RED D48195 AU174051 SS4283 >OSH3593_1(Y09809|pid:g1773004) O.sativa L. putative disease ... -resistance gene, clone pH359-3, partial; putative disease ... resistance gene. &OSH3595_1(Y09810|pid:g1773006) ...

  12. Probe data: 3193 [RED

    Full Text Available R04-033600-2AR RED C24862 AU101846 S16003 SS6003 >IT U51741_1(U51741|pid:g1272351) Ipomoea trifid ... eceptor protein kinase 2 (IRK2) mRNA, partial cds; it ... is unknown whether kinase domain is translated; ge ...

  13. Probe data: 440 [RED

    Full Text Available R08-013510-1AR RED AU162366 AU031490 E61725 EH1725 >(P27743) DEL TA-(L -AL PHA-AMINOADIPYL )-L -CYSTE ... INYL -D-VAL INE SYNTHETASE (EC 6.-.-.-) (ACV SYNTHETASE) ... (ACVS). &NL PCBABC_1(X57310|pid:g45006) &S18268(S18268;S15283;B ...

  14. Probe data: 3148 [RED

    Full Text Available R12-043420-1AR RED D47342 AU101752 S12658 SS2658 >(P38076) CYSTEINE SYNTHASE (EC 4.2.99.8) (O -AC ... ETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &JS0762(JS076 ...

  15. Probe data: 3928 [RED

    Full Text Available R03-053360-1AR RED AU164935 AU164936 E61827 EH1827 >(Q43317) CYSTEINE SYNTHASE (EC 4.2.99.8) (O - ... ACETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &CNAPCCS7_1(D ...

  16. Probe data: 1952 [RED

    Full Text Available R06-049650-1AR RED AU062957 AU082873 C51860 CG1860 >ZMU62751_1(U62751|pid:g2431767) Zea mays aci ... st in the late initiation and elongation phases of translation ... via interactions with tRNA, rRNA and translation ... f ...

  17. Probe data: 9 [RED

    Full Text Available R01-009280-1AR RED AU090561 AU029268 E30049 EE0049 >ZMU62748_1(U62748|pid:g4204372) Zea mays aci ... st in the late initiation and elongation phases of translation ... via interactions with tRNA, rRNA and translation ... f ...

  18. Probe data: 167 [RED

    Full Text Available R05-035100-1AR RED AU065617 AU030074 E50596 EG0596 >ZMU62753_1(U62753|pid:g2431771) Zea mays aci ... st in the late initiation and elongation phases of translation ... via interactions with tRNA, rRNA and translation ... f ...

  19. Probe data: 1955 [RED

    Full Text Available R06-049650-1AR RED AU082963 AU082964 E04120 EB4120 >ZMU62751_1(U62751|pid:g2431767) Zea mays aci ... st in the late initiation and elongation phases of translation ... via interactions with tRNA, rRNA and translation ... f ...

  20. Probe data: 650 [RED

    Full Text Available R05-006540-1AR RED D39257 AU032019 R03204 RA3204 >AF049236_9(AF049236|pid:g3068711) Arabidopsis ... enase (AtG6), and calcium dependent protein kinase genes , complete cds; and unknown genes ; Gp6; similar to ...

  1. Probe data: 5786 [RED

    Full Text Available R12-003540-1AR RED AU174509 AU174510 EA0438 >AF052290_6(AF052290|pid:g3184559) Synechococcus PCC ... (ppiB), ycf36 gene, putative c-type cytochrome biogenes is protein (ccdA), and c-type cytochrome biogenes is ... protein (ycf44) genes , complete cds; and unknown genes ; ORF246. ...

  2. Probe data: 1145 [RED

    Full Text Available R01-006160-1AR RED AU173929 AU056822 S20908 SA0908 >AF049236_9(AF049236|pid:g3068711) Arabidopsi ... enase (AtG6), and calcium dependent protein kinase genes , complete cds; and unknown genes ; Gp6; similar to ...

  3. Probe data: 1638 [RED

    Full Text Available R02-034120-1AR RED D21884 AU075967 C10005 CB0005 >AF049236_8(AF049236|pid:g3068710) Arabidopsis ... enase (AtG6), and calcium dependent protein kinase genes , complete cds; and unknown genes ; similar to yeast ...

  4. Probe data: 5259 [RED

    Full Text Available R09-034490-1AR RED AU173421 AU173422 RA3026 >AF047001_1(AF047001|pid:g4204413) Oenococcus oeni t ... emperate bacteriophage fOg44 Lys44 and Int44 genes , complete cds; and unknown genes ; similar to phage ...

  5. Probe data: 2029 [RED

    Full Text Available R02-055850-1AR RED D39636 AU090661 S01172 ST1172 >AF046125_3(AF046125|pid:g2996116) Rat cytomega ... ate early 2A (R122a), and immediate early 2 (R122) genes , complete cds; IE1; putative transactivator of ear ... ly and late genes ; homologous to Homo sapiens cytomegalovirus IE1; e ...

  6. Probe data: 6115 [RED

    Full Text Available R08-043820-1AR RED C22387 C22388 C12955 CB2955 >AF049236_10(AF049236|pid:g3068712) Arabidopsis t ... enase (AtG6), and calcium dependent protein kinase genes , complete cds; and unknown genes ; &ATU54615_1(U546 ...

  7. Probe data: 4872 [RED

    Full Text Available R03-007550-2AR RED AU172766 AU172767 EE0037 >F9D12_1(AF077407|pid:g3319342) Arabidopsis thaliana ... BAC F9D12; similar to mit ochondrial carrier proteins (Pfam: mit _carr.hmm, sc ...

  8. Probe data: 4475 [RED

    Full Text Available R06-038200-1AR RED AU166906 AU166907 CG2417 >ATY12227_3(Y12227|pid:g2505867) Arabidops is ... thalian ... a DNA, 24 kb s urrounding PFL locus ; gene3; homologous ... to ES T's ... T0 ... 4263, T76118; corres ponding cDNA's : Y09822, Y09823. ...

  9. Probe data: 4476 [RED

    Full Text Available R06-038200-1AR RED AU166908 AU166909 CG2421 >ATY12227_3(Y12227|pid:g2505867) Arabidops is ... thalian ... a DNA, 24 kb s urrounding PFL locus ; gene3; homologous ... to ES T's ... T0 ... 4263, T76118; corres ponding cDNA's : Y09822, Y09823. ...

  10. Probe data: 5156 [RED

    Full Text Available R02-058200-1AR RED D39105 AU173272 RA1973 >EDKCHBETA_1(AJ225806|pid:g2832783) Egeria densa mRNA ... for potassium ... channel beta subunit; highly homologous to the fam ... ily of potassium ... channel beta subunits in plants and animals.. ...

  11. Probe data: 2995 [RED

    Full Text Available R11-007900-2AR RED AU030559 AU101484 E51237 EG1237 >AF020193_1(AF020193|pid:g2895198) Glycine ma ... x DNA ... polymerase delta (Pol delta) mRNA, complete cds; D ... NA-dependent DNA ... polymerase. ...

  12. Probe data: 3220 [RED

    Full Text Available R09-025420-1AR RED AU032971 AU101898 S00086 ST0086 >D88434_1(D88434|pid:g4519507) Malus domestic ... a mRNA for protein abundantly expressed during apple ... fruit development, complete cds; similar to Garden ...

  13. Probe data: 5077 [RED

    Full Text Available R02-043650-1AR RED AU173162 AU173163 RA1507 >AF057183_1(AF057183|pid:g3264596) Zea mays putative ... nscript 1 (HIT1); induced by submergence, hypoxia, mechanical ... impedence, and 40% O2 conditions. ...

  14. Probe data: 2245 [RED

    Full Text Available R11-006150-1AR RED AU058229 AU093388 EG0218 >AF039573_1(AF039573|pid:g2773154) Oryza sativa absc ... ible protein (Asr1) mRNA, complete cds; similar to tomato ... ABA- stress- and ripening-related protein ASR. ...

  15. Probe data: 4147 [RED

    Full Text Available R05-030220-1AR RED C26117 AU166363 CB1671 >SPCC31H12_8(AL031824|pid:g3702632) S.pombe chromosome ... ble alcohol dehydrogenase transcriptional effector(carbon ... catabolite repressor protein 4), (837 aa), fasta s ...

  16. Probe data: 4748 [RED

    Full Text Available R05-030220-1AR RED C72994 AU172580 EB2630 >SPCC31H12_8(AL031824|pid:g3702632) S.pombe chromosome ... ble alcohol dehydrogenase transcriptional effector(carbon ... catabolite repressor protein 4), (837 aa), fasta s ...

  17. Probe data: 1918 [RED

    Full Text Available R06-001500-1AR RED AU031498 AU082419 E61744 EH1744 >ATU20347_1(U20347|pid:g790583) Arabidopsis t ... responding to this gene accumulates in response to ozone ... stress and pathogen (bacterial) infection; putativ ...

  18. Probe data: 1601 [RED

    Full Text Available R06-043000-1AR RED C26746 AU075577 C12957 CB2957 >HSU49082_1(U49082|pid:g1840045) Human transpor ... ter protein (g17) mRNA, complete cds; member of a new ... family of transporter protein genes; resides in th ...

  19. Probe data: 4200 [RED

    Full Text Available R03-028920-1AR RED AU062597 AU166443 CB2410 >EBV_10(V01555|pid:g1334843) Epstein-Barr virus (EBV ... stoid cell line immortalized with human EBV from a mononucleosis ... patient; BWRF1 reading frame 8; Protein sequence i ...

  20. Probe data: 487 [RED

    Full Text Available R05-018490-1AR RED D23861 AU031673 R00448 RA0448 >OSU30479_1(U30479|pid:g1041712) Oryza sativa e ... 3 (Os-EXP3) mRNA, complete cds; induces extension (creep ) in plant cell walls; former gene name RiExD. ...

  1. Probe data: 4249 [RED

    Full Text Available R02-010120-1AR RED AU166519 AU166520 CB2996 >SYNMUSUBGA_1(M11691|pid:g208891) Synthetic beta-gal ... actosidase/mouse ubiquitin fusion ... protein mRNA, clone arf3; beta-galactosidase/ubiqu ... itin fusion ... protein. ...

  2. Probe data: 6012 [RED

    Full Text Available R02-035050-1AR RED AU175046 AU175047 CH0075 >SYNSUICC_2(L37442|pid:g1246364) Expression vector p ... ytosine deaminase:uracil phosphoribosyltransferase fusion ... protein (codA:upp) gene, complete cds; thymidylate ... :zeocin resistance protein:NDP kinase fusion ... protein (tmk:Sh ble:ndk) gene, complete cds; Strep ...

  3. Probe data: 4770 [RED

    Full Text Available R03-010620-1AR RED AU172627 AU172628 EB3037 >ATF22K18_22(AL035356|pid:g4220532) Arabidopsis thal ... , BAC clone F22K18 (ESSAII project); similarity to Kaposi 's sarcoma-associated herpesvirus glycoprotein M.., ...

  4. Probe data: 4990 [RED

    Full Text Available R12-008240-1AR RED AU064916 AU172911 EF0791 >AF052429_1(AF052429|pid:g2981214) Zea mays photosys ... tem I complex PsaN subunit precursor (psaN) mRNA, nuclear ... gene encoding chloroplast protein, partial cds; nu ...

  5. Probe data: 581 [RED

    Full Text Available R02-011070-2AR RED AU031849 AU031850 R02164 RA2164 >XLU69669_1(U69669|pid:g1850344) Xenopus laev ... is nuclear ... pore complex-associated protein TPR (tpr) mRNA, pa ... rtial cds; nuclear ... pore complex-associated protein; translocated prom ...

  6. Probe data: 1182 [RED

    Full Text Available R11-002450-3AR RED AU057021 AU057022 S21071 SA1071 >(P80595) APYRASE PRECURSOR (EC 3.6.1.5) (ATP ... DIPHOSPHATASE) (ADENOSINE DIPHOSPHATASE) (ADPASE) (ATP -DIPHOSPHOHYDROLASE). &JC4616(JC4616;PC4147) &STU58 ...

  7. Probe data: 1064 [RED

    Full Text Available R10-034070-1AR RED AU162689 AU056485 S20627 SA0627 >T12H20_1(AF080119|pid:g3600032) Arabidopsis ... pomyosin (Pfam: Tropomyosin.hmm, score: 14.57) and ATP ... synthase (Pfam: ATP -synt_B.hmm, score: 10.89). ...

  8. Probe data: 512 [RED

    Full Text Available R04-055210-1AR RED D23993 AU031715 R00740 RA0740 >A70793(A70793) probable glycerol kinase - Myco ... bacterium tuberculosis ... (strain H37RV) &MTV025_45(AL022121|pid:g2960120) ...

  9. Probe data: 670 [RED

    Full Text Available R09-026690-1AR RED AU164691 AU032132 R03613 RA3613 >B70815(B70815) hypothetical protein Rv0858c ... - Mycobacterium tuberculosis ... (strain H37RV) &MTV043_50(AL022004|pid:g2916917) ...

  10. Probe data: 1269 [RED

    Full Text Available R03-055920-4AR RED AU162760 AU057613 S21617 SA1617 >F70811(F70811) hypothetical protein Rv0830 - ... Mycobacterium tuberculosis ... (strain H37RV) &MTV043_22(AL022004|pid:g2916888) ...

  11. Probe data: 6599 [RED

    Full Text Available R03-052290-1AR RED AU164264 C99686 E21077 ED1077 >A70684(A70684) hypothetical protein Rv2406c - ... Mycobacterium tuberculosis ... (strain H37RV) &MTCY253_22(Z81368|pid:g1655653) ...

  12. Experimental information: 921 [RED

    Full Text Available 6001_21_11_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  13. Experimental information: 927 [RED

    Full Text Available 6001_21_13_9 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  14. Experimental information: 894 [RED

    Full Text Available 6001_21_2_16 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  15. Experimental information: 929 [RED

    Full Text Available 6001_21_13_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  16. Experimental information: 909 [RED

    Full Text Available 6001_21_10_8 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  17. Experimental information: 934 [RED

    Full Text Available 6001_21_15_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  18. Experimental information: 933 [RED

    Full Text Available 6001_21_15_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  19. Experimental information: 906 [RED

    Full Text Available 6001_21_6_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  20. Experimental information: 892 [RED

    Full Text Available 6001_21_2_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  1. Experimental information: 899 [RED

    Full Text Available 6001_21_4_9 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  2. Experimental information: 901 [RED

    Full Text Available 6001_21_4_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  3. Experimental information: 928 [RED

    Full Text Available 6001_21_13_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  4. Experimental information: 904 [RED

    Full Text Available 6001_21_6_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  5. Experimental information: 918 [RED

    Full Text Available 6001_21_11_8 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  6. Experimental information: 915 [RED

    Full Text Available 6001_21_11_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  7. Experimental information: 897 [RED

    Full Text Available 6001_21_4_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  8. Experimental information: 882 [RED

    Full Text Available 6001_21_1_9 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  9. Experimental information: 905 [RED

    Full Text Available 6001_21_6_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  10. Experimental information: 900 [RED

    Full Text Available 6001_21_4_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  11. Experimental information: 922 [RED

    Full Text Available 6001_21_11_16 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  12. Experimental information: 890 [RED

    Full Text Available 6001_21_2_8 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  13. Experimental information: 898 [RED

    Full Text Available 6001_21_4_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  14. Experimental information: 888 [RED

    Full Text Available 6001_21_2_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  15. Experimental information: 896 [RED

    Full Text Available 6001_21_2_18 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  16. Experimental information: 884 [RED

    Full Text Available 6001_21_1_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  17. Experimental information: 910 [RED

    Full Text Available 6001_21_10_9 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  18. Experimental information: 880 [RED

    Full Text Available 6001_21_1_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  19. Experimental information: 925 [RED

    Full Text Available 6001_21_13_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  20. Experimental information: 887 [RED

    Full Text Available 6001_21_2_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  1. Experimental information: 924 [RED

    Full Text Available 6001_21_11_18 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  2. Experimental information: 907 [RED

    Full Text Available 6001_21_10_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  3. Experimental information: 912 [RED

    Full Text Available 6001_21_10_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  4. Experimental information: 886 [RED

    Full Text Available 6001_21_1_18 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  5. Experimental information: 885 [RED

    Full Text Available 6001_21_1_17 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  6. Experimental information: 914 [RED

    Full Text Available 6001_21_10_18 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  7. Experimental information: 908 [RED

    Full Text Available 6001_21_10_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  8. Experimental information: 893 [RED

    Full Text Available 6001_21_2_14 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  9. Experimental information: 903 [RED

    Full Text Available 6001_21_6_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  10. Experimental information: 920 [RED

    Full Text Available 6001_21_11_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  11. Experimental information: 923 [RED

    Full Text Available 6001_21_11_17 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  12. Experimental information: 930 [RED

    Full Text Available 6001_21_13_18 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  13. Experimental information: 911 [RED

    Full Text Available 6001_21_10_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  14. Experimental information: 881 [RED

    Full Text Available 6001_21_1_8 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  15. Experimental information: 902 [RED

    Full Text Available 6001_21_4_18 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  16. Experimental information: 932 [RED

    Full Text Available 6001_21_15_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  17. Experimental information: 883 [RED

    Full Text Available 6001_21_1_12 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  18. Experimental information: 913 [RED

    Full Text Available 6001_21_10_17 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestr ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  19. Experimental information: 895 [RED

    Full Text Available 6001_21_2_17 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  20. Experimental information: 891 [RED

    Full Text Available 6001_21_2_9 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  1. Experimental information: 879 [RED

    Full Text Available 6001_21_1_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  2. Experimental information: 919 [RED

    Full Text Available 6001_21_11_9 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  3. Experimental information: 931 [RED

    Full Text Available 6001_21_15_3 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  4. Experimental information: 917 [RED

    Full Text Available 6001_21_11_7 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  5. Experimental information: 926 [RED

    Full Text Available 6001_21_13_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  6. Experimental information: 916 [RED

    Full Text Available 6001_21_11_5 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  7. Experimental information: 889 [RED

    Full Text Available 6001_21_2_7 RED Cy3 Cy3 Utako Yamanouchi Society for Techno-Innovation of Agriculture, Forestry ... ture Mutant Temperature Mutant spotted-leaf,lesion-mimic ,heat stress,environmental stress one-dye methods 2 ...

  8. Probe data: 5495 [RED

    Full Text Available R09-031940-1R RED D48735 AU174075 SS5125 >SPBC215_13(AL033534|pid:g3873550) S.pombe chromosome I ... 932 aa), fasta scores: opt: 694, E():8e-27, (41.8% identity ... in 457 aa). ...

  9. Probe data: 2587 [RED

    Full Text Available R11-011010-4R RED AU062718 AU100766 C30311 CE0311 >AE000959_10(AE000959|pid:g2648442) Archaeoglo ... similar to GB:X79560 SP:P46464 PID:517390 percent identity : 61.98; identified by sequence similarity; putativ ...

  10. Probe data: 3857 [RED

    Full Text Available R06-042830-1AR RED AU064223 AU164111 ED0143 >AE001019_19(AE001019|pid:g2649345) Archaeoglobus fu ... similar to GB:L77117 SP:Q60179 PID:1591690 percent identity : 39.38; identified by sequence similarity; putativ ...

  11. Probe data: 3925 [RED

    Full Text Available R03-019390-1AR RED AU164858 AU164859 EH1645 >AP000005_67(AP000005|pid:g3257577) Pyrococcus horik ... position (5/7); similar to owl:HPAE0006332 percent identity :27.451 in 212aa; Swiss_Prot:P44659 percent identit ...

  12. Probe data: 3184 [RED

    Full Text Available R05-006300-1AR RED D48993 AU101824 S15595 SS5595 >AE001130_3(AE001130|pid:g2688094) Borrelia bur ... SP:P17580 GB:M24503 PID:290500 PID:551840 percent identity : 38.99; identified by sequence similarity; putativ ...

  13. Probe data: 5521 [RED

    Full Text Available R03-030160-1AR RED AU174105 AU174106 SS6038 >ATNAP16KD_1(Z96936|pid:g2765837) Arabidopsis thalia ... ociated protein NAP16kDa; pos. 112 to 116 sequence identity ... to nitrilase isoform 1 and 2. ...

  14. Probe data: 5482 [RED

    Full Text Available R02-017290-1AR RED AU174055 AU174056 SS4954 >AE000956_15(AE000956|pid:g2648379) Archaeoglobus fu ... e genome; similar to PID:1045016 SP:Q51790 percent identity : 31.21; identified by sequence similarity; putativ ...

  15. Probe data: 364 [RED

    Full Text Available R02-031580-1AR RED AU075434 AU031062 E60705 EH0705 >AF036618_1(AF036618|pid:g2708624) Arabidopsi ... thaliana acetyl-CoA synthetase mRNA, complete cds; identity ... based on similarity to known acetyl-CoA synthetase ...

  16. Probe data: 252 [RED

    Full Text Available R09-033840-1AR RED AU162299 AU030444 E51070 EG1070 >AE000968_9(AE000968|pid:g2648586) Archaeoglo ... similar to GB:L77117 SP:Q57665 PID:1498988 percent identity : 60.92; identified by sequence similarity; putativ ...

  17. Probe data: 4505 [RED

    Full Text Available R01-017940-1AR RED AU166950 AU166951 CH0192 >AE001265_11(AE001265|pid:g3323304) Treponema pallid ... the complete genome; similar to GP:606359 percent identity : 29.47; identified by sequence similarity; putativ ...

  18. Probe data: 1244 [RED

    Full Text Available R02-038610-1AR RED AU057404 AU057405 S21415 SA1415 >SPAC57A7_5(Z95396|pid:g2104440) S.pombe chro ... 5 aa), fasta scores: opt: 199, E():0.00029, (20.5% identity ... in 366 aa). ...

  19. Probe data: 5087 [RED

    Full Text Available R07-015750-1AR RED D24254 AU173174 RA1586 >AE001048_5(AE001048|pid:g2649798) Archaeoglobus fulgi ... e genome; similar to GB:L77117 PID:1591676 percent identity : 48.77; identified by sequence similarity; putativ ...

  20. Probe data: 1808 [RED

    Full Text Available R01-015680-1AR RED C72327 AU078752 EB1437 >AE000949_5(AE000949|pid:g2648274) Archaeoglobus fulgi ... of 172 of the complete genome; similar to percent identity : 28.02; identified by sequence similarity; putativ ...