WorldWideScience
 
 
1

Depolymerization of Poly(ethylene terephthalate) to Terephthalic Acid and Ethylene Glycol in High-temperature Liquid Water  

Poly(ethylene terephthalate) (PET) was depolymerized to ethylene glycol and terephthalic acid in high-temperature liquid water at temperature higher than 493 K and the depolymerization of PET was enhanced by the addition of terephthalic acid in the reaction system.   

2

Surface functionalization of poly(ethylene terephthalate) film and membrane by controlled wet chemistry : chemical characterization of carboxylated surfaces  

Surface functionalization of poly(ethylene terephthalate) (PET) film or track-etched membrane was performed using the methods of organic synthesis conducted at the solid-liquid interface. Basic hydrolysis in aqueous acetonitrile followed by permanganate oxidation in diluted sulfuric acid created new...

3

Surface Functionalization of Poly(ethylene-terephthalate) Film and Membrane By Controlled Wet Chemistry - Chemical Characterization of Carboxylated Surfaces  

Surface functionalization of poly(ethylene terephthalate) (PET) film or track-etched membrane was performed using the methods of organic synthesis conducted at the solid-liquid interface. Basic hydrolysis in aqueous acetonitrile followed by permanganate oxidation in diluted sulfuric acid created new...

4

Protecting biodegradable coatings releasing antimicrobial agents  

This article describes the synthesis and in vitro analysis of poly(ester anhydride) antimicrobial protection coatings. Poly(ester anhydride)s composed of ricinoleic acid, sebacic acid, terephthalic acid, and isophthalic acid were used in this study. The polymers were compatible with various fillers commonly used in paint preparation. The in vitro experiments showed that the polymers are able to release diuron, an antimicrobial agent, for months. Copyright 2007 Wiley Periodicals, Inc. J Appl Polym Sci 2007

5

Biodegradable aliphatic/aromatic copoly(ester-ether)s: the effect of poly(ethylene glycol) on physical properties and degradation behavior  

A series of high molecular weight copolymers based on poly(L-lactic acid) (PLLA) as the biodegradable aliphatic segments, poly(butylene terephthalate) (PBT) as the rigid aromatic segments and hydrophilic poly(ethylene glycol) (PEG) as the soft segments were synthesized with the aim of developing novel polymer materials which could combine high physical properties with good biodegradability. Via direct melt polycondensation of terephthalic acid (TPA), 1,4-butanediol (BDO), poly(L-lactic acid) oligomer (OLLA) and PEG, biodegradable aliphatic/aromatic copoly(ester-ether)s, poly(butylene terephthalate-co-lactate-co-ethylene glycol) (PBTLG), were prepared. The effect of the introduction of PEG soft segments on the synthesis, mechanical properties and thermal stabilities as well as the degradati...

6

Kinetic and Catalytic Studies in Polyethylene Terephthalate Synthesis  

Polyethylene terephthalate synthesis by polycondensation of bis (hydroxyethylene) terephthalate and its low molecular weight oligomers catalyzed by different titanium (IV) based catalysts was investigated. An industrial catalyst, antimony triacetate, was used as a reference catalyst. Polycondensatio...

7

Synthesis, crystal structures, and luminescence properties of carboxylate based rare-Earth coordination polymers.  

Rare-earth coordination polymers or lanthanide-organic frameworks with hitherto unreported crystal structures have been obtained on the basis of the "light" lanthanides Pr, Nd, Sm, and Eu in combination with terephthalic acid and using a slightly altered literature synthesis procedure. Rietveld refinement has shown that powder XRD patterns of such compounds are largely dominated by the positions of the heavy elements, pointing to isostructural networks for all four terephthalate-based materials. An in-depth luminescence study has been performed on the reported MOFs, showing rare praseodymium and samarium emission in the visible spectrum, aside from the strong europium luminescence and the near-infrared emission from both a terephthalate and 2,5-pyridinedicarboxylate based neodymium-MOF. PMID:23078525

8

IN-SITU LAMINATION OF STARCH-BASED BAKED FOAM ARTICLES WITH DEGRADABLE FILMS  

A technique for making biodegradable food service packaging comprised of a starch/fiber core and a biodegradable film laminate is described. The biodegradable films were made of polylactic acid (PLA), polybutylenesuccinate/terephthalate (PBST), rubber latex and polybutyleneadipate / terephthalate (P...

9

Metal-organometallic polymers and frameworks derived from facially metalated arylcarboxylates  

The interest in coordination polymers, also known as metal-organic frameworks, has risen drastically over the past 2 decades. In this time, the field has matured and given rise to a diverse range of crystalline structures possessing various functionalities. Coordination polymers are typically formed from the self assembly of metal ions which serve as nodes and organic ligands which act as bridges. By the careful selection of the organic ligand and the metal ion, the overall physical properties of the material may be tuned. In this work, the use of organometallic bridging ligands are explored using facially metalated aryl carboxylates ligands to synthesize metal-organometallic frameworks (MOMFs). Therefore, with the aim of synthesizing [CpM]+-functionalized (M = FeII, RuII; Cp = cyclopentadienyl) coordination polymers and metal organic frameworks, various [CpFe]+and [CpRu] + functionalized aryl carboxylates were synthesized and characterized. In particular, the [CpFe]+-functionalized benzoic, terephthalic and trimesic acids as well as the [CpRu]+-functionalized terephthalic acid were made. Using the [CpFe]+ complexes of the benzoic and terephthalic acid as bridging ligands, a number of 1D and 2D coordination polymers were synthesized. For instance, the reaction of [CpFe]+-functionalized benzoic acid with CdCl2 yielded the 1D chain of [Cd(benzoate)Cl 2]?H2O whilst the reaction of [CpFe]+-functionalized terephthalic acid with Cu(NO3)2?6H2O yielded a 2D square grid sheet. Using the [CpFe]+-functionalized terephthalic acid, a series of polymorphic, 3D metal-organometallic frameworks of the general formula [M3(terephthalate)4(mu-H2O)2(H 2O)2][NO3]2?xsolvent (M = Co II, NiII ; solvent = EtOH, DMF, H2O) were synthesized and fully characterized. The polymorphic nature of these frameworks may be attributed to the different orientations that the [CpFe]+ moiety may adapt within the cavities in the 3D frameworks. The selectivity of the desolvated forms of the polymorphs for various alcohols was also probed. A framework having the same 3D topology but slightly different composition as the polymorphic frameworks of [M3(terephthalate)4(mu-H 2O)2(H2O)2][NO3]2? xsolvent was obtained using MnBr2?4H2O. The solvothermal reaction of [CpFe]+-functionalized terephthalic acid and Co(NO3)2?6H2O afforded the first microporous metal-organometallic phosphate. This 3D framework formed a cubic, 12-connected face centered net featuring a novel dodecanuclear truncated tetrahedral node consisting of [CpFe(terephthalate)]+, CoII, F- and phosphate ions. Lastly, the [CpFe]+-functionalized terephthalic acid was successfully reticulated into the MIL-88 and MIL 53 framework topologies indicating that the metalated ligand may be used to synthesis both known and novel 3D metal organic frameworks.

10

Selective Carboxylation of Benzoic Acid Using Cyclodextrin as Mediator  

The selective synthesis of terephthalic acid from benzoic acid with carbon tetrachloride, copper powder, and aqueous alkali was achieved by the use of ?-cyclodextrin (?-CyD) as a mediator at 60°C under nitrogen of atmospheric pressure, producing terephthalic acid in 74 mol% yield with 100% selectivity. When ?-CyD or ?-CyD was used instead of ?-CyD, the reaction hardly proceeded. The addition of p-benzoquinone to the reaction mixture decreased the yield of terephthalic acid remarkably. An oxygen atmosphere also suppressed the reaction appreciably. Thus, the active species formed from carbon tetrachloride and copper powder in the reaction mixture is proposed to be trichloromethyl radical. The conformations of CyD-benzoate inclusion complexes in aqueous alkaline solution were determined by the nuclear magnetic resonance spectroscopy using 1H homonuclear Overhauser enhancement on the rotating frame. The benzoate anion was axially included in the cavity of ?-CyD with orientation such that the carboxylate group was at the primary hydroxyl side of ?-CyD. The essential factor of the carboxylation by the use of ?-CyD was the inclusion complex formation of ?-CyD with benzoate anion and ?-CyD with carbon tetrachloride in the reaction mixture. The very high selectivity was ascribed to the conformation of the ?-CyD-benzoate inclusion complex.   

11

Synthesis and hydrolytic degradation of poly(ethylene succinate) and poly(ethylene terephthalate) copolymers  

The conditions of synthesis of statistical poly(ethylene succinate-co-terephthalate) copolymers (2GTS) and high molecular weight poly(ethylene succinate) (PES) with good hydrolytic and optical parameters, designed for the production of biodegradable products and resins, are presented in this article. Copolymers were prepared by melt polycondensation of bis-(b-hydroxyethylene terephthalate) (BHET) and succinic acid (SA) with excess of ethylene glycol (2G) in the presence of a novel titanium/silicate catalyst (C-94) and catalytic grade of germanium dioxide (GeO2) as cocatalyst. The chemical structure and physical properties of those materials were characterized by 1H NMR, FT-IR, dynamical-mechanical thermal analyses (DMTA), differential scanning calorimetry (DSC), solution viscosity and spec...

12

Sequential pyrolysis of plastic to recover polystyrene HCL and terephthalic acid  

A process of pyrolyzing plastic waste feed streams containing polyvinyl chloride, polyethylene terephthalate, polystyrene and polyethylene to recover polystyrene HCl and terephthalic acid comprising: heating the plastic waste feed stream to a first temperature; adding an acid or base catalyst on an oxide or carbonate support; heating the plastic waste feed stream to pyrolyze polyethylene terephthalate and polyvinyl chloride; separating terephthalic acid or HCl; heating to a second temperature to pyrolyze polystyrene; separating styrene; heating the waste feed stream to a third temperature to pyrolyze polyethylene; and separating hydrocarbons.

13

Catalytic and Mechanistic Studies of Polyethylene Terephthalate Synthesis  

Polyethylene terephthalate synthesis by polycondensation of its monomer bis-hydroxy ethylene terephthalate was investigated. Two catalysts were studied; a homogenous one based on antimony and a heterogeneous one based on hydrotalcite. Two methods were applied to monitor the reaction progress; thermo...

14

Terephthalic acid plant for ICI T8  

Terephthalic acid is a fundamental component of such products as textiles, tires, and bottles. In the United Kingdom, a new plant has been designed to supply domestic and foreign manufacturers with more than 250,000 tons of terephthalic acid per year. The process design features of the plant and the materials and equipment engineering are described. (RCK)

15

Surface design of core-shell superparamagnetic iron oxide nanoparticles drives record relaxivity values in functional MRI contrast agents.  

Core-shell hydrophilic superparamagnetic iron oxide (SPIO) nanoparticles, surface functionalized with either terephthalic acid or 2-amino terephthalic acid, showed large negative MRI contrast ability, validating the advantage of using low molecular weight and ?-conjugated canopies for engineering functional nanostructures with superior performances. PMID:23066527

16

Economically attractive technologies for plastic recycling  

This paper describes experiments investigating the depolymerization of polyethylene terephthalate (PET). Hydrolysis, glycolysis, and methanolysis reactions were studied. The use of the crude monomer to produce the plasticizer dioctyl terephthalate (DOTP) was also examined. Hydrolysis produced a terephthalic acid unsuitable for plasticizer. The glycolysis reaction product, bis(2-hydroxyethyl terphthalate), might be suitable without further purification for producing elastomeric copolyester. Three differently prepared products of the methanolysis reaction were use in plasticizer production. Economic analysis indicates the cost of recovered dimethyl terephthalate to be on the order of 60% of $800 per metric ton. 7 refs., 2 figs., 1 tab.

17

Synthesis and Characterization of N-Phenylated Wholly Aromatic Non-Cyclic Polyimides from N,N?-Diphenylphthalimidoyl Chlorides and Phthalic Acids  

A novel class of polyimides, N-phenylated wholly aromatic non-cyclic polyimides, was synthesized by the low-temperature solution and two-phase phase-transfer catalyzed polycondensations of new aromatic bis(imidoyl chloride)s, N,N?-diphenylisophthalimidoyl chloride and N,N?-diphenylterephthalimidoyl chloride, with aromatic dicarboxylic acids, isophthalic acid and terephthalic acid. The resulting polyimides were all white in color and had reduced viscosities of 0.11–0.14 dl g?1. Compared with the conventional polyimides having cyclic imide structures, these N-phenylated non-cyclic polyimides exhibited better solubility in various organic solvents, reduced crystallinity and lower glass transition temperatures and thermal stability. The reduced viscosity of a typical polyimide decreased rapidly upon UV light irradiation, indicating the occurrence of photodegradation. Before the polymer synthesis, the effects of reaction medium, organic and inorganic bases and phase-transfer catalyst were studied on the solution and two-phase reactions of N,N?-diphenylisophthalimidoyl chloride with benzoic acid.   

18

Reversed-Phase High-Performance Liquid-Chromatographic Behavior of Phthalic Acid and Terephthalic Acid in the pH Region around the Second pKa Values  

In a reversed-phase high-performance liquid-chromatographic analysis phthalic acid and terephthalic acid were observed as two clearly separated peaks with a mobile phase of pHs around the second pKa values involving the monoanion and dianion species.   

19

Carboxylation of Benzoic Acid Using Cyclodextrin as Catalyst  

Benzoic acid is found to undergo carboxylation by warming with carbon tetrachloride in aqueous alkali in the presence of copper powder with ?-cyclodextrin as catalyst. The reaction under mild conditions gives terephthalic acid in good yield with high selectivity.   

20

Proton and water activity-controlled structure formation in zinc carboxylate-based metal organic frameworks.  

The contributions of terephthalic acid and Zn(2+)-coordinated water in N,N-diethylformamide (DEF) to the overall proton activity in the synthesis of MOF-5 (Zn4O(BDC)3, BDC = 1,4-benzenedicarboxylate) were quantitatively determined by combined electrochemical and UV-vis spectroscopic measurements. Structural transformations of zinc carboxylate-based metal organic frameworks due to their exposure to environments with variable water concentrations and the chemical means necessary to revert these transitions have been investigated. It was found that the water-induced structural transition of MOF-5 to the hydroxide structure Zn3(OH)2(BDC)2 x 2 DEF (MOF-69c) can be reverted by a thermal treatment of the obtained compound and its subsequent exposure to anhydrous DEF. MOF-5 syntheses from simple carboxylates as well as a water-free synthesis based on nitrate decomposition are presented. The latter demonstrates that nitrate can serve as the sole source for the oxide ion in MOF-5. PMID:18652430

 
 
 
 
21

Determining organic impurities in mother liquors from oxidative terephthalic acid synthesis by microemulsion electrokinetic chromatography.  

In this study, a microemulsion electrokinetic chromatography (MEEKC) method was developed to analyze and detect several aromatic acids (benzoic acid (BA), isophthalic acid (IPA), terephthalic acid (TPA), p-toluic acid (p-TA), 4-carboxylbenzaldehyde (4-CBA), trimesic acid (TSA), trimellitic acid (TMA), o-phthalic acid (OPA), and hemimellitic acid (HMA)), which are common organic impurities produced by liquid-phase catalytic oxidation of p-xylene to TPA. The effects of microemulsion composition, column temperature, column length and applied voltage were examined in order to optimize the aromatic acid separations. This work demonstrated that variation in the concentration of surfactant (sodium dodecyl sulfate (SDS)) and oil phase (octane) had a pronounced effect on separation of the nine aromatic acids. It was also found that a decrease in column length had the greatest effect on shortening separation time and improving separation resolution for these aromatic acids when compared to that of an increase in column temperature or applied voltage. However, the nature and concentration of cosurfactants and organic modifiers were found to play only minor roles in the separation mechanism. Thus, a separation with baseline resolution was achieved within 14 min by using a microemulsion solution of pH 2.0 containing 3.7% SDS, 0.975% octane, and 5.0% cyclohexanol; and a 50-cm capillary column (effective length of 40-cm) at 26 degrees C. As a result, the developed MEEKC method successfully determined eight impurities of aromatic acids in the mother liquors produced from the oxidation synthesis of TPA. PMID:19167001

22

77 FR 32503 - Certain Polyester Staple Fiber From Taiwan: Preliminary Results of Antidumping Duty...  

...the entire period). \\9\\ See Stainless Steel Sheet and Strip in Coils From...Decision Memorandum at Comment 6 and Stainless Steel Plate in Coils From Belgium...volatility for purified terephthalic acid (PTA) and monoethylene...

23

COMPATIBILITY IN POLYMER BLENDS COMPRISING BIODEGRADABLE POLYESTERS  

The rheological properties of binary blends of polystyrene (PS) with biodegradable polyesters were investigated. The biodegradable polyesters were: polylactic acid (PLA), polycaprolactone (PCL), poly(tetramethylenemadipate-co-terephthalate (EBU). All blends displayed non-Newtonian behavior, and ze...

24

High throughput synthesis of polyesters using entropically driven ring-opening polymerizations.  

Copolyesters were synthesized in a high throughput (HT) manner and in high yield on ca. a 90 mg scale using entropically driven ring-opening polymerizations (ED-ROPs). This synthetic approach is a valuable addition to the HT polymer synthesis arsenal in that it allows condensation-type polymers with relatively large repeat units, such as those in poly(ethylene terephthalate) and poly(butylene terephthalate), to be obtained easily. The synthetic procedure involved taking mixtures of the appropriate macrocyclic oligoesters and heating them together under neat conditions at 250-300 degrees C for 2 h in the presence of 0.1 mol % of di- n-butyltin oxide or tetra- n-butylammonium tetrafluoroborate. In most cases Mw values were >25,000 and, as expected for ED-ROPs, the polydispersity indices were close to 2.0. Higher molecular weights could be obtained by using longer reaction times, but this might lead to product decomposition. The method worked well for esters formally derived from aliphatic or aromatic acids and alcohols, but less well for esters derived from phenols. Attempts were also made to synthesize copolymers by mixing together the two homopolymers and heating with a catalyst. These reactions were successful in a few instances, but generally, they were not. This is probably because the homopolymers did not mix well. An aluminum reaction block with 36 wells lined with Teflon cups, that fitted snugly in a cylindrical Buchi oven, was the most successful method for carrying out syntheses in an HT manner. PMID:18698829

25

Telechelic ionomeric poly(butylene terephthalate): Synthesis, characterization and comparison with random ionomers  

Telechelic poly(butylene terephthalate) (PBT) ionomers have been prepared by melt synthesis using a new polycondensation process that involves a pre-reaction of sulfobenzoic acid sodium salt with butanediol. No side reaction occurs and the incorporation of the ionic groups is quantitative. The addition of a buffer agent, such as Na3PO4, to the catalyst reduces the THF formation and improves the polycondensation rate. The comparison of the thermo-mechanical and physical properties between random and telechelic ionomers is also reported. The ionic groups act as chain-extension reversible electrostatic links for telechelic ionomers while act as cross-links in random ionomers. Therefore, random ionomers present a consistently higher melt viscosity compared to telechelic ionomers and to PBT and...

26

Synthesis, characterization and desalination study of novel PSAB and mPSAB blend membranes with Polysulfone (PSf)  

The present paper describes the synthesis of poly sulphonyl amino benzamide (PSAB) and methyalated poly sulphonyl amino benzamide (mPSAB) polymer, using terephthalic acid chloride and substituted 4-amino-1-benzensulphonmide in N-methyl-2-pyrrolidone. Polymers were characterized by FT-IR, NMR and GPC. Polysulfone composite membranes were prepared using these novel poymers by DIPS (Diffusion Induced Phase Seperation) method. These composite membranes are useful for water purification with special emphasis on sea water desalination. Newly prepared membranes were studied for salt rejection, water flux, molecular weight cut off by PEG solution, effect of the pH on water swelling and salt rejection and flux decline was also studied. 30 to 70% of the salt rejection was observed in all membranes. ...

27

Synthesis and antibacterial activity of some novel bis-1,2,4-triazolo[3,4-b]-1,3,4-thiadiazoles and bis-4-thiazolidinone derivatives from terephthalic dihydrazide  

A novel series of 1,4-bis(6-(substituted phenyl)-[1,2,4]-triazolo[3,4-b]-1,3,4-thiadiazoles (5a-b) and 4-bis(substituted phenyl)-4-thiazolidinone derivatives (7a-c) have been synthesized from terephthalic dihydrazide (1) through multistep reaction sequence. 1,4-Bis(5-aryl-1,3,4-oxadiazole-2yl) benzene derivatives (2a-f) and bis-substituted terephthalohydrazide (6a-e) were also synthesized from terephthalic dihydrazide by cyclization with various aromatic acids and aldehydes. Terephthalic dihydrazide (1) was obtained from poly(ethylene terephthalate) waste from reaction with hydrazine hydrate in good yield (86%). All the synthesized compounds were screened for their antibacterial activities against various bacteria and fungi strains. Several of these compounds showed potential antibacterial...

28

Modification of calcium carbonate crystals growth by dibenzoic acids  

Effects of various dibenzoic acids (phthalic, isophthalic, and terephthalic) on the polymorph and morphology of calcium carbonate (CaCO3) crystals were investigated. Different dibenzoic acids induced the formation of different CaCO3 crystals. Crystallization of vaterite is favored in the presence of phthalic acid. In the presence of isophthalic acid, crystallization of vaterite is favored at 90^oC, crystallization of calcite is favored at 120 and 150^oC. In the presence of terephthalic acid, calcium terephthalate trihydrate is produced at 90^oC, calcite and aragonite are produced at 120 and 150^oC. The mechanism of structural correspondence was applied to explain the results obtained in the present work.

29

Correlation between iodide dosimetry and terephthalic acid dosimetry to evaluate the reactive radical production due to the acoustic cavitation activity.  

Acoustic cavitation plays an important role in sonochemical processes and the rate of sonochemical reaction is influenced by sonication parameters. There are several methods to evaluate cavitation activity such as chemical dosimetry. In this study, to comparison between iodide dosimetry and terephthalic acid dosimetry, efficacy of sonication parameters in reactive radical production has been considered by iodide and terephthalic acid dosimetries. For this purpose, efficacy of different exposure parameters on cavitations production by 1MHz ultrasound has been studied. The absorbance of KI dosimeter was measured by spectrophotometer and the fluorescence of terephthalic acid dosimeter was measured using spectrofluorometer after sonication. The result of experiments related to sonication time and intensity showed that with increasing time of sonication or intensity, the absorbance is increased. It has been shown that the absorbance for continuous mode is remarkably higher than for pulsing mode (p-valueacoustic cavitation activity in ultrasound field. PMID:22766173

30

Crystal morphology and phase identifications in poly(aryl ether ketones)s and their copolymers  

A series of poly(aryl ether ketone ketone)s prepared from diphenyl ether (DPE) and terephthalic acid M or isophthalic acid (T) have been investigated. PEKK(T) has been reported to exhibit two polymorphism (form I and form II) based on wide angle X-ray diffraction (WAXD) and electron diffraction (ED) experiments.

31

Regioselective carboxylation of aromatic compounds using cyclodextrin as mediator  

The direct introduction of a carboxylic group into an aromatic carboxylic acid has been considered difficult theoretically. Recently, the regioselective syntheses of terephthalic acid, 4,4prime-biphenyldicarboxylic acid and 2,6-naphthalene-dicarboxylic acid have been achieved by the carboxylation of benzoic acid, 4-biphenylcarboxylic acid and 2-naphthalenecarboxylic acid, respectively, with carbon tetrachloride and copper powder in aqueous alkali, using b-cyclodextrin (b-CyD) as mediator under mild conditions. The one-pot syntheses of terephthalic acid, 4,4prime-biphenyldicarboxylic acid and 2,6-naphthalene-dicarboxylic acid have been attained by the carboxylation of benzene, biphenyl and naphthalene, respectively, with carbon tetrachloride and copper powder in aqueous alkali, using b-CyD ...

32

Preparation, characterization, and properties of novel biodegradable aliphatic-aromatic copolyester nanohybrids with polyhedral oligomeric silsesquioxanes moieties  

Abstract Biodegradable aliphatic-aromatic copolyester nanohybrids, with polyhedral oligomeric silsesquioxane (POSS) moieties tethered between poly(lactic acid) (PLA) and poly(butylene terephthalate) segments, is designed and prepared. First, (bis(2-hydroxyethyl) dipropionate POSS, BH-POSS) is synthesized under mild conditions, then in situ polycondensation is carried out in the presence of terephthalic acid, PLA oligomer, 1,4-butanediol, and BH-POSS.1 H-NMR and Fourier transfer infrared spectroscopy confirm that Michael addition reaction of amino-POSS and hydroxyethyl acrylate takes place efficiently and forms BH-POSS in high yield at room temperature. Owing to similar functional groups, BH-POSS could be easily incorporated into the macromolecular chains and obtain final copolyester nanohy...

33

Hydrolysis of polyethyleneterephthalate by p-nitrobenzylesterase from Bacillus subtilis  

Abstract From a screening on agar plates with bis(benzoyloxyethyl) terephthalate (3PET), a Bacillus subtilis p-nitrobenzylesterase (BsEstB) was isolated and demonstrated to hydrolyze polyethyleneterephthalate (PET). PET-hydrolase active strains produced clearing zones and led to the release of the 3PET hydrolysis products terephthalic acid (TA), benzoic acid (BA), 2-hydroxyethyl benzoate (HEB), and mono-(2-hydroxyethyl) terephthalate (MHET) in 3PET supplemented liquid cultures. The 3PET-hydrolase was isolated from non-denaturating polyacrylamide gels using fluorescein diacetate (FDA) and identified as BsEstB by LC-MS/MS analysis. BsEstB was expressed in Escherichia coli with C-terminally fused StrepTag II for purification. The tagged enzyme had a molecular mass of 55.2 kDa and a specific a...

34

High density of immobilized galactose ligand enhances hepatocyte attachment and function.  

Galactosylated surface is an attractive substrate for hepatocyte culture because of the specific interaction between the galactose ligand and the asialoglycoprotein receptor on hepatocytes. In this study, we described a scheme to achieve high density of immobilized galactose ligands on polyethylene terephthalate (PET) surface by first surface-grafting polyacrylic acid on plasma-pretreated PET film under UV irradiation, followed by conjugation of a galactose derivative (1-O-(6'-aminohexyl)-D-galactopyranoside) to the grafted polyacrylic acid chains. A high galactose density of 513 nmol/cm(2) on the PET surface was used in this study to investigate the behavior of cultured hepatocyte. This engineered substrate showed high affinity to fluorescein isothiocyanate-lectin binding. Primary rat hepatocytes, when seeded at a density of 2 x 10(5) cells/cm(2), attached to the galactosylated PET substrate at a similar efficiency compared with collagen-coated substrate. The hepatocytes spontaneously formed aggregates 1 day after cell seeding and showed better maintenance of albumin secretion and urea synthesis functions than those cultured on collagen-coated surface. PMID:14624494

35

Rapid Determination of Terephthalic Acid in the Hydrothermal Decomposition Product of Poly(ethylene terephthalate) by Thermochemolysis–Gas Chromatography in the Presence of Tetramethylammonium Acetate  

Thermochemolysis–gas chromatography in the presence of tetramethylammonium acetate was applied to the direct determination of terephthalic acid (TPA) contained in solid decomposition products obtained from the hydrothermal recycling process of poly(ethylene terephthalate) (PET). On the chromatograms of the hydrothermal decomposition products of PET, a sharp peak of the TPA component was clearly observed as its corresponding dimethyl ester formed through the thermochemolysis reaction. Based on the peak intensities, the contents of TPA in the decomposition products were determined precisely and rapidly without using any cumbersome sample pretreatments.   

36

Melt reaction and structural analysis based on poly(butylene terephthalate) and oligo(lactic acid) with addition of butanediol  

The poly(1,4-butylene terephthalate-co-DL-lactide) (BLA) copolymers were successfully prepared by the melt reaction between poly(1,4-butylene terephthalate) (PBT) and DL-oligo(lactic acid) (OLA) in the presence of 1,4-butanediol (BDO) without any catalysts. The transesterification between butylenes terephthalate (BT), 1,4-butanediol and lactide (LA) segments during the reaction was confirmed by the 1H NMR analysis. The chemical structure of the copolymers was further investigated by the 13C NMR and two-dimensional 1H?13C HMQC (heteronuclear multiple quantum correlation) technique. The effect of reaction temperatures and the starting feed ratios on the molecular microstructures, molecular weights, solubility and thermal stability of the copolyesters was extensively studied. The sequence len...

37

Biotolerant and haemodynamic effects of copolymerization with acrylic acid on Dacron arterial prostheses.  

The biotolerant and haemodynamic effects of three types of woven polyethylene terephthalate (Dacron) arterial prostheses were compared. Two of these were unmodified, one low, one high porosity; and the third was the latter type radiation graft copolymerized with 5% acrylic acid. The prostheses were ...

38

Sequential reordering in condensation copolymers, 6a average block lengths in Poly(ethylene terephthalate) - Polyamide 6 copolymers as revealed by NMR spectroscopy  

An equimolar physical blend comprising poly(ethylene terephthalate) (PET), polyamide 6 (PA6) and catalytic amounts of p-toluene sulfonic acid (pTSA) was studied by differential scanning calorimetry (DSC) and 13C NMR spectroscopy before and after reactive blending for various times at 2808C that enab...

39

Visualization of Chemical Modification of Pore Internal Surfaces Using Fluorescence Microscopy  

Chemical modification of pore internal surfaces with 0.31 and 0.54 ?m in diameter in poly(ethylene terephthalate) (PET) was examined using the alkylation reaction of the carboxylic acids on the surfaces. The chemical incorporation of the reagent on the surfaces was confirmed by the fluorescence microscope images of the membranes reacting with the alkylation reagent bearing a pyrene fluorophore.   

40

RHEOLOGY AND MORPHOLOGY OF EXTRUDED BLENDS OF POLYSTYRENE WITH BIODEGRADABLE POLYESTERS  

Zero-shear viscosity (zsv) of polycaprolactone (PCL)/PS, polylactic acid (PLA)/PS, and poly(tetramethyleneadipate-co-terephthalate (EBU)/PS blends at 25/75, 50/50, and 75/25% (w/w) ratios was determined and transmission electron microscopy (TEM) of embedded, sectioned samples was performed. Except ...

 
 
 
 
41

Biodegradable composites from polyester and sugar beet pulp with antimicrobial coating for food packaging  

Totally biodegradable, double-layered antimicrobial composite Sheets were introduced for food packaging. The substrate layers of the sheets were prepared from poly (lactic acid) (PLA) and sugar beet pulp (SBP) or poly (butylene adipate-co-terephthalate (PBAT) and SBP by a twin-screw extruder. The ac...

42

Bimodal electricity generation and aromatic compounds removal from purified terephthalic acid plant wastewater in a microbial fuel cell.  

Wastewater of purified terephthalic acid (PTA) from a petrochemical plant was examined in a membrane-less single chamber microbial fuel cell for the first time. Time course of voltage during the cell operation cycle had two steady phases, which refers to the fact that metabolism of microorganisms was shifted from highly to less biodegradable carbon sources. The produced power density was 31.8 mW m(-2) (normalized per cathode area) and the calculated coulombic efficiency was 2.05 % for a COD removal of 74 % during 21 days. The total removal rate of different pollutants in the PTA wastewater was observed in the following order: (acetic acid) > (benzoic acid) > (phthalic acid) > (terephthalic acid) > (p-toluic acid). The cyclic voltammetry results revealed that the electron transfer mechanism was dominated by mediators which were produced by bacteria. PMID:23076363

43

Enzymatic Synthesis of Aromatic Polyesters by Lipase-Catalyzed Polymerization of Dicarboxylic Acid Divinyl Esters and Glycols  

Polyesters containing aromatic moiety in the main chain have been synthesized by enzymatic polymerization of dicarboxylic acid divinyl esters and glycols under mild reaction conditions. Divinyl esters of isophthalic acid, terephthalic acid, and p-phenylene diacetic acid, were used as new monomer for the enzymatic polymerization. Effects of the polymerization conditions were systematically investigated in the polymerization of divinyl isophthalate and 1,6-hexanediol. Candida antarctica lipase afforded the polymer of the highest molecular weight. Methylene chain length of the glycol affected the polymer yield and molecular weight. Divinyl terephthalate was enzymatically polymerized under the similar reaction conditions, yielding the polymer of lower molecular weight. Enzymatic polymerization of divinyl sebacate and p-xylylene glycol also afforded the aromatic polyester.   

44

Structure and plastic deformation of aromatic main-chain mesomorphic copolyesters  

Thermodynamic characteristics of inelastic deformation (work W def, heat Q def, and stored energy ?U def) are studied for aromatic main-chain copolyesters (CPEs) based on p-hydroxybenzoic acid and poly(ethylene terephthalate) (Rodrun and SKB-1), p-hydroxybenzoic acid, naphthalene carboxylic acid, and terephthalic acid with hydroquinone and dioxyphenyl (HX-6000 and HX-7000). The samples are deformed under an active uniaxial compression by ?def ? 50% at room temperature. All CPEs are semicrystalline polymers; their degree of crystallinity is (depending on their prehistory) 5?30%, and the melting temperature of crystallites is 275?350?C. Seemingly, the glassy component of CPEs includes two interpenetrating glassy structures, S-1 and S-2, with different glass-transition temperatures Tg: 90?120...

45

Crystal Structure of Potassium Hydrogen Terephthalate: Symmetric Hydrogen Bond in One-Dimensional Chain  

Crystal structure of potassium hydrogen terephthalate was determined by X-ray diffraction. Crystals have monoclinic unit cells with C2/c,?a = 18.776(6), b = 3.761(3), c = 11.150(4) Å, ? = 94.72(3)°, V = 784.6(6) Å3, and Z = 4. Acid anions form a one-dimensional chain linked by short (RO···O = 2.459(3) Å) and symmetric hydrogen bonds. The acidic hydrogen was distributed at two equivalent sites in the hydrogen bond.   

46

Kinetics and Modeling of Melt Polycondensation for Synthesis of Poly[(butylene succinate) co (butylene terephthalate)], 1 Esterification  

Abstract The kinetics of the tetrabutyl titanate catalyzed homogeneous succinic acid/1,4 butylenediol (BDO) and heterogeneous terephthalic acid/BDO esterifications were investigated experimentally and theoretically. A unified kinetic model considering two main esterifications as well as one reversible polycondensation and two THF forming side reactions has been developed for the two esterification systems. The model agrees well with the experimental results. The effects of reaction temperature, diol/diacid ratio, catalyst amount, and heterogeneity on the esterification kinetics are simulated and discussed.

47

XPS utilization in the characterization of glycerol based polyesters; Utilizacao de XPS na caracterizacao de poliesteres a base de glicerol  

X-ray photoelectron spectroscopy-XPS allows the determination of all elements of the periodical table, except hydrogen and helium, and is a very used technique for the polymers characterization, its spectra constitutes a 'fingerprint' of the material. Two samples of polymers were prepared from glycerol and fumaric acid and glycerol and terephthalic acid, with a molar ratio of 1:1 and 1:1.5. The general spectra show the presence of carbon and oxygen, the main components of the polymer. From the binding energies values of the C1s and O1s high resolution spectra it was possible to determine the carbon functional groups. Their concentration were determined and the presence of the aromatic carbon in the terephthalic polyesters was observed, and also similar proportions of aliphatic carbon and ester groups in the fumaric acid polyesters. For both polyesters, an amount of carboxyl group appears, indicating the terminal non-reacted groups. These results were confirmed qualitatively by FTIR. (author)

48

Polyesters production from the mixture of phthalic acid, terephthalic and glycerol; Producao de poliesteres a partir da mistura de acido ftalico, tereftalico e glicerol  

Glycerin, a byproduct of biodiesel is currently an environmental and economic problem for producers of this renewable fuel in Brazil and in others parts of the world. In order to offer new proposals for recovery, it is used for the manufacture of polyesters used in applications in diverse areas such as construction and automobile industry. This work reports the production of polymer from the mixture of terephthalic and phthalic acid in three different proportions. The polyesters showed good thermal stability, analyzed by TGA and DSC, with an increase proportional to the terephthalic acid content. The X-ray diffraction patterns show that the samples are semi crystalline polymers. The micrographs indicated the presence of a smoother surface in the polyester that has a larger amount of phthalic acid, as reported in the literature. Therefore, the materials showed good thermal properties and morphological characteristics, so it consists in a new alternative to use glycerin. (author)

49

Transesterification Reaction of Dimethyl Terephthalate by 2-Ethylhexanol in the Presence of Heterogeneous Catalysts under Solvent-free Condition  

In this study, the synthesis of bis-(2-ethylhexyl) terephthalate, via the transesterification reaction of dimethyl terephthalate (DMT) by 2-ethylhexanol in the presence of different heterogeneous catalysts, such as Pb(OAc)23H2O, Cd(OAc)22H2O, Zn(OAc)22H2O, Hg(OAc)2, Ca(OAc)2H2O, Cu(OAc)2H2O, NaOAc, CaCO3, CaO, ZnSO47H2O, and sulfated zirconia, has been investigated. The reactivity of the catalysts in the reaction progress has been studied and compared. It was found that, hydrated cadmium acetate and sulfated zirconia were reactive catalysts to this reaction. The extent of transesterification of methyl ester groups reached up to 93% and 85.6% using these catalysts, respectively.

50

Reactions induced by triphenyl phosphite addition during melt mixing of poly(ethylene terephthalate) poly(butylene terephthalate) blends: Influence on polyester molecular structure and thermal behaviour  

The influence of triphenyl phosphite addition in molten poly(ethylene terephthalate) or poly(ethylene terephthalate)/poly(butylene terephthalate) blends has been investigated. Torque measurements during polyester processing and corresponding intrinsic viscosity values confirm an expected chain exten...

51

Reactions induced by triphenyl phosphite addition during melt mixing of PET/PBT blends: chromatographic evidence of a molecular weight increase due to the creation of bonds of two different natures  

A detailed chromatographic investigation has been carried out on the influence of triphenyl phosphite addition in molten poly(ethylene terephthalate) or poly(ethylene terephthalate)/poly(butylene terephthalate) blends. The observed molecular weight evolution corresponds to torque and viscosity obser...

52

76 FR 54791 - Polyethylene Terephthalate (PET) Film From Korea  

...Review] Polyethylene Terephthalate (PET) Film From Korea Determination On the basis...order on polyethylene terephthalate (PET) film from Korea would not be likely to...entitled Polyethylene Terephthalate (PET) Film from Korea: Investigation No....

53

Assessment of physical properties of fibres from thermoplastic polymers by means of tensiometric tests  

Several properties of fibres and monofilaments made from polymers such as polyamide 6 (PA), poly(ethylene terephthalate) (PET), polypropylene (PP), aliphatic polyester of butanediol, succinic and adipic acids (PBSA), aliphatic-aromatic polyester of butanediol, terephthalic and adipic acids (PBTA) have been studied. Wettability of monofilaments has been tested by dynamic contact angle method, so surface free energy of synthetic fibres could be calculated. A tensiometer was used for testing the fibre-to-fibre friction coefficient, Young's modulus and bending modulus. It was found that the surface properties of fibres from synthetic polymers such as surface free energy, moisture absorption, and friction coefficient are related to the physical as well as physical-chemical properties, elasticit...

54

Evaluation of correlation between chemical dosimetry and subharmonic spectrum analysis to examine the acoustic cavitation  

Currently several therapeutic applications of ultrasound in cancer treatment are under progress which uses cavitation phenomena to deliver their effects. There are several methods to evaluate cavitation activity such as chemical dosimetry and measurement of subharmonic signals. In this study, the cavitation activity induced by the ultrasound irradiation on exposure parameters has been measured by terephthalic acid chemical dosimetry and subharmonic analysis. Experiments were performed in the near 1MHz fields in the progressive wave mode and effect of duty cycles changes with 2W/cm2 intensity (ISATA) and acoustic intensity changes in continuous mode on both fluorescence intensity and subharmonic intensity were measured. The dependence between fluorescence intensity of terephthalic acid chem...

55

Characterization and thermal-oxidative degradation behavior of poly(ethylene terephthalate-co-4,4--bibenzoate) prepared via direct esterification technique  

Abstract A series of poly(ethylene terephthalate-co-4,4--bibenzoate)s (PETBBs) were prepared via direct esterification from the monomers of terephthalic acid (TPA), 4,4--biphenyl dicarboxylic acid (BPDA), and ethylene glycol (EG) with different molar ratios. The chemical compositions of the obtained PETBBs, investigated by H1-NMR, were identical with the feed ratio, and the high molecular weights of PETBBs were confirmed by GPC analysis. The glass transition, crystallization, and melting behavior of them were measured by DSC; the results indicated that, in the range of 5-25 mol% of BPDA addition, the glass transition temperature (Tg) increased almost linearly and the melting temperature (Tm) decreased with increasing content of BPDA unit. As expected, the crystallization of PETBB became di...

56

Preparation and characterization of biodegradable aliphatic-aromatic copolyesters/nano-SiO2 hybrids via in situ melt polycondensation  

In situ melt polycondensation was proposed to prepare biodegradable aliphatic-aromatic copolyesters/nano-SiO2 hybrids based on terephthalic acid (TPA), poly(l-lactic acid) oligomer (OLLA), 1,4-butanediol (BDO) and nano-SiO2. TEM and FT-IR characterizations confirmed that TPA, OLLA and BDO copolymerized to obtain biodegradable copolyesters, poly(butylene terephthalate-co-lactate) (PBTL), and the abundant hydroxyl groups on the surface of nano-SiO2 provided potential sites for in situ grafting with the simultaneous resulted PBTL. The nano-SiO2 particles were chemically wrapped with PBTL to form PBTL/nano-SiO2 hybrids. Due to the good dispersion and interfacial adhesion of nano-SiO2 particles with the copolyester matrix, the tensile strength and the Young's modulus increased from 5.4 and 5.6M...

57

Biodegradable aliphatic/aromatic copolyesters based on terephthalic acid and poly(L-lactic acid): Synthesis, characterization and hydrolytic degradation  

Biodegradable aliphatic/aromatic copolyesters, poly(butylene terephthalate-co-lactate) (PBTL) were prepared via direct melt polycondensation of terephthalic acid (TPA), 1,4-butanediol (BDO) and poly(L-lactic acid) oligomer (OLLA). The effects of polymerization time and temperature, as well as aliphatic/aromatic moiety ratio on the physical and thermal properties were investigated. The largest molecular weight of the copolyesters was up to 64100 with molecular weight distribution index of 2.09 when the polycondensation was carried out at 230?C for 6 h. DSC, XRD, DMA and TGA analysis clearly indicated that the degree of crystallinity, glass-transition temperature, melting point, decomposition temperature, tensile strength, elongation and Young?s modulus were influenced by the ratio between T...

58

New Poly(ether-alkyl)hydrazides: Synthesis and Characterization  

A series of new acylic dichlorides were prepared from 4,4?-dihydroxybiphenyl and the ethylester of an ?-Bromo alkyl-carboxylic acid. These dichlorides condensed with terephthalic dihydrazide. The resulting poly(ether-alkyl)hydrazides (PEHZ), whose general formula is: -[-NHNH-CO-(Remark: Graphics omitted.)-CO-NHNH-CO-(CH2)n-O-(Remark: Graphics omitted.)-(Remark: Graphics omitted.)-O-(CH2)n-CO-]-x were characterized by inherent viscosity, elemental analysis, differential scanning calorimetry (DSC), thermogravimetric analysis (TGA), and WAXS experiments.   

59

Novel Zn(II) coordination polymer based on 1,2-bis(4-pyridyl)hydrazine: from two-dimensional to three-dimensional network  

Two MOFs were reported based on Zn(II) with 1,2-bis(4-pyridyl)hydrazine (L1); a two-dimensional interpenetrating MOF I of formula [Zn2(L1)2(L2)2]? was formed with terephthalic acid (L2) as an additional linker. A three-dimensional MOF II of formula [Zn2(L1)2(L3)2]?, was formed with the use of a larg...

60

Volume Change Behavior of Poly(L-lysine-alt-terephthalic acid) Microcapsules Encapsulating Glucose Oxidase  

Glucose-sensitive microcapsules, whose volume changed in response to glucose, were successfully prepared by encapsulating glucose oxidase (GOx) into poly(L-lysine-alt-terephthalic acid) (PPL) microcapsules. The GOx–PPL microcapsules decreased in size in a glucose solution, after a certain lag time. The shrinking rate of the capsules showed a linear correlation with glucose concentration, while the lag time showed a logarithmical correlation with the glucose concentration.   

 
 
 
 
61

Semipermeable membranes based on specified tetrabromobisphenol type polyesters  

This patent describes a process for separating a component from an O{sub 2}/N or CO{sub 2}/CH{sub 4} gas mixture containing. It comprises: contracting the gas mixture with one side of a gas separation membrane comprising a thin layer predominantly of a polyester or copolyester derived form the reaction of an aromatic dicarboxylic acid or derivative thereof and greater than 50 mol percent of a tetrabromobisphenol, or divalent cyclododecyl and wherein the aromatic discarboxylic acid or divalent cyclododecyl and wherein the aromatic dicarboxylic acid or derivative thereof comprises 80 mole percent or more of isophthalic acid or its dichloride and/or 4-bromoisophthalic acid or its dichloride and 20 mole percent or less of terephthalic acid or its dichlorid and/or 2-bromoterephthalic acid or its dichloride as the dicarboxylic acid compound, or 30 mole percent or less of isophthaloyl dichloride and/or 4-homoisophthalic acid or its dichloride and 70 mole percent or more of terephthalic acid or its dichloride and/or 2-bromoterepohthalic acid or is dichloride; the membrane having a combination of high selectivity and high permeation rate values, while maintaining a pressure differential across the two sides of the membrane and removing the permeated component from the other side of the membrane.

62

Molecular characterization of urban organic aerosol in tropical India: contributions of primary emissions and secondary photooxidation  

Organic molecular composition of PM10 samples, collected at Chennai in tropical India, was studied using capillary gas chromatography/mass spectrometry. Fourteen organic compound classes were detected in the aerosols, including aliphatic lipids, sugar compounds, lignin products, terpenoid biomarkers, sterols, aromatic acids, hydroxy-/polyacids, phthalate esters, hopanes, Polycyclic Aromatic Hydrocarbons (PAHs), and photooxidation products from biogenic Volatile Organic Compounds (VOCs). At daytime, phthalate esters were found to be the most abundant compound class; however, at nighttime, fatty acids were the dominant one. Di-(2-ethylhexyl) phthalate, C16 fatty acid, and levoglucosan were identified as the most abundant single compounds. The nighttime maxima of most organics in the aerosols indicate a land/sea breeze effect in tropical India, although some other factors such as local emissions and long-range transport may also influence the composition of organic aerosols. However, biogenic VOC oxidation products (e.g., 2-methyltetrols, pinic acid, 3-hydroxyglutaric acid and ?-caryophyllinic acid) showed diurnal patterns with daytime maxima. Interestingly, terephthalic acid was maximized at nighttime, which is different from those of phthalic and isophthalic acids. A positive relation was found between 1,3,5-triphenylbenzene (a tracer for plastic burning) and terephthalic acid, suggesting that the field burning of municipal solid wastes including plastics is a significant source of terephthalic acid. Organic compounds were further categorized into several groups to clarify their sources. Fossil fuel combustion (24-43%) was recognized as the most significant source for the total identified compounds, followed by plastic emission (16-33%), secondary oxidation (8.6-23%), and microbial/marine sources (7.2-17%). In contrast, the contributions of terrestrial plant waxes (5.9-11%) and biomass burning (4.2-6.4%) were relatively small. This study demonstrates that, in addition to fossil fuel combustion and biomass burning, the open-burning of plastics in urban area also contributes to the organic aerosols in South Asia.

63

Role of primary and secondary bile acids as feedback inhibitors of bile acid synthesis in the rat in vivo.  

The effect of various primary and secondary bile acids on the rates of synthesis of all major bile acids was studied in the live rat with an extracorporal bile duct. Bile acid synthesis was determined using HPLC based on mass or by isotope dilution. Derepressed rates of bile acid synthesis (30-54 h)...

64

Analysis of cotton/polyester fabrics using pyrolysis gas chromatography  

A pyrolysis gas-chromatographic method(Py-GC) was utilized for the identification as well as the content measurement of textile materials. Py-GC was applied to natural cotton fiber, synthetic polyester fiber, and their blended fabrics. The characteristic peaks originated from thermally decomposed products were observed, and the area of peak increase with the content of polyester. The products of pyrolized polyester were identified as benzoic acid terephthalic acid, and vinyl benzoic acid, which were characterized by mass spectrometry. This analytic method offered a quantitative means to identify the content of cotton and polyester. (author). 11 refs., 2 tabs., 3 figs.

65

Quantificação de antimônio em garrafas de politereftalato de etileno (PET) brasileiras por fluorescência de raios-X e avaliação quimiométrica para verificar a presença de pet reciclado através do teor de ferro/ Quantification of antimony in Brazilian polyethylene terephthalate (PET) bottles by X-ray fluorescence and chemometric evaluation to verify the presence of recycled pet through iron content  

Abstract in english Antimony is a common catalyst in the synthesis of polyethylene terephthalate used for food-grade bottles manufacturing. However, antimony residues in final products are transferred to juices, soft drinks or water. The literature reports mentions of toxicity associated to antimony. In this work, a green, fast and direct method to quantify antimony, sulfur, iron and copper, in PET bottles by X-ray fluorescence spectrometry is presented. 2.4 to 11 mg Sb kg-1 were found in 20 (more) samples analyzed. The coupling of the multielemental technique to chemometric treatment provided also the possibility to classify PET samples between bottle-grade PET/recycled PET blends by Fe content.

66

Using nanoparticles as direct-injection printing ink to fabricate conductive silver features on a transparent flexible PET substrate at room temperature  

Conductive metallic features that are flexible could have application in integrated circuits, ranging from large-area electronics to low-end applications. This paper shows the creation of conductive silver thin film and wire on the transparent flexible polyethylene terephthalate (PET) substrate by a room-temperature chemical reduction process. One-step synthesis and spectroscopic characterizations of size-controlled silver nanoparticles are also described. Transmission electron microscopy, Fourier transform infrared spectroscopy, thermal gravimetric-mass analysis, X-ray photoelectron spectroscopy and synchrotron radiation X-ray diffraction were used to characterize the dodecanoate-protected silver nanoparticles. Silver metal film and wire were produced by soaking the dodecanoate-protected ...

67

Synthesis, crystal structures, and properties of [Ca(H2O)2(Dmf@CB[6])(Bdc)] ? DMF ? 4H2O and [Ca(H2O)3(Dmf@CB[6])]Cl2 ? 2H2O  

Complexes [Ca(H2O)2(Dmf@CB[6])(Bdc)] ? DMF ? 4H2O (I) and [Ca(H2O)3(Dmf@CB[6])]Cl2 ? 2H2O (II) are synthesized by the heating (95?C) of a mixture of calcium chloride and cucurbit[6]uril (CB[6]) in a mixture of dimethylformamide (DMF) and water with the addition of terephthalic acid (H2Bdc) in the case of complex I or triethylamine for complex II. The compounds are characterized by X-ray diffraction analysis, IR spectroscopy, and thermogravimetric and elemental analyses. The luminescence spectra are also recorded. According to the X-ray diffraction data, the calcium atom is coordinated by the oxygen atoms of the cucurbit[6]uril molecule, water molecules, and terephthalate anion (for I). The internal cavity of the cavitand is occupied by DMF.

68

Anaerobic degradation of purified terephthalic acid wastewater using a novel, rapid mass-transfer circulating fluidized bed.  

The anaerobic treatability of purified terephthalic acid (PTA) wastewater in a novel, rapid mass-transfer fluidized bed reactor using brick particles as porous carrier materials was investigated. The reactor operation was stable after a short 34 day start-up period, with chemical oxygen demand (COD) removal efficiency between 65 and 75%, terephthalate (TA) removal efficiency between 60% and 70%, and system organic loading rate (OLR) increasing from 7.37 to 18.52 kg COD/m(3) d. The results demonstrate that the reactor is very efficient, and requires a low hydraulic retention time (HRT) of 8 h to remove both TA and COD from the high-concentration PTA wastewater. The system also has high resistance capacity to varied OLR. PMID:22592469

69

Molecular characterization of urban organic aerosol in tropical India: contributions of biomass/biofuel burning, plastic burning, and fossil fuel combustion  

Organic molecular composition of PM10 samples, collected at Chennai in tropical India, was studied using capillary gas chromatography/mass spectrometry. Twelve organic compound classes were detected in the aerosols, including aliphatic lipids, sugar compounds, lignin products, terpenoid biomarkers, sterols, aromatic acids, phthalates, hopanes, and polycyclic aromatic hydrocarbons (PAHs). At daytime, phthalates was found to be the most abundant compound class; while at nighttime, fatty acids was the dominant one. Concentrations of total quantified organics were higher in summer (611-3268 ng m-3, average 1586 ng m-3) than in winter (362-2381 ng m-3, 1136 ng m-3), accounting for 11.5±1.93% and 9.35±1.77% of organic carbon mass in summer and winter, respectively. Di-(2-ethylhexyl) phthalate, C16 fatty acid, and levoglucosan were identified as the most abundant single compounds. The nighttime maxima of most organics in the aerosols indicate a land/sea breeze effect in tropical India, although some other factors such as local emissions and long-range transport may also influence the composition of organic aerosols. The abundances of anhydrosugars (e.g., levoglucosan), lignin and resin products, hopanes and PAHs in the Chennai aerosols suggest that biomass burning and fossil fuel combustion are significant sources of organic aerosols in tropical India. Interestingly, terephthalic acid was maximized at nighttime, which is different from those of phthalic and isophthalic acids. A positive correlation was found between the concentration of 1,3,5-triphenylbenzene (a tracer for plastic burning) and terephthalic acid, suggesting that field burning of municipal solid wastes including plastics is a significant source of terephthalic acid. This study demonstrates that, in addition to biomass burning and fossil fuel combustion, the open-burning of plastics also contributes to the organic aerosols in South Asia.

70

A Synthesis of Senecionine, a Representative of Hepatotoxic, Macrocyclic Pyrrolizidine Alkaloids of Retronecine Type  

Described is a synthesis of (?)-senecionine, the best-known hepatotoxic, 12-membered pyrrolizidine alkaloid of retronecine type. Integerrinecic acid lactone methyl ester was converted into protected senecic acid, which was regioselectively coupled with (+)-retronecine, achieving the first synthesis of (?)-senecionine.   

71

Macrocyclic organotin(IV) carboxylates based on benzenedicarboxylic acid derivatives: Syntheses, crystal structures and antitumor activities  

Six new organotin carboxylates based on 1,3-benzenedicarboxylic acid and 1,4-benzenedicarboxylic acid derivatives, namely (Ph3Sn)2(2,5-L1)(C2H5OH)2 (1) (2,5-H2L1 = 2,5-dibenzoylterephthalic acid), (Ph3Sn)2(2,5-L2)(C2H5OH)2 (2) (2,5-H2L2 = 2,5-bis(4-methylbenzoyl)terephthalic acid), (Ph3Sn)2(2,5-L3)(C2H5OH)2 (3) (2,5-H2L3 = 2,5-bis(4-ethylbenzoyl)terephthalic acid), [(n-Bu2Sn)4(4,6-L1)O2(OH)(OC2H5)]22(C2H5OH) (4) (4,6- H2L1 = 4,6-dibenzoylisophthalic acid), [(n-Bu2Sn)4(4,6-L1)O2(OH)(OC4H9)]22(C4H9OH) (5) and [(n-Bu2Sn)4(4,6-L2)O2(OH)(OC2H5)]22(C2H5OH) (6) (4,6-H2L2 = 4,6-bis(4-methylbenzoyl)isophthalic acid), have been synthesized. All the organotin carboxylates have been characterized by elemental analysis, IR, 1H and 13C NMR spectroscopy and X-ray crystallography diffraction analyses. The...

72

Genomic expression profiles in liver of mice exposed to purified terephthalic acid manufacturing wastewater  

DNA micorarray was used to analyze hepatic transcriptional profile of male mice (Mus musculus) after 35-d intragastric perfusion treatment with purified terephthalic acid (PTA) manufacturing wastewater. Haematological analysis demonstrated that the levels of glutamyl transferase and lactate dehydrogenase in serum were significantly decreased, and DNA microarray showed that a total of 306 genes were differentially expressed in PTA wastewater-treated mice. According to Kyoto encyclopedia of genes and genomes pathway database, the differentially expressed genes were mainly grouped to metabolic pathways (58 genes) and biological processes (101 genes). PTA wastewater had significant impacts upon metabolisms of lipid, carbohydrate, amino acid, vitamin and nucleotide. Several signal transduction ...

73

High Selective Conversion of Poly(ethylene terephthalate) into Oil Using Ca(OH)2  

It is a well known fact that sublimation substances, such as benzoic acid and terephthalic acid, are produced in the thermal decomposition of PET, and this causes problems in plastic recycling plants. However, it is clear that the addition of Ca(OH)2 affects the high selectivity of benzene without producing sublimation substances. The yield of benzene was 35.85 wt % at 700 °C and a 10.0 Ca(OH)2/PET molar ratio. This value means that the selectivity of benzene is 78.8% for liquid products, and 85.1 wt % for aromatic ring in input PET.   

74

Low-temperature side-chain cleavage and decarboxylation of polythiophene esters by acid catalysis  

Abstract Solubility switching of polymers is very useful in thin layer processing of conjugated polymers, as it allows for multilayer processing and increases the stability of the polymer. Acid catalyzed thermocleavage of ester groups from thiophene polymers carrying primary, secondary, and tertiary substituents have been examined by TGA-MS using different sulphonic acids. A substantial lowering of the cleavage temperature is observed, and the ester cleavage can even be performed in situ on roll-to-roll-coated films on polyethylene terephthalate (PET). 2011 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2012

75

Low-temperature side-chain cleavage and decarboxylation of polythiophene esters by acid catalysis  

Solubility switching of polymers is very useful in thin layer processing of conjugated polymers, as it allows for multilayer processing and increases the stability of the polymer. Acid catalyzed thermocleavage of ester groups from thiophene polymers carrying primary, secondary, and tertiary substituents have been examined by TGA?MS using different sulphonic acids. A substantial lowering of the cleavage temperature is observed, and the ester cleavage can even be performed in situ on roll?to?roll?coated films on polyethylene terephthalate (PET). © 2011 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2012

76

Synthesis and characterization of novel optically active polyesters with high thermal stability  

Abstract A new optically active diacid (DA) was prepared by nucleophilic substitution reaction of R-(-)-mandelic acid with terephthaloyl chloride in the presence of potassium hydroxide. This DA named terephthalic acid bis(carboxyphenylmethyl) ester was used as a monomer for the preparation of related optically active polyesters. Polycondensation of DA with different aromatic diols, including hydroquinone, 1,5-dihydroxy naphthalene, 1,4-dihydroxy anthraquinone, 1,8-dihydroxy anthraquinone, 2,4-dihydroxy benzophenone, and bisphenol A, in the presence of 4-toluenesulfonyl chloride using high temperature solution method led to preparation of different polyesters. The prepared monomer and all the polymers were characterized by conventional methods. Thermal and physical properties of the polyest...

77

Supramolecular Polymer Hydrogels from Bolaamphiphilic L-Histidine and Benzene Dicarboxylic Acids: Thixotropy and Significant Enhancement of EuIII Fluorescence  

Abstract Supramolecular polymers from the bolaamphiphilic L-histidine (BolaHis) and benzene dicarboxylic acids (o-phthalic acid, OPA; isophthalic acid, IPA and terephthalic acid, TPA) were found to form hydrogels although neither of the single components could gel water. It was suggested that the hydrogen bond and ionic interactions among different imidazole and carboxylic acid groups are responsible for the formation of the supramolecular polymer as well as the hydrogel formation. Depending on the structures of the dicarboxylic acids, different behaviors of the gels were observed. The hydrogels from OPA/BolaHis and IPA/BolaHis showed thixotropic properties, that is, the hydrogel was destroyed by hand shaking and then slowly gelated again at room temperature. However, the hydrogels of TPA/...

78

Hydrolysis, absorption and metabolism of di(2-ethylhexyl) terephthalate in the rat.  

1. The hydrolysis of di(2-ethylhexyl) terephthalate (DEHT) and di(2-ethylhexyl) phthalate (DEHP) were studied using rat gut homogenate fractions in vitro. Both isomers were hydrolysed by the intestinal fraction; however, DEHP was hydrolysed to 2-ethylhexanol (2-EH) and mono(2-ethylhexyl) phthalate (MEHP) in about equal proportions, whereas DEHT was hydrolysed to 2-EH and terephthalic acid (TPA). The half-lives for disappearance of the diesters were determined to be 12.6 min for DEHP and 53.3 min for DEHT. 2. The absorption and metabolism of DEHT were studied by administering [hexyl-2-14C]DEHT (in corn oil) by oral gavage at a dose level of 100 mg/kg to 10 adult male Sprague-Dawley rats. Urine, faeces and expired air were collected for 144 h and analysed for the presence of radioactivity, and faeces and urine were analysed for unlabelled metabolites. 3. Radioactivity was eliminated in faeces (56.5 +/- 12.1% of dose) primarily as unchanged DEHT, small amounts of MEHT and polar metabolites; excreted in urine (31.9 +/- 10.9% of dose) principally as MEHT and metabolic products of 2-EH; and expired as 14CO2 (3.6 +/- 0.9% of dose). Less than 2% of the administered radioactivity was found in the carcass. Small amounts of 14C were found in the tissues with the highest amounts found in liver and fat. 4. Metabolites identified in urine included terephthalic acid (equivalent to 51% of dose), oxidized metabolites of 2-EH and MEHT, and glucuronic and sulphuric acid conjugates (equivalent to about 10% of dose).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8079503

79

Production of a polyester degrading extracellular hydrolase from Thermomonospora fusca.  

The production of a polyester-degrading hydrolase from the thermophilic actinomycete Thermomonospora fusca was investigated with regard to its potential technical application. Only in the presence of a polyester (random aliphatic-aromatic copolyester from 1,4-butanediol, terephthalic acid, and adipic acid with around 40-50 mol % terephthalic acid in the acid component), the excretion of the extracellular enzyme could be achieved with an optimized synthetic medium using pectin and NH(4)Cl as nitrogen source. Compared to complex media, a significantly higher specific activity at comparable volumetric yields could be obtained, thus reducing the expenditure for purification. The activity profile in the medium is controlled by a complex process involving (1) induction of enzyme excretion, (2) enzyme adsorption on the hydrophobic polyester surface, (3) inhibition of enzyme generation by monomers produced by polyester cleavage, and (4) enzyme denaturation. Diafiltration with cellulose acetate membranes as the sole downstream processing step led to a product of high purity and with sufficient yield (60% of total activity). Scaling-up from shaking flasks to a fermentor scale of 100 L revealed no specific problems. However, the excretion of the hydrolase by the actinomycete turned out to be inhibited by the degradation products (monomers) of the aliphatic-aromatic copolyester used as inductor for the enzyme production. The crude enzyme exhibited generally similar properties (temperature and pH optimum) as the highly purified hydrolase described previously; however, the storage capability and thermal stability is improved when the crude enzyme solution is diafiltrated. PMID:12363342

80

Stress?corrosion cracking of indium tin oxide coated polyethylene terephthalate for flexible optoelectronic devices  

Stress corrosion cracking of transparent conductive layers of indium tin oxide (ITO), sputtered on polyethylene terephthalate (PET) substrates, is an issue of paramount importance in flexible optoelectronic devices. These components, when used in flexible device stacks, can be in contact with acid containing pressure-sensitive adhesives or with conductive polymers doped in acids. Acids can corrode the brittle ITO layer, stress can cause cracking and delamination, and stress?corrosion cracking can cause more rapid failure than corrosion alone. The combined effect of an externally-applied mechanical stress to bend the device and the corrosive environment provided by the acid is investigated in this work. We show that acrylic acid which is contained in many pressure-sensitive adhesives can ca...

 
 
 
 
81

NEW COPOLYAMIDES CONTAINING AZOBENZENE GROUPS AND DIFFERENT DIACID AND DIAMINE IN THE MAIN CHAIN: SYNTHESIS AND CHARACTERIZATION  

Abstract in english A new series of copolyamides CoPAs 7a-f were synthesized through the direct polycondensation reaction of 4,4'-azobenzenedicarboxylic acid 1 with 1,5-naphthalenediamine 2, 3,4-diaminobenzophenone 3 in the presence of adipic acid 4, fumaric acid 5 and terephthalic acid 6 as a second diacid in a medium consisting of N-methyl-2-pyrrolidone, triphenyl phosphate (TPP), calcium chloride and pyridine. The obtained polymers were characterized by means of FT-IR spectroscopy, elemen (more) tal analyses and inherent viscosity. These CoPAs were highly soluble in polar aprotic solvents such as N,N-dimethylacetamide (DMAc), N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), W-methyl-2-pyrrolidone (NMP) and other solvents such as sulfuric acid. Thermal properties of the CoPAs 7 c, 7d and 7e were investigated using thermal gravimetric analysis (TGA and DTG).

82

Synthesis, Crystal Structures, and Properties of a Series of Coordination Polymers Employing R4-Terephthalate (R = H, F, Cl, Br) and 4,4?-Bipyridine as Bridging Ligands  

We report on the synthesis, single-crystal structures, and properties (IR, UV–vis, ESR, and TG) of a series of coordination polymers employing R4-terephthalate dianion (R4-benzenedicarboxylate dianion, R4-bdc2?: R = H, F, Cl, Br) in which halogen atoms are systematically changed and 4,4?-bipyridine (4,4?-bpy) as cobridging ligands. These compounds are synthesized under the same conditions and all display octahedral metal coordination environments. A one-dimensional coordination polymer, [Mn(µ-4,4?-bpy)(H2O)4](H4-bdc) (1) consists of Mn(II) and 4,4?-bpy was obtained by reaction of Mn(II), terephthalate and 4,4?-bpy. Uncoordinated terephthalate acts as not only counter ion but also linker to form a three-dimensional network by hydrogen-bonding and ?–? interactions. When halogen atoms are introduced to a benzene ring, layers of square-grid of octahedral Mn(II) ions are obtained for [Mn(µ-F4-bdc)(µ-4,4?-bpy)(H2O)2] (2), [Mn(µ-Cl4-bdc)(µ-4,4?-bpy)(H2O)2] (3), and [Mn(µ-Br4-bdc)(µ-4,4?-bpy)(H2O)2] (4). One of the major differences of the structures is hydrogen-bonding interactions between layers. This major difference is due to the different ionic radii of halogen atoms attached to benzene rings of the ligand to give different crystal packing. Compounds 2–4 exhibit different thermal behavior. While the XRD pattern of 2 indicates structural change upon hydration/dehydration, XRD patterns of 4 are not globally changed in these processes.   

83

A pathway for the biosynthesis of straight and branched, odd- and even-length, medium-chain fatty acids in plants.  

Pathways and enzymes of fatty acid synthase-mediated, long-even-chain (generally C16-C20) fatty acid synthesis are well studied, and general metabolism involved in short-chain (C4-C7) fatty acid biosynthesis is also understood. In contrast, mechanisms of medium-chain (C8-C14) fatty acid synthesis ar...

84

Folic Acid Involvement in Cyclopropane Fatty Acid Synthesis in Lactobacilli1  

Henderson, Thomas O. (North Carolina State University, Raleigh), John J. McNeill, and S. B. Tove. Folic acid involvement in cyclopropane fatty acid synthesis in lactobacilli. J. Bacteriol. 90:1283–1287. 1965.—Evidence for the involvement of folic acid in the synthesis of lactobacillic acid (11,12-me...

85

Mutagenic activity of dimethylterephthalate  

A commercial specimen of dimethylester of terephthalic acid (dimethylterephthalate or DMT) was studied on a Berlin wild line of Drosophila melanogaster. DMT was added to the nutrient medium on which the imagos fed or the flies developed from the stage of egg to imago. The genetic activity of the DMT was evaluated on the basis of its capability to cause dominant lethal mutations (DLM). It was found that though DMT is nontoxic for the imago it does have mutagenic effect, significantly increasing the level of DLM in the egg and subsequent stages of development of the Drosophila. 8 references.

86

Plasticizers and their degradation products in the process streams of a large urban physicochemical sewage treatment plant  

The plasticizers bis (2-ethylhexyl) phthalate (BEHP), bis (2-ethylhexyl) terephthalate (BEHTP) and bis (2-ethylhexyl) adipate (BEHA) were found in significant quantities in the influents, process streams, treated effluent and solid residues of a large physicochemical treatment plant in Montreal, Canada. Of these plasticizers, BEHA was the most abundant in the influent but most was removed during primary treatment. Evidence indicated that significant biodegradation occurred within the sewers and during treatment resulting in the formation of three biodegradation products that had been reported in earlier laboratory studies; namely, 2-ethylhexanol, 2-ethylhexanal and 2-ethylhexanoic acid. Significantly greater concentrations of 2-ethylhexanal were found in process streams than had been repor...

87

Surface modification of HDPE, PP, and PET films with KMnO4/HCl solutions  

Surface modification of high-density-polyethylene (HDPE), polypropylene (PP), and poly(ethylene terephthalate) (PET) films was promoted by potassium permanganate solutions in HCl acidic medium using eight conditions by varying time, temperature, and oxidative solution concentration. This oxidation system introduced different amounts of carbonyl-carboxyl and hydroxyl groups onto the polymer surfaces. Drop water contact angle, FTIR, TGA, and SEM were used to assess oxidation efficiency and the surface changes suffered by the polymer film. The hydrophilicity of films obtained by contact angle was analyzed using a 23 factorial design in Design-Expert program to obtain the main effects, the variance, and the interaction between the effects in action in the oxidation process.

88

Layer-by-layer assembled polyelectrolyte blend membranes and their use for ion separation and rejection  

Abstract Polyelectrolyte blend films and membranes were prepared upon alternating electrostatic adsorption of polyallylamine hydrochloride (PAH) and mixtures of polystyrene sulfonate (PSS) and polyacrylic acid (PAA) in different ratio on solid supports. Infrared studies indicated that the PSS-PAA blend composition of the films always differed from the mixture composition in the dipping solution, PSS being preferentially adsorbed. Films deposited on porous supporting membranes (polyacrylonitrile/polyethylene terephthalate) were studied on their ion permeation under diffusion dialysis conditions, and their flux and salt rejection under nanofiltration and reverse osmosis (RO) conditions. Blend membranes prepared at pH 1.7 exhibit a significantly improved anion separation and salt rejection, t...

89

High Resolution Solid State NMR in Liquids 3. 1H NMR Study of Organic Nano-Particles  

High resolution 1H NMR spectra of terephthalic acid (TPA) ultrafine particles (UFP’s) were obtained by means of motional narrowing caused by Brownian motion of UFP’s in a liquid phase of CCl4. In the case of dispersing condition of UFP’s, highly resolved signals from benzoic protons were obtained at 6.85, 6.95, 7.08, 7.25, 7.50 and 7.65 ppm with respect to tetramethylsilane (TMS), even though only a signal at 8.15 ppm was obtained from moleculary dispersed TPA in acetone. Particle size was obtained to be ca. 15 nm by a dynamic laser scattering method.   

90

Biodegradable composites from polyester and sugar beet pulp with antimicrobial coating for food packaging  

Abstract Totally biodegradable, double-layered antimicrobial composite films were introduced for food packaging. The substrate layers of the sheets were prepared from poly(lactic acid) (PLA) and sugar beet pulp (SBP) or poly (butylene adipate-co-terephthalate (PBAT) and SBP by a twin-screw extruder. The active layer consisting of antimicrobial in either PLA or chitosan was formed on the surfaces of the substrates by solution coating followed by solvent evaporation. Air-coupled ultrasonic evaluation and microscopic examination showed a homogeneous structure for the composite sheets. Mechanical analysis and acoustic emission demonstrated the double-layered composites possessing appropriate tensile strength and fracture characteristics for the use as light weight-bearing materials. The releas...

91

Anaerobic microbial counts of different potential anaerobic inocula  

Sludges of various origin were analysed on the basis of microbial counts of anaerobes in order to investigate potential and alternative sources for inoculating anaerobic digestors. Sludges from neutralization and oil and fat separation tanks of a sugar cane factory, and from a stabilisation pond of a purified terephthalic-acid-producing plant were found to be adequate potential inocula. Activated sludges were found to have both hydrogenotrophic and acetoclastic methanogens and obligate hydrogen-producing acetogens (OHPA). In all sludges tested, hydrogenotrophic methanogens were the dominant strict anaerobes. The ratio between most probable number counts of acetoclastic methanogens and OHPA seems to be different between dispersed sludges and granular sludges. (orig.)

92

Multicomponent Assembly of Cavitand-Based Polyacylhydrazone Nanocapsules  

Abstract The thermodynamically controlled syntheses of different di-, tetra-, and hexacavitand polyacylhydrazone nanocapsules are reported. [2+4]-, [4+8]-, and [6+12]-nanocapsules assemble upon reacting a tetraformyl cavitand with two equivalents of isophthalic dihydrazide, or terephthalic dihydrazide in the presence of trifluoroacetic acid, whereby the building blocks are linked together through 8, 16, or 24 newly formed acylhydrazone bonds. Futhermore, the reaction of the tetraformylcavitands with different trigonal planar trihydrazides, simultaneously leads to the formation of [2+4]- and [6+8]-nanocapsules in varying ratios that depend on the cavitand to trihydrazide ratio and the nature of the cavitand and trihydrazide building blocks. The product ratios are rationalized with the diffe...

93

The selective recycling of mixed plastic waste of polylactic acid and polyethylene terephthalate by control of process conditions  

The glycolysis of postconsumer polyethylene terephthalate (PET) waste was evaluated with catalysts of zinc acetate, zinc stearate and zinc sulfate, showing that zinc acetate was the most soluble and effective. The chemical recycling by solvolysis of polylactic acid (PLA) and PET waste in either methanol or ethanol was investigated. Zinc acetate as a catalyst was found to be necessary to yield an effective depolymerization of waste PLA giving lactate esters, while with the same reaction conditions PET remains as an unconverted solid. This provides a strategy to selectively recycle mixed plastic waste by converting one plastic to a liquid and recovering the unreacted solid plastic by filtration.

94

Glycolyzed products from PET waste and their application in synthesis of polyurethane dispersions  

Soft drinks poly(ethylene terephthalate) (PET) bottles were depolymerized by glycolysis with different molar ratio of glycol, such as propylene glycol (PG), triethylene glycol (TEG) and poly(ethylene glycol) (PEG 400), in the presence of a zinc acetate catalyst. These glycolyzed products were characterized by hydroxyl value (HV) determinations. The obtained glycolyzed products were reacted with isophorone diisocyanate (IPDI), dimethylol propionic acid (DMPA), as potential ionic center for water dispersibility, and mixed with ethylene diamine (EDA) as extender chain to prepare polyurethane dispersions. The PET glycolyzed products and polyurethane formation were characterized using Fourier transform infrared spectroscopy (FTIR). The molecular masses distribution of oligoester polyol and poly...

95

Multilayer film assembled from charged derivatives of chitosan: Physical characteristics and biological responses  

Polyelectrolyte multilayer films were successfully assembled from each of the three charged derivatives of chitosan; N-[(2-hydroxyl-3-trimethylammonium)propyl]chitosan chloride (HTACC), N-succinyl chitosan (SCC) and N-sulfofurfuryl chitosan (SFC), paired with one of the two oppositely charged polyelectrolytes, poly(acrylic acid) (PAA) and poly(allylamine hydrochloride) (PAH) on surface-treated poly(ethylene terephthalate) (treated PET) substrates by alternate layer-by-layer adsorption. Surface coverage and wettability of the multilayer films were determined by AFM and water contact angle measurements, respectively. Analysis by quartz crystal balance with dissipation (QCM-D) has suggested that all multilayer films are relatively rigid and have a high water content associated within their st...

96

Use of textile dyeing technology to create an infection-resistant functionalized polyester biomaterial  

Infection is a major complication when utilizing implantable devices. The purpose of this study was to create a functionalized polyethylene terephthalate (polyester) biomaterial with sustained antimicrobial properties using textile-dyeing technology. Polyester was hydrolyzed via exposure to sodium hydroxide (NaOH) to provide two functional sites within the polymeric backbone. A modified textile dyeing technique known as thermofixation or pad-heating (pad-heat) in conjunction with autoclaving was employed to directly incorporate the fluoroquinolone antibiotic Ciprofloxacin (Cipro) into polyester fibers. Woven polyester segments were placed into various concentrations of boiling NaOH solutions to create carboxylic acid and hydroxyl groups (HYD). The segments were then sprayed (padded) with a...

97

Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects  

Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

98

Inhibition of RNA synthesis by oxolinic acid is unrelated to average DNA supercoiling.  

Oxolinic acid reduced RNA synthesis rates whether chromosome supercoiling decreased, increased, or remained unchanged. Thus, inhibition of RNA synthesis by oxolinic acid appears to involve factors other than average DNA supercoiling level. Coumermycin A1 caused RNA synthesis rates to increase or dec...

99

Differential effects of antibiotics inhibiting gyrase.  

Both oxolinic acid and coumermycin A1, inhibitors of DNA gyrase, block DNA synthesis in Escherichia coli. At low concentrations of oxolinic acid, the rate of bacterial DNA synthesis first declines rapidly but then gradually increases. This gradual increase in synthesis rate depended on the presence ...

100

Asymmetric Electrosynthesis of Amino Acid Using an Electrode Modified with Amino Acid Oxidase and Electron Mediator  

Asymmetric synthesis of amino acid has been successfully achieved by electrochemical reduction of keto acid using an electrode on which amino acid oxidase and electron mediator are immobilized. The enantiomer excess closing to 100% was obtained.   

 
 
 
 
101

Synthesis of Hexahydropyridazine-3-phosphonic Acid  

The synthesis of hexahydropyridazine-3-phosphonic acid (piperidazine-3-phosphonic acid) was performed via a hetero-Diels–Alder reaction followed by Lewis acid-catalyzed phosphonylation. This two-step procedure was improved to a one-pot reaction.   

102

Microbial metabolism of phthalates.  

Phthalates (benzene dicarboxylates) are widely used industrial chemicals; employed, for example, as plasticizers (phthalate esters) for polyvinyl chloride and as monomers (terephthalate) in poly ethylene glycol terephthalate. Although they do not appear to have acute toxicity, phthalate esters appe...

103

Mechanical properties of ternary blends of ABS + HIPS + PETG  

The effect of a commercial styrene/butadiene/styrene-based compatibilizer (Styroflex) on the tensile and impact properties of ternary blends of poly(acrylonitrile-co-butadiene-co-styrene) (ABS), high impact poly(styrene) (HIPS) and poly(ethylene terephthalate-cocyclohexanedimethanol terephthalate) (...

104

75 FR 44224 - Initiation of Antidumping and Countervailing Duty Administrative Reviews and Requests for...  

...respect to two exporters, Polyethylene Terephthalate Film, Sheet, and Strip (``PET Film'') from South Korea with respect to one exporter...Ltd. South Korea: Polyethylene Terephthalate Film, Sheet, and 6/1/09-5/31/10 Strip,...

105

77 FR 3731 - Steel Wire Garment Hangers From the Socialist Republic of Vietnam and Taiwan: Initiation of...  

...g., Polyethylene Terephthalate Film, Sheet, and Strip from the People's...unchanged in Polyethylene Terephthalate Film, Sheet, and Strip from the People's...55039 (September 24, 2008) (``PET Film''); see also Volume III of...

106

76 FR 8770 - Polyethylene Terephthalate (Pet) Film From Korea  

...Polyethylene Terephthalate (Pet) Film From Korea AGENCY: United States...order on polyethylene terephthalate (PET) film from Korea...revocation of the antidumping order on PET film from Korea would be likely to...

107

76 FR 76941 - Polyethylene Terephthalate Film, Sheet, and Strip From Taiwan: Final Results of Antidumping Duty...  

...terephthalate film, sheet and strip (PET Film) from Taiwan. The period of review...Film, Sheet and Strip from Taiwan (PET film): Nan Ya Plastic Corporation, Ltd...Terephthalate Film, Sheet and Strip (PET Film) from Taiwan: Supplemental...

108

75 FR 49900 - Polyethylene Terephthalate Film, Sheet, and Strip From Brazil: Preliminary Results of Antidumping...  

...terephthalate film, sheet, and strip (PET film) from Brazil. This administrative...published the antidumping duty order on PET film from Brazil. See Polyethylene Terephthalate...Terphane's sales or offers for sales of PET film from Brazil made during the...

109

77 FR 20357 - Polyethylene Terephthalate Film, Sheet, and Strip From the United Arab Emirates: Final Results of...  

...antidumping duty order on polyethylene terephthalate film (PET Film) from the United Arab Emirates.\\1\\ This review...pre- treated, or primed polyethylene terephthalate film (PET Film), whether extruded or co-extruded....

110

75 FR 6634 - Polyethylene Terephthalate Film, Sheet, and Strip from India: Final Results of Countervailing...  

...terephthalate film, sheet, and strip (PET film) from India for the period January...Terephthalate Film, Sheet and Strip (PET film) from India: 2007 Administrative...00001 inches thick. Imports of PET film are classifiable in the...

111

In this issue: Biotechnology Journal 11/2010  

AbstractBiopolymer polylactic acid Pang, et al., Biotechnol. J. 2010, 5, 1125 1136 Polylactide (PLA) is a biodegradable, aliphatic polyester derived from lactic acid. It has similar mechanical properties to polyethylene terephthalate, but has a significantly lower maximum continuous use temperature. PLA products can be recycled after use, either by remelting and processing the material a second time or by hydrolyzing to lactic acid, the basic chemical. In this review by scientists from Changchun, China, technologies for polymerization of lactic acid and comparison of physical, thermal, and mechanical properties, biodegradability, and biocompatibility of the PLA and copolymers with other similar polymers are described. Biopolymer 1,3 propanediol Liu et al., Biotechnol. J. 2010, 5, 1137 1148...

112

3D sandwich-like frameworks constructed from silver chains: synthesis and crystal structures of six silver(I) coordination complexes  

The reaction of AgNO3 with combinations of 4,4?-bipyridine (bpy), 1,2-di(4-pyridyl)ethane (dpe), 1,3-bis(4-pyridyl)propane (bpp), succinic acid (H2su), terephthalic acid (H2tp), 2,2?-diphenylaminedicarboxylic acid (H2dpadc), and naphthaleneacetic acid (Hnaa) in aqueous alcohol at room temperature produces block-like crystals of [Ag3(bpy)3](su)?10H2O, [Ag2(bpy)2](tp)?6H2O, [Ag2(dpe)2(H2O)2](dpadc)?H2O, [Ag6(dpe)6(H2O)4](tp)3?12H2O, [Ag(bpp)](naa), and [Ag2(bpp)2](dpadc)?6H2O. All six compounds consist of 1D infinite silver-bpy/dpe/bpp cationic chains, interspersed with organic carboxylate anions that provide charge compensation in the crystal structures. The lattice water molecules are situated among the framework of the crystal structure and show rich hydrogen-bonding interactions {except ...

113

Study of insoluble crystals derived from solutions of Kevlar 49 in sulfuric acid  

The object of the study was to isolate and obtain x-ray diffraction analysis of the insoluble crystals which have been observed in Kevlar 49/H/sub 2/SO/sub 4/ dope. These insoluble crystals had previously been reported to be Kevlar single crystals after analysis by optical microscopy. A more detailed analysis does not support this conclusion. Additional optical microscopy coupled with FTIR and elemental analysis for C, H and N, has shown that these insoluble crystals are in fact terephthalic acid which is a decomposition product of the acid hydrolysis of Kevlar. A model compound study of sulfuric-acid hydrolysis of aromatic amide was carried out in order to better understand the sulfuric-acid-hydrolysis of Kevlar.

114

Acid doped polybenzimidazoles containing 4-phenyl phthalazinone moieties for high-temperature PEMFC  

A novel series of polybenzimidazoles containing 4-phenyl phthalazinone moieties and p-phenylene linkages (p-PPBI) were synthesized from 4-(4-(4-(4-carboxyphenoxy)phenyl)-1-oxophthalazin-2(1H)-yl)benzoic acid (CPPBC), terephthalic acid (TPA) and 3,3?-diaminobenzidine (DAB) in polyphosphoric acid (PPA). The chemical structures of p-PPBI polymers were characterized by FT–IR, 1H NMR, 13C NMR and WAXD. The resultant polymers have inherent viscosities from 1.78 to 3.43dL/g in 96% sulfuric acid at 30°C and show good solubility in aprotic polar solvents, such as N-methyl-2-pyrrolidone (NMP), N,N-dimethylacetamide (DMAc) and dimethyl sulfoxide (DMSO). These p-PPBI polymers exhibit high glass transition temperatures (Tg) in the range of 399–426°C and excellent...

115

Preparation, morphology and thermal properties of electrospun fatty acid eutectics/polyethylene terephthalate form-stable phase change ultrafine composite fibers for thermal energy storage  

The ultrafine composite fibers based on the composites of binary fatty acid eutectics and polyethylene terephthalate (PET) with varied fatty acid eutectics/PET mass ratios (50/100, 70/100, 100/100 and 120/100) were fabricated using the technique of electrospinning as form-stable phase change materials (PCMs). The five binary fatty acid eutectics including LA-MA, LA-PA, MA-PA, MA-SA and PA-SA were prepared according to Schrader equation, and then were selected as an innovative type of solid-liquid PCMs. The results characterized by differential scanning calorimeter (DSC) indicated that the prepared binary fatty acid eutectics with low phase transition temperatures and high heat enthalpies for climatic requirements were more suitable for applications in building energy storage. The structura...

116

Improved enzymatic production of phenolated acylglycerols through alkyl phenolate intermediates  

Abstract A novel approach is reported for the synthesis of dihydrocaffoylated glycerols that consists of two steps: enzymatic synthesis of octyl dihydrocaffeate (as a synthetic intermediate) from octanol and dihydrocaffeic acid, and enzymatic interesterification of triacylglycerols with octy...

117

Synthesis and carbohydrate binding studies of fluorescent alpha-amidoboronic acids and the corresponding bisboronic acids.  

Fluorescent boronic acids are very useful for the design and synthesis of carbohydrate sensors. In an earlier communication, we first described the effort of developing water soluble fluorescent alpha-amidoboronic acids, which change fluorescence upon sugar binding. In this report, we describe a general method of functionalizing such boronic acids and their applications in the preparation of bis-alpha-amidoboronic acids with significantly enhanced binding for oligosaccharides as compared to their monoboronic acid counterparts. The advantages of good water solubility, easy modification to generate diversity, and modularity in synthesis will make alpha-amidoboronic acids very useful building blocks for future synthesis of boronic acid-based fluorescent sensors. PMID:20129789

118

Computational Approach for Calcium Complex Formation of Aromatic Carboxylic Acid Monomers  

Computational analysis for stable conformation of calcium complex of aromatic methacrylate carboxylic acid monomers and the reactivity towards calcium ion were performed by molecular mechanics (MM) and molecular orbital (MO) calculations. Six kinds of carboxylic acid monomers, 4-META, 4-MET, 4-AETA, 4-methacryloxy phthalic acid (4-MPA), 2-(N-methacryloyl amino)terephthalic acid (2-MATPA) and 5-(N-methacryloyl amino)isophthalic acid (5-MAIPA) were studied.The three-dimensional structure with the lowest steric energy of carboxylic acid monomers and carboxylic acid monomer/Ca complexes were obtained by MM calculation. Steric energies of carboxylic acid monomer/Ca complexes were higher than those of carboxylic acid monomers.The energies of highest occupied MO (HOMO) and lowest unoccupied MO (LUMO) were obtained by MO calculations. A energy differences between carboxylic acid monomer/Ca complex and carboxylic acid monomer (?E) and energy differences between LUMO of Ca ion and HOMO of carboxylic acid monomers (?E') were obtained. A liner correlation was found between ?E and ?E'.It is suggested that computational MM and MO calculation will become one of the useful tools for the analysis of chemical substance and the understanding its biological role in nano biomedical field.   

119

Expeditious Synthesis of Ramipril: An Angiotensin Converting Enzyme (ACE) Inhibitor  

We document an efficient and cost-effective synthesis of ramipril 1 utilizing (i) an environmentally benign process for the esterification of racemic 2-aza-bicyclo-[3.3.0]-octane-3-carboxylic acid hydrochloride 2 using boric acid as a catalyst and (ii) a robust resolution process for the synthesis of 3a by means of inexpensive and recyclable L-(+)-mandelic acid as key steps.

120

Synthesis and structural characteristics of lithocholate triads: steroid-type channels occupied by spacer fragments  

Reported in this paper are the syntheses and X-ray investigations of C2 symmetrical molecular A-B-A triads consisting of two steroid units (lithocholic acid or its methyl ester) joined together by linkers derived from bifunctional molecules such as terephthalic acid or N,Nprime-dicarboxypiperazine. Unlike their monomeric analogues, some of these compounds form inclusion complexes. All steroidal triads form crystals that are highly pseudo-centrosymmetric, in which the constituting molecules are held together either exclusively by van der Waals forces or form lattice inclusion complexes, with guest molecules hydrogen bonded to the host. The presence of carboxyl groups promotes the inclusion of pyridine molecules and the formation of the well known carboxylic acid...pyridine hydrogen bonds. C...

 
 
 
 
121

Development of a bioprocess to convert PET derived terephthalic acid and biodiesel derived glycerol to medium chain length polyhydroxyalkanoate  

Sodium terephthalate (TA) produced from a PET pyrolysis product and waste glycerol (WG) from biodiesel manufacture were supplied to Pseudomonas putida GO16 in a fed-batch bioreactor. Six feeding strategies were employed by altering the sequence of TA and WG feeding. P. putida GO16 reached 8.70 g/l cell dry weight (CDW) and 2.61 g/l PHA in 48 h when grown on TA alone. When TA and WG were supplied in combination, biomass productivity (g/l/h) was increased between 1.3- and 1.7-fold and PHA productivity (g/l/h) was increased 1.8- to 2.2-fold compared to TA supplied alone. The monomer composition of the PHA accumulated from TA or WG was predominantly composed of 3-hydroxydecanoic acid. PHA monomers 3-hydroxytetradeeanoic acid and 3-hydroxytetradecenoic acid were not present in PHA accumulate...

122

Series of metal organic frameworks assembled from Ln(III), Na(I), and chiral flexible-achiral rigid dicarboxylates exhibiting tunable UV-vis-IR light emission.  

Two series of isoreticular chiral metal-organic frameworks assembled from Ln(III) (Ln = Sm, Eu, Gd, Tb, Dy, Ho, Er, Yb), Na(I), and chiral flexible-achiral rigid dicarboxylate ligands, formulated as [NaLn(Tart)(BDC)(H(2)O)(2)] (S1) and [NaLn(Tart)(biBDC)(H(2)O)(2)] (S2) (H(2)Tart = tartaric acid; H(2)BDC = terephthalic acid; H(2)biBDC = biphenyl-4,4'-dicarboxylic acid), were obtained as single phases under hydrothermal conditions. The compounds have been studied by single-crystal and powder X-ray diffraction, thermal analyses (TG-MS and DSC), vibrational spectroscopy (FTIR), scanning electron microscopy (SEM-EDX), elemental analysis, and X-ray thermodiffractometry. The catalytic activity has been also investigated. The photoluminescence properties of selected compounds have been investigated, exhibiting room temperature tunable UV-vis-IR light emission. PMID:22220923

123

The size control of silver nanocrystals with different polyols and its application to low-reflection coating materials  

The size of silver nanocrystals in polyol synthesis can be simply controlled by tuning the viscosity of the reaction medium such as ethylene glycol, 1,2-propanediol, 1,4-butanediol and 1,5-pentanediol. We found that a higher viscose medium (1,5-pentanediol) led to monodispersed smaller particles thanks to the slow addition of silver atoms into the nuclei. Size-controlled silver nanocrystals of 30 nm were obtained in a viscosity controlled medium of 1,5-pentanediol to synthesize a low refractive index filler by coating with silica and subsequent etching of the silver core. The coated low-reflection layer from the hollow silica nanoparticles on polyethylene terephthalate (PET) film can greatly reduce the reflection of the PET film from 10% to 2% over the entire visible region.

124

Synthesis of poly(ethylene terephthalate) in benzyl imidazolium ionic liquids  

Abstract In order to improve the method of synthesis of poly(ethylene terephthalate) (PET), a series of ionic liquids (ILs) based on benzyl imidazolium ([YBMIM][X], Y = NO2, CH3, F; B = benzyl; X = Tf2N) were used to investigate the formation of PET at low temperature and pressure. High molecular weight PET (Mw up to 2.6 104 g mol-1) was obtained by two-step polycondensation in these ILs at lower temperature (230-240 C) than with traditional melt polycondensation (270-290 C). Moreover, the molecular weight of the resulting PET was found to depend on the activities of the catalysts used in the ILs. The catalysts (Sb2(OCH2CH2O)3, Sb(OAc)3, Sb2O3) used in the preparation of PET have little effect on the thermostability of the ILs. The ILs can decrease the viscosity of the reaction system, and...

125

Microwave-assisted solvent-free synthesis of Bis(dihydropyrimidinone)benzenes and evaluation of their cytotoxic activity.  

An effective one-pot synthesis of bis(dihydropyrimidinonoe)benzenes using chlorotrimethylsilane (TMSCl) through Biginelli condensation reaction of terephthalic aldehyde, 1,3-dicarbonyl compounds and (thio)urea or guanidine under microwave irradiation conditions is described. Excellent yields of the products and simple work-up are attractive features of this green protocol. Then, the cytotoxic activities of these compounds were evaluated on five different human cancerous cell lines (Raji, HeLa, LS-180, SKOV-3 and MCF7). Their cytotoxic study indicated that they possessed a weak to moderate activity. Furthermore, the higher activity of compound 4b bearing sulfur in C2 position of pyrimidinone ring showed the importance of this site for cytotoxic activity of these compounds. PMID:20102370

126

Synthesis, characterization, and amidoximation of diaminomaleodinitrile-functionalized polyethylene terephthalate grafts for collecting heavy metals from wastewater  

Abstract Synthesis, characterization, and amidoximation of diaminomaleodinitrile-functionalized polyethylene terephthalate (PET) grafts were studied. Azobisisobutyronitrile (AIBN) was used as an initiator. Optimum conditions for grafting were as follows: monomer concentration [DAMN] = 0.5M, [AIBN] = 1.50 10-3 mol/L, T = 80C and t = 3 h. Water uptake of the grafted-PET film increased with the increase of grafting yield. The imparted cyano group of the grafted polymer chains (with degree of grafting up to 83%) was converted into amidoxime group by reaction with hydroxylamine. The unique advantage of this polymer is that it contains double amidoxime groups per repeating unit and an additional diethylene spacer unit between neighboring amidoxime groups in each monomeric unit. The grafted-PET f...

127

Synthesis and characterization of Ag-polymer nanocomposites.  

We report the synthesis of Ag nanoparticles in polyethylene terephthalate (PET) matrix using atom beam co-sputtering. Metal filling factor was evaluated by Rutherford backscattering spectrometry. Microstructural evolutions of the nanocomposites films were investigated by transmission electron microscopy, which confirmed the formation of irregular shaped Ag nanoparticles. The X-ray photoelectron spectroscopy measurements of the sputter deposited PET film and co-sputtered deposited Ag-PET as well as PET bulk foil (from Goodfellows) were performed to study chemical composition of the nanocomposite films. The optical properties of these nanocomposites were studied by light absorption/transmission, which revealed a narrow transmission of UV light approximately 320 nm and a broad surface plasmon resonance absorption extending up to infrared region (approximately 2400 nm). Swift heavy ion irradiation of Ag-PET nanocomposite resulted in narrowing the full width at half maximum of transmission band. PMID:20355509

128

PANI Conductivity: A Dependence of the Chemical Synthesis Temperature  

Abstract Summary: This work evaluated the influence of the synthesis temperature on the polyaniline (PANI) properties obtained by in-situ polymerization onto a poly (terephthalate) (PET) substrate. The residual mass of these syntheses was dried under vacuum, obtaining PANI powders for each temperature investigated. PANI/PET thin films and PANI powders were characterized by atomic force microscopy (AFM), field emission scanning electron microscopy (FEG-SEM), X-ray diffraction (XRD), ultraviolet-visible spectroscopy (UV-Vis) and four-point probe techniques. The UV-Vis results showed that the synthesized PANI presents the emeraldine oxidation state. By means of XRD technique, it was possible to verify that the PANI powders present crystalline form. The AFM and FEG-SEM techniques showed that t...

129

Formation of Single-Layered Double-Hydroxide Platelets in Poly(vinylpyrrolidone) and Alginate Medium: Conductive, Capacitive, and Dielectric Properties of the Hybrid Films  

Abstract Direct synthesis from an adapted salt coprecipitation of single-crystalline layered double-hydroxide (LDH) platelets can be realized by using polyvinylpyrrolidone (PVP) assisted by an organo-modifying agent, alginate (ALG). The formation of LDH inorganic platelets with a Zn/Al cation composition of 2:1 was demonstrated by TEM observations as well as by a topotactic restacking reaction that used the terephthalate molecule pillaring effect. From the perspective of PVP, LDH platelets can be viewed as hybrid filler. With regards to the inorganic platelets, the dispersive medium supplied by PVP chains in association with the biopolymer is an elegant process for generating single platelets, the whole of which can form an exfoliated polymer nanocomposite structure. The resulting transpar...

130

Chlorophyll biosynthesis and assembly into chlorophyll-protein complexes in isolated developing chloroplasts  

Isolated developing plastids from greening cucumber cotyledons or from photoperiodically grown pea seedlings incorporated UC-labeled 5-aminolevulinic acid (ALA) into chlorophyll (Chl). Incorporation was light dependent, enhanced by S-adenosylmethionine, and linear for 1 hr. The in vitro rate of Chl synthesis from ALA was comparable to the in vivo rate of Chl accumulation. Levulinic acid and dioxoheptanoic acid strongly inhibited Chl synthesis but not plastid protein synthesis. Neither chloramphenicol nor spectinomycin affected Chl synthesis, although protein synthesis was strongly inhibited. Components of thylakoid membranes from plastids incubated with ( UC)ALA were resolved by electrophoresis and then subjected to autoradiography. This work showed that (i) newly synthesized Chl was assembled into Chl-protein complexes and (ii) the inhibition of protein synthesis during the incubation did not alter the labeling pattern. Thus, there was no observable short-term coregulation between Chl synthesis (from ALA) and the synthesis of membrane proteins in isolated plastids.

131

Adhesive for solar control film  

A water-activatable adhesive useful for adhering a solar film, polyester (polyethylene terephthalate) film, to glass or to metal substrates. The adhesive comprises the reacted product of (A) gamma-isocyanatopropyltriethoxy silane, containing a free isocyanate (NCO) group, and (B) a thermoplastic polyester formed by reacting (i) a dibasic acid selected from the group consisting of terephthalic acid, isophthalic acid and hexahydrophthalic acid, and mixtures thereof, with (ii) a polymethylene glycol of the formula HO(CH/sub 2/) /SUB x/ OH where x is an integer from 2 to 10, neopentyl glycol and glycerin, and mixtures thereof, and (iii) an aliphatic dibasic acid selected from the group consisting of those having the formula HOOC(CH/sub 2/) /SUB n/ COOH where n is an integer from 1 to 8, and mixtures of such acids, whereby substantially no free NCO remains in the adhesive. Solar film is used for absorbing and/or reflecting solar radiation. Solar film can be a single sheet of polyester dyed sufficiently to absorb the glare of bright sunlight, or it can be a single sheet of polyester, on one side of which a reflective metal (most often aluminum) is deposited in an amount which can be totally reflective or in an amount which still allows visible light transmission and over which a protective coating is deposited, or it can be a laminated structure of the reflective film adhered to a clear or dyed polyester film by which means the reflective metal is sandwiched between two layers of polyester film, or it can be a laminated structure of a reflective film to a polyolefin film.

132

ADAPTIVE REGULATION OF ASCORBIC ACID SYNTHESIS IN RAT-LIVER EXTRACTS. EFFECT OF X-IRRADIATION AND OF DIETARY CHANGES  

The synthesis of ascorbic acid by rat-liver extracts is impaired after whole-body x irradiation of the animals. This impairment is caused by the reduction of food intake after irradiation. The synthesis of ascorbic acid is greatly reduced after starvation for 24 hr. Administration of glucuronolactone has little effect on the synthesis. Feeding rats with a carbohydrate-free diet for 24 hr causes a considerable reduction of ascorbic acid synthesis. A less severe reduction is observed if this diet is given for 6 days. It is concluded that the enzymes synthesizing ascorbic acid are adaptive to dietary carbohydrates rather than to the direct substrate. (auth)

133

0  

hydrous chromium oxide, hydrous manganese dioxide, zirconium phos- phate, tin phosphate ... phosphate, titanium phosphate, molybdenyl ferrocyanide, zirconium ferrocyanide, ferric ..... exchange properties in acidic media. ll. Synthesis of ...

134

Conservation of minimally processed pineapple using calcium chloride, edible coating and gamma radiation;Conservacao de abacaxi minimamente processado utilizando como coadjuvantes cloreto de calcio, pelicula comestivel e radiacao gama  

The aim of this study was to obtain a convenience type pineapple subjected to fresh-cut process and calcium chloride, wheat gluten and alginate-base edible coating and irradiation treatments. The fruits were washed, sanitized with Sumaveg (Sodium Dichloro-s-Triazinetrione) in a 200 mg L-1 chlorine-free solution at 7 deg C for 15 minutes, and then manually peeled. The peeled fruits were sliced into 1 cm thick slices, rinsed in 20 mg L-1 chlorine-free solution for 3 minutes and drained for 3 minutes. In the first experiment, the samples were treated with: 1% calcium chloride + vital wheat gluten solution; 1% calcium chloride + 1% alginate solution; and control. In the second experiment, the samples were treated with: 1% calcium chloride + vital wheat gluten solution + 2.3 kGy; 1% calcium chloride + 2.3kGy; irradiation with 2.3kGy; and control. The packing consisted of rigid polyethylene terephthalate (PET) trays with around 250 g of fruit. The irradiation was performed in a Cobalt-60 multipurpose irradiator with 92 kCi activity and dose value of 2.3 kGy h-1. The samples were stored at 5 +- 1 deg C and evaluated every other day for 12 days. In the first experiment pH and titratable acidity values showed slight variations but were similar between the treatments. There was a decrease in ascorbic acid values in all treatments. Browning was noticed in all treatments over the storage period. Although the values between the treatments were similar, the pineapple treated with calcium chloride + gluten showed firmer texture, less liquid loss, and lower values of polyphenoloxidase and peroxidase activities and CO{sub 2} and ethylene production. Mesophiles and mold and yeast counts were also reduced. No Salmonella and E. coli were detected. Total coliform counts were low in all the treatments and appeared in just a few isolated samples during the storage period. Sensory analyses showed that the samples treated with calcium chloride + gluten had the lower scores for texture, appearance, and aroma; the flavor was compromised from the 4th storage day onward. In the second experiment the pH and titratable acidity values showed small changes but were similar between the treatments. There were a decrease in the ascorbic acid values in all treatments; nevertheless, the samples treated with calcium chloride + gluten + 2.3 kGy retained more of this vitamin than the other treatments. Firmer texture, less liquid loss, and lower values of polyphenoloxidase and peroxidase activities were noticed in the samples with calcium chloride + 2.3 kGy. Browning was noticed in all treatments over the storage period. The darker samples were the ones treated with calcium chloride + gluten + 2.3 kGy, and irradiated with 2.3 kGy. Higher respiratory rate and ethylene synthesis were noticed in the samples treated with calcium chloride + gluten + 2.3 kGy. The lowest psychotropic, mesophiles, and mold and yeast counts occurred in the samples treated with calcium chloride + gluten + 2.3 kGy. No Salmonella and E. coli were detected. Total coliform counts were low in all the treatments and appeared in just a few samples during the storage period. Only the control kept the sensorial attributes within the acceptability limit during the storage period. The texture in all the other samples was unacceptable from the 8th day onward. The flavor was compromised from the first storage day onward in the samples with calcium chloride + gluten + 2.3 kGy (author)

135

New L-Amino Acid Ligases Catalyzing Oligopeptide Synthesis from Various Microorganisms  

L-Amino acid ligase synthesizes various peptides from unprotected L-amino acids in an ATP-dependent manner. Known L-amino acid ligases catalyze only dipeptide synthesis, but recently we found that RizB of Bacillus subtilis NBRC 3134 catalyzes oligopeptide synthesis. In the present study, we searched for new members of the L-amino acid ligase group that catalyze oligopeptide synthesis. Several hypothetical proteins possessing the ATP-grasp motif were selected by in silico analysis. These recombinant proteins were assayed for L-amino acid ligase activity. We obtained five L-amino acid ligases showing oligopeptide synthesis activities. These proteins showed low similarity in amino acid sequence, but commonly used branched-chain amino acids, such as RizB, as substrates. Furthermore, the spr0969 protein of Streptococcus pneumoniae synthesized longer peptides than those synthesized by RizB, and the BAD_1200 protein of Bifidobacterium adolescentis showed higher activity toward aromatic amino acids than toward branched-chain ones. We also examined some of their characteristics.   

136

Synthesis and structural characteristics of lithocholate triads: steroid-type channels occupied by spacer fragments.  

Reported in this paper are the syntheses and X-ray investigations of C(2) symmetrical molecular A-B-A triads consisting of two steroid units (lithocholic acid or its methyl ester) joined together by linkers derived from bifunctional molecules such as terephthalic acid or N,N'-dicarboxypiperazine. Unlike their monomeric analogues, some of these compounds form inclusion complexes. All steroidal triads form crystals that are highly pseudo-centrosymmetric, in which the constituting molecules are held together either exclusively by van der Waals forces or form lattice inclusion complexes, with guest molecules hydrogen bonded to the host. The presence of carboxyl groups promotes the inclusion of pyridine molecules and the formation of the well known carboxylic acid...pyridine hydrogen bonds. Combined with pairwise face-to-face pi-stacking between pyridine rings, these hydrogen-bond interactions lead to the formation of extended supramolecular tapes, analogous to polymers. The co-crystals of pyridine and a lithocholic acid triad undergo a symmetry-lowering phase transition from a P1 cell with Z = 1 to a P1 cell with Z = 2. The two structures are virtually the same, the two independent molecules in the larger cell being related by pseudo-translation. Changes in the type of spacer between two methyl lithocholate units from planar aromatic (terephthalic acid) to highly puckered aliphatic six-membered ring (N,N'-dicarboxypiperazine) bring about inclusion properties and changes in side-chain conformation in a crystal. Although the efficient packing of these highly elongated molecules is hindered, as indicated by low values of crystal density, ranging from 1.16 to 1.19 g cm(-3), several very short C...O and H...H contacts are present in the crystals. PMID:18490828

137

Effect of Insulin on Sterol and Fatty Acid Synthesis and Hydroxymethylglutaryl CoA Reductase Activity in Mammalian Cells Grown in Culture  

The effects of insulin on the synthesis of sterols and fatty acids and on the activity of 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34), a rate-limiting enzyme for sterol synthesis, were studied in mammalian cells grown in culture. While in some established cell lines sterol synthesi...

138

An approach towards the total synthesis of (+)-epiquinamide and (+)-a-conhydrine from Garner aldehyde  

A short and stereoselective route for the synthesis of 1-hydroxyquinolizidine, an advanced synthetic intermediate for the total synthesis of (+)-epiquinamide is presented. The key synthetic steps involve diastereoselective nucleophilic addition on l-serine derived Garner aldehyde and acid mediated (PTSA) ring closing metathesis. The methodology is also elaborated successfully for the total synthesis of (+)-a-conhydrine, an important piperidine alkaloid.

139

Synthesis of optically active amino acids from alpha-keto acids with Escherichia coli cells expressing heterologous genes.  

We describe a simple method for enzymatic synthesis of L and D amino acids from alpha-keto acids with Escherichia coli cells which express heterologous genes. L-amino acids were produced with thermostable L-amino acid dehydrogenase and formate dehydrogenase (FDH) from alpha-keto acids and ammonium f...

140

Despolimerização do poli (tereftalato de etileno) - PET: efeitos de tensoativos e excesso de solução alcalina/ Depolymerization of waste polyethylene terephthalate - PET: effects of surfactants and excess of alkaline solutions  

Abstract in portuguese A despolimerização do poli (tereftalato de etileno) - PET pós-consumo, em solução aquosa 7,5 mol.L-1 de hidróxido de sódio foi testado a 100 °C e a 1 atm, com objetivo de obter o ácido tereftálico. O efeito de tensoativos e da concentração da solução sobre o rendimento da despolimerização foi estudado quantitativamente via gravimetria e analises térmica. Excesso de solução alcalina aumenta a velocidade de reação dobrando o rendimento em reações com (more) partículas grosseiras. Os tensoativos DDS e Tween são eficientes na catálise das reações equimolares com partículas grosseiras, mas não afetam as reações com solução alcalina em excesso. Abstract in english The depolymerization of waste polyethylene terephthalate (PET) in aqueous solutions 7.5 M of sodium hydroxide was tested at 100 °C and 1 atm, in order to obtain the terephthalic acid monomers (TPA). The effect from surfactants and concentration of sodium hydroxide (NaOH) on the reaction extent of depolymerization was studied quantitatively by gravimetric and thermal measurements. Excess of alkaline solution catalyze the reaction and doubled the reaction rate with larger (more) particle size PET. The surfactants DDS and Tween are efficient in catalyzing larger particle size PET under equimolar conditions, but do not affect the reactions under excess of alkaline solution.

 
 
 
 
141

Influence of Reaction Pressure below Atmosphere on Esterification Reaction between Terephthalic Acid and Ethylene Glycol  

The simulated results by a computer were shown for the continous direct esterification in the first reactor between terephthalic acid (TPA) and ethylene glycol (EG) under reduced pressures in order to find the operational conditions in oligomer production of poly(ethylene terephthalate) with the lower content of diethylene glycol (DEG). It has been inferred from the results of simulation that the lower reaction pressure brings about the suppression of DEG formation due to the side reactions but it decreases the progress of esterification and polymerization due to main reactions. It has confirmed that the reaction mixtures of AV\\\\fallingdotseq0.6 eq kg?1 becomes a clear liquid without undissolved TPA (this point is the clearing point), independently of reaction conditions and the clearing point predicted from simulation results coincides with the experimental observation. Furthermore, a few cases of simulated results were applied for a commercial production plant in good agreement with the experimental results. The agreement suggests to support the validity of the present model for the precise predictions for a production plant.   

142

Thuringische builds large PET plant in Germany  

East Germany fibers producer Thuringische Faser AG Schwarza (TFS; Rudolstadt) is entering the polyethylene terephthalate (PET) business. The company, owned by India's Dalmia Group (New Delhi), is building an 80,000-m.t./year PET granulate plant, one of the largest in Europe, for completion at the end of 1995. The product will be used to make PET bottles and film for food packaging. TFS will need to buy 70,000 m.t./year of purified terephthalic acid and 27,000 m.t./year of ethylene glycol to feed the new plant. When acquiring TFS, Dalmia's chairman, Sanjay Dalmia, pledged to invest DM150 million ($95.4 million) in the Germany firm and keep 1,200 of the 3,000 workers. John Brown Deutsche Engineering (Essen) has been awarded a contract covering engineering, know-how, and turnkey supply of the complete plant, and will share of the complete plant, and will share the work with Austrian associate, Voest John Brown Industrieanlagenbau (Linz). The company, which completed against Zimmer (Frankfurt), will use its own technology. TFS, with 1992 sales of DM120 million, has capacities to produce 20,000 m.t/year of viscose staple fiber, 18,000 m.t./year of nylon-6 filament yarn, and 6,300 m.t./year of textile-grade polyester granulate, which will be converted to produce bottle-grade PET.

143

Biosynthesis of cyclopentenyl fatty acids. (2-Cyclopentenyl)carboxylic acid (aleprolic acid) as a special primer for fatty acid biosynthesis in Flacourtiaceae.  

The biosynthesis of cyclopentenyl fatty acids from (2-cyclopentenyl)carboxylic acid (aleprolic acid) via chain-lengthening by C2-units was tested in seeds and leaves of Caloncoba echinata and Hydnocarpus anthelminthica of Flacourtiaceae and in various prepatations of higher plants other than Fla courtiaceae. Only tissues of Flacourtiaceae, where cyclopentenyl fatty acids are found naturally, were able to accept aleprolic acid as a starter molecule for the synthesis of cyclic fatty acids. Labelling patterns of straight chain and cyclic fatty acids, synthesized after incubation of Flacourtiaceae seeds with [1-(14)C[-acetate, indicated de novo synthesis of C16 fatty acids in either case, followed by elongation to higher homologs. PMID:990306

144

Co-oxidation of p-xylene and p-toluic acid to terephthalic acid in water solvent: Kinetics and additive effects  

Co-oxidation of p-xylene (PX) and p-toluic acid (p-TA) to terephthalic acid (TA) in water with Mn acetate catalyst has been studied. Mn acetate showed better catalytic activity than Co acetate and no synergism was observed between two catalysts. During the reaction, PX was transformed to p-TA while p-TA was converted to TA by a radical reaction. In the co-oxidation, radicals generated from facile PX-to-p-TA conversion would assist more difficult p-TA to TA conversion. Addition of CO2 in the oxygen promoted the TA formation and suppressed the CO2 formation from the combustion of reactants. Additional transition metals such as Ni and Ti also promoted the catalytic activity of Mn catalyst. Furthermore, a synergism was observed between added CO2 and the added transition metal. Finally, the yie...

145

Surface Characterization and in Vitro Blood Compatibility of Poly (Ethylene Terephthalate) Immobilized with Hirudin  

Poly (ethylene terephthalate)(dacron, PET) films were exposed under argon plasma glow discharge with different glows and induced polymerization of acrylic acid(AA) in order to introduce carboxylic acid group onto PET (PET-AA) assisted by ultraviolet radiation(UV). Hirudin-immobilized PET (PET-HRD) films were prepared by the grafting of PET-AA, followed by chemical reaction with hirudin. The surface structure of the treated PET was determined by X-ray photoelectron spectroscopy (XPS). The wettability, surface free energy, and interface free energy of the films were investigated by contact angle measurement. The blood compatibility of the films was assessed by platelet-adhesion test and fibrinogen conformational change measurements to evaluate the viability of the materials in biomedical engineering. Measurement by scanning electron microscopy (SEM) revealed that the amounts of adhered, aggregated and morphologically changed platelets were reduced on the hirudin-immobilized PET films. Enzyme-linked-immunoassay measurements that disclosed fibrinogen conformational changes showed results consistent with the platelets' behavior.

146

Biodegradable starch-based films containing saturated fatty acids: thermal, infrared and raman spectroscopic characterization  

Abstract in english Biodegradable films of thermoplastic starch and poly (butylene adipate co-terephthalate) (PBAT) containing fatty acids were characterized thermally and with infrared and Raman spectroscopies. The symmetrical character of the benzene ring in PBAT provided a means to illustrate the difference between these spectroscopic techniques, because a band appeared in the Raman spectrum but not in the infrared. The thermal analysis showed three degradation stages related to fatty aci (more) ds, starch and PBAT. The incorporation of saturated fatty acids with different molecular mass (caproic, lauric and stearic) did not change the nature of the chemical bonds among the components in the blends of starch, PBAT and glycerol, according to the thermal analysis, infrared and Raman spectroscopies.

147

Effect of cross-linkable polymer on the morphology and properties of transparent multi-walled carbon nanotube conductive films  

In this study, we fabricated optically transparent and electrically conductive multi-walled carbon nanotube (MWCNT) thin films using a spray-coating technique. The transparency and the electrical resistance of thin film are dependent on the nanotube content deposited on the polyethylene terephthalate (PET) substrate. Poly(acrylic acid) (PAA) and poly(N-vinyl pyrrolidone) (PVP) were used as adhesion promoters to improve MWCNT coating more significantly. The cross-linked polymer resulted in a superior bond between the MWCNTs and the substrates. The surface electrical resistance was significantly lower than the original sheet after nitric acid (HNO3) treatment because of the removed surfactant and the increased interconnecting networks of MWCNT bundles, thus improving the electrical and optic...

148

Diisononyl 1,2-cyclohexanedicarboxylic acid (DINCH) and Di(2-ethylhexyl) terephthalate (DEHT) in indoor dust samples: Concentration and analytical problems  

Possible human health effects of phthalate plasticizers have been intensely discussed during the last decade. Di(2-ethylhexyl) phthalate (DEHP), the phthalate acid ester with the largest production volume worldwide, has been substituted by new compounds like Diisononyl 1,2-cyclohexanedicarboxylic acid (DINCH) or Di(2-ethylhexyl) terephthalate (DEHT) in many applications. There are numerous reports about concentration levels of phthalates in indoor environments, but data on concentrations of these alternative plasticizers are not available yet. Also, the methods for the determination of phthalate substitutes are not yet established. This study presents the results achieved by quantification using different analytical methods. Data on the concentration of DEHT and DINCH in 953 dust samples f...

149

Living Radical Polymerization by Biradical Compounds of Tetramethylpiperidine-1-oxyl  

The polymerization of styrene was performed using two types of biradical compounds derived from 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO). The biradical compounds are diesters of 4-hydroxy-TEMPO with phthalic acid (o-TEMPO) and with terephthalic acid (p-TEMPO). When the polymerization was carried out by o-TEMPO and benzoyl peroxide (BPO) as an initiator, a polymer obtained had showed bimodal GPC. This suggests that dimerization by coupling of the polymers occurred during the polymerization. GPC demonstrated that the polymerization in the absence of BPO suppressed the dimerization and gave a polymer with narrow polydispersity. The polymerization was found to proceed in accordance with a living mechanism, because the molecular weight was directly proportional to the conversion, and was inversely proportional to the initial concentration of the biradical compound. A polystyrene obtained by the polymerization with the biradical compound initiated the polymerization of tert-butoxystyrene, giving ABA type of triblock copolymer.   

150

Chemical etching preparation of BiOI/BiOBr heterostructures with enhanced photocatalytic properties for organic dye removal  

BiOI/BiOBr heterostructures, synthesized by a simple chemical etching method using acetic acid and KI as etching agents to react with BiOBr particles, were characterized by X-ray powder diffraction (XRD), UV-vis diffuse reflectance spectra (UV-vis DRS), scanning electron microscope (SEM), transmission electron microscopy (TEM), high-resolution transmission electron microscopy (HRTEM) and Brunauer-Emmett-Teller (BET) surface area. The as-prepared samples exhibited more efficient photocatalytic activities than pure BiOI and BiOBr for the degradation of methyl orange (MO) under visible light irradiation (l>420nm), which could be attributed to the efficient separation of electron-hole pairs caused by the formation of BiOI-BiOBr heterojunction. Terephthalic acid photoluminescence (TA-PL) probin...

151

New poly(1,3,4-oxadiazole)s bearing pentadecyl side chains: Synthesis and characterization  

Abstract The 4-[4--(Hydrazinocarbonyl)phenoxy]-2-pentadecylbenzohydrazide was polycondensed with aromatic diacid chlorides viz., terephthalic acid chloride (TPC), isophthalic acid chloride (IPC), and a mixture of TPC : IPC (50 : 50 mol %) to obtain polyhydrazides which on subsequent cyclodehydration reaction in the presence of phosphoryl chloride yielded new poly(1,3,4-oxadiazole)s bearing flexibilizing ether linkages and pentadecyl side chains. Inherent viscosities of polyhydrazides and poly(1,3,4-oxadiazole)s were in the range 0.53-0.66 dL g-1 and 0.49-0.53 dL g-1, respectively, indicating formation of medium to reasonably high molecular weight polymers. The number average molecular weights (Mn) and polydispersities (Mw/Mn) of poly(1,3,4-oxadiazole)s were in the range 14,660-21,370 and 2...

152

Recycling of Polyethylene Terephthalate Using High-pressure Steam Treatment  

In this study, polyethylene terephthalate (PET) was broken into fine particles during high-pressure steam treatment without crushing or using acidic or alkaline catalysts and solvents. Scanning electron microscopy (SEM) images showed that PET was decomposed from the surface by the high-pressure steam. 1H NMR and CP/MAS 13C NMR spectra revealed that the molecular weight of PET gradually decreased to that of an oligomer with increasing the high-pressure steam treatment time, and then reacted to a monomer. Differential scanning calorimetry (DSC) showed a decrease in the glass transition temperature (Tg), crystallization temperature (Tc), and melting temperature (Tm). X-Ray diffraction (XRD) measurements indicated that crystallinity increased with high-pressure steam treatment time. Decomposed PET consisting of hydroxyl groups and carboxylic acid thus repolymerize into new products. This investigation showed that a PET recycling method can be established easily, which had no adverse effect on the environment.   

153

Two new Zn(II) and Cd(II) coordinastion polymers based on amino-tetrazole and phenylcarboxylate: Syntheses, topological structures and photoluminescent properties  

Two Zn(II) and Cd(II) compounds with the in-situ generated ligand of 5-amino-tetrazolate (atz?) were prepared from the hydrothermal reactions of the corresponding Cd or Zn(II) salts with phenylcarboxylate, and characterized by elemental analysis, IR spectroscopy, and TGA. The results of X-ray crystallographic analysis reveal that compound [Zn2(BZA)(atz)2(OH)]n (1) (BZA=benzoic acid) presents a two-dimensional (2D) “hcb” topological network constructed from the ZnN2O2 tetrahedra. In compound [Cd6(atz)6(PTA)3]n (2) (PTA=terephthalic acid), the identical [Cd3(atz)3)]3+n clusters are connected by atz ligands to generate a 2D cationic layer, and the neighboring cationic layers are pillared by PTA giving birth to 3D network. After simplifying, the complicated 3D n...

154

Syntheses, Structures, and Luminescent Properties of Two Novel Coordination Polymers with Mixed Ligands  

Two novel metal???organic coordination polymers {[Pb2(MIP)2(BDC)2]·H2O} n 1 and [Cd(MIP)(NDC)] n 2 [MIP = 2-(3-methoxyphenyl)-1H-imidazo [4,5-f] [1, 10] phenanthroline, BDC = terephthalic acid, NDC = naphthalene-1,4-dicarboxylic acid] were obtained from hydrothermal reaction and characterized by elemental analysis, thermogravimetric (TG) analysis, infrared spectrum (IR) and single-crystal X-ray diffraction. The coordination polymers crystallize in triclinic, space group P-1 with a = 1.0335(2), b = 1.4224(3), c = 1.8156(4) nm, ? = 106.088(3)° for complex 1 and the complex 2 crystallizes in monoclinic, space group P2(1)/n with a = 1.2562(8), b = 1.4800(9), c = 1.3723(8) nm, ? = 97.257(1)°, respectively. The metal ions Pb(II) are located in [:PbN2O4] pentagonal bip...

155

Removal of two ionic dyes from water by MgO-loaded porous carbons prepared through one-step process from poly(ethylene?terephthalate)/magnesium carbonate mixtures  

Mixtures of poly(ethylene terephthalate) and magnesium carbonate at different weight ratios were heated up to 850 Formula Not Shown C in argon atmosphere. During heating, components of the initial mixtures underwent thermal decomposition yielding porous carbon materials loaded with different amounts of magnesium oxide. Structural characteristics of the prepared materials were determined from adsorption/desorption isotherms of nitrogen, measured at 77?K. For reference, portions of the products obtained were acid-washed to obtain MgO-free carbons. Pore structures of the prepared materials were strongly dependent on the quantitative compositions of starting mixtures. As a rule, specific surface areas determined for acid-washed materials were much higher than those for MgO-loaded carbons. The ...

156

Deposit control additives and fuel compositions containing the same  

This patent describes a fuel composition comprising a major amount of a fuel and an additive which imparts intake valve deposit inhibiting properties to the fuel. It comprises a polyisobutenyl succinimide which is the reaction product of a polyisobutenyl succinic anhydride and a polyalkylene polyamine; a polymer of isobutylene; an ester which is an adipate, phthalate, isophthalate, terephthalate and trimellitate of iso-octanol, iso-nonanol, iso-decanol, or iso-tridecanol or mixture thereof, polyol ester of neopentyl glycol, pentaerythritol or trimethylol-propane with corresponding monocarboxylic acid, oligomer and polymer ester of dicarboxylic acid, polyol and monoalcohol; and a polyether which is a polymer or copolymer of ethylene oxide, propylene oxide, butylene oxide, pentene oxide, hexene oxide, octene oxide, decene oxide or isomer thereof.

157

Synthesis and Properties of Optically Active Polyester-amides from Ester-Containing Chiral Dicarboxylic Acid and Aromatic Diamines  

The asymmetric hydrogenation of benzyl acetoacetate afforded benzyl (R)-3-hydroxybutanoate (II). Optically active ester-containing dicarboxylic acid V was newly prepared from II and terephthaloyl chloride, followed by debenzylation. The polycondensation of V with aromatic diamines was carried out in the presence of triphenyl phosphite, pyridine, and calcium chloride in N-methyl-2-pyrrolidone (NMP). The resulting optically active polyester-amides had inherent viscosities of 0.44–0.79 dl g?1, and specific rotations from ?43.6° to ?78.5°. The glass transition temperatures of the polymers were in the range from 129°C to 169°C, and their decomposition started at a temperature from 231°C to 249°C to afford biscrotonamide and terephthalic acid. The glass transition temperature of the optically active polymer derived from 4,4?-oxydianiline was 8°C higher than that of the corresponding inactive analogue.   

158

A Study on Fabrication of Polyester Copolymers(III) - Physical Properties of PET/PEI Copolymer -  

PET/PEI, a copolymer of terephthalic acid, isophthalic acid and ethylene glycol was melt-pressed and quenched in ice water. This copolymer film was drawn using a capillary rheometer. Crystallinity, shrinkage, thermal, dynamic mechanical, and mechanical properties of this copolymer film was figs.iftoff agree quaPET/PEI copolymer film was lower than that of PET film. The crystallinity and density of this copolymer film increased with the draw ratio but decreased with the draw temperature. The tensile strength and tensile modulus of PET/PEI copolymer film, also increased with the draw ratio and decreased with the draw temperature. The shrinkage of PET/PEI copolymer film drawn at the draw temperature of 85 degree C decreased with the draw ratio. 30 refs., 9 figs., 1 tab.

159

Polyethylene terephthalate (PET) enhances chondrogenic differentiation of ovine meniscocytes in a hyaluronic acid/polycaprolactone scaffold in vitro  

Purpose The purpose of this study was to assess the effect of polyethylene terephthalate (PET) on proliferation, differentiation, and attachment of ovine meniscocytes seeded in a hyaluronic acid/polycaprolactone biomaterial (BF-1) Methods BF-1 (30?% hyaluronic acid and 70?% polycaprolactone) cylinders with PET (CO-PET) or without PET, were seeded with 2x106 ovine meniscus cells. The specimens were harvested in triplets at 12 hours, seven, 14, 21 and 28?days. DNA content was measured to test proliferation, histological analysis for cell morphology, and biochemical assessment of glycosaminoglycan content and RT-PCR for type I and II collagen were used to assess differentiation, with immunohistochemistry as post-translational control. Attachment was evaluated by electronic microscopy at 28?da...

160

Encapsulation of isotope on novel beta-emitting poly(ethylene terephthalate) surfaces.  

Recent data indicate that intravascular betaa-irradiation from centrally located sources at the time of balloon angioplasty or stenting reduces proliferation of smooth muscle cells, neointima formation, and restenosis. In an effort to simplify radiation delivery, a novel beta-radiation source was developed based on the adsorption of 32P (phosphoric acid) by pH-sensitive chitosan hydrogel on a poly(ethylene terephthalate) balloon surface. To prevent the 32P-isotope desorption in the patient's blood, the adsorbed phosphoric acid was precipitated as CaHPO4 on the surface by a saturated Ca(OH)2/5% CaCl2 solution. Various polyurethanes were applied to seal the radioactive surface by the dip-coating method. The isotope off-rate results were determined. Optimal results were obtained by serially coating with two polyurethane solutions. This approach holds promise for simplifying and improving the safety, and minimizing the cost of intravascular brachytherapy. PMID:11553893

 
 
 
 
161

Synthesis and Photoinitiated Cationic Polymerization of Polyfunctional 1-Propenyl Ether Monomers and Polymers Containing Phosphonate Linkage in the Main Chain  

Polyfunctional 1-propenyl ether monomers (1a–c) were synthesized by the regioselective addition reaction of 1-propenyl glycidyl ether (PGE) with certain phosphonic dichlorides using quaternary onium salts as catalysts. The reaction of PGE with phenylphosphonic dichloride (PPDC) gave bis[1-(chloromethyl)-2-(propenyloxy)ethyl]phenylphosphonate (1a) in 82% yield. Polycondensation of 1a with terephthalic acid (TPC) was also carried out using 1, 8-diazabicyclo[5.4.0]undecene-7 (DBU) as a base to afford the corresponding polymer containing 1-propenyl ether groups (2a). A multifunctional monomer (3a) containing both 1-propenyl ether groups as Vc and methacrylate groups as Vr was prepared by the reaction of 1a with methacrylic acid (MA) using DBU. Photoinitiated cationic polymerization of these 1-propenyl ether compounds proceeded rapidly using bis[4-(diphenylsulfonio)phenyl]sulfide bis(hexafluorophoshate) (DPSP), as a cationic photoinitiator without solvent upon UV irradiation.   

162

Syntheses, Structures, and Luminescent Properties of Two Novel Coordination Polymers with Mixed Ligands  

Two novel metal?organic coordination polymers {[Pb2(MIP)2(BDC)2]·H2O} n 1 and [Cd(MIP)(NDC)] n 2 [MIP = 2-(3-methoxyphenyl)-1H-imidazo [4,5-f] [1, 10] phenanthroline, BDC = terephthalic acid, NDC = naphthalene-1,4-dicarboxylic acid] were obtained from hydrothermal reaction and characterized by elemental analysis, thermogravimetric (TG) analysis, infrared spectrum (IR) and single-crystal X-ray diffraction. The coordination polymers crystallize in triclinic, space group P-1 with a = 1.0335(2), b = 1.4224(3), c = 1.8156(4) nm, ? = 106.088(3)° for complex 1 and the complex 2 crystallizes in monoclinic, space group P2(1)/n with a = 1.2562(8), b = 1.4800(9), c = 1.3723(8) nm, ? = 97.257(1)°, respectively. The metal ions Pb(II) are located in [:PbN2O4] pentagonal bipyramidal geometry in complex 1...

163

Control of swelling of responsive nanogels by nanoconfinement.  

The volume phase transition (VPT) behavior and the swelling properties of individual thermoresponsive poly(N-isopropylacrylamide) (PNIPAM)-based nanogels are investigated by in situ atomic force microscopy (AFM). Using a template-based synthesis method, cylindrical nanogels are synthesized for different polymerization times within nanopores (80 nm) of poly(ethylene terephthalate) (PET) track-etched membranes. The confinement conditions, characterized by the ratio ? between the average chain length and the pore diameter, are varied between 0.35 and 0.8. After dissolving the membranes, the volume of individual nanogels composed of PNIPAM-g-PET diblock copolymers is numerically extracted from AFM images while varying the water temperature from 28 to 44 °C. From the measured volumes, the swelling of nanogels is investigated as a function of both the water temperature and the confinement conditions imposed during the synthesis. Contrary to the VPT, the maximum swelling of the nanogels is strongly affected by these confinement conditions. The volume of nanogels in the swollen state can reach 1.1 to 2.1 times their volume in the collapsed state for a ratio ? of 0.8 and 0.5, respectively. These results open a new way to tune the swelling of nanogels, simply by adjusting the degree of confinement imposed during their synthesis within nanopores, which is particularly interesting for biomedical applications requiring a high degree of control over swelling properties, such as drug-delivery nanotools. PMID:22678885

164

Synthesis of Ferrocenecarboxylic Acids and Their Derivatives.  

Following a tabulation of known methods for synthesis of ferrocenedicarboxylic acids, the paper reports on methods for which increased yields are claimed. Ferrocenecarboxylic acid was prepared (yield 45.2 percent of theory) by hypochlorite oxidation of ac...

165

Inducible and Constitutive ?-Galactosidase Formation in Cells Recovering from Protein Synthesis Inhibition1  

Inducible and constitutive ?-galactosidase formation and radioactive amino acid incorporation were measured in cells recovering from various treatments which inhibit protein synthesis in the cell. Undelayed ?-galactosidase formation was found in stringent auxotrophs recovering from amino acid starva...

166

Improved Catalysts for Heavy Oil Upgrading Based on Zeolite Y Nanoparticles Encapsulated Stable Nanoporous Host. Eighth Semi-Annual Technical Progress Report, April 1, 2006 -September 30, 2006.  

The addition of hydrothermally-aged zeolite Y precursor to an SBA-15 synthesis mixture under a mildly acidic condition resulted in the formation of mesoporous aluminosilicate catalyst, Al-SBA-15, containing strong Bronsted acid sites and aluminum (Al) sta...

167

The Reason Why K10 is an Effective Promoter for meso-Tetraalkylporphyrin Synthesis  

The reason why K10 is an efficient promoter for porphyrin synthesis is found to be due mainly to the mesoporosity rather than to the acid property of K10, by comparing K10 with progressively acid-treated montmorillonites.   

168

An improved synthesis and resolution of cis- and trans-2,3-diphenyl morpholines  

An improved procedure for the synthesis of cis- and trans-2,3-diphenyl morpholines with good overall yield is described. The stereoisomers were efficiently resolved through the corresponding diastereomeric salts using tartaric acid and (R)-mandelic acid.

169

N-to-C Solid-Phase Peptide and Peptide Trifluoromethylketone Synthesis Using Amino Acid tert-Butyl Esters  

Solid-phase peptide synthesis in the N-to-C direction, opposite to the classical C-to-N direction of peptide synthesis, provides the synthetically versatile C-terminal carboxyl group for further modification into C-terminally modified peptide mimetics. These are of general interest as potential bioactive agents, particularly as protease inhibitors. Elaboration of peptide mimetics on the solid-phase would facilitate synthesis of peptide mimetic combinatorial libraries. This report describes an effective strategy for solid-phase inverse peptide synthesis based on readily available amino acid tert-butyl esters. The potential of this approach for peptide mimetic synthesis is demonstrated by the solid-phase synthesis of two peptide trifluoromethylketones.   

170

Catalytic Transformations of Biomass-Derived Materials into Value-Added Chemicals  

This manuscript reviews recent literatures on synthesis of furfurals (5-hydroxymethylfurfural, furfural, 5-methyl-2-furaldehyde) from various sugars (glucose, fructose, d-galactose, d-arabinose, xylose, l-rhamnose, lactose, cellobiose, sucrose) and furfural conversions into other carbonyl compounds (2,5-diformylfuran, 2,5-furandicarboxylic acid, levulinic acid, succinic acid) using catalytic methodology. Our recent achievements on one-pot synthesis of furfurals using solid acid and base catalysts and selective oxidations of furfurals using heterogeneous catalysts are also included. Graphical Abstract

171

Sulfation of metal-organic framework: Opportunities for acid catalysis and proton conductivity  

A new post-functionalization method for metal-organic frameworks (MOFs) has been developed to introduce acidity for catalysis. Upon treatment with a mixture of triflic anhydride and sulfuric acid, chemically stable MOF structures MIL-101(Cr) and MIL-53(Al) can be sulfated, resulting in a Broensted sulfoxy acid group attached to up to 50% of the aromatic terephthalate linkers of the structure. The sulfated samples have been extensively characterized by solid-state NMR, XANES, and FTIR spectroscopy. The functionalized acidic frameworks show catalytic activity similar to that of acidic polymers like Nafion{reg_sign} display in the esterification of n-butanol with acetic acid (TOF {approx} 1 min{sup -1} {at} 343 K). Water adsorbs strongly up to 4 molecules per sulfoxy acid group, and an additional 2 molecules are taken up at lower temperatures in the 1-D pore channels of S-MIL-53(Al). The high water content and Broensted acidity provide the structure S-MIL-53(Al) a high proton conductivity up to moderate temperatures.

172

Okadaic acid suppresses calcium regulation of mitosis onset in sea urchin embryos.  

We show that a phosphatase inhibitor, okadaic acid, induces premature and persistent mitosis during the first cell cycle in sea urchin embryos. Okadaic acid-induced mitosis requires protein synthesis, suggesting that it activates the protein synthesis-requiring mitotic H1 kinase. By microinjecting t...

173

Creating carbon-carbon bonds with samarium diiodide for the synthesis of modified amino acids and peptides  

In this perspective, an overview of our experiences on the application of samarium diiodide in organic synthesis for the preparation of amino acid and peptide analogues is presented. Three different carbon-carbon bond forming reactions are discussed, including side chain introductions, gamma-amino acid synthesis and acyl-like radical additions for the construction of C-C mimics of the peptidic bonds.

174

Synthesis of 9-cis-retinoic acid and C-20-[{sup 3}H{sub 3}C]-9-cis-retinoic acid with high specific activity  

The synthesis of 9-cis-retinoic acid starting from 2,2,6-tri methylcyclohexanone is described. The same methodology was extended for the synthesis of deuterium and tritium labeled 9-cis-retinoic acid with high specific activity (73 Ci/mmol). In this methodology, a Grignard reaction was utilized for introducing three tritium atoms simultaneously in the final synthetic steps. (Author).

175

Regulation of Telomere Length by Fatty Acid Elongase 3 in Yeast: INVOLVEMENT OF INOSITOL PHOSPHATE METABOLISM AND Ku70/80 FUNCTION*  

In this study, we investigated the roles of very long-chain fatty acid (VLCFA) synthesis by fatty acid elongase 3 (ELO3) in the regulation of telomere length and life span in the yeast Saccharomyces cerevisiae. Loss of VLCFA synthesis via deletion of ELO3 reduced telomere length, and reconstitut...

176

Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation  

In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

177

Glucose stimulates protein synthesis in skeletal muscle of neonatal pigs through an AMPK- and mTOR-independent process  

Skeletal muscle protein synthesis is elevated in neonates in part due to an enhanced response to the rise in insulin and amino acids after eating. In vitro studies suggest that glucose plays a role in protein synthesis regulation. To determine whether glucose, independently of insulin and amino acid...

178

A practical synthesis of 4-[(4-methylpiperazin-1-yl)methyl]benzoic acid-the key precursor toward imatinib  

A simple and efficient in situ synthesis of 4-[(4-methylpiperazin-1-yl)methyl]benzoic acid through direct reductive alkylation of 1-methylpiperazine in the presence of triacetoxy sodium borohydride in 95-99% yields is elaborated. The process is easy to scale-up for the large-scale synthesis of 4-[(4-methylpiperazin-1-yl)methyl]benzoic acid as the key synthetic intermediate of imatinib. This method was used for the synthesis of benzyl derivatives of heterocyclic amines in 87-90% yields.

179

Enantioselective Synthesis of the Macrocyclic Pyrrolizidine Alkaloid Yamataimine  

Described is a short-step synthesis of optically active yamataimine, a 12-membered pyrrolizidine alkaloid of retronecine type. Methyl (1S,5R)-5-methyl-2-oxocyclopentanecarboxylate derived from (R)-(+)-pulegone was converted into the necic acid component required for the synthesis of yamataimine, in a nine-step sequence. Regioselective coupling of (+)-retronecine with the necic acid component via tin-mediated regioselective acylation followed by macrolactonization led to the first synthesis of (+)-yamataimine.   

180

In situ Synthesis of Oligonucleotide Arrays on Surfaces Coated with Crosslinked Polymer Multilayers.  

We report an approach to the in situ synthesis of oligonucleotide arrays on surfaces coated with crosslinked polymer multilayers. Our approach makes use of methods for the 'reactive' layer-by-layer assembly of thin, amine-reactive multilayers using branched polyethyleneimine (PEI) and the azlactone-functionalized polymer poly(2-vinyl-4,4'-dimethylazlactone) (PVDMA). Post-fabrication treatment of film-coated glass substrates with d-glucamine or 4-amino-1-butanol yielded hydroxyl-functionalized films suitable for the Maskless Array Synthesis (MAS) of oligonucleotide arrays. Glucamine-functionalized films yielded arrays of oligonucleotides with fluorescence intensities and signal-to-noise ratios (after hybridization with fluorescently labeled complementary strands) comparable to those of arrays fabricated on conventional silanized glass substrates. These arrays could be exposed to multiple hybridization-dehybridization cycles with only moderate loss of hybridization density. The versatility of the layer-by-layer approach also permitted synthesis directly on thin sheets of film-coated poly(ethylene terephthalate) (PET) to yield flexible oligonucleotide arrays that could be readily manipulated (e.g., bent) and cut into smaller arrays. To our knowledge, this work presents the first use of polymer multilayers as a substrate for the multi-step synthesis of complex molecules. Our results demonstrate that these films are robust and able to withstand the ~450 individual chemical processing steps associated with MAS (as well as manipulations required to hybridize, image, and dehybridize the arrays) without large-scale cracking, peeling, or delamination of the thin films. The combination of layer-by-layer assembly and MAS provides a means of fabricating functional oligonucleotide arrays on a range of different materials and substrates. This approach may also prove useful for the fabrication of supports for the solid-phase synthesis and screening of other macromolecular or small-molecule agents. PMID:22611305

 
 
 
 
181

Fatty Acid Synthesis in Trichophyton Rubrum  

Analysis of the fatty acid content of T.rubrum showed that the organism is capable of synthesizing a variety of saturated and unsaturated long-chain fatty acids (KOSTIW, VICHER & Lyon, 1966). The present study was undertaken to determine the mechanism of synthesis of these fatty acids. Experimental data point to the presence of two mechanisms of fatty acid synthesis in T. rubrum de novo synthesis and chain elongation. The presence of both mechanisms is suggested by the nature of the enzyme preparation, by the cofactor requirements for either pathway, and by the reaction products.

182

Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.  

A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant. PMID:21988471

183

Aphid-host plant interactions: Does aphid honeydew exactly reflect the host plant amino acid composition?  

Plants provide aphids with unbalanced and low concentrations of amino acids. Likely, intracellular symbionts improve the aphid nutrition by participating to the synthesis of essential amino acids. To compare the aphid amino acid uptakes from the host plant and the aphids amino acid excretion into th...

184

Novel synthesis of 2-trichloromethyl-4-vinyloxazoline and its derivatization by ring cleavage reactions*  

A novel efficient and eco-friendly method for the synthesis of 2-trichloromethyl-4-vinyloxazoline is presented that involves Lewis acid-catalyzed cyclization of bisimidate derived from but-3-ene-1,2-diol. The derivatization potential of 2-trichloromethyl-4-vinyloxazoline is demonstrated by ring opening reactions with water, hydrobromic acid, hydrochloric acid, and acetic acid leading to allylamine derivatives.

185

Biochemical and functional effects of prenatal and postnatal omega 3 fatty acid deficiency on retina and brain in rhesus monkeys.  

Docosahexaenoic acid [22:6 omega 3; 22:6-(4,7,10,13,16,19)] is the major polyunsaturated fatty acid in the photoreceptor membranes of the retina and in cerebral gray matter. It must be obtained either from the diet or by synthesis from other omega 3 fatty acids, chiefly alpha-linolenic acid (18:3 om...

186

Malonic ester and acetoacetic ester synthesis of 2-[{sup 11,14}C]methyl-fatty acids  

Suitable conditions were sought for the synthesis of various 2-[{sup 11,14}C]methyl-fatty acids by malonic ester synthesis and acetoacetic ester synthesis, both involving radio-methylation with [{sup 11,14}C]CH{sub 3}I. The malonic ester synthesis gave 2-[{sup 11}C]methyl-fatty acids with over 60% decay-corrected yields in about 40 min and the [{sup 14}C]products with somewhat higher yields at a longer time. In the acetoacetic ester synthesis, several 2-[{sup 14}C]methyl-fatty acids were synthesized in 50-70% yields by the hydrolysis of the radio-methylated acetoacetates with a concentrated potassium hydroxide solution, together with by-product ketones. This hydrolysis was completed in 5 min at 70{sup o}C, whereas rather drastic conditions or a longer time were needed for the thermal decarboxylation in the malonic ester synthesis. (author).

187

Injury-induced inhibition of small intestinal protein and nucleic acid synthesis  

Small intestinal mucosal weight and nutrient absorption are significantly diminished early after cutaneous thermal injuries. Because these intestinal properties are highly dependent on rates of nucleic acid and protein synthesis, in vivo incorporation of thymidine, uridine, and leucine into small intestinal deoxyribonucleic acid, ribonucleic acid, and proteins were measured. Deoxyribonucleic acid synthesis was markedly decreased with the lowest thymidine incorporation in the jejunum (p less than 0.01); these findings were confirmed by autoradiographic identification of radiolabeled nuclei in the intestinal crypts. Protein synthesis was decreased by 6 h postinjury (p less than 0.01) but had returned to normal by 48 h. Consistent with a decreased rate of protein synthesis, ribonucleic acid synthesis was also decreased 18 h postinjury (p less than 0.01). These decreased deoxyribonucleic acid, ribonucleic acid, and protein synthesis rates are not likely a result of ischemia because in other studies of this injury model, intestinal blood flow was not significantly changed by the burn injury. Potentially, factors initiating the acute inflammatory reaction may directly inhibit nucleic acid and protein synthesis and lead to alterations in nutrient absorption and intestinal barrier function after injury.

188

Quality evaluation of raw ground almond kernels (Prunus dulcis): Effect of active and modified atmosphere packaging, container oxygen barrier and storage conditions  

The present study investigated the effect of active and modified atmosphere packaging, container oxygen barrier and storage conditions on quality retention of raw ground almonds. Ground almond kernels were packaged in: a) polyethylene terephthalate//low density polyethylene (PET//LDPE), and b) low density polyethylene/ethylene vinyl alcohol/low density polyethylene (LDPE/EVOH/LDPE), under N2 or with an oxygen absorber and stored either under fluorescent light or in the dark at 4 or 20??C for a period of 12?months. Quality parameters monitored were: peroxide value (PV), hexanal content, color, fatty acid composition and volatile compounds. Of the sensory attributes color, texture, odor and taste were evaluated. PV ranged between 0.26 for fresh almonds and 19.98?meq O2/kg oil for almonds pac...

189

Effect of oxygen absorber, nitrogen flushing, packaging material oxygen transmission rate and storage conditions on quality retention of raw whole unpeeled almond kernels (Prunus dulcis)  

The present study investigated the effect of active packaging, nitrogen flushing, container oxygen barrier and storage conditions on quality retention of raw whole unpeeled almonds. Almond kernels were packaged in: a) polyethylene terephthalate//low-density polyethylene (PET//LDPE), and b) low-density polyethylene/ethylene vinyl alcohol/low-density polyethylene (LDPE/EVOH/LDPE) pouches under N2, with or without an oxygen absorber, heat-sealed and stored for a period of 12 months. Quality parameters monitored were: peroxide value (PV), hexanal content, color, fatty acid composition and volatile compounds. PV ranged between 0.17 for fresh almonds and 9.22meqO2/kg oil for almonds packaged in PET//LDPE pouches under N2 exposed to light at 20degreeC after 12 months of storage. Respective values...

190

Preparation, characterization and activity evaluation of CaZrTi2O7 photocatalyst  

CaZrTi2O7 photocatalyst sample was prepared by a polymerizable complex method. The photocatalyst was characterized by X-ray powder diffraction, scanning electron microscopy, UV-Vis diffuse reflectance spectroscopy, photoluminescence emission spectroscopy, Brunauer-Emmett-Teller analysis, N2 adsorption measurements, and terephthalic acid probed fluorescence technique. The photocatalytic activity of the sample was evaluated by photocatalytic oxidation of methyl orange and photocatalytic reduction of Formula Not Shown and nitrobenzene. The results showed that when the reaction solution was illuminated by UV light for 50min, the photooxidation efficiency of methyl orange and the photoreduction efficiency of Formula Not Shown were 83.1% and 87.9%, respectively. When methanol was used as the hol...

191

Preparation, characterization and activity evaluation of Ag2Mo4O13 photocatalyst  

Ag2Mo4O13 photocatalyst was prepared by the hydrothermal method using AgNO3 and (NH4)2MoO4 as raw materials in one step. The Ag2Mo4O13 photocatalyst was characterized by X-ray powder diffraction (XRD), UV-Vis diffuse reflectance spectroscopy (DRS), scanning electron microscopy (SEM), Brunauer-Emmett-Teller (BET) analysis, N2 adsorption measurements, and terephthalic acid photoluminescence (TA-PL) probing technique. The photocatalytic activity of the photocatalyst was evaluated by photocatalytic oxidation of methyl orange and photocatalytic reduction of nitrobenzene. The results showed that, the optimum catalyst concentration is 3g/L, and the optimum optical thickness is 49.4. When the reaction solution was illuminated for 60min and 10h, and the amount of photocatalyst was 2.0g/L, the methy...

192

A photo-polymerization resist for UV nanoimprint lithography  

A novel liquid photo-polymerization resist was prepared for nanoimprint lithography on transparent flexible plastic substrates. The resist is a mixture of polymethylmethacrylate (PMMA), methylmethacrylate (MMA), methacylic acid (MAA) and two photo-initiators, (2-isopropyl thioxanthone (ITX) and ethyl 4-(dimethylamino)benzoate (EDAB)). The resist can be imprinted at room temperature with a pressure of 0.25kg/cm2, and then exposed from the transparent substrate side using a broad band UV lamp to obtain nano- and micro-scale patterns. Replications of high-density line and space patterns with resolution of 150nm were obtained on a flexible indium tin oxide/poly(ethylene terephthalate) (ITO/PET) substrate. The liquid resist has low viscosity due to the liquid monomers, and low shrinkage due to ...

193

Coexistence of one- and two-dimensional supramolecular assemblies of terephthalic acid on Pd(111) due to self-limiting deprotonation  

The adsorption of terephthalic acid [C{sub 6}H{sub 4}(COOH){sub 2}, TPA] on a Pd(111) surface has been investigated by means of scanning tunneling microscopy (STM), x-ray photoelectron spectroscopy, and near-edge x-ray absorption fine structure spectroscopy under ultrahigh vacuum conditions at room temperature. We find the coexistence of one- (1D) and two-dimensional (2D) molecular ordering. Our analysis indicates that the 1D phase consists of intact TPA chains stabilized by a dimerization of the self-complementary carboxyl groups, whereas in the 2D phase, consisting of deprotonated entities, the molecules form lateral ionic hydrogen bonds. The supramolecular growth dynamics and the resulting structures are explained by a self-limiting deprotonation process mediated by the catalytic activity of the Pd surface. Our models for the molecular ordering are supported by molecular mechanics calculations and a simulation of high resolution STM images.

194

Infrared and ultraviolet-visible spectroscopy study of the degradation of polyester and polyester/ethylene methyl acrylate copolymer blend coatings on steel  

Thermally sprayed polymer coatings have been used as protection against corrosion and wear. The aim of this study was to produce coated steel with a blend film with low-velocity combustion thermal spraying and a fusion technique and to evaluate its chemical degradation with infrared and ultraviolet-visible spectroscopy. The substrate used was carbon steel coated with recycled poly(ethylene terephthalate) (PET), an ethylene/methacrylic acid copolymer (EMAA), or PET-EMAA blends. The degradation of the material was evaluated with an ultraviolet condensation-weathering test and a salt-spray test. Measurements of hardness and adhesion were carried out. The tribological properties of the polymeric films were evaluated with a pin-on-disc test. Copyright 2008 Wiley Periodicals, Inc. J Appl Polym S...

195

Thermal, Mechanical and Morphological Properties of Composites Developed from Glycerol and Dicarboxylic Acids Reinforced with Piassava Fiber  

Abstract Summary: Vegetable fibers are being widely used as reinforcement in polymer composites. These composites can be applied in several fields, such as automotive, packaging and even construction. The polymer matrix used was synthesized from glycerol with phthalic and terephthalic acids in order to open future perspectives in the use of glycerin generated from the production of purified biodiesel. Composites with 2, 5, 10-wt% untreated and treated piassava fiber were obtained. Thermal, morphological and mechanical properties were evaluated. The tensile stress-strain curve of the polyester synthesized and composites was typical of a ductile material. SEM of the surface of fracture showed that the adhesion between fiber and matrix was enhanced after chemical treatment. However, the fiber...

196

Evaluation and suitability of biomaterials for modified atmosphere packaging of fresh salmon fillets  

Abstract An evaluation of the suitability of commercially available biopolymers on the shelf-life of fresh salmon fillet was done. The comparison included two different types of biomaterials, poly lactic acid (PLA)-based and starch-based materials, and two traditional materials, amorphous polyethylene terephthalate/polyethylene (APET/PE) and high-density polyethylene (HDPE). Fresh salmon fillets were stored at 4C in modified atmosphere (60% CO2 and 40% N2) for 5, 7, 9 and 14 days. The biomaterials have been briefly evaluated with respect to composition and mechanical properties. The effect of different packaging materials on bacterial growth, off-odour, pH and colour was investigated. The traditional materials (APET/PE and HDPE trays) offered the best protection regarding the bacterial gro...

197

Formation of Oriented Carbon Nanofibrils in Pyrolyzed Product of Terephthalic Acid Disodium Salt  

Terephthalic acid disodium salt (TADS), C6H4(COONa)2, pyrolyzes in a solid phase at above 600°C. That pyrolysis produces a composite of carbon nanofibrils and fine sodium carbonate crystals. The carbon nanofibrils are amorphous and have 10-200 nm diameter. Forms of the carbon nanofibrils depend on experimental conditions. The carbon fibrils formed at 600°C are slightly entangled and bunched into bundles. Moreover, those bundles are aligned roughly in the direction parallel to the b-axis of the pristine TADS crystals. Wide-angle x-ray diffraction images of a pyrolytic product from a TADS crystal showed those arcs attributable to monoclinic sodium carbonate, indicating the rough alignment of the sodium carbonate crystals. Carbon nanofibrils are inferred to form as a result of exclusion by roughly aligned sodium carbonate crystals. [DOI: 10.1380/ejssnt.2005.484]   

198

Synthesis and crystal structures of two polymeric silver(I) complexes with polyamines and terephthalic acid  

Two polymeric silver(I) complexes, [Ag4(TAA)2(TA)2] ? 2[Ag(TA)2] (I) and [Ag2(TA)(BA)] n (II), where TAA is tris(2-aminoethyl)amine, TA is terephthalic acid, BA is butane-1,4-diamine, were synthesized and structurally characterized by elemental analyses and X-ray diffraction. Complex I consists of mononuclear [Ag(TA)2] units and TA-bridged tetranuclear [Ag4(TAA)2(TA)2] units, which are further linked via Ag?Ag interactions to form chains. In complex II, the silver atoms are linked by the TA and BA groups to form chains, which are further linked via Ag?Ag interactions to form layers. In both complexes, molecules are finally linked through intermolecular hydrogen bonds to form three-dimensional networks.

199

Use of modified atmosphere packaging to extend shelf-life of minimally processed jackfruit (Artocarpus heterophyllus L.) bulbs  

The study was carried out to investigate the effect of different modified atmosphere packaging (MAP) techniques for extending the shelf-life of fresh-cut jackfruit (Artocarpus heterophyllus L.) bulbs kept under low temperature conditions. MAP carried out consisted of 3kPa O2+5kPa CO2 (with balance of N2) gas mixture flushed polyethylene (PE) bags, polyethylene terephthalate (PET) jars with silicon membrane window on lid and PE bag with air. Fresh-cut jackfruit bulbs were given a post-cutting phytosanitation wash followed by a dip pretreatment with calcium chloride, ascorbic acid and sodium benzoate under mild acidified conditions prior to MAP. Non-dipped samples packaged in same type of MAP conditions were used as control. Dip pretreatment along with different MAP was found effective in es...

200

Phytochemical changes in fresh-cut jackfruit (Artocarpus heterophyllus L.) bulbs during modified atmosphere storage  

A minimal process was carried out for pitted jackfruit (Artocarpus heterophyllus L.) bulbs using additives CaCl2, ascorbic acid (AA), and sodium benzoate in combination with mild acidified conditions for storage under modified atmosphere (MA), i.e., 3kPa O2+5kPa CO2, gas mixture flushed polyethylene (GFPE) bags, polyethylene terephthalate jars with silicon membrane on lid and polyethylene bag with air. Samples devoid of any additive based pretreatment but packaged in similar MA conditions were used as experimental control. A restricted loss of around 7%, 8%, 43%, and 31% was found for total phenolics (TP), total flavonoids (TF), total carotenoids (TC), and AA contents respectively in the pretreated samples kept under GFPE bags towards the end of 35days storage at 6degreeC. Among the phytoc...

 
 
 
 
201

Loading and Release of Drugs from Oxygen-rich Plasma Polymer Coatings  

Abstract Low-pressure plasma-polymerized ethylene film coatings rich in bonded oxygen groups (L-PPE:O) were deposited on poly(ethylene terephthalate; PET) in order to act as hosts for antimicrobial drugs. Increasing O2 content in the ethylene (C2H4)/Ar-diluted oxygen (O2) gas mixture reduced the deposition rate, but increased the concentration of bonded oxygen, [O], including that of carboxylic acid groups, [COOH], as determined by X-ray photoelectron- (XPS) and Fourier transform infrared (FTIR) spectroscopies, and by toluidine blue O (TBO) assays. L-PPE:O coatings took up and sustained the release of ciprofloxacin for several hours. Steric hindrance impeded vancomycin penetration into the cross-linked L-PPE:O coatings. Ciprofloxacin-loaded L-PPE:O coatings inhibited in vitro the growth of...

202

Pros and cons of analytical methods to quantify surrogate contaminants from the challenge test in recycled polyethylene terephthalate  

Different analytical methods were optimized and applied to quantify certain surrogate contaminants (toluene, chlorobenzene, phenol, limonene and benzophenone) in samples of contaminated and recycled flakes and virgin pellets of polyethylene terephthalate (PET) coming from the industrial challenge test. A screening analysis of the PET samples was carried out by direct solid-phase microextraction (SPME) in headspace mode (HS). The methods developed and used for quantitative analysis were a) total dissolution of PET samples in dichloroacetic acid and analysis by HS-SPME coupled to gas chromatography-mass spectrometry (GC-MS) and, b) dichloromethane extraction and analysis by GC-MS. The concentration of all surrogates in the contaminated PET flakes analyzed by HS-SPME method was lower than exp...

203

Mechanical properties of polymer concrete made with recycled PET and recycled concrete aggregates  

The purpose of this study was to solve some of the solid waste problems posed by plastics and concrete demolition. To this end, we evaluated the mechanical properties of polymer concrete, in particular, polymer concrete made of unsaturated polyester resins from recycled polyethylene terephthalate (PET) plastic waste and recycled concrete aggregates. The strength and the resistances to acid and alkali compounds of the polymer concrete were measured by varying the coarse and fine aggregate ratio and resin content. Three main observations followed the results. First, we found that the strength of polymer concrete made with a resin based on recycled PET and recycled aggregate increases with increasing resin content; however, beyond a certain resin content, the strength does not change apprecia...

204

Preparation of polyimide-silica hybrid materials by high pressure-thermal polymerization  

Polyimide-silica hybrid materials were prepared via a modified sol-gel, high pressure-thermal polymerization procedure. Precursor monomer salts were made from ethanol soluble 2,5-diethoxycarboxyl terephthalic acid (p-PME) and either a disiloxanediamine, an aliphatic diamine (1,9 diaminononane) or combinations of the two. Solutions of tetramethoxysilane (TMOS) and monomer salt were transformed into a gel, dehydrated, and the resulting powders were subjected to high pressure and thermal polymerization and transformed into a polyimide-silica composite. By varying the TMOS content, and/or the siloxane to aliphatic diamine ratio, composites of 0 to 100 wt% SiO{sub 2} were made. The silica morphology changed significantly with siloxane/aliphatic PI ratio. Reaction mechanisms, thermal and physical properties and composite morphologies are discussed.

205

Novel soluble fluorine-containing polyamides derived from 2-(4-trifluoromethylphenoxy)terephthalic acid and trifluoromethyl-substituted aromatic bis(ether amine)s  

A series of new fluorine-containing polyamides were prepared directly by polycondensation of 2-(4-trifluoromethylphenoxy)terephthalic acid with four trifluoromethyl-substituted aromatic bis(ether amine)s in N-methyl-2-pyrrolidone (NMP) solution containing dissolved calcium chloride using triphenyl phosphite and pyridine as condensing agents. All the polymers showed excellent solubility in solvents such as NMP, N,N-dimethylacetamide, N,N-dimethylformamide, dimethyl sulfoxide, pyridine, tetrahydrofuran, and acetone at room temperature. These polymers had inherent viscosities between 0.67 and 1.09 dL/g, and their weight-average molecular weights and number-average molecular weights were in the range of 48,200?68,000 and 29,500?39,400, respectively. The resulting polymers showed glass-transiti...

206

First layer compression and transition to standing second layer of terephthalic acid on Cu(100).  

Terephthalic acid on metal surfaces is a system of high interest for interfacial layers as well as for use in generating surface nanostructures by supramolecular self-assembly. Here we demonstrate structural transitions upon compression of the first layer as well as a significant transition from a flat lying chemisorbed first monolayer to a standing second layer. The second layer structure is stable at 150 °C, but a weakly bound state is observed to desorb molecularly below that temperature, likely a transient mobile state during annealing. Molecular resolution scanning tunnelling microscopy is complemented by X-ray photoelectron spectroscopy and thermal desorption spectroscopy in this study. These results provide general insight in the development of self-assembled organic thin films at surfaces, especially with regard to the nature of the metal/organic interface and growth transitions to maximize first layer packing and obtain a second layer that bridges commensurability with the substrate and a more bulk-like structure. PMID:22546738

207

Effect of small amounts of poly(lactic acid) on the recycling of poly(ethylene terephthalate) bottles  

Poly(ethylene terephthalate) (PET) is one of the most used commodity polymers, especially for food and beverage applications, and its recycling is of great importance because of the possible use in the textile and construction industries. On the other hand, the interest in biodegradable polymers has led, in recent years, to the use of materials such as poly(lactic acid) (PLA) also in the food and beverage industry. The presence of small amounts of PLA in the PET waste can significantly affect the post-consumer recycling process. In this work, the effect of the presence of small amounts of PLA on the recycling of PET bottles is investigated by rheological, mechanical, morphological and thermogravimetric analysis. The results indicate that this presence can significantly affect the rheologic...

208

Compatibility and physical properties of poly(lactic acid)/poly(ethylene terephthalate glycol) blends  

Blends of poly(lactic acid) (PLA) and poly(ethylene terephthalate glycol) (PETG) of various compositions were prepared by melt compounding and their compatibilities, physical properties, and isothermal crystallization behaviors were investigated. The calculated solubility parameters of PETG are similar to those of PLA. The interaction parameter between PLA and PETG was derived from the Flory-Huggins theory and predicted that PLA and PETG are miscible when PETG contents are below 22 wt%. In accordance with this result, the tan δ peak and glass transition temperatures of blends determined from dynamic mechanical analysis (DMA) and differential scanning calorimetry (DSC) showed a single peak at PETG contents lower than 22 wt%. Tensile test results showed that the elongation at the break of b...

209

Chitosan/poly (vinyl pyrollidone) coatings improve the antibacterial properties of poly(ethylene terephthalate)  

Chitosan/poly (vinyl pyrollidone) (CHI/PVP) coatings were prepared to improve the antibacterial properties of poly (ethylene terephthalate) (PET) by a simple dip-coating method. The binding capability of CHI/PVP coatings was enhanced by successively pretreatment of PET by polyetherimide and polyacrylic acid and crosslinking. Measurements of water contact angle and atomic force microscope revealed that the coatings created a highly hydrophilic surface with low roughness. Adherences of Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli) on PET with CHI/PVP coating were significantly reduced. Bactericidal activity of CHI/PVP coatings was good against E. coli and S. aureus and the adding of PVP obviously increased its antiadhesion property. In vitro cytotoxicity tests, cell morphology and activity evaluation of human umbilical vein endothelial cells showed that CHI/PVP coatings had good biocompatibility.

210

Terephthalic acid adsorption on Si(111)-(33)-Bi surfaces: Effect of Bi coverage  

The influence of the density of metallic atoms on the formation of supramolecular structures onto Si surface alloys is investigated by scanning tunneling microscopy. Terephthalic acid (TPA) adsorption experiments are performed on the Si(111) ?- and ?-(3×3)-Bi surfaces. Although both surfaces have the same unit cell with Bi atoms incorporated into the Si substrate, they show a completely different behavior in respect to the formation of the supramolecular arrays. TPA molecules do not build any regular structure and adsorb randomly on the ? surface but self-assemble into ordered and extended layers on the ? surface. This demonstrates that the absence of dangling bonds in metal-Si surface alloys is not a sufficient condition for supramolecular self-assembly but that the surface density of metallic atoms is a further essential parameter.

211

In Situ Infrared Spectroscopic Study on Liquid Crystalline Phase Formation of a Random Copolyester Consisting of 60 mol% p-Hydroxybenzoic Acid/40 mol% Ethylene Terephthalate  

Conformation change occurring during the formation of the liquid crystalline phase was investigated by using the in situ Fourier transform infrared spectroscopy. An isotropic glass of a random liquid crystalline copolyester consisting of 60 mol% p-hydroxybenzoic acid/40 mol% ethylene terephthalate was prepared with the cast from a solution and was heated from the room temperature up to 300°C. The onset of the transformation from the gauche conformers to the trans conformers of the ethylene glycol group was observed at ca. 60°C. The change in packing was indicated by the change in the intensity of the bands assignable to the aromatic rings around 150°C. Liquid crystalline phase formation observed with the optical method started to occur at ca. 200°C in association with the loss of the packing.   

212

Surface modification of poly(ethylene terephthalate) (PET) film by gamma-ray induced grafting of poly(acrylic acid) and its application in antibacterial hybrid film  

Acrylic acid (AA) was facilely grafted onto poly(ethylene terephthalate) (PET) film through gamma-ray induced graft copolymerization. Silver nanoparticles produced by the chemical reduction of silver ions were then immobilized by carboxylic anions and embedded on the surface of PET-g-PAA film. It was found that the DG of PAA on PET film increases with the absorbed dose and would finally control the amount of loaded silver nanoparticles. The prepared PET-g-PAA/Ag hybrid films were characterized by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), and thermogravimetric analysis (TGA). The bactericidal activity of the PET-g-PAA/Ag hybrid film was evaluated by the efficiency of killing Escherichia coli. The results showed that the PET-g-PAA/Ag hybrid film has a strong and stable antibacterial activity.

213

A study on fabrication of polyester copolymers(IV): Physical properties of PET/BPA copolymer  

PET/BPA copolymer of terephthalic acid, bisphenol-A and ethylene glycol was melt-pressed and quenched in ice water. This copolymer film was drawn by capillary rheometer. Shrinkage, crystallinity, morphology, thermal, dynamic mechanical, and mechanical properties of these copolymer films were investigated. The PET/BPA copolymer film exhibited T{sub m} lower than that of PET film. The crystallinity and density of these drawn copolymer films increased with draw ratio and draw rate but decreased with draw temperature. The tensile strength and tensile modulus of the copolymer films increased with draw ratio but decreased with draw temperature. Shrinkage of the drawn copolymer film decreased with draw ratio and draw rate. (author). 32 refs., 17 figs.

214

Fabrication of Layer-by-Layer Self-Assembly Films Using Roll-to-Roll Process  

In this research, we fabricated thin films deposited on poly(ethylene terephthalate) (PET) films by a layer-by-layer self-assembly method using a roll-to-roll process and measured the morphology and transmittance of the thin films using atomic force microscopy (AFM) (nanoscope IIIa, Digital Instruments) and UV-vis spectroscopy (Filmetrics, Inc). The thin films consisting of poly(allylamine hydrochloride), (PAH) adjusted to pH 7.5 and poly(acrylic acid) (PAA) adjusted to pH 3.5 showed a textured structure on moving film substrates. From these results, we found that polyelectrolyte multilayer (PEM) thin films showing similar to those structures of the films fabricated using a conventional dipping process were successfully assembled via the roll-to-roll process. We consider that this roll-to-roll process is suitable for fabricating large-area thin films.   

215

UV radiation induced graft copolymerization of allyl acetate onto poly(ethylene terephthalate) (PET) films for fuel cell membranes  

Ultraviolet (UV)-induced graft copolymerization of allyl acetate (AA) monomer onto poly(ethylene terephthalate) (PET) films and the subsequent sulfonation on the monomer units in the grafting chain using chlorosulfonic acid (ClSO3H) were carried out to prepare proton exchange membranes (PEMs) for fuel cells. A maximum grafting value of 12.8% was found for 35 vol% allyl acetate after 3 h radiation time. Optimum concentration of ClSO3H was selected for the sulfonation reaction to be 0.05 mol/L based on the degree of sulfonation and the tensile strength studies of the membrane. The degree of sulfonation increased as the sulfonation reaction temperature and sulfonation time were increasing. The radiation grafting and the sulfonation have been confirmed by titrimetric and gravimetric analyses a...

216

Possibility of Solid-State Graft Copolymerization on Poly(ethylene terephthalate) Films by Plasma Irradiation and Effects of Surface Modification  

A solid-state graft copolymerization for poly(ethylene terephthalate) (PET) films was proposed for a new surface modification technique. The functional groups included in graft monomers can be introduced on a PET surface. Allylbiguanide hydrochloric acid salt (ABG), N-methylol acrylamide (NM-AAm), and N-isopropyl acrylamide (NIP-AAm) were used as graft monomers. This technique led to a large change in the N/C atomic ratio on the PET film surfaces, which shows that nitrogen functional groups were introduced on PET surfaces. On the grafted PET films, a new N 1s spectrum appeared. This N 1s spectrum contained two components, namely, amino and amido groups, which suggests that the two groups were introduced onto the PET surfaces. In particular, isopropyl groups were introduced on the PET surface in the case of NIP-AAm. The formation of these functional groups demonstrated changes in the surface properties of PET, such as improved wettability.   

217

Synthesis of protons exchange polymeric membranes via co-poly-esters doped with sodium dodecyl sulfate for application in PEM fuel cells; Sintese de membranas polimericas condutoras de protons por imobilizacao de MDs em copoliesteres para aplicacao em PEM-FC  

Polymers are largely studied for use in PEM-type fuel cell (Proton Exchange membrane, PEMFC). These fuel cells are based on polymer membranes as electrolyte, also called protons conductor. This work developed co-polyesters made electrical conductors by doping with sodium dodecyl sulfate. The copolymers were synthesized from the copolymerization of terephthalic and adipic acids with glycerol. The material was processed in a reactor and shaped by hot pressing, yielding homogeneous and flexible plates, with excellent surface finish. The co-polyesters were analyzed by SEM, FTIR, TG, DSC, and XRD. The thermal analysis showed that the composites were thermally stable up to about 250 deg C. The micrographics revealed the MDS homogeneously dispersed in the polymeric matrix. These copolymers showed electrical conductivity between 10-7 to 10-1 S/cm, suggesting strong potential use in PEM fuel cells. (author)

218

Correlation between the shade of an azo disperse dye on poly(ethylene terephthalate) and poly(lactic acid) fibres with its spectroscopic properties in selected organic solvents  

A series of azo disperse dyes was synthesised and the purified, synthesised dyes were characterised by proton nuclear magnetic resonance, thin-layer chromatography and melting point measurement. The spectroscopic properties of the dyes in solution were studied by dissolving the dyes in ethyl acetate and methyl benzoate. These were seen as mimicking the environment of the dye when inside dyed poly(lactic acid) and poly(ethylene terephthalate), respectively. Reflectance spectra of the dyes on both polyester substrates were also measured in order to correlate with the spectroscopic properties of the dyes in solution. The absorbance spectra of the dyes in solution exhibited a hypsochromic (lower wavelength of maximum exhaustion) shift when dissolved in ethyl acetate, compared with methyl benzo...

219

PET trays coated with Citrus extract exhibit antioxidant activity with cooked turkey meat  

A natural Citrus extract with potential antioxidant activity was evaluated as an ingredient for the production of active food packaging. The extract, in methanol, was sprayed onto the surface of polyethylene terephthalate (PET) trays. For comparison, a second set of trays were prepared using @a-tocopherol as the coating. The effectiveness of the two types of packaging in delaying lipid oxidation in cooked turkey meat slices, stored at 4^oC over 4 days, was compared using 2-thiobarbituric acid-reactive substances (TBARS) and hexanal assays. TBARS and hexanal values, for meat stored on the Citrus extract coated trays, were significantly lower (P<0.01) than those of meat stored on uncoated (control) trays while @a-tocopherol coated trays exhibited no significant effect compared to control tra...

220

Plastics as materials for automobiles. Jidosha sozai to shite no plastic  

Use of plastic materials in automobiles has reached 7.3% by weight in the raw material mix ratio in 1992, while engineering plastics also show steady development in use. This paper summarizes trends in technological development of heat resistant nylon that draws attention recently among other plastic materials. A breakthrough in the manufacturing techniques has made practical use possible in partially aromatic nylon containing terephthalic acid called 6T Nylon. Its main features include low temperature dependency of strength and rigidity, high loading torsional temperature, high water absorption and hygroscopic resistance, small thermal expansion, high resistance to chemicals including gasoline, having heat resistance and good property balance inherent to nylon. The material has been used for thermostat covers replacing the conventionally used aluminum die-cast parts that has successfully led to weight reduction and integration of parts. The material has highly suitable properties for underhood parts, and shows signs of spread use also in large size parts. 5 refs., 2 figs., 1 tab.

 
 
 
 
221

Durable flame retardant finishing of PET/cotton blends using a Novel PVA-based phosphorus-nitrogen polymer  

Abstract A novel polymeric flame retardant (FR) with phosphorous-nitrogen pendent groups (PVP-P-DCA) was synthesized by polyvinyl alcohol (PVA), phosphoric acid, and dicyandiamide (DCA). Its structure was characterized by FTIR, 1H, 13C, 31P NMR, elemental analysis and TG. Poly(ethylene terephthalate) (PET)/cotton blends (T/C) was treated via pad-dry-cure process with PVP-P-DCA. The surface of FR-T/C was characterized by FTIR and SEM. The fabric performance was examined by whiteness and tensile property. The fire behavior was performed by limited oxygen index (LOI), vertical burning test, cone calorimetry test. The durability effect, thermal stability, and flame retardancy mechanism of the treated T/C were investigated by TGA, FTIR, and SEM. The results show that PVP-P-DCA is not only an ef...

222

Processability enhancement of poly(lactic acid-co-ethylene terephthalate) by blending with poly(ethylene-co-vinyl acetate), poly(3-hydroxybutyrate-co-3-hydroxyvalerate), and poly(butylene succinate)  

Processability enhancement feasibility of an in-house synthesized poly(lactic acid-co-ethylene terephthalate), PLET, is investigated by blending with commercial poly(ethylene-co-vinyl acetate), EVA, poly(3-hydroxybutyrate-co-3-hydroxyvalerate), PHBV, and poly(butylene succinate), PBS. The three blend systems are prepared by varying PLET contents, and their properties are characterized. DSC, SEM, and FTIR results indicate that PLET/EVA blends are immiscible, while the corresponding PLET/PBS and PLET/PHBV blends are miscible and partially miscible, respectively. DMA results show that the three blend systems have storage modulus comparable to those of commercial EVA, PHBV, and PBS, when PLET content is kept lower than 50, 25, and 25?wt%, respectively. PLET/EVA blends show higher thermal stabi...

223

Polyesters of 2-Pyrone-4,6-dicarboxylic Acid (PDC) as Bio-based Plastics Exhibiting Strong Adhering Properties  

2-Pyrone-4,6-dicarboxylic acid (PDC), a chemically stable metabolic intermediate of lignin, its bis(hydroxyethyl) derivative (BHPDC) and bis(hydroxyethyl) terephthalate (BHT) were polymerized to prepare the corresponding polyesters carrying the oxyethyleneoxycarbonyl(2-pyrone-4,6-diyl)carbonyl and oxyethyleneoxy-terephthaloyl units [x and y units, resp., x+y=1] by polycondensation eliminating water and/or 1,2-ethanediol molecules. The polyesters were mostly stable up to 210 °C, after that the degradation of pyrone ring commenced. These polyesters exhibited strong adhering properties against metal, glass and surfaces with increasing the x unit content to 0.4–0.6, such as about 50–60 MPa for SUS/polyester/SUS or Al/polyester/Al samples, by the JIS K 6849:1994 testing method of tensile strength. As the fracturing plane was the midst of the polyester layer and at the interface, the polyester was tenaciously adhering to the metal surface.   

224

Kinetics of the Mono-esterification Between Terephthalic Acid and 1,4-Butanediol  

The chemical kinetics of the monoesterification between terephthalic acid (TPA) and 1,4-butanediol (BDO) catalyzed by a metallo-organic compound was studied using the initial rate method. The experiments were carried out in the temperature range of 463-483 K, and butylhydroxyoxo-stannane (BuSnOOH) and tetrabutyl titanate [Ti(OBu)4] were used as catalyst respectively. The initial rates of the reaction catalyzed by BuSnOOH or Ti(OBu)4 were measured at a series of initial concentrations of BDO (or TPA) with the concentration of TPA (or BDO) kept constant. The reaction orders of reagents were determined by the initial rate method. The results indicate that the reaction order for TPA is related with the species of catalyst and it is 2 and 0.7 for BuSnOOH and Ti(OBu)4 respectively. However, the ...

225

Supramolecular Polymer Hydrogels from Bolaamphiphilic L-Histidine and Benzene Dicarboxylic Acids: Thixotropy and Significant Enhancement of Eu(III) Fluorescence.  

Supramolecular polymers from the bolaamphiphilic L-histidine (BolaHis) and benzene dicarboxylic acids (o-phthalic acid, OPA; isophthalic acid, IPA and terephthalic acid, TPA) were found to form hydrogels although neither of the single components could gel water. It was suggested that the hydrogen bond and ionic interactions among different imidazole and carboxylic acid groups are responsible for the formation of the supramolecular polymer as well as the hydrogel formation. Depending on the structures of the dicarboxylic acids, different behaviors of the gels were observed. The hydrogels from OPA/BolaHis and IPA/BolaHis showed thixotropic properties, that is, the hydrogel was destroyed by hand shaking and then slowly gelated again at room temperature. However, the hydrogels of TPA/BolaHis could not. Interestingly, when Eu(III) was doped into IPA/BolaHis supramolecular polymers, very strong luminescence enhancement was observed. FT-IR spectroscopies and XRD analysis revealed that the strong luminescence enhancement could be attributed to the matched supramolecular nanostructures, which render the correct binding and a good dispersion of Eu(III) ions. The work offers a new approach for fabricating functional hydrogels through the supramolecular polymers. PMID:23097314

226

Stress-corrosion cracking of indium tin oxide coated polyethylene terephthalate for flexible optoelectronic devices  

Stress corrosion cracking of transparent conductive layers of indium tin oxide (ITO), sputtered on polyethylene terephthalate (PET) substrates, is an issue of paramount importance in flexible optoelectronic devices. These components, when used in flexible device stacks, can be in contact with acid containing pressure-sensitive adhesives or with conductive polymers doped in acids. Acids can corrode the brittle ITO layer, stress can cause cracking and delamination, and stress-corrosion cracking can cause more rapid failure than corrosion alone. The combined effect of an externally-applied mechanical stress to bend the device and the corrosive environment provided by the acid is investigated in this work. We show that acrylic acid which is contained in many pressure-sensitive adhesives can cause corrosion of ITO coatings on PET. We also investigate and report on the combined effect of external mechanical stress and corrosion on ITO-coated PET composite films. Also, it is shown that the combination of stress and corrosion by acrylic acid can cause ITO cracking to occur at stresses less than a quarter of those needed for failure with no corrosion. In addition, the time to failure, under {approx} 1% tensile strain can reduce the total time to failure by as much as a third.

227

Synthesis and Properties of Novel Aromatic Poly(ester amide)s Bearing Naphthalene-2,7-diyl Units  

Two new naphthalene ring-containing diamino-diesters, 2,7-bis(4-aminobenzoyloxy)naphthalene (p-2) and 2,7-bis(3-aminobenzoyloxy)naphthalene (m-2), were synthesized from the condensation of 2,7-dihydroxynaphthalene with 4-nitrobenzoyl chloride and 3-nitrobenzoyl chloride, respectively, followed by catalytic hydrogenation. Two series of naphthalene-containing poly(ester amide)s with inherent viscosities of 0.49–0.97 and 0.36–0.73 dL g-1 were prepared by the phosphorylation polyamidation of p-2 and m-2, respectively, with various aromatic dicarboxylic acids. Most of the poly(ester amide)s had excellent solubilities in polar aprotic solvents such as N-methyl-2-pyrrolidone and N,N-dimethylacetamide, especially for the m-series polymers. Some of the poly(ester amide)s could be cast into transparent, flexible, and tough films from DMAc solutions. The poly(ester amide)s derived from rigid dicarboxylic acids such as terephthalic acid, 4,4’-biphenyldicarboxylic acid, 2,6-naphthalenedicarboxylic acid and 4,4’-sulfonyldibenzoic acid were semicrystalline and showed less solubility. Except for three examples, most of the poly(ester amide)s displayed discernible glass transitions between 187 and 237 °C in the DSC traces. These poly(ester amide)s showed insignificant decomposition below 400 °C in nitrogen or air. The investigation of the thermal decomposition of the poly(ester amide)s using infrared spectroscopy and pyrolysis-gas chromatography/mass spectrometry (pyrolysis-GC/MS) indicated that the primary breakage of the ester linkages started at around 400 °C, which initiated the polymer chain scission.   

228

Influencing the size and anion selectivity of dimeric Ln(3+)[15-metallacrown-5] compartments through systematic variation of the host side chains and central metal.  

Dimeric Ln(3+)[15-metallacrown-5] compartments selectively recognize carboxylates through guest binding to host metal ions and intermolecular interactions with the phenyl side chains. A systematic study is presented on how the size, selectivity, and number of encapsulated guests in the dimeric containers is influenced by the Ln(3+)[15-metallacrown(Cu(II))-5] ligand side chain and central metal. Compartments of varying heights were assembled from metallacrowns with S-phenylglycine hydroxamic acid (pgHA), S-phenylalanine hydroxamic acid (pheHA), and S-homophenylalanine hydroxamic acid (hpheHA) ligands. Guests that were examined include the fully deprotonated forms of terephthalic acid, isonicotinic acid, and bithiophene dicarboxylic acid (btDC). X-ray crystallography reveals that the side-chain length constrains the maximum and minimum length guest that can be encapsulated in the compartment. Compartments with heights ranging from 9.7 to 15.2 Å are formed with different phenyl side chains that complex 4.3-9.2 Å long guests. Up to five guests are accommodated in Ln(3+)[15-metallacrown(Cu(II))-5] compartments depending on steric effects from the host side chains. The nine-coordinate La(3+) central metal promotes the encapsulation of multiple guests, while the eight-coordinate Gd(3+) typically binds only one dicarboxylate. Electrospray ionization mass spectrometry reveals that the dimerization phenomenon occurs beyond the solid state, suggesting that these containers can be utilized in solid-state and solution applications. PMID:22309194

229

75 FR 52311 - Notice of Scope Rulings  

...A-570-929: Polyethylene Terephthalate (``PET'') Film from the People's Republic of China. Requestor...Company (``CFC''); CFC's Amorphous PET (``APET''), Glycol-modified PET (``PETG''), and coextruded APET and...

230

LDEF Materials - Category: Coating  

... S1002 - Investigation of Critical Surface Degradation Effects on Coating and ... Designation/Trade Name: Titanium-aluminum-vanadium coating on titanium ...... Composition: Polyethylene terephthalate (PET) polyester Material, Remarks: ...

231

Synthesis and properties of 1-aminocyclopropane-1,2-dicarboxylic acid and compounds incorporating it  

Methods for the synthesis of 1-aminocyclopropane-1,2-dicarboxylic acid derivatives including carbo- and heterocyclic compounds and peptides are analysed. Special attention is given to methods for the synthesis of individual stereoisomers of 1-aminocyclopropane-1,2-dicarboxylic acid derivatives based on the use of diastereoselective processes or enantiomerically pure starting compounds. The transformations of 1-aminocyclopropane-1,2-dicarboxylic acid derivatives which yield compounds with potential biological activities are considered.

232

Studies on the total synthesis of lactonamycin: synthesis of the CDEF ring system.  

A concise and efficient synthesis of the tetracyclic CDEF ring system of lactonamycin (1) is described. The key step involved the Lewis acid mediated, intramolecular Friedel-Crafts acylation of carboxylic acid 6 to produce the tetracyclic CDEF core structure of target 1. The synthesis of 6 was carried out using a high-yielding Negishi coupling of benzyl bromide 7 with triflate 8, which was accessible in 11 steps and 31% overall yield on a multigram scale starting from trihydroxy acid 9. PMID:17025305

233

Esterification of mandelic acid catalyzed by heteropoly acid  

The efficacy of various supported heteropoly acids in synthesis of mandelates from mandelic acid and alcohols is investigated. Dodecatungestophosphoric acid (PW) supported on silica gives the best yield in short reaction times. The present procedure represents a clean, practical, simple, mild, time-saving, and eco-friendly method for synthesis of mandelates in short reaction times and excellent yields with 100% selectivity. The catalyst is found to be stable, highly efficient, reusable, and inexpensive during all runs.

234

Total synthesis of (+/-)-pentacycloanammoxic acid.  

The first total synthesis of (+/-)-pentacycloanammoxic acid/methyl ester (1), an unusual naturally occurring fatty acid from Candidatus Brocadia anammoxidans, has been accomplished by the sequence of reactions shown in Scheme 1. The C20-structure of 1 was assembled with stereocontrol from three building blocks: cyclooctatetraene, 2-cyclopentenone, and 7-bromoheptanoic acid. The synthesis of 1 confirms the proposed structure of 1. The mode of biosynthesis and absolute configuration have yet to be clarified. PMID:15571387

235

Subchronic 90-day oral toxicology of di(2-ethylhexyl) terephthalate in the rat.  

Di(2-ethylhexyl) terephthalate (DEHT), the 2-ethylhexyl diester of terephthalic acid (1,4-benzenedicarboxylic acid) was administered in the diet to groups of 20 male and female Sprague-Dawley rats for 90 days at 1.0, 0.5, 0.1 or 0.0% by weight. No major organ or systemic toxicity resulted from consumption of the diets in any group of animals. Changes that were observed included slight effects on some haematology parameters including haemoglobin, haematocrit, mean corpuscular volume and mean corpuscular haemoglobin at the 1.0% dose; and slight increases in relative liver weights (11.2% in the males, 8.9% in the females), also at the 1.0% dose level. Marginal changes of less than 3% in some red blood cell indices were observed at the 0.5% dietary dose level; however no anaemia or changes in relative liver weights were observed at this dose level. Thus, no significant adverse effects attributable to the test material were identified in animals consuming the two lower doses. In a morphometric study of liver sections, DEHT was found not to induce hepatic peroxisomes at the 1.0% dose level. The positive control material (2-ethylhexanol at 1000 mg/kg, 5 days/wk for 3 wk), produced a 30% increase in liver-to-body weight ratio, and increases in peroxisome cell fraction, and in peroxisome density. The no-effect levels of DEHT in rats consuming the material for 90 days in the diet were 277 and 309 mg/kg/day in males and females, respectively. These results are contrasted with those reported for di(2-ethylhexyl) phthalate (DEHP) in similar feeding studies. While DEHP at 1% in the diet is reported to produce significant effects on the liver, testes, kidney, brain, stomach and adrenal weights, DEHT has been shown in this study to have only a minor effect on liver weight in 90 days at 1.0% in the diet. PMID:7590545

236

Effect of the Quality of Dietary Amino Acids Composition on the Urea Synthesis in Rats  

We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.   

237

Metabolic characteristics of the species Variovorax paradoxus.  

This review outlines information about the Gram-negative, aerobic bacterium Variovorax paradoxus. The genomes of these species have G+C contents of 66.5-69.4 mol%, and the cells form yellow colonies. Some strains of V. paradoxus are facultative lithoautotrophic, others are chemoorganotrophic. Many of them are associated with important catabolic processes including the degradation of toxic and/or complex chemical compounds. The degradation pathways or other skills related to the following compounds, respectively, are described in this review: sulfolane, 3-sulfolene, 2-mercaptosuccinic acid, 3,3'-thiodipropionic acid, aromatic sulfonates, alkanesulfonates, amino acids and other sulfur sources, polychlorinated biphenyls, dimethyl terephthalate, linuron, 2,4-dinitrotoluene, homovanillate, veratraldehyde, 2,4-dichlorophenoxyacetic acid, anthracene, poly(3-hydroxybutyrate), chitin, cellulose, humic acids, metal-EDTA complexes, yttrium, rare earth elements, As(III), trichloroethylene, capsaicin, 3-nitrotyrosine, acyl-homoserine lactones, 1-aminocyclopropane-1-carboxylate, methyl tert-butyl ether, geosmin, and 2-methylisoborneol. Strains of V. paradoxus are also engaged in mutually beneficial interactions with other plant and bacterial species in various ecosystems. This species comprises probably promising strains for bioremediation and other biotechnical applications. Lately, the complete genomes of strains S110 and EPS have been sequenced for further investigations. PMID:23192768

238

Ceramide synthesis from free fatty acids in rat brain: function of NADPH and substrate specificity  

At the subcellular level, the synthesis of ceramide from free lignoceric acid and sphingosine in brain required reconstituted enzyme system (particulate fraction, heat-stable and heat-labile factors) and pyridine nucleotide (NADPH). The mitochondrial electron transfer inhibitors (KCN and antimycin A), energy uncouplers (oligomycin and 2,4-dinitrophenol), and carboxyatractyloside, which prevents the transport of ATP and ADP through the mitochondrial wall, inhibit the synthesis of ceramide in the presence of NADPH but have very little effect in the presence of ATP. Similar to the synthesis of ceramide, the synthesis of ATP from NADPH and NADH by the particulate fraction also required cytoplasmic factors (heat-stable and heat-labile factors). Moreover, ATP, but not its analog (AMP-CH2-P-O-P), can replace NADPH, thus suggesting that the function of the pyridine nucleotide is to provide ATP for the synthesis of ceramide. The cytoplasmic factors were not required for the synthesis of ceramide in the presence of ATP. The maximum velocity for synthesis of ceramide from free fatty acids of different chain lengths (C16-C26) was bimodal, with maxima around stearic acid (C18) and behenic acid (C22). The relative rate of synthesis of ceramide parallels the relative distribution of these fatty acids in brain cerebrosides and sulfatides.

239

[Genetico-biochemical study of acid phosphatases in Saccharomyces cerevisiae yeast. V. Genetic control of regulation of acid phosphatase II synthesis].  

Regulation of exocellular enzyme acid phosphatase 2 synthesis is studied. 21 mutants with consitutive synthesis of this enzyme are obtained by UV-irradiation. All mutants were recessive and were distributed among 3 complementation groups ACP80, ACP81, ACP82. Two groups, ACP80 and ACP81 corresponded to two different genes, which showed no linkage with ACP1, ACP2 and PHO1 genes. The type of synthesis of acid phosphatase 2 in strains acp1 acp80, acp1 acp81, acp2 acp80, acp2 acp81 is determined, and a conclusion is made about the participation of ACP2 gene in the regulation of acid phosphatase 2 synthesis. It is shown that some mutations in PHO1 gene, which block the activity of acid phosphatase 1, influence the activity and regulation of acid phosphatase 2. PMID:765203

240

Enantioselective synthesis of stimulus-responsive amino acid via asymmetric a-amination of aldehyde  

Development of a methodology to control the function of peptides and proteins is an indispensable task in the field of chemical biology and drug delivery. Recently, we reported synthesis of racemic stimulus-responsive amino acids and their application for controlling peptidyl function. In this study, we report enantioselective synthesis of a key intermediate of stimulus-responsive amino acids via asymmetric a-amination reaction of an aldehyde. The obtained chiral intermediate was converted to an Fmoc protected UV-responsive amino acid with (S)-configuration, and it was successfully incorporated into a model peptide by Fmoc solid phase peptide synthesis.

 
 
 
 
241

Synthesis of glucose oxidase and catalase by Aspergillus niger in resting cell culture system.  

The synthesis of glucose oxidase and catalase by Aspergillus niger was investigated using a resting cell culture system without growth being established. Calcium carbonate induced the synthesis of both enzymes and calcium chloride inhibited it. The optimal pH for the biosynthesis of glucose oxidase and catalase was 6.0 and 5.7, respectively. The effects of other bivalent cations, reductive compounds and metabolic products on enzyme synthesis were also tested. The biosynthesis of glucose oxidase and catalase was promoted by MnCO3, thioglycolic acid, pyroracemic acid and gluconic acid. PMID:10701992

242

Synthesis and properties of carbohydrate-phosphate backbone-modified oligonucleotide analogues and nucleic acid mimetics  

Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose-phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the phosphate group. Among nucleic acid mimetics, conformationally restricted modified peptide nucleic acids, including those bearing a negative or positive charge, and morpholino oligomers are considered. Advantages and drawbacks of the main types of analogues as regards the complexity of the synthesis and the possibility of their application as antisense agents or reagents for hybridization analysis are compared.

243

Profiles of the biosynthesis and metabolism of pyridine nucleotides in potatoes (Solanum tuberosum L.).  

As part of a research program on nucleotide metabolism in potato tubers (Solanum tuberosum L.), profiles of pyridine (nicotinamide) metabolism were examined based on the in situ metabolic fate of radio-labelled precursors and the in vitro activities of enzymes. In potato tubers, [(3)H]quinolinic acid, which is an intermediate of de novo pyridine nucleotide synthesis, and [(14)C]nicotinamide, a catabolite of NAD, were utilised for pyridine nucleotide synthesis. The in situ tracer experiments and in vitro enzyme assays suggest the operation of multiple pyridine nucleotide cycles. In addition to the previously proposed cycle consisting of seven metabolites, we found a new cycle that includes newly discovered nicotinamide riboside deaminase which is also functional in potato tubers. This cycle bypasses nicotinamide and nicotinic acid; it is NAD --> nicotinamide mononucleotide --> nicotinamide riboside --> nicotinic acid riboside --> nicotinic acid mononucleotide --> nicotinic acid adenine dinucleotide --> NAD. Degradation of the pyridine ring was extremely low in potato tubers. Nicotinic acid glucoside is formed from nicotinic acid in potato tubers. Comparative studies of [carboxyl-(14)C]nicotinic acid metabolism indicate that nicotinic acid is converted to nicotinic acid glucoside in all organs of potato plants. Trigonelline synthesis from [carboxyl-(14)C]nicotinic acid was also found. Conversion was greater in green parts of plants, such as leaves and stem, than in underground parts of potato plants. Nicotinic acid utilised for the biosynthesis of these conjugates seems to be derived not only from the pyridine nucleotide cycle, but also from the de novo synthesis of nicotinic acid mononucleotide. PMID:19820966

244

The synthesis of astaxanthin esters, independent of the formation of cysts, highly correlates with the synthesis of fatty acids in Haematococcus pluvialis.  

The compositions and contents of astaxanthin esters and fatty acids in four types of Haematococcus pluvialis cells were studied by HPLC and GC-MS. Results showed that the synthesis and accumulation of astaxanthin was independent of the formation of cysts, but was highly correlated with the synthesis and accumulation of fatty acids, though it is an well known phenomenon that the accumulation of astaxanthin is usually accompanied by the formation of cyst. The red cysts contain more than 30% of fatty acids, with 81% of the unsaturated fatty acids. Taken together, besides a resource of astaxanthin, H. pluvialis would be a good resource of valuable fatty acids. PMID:19093083

245

A method of synthesis of phosphinic acids on the basis of hypophosphites: VII. Synthesis of pseudo-?-aminobutanoyl peptides and other phosphinic analogs of ?-aminobutyric acid  

A method of synthesis of pseudo-?-aminobutanoyl peptides and other phosphinic analogs of ?-aminobutyric acid from hypophosphites is suggested. Silyl phosphonites formed by in situ addition of bis-(trimethylsilyl) hypophosphite to the corresponding ?-substituted acrylates, styrene, or vinyl phosphonate used as unsaturated components in the synthesis react in situ with N-(?-bromoalkyl)phthalimides by an Arbuzov reaction scheme, affording ?-(phthalimido)alkylphosphinic acids possessing ?-substituted ?-(alkoxycarbonyl)ethyl, ?-phenylethyl, or ?-(diethoxyphosphinoyl)ethyl substituents. Acid hydrolysis of these reaction products gives the target aminophosphinic acids: phosphinic analogs of ?-aminobutyric acid.

246

[Experimental and kinetic modeling of acid/base and redox reactions over oxide catalysts  

The research has involved the characterization of catalyst acidity, [sup 2]D NMR studies of Bronsted acid sites, and kinetic, calorimetric, and spectroscopic studies of methylamine synthesis and related reactions over acid catalysts. Approach of this work was to explore quantitative correlations between factors that control the generation, type, strength, and catalytic properties of acid sites on zeolite catalysts. Microcalorimetry, thermogravimetric analysis, IR spectroscopy, and NMR spectroscopy have provided information about the nature and strength of acid sites in zeolites. This was vital in understanding the catalytic cycles involved in methylamine synthesis and related reactions over zeolite catalysts.

247

[Experimental and kinetic modeling of acid/base and redox reactions over oxide catalysts]. Technical progress report  

The research has involved the characterization of catalyst acidity, {sup 2}D NMR studies of Bronsted acid sites, and kinetic, calorimetric, and spectroscopic studies of methylamine synthesis and related reactions over acid catalysts. Approach of this work was to explore quantitative correlations between factors that control the generation, type, strength, and catalytic properties of acid sites on zeolite catalysts. Microcalorimetry, thermogravimetric analysis, IR spectroscopy, and NMR spectroscopy have provided information about the nature and strength of acid sites in zeolites. This was vital in understanding the catalytic cycles involved in methylamine synthesis and related reactions over zeolite catalysts.

248

Tritium labeled trans-4-N-butyl-2,3- sup 3 H-cyclohexanecarboxylic acid. Preparation of testosterone 17. beta. -trans-4-N-butyl-2,3- sup 3 H-cyclohexanecarboxylate and (4- sup 14 C)-testosterone 17. beta. -trans-4-N-butylcyclohexane carboxylate  

The synthesis of trans-4-n-butyl-2,3-{sup 3}H-cyclohexanecarboxylic acid is described. The title compound was synthesized by catalytic tritiation of 4-n-butylcyclohex-2-enecarboxylic acid, which was obtained form a ''double'' Birch reduction of 4-n-butylbenzoic acid. The trans-acid was isolated from a mixture of cis/trans diastereomers by the selective formation of a thiourea inclusion complex. The title compound was used for the synthesis of the 17{beta}-ester of testosterone. In addition, (4-{sup 14}C)-testosterone was esterfied using unlabelled trans acid. the three radiolabelled compounds will be used in metabolism studies. (author).

249

Designer nucleic acids to probe and program the cell  

Recent advances in nucleic acid sequencing, structural, and computational technologies have resulted in dramatic progress in our understanding of nucleic acid structure and function in the cell. This knowledge, together with the predictable base-pairing of nucleic acids and powerful synthesis and expression capabilities now offers the unique ability to program nucleic acids to form precise 3D architectures with diverse applications in synthetic and cell biology. The unique modularity of structural motifs that include aptamers, DNAzymes, and ribozymes, together with their well-defined construction rules, enables the synthesis of functional higher-order nucleic acid complexes from these subcomponents. As we illustrate here, these highly programmable, smart complexes are increasingly enabling...

250

Thermodynamic and kinetic aspects of surface acidity. Progress report, July 1, 1993--June 30, 1994  

During the past year, the research involved studies of solid acidity, role of acidity in methylamine synthesis reactions, and catalytic cracking of hydrocarbons. Studies were completed of the acidity of ZSM-5 catalysts, in which effects of non-framework aluminum species on acidity of Broensted acid sites associated with the framework were explored. It was found that microcalorimetric studies of ammonia adsorption at 423 K can be used to determine acid strength distributions of high surface area catalysts. Effects of Sn{sup 2+} and Sn{sup 4+} on acid and base sites of alumina were investigated; the former cation neutralizes the acid and base sites. Results of microcalorimetric, infrared spectroscopic, and reaction kinetic studies are being brought together to describe the factors controlling methylamine synthesis and related reactions over acid catalysts. The catalytic cracking studies involved developing a kinetic model for isobutane cracking over acidic Y zeolites.

251

Expanding the Scope of PNA-Encoded Synthesis (PES): Mtt-Protected PNA Fully Orthogonal to Fmoc Chemistry and a Broad Array of Robust Diversity-Generating Reactions  

Abstract Nucleic acid-encoded libraries are emerging as an attractive and highly miniaturized format for the rapid identification of protein ligands. An important criterion in the synthesis of nucleic acid encoded libraries is the scope of reactions that can be used to introduce molecular diversity and devise divergent pathways for diversity-oriented synthesis (DOS). To date, the protecting group strategies that have been used in peptide nucleic acid (PNA) encoded synthesis (PES) have limited the choice of reactions used in the library synthesis to just a few prototypes. Herein, we describe the preparation of PNA monomers with a protecting group combination (Mtt/Boc) that is orthogonal to Fmoc-based synthesis and compatible with a large palette of reactions that have been productively used...

252

Synthesis of deuterium labelled diclofenac with improved isotopic enrichment  

A five-step synthesis of deuterium-labelled diclofenac starting from 2-phenyl[2H5] acetic acid is described. The synthesis prevents deuterium from scrambling during the reaction. It offers the labelled compound with over 99% isotopic enrichment. It also provides a possible alternative route for the synthesis of deuterium-labelled 4prime-hydroxydiclofenac, which is the principal human metabolite of diclofenac. Copyright Copyright 2009 John Wiley & Sons, Ltd.

253

A general solid phase method for the synthesis of sequence independent peptidyl-fluoromethyl ketones.  

We present here a new, general, solid phase strategy for the synthesis of sequence independent peptidyl-fluoromethyl ketones using standard Fmoc peptide chemistry. Our method is based on the synthesis of bifunctional linkers which allows the incorporation of amino acid fluoromethyl ketone unit at the C-terminal end of peptide sequences. Application of this approach for the synthesis of activity based probes for SENPs is also described. PMID:22543859

254

Efficient synthesis of 3-O-thia-cPA and preliminary analysis of its biological activity toward autotaxin.  

The efficient synthesis of 3-O-thia-cPAs (4a-d), sulfur analogues of cyclic phosphatidic acid (cPA), has been achieved. The key step of the synthesis is an intramolecular Arbuzov reaction to construct the cyclic thiophosphate moiety. The present synthetic route enables the synthesis of 4a-d in only four steps from the commercially available glycidol. Preliminary biological experiments showed that 4a-d exhibited a similar inhibitory effect on autotaxin (ATX) as original cPA. PMID:21676615

255

Efficient synthesis of 3-O-thia-cPA and preliminary analysis of its biological activity toward autotaxin  

The efficient synthesis of 3-O-thia-cPAs (4a-d), sulfur analogues of cyclic phosphatidic acid (cPA), has been achieved. The key step of the synthesis is an intramolecular Arbuzov reaction to construct the cyclic thiophosphate moiety. The present synthetic route enables the synthesis of 4a-d in only four steps from the commercially available glycidol. Preliminary biological experiments showed that 4a-d exhibited a similar inhibitory effect on autotaxin (ATX) as original cPA.

256

Microchemical synthesis of the serotonin receptor ligand, /sup 125/I-LSD  

The synthesis and properties of 2-(/sup 125/I)-lysergic acid diethylamide, the first /sup 125/I-labeled serotonin receptor ligand, are described. A novel microsynthesis apparatus was developed for this synthesis. The apparatus employs a micromanipulator and glass micro tools to handle microliter to nanoliter volumes on a microscope stage. This apparatus should be generally useful for the synthesis of radioligands and other compounds when limited amounts of material must be handled in small volumes.

257

Facile one-pot synthesis of polysubstituted quinolines under solvent-free conditions using sulfamic acid as a reusable catalyst  

A facile one-pot synthesis of polysubstituted quinoline derivatives has been demonstrated by using sulfamic acid as a reusable catalyst under solvent-free conditions. The synthetic method provides the basis and advantages of a simple experimental procedure and easy recovery and reuse of catalyst, which makes it a highly practical and environmentally benign pathway for the synthesis of polysubstituted quinolines. Interestingly, this one-pot synthesis could produce the products regioselectively in the presence of dis-symmetrical arylamines. Graphical abstract

258

Synthesis of Hydroxymethylglutathione from Glutathione and L-Serine Catalyzed by Carboxypeptidase Y  

  Hydroxymethylglutathione (?-L-glutamyl-L-cysteinyl-L-serine; hmGSH) occurs in many species belonging to the family Gramineae, but the biosynthetic pathway for hmGSH has not been identified. We found that carboxypeptidase Y (CPY), but not carboxypeptidase A, catalyzed hmGSH synthesis from glutathione and L-serine in vitro at acidic pH. CPY also catalyzed methylglutathione synthesis from glutathione and L-alanine. These findings suggested that a carboxypeptidase-like enzyme may be involved in hmGSH synthesis in vivo.   

259

Synthesis of (E)-9,10,13-Trihydroxy-11-octadecenoic Acids  

Our previous research concerning anti-rice blast fungus substances from the rice plants has led to the isolation of various types of oxygenated fatty acids as exemplified by 9,12,13-trihydroxy C-18 fatty acid. The fatty acids play an important role in the defense of the rice plants against this fungus. For evaluation of biological activity, we needed the isomeric trihydroxy fatty acids. This paper describes the synthesis of four stereoisomers of 9,10,13-trihydroxy fatty acid.   

260

Amino acid derived 1,4-dialkyl substituted imidazolones  

A general method for synthesis of 1,4-substituted imidazolones from amino acids on solid support or in solution has been developed. Amino acid derived 3-Boc-(1,3)-oxazinane (Box) protected amino aldehyde building blocks were coupled through urea bonds to the amino terminal of dipeptides or amino acids. Upon acidic release, the aldehyde instantaneously formed the cyclic N-carbamyliminium ion, which rearranged to the corresponding imidazolone. Under strongly acidic conditions the imidazolones acted as nuclophiles in the Pictet-Spengler reaction.

 
 
 
 
261

Synthesis of 2,5-dihydroxy (carboxy-/sup 14/C) benzoic acid for electrochemical protein modification  

The synthesis of 2,5-dihydroxy(carboxy-/sup 14/C)benzoic acid (gentisic acid) is described. The procedure utilized (carboxy-/sup 14/C)salicylic acid as a starting material. Salicylic acid was converted to gentisic acid using potassium persulfate hydroxylation. The mixture of hydroxylation products in this reaction was easily separated by UV-visualized quartz column chromatography to obtain the desired isomer in high purity (overall yield of 38%). This procedure may be used for micro and semimicro preparation of the title compound.

262

Atlantic Cod Trypsin-Catalyzed Peptide Synthesis with Inverse Substrates as Acyl Donor Components  

Atlantic cod trypsin-catalyzed peptide synthesis has been studied by using p-amidino- and p-guanidinophenyl esters of N-(tert-butyloxycarbonyl)amino acid as acyl donor components. The reaction temperature was optimized at 0 °C. The method was shown to be successful as effectively for synthesizing the peptide and useful for preparing dipeptide between D-amino acid with D-amino acid and ?-amino acid with ?-amino acid, respectively. The enzymatic hydrolysis of the resulting products was negligible.   

263

Pd-Catalyzed C?H Oxygenation with TFA/TFAA: Expedient Access to Oxygen-Containing Heterocycles and Late-Stage Drug Modification.  

Acid brings the oxygen: A general method for palladium catalyzed C?H oxygenation has been developed for the facile synthesis of a wide range of functionalized phenols with readily available aryl ketones, benzoates, benzamides, acetanilides, and sulfonamides. A trifluoroacetic acid/trifluoroacetic acid anhydride solvent system serves as the oxygen source and is the critical factor for C?H activation. PMID:23161485

264

Aspergillus oryzae laeA Regulates Kojic Acid Synthesis Genes  

Kojic acid synthesis genes regulation was investigated in Aspergillus oryzae. Our results indicate that kojic acid production was lost in the laeA disruption strain, but was recovered in the LaeA complement strain. Real-time PCR also confirmed that expression of kojic acid biosynthesis genes decreased in the laeA disruption strain, indicating that these genes are under the control of LaeA.   

265

Effects of Pyrazinamide on Fatty Acid Synthesis by Whole Mycobacterial Cells and Purified Fatty Acid Synthase I  

The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyraz...

266

Thematic Review Series: Glycerolipids. Acyltransferases in bacterial glycerophospholipid synthesis*  

Phospholipid biosynthesis is a vital facet of bacterial physiology that begins with the synthesis of the fatty acids by a soluble type II fatty acid synthase. The bacterial glycerol-phosphate acyltransferases utilize the completed fatty acid chains to form the first membrane phospholipid and thus pl...

267

Synthesis of Hydroxamic Acids by Activation of Carboxylic Acids with N,N'-Carbonyldiimidazole: Exploring the Efficiency of the Method  

Activation of carboxylic acids with N,N'-carbonyldiimidazole followed by the reaction with anhydrous or aqueous hydroxylamine hydrochloride was demonstrated to be an operationally simple method for the synthesis of hydroxamic acids in good yield and high purity after aqueous workup. The potential by-product, N,O-diacylhydroxylamine, is cleanly transformed to hydroxamic acid in these reaction conditions.

268

SOLVENT FREE POLYMERIZATION OF CITRIC ACID AND D-SORBITOL  

Copolymers of citric acid and D-sorbitol have been synthesized with molar ratios of citric acid to D-sorbitol from 1/1 to 6/1, using a solvent free vacuum oven synthesis. The extent of reaction was followed by monitoring the residual acid content of the system. As expected, the reaction occurs muc...

269

Improved Preparation of an Amino Acid Type Poly(Ethylene Glycol) Derivative  

An amino acid type poly(ethylene glycol) is a useful tool for preparation of a bi- or multivalent poly(ethylene glycol) hybrid of bioactive peptides, but synthesis is problematic. The amino acid type poly(ethylene glycol) was prepared from poly(oxyethylene)diglycolic acid followed by introduction of a fluorenylmethyloxycarbonyl group. The resulting product could be purified easily by LH-20 column chromatography and HPLC.   

270

Preparation of Layered Double Hydroxide–Organic Intercalation Compounds by Solid–Solid Reactions  

Layered double hydroxide–organic intercalation compounds were successfully synthesized by the solid–state reactions of magnesium hydroxide, aluminum hydroxide, and the guest species (p-toluenesulfonic acid, malonic acid, and oxalic acid) at room temperature. The present very simple synthesis is potentially applicable to a variety of layered double hydroxide–organic intercalation compounds.   

271

Selenothiophosphinic Acid Salts: Efficient Synthesis, Structure and Reactivity  

An efficient synthesis of selenothiophosphinic acid salts is achieved by reacting selenothiophosphinic acid S-(2-trimethylsilyl)ethyl esters with ammonium or alkali metal fluorides. The X-ray structure analysis of the potassium 18-crown-6 selenothiophosphinic acid salt shows that the salt is monomeric. Alkylation of the salts proceeds at the selenium atom whereas acylation occurs at the sulfur atom.   

272

Oxy acids of halogens HOHal  

The key methods for the synthesis of the acids HOF, HOCl, HOBr and HOI are considered. The results of investigations of the structures and properties of these acids are described. Possible participation of the HOHal acids in the destruction of stratospheric ozone is discussed.

273

Microwave-assisted chemoselective copper-catalyzed amination of o-chloro and o-bromobenzoic acids using aromatic amines under solvent free conditions  

Copper-catalyzed synthesis of N-aryl anthranilic acid derivatives using effective amination of 2-chloro and 2-bromobenzoic acid under microwave irradiation is reported. Some of the advantages of this method are high chemoselectivity, short reaction times, ease of work up procedure and elimination of the need for acid protection.

274

A Bacillus subtilis Gene Induced by Cold Shock Encodes a Membrane Phospholipid Desaturase  

Bacillus subtilis grown at 37°C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs). However, when cultures growing at 37°C are transferred to 20°C, UFA synthesis is induced. We report the identification and characterization of the gene encoding the fatty acid desatu...

275

METATHESIS OF UNSATURATED FATTY ACIDS: SYNTHESIS OF LONG CHAIN UNSATURATED ALPHA, OMEGA-DICARBOXYLIC ACIDS  

The self-metathesis of readily available monounsaturated fatty acids has the potential of being an important pathway for the synthesis of symmetrical long-chain unsaturated-alpha, omega-dicarboxylic acids (C18-C26). Previous studies on the self-metathesis of monounsaturated fatty acid esters using ...

276

Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.  

Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

277

Syntheses of dihydroartemisinic acid and dihydro-epi-deoxyarteannuin B incorporating a stable isotope label at the 15-position for studies into the biosynthesis of artemisinin  

[15-13C2H3]-Dihydroartemisinic acid (3a) and [15-13CH3]-dihydro-epi-deoxyarteannuin B (7b), intended for evaluation in vivo as biosynthetic precursors to artemisinin, have been obtained from a reconstructive synthesis. The decalenone acid 8 from acid degradation of artemisinin (1) serves as a common...

278

Primary structures of the precursor and mature forms of stearoyl-acyl carrier protein desaturase from safflower embryos and requirement of ferredoxin for enzyme activity.  

Stearoyl-acyl carrier protein (ACP) desaturase (EC 1.14.99.6) catalyzes the principal conversion of saturated fatty acids to unsaturated fatty acids in the synthesis of vegetable oils. Stearoyl-ACP desaturase was purified from developing embryos of safflower seed, and extensive amino acid sequence w...

279

Synthesis of Several Types of Bridged Nucleic Acids  

A number of bridged nucleic acids with conformationally locked sugar moiety were synthesized from the readily accessible sugar derivatives. The conformations of the sugar moiety of the bridged nucleic acids (BNAs) are locked to either N-type or S-type sugar puckering. This article summarizes the synthesis of these nucleic acid analogues.     Fullsize Image

280

GENETIC MANIPULATION OF ALFALFA FOR ORGANIC ACID SYNTHESIS AND ALUMINUM TOLERANCE  

Acid soils are a severe impediment to crop production in many parts of the world. In mineral soils, aluminum (Al) becomes phytotoxic at acid pH, inhibiting root growth and nutrient acquisition. Engineering plants for synthesis and secretion of organic acids from roots is a highly promising strategy ...

 
 
 
 
281

Synthesis of the novel ?-aminophosphoryl compounds and their acid-base properties and membrane-transport abilities towards carboxylic acids  

The highly efficient synthesis of ?-aminophosphoryl compounds with one and two ethylphosphoryl groups was performed by the addition of amines to the vinylphosphoryl compounds in water as a solvent. The acid-base properties and membrane-transport abilities of the target compounds towards carboxylic acids were studied. Selectivity towards acetic acid was revealed.

282

A chemical procedure for reprocessing of poly(ethylene terephthalate) waste  

A procedure was developed for degradation of poly(ethylene terephthalate) waste with water to the starting monomers. The possibility of preparing diethyl terephthalate without a catalyst in a rocking cylindrical pressure vessel with the rocking axis passing through the geometric center was examined.

283

Proton-transfer compounds of isonipecotamide with the aromatic dicarboxylic acids 4-nitrophthalic, 4,5-dichlorophthalic, 5-nitroisophthalic and terephthalic acid  

The structures of the 1:1 proton-transfer compounds of isonipecotamide (piperidine-4-carboxamide) with 4-nitrophthalic acid [4-carbamoylpiperidinium 2-carboxy-4-nitrobenzoate, C6H13N2O8+C8H4O6-, (I)], 4,5-dichlorophthalic acid [4-carbamoylpiperidinium 2-carboxy-4,5-dichlorobenzoate, C6H13N2O8+C8H3Cl2O4-, (II)] and 5-nitroisophthalic acid [4-carbamoylpiperidinium 3-carboxy-5-nitrobenzoate, C6H13N2O8+C8H4O6-, (III)], as well as the 2:1 compound with terephthalic acid [bis(4-carbamoylpiperidinium) benzene-1,2-dicarboxylate dihydrate, 2C6H13N2O8+C8H4O42-2H2O, (IV)], have been determined at 200-K. All salts form hydrogen-bonded structures, viz. one-dimensional in (II) and three-dimensional in (I), (III) and (IV). In (I) and (III), the centrosymmetric R22(8) cyclic amide-amide association is fou...

284

The effect of diet on tumor necrosis factor stimulation of hepatic lipogenesis  

In this study, we determined the effects of tumor necrosis factor (TNF) on serum lipid levels and hepatic lipid synthesis in animals whose diets and feeding conditions were varied to induce changes in baseline serum lipid levels and/or rates of hepatic lipid synthesis. In animals studied at both the nadir and peak of the diurnal cycle of hepatic lipid synthesis, TNF acutely increases serum triglyceride levels, stimulates hepatic fatty acid synthesis, and increases the quantity of newly synthesized fatty acids found in the serum. Similarly, in animals ingesting either high-sucrose or cholesterol-enriched diets, TNF induces the characteristic rapid increase in serum triglyceride levels, hepatic fatty acid synthesis, and quantity of labeled fatty acids in the serum. In animals fed a diet high in triglycerides, using either corn oil or lard, TNF stimulates hepatic fatty acid synthesis and increases the quantity of newly synthesized fatty acids in the serum, but serum triglyceride levels do not change. However, TNF inhibits gastric emptying, which results in a marked decrease in fat absorption in TNF-treated animals. It is likely that a decrease in the dietary contribution to serum triglyceride levels during high-triglyceride feeding counterbalances the increased hepatic contribution induced by TNF treatment. In animals fasted before TNF administration there was no acute change in either serum lipid levels, hepatic fatty acid synthesis, or the quantity of labeled fatty acids in the serum. Thus, TNF stimulates hepatic fatty acid synthesis and increases serum triglyceride levels under many diverse dietary conditions, suggesting that there is a strong linkage between the immune system and lipid metabolism that is independent of most dietary manipulations and may be of fundamental importance in the body's response to infection.

285

Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man  

In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

286

An Efficient Synthesis of C2-Symmetric Chiral Binaphthyl Ketone Catalysts  

An efficient synthesis of C2-symmetric chiral binaphthyl ketones 1a and b, effective catalysts for asymmetric epoxidation, is reported. The key features of this synthesis are Co(salen)-catalyzed macrolactonization of racemic 1,1'-binaphthyl-2,2'-dicarboxylic acid monoglycidyl esters 3a and b and lipase-catalyzed enantioselective acylation of resulting 11-membered cyclic binaphthyl alcohols 4a and b.   

287

Native chemical thioesterification: synthesis of peptide and protein thioesters through an N?S acyl shift  

The total chemical synthesis of a protein provides atomic-level control over its covalent structure, however polypeptides prepared by solid phase peptide synthesis are limited to approximately fifty amino acid residues. This limitation has been overcome by 'Native Chemical Ligation‘, which involves ...

288

Facile chemical synthesis and equilibrium unfolding properties of CopG  

The 45-amino acid polypeptide chain of the homodimeric transcriptional repressor, CopG, was chemically synthesized by stepwise solid phase peptide synthesis (SPPS) using a protocol based on Boc-chemistry. The product obtained from the synthesis was readily purified by reversed-phase HPLC to give a g...

289

Asymmetric Construction of Binaphthyl by the Chiral Diether-Mediated Conjugate Addition of Naphthyllithium to Naphthalenecarboxylic Acid 2,6-Di-t-butyl-4-methoxyphenyl Ester  

Two ways for the synthesis of binaphthyl were examined based on a chiral ligand-mediated asymmetric conjugate addition of 1-naphthyllithium to naththalene-2-carboxylic acid 2,6-di-t-butyl-4-methoxyphenyl esters. The one pot method by conjugate addition-elimination gave a relatively higher enantioselectivity than the two step synthesis based on addition and subsequent oxidative aromatization.   

290

Chemical synthesis and spontaneous folding of a multidomain protein: Anticoagulant microprotein S  

Because of recent high-yield native ligation techniques, chemical synthesis of larger multidomain bioactive proteins is rapidly coming within reach. Here we describe the total chemical synthesis of a designed “microprotein S,” comprising the ?-carboxyglutamic acid-rich module, the thrombin-sensi...

291

Meso-SiO2–C12EO10OH–CF3SO3H — a novel proton-conducting solid electrolyte  

This paper describes the synthesis and characterization of a novel mesostructured solid electrolyte composite material, denoted meso-SiO2-C12EO10OH-CF3SO3H. A lyotropic non-ionic surfactant-triflic acid-silicate liquid crystal is used as a supramolecular template for a one-pot synthesis of the mater...

292

Endogenous surfactant turnover in preterm infants measured with stable isotopes  

We studied surfactant synthesis and turnover in vivo in preterm infants using the stable isotope [U-13C]glucose, as a precursor for the synthesis of palmitic acid in surfactant phosphatidylcholine (PC). Six preterm infants (birth weight, 916 +/- 244 g; gestational age, ...

293

Total synthesis of (-)-isoschizogamine.  

A first asymmetric total synthesis of (-)-isoschizogamine has been accomplished. Our synthesis features the facile construction of the carbon framework of the natural product through a Wagner-Meerwein rearrangement, a tandem metathesis, a stereoselective rhodium-mediated 1,4-addition of an arylboronic acid, and a ring-closing metathesis via a hemiaminal ether. PMID:22779733

294

Isolation and characterization of Azospirillum brasilense loci that correct Rhizobium meliloti exoB and exoC mutations.  

The occurrence in Azospirillum brasilense of genes that code for exopolysaccharide (EPS) synthesis was investigated through complementation studies of Rhizobium meliloti Exo- mutants. These mutants are deficient in the synthesis of the major acidic EPS of Rhizobium species and form empty, non-nitrog...

295

Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent  

Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

296

Streptomycin Action: Greater Inhibition of Escherichia coli Ribosome Function with Exogenous than with Endogenous Messenger Ribonucleic Acid  

Inhibition of protein synthesis by streptomycin was tested in extracts from a strain of Escherichia coli sensitive to streptomycin. Three kinds of messenger ribonucleic acid (RNA) were employed: endogenous cellular RNA, extracted cellular RNA, and phage R17 RNA. Protein synthesis directed by extract...

297

An efficient synthesis of flavans from salicylaldehyde and acetophenone derivatives  

An efficient total synthesis of flavans from the reactions of salicylaldehyde and acetophenone derivatives is reported. The synthesis involves preparation of chalcones through an aldol reaction followed by reduction of both the double bond and the ketone using NaBH4 and an acetic acid mediated cyclization. Methoxy groups on the aromatic rings did not affect significantly the yields of the procedure.

298

THE PDZ PROTEIN-BINDING DOMAIN OF GLUT1 AFFECTS DYNAMICS OF VESICULAR TARGETING IN MAMMARY EPITHELIAL CELLS  

BACKGROUND: Lactose synthesis is necessary for milk secretion. Glucose transport supplies substrate for lactose synthesis. The glucose transporter GLUT1 is intracellular in lactating mammary epithelial (ME) cells. The terminal four amino acids of GLUT1 constitute a PDZ protein-binding domain. Protei...

299

Acetyl xylan esterase of Aspergillus ficcum catalyzed the synthesis of peracetic acid from ethyl acetate and hydrogen peroxide  

Recombinant acetyl xylan esterase (rAXE) of Aspergillus ficcum catalyzed the synthesis of peracetic acid (PAA) from ethyl acetate and hydrogen peroxide. Ten micrograms of rAXE catalyzed the synthesis of 1.34mM of PAA, which can be used for the pretreatment of cellulosic biomass in situ.

300

O-nitroso aldol synthesis: Catalytic enantioselective route to ?-aminooxy carbonyl compounds via enamine intermediate  

The approach using pyrrolidine enamine as substrate has been studied for this synthesis, and an important catalyst structural feature has been developed. After survey of pyrrolidine-based Brønsted acid catalyst, tetrazole catalyst (3f) was found to be optimal in synthesis of aminooxy carbonyl compou...

 
 
 
 
301

Chemically modified fatty acid methyl esters: their potential for use as lubrication fluids and surfactants  

A review of recent developments in the synthesis and characterization of lubrication fluids and surfactants from methyl oleate. The synthesis of materials made using an epoxidation route is the focus. This versatile method of chemical modification of fatty acid methyl esters improves their oxidati...

302

Iodine Transfer Copolymerization of Vinylidene Fluoride and a-Trifluoromethacrylic Acid in Emulsion Process Without Any Surfactants  

The synthesis of poly(VDF-co-TFMA) copolymers (where VDF and TFMA stand for vinylidene fluoride and a-trifluoromethacrylic acid, respectively) by iodine transfer polymerization without any surfactant is presented. First, the synthesis and the control of the copolymerization of VDF and TFMA were inve...

303

REGULATION OF CARDIAC AND SKELETAL MUSCLE PROTEIN SYNTHESIS BY INDIVIDUAL BRANCHED-CHAIN AMINO ACIDS IN NEONATAL PIGS  

Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

304

Solid-phase peptide synthesis and solid-state NMR spectroscopy of [Ala3-15N][Val1]gramicidin A.  

[Ala3-15N][Val1]Gramicidin A has been prepared by solid-phase peptide synthesis and studied by solid-state 15N nuclear magnetic resonance spectroscopy. The synthesis of desformyl[Ala3-15N][Val1]gramicidin A employed N-hydroxysuccinimide esters of 9-fluorenylmethoxycarbonyl-N alpha-amino acids and co...

305

Synthesis of mycophenolate mofetil-[{sup 14}C], RS-61443-{sup 14}C  

Synthesis of the potent immunosuppressive agent, mycophenolate mofetil labelled with carbon-14 is described. Methoxyethoxymethyl (MEM) protected mycophenolate norbromide was prepared from unlabelled mycophenolic acid using a modified Hunsdiecker reaction. A three step synthesis furnished the title compound, having a specific activity of 53.8 mCi/mmol, in 49.5% overall yield from K{sup 14}CN. (author).

306

On the Stereoselectivity of Asymmetric Strecker Synthesis in a Cyclohexane System: Synthesis of Optically Active cis- and trans-1-Amino-2-hydroxycyclohexane-1-carboxylic Acids  

Stereoselective synthesis of both optically active cis- and trans-1-amino-2-hydroxycyclohexane-1-carboxylic acids (Ahhs) 1a and 1b was accomplished by an asymmetric version of the Strecker synthesis. Stereochemical aspects of their chiral induction processes are investigated.   

307

Síntese do isobutileno e seu emprego em reações de esterificação: propostas de aulas práticas de química orgânica para a graduação/ Synthesis and esterification reactions of isobutylene: an undergratuate organic chemistry experiment  

Abstract in english An experiment for the synthesis of isobutylene from tert-butanol dehydratation using oxalic acid as catalyst, followed by preparations of tert-butyl benzoate and tert-butyl cinnamate is described. The synthesis are simple, requiring two periods of 4 hours and are suitable for undergraduate organic chemistry experimental courses.

308

Total Synthesis of Siastatin B and Its Enantiomer Using Carbohydrate as a Chiral Educt  

The enantioselective synthesis of siastatin B, an inhibitor of neuraminidase and its antipode from D-ribono-?-lactone has stereospecifically been achieved. The total synthesis elucidated the absolute configuration of siastatin B as (3S,4S,5R,6R)-6-acetamido-4,5-dihydroxy-3-piperidinecarboxylic acid.   

309

Cutaneous barrier perturbation stimulates cytokine production in the epidermis of mice.  

The disruption of the cutaneous permeability barrier results in metabolic events that ultimately restore barrier function. These include increased epidermal sterol, fatty acid, and sphingolipid synthesis, as well as increased epidermal DNA synthesis. Because tumor necrosis factor (TNF) and other cyt...

310

Barrier function regulates epidermal DNA synthesis.  

We examined the possibility that the cutaneous permeability barrier regulates epidermal DNA synthesis in two acute and two chronic models of barrier perturbation. In animals treated topically with acetone, DNA synthesis is increased 102%, in tape-stripped animals 127%, in essential fatty acid defici...

311

Synthesis of the Epimer of Pericosine B from (?)-Quinic Acid  

Synthesis of the epimer of pericosine B from (?)-quinic acid was achieved. This synthesis involves some regioselective and stereoselective processes. The desired product showed lower cytotoxic activity in comparison with natural pericosine B against the P388 leukemia cell line. The result implies that the stereocenter of C-6 in natural pericosine B plays an important role in this activity.   

312

One-Pot Synthesis of Simple Alkaloids: 2,3-Polymethylene-4(3H)-quinazolinones, Luotonin A, Tryptanthrin, and Rutaecarpine  

One-pot synthesis of various 2,3-polymethylene-4(3H)-quinazolinones from anthranilic acid, corresponding lactam and SOCl2 is described, which can be applicable to the synthesis of simple 4(3H)-quinazolinone-derived alkaloids, such as luotonin A, tryptanthrin, and rutaecarpine.   

313

The mitogenic activities of phosphatidate are acyl-chain-length dependent and calcium independent in C3H/10T1/2 cells.  

Phosphatidates (PA or phosphatidic acid) were shown to have mitogenic properties, including the stimulation of DNA synthesis and calcium mobilization in C3H/10T1/2 cells. Their continuous presence for a minimum of 7 h induced DNA synthesis with kinetics similar to that observed when 10% fetal bovine...

314

Regulation of Cell Division in Escherichia coli  

The rate of cell division was measured in cultures of Escherichia coli B/r strain after periods of partial or complete inhibition of deoxyribonucleic acid (DNA) synthesis. The rate of DNA synthesis was temporarily decreased by removing thymidine from the growth medium or replacing it with 5-bromoura...

315

Solvent-free protocol for amide bond formation via trapping of nascent phosphazenes with carboxylic acids  

A solvent-free synthesis of amides via the coupling of phosphazenes with carboxylic acids is reported. Increasing the rate of heating either by microwave irradiation or conventional heating results in multifold increase in the rate of amide bond formation. Synthesis of a library of amides including a potent antitumour candidate has been accomplished.

316

A single bolus meal elicits different regulation of protein synthesis and mTOR signaling in visceral tissues and skeletal muscle of newborn pigs  

Neonates, a highly anabolic population, use dietary amino acids efficiently for growth because they can increase protein synthesis in response to feeding to a greater extent than mature animals. The enhancement of protein synthesis after a meal in neonatal pigs is well known, but the time course of ...

317

Enantioselective synthesis of 2-isoxazolines by a one-flask conjugate addition/oxime-transfer process.  

Enantioselective isoxazoline synthesis: A combination of 1) a catalytic enantioselective conjugate addition of oximes to alpha,beta-unsaturated aldehydes and 2) an acid-catalyzed intramolecular oxime-transfer reaction lead to the first asymmetric synthesis of 3-unsubstituted 2-isoxazolines (see scheme). PMID:19263445

318

Synthesis of Phosphatidylcholine Having a Very Long Chain Polyunsaturated Fatty Acid  

A phosphatidylcholine 9 bearing icosadienoyl and docosahexaenoyl groups at the 1- and 2-positions respectively was synthesized. The synthetic route involves carbon chain elongation of linoleic acid via malonic ester synthesis, preparation of lyso-phosphatidylcholine via lipase-catalyzed mon-acylation of 2-O-methoxyethoxymethylglycerol and phosphodiester synthesis, and finally DCC-mediated esterification.   

319

Nuclear medicine program progress report for quarter ending December 31, 1991  

This report presents information on (1) a new improved synthesis of carrier-free rhenium-188-labeled Re(V) dimercaptosuccinic acid (DMSA) complex as a potential therapeutic agent for treatment of thyroid medullary carcinoma; and (2) the synthesis and evaluation of a series of iodine-125-labeled analogues of altanserine for imaging of serotonin receptors.

320

Mutations Suppressing the Loss of DegQ Function in Bacillus subtilis (natto) Poly-?-Glutamate Synthesis ? †  

The degQ gene of Bacillus subtilis (natto), encoding a small peptide of 46 amino acids, is essential for the synthesis of extracellular poly-gamma-glutamate (?PGA). To elucidate the role of DegQ in ?PGA synthesis, we knocked out the degQ gene in Bacillus subtilis (natto) and screened for suppressor ...

 
 
 
 
321

Simple synthesis of deuterium and 13C labeled trifluoromethyl phenyldiazirine derivatives as stable isotope tags for mass spectrometry.  

The synthesis of trifluoromethyl diazirine with a stable isotope tag is reported. We found that both Friedel-Crafts acylation and reduction of aryl carbonyl to methylene, using commercially available stable-isotope reagents, were utilized for the synthesis of diazirinyl fatty acid derivatives. The stable isotope labeled diazirine may be valuable for identifying binding sites by mass spectrometry. PMID:15516771

322

Simple Synthesis of Deuterium and 13C Labeled Trifluoromethyl Phenyldiazirine Derivatives as Stable Isotope Tags for Mass Spectrometry  

The synthesis of trifluoromethyl diazirine with a stable isotope tag is reported. We found that both Friedel–Crafts acylation and reduction of aryl carbonyl to methylene, using commercially available stable-isotope reagents, were utilized for the synthesis of diazirinyl fatty acid derivatives. The stable isotope labeled diazirine may be valuable for identifying binding sites by mass spectrometry.   

323

Effect of ppGpp on Escherichia coli Cyclopropane Fatty Acid Synthesis Is Mediated through the RpoS Sigma Factor (?S)  

Strains of Escherichia coli carrying mutations at the relA locus are deficient in cyclopropane fatty acid (CFA) synthesis, a phospholipid modification that occurs as cultures enter stationary phase. RelA protein catalyzes the synthesis of guanosine-3?,5?-bisdiphosphate (ppGpp); therefore, ppGpp was ...

324

Divergent synthetic approach to 6''-modified ?-GalCer analogues.  

A synthetic approach is presented for the synthesis of galacturonic acid and D-fucosyl modified KRN7000. The approach allows for late-stage functionalisation of both the sugar 6''-OH and the sphingosine amino groups, which enables convenient synthesis of promising 6''-modified KRN7000 analogues. PMID:22042483

325

Effect of mutations in global regulator genes grrS and rpoS on synthesis of phosphatases in Serratia plymuthica  

The participation of global regulators GrrS (sensor kinase GacA/GacS-like regulatory system) and sigma S subunit of RNA polymerase in the control of phosphatase synthesis in a soil bacterium Serratia plymuthica was shown. In cells of null mutants for genes grrS and rpoS synthesis of acid and alkaline phosphatases was markedly decreased.

326

[Influence of mutations in global regulator genes grrS and rpoS on synthesis of phosphatases in Serratia plymuthica].  

The participation of global regulators GrrS (sensor kinase GacA/GacS-like regulatory system) and sigma S subunit of RNA polymerase in the control of phosphatase synthesis in a soil bacterium Serratia plymuthica was shown. In cells of null mutants for genes grrS and rpoS synthesis of low-acidic and alkaline phosphatases was markedly decreased. PMID:18592699

327

Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria  

Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

328

Decreased nucleic acid synthesis in low-dose-irradiated lymphocytes--effect of TCGF addition  

Flow cytometry was used to evaluate nucleic acid synthesis in irradiated mixed lymphocyte cultures (MLC) compared to nonirradiated control cultures. Two staining methods were used (propidium iodide and acridine orange). We showed that RNA and DNA synthesis are retarded in MLC receiving 0.2 Gy. This effect was reversed by lymphocyte growth factor.

329

Proton-conducting polymer electrolyte membranes based on fluoropolymers incorporating perfluorovinyl ether sulfonic acids and fluoroalkenes Synthesis and characterizations  

This paper presents the synthesis of new polymer electrolyte membranes based on fluoropolymers incorporating aromatic perfluorovinyl ether sulfonic acids. A novel synthetic route describing the preparation of perfluorovinyl ether monomer containing sulfonic functionalities, 4-[(alpha,beta,beta-trifl...

330

Effects of Resin Swelling and Substitution on Solid Phase Synthesis. (Reannouncement with New Availability Information).  

Resins sold by several companies were examined for swelling, uniformity of beads, and substitution in the case of resins sold with the first amino acid attached. Effects of resin swelling, uniformity, and substitution on the solid phase synthesis of long,...

331

Rapid synthesis of oligodeoxyribonucleotides. III. Effect of added carboxylate ion on the efficiency of internucleotide bond formation. Solid-phase synthesis of the dodecanucleotide, d(pT-A-A-C-T-G-C-T-C-A-C-T).  

In solid-phase oligodeoxyribonucleotide synthesis the addition of benzoic acid to internucleotide phosphodiester bond-forming reactions lowers coupling yields by far greater amount than anticipated on a simple nucleotide-carboxylate molar ratio. High coupling yields were consistently obtained in syn...

332

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.  

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). ...

333

Facile synthesis of colorimetric histone deacetylase substrates.  

Here we report a simple procedure for generating colorimetric histone deacetylase (HDAC) substrates by solid-phase peptide synthesis based on racemization-free couplings of amino acid chlorides. We demonstrate the applicability of these substrates in HDAC assays. PMID:22902974

334

Maximization of fructose esters synthesis by response surface methodology  

Enzymatic synthesis of fructose fatty acide sterwasper formed inorganic solventmedia, using apurified lipase from Candida antartica B immobilizedinacrylicresin. Response sur face methodology with a central composit erotatable design based on five levels was implemented to optimize three experimental...

335

Synthesis of 3,4-dihydropyrimidinones in the presence of water under solvent free conditions using conventional heating, microwave irradiation/ultrasound  

An efficient, simple, and environmentally clean synthesis of 3,4-dihydropyrimidinones in excellent yields in the presence of water without additional solvent/acid catalyst under conventional heating, microwave irradiation/ultrasound is reported.

336

Dr. Michael P Callahan - Sciences and Exploration Directorate - Nasa  

... Return Samples, Properties of Nucleobases and Other Nitrogen Heterocycles ... Primordial synthesis of amines and amino acids in a 1958 Miller H2S-rich spark ... Isomer discrimination of polycyclic aromatic hydrocarbons in the Murchison ...

337

Bio - Dr. Michael P Callahan  

... Return Samples, Properties of Nucleobases and Other Nitrogen Heterocycles ... Primordial synthesis of amines and amino acids in a 1958 Miller H2S-rich spark ... Isomer discrimination of polycyclic aromatic hydrocarbons in the Murchison ...

338

Novel nanodispersed coal liquefaction catalysts: Molecular design via microemulsion-based synthesis. Technical progress report, October--December 1993  

Three different synthesis protocols were used to synthesize nanosize molybdenum sulfide particles in the microemulsion system polyoxyethylene(5)nonylphenyl ether (NP-5)/cyclohexane/water: (a) acid-solubilized microemulsion plus tetrathiomolybdate (ASMPT), (b) tetrathiomolybdate-solubilized microemulsion plus acid (TSMPA) and (c) microemulsion plus microemulsion (MPM), i.e., acid-solubilized microemulsion plus tetrathiomolybdate-solubilized microemulsion. The particle size was found to depend on the synthesis method, especially at water-to-surfactant molar ratios (R) greater than 2.5. At R=3.5-4.5, the average particle size increased according to the synthesis method in the order: ASMPT < MPM < TSMPA. Furthermore, for each synthesis protocol, the average particle diameter increased with the water-to-surfactant molar ratio (R). These trends are rationalized by considering: (a) the increase in the rate of exchange of materials between the inverse micelles as R is increased, and (b) the different effects of the electrolytes (i.e., sulfuric acid and ammonium tetrathiomolybdate plus sodium hydroxide) on microemulsion stability.

339

A Simple and Highly Practical Oxidation of Primary Alcohols to Acids Mediated by 2,2,6,6-Tetramethyl-1-piperidinyloxy (TEMPO)  

Primary alcohols were quantitatively oxidized in one-pot to acids via 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) mediated oxidation. The reported method is simple and suitable for large scale synthesis.   

340

Synthesis of (±)-Sundiversifolide Based on Lewis Acid-Mediated Claisen Rearrangement  

A new and concise synthesis of (±)-sundiversifolide (1), an allelopathic bisnor-sesquiterpene lactone isolated from germinating sunflower (Helianthus annuus L.) seeds, was achieved by employing Lewis acid-mediated Claisen rearrangement as the key step.   

 
 
 
 
341

Method for synthesis of 1-adamantyl esters of unsaturated acids  

New method for synthesis of adamantyl esters of acrylic, methacrylic, and cinnamic acids was developed. The reactions carried out under mild conditions in the absence of catalysts provide a high yield.

342

Novel One-Pot Synthesis of New Oxindole Derivatives Catalyzed by PTSA  

The one-pot synthesis of spirooxindoles via three-component reaction of urea, isatin, and 1,3-dicarbonyl compounds in the presence of a catalytic amount of p-toluenesulfonic acid in acetonitrile has been carried out. [image omitted

343

PTSA-catalyzed tandem cyclization protocol for the stereoselective total synthesis of obolactone  

Stereoselective total synthesis of obolactone by the Bronsted acid (PTSA) mediated tandem cyclization of the appropriately substituted diketone in one-pot in a highly selective and efficient manner is reported.

344

Repetitive Two-step Method for Oligoarene Synthesis through Rapid Cross-coupling of Hydroxyphenylboronic Acids and Anhydrides  

A two-step Suzuki–Miyaura coupling–triflation procedure, which features the use of hydroxyphenylboronic acids or anhydrides in the palladium-catalyzed cross-coupling step, has been developed for the synthesis of oligoarenes.   

345

Efficient Synthesis of Fused 1,2,3-Triazolo-?-lactams Using Huisgen [3 + 2] Dipolar Cycloaddition “Click-chemistry” in Water  

A general approach for the quick synthesis of various 1,2,3-triazolo-?-lactams has been described, which involves the Huisgen [3 + 2] dipolar cycloaddition of azides derived from different amino acids with dimethyl acetylenedicarboxylate in water followed by cyclization.   

346

First Synthesis of (±)-Basidifferquinone C, an Inducer for Fruiting-Body Formation in Polyporus arcularius  

Basidifferquinones, isolated from Streptomyces sp., are potent inducers of fruiting-body formation in the basidiomycete, Polyporus arcularius. The first synthesis of (±)-basidifferquinone C was accomplished by starting from 3,5-dihydroxy-2-naphthoic acid.   

347

Mycophenolate mofetil: safety and efficacy in the prophylaxis of acute kidney transplantation rejection  

Mycophenolate mofetil (MMF), a prodrug of mycophenolic acid (MPA), is an inhibitor of inosine monophosphate dehydrogenase (IMPDH). It preferentially inhibits denovo pathway of guanosine nucleotide synthesis in T and B-lymphocytes and prevents their proliferation, thereby suppresses both cell mediate...

348

Alternative splicing and gene duplication differentially shaped the regulation of isochorismate synthase in Populus and Arabidopsis  

Isochorismate synthase (ICS) converts chorismate to isochorismate for the biosynthesis of phylloquinone, an essential cofactor for photosynthetic electron transport. ICS is also required for salicylic acid (SA) synthesis during Arabidopsis defense. In several other species, including Populus, SA is ...

349

Modular Synthesis of Planar-Chiral para-Substituted Paracyclophanes by Double Suzuki Coupling  

Abstract The first synthesis of enantiomerically pure 4,7-paracyclophane ditriflate starting from a quinone was reported. Using this molecule, mono- or dicoupling with boronic acids delivered enantiomerically pure arylparacyclophanes.

350

"1  

When the speed of fatty acid synthesis must be changed immediately ... proteins. Consequently, animals are able to regulate properly their metabolism of fats, and ..... diagram to illustrate the mechanism for regulating the activity of the acetyl- ...

351

I enzyme; detergent lysis  

2. investigation of the association of nucleic acids and the protein synthetic machinery with .... (a) Diagram of a resting membrane illustrating the unit membrane concept; .... synthesis and function in nerve cell membranes and their derivatives.

352

Amino acids of fulvic and humic acids in certain types of soils  

in the humic acids of various types of soils in [2, 151; in plasma proteins and ... Subsequently, a spot diagram was used for identification with strict ..... present in the chernozem zone, where phenomena of synthesis predominate and the most ...

353

A MEETING WITH THE UNIVERSE  

... for the synthesis of polymers essential for life under conditions simulating the ... like proteins and nucleic acids, could form from simpler molecules present in ... This geologic "clock" diagram summarizes the history of life on Earth and its ...

354

Metal Nanoparticles Derived from Polysilane Shell Cross-linked Micelle Templates  

Polysilane shell cross-linked micelles, where the polysilane core is surrounded by a partially cross-linked shell of poly(methacrylic acid), can be used as the template for the synthesis of metal nanoparticles.   

355

Facile Synthesis of 2,3-Diacetoxyflavanones from 3-Aminoflavones  

3-Aminoflavone reacts with isopentyl nitrite in acetic acid to give 2,3-diacetoxyflavanone in good yield. 3-Aminoflavone, the starting material, is readily available, and this method is a powerful tool for the synthesis of 2,3-dihydroxyflavanone derivatives.   

356

Synthesis of 3,4-Disubstituted Quinolin-2(1H)-ones via Palladium-catalyzed Regioselective Cross-coupling Reactions of 3-Bromo-4-trifloxyquinolin-2(1H)-one with Arylboronic Acids  

Palladium-catalyzed regioselective cross-coupling reactions of 3-bromo-4-trifloxyquinolin-2(1H)-one with arylboronic acids provide an efficient and practical route for the synthesis of 3,4-disubstituted quinolin-2(1H)-ones.   

357

High-resolution structures of Thermus thermophilus enoyl-acyl carrier protein reductase in the apo form, in complex with NAD+ and in complex with NAD+ and triclosan  

Enoyl-acyl carrier protein reductase (ENR; the product of the fabI gene) is an important enzyme that is involved in the type II fatty-acid-synthesis pathway of bacteria, plants, apicomplexan protozoa and mitochondria. Harmful pathogens such as Mycobacterium tuberculosis and Plasmodium falciparum use the type II fatty-acid-synthesis system, but not mammals or fungi, which contain a type I fatty-acid-synthesis pathway consisting of one or two multifunctional enzymes. For this reason, specific inhibitors of ENR are attractive antibiotic candidates. Triclosan, a broad-range antibacterial agent, binds to ENR, inhibiting fatty-acid synthesis. As humans do not have an ENR enzyme, they are not affected. Here, high-resolution structures of Thermus thermophilus (Tth) ENR in the apo form, bound to NA...

358

THE CHEMISTRY OF LIVING SYSTEMS Annual Report, Mar. 1970  

Synthesis of Biologically Active Peptides Dr.Young k6 x. Determination of Nucleic Acid ...... ligands such as carbon monoxide, cyanide, and azide, and the other of which is not reactive ..... Cofactor Requi rement. Relative Substrate Specificity ...

359

Project: Prebiotic Molecular Selection and Organization « CIW ...  

Oct 12, 2012 ... The group observed facile amphiphile synthesis and subsequent self-assembly of ... Hazen and colleagues characterized the surfaces of calcite, quartz, and ... All known cells use predominantly left-handed amino acids and ...

360

An Efficient Procedure for Synthesis of Phosphopeptides through the Benzyl Phosphate-Protection by the Boc Mode Solid-Phase Method  

The benzyl phosphate-protection for phosphoamino acid is very useful for Boc mode solid-phase synthesis of phosphopeptides. A phosphothreonine-containing peptide related to the EGF receptor protein was synthesized by use of this methodology.   

 
 
 
 
361

Examination of the effect of copper and molybdenum on microbial protein synthesis in rumen contents using /sup 35/S  

The influence of different concentrations of molybdenum and copper on microbial protein synthesis, volatile fatty acid production and other parameters has been investigated in bovine rumen contents incubated in vitro.

362

Ion-exchangeable Layered Aminophenylsilica Prepared with Anionic Surfactant Templates  

The synthesis of a novel anion-exchangeable nanostructured aminophenylsilica with a well-ordered layer geometry was demonstrated by utilizing the sol-gel reaction of p-aminophenyltrimethoxysilane in the presence of an anionic surfactant micelle under acidic conditions   

363

An easy synthesis of 3,5-disubstituted 1,2,4-oxadiazoles from carboxylic acids and arylamidoximes mediated by ethyl chloroformate  

An efficient, clean and easy high-yielding synthesis of 3,5-disubstituted 1,2,4-oxadiazoles starting from mixed anhydrides (generated from carboxylic acids and ethyl chloroformate) and arylamidoximes is described. (author)

364

Design and biological properties of iodine-123 labeled. beta. -methyl-branched fatty acids  

The synthetic strategy, synthesis, preclinical evaluation and potential clinical applications of 3-methyl-branched radioiodinated iodophenyl- and iodovinyl-substituted fatty acids are reviewed for use as myocardial imaging agents. 50 references, 6 figures. (ACR)

365

Enantioselective synthesis of levomilnacipran.  

A novel approach for the asymmetric synthesis of the active (1S,2R)-enantiomer of the antidepressant milnacipran is reported. The two stereogenic centers borne by the cyclopropane ring were sequentially installed starting from phenylacetic acid. PMID:22767143

366

Inherited human cPLA2? deficiency is associated with impaired eicosanoid biosynthesis, small intestinal ulceration, and platelet dysfunction  

Cytosolic phospholipase A2? (cPLA2?) hydrolyzes arachidonic acid from cellular membrane phospholipids, thereby providing enzymatic substrates for the synthesis of eicosanoids, such as prostaglandins and leukotrienes. Considerable understanding of cPLA2? function has been derived from investigations ...

367

Synthesis of Methyl (S)-(-)-6,8-Dihydroxyoctanoate as a Precursor of (R)-(+)-?-Lipoic Acid  

  The synthesis of methyl (S)-(-)-6,8-dihydroxyoctanoate as a precursor of (R)-(+)-?-lipoic acid was accomplished by using methyl (S)-(-)-(2-oxocyclohexyl)acetate, which had been obtained from baker’s yeast reduction, as a chiral starting material.   

368

#The #lipase-catalyzed synthesis of fatty acid fructose esters in organic media and in supercritical carbon dioxide Sinteza estra fruktoze i masnih kiselina katalizovane lipazama u prisustvu natkriti?nog ugljen dioksida  

Sugar fatty acid esters are biodegradable surface active compounds in foodstuffs and cosmetics or pharmaceuticals. They have potential in replacing pollutant chemically synthesized surfactants. The enzymatic synthesis of fructose palmitate catalyzed by Candida antarctica B lipase was performed in di...

369

Formation mechanism of anionic-surfactant-templated mesoporous silica (AMS)  

This dissertation is focused on synthesis, characterization and formation mechanism of anionic-surfactant-templated mesoporous silica (AMS).Structural control mechanisms of AMS are investigated. First, different ionization degree of anionic surfactant affected by the acidity or alkalinity ...

370

Flame Resistant Cotton Durability and Antimicrobial Resistance Properties by using a Novel Epoxy Phosphonate Monomers  

Recently we showed the design, synthesis, characterization, and usefulness of 2-(dimethoxy-phosphorylmethyl)-oxiranylmethyl]-phosphonic acid dimethyl ester that was generated from 3-chloro-2-chloromethylpropene (Polymer Preprints 2005, 46(1), 583-584). This monomer was grafted onto cotton fabrics (...

371

Novel Reversed Chain Modified Oligopeptides via Sequential ?-N-Mitsunobu Condensation of a Functionalized C-glycoside  

The synthesis of a novel reversed chain modified oligopeptide via sequential ?-N-Mitsunobu condensation reactions on a C-glycoside with amino acid derived nitrobenzenesulfonamides is described. Structural analysis of the target compound 11 using NMR techniques indicates a folded structure.   

372

Short-step Synthesis of Chenodiol from Stigmasterol  

Chenodiol is an important bile acid widely used for gallstone dissolution and cholestatic liver diseases. We succeeded in a short-step synthesis of chenodiol, starting from the safer phytosterol, stigmasterol.   

373

Boron-10 and Boron-11 Production  

Development of Plants for the Production of Highly Concentrated Boron Isotopes and Synthesis of Boric Acid Labeled with Boron-10 and Boron-11 Isotopes; Development of the Process for the Production of Highly Pure Elementary Boron.

374

ALCOHOL OXIDATION - A COMPARATIVE STUDY OF DIFFERENT CATALYTIC PROCESSES  

Oxidation of alcohols to aldehydes, ketones or carboxylic acids is one of the most desirable chemical transformations in organic synthesis as these products are important precursors and intermediates for many drugs, vitamins and fragrances. Numerous methods are available for alco...

375

Whole-body nitrogen and tyrosine metabolism in surgical patients receiving branched-chain amino acid solutions  

Fifteen patients undergoing gastric bypass surgery for morbid obesity received preoperatively a standard crystalline amino acid solution containing 15.6% branched-chain amino acids. During the first five postoperative days, the patients were randomized to receive one of three amino acid solutions of different branched-chain amino acid content. Whole-body amino acid appearance and oxidation were estimated using a continuous intravenous infusion of L-(U-/sup 14/C)-tyrosine preoperatively and on the third postoperative day. This study suggests that an adequate nitrogen intake of a balanced amino acid mixture, as well as a solution enriched with branched-chain amino acids, maintains protein homeostasis and supports protein synthesis similarly in well-nourished patients following major abdominal surgery. A diet containing only branched-chain amino acids in isomolar ratios was as effective at maintaining protein retention and whole-body protein synthesis and albumin renewal postoperatively when compared with a standard amino acid formula.

376

Comparison of the formation of nicotinic acid conjugates in leaves of different plant species  

There are three metabolic fates of nicotinic acid in plants: (1) nicotinic acid mononucleotide formation for NAD synthesis by the so-called salvage pathway of pyridine nucleotide biosynthesis; (2) nicotinic acid N-glucoside formation; and (3) trigonelline (N-methylnicotinic acid) formation. In the present study, the metabolism of [carbonyl-^1^4C]nicotinamide was investigated in leaves of 23 wild plant species. All species readily converted nicotinamide to nicotinic acid, and only a fraction of nicotinic acid was utilised for NAD and NADP synthesis. The remaining nicotinic acid is converted to the nicotinic acid conjugates. Only one plant species, Cycas revoluta, produced both nicotinic acid N-glucoside and trigonelline; the other 22 species produced one or other of the conjugates. The nico...

377

A process for the synthesis of PUFA-enriched triglycerides from high-acid crude fish oil  

This paper reports a research interest, that aims to establish a feasible industrial process, for the enzymatic production of glycerides with highly concentrated n-3 polyunsaturated fatty acids (eicosapentaenoic acid and docosahexaenoic acid), from high-acid crude fish oils. The process covers enzymatic deacidification of crude fish oil, alkaline-based synthesis of polyunsaturated fatty acids ethyl esters, concentration of polyunsaturated fatty acids ethyl esters, and enzyme catalyzed synthesis of polyunsaturated fatty acids glycerides. Commercial available immobilized lipase, Novozym 435, was used as the catalyst. The synthesized glycerides contained 5.5% of eicosapentaenoic acid and 74.6% of docosahexaenoic acid, which was 1.21 and 2.71 times more than that in the original fish oil, resp...

378

The SNPs in the ACACA gene are effective on fatty acid composition in holstein milk  

Fatty acid composition is an important economic trait for both dairy and beef cattle and controlled by genetic factors. Candidate genes controlling fatty acid composition may be found in fat synthesis and metabolism pathways. Acetyl-CoA carboxylase is the flux-determining enzyme in the regulation of fatty acid synthesis in animal tissues. One of two isozymes of this enzyme, acetyl-CoA carboxylase-? (ACACA), catalyses the first committed step of fatty acid synthesis in mammalian cytosol, leading to the biosynthesis of long-chain fatty acids. In the current study, the sequence comparison of the coding sequence (CDS) and two promoter regions (PIA and PIII) in bovine ACACA gene was performed between Japanese Black and Holstein cattle to detect nucleotide polymorphisms influencing fatty acid co...

379

The synthesis, properties, and applications of ascorbyl esters  

Abstract Ascorbic acid is a naturally occurring antioxidant. Nevertheless, its primary applications as an antioxidant in the life science, food and pharmaceutical industries are limited because of its hydrophilic nature. Alternatively, ascorbyl acid esters are potential surfactants and antioxidants. Chemical methods for the synthesis of ascorbyl esters lead to the formation of side products and simultaneous decomposition of ascorbic acid due to harsh reaction conditions. In contrast, lipases are used as regioselective and mild catalysts for the synthesis of ascorbyl esters. So far, various acyl donors namely, fatty acids, fatty acid alkyl esters, fatty acid vinyl esters and triacylglycerols have been explored for the synthesis of ascorbyl fatty esters. Other compounds such as L-methyl lact...

380

Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose Substrates (Formaldehyde and Glycolaldehyde) and Ammonia  

Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded ?-hydroxy acid thioesters (Weber, 1984a, b), the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters - intermediates capable of forming peptides (Weber and Orgel 1979). A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40°C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

 
 
 
 
381

Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia  

Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

382

A New Route to 2,4,6-Trisubstituted-6H-1,3-Oxazines  

The Lewis acid (borontrifluoride etherate) catalyzed novel synthesis of 2,4,6-trisubstituted-6H-1,3-oxazines is described here. Also, a new route towards an environmentally benign synthesis of the title compounds has been developed using montmorillonite K-10 clay as a catalyst under microwave irradiation (MWI). The procedure replaces the Lewis acid, and the products are obtained in a high yield and shorter reaction time.   

383

MCM-41-SO3H as a Highly Efficient Sulfonic Acid Nanoreactor for the Rapid and Green Synthesis of Some Novel Highly Substituted Imidazoles under Solvent-Free Condition  

Abstract Nanosized MCM-41-SO3H based on ordered mesoporous silica material with a covalent sulfonic acid group was synthesized and used as acid catalyst for the new, simple, convenient and green synthesis of 2,4,5-trisubstituted and 1,2,4,5-tetra-substituted imidazoles. Also some of synthesis products are new. Echo-friendly protocol, short reaction times, easy and quick isolation of the products and excellent yields are the main advantages of this procedure.

384

Carboranyl amino acids for the specific neutron capture therapy of malignant melanoma  

We are pleased to summarize the very significant progress made since our last report dated April 6, 1990. Significant progress has been made toward our twin objectives of both the steroselective and non-steroselective synthesis of carborane-containing amino acids for boron neutron capture therapy of malignant melanoma. Additionally, we have developed a new, general procedure for the synthesis of a variety of {alpha}-amino acids which may find wide applicability in this area. 8 refs., 5 figs., 1 tab.

385

Carotenoids and Related Polyenes, Part 12  

The synthesis of 3?-deoxycapsanthin (1) and 3,4-didehydroxy-3?-deoxycapsanthin (2), carotenoids of paprika, has been achieved by employing Lewis acid-promoted regio- and stereoselective rearrangement of the C15-epoxy dienal 5a. The absolute stereochemistry of the newly formed C-5 chiral center of rearrangement product 6a was determined to be (R) from its alternative synthesis derived from (+)-(R)-camphonanic acid (11).   

386

A traceless solid-supported synthesis of novel pyrazinediazepinedione derivatives  

A simple, convenient, six-step synthesis of novel, tricyclic pyrazinebenzodiazepinedione derivatives has been described. The strategy is based on the use of the orthogonally-protected, optically pure, (S)-piperazine-2-carboxylic acid, in a Petasis reaction, followed by coupling with anthranilic acid and finally cyclizing cleavage. The investigated method was applied for the synthesis of novel bicyclic pyrazinediazepinedione derivatives. This traceless, solid-supported approach allows the preparation of a wide variety of compounds in moderate yields from commercially available or easily obtainable reagents.

387

A multicomponent approach to the synthesis of 1,3-dicarbonylic compounds  

A general synthesis of 1,3-dicarbonylic compounds using multicomponent reactions of isocyanides is described. The process involves a Passerini three-component condensation of glyoxal derivatives, isocyanides and acetic acid, followed by metal mediated reductive or solvolytic removal of the acid component. Noteworthy, reductive deacetoxylation of Passerini glyoxylamide adducts was successfully achieved using photochemically activated SmI2. This procedure constitutes a novel convenient method for the direct synthesis of malonic retro-peptidic subunits.

388

Nonbiogenic amino acids in natural bitumens and problem of genetic identification of geo- and astro-problematics  

In solid hydrocarbons and carbonaceous substances of terrestrial and cosmic origin, abiogenic synthesis of protein amino acids takes place, and their concentrations can be very high. The main mechanisms of their formation are crystallization, thermal synthesis, and radiosynthesis. Amino acid spectra are individual for different genetic types of bitumens, and together with other data they can be successfully used for geo- and astrobioproblematics indication. Their usage in the capacity of biomarkers is challenged due to the convergence of characteristics connected with biomineral homologies.

389

Transcytosis of albumin in astrocytes activates the sterol regulatory element-binding protein-1, which promotes the synthesis of the neurotrophic factor oleic acid.  

We have recently reported that albumin, a serum protein present in the developing brain, stimulates the synthesis of oleic acid by astrocytes, which promotes neuronal differentiation. In this work, we gain insight into the mechanism by which albumin induces the synthesis of this neurotrophic factor. Our results show that astrocytes internalize albumin in vesicle-like structures by receptor-mediated endocytosis. Albumin uptake was followed by transcytosis, including passage through the endoplasmic reticulum, which was required to induce the synthesis of oleic acid. Oleic acid synthesis is feedback-regulated by the sterol regulatory element-binding protein-1, which induces the transcription of stearoyl-CoA 9-desaturase, the key rate-limiting enzyme for oleic acid synthesis. In our research, the presence of albumin activated the sterol regulatory element-binding protein-1 and increased stearoyl-CoA 9-desaturase mRNA. Moreover, when the activity of sterol regulatory element-binding protein-1 was inhibited by overexpression of a truncated form of this protein, albumin did not affect stearoyl-CoA 9-desaturase mRNA, indicating that the effect of albumin is mediated by this transcription factor. The effect of albumin was abolished when traffic to the endoplasmic reticulum was prevented or when albumin was accompanied with oleic acid. In conclusion, our results suggest that the transcytosis of albumin includes passage through the endoplasmic reticulum, where oleic acid is sequestrated, initiating the signal cascade leading to an increase in its own synthesis. PMID:11724788

390

A novel and high-yielding asymmetric synthesis of oseltamivir phosphate (Tamiflu) starting from (-)-shikimic acid  

A novel and high-yielding asymmetric synthesis of oseltamivir phosphate 1 (Tamiflu) is described. The target compound 1 was obtained in 55% overall yield via an 11-step asymmetric synthesis starting from the naturally abundant (-)-shikimic acid. The present synthesis is characterized by some advantages such as the easy separation of intermediate 6 from triphenylphosphine oxide by using its large water-solubility, the use of inexpensive reagents throughout the synthesis, the lack of toxic heavy metals, mild reaction conditions and high yields for all steps. The stereochemical structure of the key intermediate 6 was unequivocally confirmed by X-ray crystallographic analysis.

391

EFFECT OF PARTIAL HEPATECTOMY ON NUCLEIC ACID METABOLISM OF REGENERATING THYMUS  

The incorporation of orotic acid-C/sup 14/ was investigated in C57BL mouse thymus DNA and RNA after local irradiation with 300 r, and in liver regenerating after partial hepatectomy. The effect of DNA synthesis in regenerating liver on DNA synthesis in regenerating thymus was further investigated by arranging the time sequence of the irradiation of the thymus and of the partial hepatectomy so as to make maximum DNA synthesis in liver coincide with maximum DNA synthesis in thymus. It was observed that, under these conditions, the incorporation of the precursor into the irradiated thymus was reduced 40%, suggesting a competition between liver and thymus for factors necessary for regeneration. (auth)

392

Simple one-pot synthesis of cyclopropane (/sup 11/C) carbonyl chloride. Synthesis and biodistribution of (/sup 11/C) cyclorphan  

A rapid, one-pot, synthesis of cyclopropane (/sup 11/C) carbonyl chloride was developed. This synthesis proceeded in 80% radio-chemical yield (EOB) in a synthesis time of 10 minutes. This acid chloride was then used to synthesize a model compound, (/sup 11/C)cyclorphan, by alkylation of norlevorphanol followed by reduction of the intermediate (/sup 11/C)amide in an overall synthesis time of 55 minutes and a radiochemical yield of 15% (EOB). The biodistribution of (/sup 11/C)cyclorphan in control and naloxone pretreated mice showed non-specific binding and rapid clearance from brain.

393

Synthesis of new fatty acids amides from aminolysis of fatty acid methyl esters (FAMEs); Sintese de novas amidas graxas a partir da aminolise de esteres metilicos  

Recent biochemical and pharmacological studies have led to the characterization of different fatty acid amides as a new family of biologically active lipids. Here, we describe the synthesis of new amides from C16:0, 18:0, 18:1 and 18:1, OH fatty acids (FFA) families with cyclic and acyclic amines and demonstrate for the first time that these compounds produce cytotoxic effects. Application of this method to the synthesis of fatty acid amides was performed using the esters aminolysis as a key step and various carboxylic amides were prepared in good yield from fatty acid methyl esters (FAMEs). (author)

394

Síntese de novas amidas graxas a partir da aminólise de ésteres metílicos/ Synthesis of new fatty acids amides from aminolysis of fames  

Abstract in english Recent biochemical and pharmacological studies have led to the characterization of different fatty acid amides as a new family of biologically active lipids. Here, we describe the synthesis of new amides from C16:0, 18:0, 18:1 and 18:1, OH fatty acids (FFA) families with cyclic and acyclic amines and demonstrate for the first time that these compounds produce citotoxic effects. Application of this method to the synthesis of fatty acid amides was performed using the esters (more) aminolysis as a key step and various carboxylic amides were prepared in good yield from fatty acid methyl esters (FAMEs).

395

THERMAL STUDIES OF POLY(ESTERS) CONTAINING SILICON OR GERMANIUM  

Abstract in spanish Las propiedades térmicas de poli(ésteres) conteniendo silicio o germanio en la cadena principal y derivados de los difenoles bis(4-hidroxifenil)-difenilsilano o bis(4-hidroxifenil)-difenilgermano y los cloruros de los ácidos isoftálico y tereftálico fueron estudiadas mediante calorimetría diferencial de barrido y termogravimetría dinámica. Los poli(ésters) derivados del ácido tereftálico mostraron mayores valores de Tg y estabilidad térmica que aquellos deriva (more) dos del ácido isoftálico. Los poli(ésteres) conteniendo Ge mostraron mayores valores de Tg pero menores valores de temperatura de descomposición térmica que sus análogos conteniendo Si Abstract in english The thermal properties of poly(esters) containing silicon or germanium in the main chain and derived from the diphenols bis(4-hydroxyphenyl)-diphenylsilane and bis(4-hydroxyphenyl)-diphenylgermane and isophthaloyl or terephthaloyl acid dichlorides were studied by differential scanning calorimetry and dynamic thermogravimetry. Poly(esters) derived from terephthalic acid showed higher Tg and thermal stability values than those derived from isophthalic acid. Poly(esters) con (more) taining Ge showed higher Tg values but lower thermal decomposition temperatures when compared with the analogous with Si

396

Effect of cross-linkable polymer on the morphology and properties of transparent multi-walled carbon nanotube conductive films  

In this study, we fabricated optically transparent and electrically conductive multi-walled carbon nanotube (MWCNT) thin films using a spray-coating technique. The transparency and the electrical resistance of thin film are dependent on the nanotube content deposited on the polyethylene terephthalate (PET) substrate. Poly(acrylic acid) (PAA) and poly(N-vinyl pyrrolidone) (PVP) were used as adhesion promoters to improve MWCNT coating more significantly. The cross-linked polymer resulted in a superior bond between the MWCNTs and the substrates. The surface electrical resistance was significantly lower than the original sheet after nitric acid (HNO3) treatment because of the removed surfactant and the increased interconnecting networks of MWCNT bundles, thus improving the electrical and optical properties of the films. Stronger interaction between the MWCNTs and the substrates resulted in lower decomposition of the polymer chain and less amounts of MWCNTs separated into the HNO3 solution. The lower sheet electrical resistance of PVP/PAA-g-MWCNT conductive films on the PET substrate was because of a more complete conductive path with the cross-linked polymer than that without. Such an improved sheet of electrical resistance varied from 8.83 × 104 ?/? to 2.65 × 103 ?/? with 5.0 wt.% PVP/PAA-g-MWCNT sprayed on the PET after acid treatment.

397

Aerobic metabolism and adsorption of pyrethroid insecticide metofluthrin in soil  

Metofluthrin [2,3,5,6-tetrafluoro-4-(methoxymethyl)benzyl (1R,3R)-2,2-dimethyl-3-((1EZ)-prop-1-enyl)cyclopropanecarboxylate] was rapidly degraded in two aerobic US soils with first-order half-lives of 2.3–3.5 days primarily via ester cleavage to give the corresponding acid and alcohol without any epimerization and geometrical isomerization. The rapid oxidation proceeded either at the prop-1-enyl group of the acid to moiety form the diacid derivative or the benzyl carbon to finally give the terephthalic acid derivative. These metabolites were finally mineralized to carbon dioxide with partial formation of bound residues. The soil adsorption coefficients (Koc) of the Z isomer, the main component of metofluthrin, in three German soils were determined to be 3553–6124 (ml/g o.c.) by the batch equilibrium method. The screening groundwater simulation model SCI-GROW using the metabolic half-lives and Koc values clearly indicates that metofluthrin is most unlikely to contaminate groundwater even in the unrealistic worst case.   

398

Balloon for Long-Duration, High-Altitude Flight at Venus  

A document describes a 5.5-m-diameter, helium-filled balloon designed for carrying a scientific payload having a mass of 44 kg for at least six days at an altitude of about 55 km in the atmosphere of Venus. The requirement for floating at nearly constant altitude dictates the choice of a mass-efficient spherical super-pressure balloon that tracks a constant atmospheric density. Therefore, the balloon is of a conventional spherical super-pressure type, except that it is made of materials chosen to minimize solar radiant heating and withstand the corrosive sulfuric acid aerosol of the Venusian atmosphere. The shell consists of 16 gores of a multilayer composite material. The outer layer, made of polytetrafluoroethylene, protects against sulfuric acid aerosol. Next is an aluminum layer that reflects sunlight to minimize heating, followed by an aluminized polyethylene terephthalate layer that resists permeation by helium, followed by an aromatic polyester fabric that imparts strength to withstand deployment forces and steady super-pressure. A polyurethane coat on the inner surface of the fabric facilitates sealing at gore-to-gore seams. End fittings and seals, and a tether connecting the end fittings to a gondola, are all made of sulfuric-acid-resistant materials.

399

Entangled coordination polymers with mixed N- and O-donor organic linkers: a case of module-matching priority.  

A series of four coordination polymers showing entangled architectures based on cobalt and mixed N-donor/O-donor ligands, namely [Co(4,4'-BPIPA)(TP)]·2DMF (1), [Co(4,4'-BPIPA)(2,6-NDC)(DMF)]·DMF (2), [Co(4,4'-BPIPA)(2,6-NDC)]·2DMF (3) and [Co(4,4'-BPIPA)(4,4'-BPDC)]·2DMF (4) (4,4'-BPIPA = N,N'-bis-4-pyridinyl-isophthalamide, TP = terephthalic acid, 2,6-NDC = 2,6-naphthalenedicarboxylic acid, 4,4'-BPDC = 4,4'-biphenyldicarboxylic acid), have been synthesized under solvothermal conditions. Complex 1, containing 4,4'-BPIPA and relatively short dicarboxylate ligands (TP), exhibits two-dimensional (2D) two-fold interpenetration of double wavy 4(4)-sql nets. Complex 2 displays interesting 2D?3D parallel polycatenation of undulated 2D 4(4)-sql layers built by 4,4'-BPIPA and moderate dicarboxylate ligands (2,6-NDC). Complexes 3 and 4, although constructed of dicarboxylate ligands with different lengths (moderate 2,6-NDC and long 4,4'-BPDC), possess similar 3-fold interpenetration of identical self-catenated single nets with 6(5)·8-mok topologies. It has been found that the length of the dicarboxylate ligands plays a key role of module-matching in the self-assemblies of complexes 1-4. Moreover, the effect of the conformations of 4,4'-BPIPA, which can be controlled by tuning reaction temperatures, is also discussed. PMID:22228032

400

Dicarboxylate-controlled three Zn(II) coordination polymers incorporating flexible 1,2-bis(imidazol-1prime-yl)ethane ligand: Syntheses, structures, thermal stabilities and photoluminescent properties  

Three mixed-ligand Zn(II) coordination polymers (CPs) of the formula {[Zn2(bime)2(adip)2]s(H2O)5}n (1), {[Zn(bime)(ipa)]s(H2O)3}n (2), {[Zn(bime)(tpa)]s(H2O)s(CH3OH)}n (3) (bime=1,2-bis(imidazol-1prime-yl)ethane, H2adip=adipic acid, H2ipa=isophthalic acid and H2tpa=terephthalic acid) were synthesized. All CPs have been characterized by element analysis, powder X-ray diffraction (PXRD), IR and X-ray single-crystal diffraction. Complexes 1 and 2 exhibit similar wavy two-dimensional (2D) sheets with 44-sql topology. Compared to 1, complex 2 contains a larger window owing to the different conformation of bime ligand. In both 1 and 2, we observed 1D water chain filling in the 44-sql net. In 3, the bime acts as a bidentate ligand and the tpa adopts a m2-1,1 coordinated mode which links the Zn(II...

 
 
 
 
401

Dicarboxylate-controlled three Zn(II) coordination polymers incorporating flexible 1,2-bis(imidazol-1?-yl)ethane ligand: Syntheses, structures, thermal stabilities and photoluminescent properties  

Three mixed-ligand Zn(II) coordination polymers (CPs) of the formula {[Zn2(bime)2(adip)2]?(H2O)5}n (1), {[Zn(bime)(ipa)]?(H2O)3}n (2), {[Zn(bime)(tpa)]?(H2O)?(CH3OH)}n (3) (bime = 1,2-bis(imidazol-1?-yl)ethane, H2adip = adipic acid, H2ipa = isophthalic acid and H2tpa = terephthalic acid) were synthesized. All CPs have been characterized by element analysis, powder X-ray diffraction (PXRD), IR and X-ray single-crystal diffraction. Complexes 1 and 2 exhibit similar wavy two-dimensional (2D) sheets with 44-sql topology. Compared to 1, complex 2 contains a larger window owing to the different conformation of bime ligand. In both 1 and 2, we observed 1D water chain filling in the 44-sql net. In 3, the bime acts as a bidentate ligand and the tpa adopts a ?2-?1,?1 coordinated mode which links the Zn(II) ions to form a 2D 63-hcb net. The results suggest that the dicarboxylates play crucial roles in the formation of the different structures. In addition, the thermal stabilities and the photoluminescence properties of them were also investigated.

402

Metal organic frameworks assembled from Y(III), Na(I), and chiral flexible-achiral rigid dicarboxylates.  

New chiral metal organic frameworks, assembled from Y(III), Na(I), and chiral flexible-achiral rigid dicarboxylate ligands, formulated as [NaY(Tart)(BDC)(H(2)O)(2)] (1) and [NaY(Tart)(biBDC)(H(2)O)(2)] (2) (H(2)Tart = Tartaric acid; H(2)BDC = Terephthalic acid; H(2)biBDC = Biphenyl-4,4'-dicarboxylic acid), were obtained as single phases under hydrothermal conditions. Their structures were solved by single-crystal X-ray diffraction (XRD), and characterized by (13)C CPMAS NMR, thermal analyses (thermogravimetry-mass spectrometry (TG-MS) and differential scanning calorimetry (DSC)), and X-ray thermodiffractometry. Both compounds crystallize in the orthorhombic chiral space group C222(1) with a = 6.8854(2) A, b = 30.3859(7) A, c = 7.4741(2) A for 1, and a = 6.8531(2) A, b = 39.0426(8) A, c = 7.4976(2) A for 2. 1 and 2 are layered structures whose three-dimensional stability is ensured by strong hydrogen bond interactions. The dehydration of both compounds is accompanied by phase transformation, while the spontaneous rehydration process is characterized by different kinetics, fast in the case of 1 and slow for 2. PMID:20672844

403

A New Class of Aromatic Poly(1,3,4-oxadiazole)s and Poly(amide-1,3,4-oxadiazole)s Containing (Naphthalenedioxy)diphenylene Groups  

Polyhydrazides and poly(amide-hydrazide)s having inherent viscosities of 0.31–1.17 dL g-1 were prepared from two ether-naphthalene-dicarboxylic acids, 4,4’-(1,5-naphthalenedioxy)dibenzoic acid (1,5-NDA) and 4,4’-(2,3-naphthalenedioxy)dibenzoic acid (2,3-NDA) with terephthalic dihydrazide, isophthalic dihydrazide, and p-aminobenzhydrazide via the phosphorylation polycondensation reaction. Except for one example, the hydrazide polymers were essentially amorphous and readily soluble in polar organic solvents such as N-methyl-2-pyrrolidone (NMP) and N,N-dimethylacetamide (DMAc). They could be cast into transparent, flexible, and tough films with good mechanical strengths from solution in DMAc. These hydrazide polymers exhibited glass-transition temperatures (Tgs) in the range 179–190 °C and could be thermally cyclodehydrated into the corresponding poly(1,3,4-oxadiazole)s and poly(amide-1,3,4-oxadiazole)s in the solid state at elevated temperatures. The oxadiazole polymers had Tgs of 228–242 °C (by differential scanning calorimetry) and 10% weight loss temperatures above 500 °C, as revealed by thermogravimetric analysis in nitrogen or in air.   

404

Gasification of waste tyre and plastic (PET) by solar thermochemical process for solar energy utilization  

Waste tyre and plastic such as polyethylene terephthalate can be utilized as a useful material for conversion of solar energy into chemical energy by solar thermochemical gasification into synthesis gas (CO + H{sub 2}) using concentrated solar energy. In the present paper, the gasification of waste tyre (C: 86 wt.%, H: 8.4 wt.%) and of PET (C{sub 10}H{sub 8}O{sub 4}){sub n}, were studied using ZnO as a donor of oxygen in the infra-red furnace at 1373 K. For the gasification of tyre, most of the chemically bound hydrogen was converted into H{sub 2} (62%) and CH{sub 4} (29%) gases, while 71 mole% of the inherent carbon was gasified to CO (36%), CH{sub 4} (29%), C{sub 2}H{sub 4} (2%), and CO{sub 2} (4%) in 200 s of the decomposition reaction. The CO{sub 2}:CO ratio was about 1/10, indicating that the carbon in the waste tyre can be converted effectively to gaseous fuels. In the experiment without ZnO, the conversion efficiency of C and H were decreased to 17% and 77%, respectively. However an appreciable effect of ZnO on the enhancement of the gasification of PET was not observed. (author)

405

[Ph(3)PCH(2)Ph](2)[Zn(3)(tp)(3)Cl(2)] and Ni(3)(tma)(2)(H(2)O)(8): two unusual claylike frameworks of metal-polycarboxylate coordination polymers (tp = terephthalate, tma = trimesate).  

Two new compounds, [Ph3PCH2Ph]2[Zn3(tp)3Cl2] (1) and Ni3(tma)2(H2O)8 (2) (tp = terephthalate, tma = trimesate), are metal-polycarboxylate coordination polymers prepared by similar hydrothermal synthesis techniques. X-ray single-crystal structural analysis shows that both compounds crystallize in the 2D claylike lamellar architectures, in which 1 possesses the interlayer [Ph3PCH2Ph]+ exchangeable cation and has been confirmed by PXRD patterns. 1 (C74H56Cl2O12P2Zn3) belongs to monoclinic P21/c, Z = 2 (a = 18.956(1) A, b = 10.2697(5) A, c = 17.067(1) A, beta = 99.486(4) degrees ). 2 (C18H22O20Ni3) is attributed to triclinic P, Z = 1 (a = 6.6643(8) A, b = 9.622(1) A, c = 10.089(1) A, alpha = 112.675(2) degrees , beta = 94.007(1) degrees, gamma = 106.411(2) degrees ). Linear metal trinuclear clusters bridged by rigid linear tp ligands for 1 and trigonal tma ligands for 2 give rise to a novel 2D 6-linked (3,6) topological anionic network in 1 and an interesting 2D 3,6-linked molybdenite topological neutral network in 2, respectively. Both compounds exhibit intense fluorescent emission bands at 410 nm (lambda(exc) = 355 nm) for 1 and 398 nm (lambda(exc) = 300 nm) for 2 in the solid state at room temperature. PMID:17696493

406

Skin Deep: Highlights of NREL Surface Analysis PV Research  

The Surface Analysis project provides measurement support and leadership for collaborative research activities involving surface chemistry and physics in all areas of the PV program. Significant results from the past fiscal year include the following: i) in-situ XPS, UPS, and AES studies of chemical-bath exposure of CIGS surfaces demonstrated that Group-III elements are preferentially removed from the surface, that type conversion of the surface occurs, and that the addition of a surfactant improves CdS deposition and thus device performance; ii) XPS studies of polyethylene terephthalate (PET) candidate backsheet materials have shown that plasma exposure prior to oxide-barrier deposition results in the formation of low-molecular-weight fragments that result in the formation of a weak interfacial layer that fails during damp-heat exposure; iii) an empirical relation was derived for the source geometry that leads to optimal film-thickness uniformity in rotating-substrate physical-vapor deposition (PVD) systems; and iv) PVD flux-distribution calculations were performed to develop a novel method for combinatorial thin-film synthesis.

407

Eastman, AP start on coal unit  

Eastman Chemical and Air Products and Chemicals (AP) have started construction of a $214-million, coal-to-methanol demonstration unit at Eastmans site in Kingsport, TN. The project is part of the Department of Energy`s clean coal technology program and is receiving $93 million in federal support. The demonstration unit-which will have a methanol capacity of 260 tons/day-will use novel catalyst technology for converting coal-derived synthesis gas (syngas) to methanol. Unlike conventional technology that processes syngas through a fixed bed of dry catalyst particles, the liquid-phase methanol process converts the syngas in a single vessel containing catalysts suspended in mineral oil. The companies say the innovation allows the process to better able handle the gases from coal gasifiers and is more stable and reliable than existing processes. Eastman says it will use the methanol produced by the plant as a chemical feedstock. It currently uses methanol as an intermediate in making acetic anhydride and dimethyl terephthalate. In addition, the companies say the methanol will be evaluated as a feedstock in making methyl tert-butyl ether for reformulated fuels. Eastman also says it will evaluate coproducing dimethyl ether (DME) with the methanol. DME can be used as a fuel additive or blended with methanol for a chemical feedstock, according to Eastman.

408

FXR agonists and FGF15 reduce fecal bile acid excretion in a mouse model of bile acid malabsorption.  

Bile acid malabsorption, which in patients leads to excessive fecal bile acid excretion and diarrhea, is characterized by a vicious cycle in which the feedback regulation of bile acid synthesis is interrupted, resulting in additional bile acid production. Feedback regulation of bile acid synthesis is under the control of an endocrine pathway wherein activation of the nuclear bile acid receptor, farnesoid X receptor (FXR), induces enteric expression of the hormone, fibroblast growth factor 15 (FGF15). In liver, FGF15 acts together with FXR-mediated expression of small heterodimer partner to repress bile acid synthesis. Here, we show that the FXR-FGF15 pathway is disrupted in mice lacking apical ileal bile acid transporter, a model of bile acid malabsorption. Treatment of Asbt-/- mice with either a synthetic FXR agonist or FGF15 downregulates hepatic cholesterol 7alpha-hydroxylase mRNA levels, decreases bile acid pool size, and reduces fecal bile acid excretion. These findings suggest that FXR agonists or FGF15 could be used therapeutically to interrupt the cycle of excessive bile acid production in patients with bile acid malabsorption. PMID:17823457

409

Enantioselective synthesis of ?-oxy amides via Umpolung Amide Synthesis.  

?-Oxy amides are prepared through enantioselective synthesis using a sequence beginning with a Henry addition of bromonitromethane to aldehydes and finishing with Umpolung Amide Synthesis (UmAS). Key to high enantioselection is the finding that ortho-iodo benzoic acid salts of the chiral copper(II) bis(oxazoline) catalyst deliver both diastereomers of the Henry adduct with high enantiomeric excess, homochiral at the oxygen-bearing carbon. Overall, this approach to ?-oxy amides provides an innovative complement to alternatives that focus almost entirely on the enantioselective synthesis of ?-oxy carboxylic acids. PMID:22967461

410

Chiral Glycolate Equivalents for the Asymmetric Synthesis of ?-Hydroxycarbonyl Compounds  

Chiral glycolic acid equivalents are used extensively for the enantioselective synthesis of ?-hydroxycarbonyl compounds. Their efficacy in enolate reactions and their utility in synthetic applications are discussed, highlighting the relevance of these methods to natural product synthesis. Hydroxycarbonyl compounds are valuable intermediates in asymmetric synthesis, particularly in the preparation of complex structures such as terpenes, carbohydrates, and alkaloids. In addition, the use of chiral glycolic acid equivalents has been the approach of choice for ?-hydroxycarbonyl-containing natural products such as herbarumin II and rapamycin.   Fullsize Image

411

Improving cancer treatment with cyclotron produced radionuclides. Progress report, February 1987--September 1989  

This report is divided into six sections, each section dealing with a separate aspect of the program. The six sections are entitled (1) In Vivo Measurement of Amino Acid Transport and Protein Synthesis, (2) Angiogenesis in Human Gliomas: Correlations with Blood Flow and Transport of C-11 AIB, (3) Use of F-18 Fluoropyrimidines for Design and Evaluation of Regional and Systemic Chemotherapeutic Strategies in Human Adenocarcinomas of the Gastrointestinal Tract, (4) Enzymatic Synthesis of Metabolites Labeled with N-13 or C-11, (5) Synthesis of Amino Acids Labeled with C-11, and (6) Instrumentation: Cyclotron and Imaging Systems.

412

Scalable synthesis of an integrin-binding peptide mimetic for biomedical applications  

A scalable, solution-phase synthesis of the selectively protected non-peptide RGD (arginine-glycine-aspartic acid) mimetic 6 is described. This synthesis serves as an alternative to the previously described solid-phase synthesis of this compound, thereby making this important integrin-binding mimetic readily accessible. The free carboxylic acid of 6 was conjugated to a protected diamine, followed by global deprotection to give a derivative 27, suitable for immobilization onto amine-reactive surfaces. The RGD mimetic 28 demonstrated superior biological activity in comparison to a native linear RGD peptide and the semi-synthetic cyclic cRGDfK peptide in a cell attachment inhibition assay.

413

Total synthesis of (+/-)-taiwaniaquinol B via a domino intramolecular friedel-crafts acylation/carbonyl alpha-tert-alkylation reaction.  

The first synthesis of taiwaniaquinol B, a 6-nor-5(6-->7)abeoabietane-type diterpenoid exhibiting the uncommon fused 6-5-6 tricyclic carbon skeleton, was accomplished in 15 steps. A Lewis acid-promoted tandem intramolecular Friedel-Crafts/carbonyl alpha-tert-alkylation reaction was exploited as the core strategy for the synthesis of the sterically congested 1-indanone-containing tricyclic structure. This multiple carbon-carbon bond forming reaction exploits the unique reactivity of Meldrum's acid. The facile precursor synthesis makes this a useful methodology for the expedient modification and assembly of sterically congested 1-indanone-containing ring systems. PMID:16173732

414

Dependence of arbuscular-mycorrhizal fungi on their plant host for palmitic acid synthesis.  

Lipids are the major form of carbon storage in arbuscular-mycorrhizal fungi. We studied fatty acid synthesis by Glomus intraradices and Gigaspora rosea. [(14)C]Acetate and [(14)C]sucrose were incorporated into a synthetic culture medium to test fatty acid synthetic ability in germinating spores (G. intraradices and G. rosea), mycorrhized carrot roots, and extraradical fungal mycelium (G. intraradices). Germinating spores and extraradical hyphae could not synthesize 16-carbon fatty acids but could elongate and desaturate fatty acids already present. The growth stimulation of germinating spores by root exudates did not stimulate fatty acid synthesis. 16-Carbon fatty acids (16:0 and 16:1) were synthesized only by the fungi in the mycorrhized roots. Our data strongly suggest that the fatty acid synthase activity of arbuscular-mycorrhizal fungi is expressed exclusively in the intraradical mycelium and indicate that fatty acid metabolism may play a major role in the obligate biotrophism of arbuscular-mycorrhizal fungi. PMID:16151123

415

Haem synthesis during cytochrome P-450 induction in higher plants. 5-Aminolaevulinic acid synthesis through a five-carbon pathway in Helianthus tuberosus tuber tissues aged in the dark.  

Chlorophyll and haem synthesis in illuminated Jerusalem artichoke tuber tissues were very efficiently inhibited by gabaculine (3-amino-2,3-dihydrobenzoic acid). This inhibition seems to be due specifically to a blockade of the pathway for 5-aminolaevulinate biosynthesis which used glutamate as a substrate (the so-called C5 pathway) since we could not detect any inhibition of protein synthesis in the treated tissues and there was no effect of gabaculine on the glycine-dependent yeast 5-aminolaevulinate synthase used as a model. In dark-aged artichoke tissues, gabaculine also effectively blocked cytochrome P-450 induction, peroxidase activity and 5-aminolaevulinic acid synthesis, thus suggesting the involvement of a C5 pathway in cytoplasmic and microsomal haemoprotein synthesis in this higher plant. Allylglycine and (2-amino-ethyloxyvinyl)glycine, two olefinic glycine analogues which are potential suicide inhibitors of pyridoxal phosphate enzymes, were also demonstrated to be effective blockers of chlorophyll synthesis in artichoke tuber and Euglena cells exposed to light. PMID:3342026

416

Relationship of postirradiation repair processes to the protein synthesis and synthesis of DNA  

From international conference on the bases of the biological effects of ultraviolet radiation; Brno, Czechoslovakia (2 Oct Amino acid starvation or other inhibitions of protein synthesis prior to uv-irradiation of Lactobacillus acidophilus resulted in a shoulder on the dose-effect curve. The appearance of this shoulder was prevented, if together with the inhibition of protein synthesis DNA synthesis was also inhibited. On the contrary, amino acid starvation post irradiation resulted in no shoulder, but the shoulder resulted, if both protein synthesis and DNA synthesis were inhibited after irradiation. On the basis of these results, a temporary lag of DNA after uv irradiation is considered to be an important condition allowing the repair to take place. (auth)

417

Energy optimization of integrated process plants  

A general approach for viewing the process synthesis as an evolutionary process is proposed. Each step is taken according to the present level of information and knowledge. This is formulated in a Process Synthesis Cycle. Initially the synthesis is conducted at a high abstraction level maximizing use of heuristics (prior experience, rules of thumbs etc). When further knowledge and information are available, heuristics will gradually be replaced by exact problem formulations. The principles in the Process Synthesis Cycle, is used to develop a general procedure for energy synthesis, based on available tools. The procedure is based on efficient use of process simulators with integrated Pinch capabilities (energy targeting). The proposed general procedure is tailored to three specific problems (Humid Air Turbine power plant synthesis, Nitric Acid process synthesis and Sulphuric Acid synthesis). Using the procedure reduces the problem dimension considerable and thus allows for faster evaluation of more alternatives. At more detailed level a new framework for the Heat Exchanger Network synthesis problem is proposed. The new framework is object oriented based on a general functional description of all elements potentially present in the heat exchanger network (streams, exchangers, pumps, furnaces etc.). (LN) 116 refs.

418

Modulation of unsaturated fatty acids content in algae Spirulina platensis and Chlorella minutissima in response to herbicide SAN 9785  

Abstract in english The accumulation of polyunsaturated fatty acids by algae Spirulina platensis and Chlorella minutissima was studied. Response of these organisms to the substituted pyridazinone, SAN 9785, an inhibitor of the long chain fatty acid desaturase, indicated that fatty acid synthesis and their desaturation were regulated differently in these organisms. While the pool of palmitic acid, the precursor for the unsaturated C18 fatty acids, was stringently maintained in the green alga (more) C. minutissima, in the cyanobacterium S. platensis the level of palmitic acid was liberally maintained in spite of the enhanced accumulation of unsaturated C18 fatty acids.

419

The Effect of Pantothenic Acid Deficiency on Keratinocyte Proliferation and the Synthesis of Keratinocyte Growth Factor and Collagen in Fibroblasts  

It has been reported that pantothenic acid (vitamin B5) and panthenol, an alcohol derivative of pantothenic acid, have beneficial moisturizing effects on the skin. However, few studies have investigated the mechanism of action of pantothenic acid on skin tissues. We tried to clarify the role of pantothenic acid on skin function by using keratinocytes and fibroblasts. The depletion of pantothenic acid from the culture medium suppressed keratinocyte proliferation and promoted differentiation. Moreover, pantothenic acid depletion decreased the synthesis of keratinocyte growth factor and procollagen 4a2 in fibroblasts. These results suggest that pantothenic acid is essential for maintaining keratinocyte proliferation and differentiation.   

420

Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.  

Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

 
 
 
 
421

Enhancing the accumulation of omega-3 long chain polyunsaturated fatty acids in transgenic Arabidopsis thaliana via iterative metabolic engineering and genetic crossing.  

The synthesis and accumulation of long chain polyunsaturated fatty acids such as eicosapentaenoic acid has previously been demonstrated in the seeds of transgenic plants. However, the obtained levels are relatively low, indicating the need for further studies and the better definition of the interplay between endogenous lipid synthesis and the non-native transgene-encoded activities. In this study we have systematically compared three different transgenic configurations of the biosynthetic pathway for eicosapentaenoic acid, using lipidomic profiling to identify metabolic bottlenecks. We have also used genetic crossing to stack up to ten transgenes in Arabidopsis. These studies indicate several potential approaches to optimize the accumulation of target fatty acids in transgenic plants. Our data show the unexpected channeling of heterologous C20 polyunsaturated fatty acids into minor phospholipid species, and also the apparent negative metabolic regulation of phospholipid-dependent ?6-desaturases. Collectively, this study confirms the benefits of iterative approaches to metabolic engineering of plant lipid synthesis. PMID:22350763

422

Solvent-Free Synthesis of Layered Polymer Crystals  

A new solvent-free synthetic process of layered polymer crystals as novel organic intercalation materials from (Z,Z)-muconic acid is described. This process includes the monomer synthesis, topochemical polymerization, transformation to poly(muconic acid), and intercalation. Alkylammonium muconate monomers were prepared by grinding muconic acid and the corresponding alkylamines in a ceramic mortar without any solvent. Topochemical polymerization of the alkylammonium muconates in the crystalline state was carried out under UV irradiation with a high-pressure mercury lamp or sunlight. Transformation from poly(alkylammonium muconate) to poly(muconic acid) was achieved by thermolysis at 250 °C under reduced pressure with a maintenance of their crystallinity. Intercalation of alkylamines into the polymer crystals proceeded by grinding poly(muconic acid) and alkylamine similar to the monomer synthesis. This process is a new type of polymer synthesis using green and sustainable materials and reactions as the solvent-free system.   

423

Biocatalytic Synthesis of Dihydroxynaphthoic Acids by Cytochrome P450 CYP199A2  

CYP199A2, a bacterial P450 monooxygenase from Rhodopseudomonas palustris, was found to exhibit oxidation activity towards three hydroxynaphthoic acids. Whole cells of the recombinant Escherichia coli strain expressing CYP199A2 efficiently catalyzed the regioselective oxidation of 1-, 3-, and 6-hydroxy-2-naphthoic acids to produce 1,7-, 3,7-, and 6,7-dihydroxynaphthoic acid respectively. These results suggest that CYP199A2 might be a useful oxidation biocatalyst for the synthesis of dihydroxynaphthoic acids.   

424

Molecular Structure of Cyclopropane carboxylic acid  

Cyclopropane carboxylic acid is a clear liquid used as an intermediate for agrochemicals, pharmaceuticals, and other organic synthesis such as for the applications of electronics, chemicals, polymer additives, coatings, adhesives, surfactants, and other applications. Also, derivatives of cyclopropane-carboxylic acid are used against parasites in plants and animals. For example, the alkynyl esters of cyclopropane-carboxylic acid are used as pesticides. Similarly, cyclopropane carboxylic acid esters containing a polyhalogenated substituent are used as fungicides.

425

Synthesis of [2-[sup 14]C] griseolic acid 9'-(4-acetoxy-3-methoxybenzyl)ester, a antiglaucoma agent  

Starting from [[sup 14]C] ethyl orthoformate an amidine derivative derived from griseolic acid in 6 steps, the synthesis of [2-[sup 14]C] griseolic acid 9'-(4-acetoxy-3-gethoxybenzyl)ester [14C], a promising antiglaucoma agent with its regioisomer [2-[sup 14]C] griseolic acid 8'-(4-acetoxy-3-gethoxybenzyl)ester and [2-[sup 14]C] griseolic acid [14C] has been achieved. (Author).

426

Effects of Adding Dietary Lysine to a Low Gluten Diet on the Brain Protein Synthesis Rate in Aged Rats  

  The purpose of this study was to find whether the addition of dietary lysine affected the rate of brain protein synthesis in aged rats fed on a gluten diet. Experiments were done on two groups of aged rats (30 wk) given the diets containing 5% gluten or 5% gluten+0.3% lysine for 10 d. The fractional rates of protein synthesis in brain, liver, and kidney increased with an addition of dietary lysine. In brain, liver, and kidney, the RNA activity [g protein synthesized/(g RNA•d)] was significantly correlated with the fractional rate of protein synthesis. The RNA concentration (mg RNA/g protein) was not related to the fractional rate of protein synthesis in any organ. The results suggest that the addition of the limiting amino acid for the low quality protein elevates the rate of protein synthesis in the brain of aged rats, and that RNA activity is at least partly related to the fractional rate of brain protein synthesis.   

427

Regioselective synthesis of isotopically labeled D9-tetrahydrocannabinolic acid A (THCA-A-D3) by reaction of D9-tetrahydrocannabinol-D3 with magnesium methyl carbonate  

For the reliable quantification of D9-tetrahydrocannabinolic acid A (THCA-A), the biogenetic precursor of D9-tetrahydrocannabinol (THC), in biological matrices by LC-MS/MS and GC-MS(/MS), an isotopically labeled internal standard was synthesized starting from D9-tetrahydrocannabinol-D3 (THC-D3). Synthesis strategy was based on a method reported by Mechoulam et al. in 1969 using magnesium methyl carbonate (MMC) as carboxylation reagent for the synthesis of cannabinoid acids. Preliminary experiments with THC to optimize yield of the product (THCA-A) resulted in the synthesis of the positional isomer tetrahydrocannabinolic acid B (THCA-B) as a byproduct. Using the optimized conditions for the desired isomer, THCA-A-D3 was prepared and isolated with a yield of approx. 10% after two synthesis c...

428

A tissue engineering approach to anterior cruciate ligament regeneration using novel shaped capillary channel polymer fibers  

Ruptures of the anterior cruciate ligament (ACL) are the most frequent of injuries to the knee due to its role in preventing anterior translation of the tibia. It is estimated that as many as 200,000 Americans per year will suffer from a ruptured ACL, resulting in management costs on the order of 5 billion dollars. Without treatment these patients are unable to return to normal activity, as a consequence of the joint instability found within the ACL deficient knee. Over the last thirty years, a variety of non-degradable, synthetic fibers have been evaluated for their use in ACL reconstruction; however, a widely accepted prosthesis has been unattainable due to differences in mechanical properties of the synthetic graft relative to the native tissue. Tissue engineering is an interdisciplinary field charged with the task of developing therapeutic solutions for tissue and organ failure by enhancing the natural wound healing process through the use of cellular transplants, biomaterials, and the delivery of bioactive molecules. The capillary channel polymer (CC-P) fibers used in this research were fabricated by melt extrusion from polyethylene terephthalate and polybutylene terephthalate. These fibers possess aligned micrometer scale surface channels that may serve as physical templates for tissue growth and regeneration. This inherent surface topography offers a unique and industrially viable approach for cellular contact guidance on three dimensional constructs. In this fundamental research the ability of these fiber channels to support the adhesion, alignment, and organization of fibroblasts was demonstrated and found to be superior to round fiber controls. The results demonstrated greater uniformity of seeding and accelerated formation of multi-layered three-dimensional biomass for the CC-P fibers relative to those with a circular cross-section. Furthermore, the CC-P geometry induced nuclear elongation consistent with that observed in native ACL tissue. Through the application of uniaxial cyclic strain the mechanical properties of the cell seeded CC-P fiber scaffold systems were shown to improve via the induction of increased cellular proliferation and extracellular matrix synthesis. Finally, unlike many studies examining the effects of cyclic strain on cellular behavior, the CC-P fiber geometry displayed the ability to maintain cellular alignment in the presence of an applied uniaxial cyclic strain.

429

Penicillins and other acylamino compounds synthesized by the cell-bound penicillin acylase of Escherichia coli.  

1. The penicillin acylase of Eschericha coli N.C.I.B. 8743 is a reversible enzyme. Reaction rates for the two directions have been determined. 2. Measurements of the rates of enzymic synthesis of penicillins from 6-aminopenicillanic acid and various carboxylic acids revealed that p-hydroxyphenylacetic acid was the best substrate, followed by phenylacetic, 2-thienylacetic, substituted phenylacetic, 3-hexenoic and n-hexanoic acids. 3. The rate of synthesis of penicillin improved when amides or N-acylglycines were used; alpha-aminobenzylpenicillin and phenoxymethylpenicillin were only synthesized when using these more energy-rich compounds. 4. Phenyl-acetylglycine was the best substrate for the synthesis of benzylpenicillin compared with other derivatives of phenylacetic acid. 5. The enzyme was specific for acyl-l-amino acids, benzylpenicillin being synthesized from phenylacetyl-l-alpha-aminophenylacetic acid but not from phenylacetyl-d-alpha-aminophenylacetic acid. 6. alpha-Phenoxyethylpenicillin was synthesized from 6-aminopenicillanic acid and alpha-phenoxypropionylthioglycollic acid non-enzymically, but the rate was faster in the presence of the enzyme. 7. The E. coli acylase catalysed the acylation of hydroxylamine by acids or amides to give hydroxamic acids, the phenylacetyl group being the most suitable acyl group. The enzyme also catalysed other acyl-group transfers. PMID:4982418

430

A thermodynamic basis for prebiotic amino acid synthesis and the nature of the first genetic code  

Of the twenty amino acids used in proteins, ten were formed in Miller's atmospheric discharge experiments. The two other major proposed sources of prebiotic amino acid synthesis include formation in hydrothermal vents and delivery to Earth via meteorites. We combine observational and experimental data of amino acid frequencies formed by these diverse mechanisms and show that, regardless of the source, these ten early amino acids can be ranked in order of decreasing abundance in prebiotic contexts. This order can be predicted by thermodynamics. The relative abundances of the early amino acids were most likely reflected in the composition of the first proteins at the time the genetic code originated. The remaining amino acids were incorporated into proteins after pathways for their biochemical synthesis evolved. This is consistent with theories of the evolution of the genetic code by stepwise addition of new amino acids. These are hints that key aspects of early biochemistry may be universal.

431

1,3 Propanediol and its copolymers: Research, development and industrialization  

Abstract 1,3 Propanediol (PDO), is now taking the transition from a traditional specialty chemical to a commodity chemical . The market for PDO is growing rapidly as the technology develops. With the advancing PDO production technology, polytrimethylene terephthalate (PTT) as a new type of polyester has been applied in carpet and textile fibers, monofilaments, films, and nonwoven fabrics, and in the engineering thermoplastics area, because PTT has unique properties compared to other polymers such as polyethylene terephthalate (PET) and polybutylene terephthalate (PBT). Responding to the environmental and sustainability factors, one or two step fermentation technology for PDO production has attracted people's attention. A novel flexible process for PDO production by using aerobic fermentati...

432

Syntheses of random PET-co-PTTs and some related copolyesters by entropically-driven ring-opening polymerizations and by melt blending: Thermal properties and crystallinity  

Abstract A library of random poly(ethylene terephthalate) (PET), poly(trimethylene terephthalate) (PTT), and seven PET-PTT copolymers has been prepared in a high throughput manner by entropically-driven ring-opening polymerizations of the corresponding macrocyclic oligomers. The products have been investigated by differential scanning calorimetry and wide angle X-ray diffraction. They show that the 50:50 copolymer displays a crystalline phase. The same phase can be formed by in situ transesterification when a 50:50 mixture of PET and PTT is melt blended. Poly(butylene terephthalate) (PBT)-PET and PTT-PBT 50:50 copolymers also show crystal phases. 2010 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2011

433

Endogenous red blood cell membrane fatty acids and sudden cardiac arrest  

Little is known of the associations of endogenous fatty acids with sudden cardiac arrest (SCA). We investigated the associations of SCA with red blood cell membrane fatty acids that are end products of de novo fatty acid synthesis: myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1 n7), vaccenic acid (18:1 n7), stearic acid (18:0), oleic acid (18:1 n9), and a related fatty acid, cis-7 hexadecenoic acid (16:1 n9). We used data from a population-based case-control study where cases, aged 25 to 74 years, were out-of-hospital SCA patients attended by paramedics in Seattle, WA (n = 265). Controls, matched to cases by age, sex, and calendar year, were randomly identified from the community (n = 415). All participants were free of prior clinically diagnosed heart disease. We obser...

434

Comparative proteomic analysis of differentially expressed proteins in ?-aminobutyric acid enhanced Arabidopsis thaliana tolerance to simulated acid rain.  

Acid rain is a worldwide environmental issue that has seriously destroyed forest ecosystems. As a highly effective and broad-spectrum plant resistance-inducing agent, ?-aminobutyric acid could elevate the tolerance of Arabidopsis when subjected to simulated acid rain. Using comparative proteomic strategies, we analyzed 203 significantly varied proteins of which 175 proteins were identified responding to ?-aminobutyric acid in the absence and presence of simulated acid rain. They could be divided into ten groups according to their biological functions. Among them, the majority was cell rescue, development and defense-related proteins, followed by transcription, protein synthesis, folding, modification and destination-associated proteins. Our conclusion is ?-aminobutyric acid can lead to a large-scale primary metabolism change and simultaneously activate antioxidant system and salicylic acid, jasmonic acid, abscisic acid signaling pathways. In addition, ?-aminobutyric acid can reinforce physical barriers to defend simulated acid rain stress. PMID:21500342

435

The effect of propionic acid and valeric acid on the cell cycle in root meristems of Pisum sativum  

Propionic acid and valeric acid at 1mM reduced the mitotic index of root meristem cells of Pisum sativum to < 1% after 12 hr in aerated White's medium. This effect varied with different acid concentrations. After a 12 hr exposure to either acid, seedlings transferred to fresh medium without either acid, resumed their normal mitotic index after 12 hr, with a burst of mitosis 8 hr post-transfer. Exposure of root meristem cells to either acid also inhibited ({sup 3}H)-TdR incorporation. Neither acid significantly altered the distribution of meristematic cells in G1 and G2 after 12 hr. The incorporation of ({sup 3}H) - uridine was also unaltered by the addition of either acid. This information suggests that propionic acid and valeric acid, limit progression through the cell cycle by inhibiting DNA synthesis and arresting cells in G1 and G2. These results were consistent with previous data which utilized butyric acid.

436

Propyl gallate synthesis using acidophilic tannase and simultaneous production of tannase and gallic acid by marine Aspergillus awamori BTMFW032.  

Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 ?g/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 ?g/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase. PMID:21279470

437

Synthesis and anticoagulant activity of bioisosteric sulfonic-Acid analogues of the antithrombin-binding pentasaccharide domain of heparin.  

Two pentasaccharide sulfonic acids that were related to the antithrombin-binding domain of heparin were prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic-acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic-acid esters were found to be excellent donors and acceptors in the glycosylation reactions. Throughout the synthesis, the hydroxy groups to be methylated were masked in the form of acetates and the hydroxy groups to be sulfated were masked with benzyl groups. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of these new sulfonic-acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor?Xa with outstanding efficacy; however, the introduction of the third sulfonic-acid moiety resulted in a notable decrease in the anti-Xa activity. The difference in the biological activity of the disulfonic- and trisulfonic-acid counterparts could be explained by the different conformation of their L-iduronic-acid residues. PMID:22782535

438

Functionalization of different polymers with sulfonic groups as a way to coat them with a biomimetic apatite layer.  

Covalent coupling of sulfonic group (-SO 3H) was attempted on different polymers to evaluate efficacy of this functional group in inducing nucleation of apatite in body environment, and thereupon to design a simple biomimetic process for preparing bonelike apatite-polymer composites. Substrates of polyethylene terephthalate (PET), polycaprolactam (Nylon 6), high molecular weight polyethylene (HMWPE) and ethylene-vinyl alcohol co-polymer (EVOH) were subjected to sulfonation by being soaked in sulfuric acid (H2SO4) or chlorosulfonic acid (ClSO 3H) with different concentrations. In order to incorporate calcium ions, the sulfonated substrates were soaked in saturated solution of calcium hydroxide (Ca(OH)2). The treated substrates were soaked in a simulated body fluid (SBF). Fourier transformed infrared spectroscopy, thin-film X-ray diffraction, and scanning electron microscopy showed that the sulfonation and subsequent Ca(OH)2 treatments allowed formation of -SO3H groups binding Ca2+ ions on the surface of HMWPE and EVOH, but not on PET and Nylon 6. The HMWPE and EVOH could thus form bonelike apatite layer on their surfaces in SBF within 7 d. These results indicate that the -SO3H groups are effective for inducing apatite nucleation, and thereby that surface sulfonation of polymers are effective pre-treatment method for preparing biomimetic apatite on their surfaces. PMID:17554598

439

Diisononyl 1,2-cyclohexanedicarboxylic acid (DINCH) and Di(2-ethylhexyl) terephthalate (DEHT) in indoor dust samples: concentration and analytical problems.  

Possible human health effects of phthalate plasticizers have been intensely discussed during the last decade. Di(2-ethylhexyl) phthalate (DEHP), the phthalate acid ester with the largest production volume worldwide, has been substituted by new compounds like Diisononyl 1,2-cyclohexanedicarboxylic acid (DINCH) or Di(2-ethylhexyl) terephthalate (DEHT) in many applications. There are numerous reports about concentration levels of phthalates in indoor environments, but data on concentrations of these alternative plasticizers are not available yet. Also, the methods for the determination of phthalate substitutes are not yet established. This study presents the results achieved by quantification using different analytical methods. Data on the concentration of DEHT and DINCH in 953 dust samples from German households are presented. These samples were obtained in four different studies conducted from 1997 to 2009. Maximum concentrations of 110 mg DINCH/kg dust and 440 mg DEHT/kg dust were found. Especially the amount of DINCH has increased significantly after the market introduction of this plasticizer in 2002. Up to the beginning of 2006, DINCH was found in 44% of the dust samples. Dust samples collected in 2009 indicate an increased concentration for both softeners. PMID:20851676

440

Pros and cons of analytical methods to quantify surrogate contaminants from the challenge test in recycled polyethylene terephthalate.  

Different analytical methods were optimized and applied to quantify certain surrogate contaminants (toluene, chlorobenzene, phenol, limonene and benzophenone) in samples of contaminated and recycled flakes and virgin pellets of polyethylene terephthalate (PET) coming from the industrial challenge test. A screening analysis of the PET samples was carried out by direct solid-phase microextraction (SPME) in headspace mode (HS). The methods developed and used for quantitative analysis were a) total dissolution of PET samples in dichloroacetic acid and analysis by HS-SPME coupled to gas chromatography-mass spectrometry (GC-MS) and, b) dichloromethane extraction and analysis by GC-MS. The concentration of all surrogates in the contaminated PET flakes analyzed by HS-SPME method was lower than expected according to information provided by the supplier. Dichloroacetic acid interacted with the surrogates, resulting in a tremendous decrease of limonene concentration. The degradation compounds from limonene were identified. Dichloromethane extraction and GC-MS analysis evidenced the highest values of analytes in these PET samples. Based on the foregoing data, the efficiency of the recycling process was evaluated, whereby the removal of 99.9% of the surrogates proceeding from the contaminated flakes was confirmed. PMID:21241848

 
 
 
 
441

Selective biological response of human pulmonary microvascular endothelial cells and human pulmonary artery smooth muscle cells on cold-plasma-modified polyester vascular prostheses.  

The aim of this work was to improve the hemocompatibility and the selectivity according to cells of non-woven poly(ethylene terephthalate) (PET) membranes. Non-woven PET membranes were modified by a combined plasma-chemical process. The surface of these materials was pre-activated by cold-plasma treatment and poly(acrylic acid) (PAA) was grafted by the in situ free radical polymerization of acrylic acid (AA). The extent of this reaction and the number of carboxylic groups incorporated were evaluated by colorimetric titration using toluidine blue O. All samples were characterized by SEM, AFM and thermogravimetric analysis, and the mechanical properties of the PAA grafted sample were determined. A selective cell response was observed when human pulmonary artery smooth muscle cells (HPASMC) or human pulmonary micro vascular endothelial cells (HPMEC) were seeded on the modified surfaces. HPASMC proliferation decreased about 60%, while HPMEC proliferation was just reduced about 10%. PAA grafted samples did not present hemolytic activity and the platelet adhesion decreased about 28% on PAA grafted surfaces. PMID:22002636

442

Spectroscopic and kinetic studies on the degradation of methylene blue using the supramolecular coordination polymer [(Ph3Sn)4FeCN(6)] as catalyst.  

The structure of the supramolecular coordination polymer (SCP), [(Ph(3)Sn)(4)Fe(CN)(6)], 1, consists of octahedral [Fe(CN)(6)](4-) building blocks which are connected by the TBPY-5 configured Ph(3)Sn(CN…)(2) fragments creating 3D-network structure that contains terminal cyanide groups. The catalytic behavior of the SCP 1 was utilized for Fenton and photo-Fenton degradation of methylene blue dye (MB). The plot of kinetic degradation indicates pseudo first-order rate with respect to the MB dye concentration, K(obs.)=0.071 min(-1). On the other hand, the observed rate constant of the photo catalytic degradation of MB equals to 1.45 min(-1) indicating that irradiation enhances, significantly, the rate of degradation of MB dye. Discoloration of the dye was obtained in less than 3h. Meanwhile, the conjugated structure and the phenyl rings of the MB molecule were destroyed or even broken down into small organic acids and inorganic ions, as indicated by FT-IR spectra. Disodium salt of terephthalic acid photoluminescence probing technology and radical scavenging measurements were carried out to identify the reactive oxygen species. The different parameters that affect MB degradation rate were evaluated. Moreover, the efficiency of recycled the SCP 1 and the mechanism of degradation of MB dye was investigated. PMID:22446773

443

Methanol`s role in reducing greenhouse gases  

Methanex New Zealand produces methanol, a globally traded commodity, at its Taranaki petrochemical plants. Methanol is an input into a number of products that have positive environmental impacts in reducing greenhouse gases. The methanol industry and Methanex, being a key player in that industry, continue to focus on initiatives to reduce greenhouse gases. The paper explains how methanol is manufactured from gas in the Maui and Kapuni fields. Although CO{sub 2} is emitted during its production, it is the building block of a number of products that aid the environment and reduce greenhouse gases. These include formaldehyde, acetic acid, terephthalic acid, chlorine dioxide and methyl tertiary butyl ether (MTBE). Methanex is supporting a project to develop a diesel/methanol mixture which can be used interchangeably with standard diesel fuels in existing vehicles. Trials carried out on buses in Santiago showed large reductions in particulates and nitrous oxide emissions. Commercialisation of a methanol based fuel cell for electric vehicles is progressing. Text accompanies 14 slides shown at the conference.

444

Acidity and basicity of hydrotalcite derived mixed Mg-Al oxides studied by test reaction of MBOH conversion and temperature programmed desorption of NH{sub 3} and CO{sub 2}  

Mg-Al hydrotalcites intercalated with five different interlayer anions--CO{sub 3}{sup 2-}, SO{sub 4}{sup 2-}, Cl{sup -}, HPO{sub 4}{sup 2-} or terephthalate--were synthesized by either the coprecipitation or ion-exchange method. The structure of the as-synthesized samples and the presence of intended anions in the interlayer gallery of hydrotalcites were determined by X-ray diffraction and FTIR spectroscopy. On calcination at 600 deg. C the materials were transformed into mixed metal oxides. The kind of the counterbalancing anions present in the parent hydrotalcite influences strongly textural parameters of the obtained Mg-Al oxides. Both temperature-programmed desorption of NH{sub 3} and CO{sub 2}, and test reaction of 2-methyl-3-butyn-2-ol (MBOH) conversion were used to determine the acidity and basicity of the samples. The hydrotalcite derived mixed Mg-Al oxides showed the presence of Broensted and Lewis acid and base sites. However, the strong basic character of the solids caused that acetone and acetylene were observed as the major products of MBOH conversion.

445

An evaporation study for phthalic acids--a rapid method for pharmaceutical characterization.  

The objective of this study was to develop and analyze an analytical method in order to evaluate preformulation candidates by their thermodynamic parameters and evaporation characteristics. Ortho, meta and tere-phthalic acids were chosen as model compounds. The relative advantages and disadvantages of a rapid thermogravimetric method have been studied in detail, which would aid in the preformulation characterization for pharmaceuticals. Methyl paraben was taken as the model compound for calibration, as its evaporation characteristics are well known. Using the Antoine and the Langmuir equation for evaporation conjointly, the parameter k, known as the coefficient of evaporation was determined. The value for this constant was validated by three methods simultaneously. Previously the use of such methods for compounds having uninhibited zero order evaporation has been documented. In the present study, phthalic acid was chosen as the model compound since its evaporation is a two-step overlapping phenomenon. In this study we have shown the use of Pressure Differential Scanning Calorimetry in separating such simultaneous endothermic processes. The Clausius-Clapeyron equation seemingly has anomalous behavior for vapor pressure over high temperature ranges. In this study a modification of the equation has been suggested to take into account the changes in the heat capacities that result due to high temperature effects. This study aims at documenting a concise method for rapid pharmaceutical characterization and suggests modifications for some basic thermodynamic parameters over higher temperature ranges. PMID:11948554

446

Microbial bioconversion of pollutants  

Microorganisms totally detoxicate xenobiotics of various chemical structures, which are serious and, in some cases, very hazardous pollutants. At present, the efforts of a number of researchers promoted the establishment in this country of a collection of microorganisms able to degrade volatile toxic pollutants--toluene, isomeric xylenes, styrene, alpha-methylstyrene, crotonaldehyde; widely distributed xenobiotics chlorobenzoic acids; isomeric aryldicarboxylic acids; and ecologically hazardous pollutants such as aromatic nitrocompounds. The active strains-destructors are mainly representatives of the genera Pseudomonas and Rhodococcus. Research into their physiological characteristics, key enzymes, pathways of xenobiotics degradation, genetic mechanisms determining the degradation of these foreign compounds, and behaviour of the strains in a real environment made it possible to develop the theoretical principles of using these microbial cultures to purify real industrial wastes and remediate polluted areas of soil and water. Improvement of the methods of immobilizing the active xenobiotics-degrading strains on cheap and efficient carriers made it possible to significantly intensify the cleanup process of industrial wastes and eliminate a number of problems during the development of the biotechnologies for industrial waste cleanup. Successfully operated at present are the biotechnologies of the local cleanup of waste waters of terephthalate production, microbial purification of industrial waste waters in nylon-66 production from hexamethylenediamine, purification of coke production wastes from phenols, waste waters of polyisocyanate production from aromatic amines, local purification of waste waters in synthetic rubber production from alpha-methylstyrene, acetaldehyde production wastes from crotonaldehyde and mercury. 97 references.

447

Biodegradation of plasticizers by Rhodococcus rhodochrous.  

Rhodococcus rhodochrous was grown in the presence of one of three plasticizers: bis 2-ethylhexyl adipate (BEHA), dioctyl phthalate (DOP) or dioctyl terephthalate (DOTP). None of the plasticizers were degraded unless another carbon source, such as hexadecane, was also present. When R. rhodochrous was grown with hexadecane as a co-substrate, BEHA was completely degraded and the DOP was degraded slightly. About half of the DOTP was degraded, if hexadecane were present. In all of these growth studies, the toxicity of the media, which was assessed using the Microtox assay, increased as the organism degraded the plasticizer. In each case, there was an accumulation of one or two intermediates in the growth medium as the toxicity increased. One of these was identified as 2-ethylhexanoic acid and it was observed for all three plasticizers. Its concentration increased until degradation of the plasticizers had stopped and it was always present at the end of the fermentation. The other intermediate was identified as 2-ethylhexanol and this was only observed for growth in the presence of BEHA. The alcohol was observed early in the growth studies with BEHA and had disappeared by the end of the experiment. Both the 2-ethylhexanol and 2-ethylhexanoic acid were shown to be toxic and their presence explained the increase of toxicity as the fermentations proceeded. The appearance of these intermediates was consistent with similar degradation mechanisms for all three plasticizers involving hydrolysis of the ester bonds followed by oxidation of the released alcohol. PMID:12688586

448

Impurities in Kevlar 49 fibers  

The impurities in Kevlar 49 fibers (poly(p-phenylene terephthalamide)PPTA) are reported and discussed in terms of the fiber fabrication processes. These impurities were monitored by inductively coupled plasma emission and optical emission spectroscopy. The principal impurities Na/sub 2/SO/sub 4/ and total S were analyzed chemically. From these chemical analyses together with C, N, H elemental analyses we show that there are 1.5 wt % impurities present in Kevlar 49 fibers of which approx. 50% are in the form of Na/sub 2/SO/sub 4/ and the remainder probably in the form of benzene sulfonic -SO/sub 3/H PPTA side groups. There are 3 of these acid groups per each PPTA macromolecule. Organic impurities, such as terephthalic acid are discussed in the light of degradation studies of PPTA-H/sub 2/SO/sub 4/ spinning dopes. Electron microprobe x-ray spectroscopy and laser-induced damage studies were utilized to investigate the distribution of impurities through the fiber cross-section. The distribution of impurities throughout the fiber are determined by the fiber fabrication processes and are discussed at the microscopic and molecular level. The defects caused by these impurities and their effect on the deformation and failure modes are also considered. 22 references, 3 tables.

449

Syntheses, Structures, and Luminescent Properties of Two Novel Coordination Polymers with Mixed Ligands  

Two novel metalâ??organic coordination polymers {[Pb2(MIP)2(BDC)2]·H2O} n 1 and [Cd(MIP)(NDC)] n 2 [MIP = 2-(3-methoxyphenyl)-1H-imidazo [4,5-f] [1, 10] phenanthroline, BDC = terephthalic acid, NDC = naphthalene-1,4-dicarboxylic acid] were obtained from hydrothermal reaction and characterized by elemental analysis, thermogravimetric (TG) analysis, infrared spectrum (IR) and single-crystal X-ray diffraction. The coordination polymers crystallize in triclinic, space group P-1 with a = 1.0335(2), b = 1.4224(3), c = 1.8156(4) nm, β = 106.088(3)° for complex 1 and the complex 2 crystallizes in monoclinic, space group P2(1)/n with a = 1.2562(8), b = 1.4800(9), c = 1.3723(8) nm, β = 97.257(1)°, respectively. The metal ions Pb(II) are located in [:PbN2O4] pentagonal bip...

450

Polyesters of 2-Pyrone-4,6-Dicarboxylic Acid (PDC) Obtained from a Metabolic Intermediate of Lignin  

2-Pyrone-4,6-dicarboxylic acid (PDC), a chemically stable metabolic intermediate of lignin, was for the first time utilized to prepare polyesters. Condensation polymerization at about 200 °C with 1,2-ethanediol, 1,3-propanediol or bis(2-hydroxyethyl) terephthalate was effectively promoted by the catalytic amount of Sb2O3. The corresponding polyesters, P(PDC2), P(PDC3) or P(PDCB)x (x: PDC unit content, and x?0.5), became insoluble when the number-average molecular weight exceeded about 4×103. Due to the pseudo-aromatic nature of PDC ring, these polyesters were thermally stable up to 210 °C. From the measurements of strain-stress characteristics, Yong’s modulus of P(PDC2) or P(PDC3) was as high as 250 MPa and 2 times larger than that of amorphous PET. The accelerated hydrolysis of P(PDC2) or P(PDC3) in basic, acidic, and pure water at 60 °C gave 60–100% degradation in 1.5–3 weeks. The degradability could be controlled by changing the PDC content “x” in the case of P(PDCB)x, because the lactone ring cleavage as well as ester hydrolysis were considered to be the major events in the main-chain scission.   

451

New approach for the synthesis of [18F]fluoroethyltyrosine for cancer imaging: simple, fast, and high yielding automated synthesis.  

O-(2-[(18)F]fluoroethyl)-L-tyrosine ([(18)F]FET) is one of the first (18)F-labeled amino acids for imaging amino acid metabolism in tumors. This tracer overcomes the disadvantages of [(18)F]fluorodeoxyglucose, [(18)F]FDG, and [(11)C]methionine, [(11)C]MET. Nevertheless, the various synthetic methods providing (18)F[FET] exhibit a big disadvantage concerning the necessity of two purification steps during the synthesis including HPLC purification, which causes difficulties in the automation, moderate yields, and long synthesis times >60 min. A new approach for the synthesis of [(18)F]FET is developed starting from 2-bromoethyl triflate as precursor. After optimization of the synthesis parameters including the distillation step of [(18)F]-FCH(2)CH(2)Br combined with the final purification of [(18)F]FET using a simple solid phase extraction instead of an HPLC run the synthesis [(18)F]FET could be significantly simplified, shortened, and improved. The radiochemical yield (RCY) was about 45% (not decay corrected and calculated relative to [(18)F]F(-) activity that was delivered from the cyclotron). Synthesis time was only 35 min from the end of bombardment (EOB) and the radiochemical purity was >99% at the end of synthesis (EOS). Thus, this simplified synthesis for [(18)F]FET offers a very good option for routine clinical use. PMID:19804977

452

Convenient One-Pot Synthesis of Sulfonamides from Thiols using Trichloroisocyanuric Acid  

A convenient synthesis of sulfonamides from thiols is described. In situ preparation of sulfonyl chlorides from thiols is accomplished by oxidation with trichloroisocyanuric acid (TCCA), benzyltrimethylammonium chloride and water (2.5 equiv). The sulfonyl chlorides are then further allowed to react with excess amine in the same reaction vessel. Triethylamine can be optionally added as acid scavenger.

453

New proton conducting membranes for fuel cell applications  

In order to synthesize proton-conducting materials which retain acids in the membrane during fuel cell operating conditions, the synthesis of poly(vinylphosphonic acid) grafted polybenzimidazole (PVPA grafted PBI) and the fabrication of multilayer membranes are mainly focussed in this dissertation. ...

454

P  

acids; each by a long and laborious synthesis, and blending these in the optimum .... As the columns on the left show, vapor phase thermal reactions of methane .... The range of possibilities by varying solid support, temperature, etc. , needs to be ... offers the possibility of feeding amino acids in peptide bound polymers with ...

455

Isocitrate Dehydrogenase and Glutamate Synthesis in Acetobacter suboxydans1  

Acetobacter suboxydans is an obligate aerobe for which an operative tricarboxylic acid cycle has not been demonstrated. Glutamate synthesis has been reported to occur by mechanisms other than those utilizing isocitrate dehydrogenase, a tricarboxylic acid cycle enzyme not previously detected in this ...

456

Nonfunctional Tricarboxylic Acid Cycle and the Mechanism of Glutamate Biosynthesis in Acetobacter suboxydans  

Acetobacter suboxydans does not contain an active tricarboxylic acid cycle, yet two pathways have been suggested for glutamate synthesis from acetate catalyzed by cell extracts: a partial tricarboxylic acid cycle following an initial condensation of oxalacetate and acetyl coenzyme A. and the citrama...

457

Novel Synthesis of 4- or 6-Substituted Indirubin Derivatives  

A simple and convenient route for synthesis of a series of 4- or 6-substituted indirubin derivatives by oxidation and subsequent condensation of indoxyl and isatin is described. Acidic reaction conditions are crucial to the condensation of 4-substituted derivatives, whereas for the condensation of 6-substituted derivatives, both acidic and basic conditions work well.

458

Purification, Characterization, and Potential Bacterial Wax Production Role of an NADPH-Dependent Fatty Aldehyde Reductase from Marinobacter aquaeolei VT8? †  

Wax esters, ester-linked fatty acids and long-chain alcohols, are important energy storage compounds in select bacteria. The synthesis of wax esters from fatty acids is proposed to require the action of a four-enzyme pathway. An essential step in the pathway is the reduction of a fatty aldehyde to t...

459

A Type II Pathway for Fatty Acid Biosynthesis Presents Drug Targets in Plasmodium falciparum  

It has long been held that the malaria parasite, Plasmodium sp., is incapable of de novo fatty acid synthesis. This view has recently been overturned with the emergence of data for the presence of a fatty acid biosynthetic pathway in the relict plastid of P. falciparum (known as the apicoplast). Thi...

460

Investigations on the effects of forage source and feed particle size on ruminal fermentation and microbial protein synthesis in vitro  

The synthesis of microbial protein in the rumen has a major impact on protein- and amino acid supply in ruminants. The amount and amino acid composition of the protein that enters the small intestine primarily depends on diet formulation. In the present studies the effects of maize silage (MS) and g...

 
 
 
 
461

Esterification of Eschericia coli tRNAs with D-Histidine and D-Lysine by Aminoacyl-tRNA Synthetases  

It is generally believed that only L-amino acids are acceptable in protein synthesis, though some D-amino acids, including D-tyrosine, D-aspartate, and D-tryptophan are known to be bound enzymatically to tRNAs. In this report, we newly show that D-histidine and D-lysine are also able to be the substrates of respective Escherichia coli aminoacyl-tRNA synthetases.   

462

Ligand-binding regulation of LXR/RXR and LXR/PPAR heterodimerizations: SPR technology-based kinetic analysis correlated with molecular dynamics simulation  

Liver X receptor (LXR) and peroxisome proliferator-activated receptor (PPAR) are two members of nuclear receptors involved in the nutrient metabolisms of dietary fatty acid and cholesterol. They are found to be of cross-talk function in that LXR regulates fatty acid synthesis and PPAR controls fatty...

463

Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability  

The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

464

SYNTHESIS AND CHARACTERIZATION OF A NOVEL SOLID ACID CATALYST FOR IMPROVED USE OF WASTE OIL FEEDSTOCK FOR BIODIESEL PRODUCTION  

Carbon Catalyst Synthesis - Sucrose was treated directly with excess sulfuric acid sulfuric acid (9:1 mol/mol, 25°C). A carbon foam (nearly 20 fold increase in bulk volume) was immediately formed. The foam was then washed until no sulfate was dete...

465

An Expedient Synthesis of ?,?-Unsaturated Ketones Using Nitroalkenes and Sulfones  

A facile synthesis of various substituted ?,?-unsaturated ketones utilizing nitroalkenes and sulfones are described, in which conjugate addition of sulfonyl carbanions to nitroalkenes, ozonolysis or acid treatment of the resulting lithium nitronates, and subsequent elimination of sulfinic acid from keto sulfones by DBU are involved.   

466

Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.  

Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cu...

467

Incorporation of C14 From Carbon Dioxide into Sugar Phosphates, Carboxylic Acids, and Amino Acids by Clostridium thermoaceticum  

Ljungdahl, Lars (Western Reserve University, Cleveland, Ohio), and Harland G. Wood. Incorporation of C14 from carbon dioxide into sugar phosphates, carboxylic acids, and amino acids by Clostridium thermoaceticum. J. Bacteriol. 89:1055–1064. 1965.—The mechanism of synthesis of acetate from carbon dio...

468

Effect of the multistage chemical treatment of carbon nanotubes on their purity and quality of walls  

The effect of chemical methods that include the gas-phase and liquid-phase selective oxidation methods, of hydrochloric acid when used in different sequences, and of concentrated nitric acid on the purification efficiency of carbon nanotubes after their synthesis is studied. Changes in the quality of walls of this material at different stages of purification are studied physicochemically.

469

The effect of dietary supplementation with linoleic and gammalinolenic acids on the pressor response to angiotensin II--a possible role in pregnancy-induced hypertension?  

Dietary supplementation with 3 g/day linoleic acid, 32 mg/day gammalinolenic acid and co-factors for prostaglandin synthesis was given to 10 pregnant and 10 non-pregnant subjects for a week. Their pressor response to the infusion of three doses of angiotensin II (AII) (pregnant: 4, 8, 16 ng kg-1 min...

470

Glycerine and levulinic acid: renewable co-substrates for the fermentative synthesis of short-chain poly(hydroxyalkanoate) biopolymers  

Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...

471

GLYPHOSATE AFFECTS SOYBEAN ROOT EXUDATION AND RHIZOSPHERE MICROORGANISMS  

Glyphosate is a nonselective, broad-spectrum herbicide that kills plants by inhibiting the enzyme 5-enolpyruvylshikimic acid-3-phosphate synthase (EPSPS), which is necessary for synthesis of aromatic amino acids. A secondary mode of action involves infection of roots by soilborne microorganisms due ...

472

Synthesis and characterization of poly(benzobisoxazole)s and poly(benzobisthiazole)s with 2,2?-bipyridyl units in the backbone  

This paper reports the synthesis and physical properties of a series of novel bipyridine-containing poly(benzobisoxazole)s and poly(benzobisthiazole)s. The polymers were synthesized by polycondensation of 2,2?-bipyridine-5,5?-dicarboxylic acid with diaminobenzenediols in poly(phosphoric acid). Some ...

473

Total Synthesis of Bistratamide D.  

The total synthesis of the macrocyclic hexapeptide bistratamide D is reported. The synthetic strategy involved assembly of enantiomerically pure oxazole, thiazole, and oxazoline segments derived from amino acids. Macrocyclization of the hexapeptidic aminooxazoline-oxazole-thiazole carboxylic acid fragment was accomplished by activation with O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU). PMID:11674153

474

CEREBRAL LEUCINE NITROGEN METABOLISM IN CONSCIOUS RATS  

Brain glutamic acid (GLU) and gamma aminobutyric acid (GABA) derive virtually exclusively from synthesis de novo. Although glucose is the main source of their carbon skeleton, the source of nitrogen remains controversial. Because leucine (LEU) is readily transported into the brain and the brain co...

475

Automated Solid-Phase Synthesis of Hyaluronan Oligosaccharides.  

Well-defined fragments of hyaluronic acid (HA) have been obtained through a fully automated solid-phase oligosaccharide synthesis. Disaccharide building blocks, featuring a disarmed glucuronic acid donor moiety and a di-tert-butylsilylidene-protected glucosamine part, were used in the rapid and efficient assembly of HA fragments up to the pentadecamer level, equipped with a conjugation-ready anomeric allyl function. PMID:22780913

476

Leucine supplementation of a low-protein meal increases skeletal muscle and visceral tissue protein synthesis in neonatal pigs by stimulating mTOR-dependent translation initiation  

Protein synthesis and eukaryotic initiation factor (eIF) activation are increased in skeletal muscle of neonatal pigs parenterally infused with amino acids. Leucine appears to be the most effective single amino acid to trigger these effects. To examine the response to enteral leucine supplementation...

477

MODEL STUDIES FOR PREDICTING THE DIASTEREOSELECTIVITY IN THE CONDENSATION OF ALDEHYDES WITH ZINC AND COPPER-COMPLEXES OF AMINO-ACID DERIVATIVES .2. APPLICATION OF THE MODELS AND ANALYSIS OF RESULTS  

The ability to predict the stereochemical outcome of the condensation reaction between a transition metal containing a complex of amino acid derivatives and an aldehyde gives rise to the possibility of directing synthetic efforts toward the synthesis of beta-hydroxy-alpha-amino acids of known config...

478

A new chemoenzymatic synthesis of d-cloprostenol  

A new chemoenzymatic synthesis Of D-cloprostenol based on the biocatalytical resolution of anti-2-oxotricyclo[2.2.1.0]heptan-7-carboxylic acid 1 has been developed. The resolution was attempted by different approaches: esterification or reduction of the acid and hydrolysis or reduction of the corres...

479

Mutants of Escherichia coli K-12 that are resistant to a selenium analog of lipoic acid identify unknown genes in lipoate metabolism.  

Lipoic acid is a disulfide-containing cofactor required for the reactions catalyzed by alpha-ketoacid dehydrogenase enzyme complexes. We report the chemical synthesis and biological properties of lipoic acid analogs in which one or both sulfur atoms were replaced by selenium. Replacement of either t...

480

Copper/DIPEA-catalyzed, aldehyde-induced tandem decarboxylation-coupling of natural ?-amino acids and phosphites or secondary phosphine oxides.  

A copper/DIPEA-catalyzed, aldehyde-induced intermolecular decarboxylative coupling reaction of natural ?-amino acids and phosphites or secondary phosphine oxides was developed. In this process, a series of potentially useful ligands for organic synthesis and biologically important unnatural amino acid derivatives (tertiary amino phosphorus compounds) were obtained. PMID:21718035

 
 
 
 
481

Initiation of Deoxyribonucleic Acid Replication in Germinating Spores of Bacillus subtilis 168 Carrying the dnaB(Ts)134 Mutation  

The nature of the deoxyribonucleic acid synthesis reported by others to occur at 45°C in germinating spores of the temperature-sensitive deoxyribonucleic acid initiation mutant of Bacillus subtilis 168, TsB134, has been investigated. Density transfer experiments, using 5-bromouracil, show that a nor...

482

Overexpression of Fatty Acid Synthase in Middle Eastern Epithelial Ovarian Carcinoma Activates AKT and Its Inhibition Potentiates Cisplatin-Induced Apoptosis  

Fatty acid synthase (FASN), the enzyme responsible for de novo synthesis of fatty acids, has been shown to be deregulated in several cancers, including epithelial ovarian carcinoma (EOC). In this study, we investigated the function of the FASN signaling pathway in a large series of Middle Eastern EO...

483

Glutamate transporter type 3 knockout reduces brain tolerance to focal brain ischemia in mice  

Excitatory amino-acid transporters (EAATs) transport glutamate into cells under physiologic conditions. Excitatory amino-acid transporter type 3 (EAAT3) is the major neuronal EAAT and also uptakes cysteine, the rate-limiting substrate for synthesis of glutathione. Thus, we hypothesize that EAAT3 con...

484

DNA-RNA-Protein - Nobel Prize Educational Tutorial  

The Nobel Prize in Physiology or Medicine 1959 was awarded jointly to Severo Ochoa and Arthur Kornberg "for their discovery of the mechanisms in the biological synthesis of ribonucleic acid and deoxyribonucleic acid." This tutorial goes through DNA replication, RNA transcription, RNA processing, mRNA transport, and protein translation. The tutorial has two levels: basic and advanced.

485

Dianion of Sulfinylacetone as a Synthetic Equivalent of ?-Enolate of Propionic Acid: A Novel Synthesis of Carboxylic Acids from Alkyl Halides with Three-Carbon Elongation  

The reaction of the dianion of phenylsulfinylacetone with alkyl halides afforded ?-keto sulfoxides, which were first chlorinated with hexachloroethane and then treated successively with KH and t-BuLi to give carboxylic acids in three-steps in moderate overall yields from the alkyl halides. This procedure affords a good method for a synthesis of carboxylic acids from alkyl halides with three-carbon elongation.   

486

Effect of the multistage chemical treatment of carbon nanotubes on their purity and quality of walls  

The effect of chemical methods that include the gas-phase and liquid-phase selective oxidation methods, of hydrochloric acid when used in different sequences, and of concentrated nitric acid on the purification efficiency of carbon nanotubes after their synthesis is studied. Changes in the quality of walls of this material at different stages of purification are studied physicochemically.

487

THE EFFECT OF DIPHTHERIA TOXIN ON THE METABOLISM OF HELA CELLS : II. EFFECT ON NUCLEIC ACID METABOLISM  

The effect of toxin on the incorporation of uridine and thymidine into nucleic acids was investigated. P32 orthophosphate incorporation into the nucleoside phosphate fraction was also investigated. No early effect of toxin on nucleic acid synthesis was evident and only a slight effect of toxin on n...

488

Mechanism and synthetic possibilities of radiation-initiated ring opening reactions in. cap alpha. -oxides  

The principal features of radiation-initiated reactions of ..cap alpha..-oxides with amines, acids, and alcohols were studied, theories are proposed for the mechanism of these reactions, and their use in synthesis is discussed. It is assumed that ionizing radiation is responsible for the formation in the reaction mixture during amine hydrolysis of an acid type catalyst for the epoxy ring opening.

489

Regulation of the Bacterial Cell Wall: Analysis of a Mutant of Bacillus subtilis Defective in Biosynthesis of Teichoic Acid  

Bacillus subtilis 168ts-200B is a temperature-sensitive mutant of B. subtilis 168 which grows as rods at 30 C but as irregular spheres at 45 C. Growth at the nonpermissive temperature resulted in a deficiency of teichoic acid in the cell wall. A decrease in teichoic acid synthesis coupled with the r...

490

Normal Fur Development and Sebum Production Depends on Fatty Acid 2-Hydroxylase Expression in Sebaceous Glands*  

2-Hydroxylated fatty acid (HFA)-containing sphingolipids are abundant in mammalian skin and are believed to play a role in the formation of the epidermal barrier. Fatty acid 2-hydroxylase (FA2H), required for the synthesis of 2-hydroxylated sphingolipids in various organs, is highly expressed in ski...

491

Protein and Nucleic Acid Synthesis in Two Mutants of Escherichia coli with Temperature-Sensitive Aminoacyl Ribonucleic Acid Synthetases1  

Eidlic, Lia (Purdue University, Lafayette, Ind.), and Frederick C. Neidhardt. Protein and nucleic acid synthesis in two mutants of Escherichia coli with temperature-sensitive aminoacyl ribonucleic acid synthetases. J. Bacteriol. 89:706–711. 1965.—Two temperature-sensitive mutants of Escherichia coli...

492

Boron-containing amino carboxylic acid compounds and uses thereof  

Novel compounds which are useful for boron neutron capture therapy (BNCT) are disclosed. The compounds comprise a stable boron-containing group and an aminocycloalkane carboxylic acid group or a boronated acyclic hydrocarbon-linked amino carboxylic acid. Methods for synthesis of the compounds and for use of the compounds in BNCT are disclosed.

493

Alanine scanning site-directed mutagenesis of the zinc fingers of transcription factor ADR1: residues that contact DNA and that transactivate.  

To identify functionally important amino acids in the two zinc fingers of transcription factor ADR1 [alcohol dehydrogenase (ADH) II synthesis regulator], oligonucleotide-directed mutagenesis was used to substitute alanine for the original amino acid at each position in both fingers. The effects of t...

494

A facile and convenient approach for the one-pot synthesis of 2,4(1H,3H)-quinazolinediones  

A fast and efficient method is described for the one-pot synthesis of 2,4(1H,3H)-quinazolinediones by cyclization reaction of anthranilic acid derivatives with potassium cyanate and acetic acid in PEG. Good to high yields of the products obtain in short reaction times with simple work-up.

495

Alteration of Chain Length Substrate Specificity of Aeromonas caviae R-Enantiomer-Specific Enoyl-Coenzyme A Hydratase through Site-Directed Mutagenesis  

Aeromonas caviae R-specific enoyl-coenzyme A (enoyl-CoA) hydratase (PhaJAc) is capable of providing (R)-3-hydroxyacyl-CoA with a chain length of four to six carbon atoms from the fatty acid ?-oxidation pathway for polyhydroxyalkanoate (PHA) synthesis. In this study, amino acid substitutions were int...

496

Stimulation of Protein Synthesis in Normal and Tumor Cells by Agents Modifying the Cell Surface.  

The report discusses the study of the intensity of protein synthesis in cells of various origin (both malignant and normal), by the inclusion of C14 of amino acids in the acid-insoluble fraction. For agents modifying the cell surface, several substances h...

497

Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis  

The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

498

Nutritional regulation of mTOR signaling in skeletal muscle of neonates in vivo  

The post-prandial rise in both amino acids and insulin independently stimulate protein synthesis in the rapidly growing skeletal muscle of the neonate. Leucine, in particular, is important in mediating the response to amino acids. We have shown that a physiological rise in leucine, but not isoleuc...

499

Rapid analysis of specific DNA sequences by Fluorescent single-molecule detection  

We have developed a technique for the detection of specific nucleic acid sequences at the single molecule level of sensitivity. This method is based on the synthesis of a highly fluorescent reporter molecule using the target nucleic acid as a template.

500

Two inducers of plant defense responses, 2,6-dichloroisonicotinec acid and salicylic acid, inhibit catalase activity in tobacco.  

2,6-Dichloroisonicotinic acid (INA) and salicylic acid (SA) are potent inducers of plant defense responses including the synthesis of pathogenesis-related (PR) proteins and the development of enhanced disease resistance. A soluble SA-binding protein has been purified from tobacco with an affinity an...