WorldWideScience

Sample records for semen plasma glycerylphosphorylcholine

  1. Efecto del plasma seminal sobre el estado redox del semen equino criopreservado / Effect of seminal plasma on the redox state of cryopreserved stallion semen

    Scientific Electronic Library Online (English)

    Edison, Pizarro L; Giovanni, Restrepo B; José, Echeverry Z; Benjamín, Rojano.

    2013-12-01

    Full Text Available Objetivo. Determinar el efecto del plasma seminal sobre la generación de especies reactivas de oxígeno (ERO) y la peroxidación lipídica de semen equino criopreservado y su asociación con parámetros de calidad seminal. Materiales y métodos. El semen de cinco caballos de la raza criollo colombiano (do [...] s eyaculados cada uno), fue criopreservado mediante un protocolo de congelación rápida, empleando un diluyente leche-yema de huevo, suplementado con 0%, 10% y 20% de plasma seminal equino. En muestras de semen fresco y criopreservado se evaluó la generación de ERO y la peroxidación lipídica por espectrofluorimetría, y los parámetros de calidad seminal de movilidad progresiva, vitalidad e integridad de membrana, mediante microscopia de contraste de fase. Para el análisis estadístico se ajustaron modelos mixtos y se realizaron análisis de regresión y correlación. Resultados. Se hallaron promedios post-descongelación de movilidad progresiva, vitalidad e integridad de membrana de 37.8%±20.2, 50.6% ± 14.6 y 37.8% ± 15.5, respectivamente. Para el semen fresco y criopreservado suplementado con 0%, 10% y 20% de plasma seminal, los promedios de producción de ERO (URF) fueron de 13.34±10.7, 16.15 ± 13.5, 17.32 ± 16 y 22.98 ± 19.4, respectivamente; mostrando un incremento estadísticamente significativo (p?0.05) en la producción de ERO por efecto de la criopreservación y la suplementación con plasma seminal. Los promedios de peroxidación lipídica (nmolMDA/ml) para estos mismos tratamientos, fueron de 0.41 ± 0.25, 0.72±0.37, 0.51 ± 0.29 y 0.47±0.26, respectivamente; mostrando una reducción significativa (p?0.05) de la peroxidación lipídica del semen suplementado con 10% y 20% de plasma seminal, respecto al semen no suplementado (0%). Conclusiones. El plasma seminal reduce la peroxidación lipídica del semen equino criopreservado. Abstract in english Objective. Determine the effect of seminal plasma on the generation of reactive oxygen species (ROS) and lipid peroxidation of cryopreserved stallion semen, and its association with semen quality parameters. Materials and methods. The semen of five stallions of Colombian creole breed (two ejaculates [...] each) was cryopreserved by a rapid freezing protocol, using a milk-egg yolk extender supplemented with 0%, 10% and 20% of equine seminal plasma. The samples of fresh and cryopreserved semen were evaluated for ROS generation and lipid peroxidation by spectrofluorimetry, and semen quality parameters of progressive motility, vitality and membrane integrity using phase contrast microscopy. Mixed models were adjusted for statistical, regression, and correlation analysis. Results. Post-thaw averages of progressive motility, vitality and integrity of membrane of 37.8% ± 20.2, 50.6% ± 14.6 and 37.8 ± 15.5%, respectively were found. For fresh and cryopreserved semen supplemented with 0%, 10% and 20% of seminal plasma, the averages of ROS production (RFU) were 13.34 ± 10.7, 16.15 ± 13.5, 17.32 ± 16 and 22.98 ± 19.4, respectively; showing a statistically significant increase (p?0.05) of ROS production by effect of cryopreservation and seminal plasma supplementation. The averages of lipid peroxidation (nmolMDA / ml) for these same treatments were 0.41 ± 0.25, 0.72 ± 0.37, 0.51 ± 0.29 and 0.47 ± 0.26, respectively; showing a significant decrease (p?0.05) of lipid peroxidation of semen supplemented with 10% and 20% of seminal plasma compared to unsupplemented semen (0%). Conclusions. Seminal plasma reduces lipid peroxidation of stallion cryopreserved semen.

  2. Relationship of zinc concentrations in blood and seminal plasma with various semen parameters in infertile subjects

    International Nuclear Information System (INIS)

    To find out relationship of zinc concentrations in blood and seminal plasma with various semen parameters between fertile and infertile men. (JPMC), Karachi and Department of Biochemistry. Basic Medical Sciences Institute, JPMC, Karachi. Fifty eight primary infertile male subjects, without any treatment, who had regular unprotected intercourse for at least 12 months without conception with their partners, aged 20-40 years, were selected from Infertility Clinic Jinnah Postgraduate Medical Center, Karachi. After semen analyses they were grouped as, oligospermic (30), and azoospermic (28). Twenty five known fertile male selected from general population and after semen analysis were taken as normospermic control group. Semen analyzed according to WHO criteria. Serum and seminal plasma zinc were estimated by 5Br. PAPS Colorimetric method. This study showed significant difference in serum and seminal zinc levels in normospermic, oligospermic (p<0.05) and azoospermic (p<0.005). Seminal plasma zinc showed a positive correlation with sperm count and negative with sperm motility in normospermic and oligospermic and negative correlation with volume, pH, WBC concentration in all three groups. There was no correlation found with sperm morphology. On the basis of the findings of this study and those of other reports, zinc may contribute to fertility through its significant effects on various semen parameters. It seems that the estimation of seminal plasma zinc may help in investiga seminal plasma zinc may help in investigation and treatment of infertile males. (author)

  3. Antioxidant effect of vitamin E and glutathione on lipid peroxidation in boar semen plasma.

    Science.gov (United States)

    Brezezi?ska-Slebodzi?ska, E; Slebodzi?ski, A B; Pietras, B; Wieczorek, G

    1995-01-01

    The protective effect of vitamin E and reduced glutathione (GSH) against lipid peroxidation in boar semen plasma was studied. The lipid peroxidation, measured by the test for thiobarbituric acid reactive substances (TBARS), doubled in the presence of the lipid peroxidation Fe(2+)-sodium ascorbate-inducing system. The ascorbate-induced TBARS were inhibited by about 62% through the water-soluble vitamin E analog (TROLOX) and about 57% by GSH. In the in vivo experiments, 7 wk of oral DL-alpha-tocopherol acetate (1000 IU/d/animal) administration caused a significant fall in the level of the semen plasma TBARS, from 2.2 +/- 0.09 to 1.2 +/- 0.13 nmol MDA/mL. The semen plasma superoxide dismutase (SOD) and GSSG tended to increase with the time of vitamin E administration, but the increment did not reach a significant level by the seventh week. The vitamin E supplementation significantly increased the number of spermatozoa per 1 cm3 of ejaculate. The protective role of vitamin E and GSH with respect to boar semen against fatty acid peroxidation and a positive influence of vitamin E supplementation on semen quality have been evidenced. PMID:7779577

  4. Effect of holding of semen and washing of seminal plasma on quality and fertility of Hampshire boar semen preserved at liquid state.

    Science.gov (United States)

    Chutia, T; Biswas, R K; Tamuli, M K; Deka, B C; Sinha, S; Goswami, J; Banik, S; Kayastha, R B

    2014-03-01

    The present study was aimed to reveal the effect on keeping quality of boar semen on holding or not holding at an elevated temperature than that used for preservation when combined with washing or not washing of seminal plasma. Twenty ejaculates, four from each of five Hampshire boars were used to hold for 0 and 4h in GEPS extender at 22°C and subsequently washed (1500×g for 10min) of seminal plasma or left unwashed and preserved at 15°C for 72h after extending with the same extender. The seminal parameters in terms of sperm motility, live spermatozoa, and live spermatozoa with intact acrosome (LIA) were evaluated at 0h-(immediately after extension) and thereafter at 24h intervals. The mean percentage of sperm motility was significantly (P<0.01) higher in unwashed than washed semen at both 0h and 4h of holding irrespective of preservation period. It was significantly (P<0.01) higher in semen held for 4h than 0h irrespective of washing and significantly (P<0.01) lower in washed than in unwashed semen irrespective of holding during preservation. Irrespective of preservation period the mean percentage of live spermatozoa was significantly (P<0.01) higher with 4h than 0h of holding in both unwashed and washed semen and was significantly (P<0.01) higher in unwashed than washed semen at both 0h and 4h of holding. It was significantly (P<0.01) higher for 4h held semen irrespective of washing and was significantly (P<0.01) lower in washed than in unwashed semen irrespective of holding during preservation. The mean percentage of LIA was significantly (P<0.01) higher with 4h than with 0h holding in both unwashed and washed semen and was significantly (P<0.01) higher in unwashed than in washed semen at both 0h and 4h of holding irrespective of preservation period. It was significantly (P<0.01) higher for 4h held as compared to unheld semen irrespective of washing and was significantly (P<0.01) lower in washed than unwashed semen irrespective of holding during preservation. The mean percentage of sperm motility, live spermatozoa and LIA decreased significantly (P<0.01) in 0h and 4h holding irrespective of washing and in unwashed and washed semen irrespective of holding with increase in preservation period. Among all the treatments unwashed semen held for 4h yielded superior sperm quality on preservation. A total of 32 female pigs were inseminated using preserved semen obtained with the best processing technique found in the study. The conception rate, farrowing rate and litter size at birth were recorded to be 81.25%, 78.13% and 7.96 respectively as compared to 73.38%, 67.57% and 6.68 respectively in the control group. It could be concluded that unwashed Hampshire boar semen held for 4h, extended with GEPS and preserved at 15°C for 72h was conducive to obtain optimum fertility and fecundity in females when used for artificial insemination. PMID:24559728

  5. Asssessment of the effect of selected components of equine seminal plasma on semen freezability

    Directory of Open Access Journals (Sweden)

    Miroslava Mrá?ková

    2015-03-01

    Full Text Available In this study, selected components of seminal plasma in equine semen were evaluated. Levels of enzymes, electrolytes, microelements and some other components were observed. The aim of this study was to fi nd some important differences between the levels of these components and the total sperm motility after freezing and thawing (freezability of the semen. Total of 32 ejaculates from 7 stallions were collected, assessed and prepared in 0,5 ml straws for freezing. After thawing, the sperm motility was analyzed and ejaculates were divided into two groups: “good” freezable and “poor” freezable. The only statistically significant difference between groups of „good“ and „poor“ freezable ejaculates was in the concentration of vitamin E in the seminal plasma. In the group of „good“ freezable ejaculates, the level of vitamin E was significantly lower (p?0,05 than in the group of “poor” freezable ejaculates.

  6. Effect of seminal plasma and egg yolk concentration on freezability of goat semen

    Scientific Electronic Library Online (English)

    Valéria da Silva, Ferreira; Marco Roberto Bourg de, Mello; Carlos Elysio Moreira da, Fonseca; Állan César Ferreira, Dias; Jéssica Machado, Cardoso; Rebecca Barbosa, Silva; Wagner Pereira, Martins Júnior.

    2014-10-01

    Full Text Available The objective of this study was to evaluate the effects of egg yolk and seminal plasma on the viability of cryopreserved goat semen. To this end, four fertile Saanen bucks, aged between 10 months and 1 year, and weighing 18 to 25 kg, were used. Semen was collected from each buck by the artificial va [...] gina method at the end of breeding season (June-July). The extender used was the yolk citrate, which was split into two equal aliquots: 5% egg yolk (2.5 mL egg yolk: 47.5 mL citrate solution) were added to one of the samples and 10% egg yolk (5.0 mL egg yolk: 45.0 mL citrate solution) were added to another. The sperm motility and vigor after thawing and post thermal resistance test (TRT) were evaluated and the data were subjected to analysis of variance and means were compared by the F test at 5.0% probability. The observed values for motility and vigor after thawing and post thermal resistance test (TRT), fast and slow, according to the presence of seminal plasma and egg yolk percentage were: 5% egg yolk with plasma (25.0% and 3.3; 1.60% and 0.7; 12.36% and 1.6, respectively); 5% egg yolk without plasma (23.61% and 3.1; 1.25% and 0.2; 9.93% and 1.3, respectively); 10% egg yolk with plasma (30.8% and 3.3; 4.4% and 1.9; 19.5% and 2.7, respectively); and 10% egg yolk without plasma (13.4% and 2.5; 4.1% and 0.5; 17.0% and 1.0, respectively). There were significant differences between the analyzed data in relation to semen with or without plasma at different percentages of egg yolk, and the group that presented the best results was 10% egg yolk citrate in extender with plasma. The presence of seminal plasma and higher concentration of egg yolk in extender provide a higher viability of cryopreserved goat semen.

  7. Relationship between seminal plasma zinc and semen quality in a subfertile population

    Directory of Open Access Journals (Sweden)

    Dissanayake DMAB

    2010-01-01

    Full Text Available Rationale : Current knowledge on the relationship between seminal zinc levels and different parameters of human semen is inconsistent. Objectives : To assess the relationship between seminal plasma zinc and semen quality using two markers; zinc concentration (Zn-C and total zinc per ejaculate (Zn-T. Design : The study was carried out as a cross-sectional study. Subjects and Methods : Semen parameters of 152 healthy men undergoing evaluation for subfertility were assessed. Seminal plasma zinc levels were determined using flame atomic absorption spectrometry. Zn-C, expressed as ?g/mL, was multiplied by ejaculated volume to calculate Zn-T. Mann Whitney U test and Chi-square test were used to compare the zinc levels between different seminal groups when appropriate. Correlations were observed with Pearson?s correlation of coefficient. Analysis was carried out using SPSS 10.0 for windows software. Results : Zn-C was low in 23 (15% samples, while in 32 (21% of the samples Zn-T was abnormal. The number of subnormal samples was high in the low-zinc groups compared with the normal-zinc groups, 15 vs. 8 (P > 0.05 for Zn-C and 28 vs. 4 (P < 0.001 for Zn-T. Zn-C was significantly high in the asthenozoospermics compared with the normal motile group; 138.11 ?g/mL (83.92 vs. 110.69 11 ?g/mL (54.59 (P < 0.05. Zn-T was significantly low in samples with hyperviscosity compared with samples with normal viscosity; 220.06 ?g (144.09 vs. 336.34 ?g (236.33 (P < 0.05. Conversely, Zn-T was high in samples with low viability compared with those with normal viability; 437.67 ?g (283.88 vs. 305.15 ?g (221.19 (P < 0.05. Weak correlations were found between Zn and some semen parameters. However, the correlation was negative between pH and Zn-C (r = -0.193, P < 0.05 as well as Zn-T (r = -0.280, P < 0.01. On the other hand, correlations were positive between Zn-T and sperm count (r = 0.211, P < 0.05. Conclusion : Count, motility, viability, pH and viscosity are affected by variations of seminal plasma zinc. Seminal plasma Zn-T is the better marker for assessing the relationship between zinc and semen quality.

  8. Fertilidad en ovejas de pelo inseminadas con semen congelado rediluido con plasma seminal / Fertility in hair sheep inseminated with freeze spermatozoa rediluited with seminal plasma

    Scientific Electronic Library Online (English)

    Alvaro, Domínguez Rebolledo; Luis, Navarrete Sierra; Alvar, Cruz Tamayo; Alfonso, Aguiar Loria; Sergio, Erosa Denis; Raúl, Bolio Oses; Eugenia, González Parra; Lorenzo, Paredes Monsreal; Julio, Ramón Ugalde.

    2007-02-01

    Full Text Available El objetivo del presente estudio fue determinar la viabilidad espermática del semen congelado rediluido con plasma seminal a través de la fertilidad de 146 ovejas de pelo, inseminadas vía cervical e intrauterina. La fertilidad se midió en dos tiempos; retorno a celo a los 17 días postinseminación y [...] diagnóstico de gestación por ultrasonografia a los 45 días postinseminación. Los datos de fertilidad se analizaron mediante el test de Ji-cuadrado. Los resultados obtenidos muestran que la adición del plasma seminal en el semen fresco no mejora la fertilidad (P>0,05) obtenida vía cervical e intrauterina, por el contrario, el semen congelado rediluido con plasma seminal, tanto en su aplicación cervical como intrauterina, mejora (P Abstract in english The objective of this study was to determine the spermatozoa viability of the frozen semen rediluted with seminal plasma through the fertility of 146 hair sheep inseminated cervical and intrauterine way. The fertility was measured in two times; return to estrus to the 17 days postinsemination and pr [...] egnancy diagnostic by ultrasound scanning to the 45 days postinsemination. The data of fertility were analyzed by means of the Chi-Square test. The obtained results showed that the addition of the seminal plasma in the semen fresh does not improve the fertility (P>0.05) obtained cervical and intrauterine way, on the contrary, the semen frozen rediluted with seminal plasma, so much in its cervical application as intrauterine, improvement (P

  9. Lactotransferrin in Asian elephant (Elephas maximus) seminal plasma correlates with semen quality.

    Science.gov (United States)

    Kiso, Wendy K; Selvaraj, Vimal; Nagashima, Jennifer; Asano, Atsushi; Brown, Janine L; Schmitt, Dennis L; Leszyk, John; Travis, Alexander J; Pukazhenthi, Budhan S

    2013-01-01

    Asian elephants (Elephas maximus) have highly variable ejaculate quality within individuals, greatly reducing the efficacy of artificial insemination and making it difficult to devise a sperm cryopreservation protocol for this endangered species. Because seminal plasma influences sperm function and physiology, including sperm motility, the objectives of this study were to characterize the chemistry and protein profiles of Asian elephant seminal plasma and to determine the relationships between seminal plasma components and semen quality. Ejaculates exhibiting good sperm motility (?65%) expressed higher percentages of spermatozoa with normal morphology (80.3±13.0 vs. 44.9±30.8%) and positive Spermac staining (51.9±14.5 vs. 7.5±14.4%), in addition to higher total volume (135.1±89.6 vs. 88.8±73.1 ml) and lower sperm concentration (473.0±511.2 vs. 1313.8±764.7×10? cells ml?¹) compared to ejaculates exhibiting poor sperm motility (?10%; Pelephants. One- and two-dimensional (2D) gel electrophoresis revealed largely similar compositional profiles of seminal plasma proteins between good and poor motility ejaculates. However, a protein of ?80 kDa was abundant in 85% of ejaculates with good motility, and was absent in 90% of poor motility ejaculates (PAsian elephant sperm motility, and for improving semen collection and storage in this endangered species. PMID:23976974

  10. Calcium, Magnesium and Total Antioxidant Capacity (TAC) in Seminal Plasma of Water Buffalo (Bubalus Bubalis) Bulls and their Relationships with Semen Characteristics

    OpenAIRE

    Mohammad-Hassan Khadem Ansari; Siamak Asri-Rezaei; Sayed Mortaza Alavi-Shoushtari; Mahdi Eghbali

    2010-01-01

    In order to determine calcium (Ca), magnesium (Mg) content and total antioxidant capacity (TAC) of seminal plasma in buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls; semen quality was evaluated, seminal plasma was then harvested by centrifugation and its Ca and Mg content were estimated and its TAC determined. The Ca and Mg content of the seminal plasma (Mean ± SEM) were recorded as 22.36 ± 0.52 mg dl-1 and 11.94 ...

  11. Effects of the Seminal Plasma Iron and Lead Content on Semen Quality of Water Buffalo (Bubalus bubalis Bulls

    Directory of Open Access Journals (Sweden)

    Mohammad-Hassan Khadem Ansari

    2010-12-01

    Full Text Available In order to determine iron and lead content of seminal plasma in water buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls. The semen characteristics were evaluated; its iron and lead content were estimated by atomic absorption spectrophotometer. The iron and lead content of the seminal plasma (Mean ± SEM was recorded as 40.68 ± 0.75 mg L-1 and 0.026 ± 0.008 mg L-1, respectively. The mean iron value was highly associated with sperm progressive motility, gross motility and viability, negatively with lead content, and had a negative association with semen volume. The mean lead value was highly negatively associated with sperm progressive motility, gross motility, viability and positively associated with sperm abnormal morphology.For further clarification of these associations, the results were categorized in three groups of excellent (Ex, > 90 % motile, n = 33, good (Go, 80-89 % motile, n = 15 and moderate (Mo, < 79 % motile, n = 6 according to their percentage of sperm motility. The mean progressive motility in Ex, Go and Mo group was 92.24 ± 0.51 %, 81.66 ± 0.62 %, and 71.66 ± 1.05 % respectively. The mean iron and lead values and their associations with other parameters in these groups are discussed.The results show that seminal plasma iron content is associated with the motility and viability of the spermatozoa after ejaculation, but its lead content has an adverse effect on these parameters.

  12. Influence of dietary zinc on semen traits and seminal plasma antioxidant enzymes and trace minerals of beetal bucks.

    Science.gov (United States)

    Rahman, H U; Qureshi, M S; Khan, R U

    2014-12-01

    Zinc (Zn) is a potent antioxidant and plays a key role in scavenging free radicals. We hypothesized that supplementation of Zn would reduce the oxidative damage, which is linked with poor sperm quality. Sixteen bucks of similar average age (2 years) and body weight (41 kg) were randomly divided into four groups viz., 1, 2, 3 and 4 supplemented with zinc sulphate into the diet at the rate of 0, 50, 100 and 200 mg/buck/day, respectively, for 3 months. At the end of the experiment, semen samples were collected and assessed. Seminal plasma was separated to find the concentration of superoxide dismutase (SOD), glutathione peroxidase (GPx), aspartate aminotransferase (AST), alanine aminotransferase (ALT) and trace minerals (Zn, Cu, Mn and Fe). The results revealed that semen volume (1.85 ± 0.01 ml) and sperm motility (88.23 ± 5.77%) increased significantly (p 0.05) was observed. From the present results, we concluded that zinc sulphate at the rate of 100 mg/buck/day improved semen traits and seminal plasma antioxidant capacity in Beetal bucks. PMID:25263460

  13. Effects of the Seminal Plasma Zinc Content and Catalase Activity on the Semen Quality of Water Buffalo (Bubalus bubalis Bulls

    Directory of Open Access Journals (Sweden)

    S.M. Alavi-Shoushtari

    2009-01-01

    Full Text Available In order to determine zinc and catalase content of seminal plasma in the buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls; semen volume and sperm concentration, gross and progressive motility and viability were evaluated, seminal plasma was then harvested by centrifugation and its zinc content was estimated by atomic absorption spectrophotometer and its catalase activity determined by using a commercial kit. The zinc content of the seminal plasma (Mean ± SEM was recorded as 154.40 ± 1.74 mg L-1, while, the mean catalase value was 32.00 ± 0.42 U mL-1. The mean zinc values was highly correlated with sperm progressive motility and viability and with catalase values (p = 0.000 for all and also was associated with gross motility (p = 0.020 and negatively with abnormal morphology (p = 0.049. The catalase values were highly associated with sperm progressive motility, viability and zinc content (p = 0.000 for all and was associated with sperm gross motility (p = 0.024. For further clarification of these correlations, the samples were categorized in three groups of excellent (Ex, > 90% motile, n = 33, good (Go, 80-89% motile, n = 15 and moderate (Mo, < 79% motile, n = 6 according to their percentage of sperm motility. The mean progressive motility in Ex group was 92.54 ± 0.51%, in Go group was 81.66 ± 0.62% and in Mo group was 71.66 ± 1.05%. The mean zinc and catalase values were recorded as 161.07 ± 1.63 mg L-1 and 33.41 ± 0.34 U mL-1 in Ex, 146.70 ± 1.91 mg L-1 and 31.01 ± 0.67 in Go and 136.42 ± 4.97 mg L-1 and 26.51 ± 0.87 U mL-1 in Mo groups. The mean zinc value in Ex group was highly associated with sperm motility, viability and catalase values, in Go group was associated with catalase values and highly associated with sperm abnormal morphology and in Mo group it was highly associations with catalase values only. The mean catalase value in Ex group, was highly associated with sperm motility and viability, in Go group was associated with zinc content and in Mo groups was highly associated with the zinc content. These results show that seminal plasma zinc and catalase content are correlated with semen characteristics and synergistically act to preserve motility and viability of the spermatozoa after ejaculation.

  14. The relationship between seminal plasma aspartate aminotransferase activity, sperm osmotic resistance test value, and semen quality in boars

    Directory of Open Access Journals (Sweden)

    Jacyno Eugenia

    2013-01-01

    Full Text Available The relationship between the activity of aspartate aminotransferase (AspAT in seminal plasma and the values of the osmotic resistance test (ORT of acrosomal membranes and semen traits was examined on 120 young hybrid Pietrain and Duroc boars. The following semen quality traits were determined: the volume of the ejaculate, the percentage of spermatozoa with progressive motility, sperm concentration and the total number of spermatozoa in the ejaculate, percentage of spermatozoa with normal acrosome, the percentage of spermatozoa with major and minor morphological defects, ORT, and the activity of AspAT in seminal plasma. The activity of AspAT in seminal plasma was negatively correlated (p_0.01 with the spermatozoa concentration and total number per ejaculate, percentage of spermatozoa with progressive motility and percentage of spermatozoa with a normal acrosome, while positively with the percentage of spermatozoa with major (p?0.001 and minor (p?0.01 morphological defects. The ORT values negatively correlated with the percentage of spermatozoa with major (p?0.05 and minor (p?0.01 morphological defects, while positively (p?0.001 with the percentage of spermatozoa with a normal acrosome.

  15. Selección Espermática en Semen Congelado/Descongelado de Equino: Evaluación de las Membranas Plasmática, Acrosomal y Potencial de Membrana Mitocondrial / Sperm Selection in Frozen/Thawed Semen of Equine: Evaluation of Plasma, Acrosome Membranes and Mitochondrial Membrane Potential

    Scientific Electronic Library Online (English)

    Paulina, Cabrera; Raúl, Sánchez; Jennie, Risopatrón.

    2014-06-01

    Full Text Available Los procedimientos de criopreservación inducen cambios morfofuncionales en los espermatozoides. Es importante post descongelación espermática utilizar procedimientos de selección que permitan recuperar espermatozoides altamente funcionales. El objetivo del presente estudio fue comparar la eficiencia [...] del Swim-up y Equipure® en la selección de espermatozoides funcionales en semen descongelado de equino. Semen de 4 potros reproductores Criollos Chilenos (A, B, C y D), fueron descongelados separadamente y procesados (n=15) por: I.- Swim-up (SU) y II.- Equipure® (EQ). Post descongelación se determinó por citometría de flujo la viabilidad e integridad de membrana plasmática (SYBR-14/PI), potencial de membrana mitocondrial (YDm; JC-1), integridad de la membrana acrosomal (FITC-PSA/PI). La motilidad progresiva (%) en dos animales fue más alta (P Abstract in english Freeze-thaw procedures induce structural and functional changes in sperm. It is important to use post thaw sperm selection procedures that can retrieve highly functional sperm. The aim of this study was to compare the efficiency of the Swim-up and Equipure® in the selection of functional sperm of th [...] awed equine semen. Semen of four Chilean Criollo reproductive stallions (A, B , C and D) were frozen and thawed using a standard protocol and processed separately (n = 15) : I. Swim-up (SU) and II. Equipure® (EQ). Post sperm selection,was determined by flow cytometry. Viability and plasma membrane integrity (SYRB-14/PI), mitochondrial membrane potential (YDm, JC -1), acrosome membrane integrity (FITC-PSA/PI). Progressive motility (%) was higher (P

  16. Changes in prostaglandin E2 levels in seminal plasma during ejaculation and the effect of exogenous prostaglandin E2 on semen volume in the dog.

    Science.gov (United States)

    Kobayashi, Masanori; Hori, Tatsuya; Kawakami, Eiichi

    2013-01-01

    In healthy male dogs, peripheral plasma testosterone (T), prostaglandin E2 (PGE2) and seminal plasma PGE2 levels were measured before, during and after ejaculation, and semen quality was examined after oral administration of PGE2. Plasma T and PGE2 levels did not change during these periods, but the seminal plasma PGE2 level of combined the first and second fractions was significantly higher than those at 0-5 and 5-10 min after the start of ejaculation of the third fraction. Semen volume but not quality increased after PGE2 administration. In conclusion, large amounts of PGE2 are released from the prostate gland during the early part of ejaculation, and PGE2 plays an essential role in secretion of seminal plasma. PMID:23629017

  17. Calcium, Magnesium and Total Antioxidant Capacity (TAC in Seminal Plasma of Water Buffalo (Bubalus Bubalis Bulls and their Relationships with Semen Characteristics

    Directory of Open Access Journals (Sweden)

    Mohammad-Hassan Khadem Ansari

    2010-06-01

    Full Text Available In order to determine calcium (Ca, magnesium (Mg content and total antioxidant capacity (TAC of seminal plasma in buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls; semen quality was evaluated, seminal plasma was then harvested by centrifugation and its Ca and Mg content were estimated and its TAC determined. The Ca and Mg content of the seminal plasma (Mean ± SEM were recorded as 22.36 ± 0.52 mg dl-1 and 11.94 ± 0.36 mg dl-1 respectively, while, its mean TAC value was 1.50 ± 0.02 mmol L-1. The mean Ca value was highly associated with sperm progressive motility, gross motility, viability (P = 0.000 for all, negatively with semen volume (P = 0.01, and with Mg and TAC values (P = 0.000 for both. The mean Mg values was highly associated with sperm progressive motility, gross motility and viability and seminal plasma Ca and TAC (P = 0.000 for all and negatively associated with semen volume (P = 0.014. The mean TAC values was highly associated with sperm progressive motility, gross motility and viability and seminal plasma Ca and Mg (P = 0.000 for all. For further clarification of these associations, the data was categorized in three groups of excellent (Ex, >90% motile, n = 33, good (Go, 80-89% motile, n = 15 and moderate (Mo, <79% motile, n = 6 according to their percentage of sperm motility. The mean progressive motility in Ex group was 92.24 ± 0.51%, in Go group it was 81.66 ± 0.62 %, and in Mo group it was 71.66 ± 1.05 %. The mean Ca, Mg and TAC values were respectively recorded as 25.12 ± 0.29 mg dl-1, 13.78 ± 0.20 mg dl-1, and 1.57 ± 0.009 mmol L-1 in Ex, 18.74 ± 0.63 mg dl-1, 9.14 ± 0.33mg dl-1, and 1.42 ± 0.044 mmol L-1 in Go, and 17.34 ± 0.18 mg dl-1, 8.06 ± 0.25 mg dl-1, and 1.23± 0.05 mmol L-1 in Mo groups. The associations in groups are discussed. These results show that seminal plasma Ca and Mg content and TAC are associated with semen characteristics, and synergistically have an effect on motility and viability of the spermatozoa after ejaculation, which are important factors in semen fertility.

  18. Recent advances in cooled-semen technology.

    Science.gov (United States)

    Aurich, Christine

    2008-09-01

    The majority of horse registries approve the use of artificial insemination, and horse breeding has widely taken benefit from the use of cooled-stored semen. New insights into cooled-semen technology open possibilities to reduce problems such as impaired semen quality after cooled-storage in individual stallions. The stallion itself has major impacts on quality and fertility of cooled-stored semen. Dietary supplementation of antioxidants and polyunsaturated fatty acids improves semen quality in a variety of species, but only few studies on this topic exist in the horse. Proper semen collection and handling is the main key to the maintenance of semen quality during cooled-storage. Semen collection should be achieved by minimal sexual stimulation with a single mount; this results in high sperm concentration, low content of seminal plasma and minimal contamination with bacteria. Milk-based semen extenders are most popular for semen processing and storage. The development of more defined extenders containing only the beneficial milk ingredients has made extender quality more constant and reliable. Semen is often centrifuged to decrease the seminal plasma content. Centrifugation results in a recovery rate of only 75% of spermatozoa in the semen pellet. Recovery rates after centrifugation may be improved with use of a "cushion technique" allowing higher centrifugation force and duration. However, this is not routinely used in cooled-semen technology. After slow-cooling, semen-storage and shipping is best performed at 5 degrees C, maintaining semen motility, membrane integrity and DNA integrity for up to 40 h after collection. Shipping containers created from Styrofoam boxes provide maintenance of semen quality at low cost. PMID:18524507

  19. Effect of the addition of seminal plasma, vitamin E and incubation time on post-thawed sperm viability in boar semen / Efecto de la adición de plasma seminal, vitamina E y tiempo de incubación en la viabilidad post-congelamiento del esperma en semen de verraco

    Scientific Electronic Library Online (English)

    A. G. C., Pech- Sansores; F. G., Centurión- Castro; J. C., Rodríguez-Buenfil; J. C., Segura-Correa; J. R., Aké-Lopez.

    2011-12-01

    Full Text Available El objetivo del estudio fue evaluar el efecto del plasma seminal (PS), Vitamina E (VE) y tiempo de incubación sobre la viabilidad espermática de semen de verracos después de su congelamiento. Treinta y seis eyaculados fueron usados y asignados a cuatro tratamientos: Tl, semen + BTS (Solución de post [...] congelamiento Belstville) + 10% PS; T2, semen + BTS + 200?g/ml VE; T3, semen + BTS + 10% PS + 200ug/ml VE; T4, semen + BTS (control). La motilidad (MOT), integridad de acrosomas (IA), integridad de membrana (IM) y la actividad mitocondrial (AM) se evaluaron a los 0 y 30 min después del congelamiento. Se utilizó un diseño en parcelas divididas y los datos se analizaron mediante un análisis de varianza para modelos mixtos. Se encontró efecto significativo de PS y VE sobre IA y IM (PO.05) pero no sobre MOT y AM (P>0.05). Hubo efecto significativo de tiempo de incubación sobre MOT (21.3 y 27.9%) y IA (46.0 y 36.0%), a los 0 y 30 min postcongelación (P Abstract in english The objective of the study was to evaluate the effect of seminal plasma (SP), vitamin E (VE), and incubation time on sperm viability of post-thawed boar semen. Thirty six ejaculates were used and allocated to four treatments: Tl, semen + BTS (Belstville Thawing Solution) + 10% SP; T2, semen + BTS + [...] 200?g/ml VE; T3, semen + BTS + 10% SP + 200ug/ml VE; T4, semen + BTS (control). Motility (MOT), intact acrosomes (IA), membrane integrity (MI) and mitochondrial activity (MA) were evaluated, at 0 and 30 min after thawing. A split plot design was used and the data analyzed using a mixed model analysis of variance. There was a significant effect of SP and VE on IA and MI (PO.05) but not on MOT and MA (P>0.05). There was significant effect of incubation time on MOT (21.3 and 27.9%) and IA (46.0 and 36.0%), at 0 and 30 min post-thawing (P

  20. Alergia al semen / Semen allergy

    Scientific Electronic Library Online (English)

    Laura, Franco Cuadros; Jenniffer, Puerta Suárez; Ángela, Cadavid Jaramillo; Walter, Cardona Maya.

    2013-12-01

    Full Text Available La alergia al semen comprende una variedad de síntomas tanto locales como sistémicos causados por reacciones de hipersensibilidad inmediata y caracterizados por títulos elevados de IgE. El objetivo de este estudio es describir el caso de una paciente con alergia al semen: mujer de 21 años de edad qu [...] e presenta ardor y sensación de quemazón en el área genital luego de tener contacto con el semen de su pareja. El análisis seminal del compañero sexual no presenta ningún tipo de alteración. Los síntomas desaparecen con el uso de condón o con la práctica del coito interrumpido. La alergia al semen es una alteración, que si bien es poco frecuente, puede afectar los deseos de concepción de las mujeres que la presentan, es un fenómeno poco estudiado por lo que se requieren más reportes para su caracterización. Abstract in english Semen allergy includes several local and systemic symptoms caused by immediate hypersensitivity reactions and it is characterized by high levels of IgE. The objective of this study was to describe the case of a patient with semen allergy. A 21 year-old woman experienced itching and burning sensation [...] in the genital area after contact with the semen of her sexual partner. Semen analysis was normal. Symptoms disappear with the use of condom or the practice of coitus interruptus. Semen allergy is a condition, although rare, can affect the desire of conceiving in women who suffers it. It is a briefly studied phenomenon which requires more reports for proper characterization.

  1. Crioprotetor para sêmen de carneiro a base de plasma de gema mantém membrana acrossomal intacta após a descongelação / Ram semen cryoprotector based on egg yolk plasma maintain the viability of acrosomal membrane

    Scientific Electronic Library Online (English)

    Ivo Walter dos, Santos; Jandui Escarião da, Nóbrega Junior; Matheus Pedrotti de, Cesaro; Gustavo Freitas, Ilha; Monique Tomazele, Rovani; Paulo Bayard Dias, Gonçalves.

    2015-06-01

    Full Text Available O presente estudo teve como objetivo avaliar a capacidade crioprotetora das lipoproteínas de baixa densidade (LDL) presentes no plasma de gema de ovo, adicionado ao trihidroxiaminometano (TRIS) para congelar sêmen ovino. Trinta e seis ejaculados foram coletados para formar 12 "pool". Cada alíquota d [...] e sêmen foi diluída em TRIS-gema de ovo (TRISG) ou TRIS- plasma de gema de ovo (TRISP) antes de congelar o sêmen. Para a obtenção do plasma da gema de ovo, foi utilizado o método de ultracentrifugação. Após o descongelamento, não houve diferença entre os dois extensores em relação aos parâmetros seminais (motilidade, viabilidade, membrana acrossômica e plasma). No entanto, no Teste de Termo Resistência Lenta (TTRL - 4h/38°C), o sêmen congelado com TRISP resultou no aumento do número de espermatozoides com acrossoma intacto (P Abstract in english The present study aimed to evaluate the cryoprotectant low-density lipoprotein (LDL) present in the plasma of egg yolk added to the extender trihidroxiaminometano (TRIS) for freezing ram semen. Thirty-six ejaculates were collected to form 12 pool. Each aliquot of semen was diluted in TRIS-egg yolk ( [...] TRISG) or TRIS-egg yolk plasma (TRISP) before freezing the semen. The plasma of egg yolk was obtained by ultracentrifugation. After thawing, no difference was detected between the two extenders in relation to seminal parameters (motility, viability, plasma membrane and acrosome). However, in the thermal resistance slow test (4h in a water bath at 38°C), the semen frozen with TRISP resulted in higher number of sperm with intact acrosome than those with TRISG (P

  2. Blood serum and seminal plasma selenium, total antioxidant capacity and coenzyme q10 levels in relation to semen parameters in men with idiopathic infertility.

    Science.gov (United States)

    Eroglu, Mustafa; Sahin, Sadik; Durukan, Birol; Ozakpinar, Ozlem Bingol; Erdinc, Nese; Turkgeldi, Lale; Sofuoglu, Kenan; Karateke, Ates

    2014-06-01

    In this case-control study, we aimed to evaluate the serum and seminal plasma levels of Selenium (Se), total antioxidant capacity (TAC), and Coenzyme Q10 (CoQ-10) and determine their relationship with sperm concentration, motility, and morphology in men with idiopathic infertility. A total of 59 subjects were enrolled in the study. Forty four patients were diagnosed with idiopathic male infertility and had abnormal sperm parameters, and 15 subjects had normal sperm parameters with proven fertility. Serum Se, semen Se, and semen TAC levels were significantly different in the fertile and infertile groups (pdeterminant of abnormal sperm parameters and idiopathic male infertility. Measurement of serum Se levels may help determine nutritional status and antioxidant capacity in infertile patients, which may help distinguish those patients who will benefit from supplementation therapy. PMID:24752972

  3. Lactotransferrin in Asian Elephant (Elephas maximus) Seminal Plasma Correlates with Semen Quality

    OpenAIRE

    Kiso, Wendy K.; Selvaraj, Vimal; Nagashima, Jennifer; Asano, Atsushi; Brown, Janine L.; Schmitt, Dennis L.; Leszyk, John; Travis, Alexander J.; Pukazhenthi, Budhan S.

    2013-01-01

    Asian elephants (Elephas maximus) have highly variable ejaculate quality within individuals, greatly reducing the efficacy of artificial insemination and making it difficult to devise a sperm cryopreservation protocol for this endangered species. Because seminal plasma influences sperm function and physiology, including sperm motility, the objectives of this study were to characterize the chemistry and protein profiles of Asian elephant seminal plasma and to determine the relationships betwee...

  4. Storage of ram semen.

    Science.gov (United States)

    Salamon, S; Maxwell, W M

    2000-08-18

    Storage of ram semen in liquid and frozen state, the diluents used for both methods, processing, cooling, freezing and thawing of semen are reviewed. Factors influencing the fertility of stored semen and methods used for improvement are discussed, and fertility results of long-term frozen stored ram semen are also given. PMID:10924821

  5. The activity of N-acetyl-?-hexosaminidase in boar seminal plasma is linked with semen quality and its suitability for cryopreservation.

    Science.gov (United States)

    Wysocki, Pawe?; Orzo?ek, Aleksandra; Strze?ek, Jerzy; Koziorowska-Gilun, Magdalena; Zasiadczyk, ?ukasz; Kordan, W?adys?aw

    2015-04-15

    The determination of sperm cryotolerance is an important step in the process of developing optimal techniques for the storage of boar semen. The objective of this study was to determine individual proteome variations in boar seminal plasma and spermatozoa and establish their influence on the cryotolerance of ejaculate. Sodium dodecyl sulfate polyacrylamide gel electrophoresis revealed the presence of protein with estimated molecular weight of 90 kDa in sperm extracts from ejaculates of selected boars. In all cases, dialysis performed at the initial stage of cryopreservation effectively removed the protein from sperm cells. The protein had an affinity for Zn(2+) ions. Mass spectrometry revealed similarities between the discussed protein and the ? subunit of N-acetyl-?-hexosaminidase (?-HEX). Seminal plasma ?-HEX was purified 252-fold with approximately 27% recovery and specific activity of 1800 U/mg of protein. Enzyme activity in fresh seminal plasma was correlated with superoxide dismutase activity (r = -0.42, P 20,000 U/L) levels of ?-HEX activity in seminal plasma. In plasma with high ?-HEX activity, spermatozoa were characterized by lower plasma membrane integrity (84.7%, P < 0.05). Higher glutathione levels (1250.3 ?M), higher total protein content (50 mg/mL), and higher total oxidant status (6.82-?mol H2O2 Equiv/L) were also observed (P < 0.05). After thawing, lower sperm motility (20.4%), lower plasma membrane integrity (41.7%), and higher lipid peroxidation (30.9-nM malondialdehyde/10(8) spermatozoa/h) were reported in ejaculates with high seminal plasma ?-HEX activity. The results of this study indicate that ?-HEX activity in seminal plasma is a useful indicator in preliminary evaluations of boar sperm cryotolerance. PMID:25661485

  6. Efeito de proteínas do plasma seminal eqüino com massa superior a 10 kDa concentradas 10 vezes sobre a congelabilidade do sêmen / Effect of high concentration of protein of the equine seminal plasma on semen cryopreservation

    Scientific Electronic Library Online (English)

    Marcus Antonio Pessanha, Barreto; José Frederico Straggiotti, Silva; Bruno, Fagundes; José Renato Costa, Caiado; Guilherme Valente de, Souza; Aldo, Shimoya.

    2008-12-01

    Full Text Available Objetivou-se avaliar os efeitos da adição de concentrados de proteínas do plasma seminal (PPS) no diluente de congelamento sobre a congelabilidade do sêmen eqüino. Foram avaliados três tratamentos: um controle, no qual o sêmen foi congelado no diluente Botu-Crio®; e outros dois, com adição de 10% ou [...] 20% (v/v) de proteínas do plasma seminal ao diluente. As maiores médias de motilidades total e progressiva foram observadas no tratamento controle, que foram superiores às obtidas com adição de 20% de proteínas, mas não diferiram das obtidas com adição de 10% de PPS. Os resultados do teste hiposmótico e do número de espermatozóides vivos obtidos com o congelamento do sêmen no diluente (controle) foram superiores aos encontrados com a adição de 10% de PPS, que, por sua vez, foram melhores que os observados com a adição de 20% de PPS ao diluente. A adição do concentrado de proteínas do plasma seminal não melhora os parâmetros espermáticos do sêmen eqüino. Abstract in english The aim of this study was to evaluate the effect of increasing the concentration of protein of the seminal plasma in the extender used for frozing equine semen. Three treatments were compared: The conventional one, defined by using only the Botu-Crio® extender for frozing semen; and other two define [...] d by adding 10% (v/v) or 20% (v/v) of seminal plasma proteins to Botu-Crio® extender. Averages of total and progressive motility were statistically higher in the conventional treatment than in that defined by adding 20% (v/v) of seminal plasma proteins but they did not differ from those obtained by adding 10% (v/v) of seminal plasma proteins to Botu-Crio® extender. The best results for the hypoosmotic test and the number of live spermatozoa were obtained in the conventional treatment, and results for adding 10% (v/v) of seminal plasma proteins were better than those obtained by adding 20% (v/v) of seminal plasma proteins to Botu-Crio® extender. These results indicate that the addition of concentrated protein of the seminal plasma to the extender did not improve the cryopreservation of equine semen.

  7. Efeito de proteínas do plasma seminal eqüino com massa superior a 10 kDa concentradas 10 vezes sobre a congelabilidade do sêmen Effect of high concentration of protein of the equine seminal plasma on semen cryopreservation

    Directory of Open Access Journals (Sweden)

    Marcus Antonio Pessanha Barreto

    2008-12-01

    Full Text Available Objetivou-se avaliar os efeitos da adição de concentrados de proteínas do plasma seminal (PPS no diluente de congelamento sobre a congelabilidade do sêmen eqüino. Foram avaliados três tratamentos: um controle, no qual o sêmen foi congelado no diluente Botu-Crio®; e outros dois, com adição de 10% ou 20% (v/v de proteínas do plasma seminal ao diluente. As maiores médias de motilidades total e progressiva foram observadas no tratamento controle, que foram superiores às obtidas com adição de 20% de proteínas, mas não diferiram das obtidas com adição de 10% de PPS. Os resultados do teste hiposmótico e do número de espermatozóides vivos obtidos com o congelamento do sêmen no diluente (controle foram superiores aos encontrados com a adição de 10% de PPS, que, por sua vez, foram melhores que os observados com a adição de 20% de PPS ao diluente. A adição do concentrado de proteínas do plasma seminal não melhora os parâmetros espermáticos do sêmen eqüino.The aim of this study was to evaluate the effect of increasing the concentration of protein of the seminal plasma in the extender used for frozing equine semen. Three treatments were compared: The conventional one, defined by using only the Botu-Crio® extender for frozing semen; and other two defined by adding 10% (v/v or 20% (v/v of seminal plasma proteins to Botu-Crio® extender. Averages of total and progressive motility were statistically higher in the conventional treatment than in that defined by adding 20% (v/v of seminal plasma proteins but they did not differ from those obtained by adding 10% (v/v of seminal plasma proteins to Botu-Crio® extender. The best results for the hypoosmotic test and the number of live spermatozoa were obtained in the conventional treatment, and results for adding 10% (v/v of seminal plasma proteins were better than those obtained by adding 20% (v/v of seminal plasma proteins to Botu-Crio® extender. These results indicate that the addition of concentrated protein of the seminal plasma to the extender did not improve the cryopreservation of equine semen.

  8. Evaluation of inductively coupled plasma mass spectrometry for determining Ca, Cu, Fe, Mg, Mn, Se and Zn in bovine semen samples using a simple sample dilution method

    Scientific Electronic Library Online (English)

    Giovanna F. M., Aguiar; Bruno L., Batista; Jairo L., Rodrigues; Pedro O., Luccas; Fernando, Barbosa Jr..

    2012-03-01

    Full Text Available Um método simples e rápido para a determinação de Ca, Cu, Fe, Mg, Mn, Se e Zn em sêmen bovino por espectrometria de massas com plasma indutivamente acoplado (q-ICP-MS) é descrito. Previamente as análises, 200 µL de amostras foram diluídas 1:50 em solução contendo Triton® X-100 (0,01% v/v) e ácido ní [...] trico (0,5% v/v). Os limites de detecção foram de 0,3, 0,03, 0,2, 0,04, 0,04, 0,03 e 0,03 µg L-1 para 44Ca, 63Cu, 57Fe, 24Mg, 64Zn, 82Se e 55Mn, respectivamente. Para efeitos de comparação e validação do método, quatro amostras de sêmen bovino foram analisadas por ICP-MS pelo método proposto e por espectrometria de absorção atômica com chama (FAAS) ou espectrometria de absorção atômica em forno de grafite (GF AAS), e não foram encontradas diferenças estatísticas entre as técnicas com aplicação do teste-t (95% de confiança). Então, o método proposto foi aplicado na determinação de Ca, Cu, Fe, Mg, Mn, Se e Zn em amostras de sêmen bovino coletadas de diferentes raças, as quais são usadas em programas de reprodução animal e inseminação artificial. Abstract in english A simple and fast method for the determination of Ca, Cu, Fe, Mg, Mn, Se and Zn in bovine semen by quadrupole inductively coupled plasma spectrometry (q-ICP-MS) is described. Prior to analysis, samples (200 µL) were diluted 1:50 in a solution containing 0.01% v/v Triton® X-100 and 0.5% v/v nitric ac [...] id and directly analyzed by ICP-MS. The limits of detection of the method are 0.3, 0.03, 0.2, 0.04, 0.04, 0.03 and 0.03 µg L-1 for 44Ca, 63Cu, 57Fe, 24Mg, 64Zn, 82Se and 55Mn, respectively. For purposes of comparison and method validation, four ordinary bovine semen samples were directly analyzed by ICP-MS and by flame atomic absorption spectrometry (FAAS) or graphite furnace atomic absorption spectrometry (GF AAS), with no statistical difference between the techniques at the 95% level when applying the t-test. Then, the proposed method was applied in the determinations of Ca, Cu, Fe, Mg, Mn, Se and Zn in collected samples of bovine semen from different breeds, which are used in reproduction programs and artificial insemination.

  9. Adição de plasma seminal ao sêmen descongelado e taxa de prenhez de ovelhas inseminadas em tempo fixo Addition of seminal plasma to frozen-thawed semen and pregnancy rate of fixed time inseminated ewes

    Directory of Open Access Journals (Sweden)

    O.R. Prado

    2013-02-01

    Full Text Available Avaliou-se o efeito da adição de plasma seminal ovino ao sêmen descongelado sobre a taxa de prenhez de ovelhas em rebanho comercial. Cento e setenta e quatro ovelhas cruza Texel foram distribuídas em quatro tratamentos: T1 inseminação artificial cervical (IAC com sêmen descongelado (SD diluído em solução tampão fosfato salino (PBS; T2 IAC com SD e adição de plasma seminal ovino; T3 grupo-controle I: IAC com sêmen fresco diluído em PBS; T4 grupo-controle II: inseminação artificial por laparoscopia com SD diluído em PBS. Para indução de cio, utilizaram-se esponjas impregnadas com acetato de medroxiprogesterona (MAP por 12 dias, com aplicação intramuscular de 400 UI de eCG (Novormon® e de 37,5µg de cloprostenol sódico (Sincrocio®, no dia da retirada das esponjas. O aparecimento de cio foi monitorado com rufiões vasectomizados a partir da retirada das esponjas até a inseminação artificial em tempo fixo - 54 a 60 horas. A taxa de prenhez do tratamento com adição de plasma seminal ao sêmen descongelado (7,0% não diferiu (P>0,05 do tratamento sem adição de plasma (4,3%, entretanto foi menor (PThe effect of seminal plasma addition to thawed-frozen ram semen on the pregnancy rate of commercial herd ewes was evaluated. One hundred and seventy-four crossbred Texel sheep were allocated to four treatments: T1 cervical artificial insemination (CAI using frozen-thawed semen (FTS diluted in phosphate buffered saline solution (PBS; T2 CAI using FTS diluted in ovine seminal plasma; T3 control group I: CAI using fresh semen diluted in PBS; T4 control group II: laparoscopic insemination using FTS diluted in PBS. Estrus induction was performed with medroxiprogesterone acetate (MAP impregnated sponges for 12 days, followed by intramuscular injection of 400 IU of eCG (Novormon® and 37.5µg of sodium cloprostenol (Sincrocio® on the day of sponge removal. Estrus was monitorated with vasectomized rams, beginning at the time of the sponge removal until the fixed time artificial insemination - 54 to 60 hours. The pregnancy rate of FTS diluted in seminal plasma treatment (7.0% did not differ (P>0.05 for the treatment without addition of seminal plasma (4.3%, however it was lower (P<0.05 when compared to the pregnancy rate of the cervical inseminated control I group with PBS diluted fresh semen (50.0% and laparoscopic inseminated control group II with PBS diluted FTS (39.4%. The cervical artificial insemination with the addition of seminal plasma to frozen-thawed semen did not increase the pregnancy rate at acceptable values to make this biotechnology useful on commercial herds.

  10. Adição de plasma seminal ao sêmen descongelado e taxa de prenhez de ovelhas inseminadas em tempo fixo / Addition of seminal plasma to frozen-thawed semen and pregnancy rate of fixed time inseminated ewes

    Scientific Electronic Library Online (English)

    O.R., Prado; G.M., Bastos; A.L.G., Monteiro; B.B., Saab; S., Gilaverte; C.C., Pierobom; F., Hentz; L.H.S., Martins; C.J.A., Silva; G.S., Dranca; T.S.S., Stivari; G., Cerqueira.

    2013-02-01

    Full Text Available Avaliou-se o efeito da adição de plasma seminal ovino ao sêmen descongelado sobre a taxa de prenhez de ovelhas em rebanho comercial. Cento e setenta e quatro ovelhas cruza Texel foram distribuídas em quatro tratamentos: T1) inseminação artificial cervical (IAC) com sêmen descongelado (SD) diluído em [...] solução tampão fosfato salino (PBS); T2) IAC com SD e adição de plasma seminal ovino; T3) grupo-controle I: IAC com sêmen fresco diluído em PBS; T4) grupo-controle II: inseminação artificial por laparoscopia com SD diluído em PBS. Para indução de cio, utilizaram-se esponjas impregnadas com acetato de medroxiprogesterona (MAP) por 12 dias, com aplicação intramuscular de 400 UI de eCG (Novormon®) e de 37,5µg de cloprostenol sódico (Sincrocio®), no dia da retirada das esponjas. O aparecimento de cio foi monitorado com rufiões vasectomizados a partir da retirada das esponjas até a inseminação artificial em tempo fixo - 54 a 60 horas. A taxa de prenhez do tratamento com adição de plasma seminal ao sêmen descongelado (7,0%) não diferiu (P>0,05) do tratamento sem adição de plasma (4,3%), entretanto foi menor (P Abstract in english The effect of seminal plasma addition to thawed-frozen ram semen on the pregnancy rate of commercial herd ewes was evaluated. One hundred and seventy-four crossbred Texel sheep were allocated to four treatments: T1) cervical artificial insemination (CAI) using frozen-thawed semen (FTS) diluted in ph [...] osphate buffered saline solution (PBS); T2) CAI using FTS diluted in ovine seminal plasma; T3) control group I: CAI using fresh semen diluted in PBS; T4) control group II: laparoscopic insemination using FTS diluted in PBS. Estrus induction was performed with medroxiprogesterone acetate (MAP) impregnated sponges for 12 days, followed by intramuscular injection of 400 IU of eCG (Novormon®) and 37.5µg of sodium cloprostenol (Sincrocio®) on the day of sponge removal. Estrus was monitorated with vasectomized rams, beginning at the time of the sponge removal until the fixed time artificial insemination - 54 to 60 hours. The pregnancy rate of FTS diluted in seminal plasma treatment (7.0%) did not differ (P>0.05) for the treatment without addition of seminal plasma (4.3%), however it was lower (P

  11. Enhancement of Herpes Simplex Virus (HSV) Infection by Seminal Plasma and Semen Amyloids Implicates a New Target for the Prevention of HSV Infection

    Science.gov (United States)

    Torres, Lilith; Ortiz, Tatiana; Tang, Qiyi

    2015-01-01

    Human herpesviruses cause different infectious diseases, resulting in world-wide health problems. Sexual transmission is a major route for the spread of both herpes simplex virus-1 (HSV-1) and -2. Semen plays an important role in carrying the viral particle that invades the vaginal or rectal mucosa and, thereby, initiates viral replication. Previously, we demonstrated that the amyloid fibrils semenogelin (SEM) and semen-derived enhancer of viral infection (SEVI), and seminal plasma (SP) augment cytomegalovirus infection (Tang et al., J. Virol 2013). Whether SEM or SEVI amyloids or SP could also enhance other herpesvirus infections has not been examined. In this study, we found that the two amyloids as well as SP strongly enhance both HSV-1 and -2 infections in cell culture. Along with SP, SEM and SEVI amyloids enhanced viral entry and increased infection rates by more than 10-fold, as assessed by flow cytometry assay and fluorescence microscopy. Viral replication was increased by about 50- to 100-fold. Moreover, viral growth curve assays showed that SEM and SEVI amyloids, as well as SP, sped up the kinetics of HSV replication such that the virus reached its replicative peak more quickly. The interactions of SEM, SEVI, and SP with HSVs are direct. Furthermore, we discovered that the enhancing effects of SP, SEM, and SEVI can be significantly reduced by heparin, a sulfated polysaccharide with an anionic charge. It is probable that heparin abrogates said enhancing effects by interfering with the interaction of the viral particle and the amyloids, which interaction results in the binding of the viral particles and both SEM and SEVI. PMID:25903833

  12. ALKALINE PHOSPHATASE ACTIVITY AS A MARKER OF DOG SEMEN FREEZABILITY

    Directory of Open Access Journals (Sweden)

    K. KOSINIAK-KAMYSZ

    2013-12-01

    Full Text Available The investigation was performed to evaluate the dog semen freezability and itsquality after thawing allowing its use for artificial insemination (AI. On the basis ofsperm motility, concentration and alkaline phosphatase (AP activity in semenplasma it was possible to establish that AP activity corresponds with the basic factorof semen examination. Significant statistical differences occurred between thequality of ejaculates which were qualified or disqualified to deep freezing and AI.These results show that AP activity in raw dog semen plasma can be used as amarker for the dog semen qualification for deep freezing and AI with 95%probability of the prognosis of the results.

  13. Las proteínas del plasma seminal incrementan la viabilidad espermática post-descongelación del semen de toros Sanmartinero / Seminal plasma proteins increase the post-thaw sperm viability of Sanmartinero bull's semen

    Scientific Electronic Library Online (English)

    Fabián, Rueda A; Tatiana, Garcés P; Rocío, Herrera L; Luis, Arbeláez R; Miguel, Peña J; Henry, Velásquez P; Aureliano, Hernández V; Jaime, Cardozo C.

    2013-01-01

    Full Text Available Objetivo. El objetivo de este trabajo fue evaluar el efecto de la adición de proteínas del plasma seminal sobre el porcentaje de espermatozoides bovinos viables post-descongelación. Materiales y métodos. Los espermatozoides se congelaron usando dos medios (citrato-fructosa-yema y Bioxcell®) y la obt [...] ención de proteínas de plasma seminal de bajo peso molecular se realizó por medio de cromatografía líquida de baja presión. Las proteínas de interés eluyeron en las fracciones 21-25 y se sometieron a electroforésis en una y dos dimensiones. Los espermatozoides se incubaron a 37°C durante una hora, con 0.5, 1.0, 1.5 y 2.0 mg de la fracción 21-25. Se incluyeron dos tratamientos adicionales: uno con proteínas totales del plasma seminal y otro sin proteína. Resultados. La electroforésis bidimensional de las fracciones confirmó la presencia de siete puntos de proteína de bajo peso molecular (14-16 kDa y punto Isoeléctrico de 5.0 - 5.5). La adición de estas proteínas aumentó 20% (p Abstract in english Objective. This study was performed to evaluate the effect of the addition of proteins on the post-thawing viability of spermatozoa. Materials and methods. Spermatozoa were frozen with two different media: Citrate-fructose and Bioxcell®. The isolation of seminal plasma proteins of low molecular weig [...] ht was performed through low pressure liquid chromatography. It was determined that the proteins of interest eluted in fractions 21-25, and two dimensional electrophoresis was performed. Thawed sperm was incubated at 37°C for one hour with 0.5, 1, 1.5 and 2.0 mg of 21-25 fraction protein. Two additional treatments were included: one with seminal plasma total protein, and another one without protein. Results. Two dimensional electrophoresis of protein confirmed the presence of two bands of 14 and 16 kDa and seven spots with iso-electric points between 5.0 - 5.5 respectively. Incubation of the spermatozoa with the 21-25 fraction showed that sperm viability increases by 20% with doses of 1 and 1.5 mg of protein/106 spermatozoa in the citrate-fructose medium, and 25% with 0.5 mg of protein/106 spermatozoa in Bioxcell® medium. A positive effect in sperm viability was demonstrated although it depends on the doses of protein and the cryopreservation medium used. Conclusions. This investigation suggests that the use of seminal plasma proteins can be useful for reducing the harmful effect on sperm cryopreservation.

  14. Las proteínas del plasma seminal incrementan la viabilidad espermática post-descongelación del semen de toros Sanmartinero

    Directory of Open Access Journals (Sweden)

    Fabián Rueda A.

    2013-03-01

    Full Text Available Objetivo. El objetivo de este trabajo fue evaluar el efecto de la adición de proteínas del plasma seminal sobre el porcentaje de espermatozoides bovinos viables post-descongelación. Materiales y métodos. Los espermatozoides se congelaron usando dos medios (citrato-fructosa-yema y Bioxcell® y la obtención de proteínas de plasma seminal de bajo peso molecular se realizó por medio de cromatografía líquida de baja presión. Las proteínas de interés eluyeron en las fracciones 21-25 y se sometieron a electroforésis en una y dos dimensiones. Los espermatozoides se incubaron a 37°C durante una hora, con 0.5, 1.0, 1.5 y 2.0 mg de la fracción 21-25. Se incluyeron dos tratamientos adicionales: uno con proteínas totales del plasma seminal y otro sin proteína. Resultados. La electroforésis bidimensional de las fracciones confirmó la presencia de siete puntos de proteína de bajo peso molecular (14-16 kDa y punto Isoeléctrico de 5.0 - 5.5. La adición de estas proteínas aumentó 20% (p<0.05, el porcentaje de espermatozoides viables post-descongelación en muestras congeladas en medio citrato-fructosa-yema (con dosis de 1 ó 1.5 mg de proteína/106 espermatozoides, y 25% (p<0.05 en muestras congeladas en medio Bioxcell® (con dosis de 0.5 mg de proteína/106 espermatozoides. Conclusiones. Los resultados de esta investigación sugieren el posible uso de proteínas de bajo peso molecular del plasma seminal, para disminuir el efecto deletéreo de la criopreservación en los espermatozoides.

  15. Blood in the semen

    Science.gov (United States)

    ... Semen culture Ultrasound of prostate, pelvis or scrotum Urinalysis Urine culture ... the urologic patient: History, physical examination, and the urinalysis. In: Wein AJ, ed. Campbell-Walsh Urology . 10th ...

  16. Effect of dietary energy on seminal plasma insulin-like growth factor-I (IGF-I), serum IGF-I and testosterone levels, semen quality and fertility in adult rams.

    Science.gov (United States)

    Selvaraju, S; Sivasubramani, T; Raghavendra, B S; Raju, P; Rao, S B N; Dineshkumar, D; Ravindra, J P

    2012-08-01

    The objective of the present study was to modulate seminal plasma insulin-like growth factor-I (IGF-I) by dietary energy and assess the relationship among testosterone and IGF-I levels, semen quality and fertility in adult rams. Twenty-four 1-yr old adult Nellore rams were equally divided into three groups (n = 8) and fed with three different concentrate mixtures formulated using conventional ingredients and finger millet (Eleucine corocana) straw to ensure rams received with similar amount of crude protein with three levels of energy. Rams in low-energy group were offered diets with 20% less energy than the control energy group (optimum energy, 100%, recommended energy level), whereas rams in high energy group were offered diets with 20% more energy than the optimum energy group. Semen was collected from rams 60 days after start of the experimental feeding. The percentages of progressive forward motility, functional membrane integrity and mitochondrial membrane potential of the spermatozoa were significantly (P < 0.05) higher in control and high energy groups as compared to low-energy group. Feeding of low-energy diet significantly (P < 0.05) decreased spermatozoa VSL, VCL and VAP when compared to control and high energy fed groups. The number of spermatozoa binding/oocyte was significantly (P < 0.05) higher in control (11.23 ± 0.20) and high energy (10.57 ± 0.19) groups as compared to the low energy (6.14 ± 0.01) group. The serum and seminal plasma IGF-I levels were significantly (P < 0.05) higher in control and high energy fed groups as compared to the low-energy group. The serum testosterone and cholesterol levels were significantly (P < 0.05) higher in the control group as compared to the low-energy group. The seminal plasma fructose levels in optimum energy fed animals were significantly (P < 0.05) higher as compared to other two groups. The seminal plasma IGF-I level had positive correlation with progressive forward motility (r = 0.7) and other velocity (linearity, r = 0.7; straightness, r = 0.7) parameters. The study suggested that the modulation of seminal plasma IGF-I levels by dietary energy is possible and the optimum level of seminal plasma IGF-I is necessary and sufficient to influence semen quality. PMID:22626778

  17. Value of semen parameters, with special reference to TNF-?, in predicting the quality of boar semen after short-term storage.

    Science.gov (United States)

    Mrkun, Janko; Kosec, Marjan; Zrimšek, Petra

    2013-06-01

    The aim of this study was to address the question whether changes in boar semen quality after short-term storage could be predicted on the basis of standard semen parameters and TNF-? level determined on the day of semen collection under commercial conditions. Progressive motility showed the highest positive correlation with morphology on day 0 of collection, and progressive motility on day 3 (P 0.5; P analysis shows that TNF-? level is helpful in discriminating viability outcome after semen storage (AUC = 0.94, P < 0.001). We can predict with 92.35% certainty that fresh semen samples with more than 150 pg/ml of TNF-? in the seminal plasma will retain more than 85% of viable spermatozoa after 3 days of storage. Thus, TNF-? can contribute to predicting the quality of short-term stored semen. PMID:23661389

  18. EFECTO DE LA ADICIÓN DE PLASMA SEMINAL SOBRE LA ELIMINACIÓN DE GOTAS CITOPLÁSMICAS EN SEMEN DE SUS SCROFA LINAEUS, 1758 / EFFECTS OF ADITION OF SE MINAL PLASMA ON THE ELIMINATION OF CYTOPLASMIC DROPLETS IN OF SUS SCROFA LINAEUS, 1758 BOAR SEMEN

    Scientific Electronic Library Online (English)

    Francisco Javier, Henao Uribe; Julián Alonso, Valencia Giraldo; Orlando, Díaz Franco; Marcos Yesid, Rangel Sierra.

    2011-12-01

    Full Text Available Las gotas citoplásmicas (GCs) son remanentes del citoplasma que quedan adheridos al espermatozoide después de la espermatogénesis, constituyen la anormalidad espermática más frecuente en porcinos, y se relacionan claramente con baja fertilidad. Hay serios indicios de que la fructosa y el AMPc del pl [...] asma seminal intervienen en la maduración espermática, en el desprendimiento de las GCs, y en la reacción acrosómica. El objetivo del presente estudio fue evaluar el efecto de la adición de plasma seminal, en el desprendimiento de las GCs en machos con diagnóstico de persistencia de las mismas. En el estudio se emplearon tres verracos (dos con persistencia de GCs y uno normal) de tres a cinco años de edad, alojados en la granja Montelindo de la Universidad de Caldas; a los cuales se les realizaron análisis seminales semanales, completos, durante cuatro meses. Se llevó a cabo un arreglo factorial 3x3x2 (adición a la FR de los machos con persistencia de GCs de 0%, 20% de PSMS y 20% de PSMGCs; 0, 60 y 120 minutos de incubación, y 16 y 37ºC de temperaturas de incubación) en un diseño de bloques completos al azar, analizado mediante análisis de varianza y prueba de Tukey. La incubación del semen de machos con persistencia de GCs con PSMGCs redujo más del 4% las GCs respecto a la incubación sin PS y con PSMS; igualmente se registró reducción de aproximadamente el 5% en las GCs, al aumentar el tiempo de incubación de 0 a 120 minutos, y alrededor de 2% al llevar la temperatura de incubación de 16 a 37ºC. Abstract in english The cytoplasmic droplets (CDs) are remnants of the cytoplasm that are attached to the sperm after spermatogenesis. CDs constitute the most frequent sperm abnormality in pigs and are clearly related to low fertility. There are serious indications that fructose and the seminal plasma AMPc are involved [...] in sperm maturation in the CDs detachment and in the acrosome reaction. The objective of this study was to evaluate the effect of the addition of seminal plasma in the CDs detachment in males with diagnosis of persistence of such detachment. Three boars (two with persistence of CDs and one normal) from three to five years of age, housed in the Montelindo farm at Universidad de Caldas were used in the study. These boars were performed complete seminal analysis weekly during four months. A factorial arrangement 3x3x2 (addition to the males FR with CDs persistence of 0%, 20% of SPHM and 20% of SPMCDs; 0, 60 and 120 minutes incubation, and 16, and 37ºC incubation temperature) was carried out in a randomized complete blocks design, analyzed through variance analysis and Tukey's test. Incubation of males semen with persistence of CDs with SPMCDs decreased more than 4% the CDS with regards to incubation without SP and SPHM; similarly, there was reduction of approximately 5% in CDs when increasing incubation time from 0 to 120 minutes, and about 2% when increasing incubation temperature from 16 to 37ºC.

  19. Increase in post-thaw viability by adding seminal plasma proteins to Sanmartinero and Zebu sperm / Aumento da viabilidade espermática pós-descongelamento, com a adição de proteínas do plasma seminal de sêmen de touros das raças Sanmartinero e Zebu / Incremento en la viabilidad espermática post-descongelación por la adición de proteínas del plasma seminal a semen de toros Sanmartinero y Cebú

    Scientific Electronic Library Online (English)

    Fabián L, Rueda; Rocío F, Herrera; Luis F, Arbeláez; Tatiana, Garcés; Henry, Velasquez; Miguel A, Peña; Jaime A, Cardozo.

    2013-06-01

    Full Text Available Antecedentes: a criopreservação diminui a viabilidade espermática abaixo de um 50%. Objetivo: o objetivo desta pesquisa foi determinar o efeito da adição de proteínas do plasma seminal na viabilidade espermática pós-descongelamento de sêmen de touros das raças Sanmartinero y Zebú. Métodos: coletou-s [...] e sêmen de 10 touros de cada raça, as amostras do plasma seminal foram submetidas à eletroforese bidimensional, para estabelecer a relação entre a quantidade relativa de cada ponto de proteína e a viabilidade espermática. Ao serem identificados os pontos, o plasma seminal também foi submetido ao processo de cromatografia por exclusão para separar a fração que continha as proteínas. A fração foi adicionada nas doses de 0,5, 1,0, 1,5 y 2,0 mg, amostras de 1 x 106 espermatozoides, em descongelamento e incubados à temperatura de 37 ° C durante 1 hora, para determinar o efeito na viabilidade pós-descongelamento. Os espermatozoides foram congelados utilizando dois meios (Citrato- frutose-gema e Bioxcell®). Resultados: encontrou-se um ponto de proteína (16,20 kDa, ponto Isoelétrico 5,5) no plasma de touro Sanmartinero, que correlacionou (r=0,64 p Abstract in spanish Antecedentes: la criopreservación disminuye la viabilidad espermática por debajo del 50%. Objetivo: el objetivo de esta investigación fue determinar el efecto de la adición de proteínas del plasma seminal sobre la viabilidad espermática post-descongelación de semen de toros Sanmartinero y Cebú. Méto [...] dos: se colectó semen de 10 toros de cada raza, y el plasma seminal se sometió a electroforesis bidimensional, para establecer la relación entre la cantidad relativa de cada punto de proteína y la viabilidad espermática. Identificados dichos puntos, el plasma seminal se sometió a cromatografía de exclusión para separar la fracción que contenía estas proteínas. Esta se adicionó en dosis de 0,5, 1,0, 1,5 y 2,0 mg, a muestras de 1 x 10(6) espermatozoides, descongelados e incubados a 37 °C durante 1 hora, para determinar su efecto en la viabilidad post-descongelación. Los espermatozoides se congelaron usando dos medios (citrato-fructosa-yema y Bioxcell®). Resultados: se encontró un punto de proteína (16,20 kDa, punto Isoeléctrico 5,5) en plasma de toros Sanmartinero, que correlacionó (r = 0,64 p Abstract in english Background: cryopreservation decreases sperm viability by approximately 50%. Objective: the objective of this study was to determine the effect of the addition of seminal plasma proteins on post-thawing sperm viability in Sanmartinero and Zebu semen. Methods: semen samples from 10 bulls of each bree [...] d were used, and seminal plasma was subjected to two-dimensional electrophoresis to establish the relationship between the relative amount of each protein spot and sperm viability. Then, seminal plasma was subjected to exclusion chromatography to separate the fraction containing these proteins. This fraction was added in doses of 0.5, 1.0, 1.5 and 2.0 mg, to 1 x 10(6). Sperm was thawed and incubated at 37 °C for 1 h to determine its effect on postthaw viability. Sperm were frozen using two media (citrate-fructose-yolk and Bioxcell®). Results: we found one protein spot (16.20 kDa, PI 5.5) in Sanmartinero seminal plasma that correlated (r = 0.64 p

  20. Biomarkers of semen exposure.

    Science.gov (United States)

    Mauck, Christine K

    2009-03-01

    Biomarkers of semen exposure have historically played their most important role in forensics, i.e., determining whether ejaculation took place in the course of a crime. However, it is becoming increasingly recognized that biomarkers of semen exposure can be useful in the development of new vaginal methods of HIV/sexually transmitted infections (STI) prevention and contraception. This review is based on the presentations of Drs. Michael Coppola (ContraVac, Inc.), Maurizio Macaluso (Centers for Disease Control and Prevention), Andrezej Kulczycki (University of Alabama at Birmingham), Christine Mauck (CONRAD), Robin Maguire (Population Council), and the subsequent discussion led by Drs. Susan Ballagh (CONRAD) and Johan Melendez (Johns Hopkins University) during a session entitled "Biomarkers of semen exposure" held during the conference entitled "Biomarkers for evaluation of vaginal microbicides and contraceptives: Discovery and early validation," organized by CONRAD and the Alliance for Microbicide Development in November of 2006. PMID:19218891

  1. Advances in Boar Semen Cryopreservation

    OpenAIRE

    Heriberto Rodriguez-Martinez; Margareta Wallgren

    2010-01-01

    The present paper highlights aspects of the cryopreservation of boar semen, a species with particular large, fractionated ejaculates, and a cumbersome cryotechnology that had prevented its commercial application. With the dramatic increase of use of liquid pig semen for artificial breeding over the past decade, developments on cryopreservation alongside the routine use of stud boar semen for AI had been promoted. Recent advances in our laboratory, accommodating the best use of portions of the...

  2. Low level determination of a novel 4-azasteroid and its carboxylic acid metabolite in human plasma and semen using high-performance liquid chromatography with atmospheric pressure chemical ionization tandem mass spectrometry.

    Science.gov (United States)

    Constanzer, M L; Chavez, C M; Matuszewski, B K; Carlin, J; Graham, D

    1997-05-23

    Compound I (4.7beta-dimethyl-4-azacholestan-3-one, MK-0386) is a potent 5alpha-reductase type 1 (5alphaR1) inhibitor. Sensitive (0.2 ng/ml), specific and separate assays have been developed and validated for the analysis of I and its carboxylic acid metabolite (II) in human semen and plasma based on high-performance liquid chromatography (HPLC) with tandem mass spectrometric (MS-MS) detection. After liquid-liquid extraction of the analytes from biological matrix, the extracts were chromatographed on a short (50 mm) analytical column during analysis of I, and on a longer (150 mm) column with a weaker mobile phase during the analysis of II. This additional chromatographic separation was required to separate II from a secondary metabolite present in post-dose plasma samples interfering with the quantification of II. The MS-MS detection was performed on a Sciex API III Plus tandem mass spectrometer using the heated nebulizer probe. Monitoring the parent-->product ion combinations of m/z 416-->114 and 404-->114, in the multiple reaction monitoring (MRM) mode, after chromatographic separation, allowed quantification of both analytes. The standard curve in plasma was linear in the concentration range of 0.2 to 200 ng/ml for both I and II with correlation coefficients greater than 0.99 and coefficients of variation of less than 15% for replicate (n=5) analysis at all concentrations within the standard curve range. For the semen assay the linear range for determination of I was from 0.2 to 50 ng/ml. These assays were applied to support a number of clinical studies with I and their validity and long-term performance was confirmed during analyses of clinical samples from these studies. The need for careful assessment of the specificity of MS-MS assays in post-dose biological fluid samples in the presence of metabolites was emphasized. PMID:9200525

  3. RELATIONSHIP BETWEEN SOME ENZYMES ACTIVITY, SPERM MORPHOLOGY AND STALLION SEMEN QUALITY

    Directory of Open Access Journals (Sweden)

    Z. PODSTAWSKI

    2013-12-01

    Full Text Available The sperm morphology is one of the factors determining semen quality besidessperm motility and concentration. An important role in this aspect plays someenzymes which are estimated in raw semen plasma. The examination of numerouspopulations of stallions of different breeds and age performed by Kosiniak-Kamyszet al. (2005 showed that significant differences occurred between stallion semenquality concerning both macro- and microscopic examination and some enzymesactivity. It was found that aspartate aminotranspherase (AspAT, lactatedehydrogenase (LDH and alkaline phosphatase (AP activity and total proteinamount (TP in raw seminal plasma decreased when the percent of sperms withcytoplasmatic droplets increased. The increase of these enzymes activity is observedwith the increase of the number of loose heads. These observations showed thatmany examined factors of the semen and semen plasma decided on its quality and onthis reason that these factors need to be applied for seminological diagnosis.

  4. The utility of nanowater for ram semen cryopreservation.

    Science.gov (United States)

    Murawski, Maciej; Schwarz, Tomasz; Grygier, Joanna; Patkowski, Krzysztof; Oszcz?da, Zdzis?aw; Jelkin, Igor; Kosiek, Anna; Gruszecki, Tomasz M; Szymanowska, Anna; Skrzypek, Tomasz; Zieba, Dorota A; Bartlewski, Pawel M

    2015-05-01

    Nanowater (NW; water declusterized in the low-temperature plasma reactor) has specific physicochemical properties that could increase semen viability after freezing and hence fertility after artificial insemination (AI) procedures. The main goal of this study was to evaluate ram semen quality after freezing in the media containing NW. Ejaculates from 10 rams were divided into two equal parts, diluted in a commercially available semen extender (Triladyl®; MiniTüb GmbH, Tiefenbach, Germany) prepared with deionized water (DW) or NW, and then frozen in liquid nitrogen. Semen samples were examined for sperm motility and morphology using the sperm class analyzer system and light microscopy. Cryo-scanning electron microscopy (cryo-SEM) was employed to determine the size of extracellular water crystals in frozen semen samples. Survival time at room temperature, aspartate aminotransferase (AspAT) and alkaline phosphatase (ALP) concentrations post-thawing as well as conception/lambing rates after laparoscopic intrauterine AI of 120 ewes were also determined. There were no significant differences between DW and NW groups in sperm progressive motility (26.4?±?12.2 and 30.8?±?12.4%) or survival time (266.6?±?61.3 and 270.9?±?76.7?min) after thawing and no differences in the percentages of spermatozoa with various morphological defects before or after freezing. There were, however, differences (P?productivity of inseminated ewes. PMID:25491414

  5. Alpaca semen quality in relation to different diets.

    Science.gov (United States)

    Juyena, N S; Vencato, J; Pasini, G; Vazzana, I; Stelletta, C

    2013-01-01

    The aim of the present study was to evaluate the biochemical composition of seminal plasma, along with semen quality, of alpacas maintained on different diets (hay; hay+pasture grazing; pasture grazing+sheep concentrate; pasture grazing+horse concentrate; Periods 1-4, respectively). Alpacas (n=5) were fed the four different diets for a period of 6 weeks each. During the period of feeding of each diet, semen was collected using an artificial vagina to determine its volume, viscosity, sperm concentration and sperm motility. Moreover, testicular volume and body condition score were evaluated. Seminal plasma was analysed biochemically to measure total protein, triglyceride, cholesterol, ?-glutamyl transferase, alanine aminotransferase (ALT) and alkaline phosphatase levels. Protein profiles were investigated using one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis. There was high variability in semen parameters between different males maintained on the same diet. Semen volume increased significantly (Phorse concentrates. In contrast, sperm concentration and motility decreased significantly (Psemen quality, as well as some parameters related to the composition of alpaca seminal plasma, that are dependent on diet, which may indicate the need for specific diet formulation to improve reproductive performance. We hypothesise that, in alpacas, the mechanisms underlying the changes in some reproductive traits in response to feeding regimens could be related to changes in the endocrine-gonadal system. PMID:22951252

  6. Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection / Parâmetros seminais e perfis bioquímicos e proteicos do plasma seminal de cães com hyperplasia prostática benigna após a administração intra-prostática de toxina botulínica tipo A

    Scientific Electronic Library Online (English)

    Tathiana Ferguson, Motheo; Aracélle Elisane, Alves; Giuliano Queiroz, Mostachio; Maricy, Apparício; Alexandre Pinto, Ribeiro; Fabiana Ferreira de, Souza; Maria Denise, Lopes; Wilter Ricardo Russiano, Vicente.

    1113-11-01

    Full Text Available O objetivo do presente estudo foi determinar a ação de diferentes concentrações de toxina botulínica tipo A (TB-A) sobre os parâmetros seminais, perfis bioquímicos e proteicos do plasma seminal de cães com hiperplasia prostática benigna (HPB). Dezoito cães hígidos, não orquiectomizados com HPB foram [...] divididos em três grupos, os quais foram submetidos à injeção intra-prostática de solução salina (grupo controle - GC), 250UI (GI) ou 500UI (GII) de TB-A. Amostras seminais foram coletadas previamente aos tratamentos e após 2, 4 e 8 semanas. Os parâmetros seminais assim como os valores de pH e concentrações de proteínas totais (TP), cloretos totais (CT), cálcio (Ca), potássio (K), sódio (Na) do plasma seminal foram mensurados após as coletas. O perfil proteico do fluido prostático foi estabelecido por meio de eletroforese SDS-PAGE. Não foram constatadas diferenças significativas quanto aos parâmetros espermáticos e perfil bioquímico do plasma seminal intragrupos e intergrupos (P>0,05). À SDS-PAGE foram identificadas 31 bandas proteicas com pesos moleculares de 3,9 a 106,2kDA, em todos os tratamentos e durante todo o período de avaliação. Dessa forma, concluiu-se que, independentemente da dose utilizada, a injeção intra-prostática de TB-A não altera os parâmetros seminais, assim como os perfis bioquímico e proteico do plasma seminal de cães com HPB. Abstract in english This study aimed to determine the effects of different concentrations of botulinum toxin type A (BT-A) on semen parameters, and seminal plasma biochemical and protein profiles of dogs with benign prostatic hyperplasia (BPH). Eighteen sexually intact male dogs with BPH were randomly divided in three [...] groups, and received an intraprostatic injection of saline solution (control group - CG), 250UI (GI) or 500UI (GII) of BT-A under transabdominal ultrasound guidance. Semen was collected at baseline, 2, 4 and 8 weeks after treatment. Semen parameters were determined and seminal plasma pH, total protein (TP), total chlorides (TC), calcium (Ca), potassium (K), and sodium (Na) concentrations were assessed. One-dimensional sodium dodecyl sulfatepolyacrilamide gel eletrophoresis (SDS- PAGE) was performed to determine seminal plasma protein profile. Sperm parameters and seminal plasma pH, TP, TC, Ca and K mean values did not change significantly at any time point and among treated groups (P>0.05). The SDS-PAGE analysis of the pooled fractions identified 31 protein bands with molecular weights ranging from 3.9 to 106.2kDA in all treatment groups during the entire evaluation period. Regardless the used dose, intraprostatic BT-A injection do not alter semen parameters and seminal plasma biochemical and protein profiles of dogs with BPH.

  7. 9 CFR 98.36 - Animal semen from Canada.

    Science.gov (United States)

    2010-01-01

    ...2010-01-01 false Animal semen from Canada. 98.36 Section 98.36 Animals...Semen § 98.36 Animal semen from Canada. (a) General importation requirements for animal semen from Canada. If the product is . . ....

  8. Effect of dietary parsley (Petroselinium crispum supplementation on semen quality of local Iraqi ganders

    Directory of Open Access Journals (Sweden)

    Hazim J. Al-Daraji,

    2011-08-01

    Full Text Available This study was carried out to investigate the effect of dietary supplementation with different levels of parsley on semen quality of local Iraqi ganders. A total of thirty two local ganders were used in this study during the period from beginning of February to the end of April. The ganders were allocated for 4 treatment groups containing 8 ganders each. Treatment groups were as follows: Control diet (free from parsley, T1: Control diet + 80 g/d parsley, T2: Control diet + 160 g/d parsley; T3: Control diet + 240 g/d parsley. Semen samples were collected twice a week fortnightly from each gander by dorsal-abdominal message method. First semen collection was used to evaluate semen volume, sperm concentration, live in total sperm, live and normal morphology sperm, semen quality factor, sperm motility, abnormal sperm, acrosomal abnormalities, spermatocrit and pH of semen. However, the second semen collection was used for determine seminal plasma concentrations of glucose, protein, cholesterol & activities of aspartate aminotransferase (AST, alanine aminotransferase (ALT and alkaline phosphatase (ALP enzymes. Results revealed that feeding diets containing different levels of parsley (T1, T2, and T3 resulted in significant (P<0.05 increase in semen volume, sperm concentration, live and normal morphology sperm, semen quality factor, sperm motility, spermatocrit and seminal plasma activity of ALP enzyme and significant (P< 0.05 decrease in abnormal sperm and acrosomal abnormalities and seminal plasma concentrations of glucose, protein, and cholesterol and seminal plasma activities of AST and ALT enzymes as compared with control group. There was no significant difference in pH of semen among the control and experimental groups (C, T1, T2, and T3. In conclusion, dietary supplementation with different levels of parsley especially at the level of 240 g/d (T3 caused significant improve- ment with relation to semen traits. So, parsley can be used as an effective tool for improve semen quality of ganders.

  9. Kualitas Semen Beku Kuda dalam Pengencer Susu Skim dan Dimitropoulos dengan Dimetilformamida Sebagai Krioprotektan

    Directory of Open Access Journals (Sweden)

    I. Arifiantini

    2007-08-01

    Full Text Available Equine semen are far less tolerant in the freezing and thawing process than bull semen. The stallion spermatozoa are known susceptible to cold-shock relating with the content of their fatty acid on the plasma membrane. The extender is one of determining factors in the success of stallion semen cryopreservation, as an energy source and protector the cell from harmfull effect of cold shock. The common cryoprotective agent (CPA for mammalian spermatozoa was glycerol, but for stallion semen cryopreservation, dimethyl formamide (DMF was more suitable. This research was conducted to compare the success of the stallion semen cryopreservation in skim milk and dimitropoulos (DV extender with DMF as cryoprotectant. Semen from three sexualy mature stallions was collected twice a week using an artificial vagina. Semen was evaluated macro- and microscopically and then divided into two tubes, diluted each of them with skim milk dan DV extender (1:1, centrifuged at 3 000 rpm for 15 minutes. The supernatant was removed and the pellet (spermatozoa was re-diluted in skim DMF (SDMF and DVDMF extender with the concentration of spermatozoa was 200x106 ml-1. The semen then packed in 0.3ml minitub straw equilibrated for two hours at 4-5oC and frezee in liquid N2 vapor for 10 minutes. The assessment of sperm quality was conducted based on the percentage of sperm motility and viability. In this research, post-thawed semen in DVDMF showed the percentages of the motility (36.2% and the viability (59.3% higher (P<0.05 than SDMF (28.5 and 48.0 %. In conclusion, the DVDMF extender provided better post-thawed semen quality than SDMF.

  10. Biologic parameters of polar fox (Alopex lagopus L.) semen during the breeding season

    OpenAIRE

    Stasiak, Karolina; Bogdan JANICKI; KUPCEWICZ, Bogumila

    2010-01-01

    The aim of this work was to evaluate the biologic properties of polar fox (Alopex lagopus L.) semen collected during the reproductive season. In 126 ejaculates manually collected from 18 foxes at 10- to 12-day intervals, semen parameters (such as the sperm concentration, volume, pH, sperm morphology, and activity of acid and alkaline phosphatase) were determined. The seminal plasma acid and alkaline phosphatase activity correlated positively with the sperm concentration (r = 0.5676; r = 0.630...

  11. Effect of organic and inorganic forms of selenium in diets on turkey semen quality.

    Science.gov (United States)

    Slowi?ska, M; Jankowski, J; Dietrich, G J; Karol, H; Liszewska, E; Glogowski, J; Koz?owski, K; Sartowska, K; Ciereszko, A

    2011-01-01

    The effects of Se supplementation and its organic or inorganic form on semen quantitative parameters (ejaculate volume, sperm concentration, and total number of sperm) and biochemical parameters of seminal plasma (protein concentration, acid phosphatase activity, superoxide dismutase activity, and total antioxidant capacity) were investigated over a 25-wk reproductive season. Additionally, DNA fragmentation and motility characteristics of turkey spermatozoa were measured. The parameters of turkey semen in relation to yellow semen syndrome were also determined. Twenty-four males (Big 6) were divided into 3 experimental groups differing in form of Se supplementation (no Se supplementation, 0.3 mg/kg of inorganic Se from sodium selenite and 0.3 mg/kg of organic Se from Sel-Plex, Alltech Inc., Nicholasville, KY). Dietary Se supplementation enhanced the sperm concentration and total number of sperm and did not influence the antioxidative properties of turkey seminal plasma and most biochemical parameters. Only seminal plasma acid phosphatase activity was increased in turkeys fed inorganic Se. The main sperm DNA fragmentation parameters were not affected by dietary Se. The highest percentage of motile spermatozoa (85%) was recorded for the semen of turkeys fed organic Se. Values of the biochemical parameters (acid phosphatase, superoxide dismutase, total antioxidant capacity) of seminal plasma increased during the reproductive season. Yellow semen was characterized by increased biochemical parameters and decreased spermatozoa motility characteristics. However, the percentage of motile spermatozoa did not differ between white and yellow semen. Organic Se seemed to be the preferred form of diet supplementation in comparison with inorganic Se. Biochemical parameters of semen and spermatozoa motility parameters appear to be useful for evaluating the effect of age on semen quality. Monitoring the DNA fragmentation of spermatozoa at the end of the reproductive season could be a useful tool for monitoring turkey semen quality. Increased superoxide dismutase activity can be used as an indicator of yellow semen. A decline in the quality of yellow semen can be related to a decrease in the spermatozoa motility parameters of turkeys. PMID:21177458

  12. Efficiency of short-term storage of equine semen in a simple-design cooling system.

    Science.gov (United States)

    Nunes, D B; Zorzatto, J R; Costa e Silva, E V; Zúccari, C E S N

    2008-03-01

    Five experiments tested the efficiency of a simple, low-cost system (CP) for cooling and storing equine semen at 2.0 degrees C for 24 h and 48 h. Pantaneiro stallions of known fertility were used. Semen quality was evaluated for progressive motility (PM), plasma membrane integrity (PMI), and pregnancy rate. Experiment 1 showed that PM and PMI were similar between CP and the control (Equitainer) in cooled semen. In Experiment 2, the influence was evaluated of combinations (four treatments) of two volumes (50/100 ml) and two sperm concentrations (500/750x10(6)) on sperm quality of semen cooled and preserved by CP (cooling system replaced at 24 h). While PM decreased gradually from before cooling to 24 h and 48 h, PMI decreased only at the least and greatest sperm volume and concentrations. Storage time did not affect PMI. Results from Experiment 3 showed that CP maintained semen PM>or=30% in all samples 24 h after cooling and decreased to about 70% 42 h after cooling. Results from Experiments 4 and 5 confirmed semen quality after cooling and storage (24 h and 48 h, respectively), achieving a 69% pregnancy rate in the first estrous cycle when insemination occurred. Thus, the CP system is satisfactory for cooling and preserving equine semen for up to 48 h. PMID:17681679

  13. Use of immobilized cryopreserved bovine semen in a blind artificial insemination trial.

    Science.gov (United States)

    Standerholen, Fride Berg; Waterhouse, Karin Elisabeth; Larsgard, Anne Guro; Garmo, Randi Therese; Myromslien, Frøydis Deinboll; Sunde, Jan; Ropstad, Erik; Klinkenberg, Geir; Kommisrud, Elisabeth

    2015-08-01

    To make timing of artificial insemination (AI) relative to ovulation less critical, methods for prolonging shelf life of spermatozoa in vivo after AI have been attempted to be developed. Encapsulation of sperm cells is a documented technology, and recently, a technology in which sperm cells are embedded in alginate gel has been introduced and commercialized. In this study, standard processed semen with the Biladyl extender (control) was compared with semen processed by sperm immobilization technology developed by SpermVital AS in a blind field trial. Moreover, in vitro acrosome and plasma membrane integrity was assessed and compared with AI fertility data for possible correlation. Semen from 16 Norwegian Red young bulls with unknown fertility was collected and processed after splitting the semen in two aliquots. These aliquots were processed with the standard Biladyl extender or the SpermVital extender to a final number of 12 × 10(6) and 25 × 10(6) spermatozoa/dose, respectively. In total, 2000 semen doses were produced from each bull, divided equally by treatment. Artificial insemination doses were set up to design a blinded AI regime; 5 + 5 straws from each extender within ejaculates in ten-straw goblets were distributed to AI technicians and veterinarians all over Norway. Outcomes of the inseminations were measured as 56-day nonreturn rate (NRR). Postthaw sperm quality was assessed by flow cytometry using propidium iodide and Alexa 488-conjugated peanut agglutinin to assess the proportion of plasma membrane and acrosome-intact sperm cells, respectively. In total, data from 14,125 first inseminations performed over a 12-month period, 7081 with Biladyl and 7044 with SpermVital semen, were used in the statistical analyses. There was no significant difference in 56-day NRR for the two semen categories, overall NRR being 72.5% and 72.7% for Biladyl and SpermVital, respectively. The flow cytometric results revealed a significant higher level of acrosome-intact live spermatozoa in Biladyl-processed semen compared to SpermVital semen. The results indicate that the level of acrosome-intact live spermatozoa in the AI dose did not affect the 56-day NRR for the two semen processing methods. In conclusion, this study has showed that immobilized spermatozoa provide equal fertility results as standard processed semen when AI is performed in a blinded field trial, although the immobilization procedure caused increased sperm damage evaluated in vitro compared to standard semen processing procedure. PMID:25922170

  14. Histochemical demonstration of zinc ions in ejaculated human semen

    DEFF Research Database (Denmark)

    Stoltenberg, M; SØrensen, M B

    1997-01-01

    A revised in-vitro technique for autometallographic demonstration of chelatable zinc in the human ejaculate is presented, and the localization of the loosely bound pool of zinc ions is described in semen smears and at the ultrastructural level. In semen smears, black autometallographic (AMG) grains indicated the presence of zinc ions dispersed between the spermatozoa. These AMG grains have the same size as grains associated with the sperm tail and may have the same origin. EM analysis of AMG-developed smears fixed in osmium suggested that the detected zinc ions might be related to huge protein molecules present in semen and adhering to the surface of the spermatozoa. Spermatozoa in AMG-stained smears exhibited zinc ions in the midpiece and head, and also joined to the membrane of the tail. Washed spermatozoa exhibited zinc ions only within the midpiece. Ultrastructurally, they were found located in the helecine mitochondria. A few grains were found in the acrosome of the washed spermatozoa. Treatment with thechelating agent DEDTC resulted in complete bleaching of the zinc staining. These findings and the fact that calcium EDTA acid blocks the plasma and surface staining, but not the acrosomal and mitochondrial staining, suggest that chelatable zinc ions exist in two separate pools in human semen.

  15. Galectin-3 Is Associated with Prostasomes in Human Semen

    OpenAIRE

    Jennifer L. Jones; Saraswati, Sarika; Block, Ashley S.; Lichti, Cheryl F.; Mahadevan, Maha; Diekman, Alan B.

    2009-01-01

    Galectin-3 is a ?-galactoside-binding protein involved in immunomodulation, cell interactions, cancer progression, and pathogenesis of infectious organisms. We report the identification and characterization of galectin-3 in human semen. In the male reproductive tract, the ~30 kDa galectin-3 protein was identified in testis, epididymis, vas deferens, prostate, seminal vesicle, and sperm protein extracts. In seminal plasma, galectin-3 was identified in the soluble fraction and in prostasomes, ...

  16. Effect of organic selenium on turkey semen quality during liquid storage.

    Science.gov (United States)

    Dimitrov, S G; Atanasov, V K; Surai, P F; Denev, S A

    2007-08-01

    The aim of the present study was to evaluate the effect of dietary organic selenium on the turkey semen during storage. Twenty males (BUT, Big 6, 40 weeks of age) were divided into control (n=10) and experimental group (n=10). The turkeys in the both groups were fed with a commercial diet containing 0.1 ppm Se in the form of sodium selenite. The experimental birds were additionally supplied with 0.3 ppm organic Se in the form Sel-Plex (Alltech, Inc.). After 30 days of feeding, the semen samples were collected twice a week for the 3 weeks of the study and diluted 1+1(v/v) with TUR-2 diluent, and stored in a water bath (+10 to 15 degrees C) for 6 h. The percentage of motile spermatozoa, the sperm viability (live/dead spermatozoa), total lipids, phospholipids and total cholesterol were assessed in fresh and stored semen. The fertilizing ability of semen was assessed by artificial insemination of 30 hens per group with dose containing 200x10(6) spermatozoa weekly. After 6 h of semen storage, the motility of spermatozoa decreased significantly in the control group (by 8.7 relative percent, P0.05) in experimental group reflecting a protective effect of dietary Se supplementation. The proportion of live spermatozoa was higher in fresh semen and significantly lower in stored semen. The positive effect of Se supplementation was observed on the lipid composition of stored semen: the concentration of the total lipids and phospholipids in the seminal plasma from control group significantly increased, while in the experimental group remained constant. Better semen integrity in the experimental group was associated with an improved fertilizing ability of spermatozoa: the fertility rate of stored spermatozoa in the control group was 88%, while in the experimental group was 90.5%. PMID:16935439

  17. Efecto de dos métodos de congelación sobre la viabilidad espermática de semen de verraco / Effect of two freezing methods on sperm viability of boar semen

    Scientific Electronic Library Online (English)

    Mateo, Carpio C.; José, Cadillo C.; Edwin, Mellisho S..

    2008-01-01

    Full Text Available El objetivo del presente trabajo fue evaluar el efecto de dos métodos de congelación sobre la viabilidad espermática de semen de verraco. Se utilizaron seis eyaculados (dos por macho), de tres verracos adultos de las razas Hampshire, Duroc y Landrace. Se evaluó el volumen, motilidad y concentración [...] espermática de cada eyaculado. Posteriormente, el semen fue diluido con solución BTS (Beltsville Thawing Solution) y centrifugado a 1500 rpm por 10 min para retirar el plasma. El pellet (porción espermática) obtenido fue extendido con dilutor de congelación (A y B), enfriado y equilibrado a 5 °C por 2 horas previas a la congelación. El semen equilibrado fue criopreservado usando dos métodos de congelamiento: a) en pellets colocando alícuotas de 0.25 ml de semen equilibrado en agujeros preparados en la superficie del bloque de hielo seco manteniéndolo por 2 min y luego vertiéndolo al nitrógeno líquido; y b) en pajillas de 0.5 ml, exponiéndolas al vapor de nitrógeno líquido a 7 cm de altura por 10 min (dentro de una caja de tecnopor) para luego verterlas al nitrógeno liquido. No se encontró diferencias significativas entre la motilidad individual y proporción de espermatozoides vivos del semen congelado en pellets (40.1 y 48.8%) vs. pajillas (34.5 y 40.7%), respectivamente. Abstract in english The objective of this experiment was to evaluate the effect of two freezing methods on the spermatic viability of boar semen. Six collects (2 ejaculates per male) of three adult boars (Hampshire, Duroc and Landrace) were used. Immediately after the collection, volume, motility and spermatic concentr [...] ation of each ejaculate were evaluated. Then, the semen was diluted with BTS solution (Beltsville Thawing Solution) and centrifuged at 1500 rpm for 10 min for plasma withdrawal. The pellet (spermatic portion) was diluted with freezing dilutor (A and B), cooled and equilibrated at 5 °C for two hours before freezing. The equilibrated semen was cryopreserved using two freezing methods: a) in pellets placing 0.25 ml aliquota of semen in holes prepared on the surface of a dry ice block for 20 min and then, pouring them in liquid nitrogen; and b) in straws of 0.5 ml exposing them at 7 cm over liquid nitrogen steam for 10 min (in a styrofoam box). The results showed no statistically differences amongst individual motility and live spermatozoa percentage in semen frozed in pellets (40.1 and 48.8%) as compared to straws (34.5 and 40.7%).

  18. Evaluation of superoxide dismutase activity and its impact on semen quality parameters of infertile men.

    Directory of Open Access Journals (Sweden)

    Jolanta Saczko

    2008-04-01

    Full Text Available The evaluation of superoxide dismutase (SOD activity, as one of the most important antioxidative defence enzymes, in seminal plasma of patients consulting for male infertility was presented in the article. The study included also the determination of its influence on selected human semen quality parameters. The material represents semen samples obtained from 15 men, which were divided into two groups: Group I (n=10 including patients consulting for infertility and Group II (n=5 containing healthy sperm donors as a control. All of the semen samples were cryopreserved and stored in liquid nitrogen. The frozen samples were thawed at the same time and then SOD activity was determined spectrophotometrically. The analysis of the investigations results indicates a significantly lower semen SOD activity detected in oligoasthenozoospermic patients, comparing to the activity found in normospermic men. The study showed a positive correlation between SOD activity in seminal plasma and semen quality parameters--sperm concentration and overall motility, which are regarded as the most important for normal fertilizing ability of the spermatozoa. Significantly lower SOD activity in seminal plasma of infertile patients, comparing to healthy sperm donors, as well as positive correlation and beneficial impact of SOD activity on human semen quality parameters seem to confirm the observations, that decreased seminal plasma scavenger antioxidant capacity, particularly in form of low SOD activity, can be responsible for male infertility. This trial shows that SOD activity survey in seminal plasma could be a useful tool for determining sperm fertilization potential and could improve the diagnosis of male infertility.

  19. The measurement of reactive oxygen species in human neat semen and in suspended spermatozoa: a comparison

    Directory of Open Access Journals (Sweden)

    Brezinova Jana

    2009-10-01

    Full Text Available Abstract Background It is generally accepted that oxidative stress is an important factor in male infertility because it may impair the physiological function of spermatozoa at the molecular level. Nevertheless, although several approaches have been reported, the imbalance between production of reactive oxygen species (ROS and activity of the antioxidant defense system in semen is difficult to investigate and remains poorly understood. Methods This study compares measurement of ROS production in neat semen and in washed spermatozoa obtained from the same ejaculate, and suspended in phosphate buffered saline using exactly the same luminol-mediated chemiluminescence method. Ninety one samples were obtained from males of infertile couples and 34 from volunteers with proven fertility. Results As expected, ROS levels were markedly lower in neat semen than in washed spermatozoa suspensions where seminal plasma with its potent antioxidant capacity was removed. In the cases of both neat semen and washed spermatozoa, ROS production was lowest in samples from normozoospermic males and highest in samples containing more than half million peroxidase-positive leukocytes per milliliter. For all samples, there was a significant positive correlation between ROS production by neat semen and that by washed spermatozoa suspension. Conclusion Measurement of ROS production in neat semen better reflects actual oxidative status because it detects only the overproduction of ROS which are not effectively scavenged by antioxidant capacity of seminal fluid. The results of our study show a good commutability of both measurements for identification of semen samples with high ROS production. The measurement in neat semen is even less time consuming and therefore easier to implement into laboratory routine.

  20. Semen Allergy Manifesting As Chronic Pruritus Vulva

    Directory of Open Access Journals (Sweden)

    Pavithran K

    1997-01-01

    Full Text Available A young woman of 24 with personal and family history of atopy development pruritus vulva each time after sexual intercourse with her husband. History of urticaria of sites of contact with semen on her thighs gave suspicion of contact urticaria. Positive wheal and flare response to pin prick test with semen, excellent therapeutic response to topical steroid and oral Cetirizine and non- recurrence of the problem after using condom by her husband confirmed the diagnosis of semen allergy.

  1. Therapeutic donor insemination with frozen semen.

    OpenAIRE

    Scott, S. G.; Mortimer, D.; Taylor, P. J.; Leader, A.; Pattinson, H. A.

    1990-01-01

    Although it is now accepted that cryopreserved semen must, on ethical and medicolegal grounds, be used for donor insemination many clinicians still believe that it has an unacceptably reduced fecundability rate as compared with fresh semen. We studied the outcome of 81 recipients who started therapeutic donor insemination (TDI) treatment during 1986 in a program that used exclusively cryopreserved semen; 55 had never undergone TDI and were receiving the first series (six cycles), 6 were recei...

  2. Detection of HIV and HCV RNA in semen from Brazilian coinfected men using multiplex PCR before and after semen washing / Detecção do RNA do HIV e HCV em sêmen de homens brasileiros, usando PCR multiplex antes e depois do "semen washing"

    Scientific Electronic Library Online (English)

    Cynthia Liliane Motta do, Canto; Aluisio C., Segurado; Cláudio, Pannut; Agnaldo, Cedenho; Miguel, Srougi; Deborah, Spaine; Silvana, Fernandes; Nadily, Carretiero; Maria Carolina, Bernal; José Eduardo, Levi.

    2006-08-01

    Full Text Available O aumento da sobrevida dos pacientes que utilizam terapêutica antiretroviral altamente eficaz (HAART- Highly Active Antiretroviral Therapy) trouxe uma nova demanda de casais sorodiscordantes que desejam filhos. Como esses casais não podem abandonar o uso de preservativos, torna-se indispensável trat [...] ar o sêmen infectado com técnicas laboratoriais eficazes que além de isolar os melhores espermatozóides, reduzam a carga viral do HIV e HCV a níveis indetectáveis. Para isso, são utilizadas técnicas de semen washing, associadas a testes ultra sensíveis de biologia molecular. Após análise seminal, sêmen de 20 pacientes co-infectados HIV-HCV foram submetidos a fracionamento celular e isolamento de espermatozóides móveis através de método de densidade de gradiente descontínuo e swim-up. Posteriormente, testes para detecção do RNA do HIV e HCV foram aplicados nos sêmens totais e frações seminais obtidas. Em fase pré semen washing, o HIV foi detectado em 100% dos semens totais. Contrariamente, o HCV foi detectado em apenas uma amostra. Em fase pós semen washing, o HIV e HCV não foram detectados em nenhuma das frações seminais. A redução do HIV e do HCV através de semen washing mostra-se um método eficaz a indivíduos co-infectados HIV-HCV, apesar do encontro do HCV no sêmen ser raro. Abstract in english INTRODUCTION: Prolonged survival of patients under HAART has resulted in new demands for assisted reproductive technologies. HIV serodiscordant couples wish to make use of assisted reproduction techniques in order to avoid viral transmission to the partner or to the newborn. It is therefore essentia [...] l to test the effectiveness of techniques aimed at reducing HIV and HCV loads in infected semen using molecular biology tests. METHODS: After seminal analysis, semen samples from 20 coinfected patients were submitted to cell fractioning and isolation of motile spermatozoa by density gradient centrifugation and swim-up. HIV and HCV RNA detection tests were performed with RNA obtained from sperm, seminal plasma and total semen. RESULTS: In pre-washing semen, HIV RNA was detected in 100% of total semen samples, whereas HCV RNA was concomitantly amplified in only one specimen. Neither HIV nor HCV were detected either in the swim-up or in the post-washing semen fractions. CONCLUSIONS: Reduction of HIV and/or HCV shedding in semen by density gradient centrifugation followed by swim-up is an efficient method. These findings lead us to believe that, although semen is rarely found to contain HCV, semen processing is highly beneficial for HIV/HCV coinfected individuals.

  3. The Viability of Local Ram Semen in Tris Buffer With Three Different Egg Yolks

    Directory of Open Access Journals (Sweden)

    WMM Nalley

    2011-01-01

    Full Text Available Egg yolk consisted of lecithin and phospholipids are one of the most commonly used components that will protect spermatozoa against cold shock during cooling and freezing. The aim of this study was to evaluate the effect of different hen egg yolk on Tris extender on the freezability of local ram semen. Semen from six sexually matured local rams was collected weekly using artificial vagina. Collected semen was evaluated macroscopically and microscopically and extended using tris extender consisted of 20% (v/v regular egg yolk (TRCEY, native egg yolk (TNCEY, omega-3 hen egg yolk (TOEY and 6% (v/v glycerol. Those were packed in 0.25 ml straws, equilibrated at 5oC for 3 hours, frozen and stored in nitrogen tank for 24 hours, and thawed at 37oC for 30 second. The result of the experiment showed that there were no significant differences on the sperm motility and the number of living sperm. Percentage of plasma membrane intact in TOEY (60.3% was significantly higher compared to TREY (56.9% and TNEY (55.6%. In conclusion, the addition of omega 3 egg yolk in Tris extender protects plasma membrane better than the regular or native hen egg yolk. (Animal Production 13 (1:39-44 (2011Key Words: ram semen, egg yolk, frozen semen

  4. Assessment of semen quality in Swamp Buffalo AI Bulls in Thailand

    Directory of Open Access Journals (Sweden)

    S. Koonjaenak

    2010-02-01

    Full Text Available Characteristic of Thai swamp buffalo bulls semen used for artificial insemination (AI in Thailand, aspects relevance in freezing and thawing of semen are review. Semen and sperm characteristics were evaluated included sperm count, motility (assessed subjectively and by CASA, morphology (using phase-contrast light microscopy and SEM, plasma membrane integrity (PMI (using a hypo-osmotic swelling test [HOST] and SYBR- 14/propidium iodide [PI], plasma membrane stability (PMS (using Annexin-V/PI and deoxyribonucleic acid (DNA integrity (using SCSA and flow cytometry [FCM]. The average ejaculate volume was about 3.0–4.0 mL, with good viability (PMI measured by the HOST and motility (>65% and >70%, respectively. Sperm concentration ranged from 1.1 to 1.2 billion/mL, being also affected by bull age. Whereas semen quality (including sperm output, pH and initial sperm motility did not differ between the seasons. Few spermatozoa (<15%/ ejaculate had abnormal morphology with abnormalities resembling those in other bovidae. In FT semen, PMI (using SYBR-14/PI and PMS were highest in winter. Across seasons, ~50% of post-thaw spermatozoa depicted linear motility, a proportion that decreased to ~35% during incubation (38oC for 60 minutes, without marking any seasonal difference. The sperm DNA was hardly damaged (with <3% fragmentation, expressed as DNA fragmentation index [DFI], among seasons.

  5. A comparison of ABAcard(®) p30 and RSID™-Semen test kits for forensic semen identification.

    Science.gov (United States)

    Boward, Emily S; Wilson, Stacey L

    2013-11-01

    The screening and confirmatory tests available to a forensic laboratory allow evidence to be examined for the presence of bodily fluids. With the majority of evidence being submitted involving sexual assaults, it is important to have confirmatory tests for the identification of semen that are straightforward, quick, and reliable. The purpose of this study was to compare two commonly used semen identification kits utilized by forensic laboratories: ABAcard(®) p30 and Rapid Stain Identification of Human Semen (RSID™-Semen). These kits were assessed with aged semen stains, fresh and frozen post-vasectomy semen, post-coital samples collected on different substrates, post-vasectomy semen mixed with blood, saliva, and urine, a series of swabs collected at increasing time intervals after sexual intercourse, and multiple non-semen samples. The test kits were compared on the basis of sensitivity, specificity, and the cost and time effectiveness of each protocol. Overall, both semen identification tests performed well in the studies. Both kits proved specificity for identifying semen, however the ABAcard(®) p30 test surpassed the RSID™-Semen test in sensitivity, cost per test, and simplified test protocol. PMID:24237835

  6. Leakage of Phosphatases and Fertility of Buck Semen Cryopreserved under Different Freezing Modes

    Directory of Open Access Journals (Sweden)

    Sunanda Sharma

    2014-12-01

    Full Text Available Present study was conducted on 160 ejaculates collected at weekly interval by artificial vagina method from 13 adult Sirohi bucks. Pooled ejaculates were diluted with Tris-egg yolk-citric acid-fructose-glycerol extender (1:4, filled and sealed in straws. Few straws of diluted semen were thawed (40° C/15 seconds and assessed for acid and alkaline phosphatases (ACP and AKP in seminal plasma of diluted semen (Control Group. Remaining semen straws were randomly grouped to constitute freezing mode groups (M1, M2, M2, and M4 and processed further for cryo-preservation of semen. Accordingly diluted semen straws were cooled @-4° C/minute from 25° C up to 5° C thereafter equilibrated for 2 hours and frozen up to -160° C @ 15, 20, 25 and 300 C/minute for M1, M2, M3 and M4 groups respectively. These frozen straws were hold at this temperature for 2 minutes then stored separately in LN2. After 7 days of storage, straws from each freezing mode group were thawed and assessed for ACP and AKP in seminal plasma. In vivo fertility trials were also conducted with straws of control (fresh diluted semen as well as freezing mode groups (frozen at different freezing rates. Least square analysis of variance for the data obtained revealed highly significant (P ? 0.01 rise in the seminal plasma ACP and AKP enzyme levels in frozen thawed semen as compared to that in fresh diluted semen. The Values of ACP and AKP also differed significantly (P ? 0.05 among all the freezing mode groups wherein lowest values of ACP were observed in M3 group followed by M4, M2 and M1 groups in increasing order whereas, lowest values of AKP were observed in M3 followed by M2, M4 and M1 groups in increasing order. Highest fertility rates were observed with semen from M3 followed by M2, M4 and M1 groups. On the basis of enzyme leakage and in-vivo fertility trials, the optimum freezing rate for cryopreservation protocol was arrived at 25° C/minute.

  7. Effects of Different Levels of Pigeon Egg Yolk in Extenders on the Post-Thaw Semen Quality of Sahiwal Bulls

    Directory of Open Access Journals (Sweden)

    Hafez Jamil-ur-Rahman, Nazir Ahmad*, Najib-ur-Rahman, Salman Waheed, Maqbool Ahmad, Muhammad Younis1 and Tanveer Ahmad2

    2012-06-01

    Full Text Available In this study, effects of replacing chicken egg yolk (CEY with pigeon egg yolk (PEY in extenders on post-thaw semen quality in Sahiwal bulls were investigated. Attempts were also made to see if post thaw semen quality was affected by reducing PEY level in the extender. Twenty four semen samples were diluted with five Tris-based extenders. Extender A contained 20% CEY and was used as control, while extenders B, C, D and E contained 5, 10, 15 and 20% PEY, respectively. After freezing and storage for 24 hrs in liquid nitrogen, these samples were evaluated for post-thaw semen quality parameters.The difference in post extension sperm motility between extenders A (20% CEY and E (20% PEY was non significant. Post extension sperm motility decreased as the level of PEY in the extender was decreased. A similar trend was recorded for post thaw sperm motility, livability, absolute index of livability and sperm with intact plasma membrane. The percentages of spermatozoa with abnormal head, or tail were lower (P<0.01 in control extender A and extender E compared to extenders B, C and D. However, for abnormal mid-piece, extenders A and E showed lower values than extender C only. It was concluded that replacing CEY with PEY in same concentration (20% did not improve post thaw semen quality. Moreover, reducing the concentration of PEY in semen extender from 20 to 5% had adverse effects on post-thaw quality of Sahiwal bull semen.

  8. Biomarkers of semen in the vagina: applications in clinical trials of contraception and prevention of sexually transmitted pathogens including HIV.

    Science.gov (United States)

    Mauck, Christine K; Doncel, Gustavo F

    2007-06-01

    Biomarkers of vaginal exposure to semen, long used in forensic medicine, are now becoming important in the development of vaginal microbicides to prevent HIV/STIs and the development of contraceptives. Semen biomarkers could help evaluate the safety of a new physical or chemical barrier, give preliminary indication of the effectiveness of physical barriers such as diaphragms or condoms, and provide information on unprotected intercourse among participants in a clinical trial who have been advised to use condoms. Candidate biomarkers of semen exposure fall into two broad categories: (1) biomarkers of seminal plasma, among which prostate-specific antigen (PSA) is the best characterized; and (2) biomarkers of spermatozoa and other cells present in semen. This paper, authored by a working group of investigators performing research in the field of semen biomarkers, summarizes the characteristics of an ideal semen biomarker, reviews preclinical and clinical data on existing and potential biomarkers, and outlines the steps that should be carried out to develop an improved biomarker of semen exposure. PMID:17519146

  9. Effect of stress on semen quality in semen donors.

    Science.gov (United States)

    Poland, M L; Giblin, P T; Ager, J W; Moghissi, K S

    1986-01-01

    Fifty-three donors with good semen quality were studied monthly for sperm count and motility over 9 to 22 months. Medical students (n = 31) in freshman and sophomore years subjected to the stress of twice-yearly examinations were compared with nonstudents (n = 22) not exposed to common stressful periods. Sperm count and quality (count X motility) for the student group were significantly elevated during examination months versus nonexamination months. Controls demonstrated no differences over these months. Differences between individuals, donor selection factors, and the effects of variable degrees of stress on sperm transport may have contributed to this finding. PMID:2875966

  10. Effects of reverse transcriptase inhibitor therapy on the HIV-1 viral burden in semen.

    Science.gov (United States)

    Gilliam, B L; Dyer, J R; Fiscus, S A; Marcus, C; Zhou, S; Wathen, L; Freimuth, W W; Cohen, M S; Eron, J J

    1997-05-01

    HIV-1 infection continues to spread worldwide, primarily through sexual intercourse. Because semen is a major vehicle for transmission of HIV-1, we evaluated the effects of reverse transcriptase inhibitor therapy on the amount of HIV-1 in semen. The semen and blood of 11 HIV-1-infected men (i.e. treatment group) were collected before the initiation of reverse transcriptase inhibitor therapy and then 8 to 18 weeks after initiation of therapy. The semen and blood of another 11 HIV-1-infected men (i.e., longitudinal group), who were not on or had no change in antiretroviral therapy for at least 2 months before study entry, were collected at approximately 2-week intervals for 10 to 26 weeks. In the treatment group, 82% of the seminal plasma HIV-1 RNA levels decreased from baseline after 8 to 18 weeks of therapy (median reduction of 1.01 log10, p = 0.01), and 100% of the blood plasma RNA levels decreased from baseline over the same period (median reduction of 0.92 log10, p = 0.003). Five of these patients were followed for at least 52 weeks and had a median seminal plasma HIV-1 RNA level of 0.66 log10 below baseline at 1 year. All subjects in the treatment group with positive cultures at baseline (50%) had negative cultures or a lower infectious units per ejaculate at the 8- to 18-week follow-up examinations. The HIV-1 RNA levels in blood and semen of the longitudinal group did not change significantly over 10 to 26 weeks. Initiation of reverse transcriptase inhibitor therapy effectively reduces shedding of HIV-1 in semen and may therefore reduce the spread of infection within populations. PMID:9215655

  11. Adição de plasma seminal ao sêmen descongelado e taxa de prenhez de ovelhas inseminadas em tempo fixo Addition of seminal plasma to frozen-thawed semen and pregnancy rate of fixed time inseminated ewes

    OpenAIRE

    O.R. Prado; G.M. Bastos; A.L.G. Monteiro; B.B. Saab; S. Gilaverte; C.C. Pierobom; F. Hentz; L.H.S. Martins; C.J.A. Silva; G.S. Dranca; T.S.S. Stivari; G. Cerqueira

    2013-01-01

    Avaliou-se o efeito da adição de plasma seminal ovino ao sêmen descongelado sobre a taxa de prenhez de ovelhas em rebanho comercial. Cento e setenta e quatro ovelhas cruza Texel foram distribuídas em quatro tratamentos: T1) inseminação artificial cervical (IAC) com sêmen descongelado (SD) diluído em solução tampão fosfato salino (PBS); T2) IAC com SD e adição de plasma seminal ovino; T3) grupo-controle I: IAC com sêmen fresco diluído em PBS; T4) grupo-controle II: inseminação artificial por l...

  12. Effect of alternate day collection on semen quality of Asian elephants (Elephas maximus) with poor initial fresh semen quality

    OpenAIRE

    Imrat, Podjana; Mahasawangkul, Sittidet; Thitaram, C.; Suthanmapinanth, P.; Kornkaewrat, K.; Sombutputorn, P.; Jansittiwate, S.; Thongtip, N.; Pinyopummin, A.; Colenbrander, B.; Holt, W. V.; Stout, Tom A. E.

    2014-01-01

    In captivity, male Asian elephants often yield poor quality semen after transrectal manually assisted semen collection; however, the reasons for the disappointing semen quality are not clear. Here we test the hypothesis that accumulation of senescent spermatozoa is a contributory factor, and that semen quality can therefore be improved by more frequent ejaculation. To this end we investigated the effect of collecting semen five times on alternate days, after a long period of sexual rest, on s...

  13. Reduction of concentrate for bovine sires: Influence on metabolic status and semen quality under production conditions

    International Nuclear Information System (INIS)

    The effects of reduced concentrate fed in rations of Holstein Friesian bulls for artificial insemination was evaluated with respect to metabolic status, sexual behaviour, semen production and semen quality during one year. In the first of two studies, twenty bulls were fed diets based on hay, green forage and concentrate according to the standard nutrient requirements for dairy cattle in artificial insemination centres. Bulls were divided into two groups: Group 1 (n = 10, control, 5 kg concentrate) and Group 2 (n = 10, experimental, 1 kg concentrate). Feed, blood semen samples were taken for bromatological analysis, metabolic profile and semen evaluation, respectively. Group 2 had lower plasma concentrations of urea (P<0.001), calcium (P<0.05) and phosphorous (P<0.01). Urea were below the reference range. Season of the year affected lipid metabolite concentrations (P<0.001) and osteotrophic minerals (P<0.05 to P<0.001). Group 2 had better production and quality of semen than did Group 1. In the second study, five bulls were fed as the experimental group in the first study. Time of sampling, season of the year and sire affected the hormonal secretion pattern (P<0.001). There were no differences in testoterone and LH plasma concentrations before and after mounting; however, cortisol concentrations showed a significant raise during the period of maximum excitation. Individual secretion patterns varied between bulls and were related to pathological morphology of reproducted to pathological morphology of reproductive and endocrine organs. The effect of sire was significant on all the indicators of the sperm production, except to percentage of live sperm. Season of the year significantly affected sperm concentration and number of doses of extended sperm produced. It is concluded that a reduction of concentrate in the diet did not affect the metabolic status, sexual behaviour, semen production or sperm quality of sires. 29 refs, 2 figs, 4 tabs

  14. Alternatives to antibiotics in semen extenders: a review.

    Science.gov (United States)

    Morrell, Jane M; Wallgren, Margareta

    2014-01-01

    Antibiotics are added to semen extenders to be used for artificial insemination (AI) in livestock breeding to control bacterial contamination in semen arising during collection and processing. The antibiotics to be added and their concentrations for semen for international trade are specified by government directives. Since the animal production industry uses large quantities of semen for artificial insemination, large amounts of antibiotics are currently used in semen extenders. Possible alternatives to antibiotics are discussed, including physical removal of the bacteria during semen processing, as well as the development of novel antimicrobials. Colloid centrifugation, particularly Single Layer Centrifugation, when carried out with a strict aseptic technique, offers a feasible method for reducing bacterial contamination in semen and is a practical method for semen processing laboratories to adopt. However, none of these alternatives to antibiotics should replace strict attention to hygiene during semen collection and handling. PMID:25517429

  15. Alternatives to Antibiotics in Semen Extenders: A Review

    Directory of Open Access Journals (Sweden)

    Jane M. Morrell

    2014-12-01

    Full Text Available Antibiotics are added to semen extenders to be used for artificial insemination (AI in livestock breeding to control bacterial contamination in semen arising during collection and processing. The antibiotics to be added and their concentrations for semen for international trade are specified by government directives. Since the animal production industry uses large quantities of semen for artificial insemination, large amounts of antibiotics are currently used in semen extenders. Possible alternatives to antibiotics are discussed, including physical removal of the bacteria during semen processing, as well as the development of novel antimicrobials. Colloid centrifugation, particularly Single Layer Centrifugation, when carried out with a strict aseptic technique, offers a feasible method for reducing bacterial contamination in semen and is a practical method for semen processing laboratories to adopt. However, none of these alternatives to antibiotics should replace strict attention to hygiene during semen collection and handling.

  16. Effect of initial seminal plasma fructose concentration on goat semen storage at 5ºC / Efeito da concentração inicial de frutose sobre a conservação a 5 ºC do sêmen caprino

    Scientific Electronic Library Online (English)

    B.G., Matos-Brito; I.C.S., Lima; J.F., Pereira; F.M., Barboza; M.A.B., Linard; G.V., Aguiar; A.G.V., Catunda; A.A.A., Moura; J.F., Nunes; A.C.N., Campos.

    2013-03-01

    Full Text Available Foram coletadas 24 amostras de sêmen caprino. Cada ejaculado foi dividido em 4 alíquotas, e foram diluídas em citrato-gema de ovo (CG), TRIS-gema de ovo (TG) e água de coco industrializada-gema de ovo (ACI-G), a quarta, foi centrifugada para determinação da concentração de frutose e atividade da FLA [...] 2 no PS. O sêmen foi conservado a 5 ºC e avaliado a fresco, 2, 24 e 48 h, em cada tempo foi avaliado o vigor, motilidade e alterações morfológicas. Os reprodutores foram divididos em dois grupos: grupo I-concentração de frutose >710 mg/dL e o grupo II-concentração de frutose Abstract in english Twenty-four goat semen samples were collected and divided into four aliquots, diluted with the citrate-egg yolk (CY), TRIS-egg yolk (TY) or industrialized coconut water with egg yolk (ICW-Y) extenders. The fourth aliquot was centrifuged to analyze fructose concentration and PLA2 activity on SP. The [...] semen was stored at 5ºC and evaluated at times fresh, 2, 24 and 48 h, in each time was evaluated the vigor, sperm motility and total morphological alterations. The animals were divided into two groups: group Ifructose concentration >710 mg/dL and group IIfructose concentration

  17. Image content influences men's semen quality

    OpenAIRE

    Kilgallon, Sarah J.; Simmons, Leigh W.

    2005-01-01

    There is increasing evidence from non-human animals that males adjust their ejaculate expenditure according to the risk of sperm competition. In this study we show that, after controlling for lifestyle factors known to influence semen quality, human males viewing images depicting sperm competition had a higher percentage of motile sperm in their ejaculates. Many lifestyle variables were confirmed to influence semen quality, including the recent suggestion that storage of mobile phones close t...

  18. Prevention of disease transmission by semen in cattle

    OpenAIRE

    Wentink, G. H.; Frankena, K.; Bosch, J. C.; Vandehoek, J. E. D.; Berg, T.

    2000-01-01

    To test the safety of semen two approaches can be applied: checking the end product, or continuous surveillance of the bulls before and after semen production. The first method is examination of semen for the presence of infectious agents. This method depends completely on a single investigation and therefore relies only on the sensitivity of the test method. The second method is testing the bulls for diseases before and after semen collection, based on sequential investigations for the absen...

  19. Effects of Exogenous Glutathione Supplementation in Biocell® Extender on Quality of Cryopreserved Buffalo (Bubalus bubalis Semen

    Directory of Open Access Journals (Sweden)

    Tohid Rezaei Topraggaleah

    2012-01-01

    Full Text Available The study was designed to investigate the effect of exogenous glutathione supplementation in soybean based extender Bioxcell® extender on post thaw semen quality of buffalo (Bubalus bubalis. Split pooled ejaculates (n = 6, possessing >70% visual sperm motility were extended at 37°C with different levels of glutathione (0.0, 0.5, 1 and 2 mM in Bioxcell® extender. Semen was cooled to 4°C in 2 h, equilibrated at 4°C for 4 h, filled in 0.5 mL straws and frozen in a programmable cell freezer before plunging into liquid nitrogen. Thawing of frozen semen was performed after 72 h at 37°C for 30 sec. Sperm motion characteristics, viability, plasma membrane integrity, acrosome morphology of each semen sample immediately after thawing and incubation for 2 h were assessed by using Computer assisted semen analyzer (SCA, eosin-nigrosin staining, Hypo Osmotic Swelling (HOS assay and phase contrast microscope, respectively. Results revealed that the addition 0.5 and 1.0 Mm of glutathione in Bioxcell® extender did not present any significant effect on overall and progressive motility as well as sperm motility characteristics (VAP, VSL, VCL, LIN and ALH, compared to the control groups (p>0.05. Immediately after thawing the proportion of post thaw sperm viability, plasma membrane integrity and normal apical ridge remained similar in all groups. However, glutathione supplementation of the extender with 2.0 mM concentration decreased sperm motility, viability at 0 and 2 h after thawing in a dose dependent manner compared to the control (p0.05. These results revealed that supplementation of the new commercial in soybean based extender Bioxcell® with glutathione did not improve sperm post thaw motility or acrosomal integrity.

  20. Methods of cryopreservation of Tambaqui semen, Colossoma macropomum.

    Science.gov (United States)

    Varela Junior, A S; Goularte, K L; Alves, J P; Pereira, F A; Silva, E F; Cardoso, T F; Jardim, R D; Streit, D P; Corcini, C D

    2015-06-01

    This study compared three different techniques for sperm cryopreservation of Tambaqui (Colossoma macropomum). Semen was diluted in Beltsville Thawing Solution with the addition of dimethyl sulfoxide (DMSO) at various concentrations (5%, 10%, 15% and 20%). Cryopreservation was performed using three methods: Box Conditioner Method with straws at a 5cm distance from liquid nitrogen vapor (N2L); Dry Shipper Method placing the straws inside the machine; Vitrification Method placing the straws directly into N2L, amounting to 12 treatments (four DMSO concentrations×three freezing methods). The samples were evaluated for analysis of sperm quality in vivo and in vitro. Use of the Vitrification Method at different concentrations of DMSO provided the least values in the different evaluations. Fertilization, hatching rates and plasma membrane integrity using the Box Conditioner Method with 5% and 10% DMSO did not differ (P>0.05) but use of the concentration of 5% DMSO resulted in greater values than the other treatments (Ptime (P<0.05), although sperm viability was superior using the Dry Shipper Method with 20% of the cryoprotectant. Mitochondrial functionality was impaired by use of the Vitrification Method with all DMSO concentration tested showing the most desirable values when the Box Conditioner Method was used with 5%, 10%, 15% DMSO and the Dry Shipper Method was used with 10% and 15% DMSO. Considering the variables evaluated, the use of the Box Conditioner Method is associated with enhanced Tambaqui semen quality with freeze concentrations of 5% and 10% DMSO. PMID:25906678

  1. Characterization and usage of sexed semen from US field data

    Science.gov (United States)

    The objectives were to characterize sexed semen available and its usage from US field data. This included investigating active Holstein proven bulls with sexed semen available, as well as percentages and frequencies of sexed semen matings for heifers and cows. Herds were also characterized for the...

  2. Correlation of phthalate exposures with semen quality

    International Nuclear Information System (INIS)

    Phthalates are widely used man-made chemical released in the environment and human exposure is mainly through diet. As the phthalate plasticizers are not covalently bound to PVC, they can leach, migrate or evaporate into the environment and as a result have become ubiquitously contaminants. The present study investigates the correlation, if any, between the phthalate esters (DEP, DEHP, DBP, DMP, DOP) and sperm mitochondrial status, ROS, LPO, SCSA, and sperm quality. The study was conducted in the urban/rural population of Lucknow visiting Obstetrics and Gynecology Department, CSMMU, Lucknow. Semen analysis was performed according to the WHO guidelines while phthalate analysis by HPLC and LPO by spectrophotometer and the sperm mitochondrial status, ROS, SCSA using flow cytometry. The questionnaire data showed no significant difference in the demographic characteristics among the groups. In general, urban population was found to have statistically significant higher levels of phthalate esters than the rural. Further, infertile men showed statistically significant (p < 0.05) higher levels of pollutants in the semen than fertile men. A negative correlation between semen phthalate level viz DEHP and sperm quality and positive association with depolarized mitochondria, elevation in ROS production and LPO, DNA fragmentation was established. The findings are suggestive that phthalates might be one among the contributing factors associated with the deterioration in semen qualiated with the deterioration in semen quality and these adverse effects might be ROS, LPO and mitochondrial dysfunction mediated

  3. Effect of Genotype and Frequency of Semen Collection on Semen Characteristics of Local Chicken Cocks

    Directory of Open Access Journals (Sweden)

    S.N. Ibe

    2006-01-01

    Full Text Available This study reports the effect of genotype and frequency of semen collection on seminal traits of local chicken cocks. Semen was collected, using the back-lumbar massage method from Normal Feather (NOF, Naked Neck (NN, Frizzle (FR and Naked Neck x Frizzle (NNxFR cocks at two ejaculation frequencies, namely once and twice per week for nine weeks. Ejaculates were subjected to both physical and laboratory evaluations for quality. Results showed that there were significant (p<0.05 differences between the genotypes for semen volume with the NOF (0.150.009 mL and NN x FR (0.130.013 mL cocks having higher semen volumes than that of the NN (0.110.013 mL and FR (0.080.013 mL counterparts. Total spermatozoa was the only seminal trait significantly affected by the two frequencies of collection with once a week giving higher values than twice a week collection. Interaction effect was significant for sperm concentration and total spermatozoa. This effect was stronger when semen was harvested twice a week with the NN x FR and NOF cocks producing higher values. It was therefore concluded that NN x FR and NOF genotype were superior to their NN and FR counterparts in both semen output and frequency of semen collections and may be considered as potential candidates for use in natural mating and/or artificial insemination programmes aimed at improving the lot of the local chicken.

  4. Semen abnormalities with SSRI antidepressants.

    Science.gov (United States)

    2015-01-01

    Despite decades of widespread use, the adverse effect profile of "selective" serotonin reuptake inhibitor (SSRI) antidepressants has still not been fully elucidated. Studies in male animals have shown delayed sexual development and reduced fertility. Three prospective cohort studies conducted in over one hundred patients exposed to an SSRI for periods ranging from 5 weeks to 24 months found altered semen param-eters after as little as 3 months of exposure: reduced sperm concentration, reduced sperm motility, a higher percentage of abnormal spermatozoa, and increased levels of sperm DNA fragmentation. One clinical trial showed growth retardation in children considered depressed who were exposed to SSRls. SSRls may have endocrine disrupting properties. Dapoxetine is a short-acting serotonin reuptake inhibitor that is chemically related to fluoxetine and marketed in the European Union for men complaining of premature ejaculation. But the corresponding European summary of product characteristics does not mention any effects on fertility. In practice, based on the data available as of mid-2014, the effects of SSRI exposure on male fertility are unclear. However, it is a risk that should be taken into account and pointed out to male patients who would like to father a child or who are experiencing fertility problems. PMID:25729824

  5. Semen quality in Peruvian pesticide applicators: association between urinary organophosphate metabolites and semen parameters

    Directory of Open Access Journals (Sweden)

    Gasco Manuel

    2008-11-01

    Full Text Available Abstract Background Organophosphates are broad class of chemicals widely used as pesticides throughout the world. We performed a cross-sectional study of associations between dialkylphosphate metabolites of organophosphates and semen quality among pesticide applicators in Majes (Arequipa, Peru. Methods Thirty-one men exposed to organophosphate (OP pesticides and 31 non-exposed were recruited (age, 20–60 years. In exposed subjects, semen and a blood sample were obtained one day after the last pesticide application. Subjects were grouped according to levels of OP metabolites in urine. Semen samples were analyzed for sperm concentration, percentage of sperm motility, percentage of normal morphology, semen leucocytes and concentrations of fructose and zinc. Exposure to OP was assessed by measuring six urinary OP metabolites (dimethyl and diethyl phosphates and thiophosphates by gas chromatography using a single flame photometric detector. Results Diethyldithiophosphate (p = 0.04 and diethylthiophosphate (p = 0.02 better reflected occupational pesticide exposure than other OP metabolites. Semen analysis revealed a significant reduction of semen volume and an increase in semen pH in men with OP metabolites. Multiple regression analysis showed that both occupational exposure to pesticides and the time of exposure to pesticides were more closely related to alterations in semen quality parameters than the single measurement of OP metabolites in urine. Conclusion The study demonstrated that occupational exposure to OP pesticides was more closely related to alterations in semen quality than a single measurement of urine OP metabolites. Current measurement of OP metabolites in urine may not reflect the full risk.

  6. Effect of Addition of Taurine on the Liquid Storage (5°C) of Mithun (Bos frontalis) Semen

    OpenAIRE

    Perumal, P; Kezhavituo Vupru; Rajkhowa, C.

    2013-01-01

    The present study was undertaken to assess the effect of taurine on sperm motility, viability, total sperm abnormalities, acrosomal and plasma membrane integrity, enzymatic profiles such as reduced glutathione (GSH), glutathione peroxidase (GPX), superoxide dismutase (SOD), and catalase (CAT), and biochemical profiles such as cholesterol efflux and malondialdehyde (MDA) production. A total of 50 ejaculates were collected twice a week from 8 mithun bulls, and semen was split into 4 equal aliqu...

  7. Antidepressant-associated changes in semen parameters.

    Science.gov (United States)

    Tanrikut, Cigdem; Schlegel, Peter N

    2007-01-01

    We describe 2 cases of patients referred for evaluation of male infertility who had antidepressant medication-associated changes in sperm motility and/or concentration. The physical examination and endocrinologic study findings were unremarkable in each case. Analysis of the initial semen specimens revealed oligospermia, impaired motility, and abnormal morphology in each patient while they were taking serotonin reuptake inhibitors. Repeat semen analyses performed 1 to 2 months after discontinuation of the antidepressants demonstrated marked improvements in sperm concentration and motility. Additional assessment of the potential impact of antidepressant medications on male fertility is warranted. PMID:17270655

  8. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen / Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen

    Scientific Electronic Library Online (English)

    G.V., Aguiar; M.F., van Tilburg; A.G.V., Catunda; C.K.S., Celes; I.C.S., Lima; A.C.N., Campos; A.A.A., Moura; A.A., Araújo.

    2013-02-01

    Full Text Available Verificou-se as características seminais de caprinos durante a época seca e a chuvosa no Nordeste brasileiro e a influência da época no resfriamento do sêmen. Foram mensurados volume, concentração espermática, porcentagem de espermatozoides móveis, vigor, morfologia espermática e características bio [...] químicas (frutose, ácido cítrico, fósforo, magnésio, proteínas totais e atividade da fosfolipase A2). Observou-se redução (P Abstract in english The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile ( [...] fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity) were analyzed. It was observed a reduction (P

  9. Bovine Leukemia ProVirus: Evidence of Presence of Part of Gag Gene in Seminal Plasma of Naturally Infected Bulls

    OpenAIRE

    Razi Jafari; Reza Asadpour

    2010-01-01

    It is of critical importance to understand the modalities of BLV presence in semen, especially with regard to artificial insemination (AI). Presence of bovine leukemia provirus was demonstrated in fresh and frozen semen samples by researchers. In this study paired blood and semen samples from 45 bulls were assessed for the presence of part of gag gene and antibodies to BLV in blood, semen and cell-free fraction of the semen (seminal plasma). Proviral DNA was detected in 5 out of 45 seminal pl...

  10. Testicular endocrine function, seasonality and semen quality of the stallion.

    Science.gov (United States)

    Hoffmann, B; Landeck, A

    1999-10-31

    To gain further information on gonadal function of the stallion, concentrations of testicular steroids in blood plasma (bpl) and seminal plasma (spl) and their distribution in the ejaculate were determined. Blood and semen samples from a total of 11 stallions were collected from November to July. Estrone (E1), estrone sulfate (E1S), estradiol-17beta (E2beta) and testosterone (T) were determined in bpl and spl, and in addition androstenedione (A), dehydroepiandrosterone (DHEA) and 5alpha-dihydrotestosterone (5alpha-DHT) were measured in spl. At certain points of time, aliquots of an ejaculate were centrifuged, washed and the distribution of E1, E1S, E2beta and T into seminal plasma and the sperm fraction was assessed. Hormone assay was by RIA, partly after prior separation by HPLC. Mean concentrations (X(g) x DF) were as follows: E2beta (bpl) 31.1 (1.16), (spl) 24.2 (1.42) pg ml(-1); E1 (bpl) 143.3 (1.21), (spl) 117.7 (1.53) pg ml(-1); E1S (bpl) 157.3 (1.44), (spl) 2.92 (1.42) ng ml(-1); T (bpl) 570.6 (1.43), (spl) 23.1 (1.68) pg ml(-1); A (spl) 17.9 (1.39) pg ml(-1); DHEH (spl) 12.4 (1.51) pg ml(-1); 5alpha-DHT (spl) 9.7 (1.29) pg ml(-1). Except for E2beta and A in seminal plasma, a seasonal pattern was established for all other steroids with lowest mean values occurring from November to April. From the semen parameters determined, only motility was correlated to season. There was a higher correlation among oestrogen in blp than in spl and the only correlation identified between oestrogenic and androgenic steroids was between T and E2beta in blp. In spl, T was correlated with A and 5alpha-DHT. T was the dominant free steroid in bpl while it was E1 in spl; T and E1S concentrations were about 23- and 54-fold lower in spl compared to bpl with E1S, however, showing the highest absolute values in both fluids. In the fractionated ejaculate an association of free oestrogens, particularly E2beta, with spermatozoa was observed. PMID:10565441

  11. Occurrence of mycoplasmas in semen samples of birds of prey

    OpenAIRE

    Lierz, Michael; Hafez, Hafez Mohamed

    2008-01-01

    Abstract Mycoplasmas are well known pathogens in a variety of animals. In poultry it is known, that they can be transmitted by semen and infect the uterus of females. As the prevalence of mycoplasmas in birds of prey is very high and artificial insemination is a common used technique in bird of prey reproduction, the possibility of Mycoplasma transmission by contaminated semen in birds of prey was investigated. Isolation of mycoplasmas was possible in 5 of 32 (15.6%) semen samples ...

  12. Métodos de colección de semen en camélidos sudamericanos

    Directory of Open Access Journals (Sweden)

    Pacheco Curie, Joel Iván

    2008-05-01

    Full Text Available La colección de semen depende de una buena y constante producciónespermática para que la calidad del semen sea buena. Las técnicas decolección de semen están bastante desarrolladas en otros animales,especialmente en rumiantes domésticos en los cuales ya es unprocedimiento de rutina, pero en camélidos, dadas las especialescaracterísticas reproductivas, anatómicas y fisiológicas de estas especies, esta colección es bastante dificultosa y no existe un protocolo recomendado y una técnica optima, así como su manejo posterior.

  13. Environmental exposure to arsenic may reduce human semen quality: associations derived from a Chinese cross-sectional study

    Directory of Open Access Journals (Sweden)

    Xu Weipan

    2012-07-01

    Full Text Available Abstract Background Recent observations in in vitro and in vivo models suggest that arsenic (As is an endocrine disruptor at environmentally-relevant levels. When exposed to As, male rats and mice show steroidogenic dysfunction that can lead to infertility. However, the possible effects of As on human male semen quality remain obscure. Methods We monitored the profile of As species in the urine of a reproductive-age human cohort and assessed its association with semen quality. Men (n?=?96 were recruited in an infertility clinic from July 2009 to August 2010 in the Affiliated Hospital of Chongqing Institute for Population and Family Planning. Five urinary As species were analyzed by high-performance liquid chromatography coupled with inductively coupled plasma mass spectrometry (HPLC-ICP-MS. Clinical information on the semen volume, sperm concentration and motility was employed to catalogue and evaluate semen quality according to WHO guidelines. As species concentrations in addition to other continuous variables were dichotomized by the medians and modelled as categorical variables in order to explore using the binary logistic regression possible associations between As exposure and semen quality. Results Urinary concentrations (geometric mean ± SD, ?g g-1 creatinine of different As species were 7.49 (±24.8 for AsB, 20.9 (±13.7 for DMA, 2.77 (±3.33 for MMA, and 4.03 (±3.67 for Asi (AsiIII and AsiV. DMA concentrations above the median were significantly associated with below-reference sperm concentrations (P =0.02 after adjusting for age, body mass index (BMI, abstinence, smoking and drinking habits. In addition, smoking was positively associated with MMA. Conclusion Reduced parameters in human semen quality are positively associated with As exposure in a reproductive-age Chinese cohort.

  14. Semen quality of Italian local pig breeds

    Directory of Open Access Journals (Sweden)

    G. Gandini

    2010-01-01

    Full Text Available From 1996 to 1999 a conservation programme was carried out within the framework of EC contract “European gene banking project for the pig genetic resources” (Ollivier et al., 2001 in the Italian local pig breeds. The aims of the program included the primary characterization of the breeds, i.e. information on the organization in charge of the breed, breeding population numbers, breed description and qualifications, and field trials on productive and reproductive performances. In this context the “Semen Bank of Italian local pig breeds” was built. A total of 30,835 straws of four Italian local pig breeds (Cinta Senese, Casertana, Mora Romagnola and Nero Siciliano, collected from 42 sires, have been stored. In this work semen quality traits, lipid composition and freezability of the four Italian local pig breeds are reported.

  15. Monitoring environmental exposures with semen assays

    International Nuclear Information System (INIS)

    Semen studies in humans and animals have yielded extensive and compelling evidence that sperm can be used to assess reproductive potential and diagnose pathology. More recent studies on mutagens and carcinogens both at this and other laboratories suggest that a combination of mouse and human assays can be an efficient, effective approach to monitoring for reproductive hazards in the environment. We are investigating the potential of using variability in sperm morphology and DNA content to quantify and monitor the effects of environmental agents on the human testes. Here we review the status of human and mouse assays for environmental surveillance, discuss the genetic and fertility implications of chemically induced semen changes, and describe the high-speed flow methods being developed to automate sperm assays

  16. Is posthumous semen retrieval ethically permissible?

    OpenAIRE

    ORR, R; Siegler, M.

    2002-01-01

    It is possible to retrieve viable sperm from a dying man or from a recently dead body. This sperm can be frozen for later use by his wife or partner to produce his genetic offspring. But the technical feasibility alone does not morally justify such an endeavour. Posthumous semen retrieval raises questions about consent, the respectful treatment of the dead body, and the welfare of the child to be.

  17. Influence of addition of different antibiotics in semen diluent on viable bacterial count and spermatozoal viability of Awassi ram semen

    OpenAIRE

    O.I. Azawi; M A Ismaeel

    2012-01-01

    The objectives of the present study were to determine the effects of six different antibiotics in controlling the growth of semen contaminating bacteria and if these antibiotics have any adverse effect on Awassi ram spermatozoa. Semen samples from six mature Awassi rams were used in this study. A total number of 120 ejaculates were collected from the rams using an artificial vagina once a week. Semen ejaculates were evaluated for volume, sperm concentration, mass motility, individual motility...

  18. Métodos de coleccion de semen en camélidos sudamericanos - Methods of semen collection in south american camelids

    Directory of Open Access Journals (Sweden)

    Pacheco Curie, Joel Iván;

    2008-04-01

    Full Text Available ResumenLa colección de semen depende de una buena y constante producciónespermática para que la calidad del semen sea buena. Las técnicas decolección de semen están bastante desarrolladas en otros animales,especialmente en rumiantes domésticos en los cuales ya es unprocedimiento de rutina, pero en camélidos, dadas las especialescaracterísticas reproductivas, anatómicas y fisiológicas de estasespecies, esta colección es bastante dificultosa y no existe un protocolo recomendado y una técnica optima, así como su manejo posterior. Las características seminales son también muy variables y dependen de la forma de colección y existen varios factores que afectan su calidad, así como frecuencia de colección, edad, época, etc., por lo que también se evaluaron y desarrollaron diferentes técnicas de degelificar, diluir, conservar y congelar estas células espermáticas, de acuerdo a la técnica de colección y la especie, así como la utilización de dilutores y crioprotectores utilizados para otras especies, pudiéndose posteriormente utilizar en la evaluación reproductiva de los machos.SummaryThe collection of semen depends on a good and constant spermaticproduction so that the quality of the semen is good. The techniques ofcollection of semen enough developed in other animals are, especially in ruminant domestic in which is already a routine procedure, but incamélids, given the special ones characteristic reproductive, anatomical and physiologic of these species, this collection is quite difficult and it doesn't exist a recommended protocol and a good technique, as well as its later handling. The seminal characteristics are also very variable and they depend in the collection way and several factors that affect their quality, exist as well as collection frequency, age, time, etc, for what too were also evaluated and they developed different techniques of degelification, to dilute, to conserve and to freeze these spermatic cells,according to the collection technique and the species, as well as theextenders use and crioprotectors used for other species, being able tolater on to use in the reproductive evaluation of the males.

  19. Effect of alternate day collection on semen quality of Asian elephants (Elephas maximus) with poor initial fresh semen quality.

    Science.gov (United States)

    Imrat, P; Mahasawangkul, S; Thitaram, C; Suthanmapinanth, P; Kornkaewrat, K; Sombutputorn, P; Jansittiwate, S; Thongtip, N; Pinyopummin, A; Colenbrander, B; Holt, W V; Stout, T A E

    2014-06-30

    In captivity, male Asian elephants often yield poor quality semen after transrectal manually assisted semen collection; however, the reasons for the disappointing semen quality are not clear. Here we test the hypothesis that accumulation of senescent spermatozoa is a contributory factor, and that semen quality can therefore be improved by more frequent ejaculation. To this end we investigated the effect of collecting semen five times on alternate days, after a long period of sexual rest, on semen quality in Asian elephants known to deliver poor semen during infrequent single collections. All eight bulls initially displayed a high incidence of detached sperm heads and low percentages of motile (close to 0%) spermatozoa. After semen collection on alternate days, the percentages of detached sperm heads, and head and mid-piece abnormalities, were reduced significantly (p<0.05). In particular, one bull showed markedly improved sperm motility (increased from 0% to 60%) and membrane integrity (increased from 5% to 75%). In addition, advancing age significantly (p<0.01) correlated with lower percentages of sperm with intact membranes and a higher frequency of detached sperm heads. In contrast to sperm accumulation problems in other species, a small ampullary diameter correlated significantly (p<0.05) with reduced semen quality. PMID:24832106

  20. Criopreservação de sêmen suíno: avanços tecnológicos e perspectivas / Cryopreservation of boar semen: progress and perspectives / Criopreservación de semen de verraco: avances y perspectivas tecnológicas

    Scientific Electronic Library Online (English)

    Tainã, Figueiredo Cardoso; Estela, Fernandes e Silva; Carine, Dahl Corcini.

    2013-07-01

    Full Text Available Resumo A criopreservação de sêmen suíno é uma técnica ainda não consolidada devido à alta sensibilidade do espermatozoide da espécie ao processo de congelamento e descongelamento. Ainda assim, a utilização do sêmen criopreservado é altamente desejável para o intercâmbio genético e manutenção da bios [...] segurança. Esta revisão tem como objetivo ressaltar alguns fatores limitantes do processo e apontar os consideráveis avanços desenvolvidos nos últimos anos, principalmente devido ao aperfeiçoamento das técnicas já existentes, como caracterização das proteínas do ejaculado, ajustes na remoção do plasma seminal e uso de adjuvantes na confecção dos diluentes. Todas estas técnicas tornarão a criopreservação do sêmen suíno mais aplicável nos próximos anos para que possa ser finalmente uma técnica de uso comercial. Abstract in spanish Resumen La criopreservación del semen de porcino es una técnica aún no consolidada debido a la alta sensibilidad del espermatozoide de esta especie al proceso de congelación y descongelación, aun así, el uso de semen criopreservado es altamente deseable para el intercambio genético y el mantenimient [...] o de la bioseguridad. Esta revisión tiene por objeto poner de relieve algunos factores limitantes del proceso y señalar las importantes avances desarrollados en los últimos años, debido principalmente al mejoramiento de las técnicas existentes, entre ellas, la caracterización de las proteínas de la eyaculación, los ajustes de extracción del plasma seminal y el uso de adyuvantes en la producción de los diluyentes. Todas estas técnicas harán que la criopreservación del semen de porcino sea más aplicable en los próximos años, para ser finalmente una técnica de uso comercial. Abstract in english Abstract Biotechnology of boar semen cryopreservation has not succeeded due to the high sensitivity of swine sperm to the freezing and thawing process. However, its use is highly desirable for genetic improvement and maintenance of biosecurity. This review aims to highlight some limitations of the p [...] rocess and point out important advances obtained in recent years, including the improvement of existing techniques, such as protein characterization of the ejaculate, adjustments in the removal of seminal plasma, and use of adjuvants in the manufacture of diluents; all of which will make cryopreservation commercially available in the near future.

  1. Congelamiento de semen de burro (Equus asinus) / Freezing of donkey semen (Equus asinus)

    Scientific Electronic Library Online (English)

    Igor Frederico, Canisso; Fernando Andrade, Souza; Jeanny Marlén, Ortigoza Escobar; Giovanni Ribeiro de, Carvalho; Mina C., Davies Morel; Erotides, Capistrano da Silva; José, Domingos Guimarães; Anali, Linhares Lima.

    2008-07-01

    Full Text Available Por muitas décadas, o desenvolvimento e utilização da inseminação artificial nos eqüídeos, principalmente com sêmen congelado, esteve restrito devido a imposições por muitas associações de criadores que não permitiam a utilização da técnica. Recentemente, as legislações das associações de criadores [...] de eqüídeos em diversos países do mundo se tornaram mais flexíveis, permitindo o registro de produtos oriundos de sêmen congelado. No Brasil, frente a essa nova mudança, a principal associação criadores de jumentos (Associação Brasileira de Criadores de Jumento Pêga), revisou seus conceitos e passou a permitir a utilização desta biotecnologia. Atualmente em muitos países, o maior interesse no reprodutor jumento é para a produção de muares, pois esses animais são produtos bastante desejáveis no meio rural, devido reunirem as melhores características destas duas espécies. O primeiro trabalho envolvendo o congelamento de sêmen de jumentos utilizaram diluidor a base de gema de ovo, glicerol e ampolas de vidro como sistema de envase baseados na metodologia de congelamento de touros. Contudo, apesar da longa data de início dos estudos, poucas pesquisas têm sido direcionadas à espécie, em especial a biotecnologias do sêmen. Nesta revisão de literatura discute se as principais técnicas de congelamento de sêmen de eqüídeos bem como descrição detalhada dos estudos envolvendo o congelamento de sêmen da espécie asinina. Abstract in spanish Por muchas décadas, el desarrollo y utilización de la inseminación artificial en los équidos, especialmente con semen congelado, estuvo restringido, principalmente, por imposiciones de las asociaciones de criadores. Recientemente, las legislaciones de criadores de équidos en varios países se han tor [...] nado más flexibles, permitiendo el registro de productos oriundos de semen congelado. En el Brasil, frente a ese nuevo cambio, la principal asociación de criadores de burros (Associação Brasileira de Criadores de Jumento Pêga) revisó sus conceptos y comenzó a permitir la utilización de esta biotecnología. Asimismo, en muchos países, el mayor interés en el asno o burro como semental está relacionado a la producción de mulares, pues estos animales son deseables en el medio rural, debido a que reúnen las mejores características del burro y del caballo. Los primeros trabajos en congelamiento de semen de asnos utilizaron dilutores a base de yema de huevo y glicerol, y ampolletas de vidrio como sistema de envase, basados en la metodología de congelamiento de toros. Sin embargo, pese al tiempo transcurrido, pocas investigaciones han sido dirigidas a esta especie, en especial a biotecnologías del semen. En esta revisión de literatura se discuten las principales técnicas de congelamiento de semen de équidos y se describen estudios referentes al congelamiento de semen de la especie asnal. Abstract in english For decades, the development and use of the artificial insemination in the equine, especially with frozen semen, was restricted due to impositions of equine breeders associations that opposed the use of the technique. Recently, these legislations have become more flexible in several countries, allow [...] ing the registration of products originating from frozen semen. In Brazil, based on these changes, the main donkey breed association (Brazilian Breeders Association of the Pêga Donkeys) revised their concepts and started to allow the use of this biotechnology. The current interest in many countries for the donkey sire is the production of mules, because their acceptability as these animals inherits suitable characteristics of both donkeys and horses. The first reports on donkey frozen semen used extenders based on egg yolk and glycerol, packed in glass ampoules, and followed the existing methodology for freezing bull semen. However, despite of the elapsed time, few research works have been carried out on this species, especially on semen. This literature review discussed the main techniques of freezi

  2. Semen characteristics and malondialdehyde levels in men with different reproductive problems.

    Science.gov (United States)

    Collodel, G; Moretti, E; Micheli, L; Menchiari, A; Moltoni, L; Cerretani, D

    2015-03-01

    The aim of this study was to assess the level of malondialdehyde (MDA) in the seminal plasma of infertile men and to highlight a relationship between the level of MDA and semen parameters. Eighty-one infertile patients were divided into groups according to their clinical diagnosis: genitourinary infections, varicocele and idiopathic infertility. Semen quality was assessed by light and transmission electron microscopy (TEM). TEM data were quantified with a mathematical formula able to obtain a fertility index and the percentage of sperm apoptosis, immaturity, and necrosis. Seminal MDA levels were determined by spectrofluorometry. Scrotal Eco-color Doppler was used to detect the varicocele. Infected patients had a positive bacteriological semen analysis. A control group consisted of 14 normospermic fertile men. Fertile group showed significantly increased values of sperm concentration, motility, and fertility index compared to infertile groups. In the infertile groups, sperm motility, concentration, apoptosis, and fertility index were not significantly different. In infection group, the percentage of necrosis was significantly higher than that observed in fertile men, varicocele, and idiopathic infertility groups (p varicocele group (p varicocele group compared to idiopathic infertility group (p varicocele group MDA levels correlated positively with necrosis and negatively with immaturity (p < 0.05). In fertile men and idiopathic infertility group, they did not show any correlation. In conclusion, we suggest that the evaluation of seminal MDA may be a good marker for understanding pathologies responsible of a sperm motility reduction such as urogenital infections or inflammatory status. PMID:25331426

  3. Differences in preservation of canine chilled semen using different transport containers.

    Science.gov (United States)

    Lopes, G; Simões, A; Ferreira, P; Martins-Bessa, A; Rocha, A

    2009-05-01

    In the present study, the effect of three different containers in the preservation of dog chilled semen, during 24, 48 and 72h was evaluated. Weekly sperm pools of different dogs were obtained, during 10 consecutive weeks. Semen samples were diluted in egg-yolk-Tris-fructose extender and stored in a Styrofoam box, a common Thermos flask and an Equitainer. Progressive motility, morphology and sperm membrane integrity were examined in semen aliquots taken daily from each container during the 3 days of storage. Additionally, integrity of the acrosome and sperm plasma membranes, determined by PI/Fitc-PSA staining was assessed at 48 and 72h of storage. At 24h no differences were observed between the three containers for the evaluated parameters. At 48h samples kept in the Equitainer presented a higher progressive motility than samples kept in the Thermos. At 72h, progressive motility was higher in the Equitainer than in the other two containers. Only samples kept in the Equitainer maintained similar levels of progressive motility between 24 and 72h. Membrane integrity assessed by eosin-nigrosin deteriorated over the 72h period, whereas functional membrane integrity determined by the hypoosmotic swelling test was independently affected by type of container (the Equitainer) kept a higher percentage of sperm cells with intact membrane) and time of storage (a decrease of membrane integrity between 24 to 72h). Staining with PI-Fitc-PSA allowed the detection of differences between containers but not between the two studied storage periods (48 and 72h). The results indicated that the use of the Equitainer is preferable when transporting chilled dog semen for more than 48h. PMID:18479849

  4. Opportunities to improve liquid and frozen storage of boar semen

    Science.gov (United States)

    Artificial insemination has facilitated the utilization of superior genetics, and has reduced boar biosecurity problems and housing costs. The use of frozen semen permits the flexibility to inseminate animals at unscheduled times and to use semen of deceased boars. While good long-term storage exten...

  5. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen

    Directory of Open Access Journals (Sweden)

    G.V. Aguiar

    2013-02-01

    Full Text Available The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile (fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity were analyzed. It was observed a reduction (PVerificou-se as características seminais de caprinos durante a época seca e a chuvosa no Nordeste brasileiro e a influência da época no resfriamento do sêmen. Foram mensurados volume, concentração espermática, porcentagem de espermatozoides móveis, vigor, morfologia espermática e características bioquímicas (frutose, ácido cítrico, fósforo, magnésio, proteínas totais e atividade da fosfolipase A2. Observou-se redução (P<0,05 no número de espermatozóides morfologicamente normais, frutose, ácido cítrico, fósforo, magnésio e proteínas totais durante a época seca que não influenciaram na motilidade, vigor, volume e concentração do sêmen. Entretanto, a atividade da fosfolipase A2 foi maior na época seca. Quando o sêmen foi submetido ao resfriamento a 4ºC durante 48 horas, houve redução (P<0,05 na motilidade total e no vigor espermático durante a época seca. Com base nesses resultados, conclui-se que o período chuvoso é melhor para resfriar sêmen de caprinos no Nordeste brasileiro.

  6. Indian story on semen loss and related Dhat syndrome.

    Science.gov (United States)

    Prakash, Om; Kar, Sujit Kumar; Sathyanarayana Rao, T S

    2014-10-01

    India is a country of many religions and ancient cultures. Indian culture is largely directed by the Vedic culture since time immemorial. Later Indian culture is influenced by Buddhism, Islam, and Christianity. Indian belief system carries the footprints of these cultures. Every culture describes human behaviors and an interpretation of each human behavior is largely influenced by the core cultural belief system. Sexuality is an important domain which is colored by different cultural colors. Like other cultures, Indian culture believes "semen" as the precious body fluid which needs to be preserved. Most Indian beliefs consider loss of semen as a threat to the individual. Ancient Indian literature present semen loss as a negative health related event. Dhat syndrome (related to semen loss) is a culture-bound syndrome seen in the natives of Indian subcontinent. This article gathers the Indian concepts related to semen loss. It also outlines belief systems behind problems of Dhat syndrome. PMID:25568479

  7. AZF Microdeletions in Human Semen Infected with Bacteria

    Directory of Open Access Journals (Sweden)

    Hayfa H Hassani

    2011-11-01

    Full Text Available Bacterial infections are associated with infertility in men. This study was aimed to investigate microdeletions on Yq chromosome in semen infected with bacteria by using bacteriological, biochemical, and serological assays. The investigation showed that 107 of 300 (84.80% semen samples collected from infertile men with primary or secondary infertility were infected with different species of bacteria. Chlamydia trachomatis and Neisseria gonorrheae were the most frequently diagnosed bacteria in the infected semen samples. The percentages of infections of semen samples with C. trachomatis and N. gonorrhea were 42.31% and 35.28% respectively. Genomic DNA from each semen sample infected with predominant bacteria was analyzed for AZF deletions by using multiplex PCR. Different patterns of AZF microdeletions were obtained. It can be concluded that sexually transmitted bacteria may contribute in microdeletions of Yq chromosome by indirectly producing reactive oxygen species and causing gene defect in AZF regions.

  8. Artificial insemination in Denmark by frozen donor semen supplied from a central bank.

    Science.gov (United States)

    Hansen, K B; Nielsen, N C; Rebbe, H

    1979-05-01

    A central semen bank in Denmark supplied deep-frozen semen. Selection of donors, freezing technique, and practical details about transport of specimens are described. In one of the gynaecological departments supplied with frozen semen, 22 out of 30 patients who had artificial insemination became pregnant. The advantages and disadvantages of using frozen semen are discussed. PMID:465386

  9. Effect of psychological stress on the L-arginine-nitric oxide pathway and semen quality

    Directory of Open Access Journals (Sweden)

    S. Eskiocak

    2006-05-01

    Full Text Available It has been reported that mental stress causes abnormality of spermiogram parameters. We investigated the effect of psychological stress on the L-arginine-nitric oxide (NO pathway. Semen samples were collected from 29 healthy fourth semester medical students just before (stress and 3 months after (non-stress the final examinations. Psychological stress was measured by the State Anxiety Inventory questionnaire. After standard semen analysis, arginase activity and NO concentration were measured spectrophotometrically in the seminal plasma. Measurements were made in duplicate. During the stress period, sperm concentration (41.28 ± 3.70 vs 77.62 ± 7.13 x 10(6/mL, rapid progressive motility of spermatozoa (8.79 ± 1.66 vs 20.86 ± 1.63% and seminal plasma arginase activity (0.12 ± 0.01 vs 0.22 ± 0.01 U/mL were significantly lower than in the non-stress situation, whereas seminal plasma NO (17.28 ± 0.56 vs 10.02 ± 0.49 µmol/L was higher compared to the non-stress period (P < 0.001 for all. During stress there was a negative correlation between NO concentration and sperm concentration, the percentage of rapid progressive motility and arginase activity (r = -0.622, P < 0.01; r = -0.425, P < 0.05 and r = -0.445, P < 0.05, respectively. These results indicate that psychological stress causes an increase of NO level and a decrease of arginase activity in the L-arginine-NO pathway. Furthermore, poor sperm quality may be due to excessive production of NO under psychological stress. In the light of these results, we suggest that the arginine-NO pathway, together with arginase and NO synthase, are involved in semen quality under stress conditions.

  10. EFFECT OF LOW DENSITY LIPOPROTEINS IN EXTENDER ON FREEZABILITY AND FERTILITY OF EGYPTIAN BUFFALO BULL SEMEN

    Directory of Open Access Journals (Sweden)

    El-Seify

    2012-01-01

    Full Text Available Semen from three Egyptian buffalo bulls was collected once weekly and ejaculates with more 75% progressive motility and more 85 % normal sperm morphology prior to cryopreservation were pooled in order to have sufficient semen for a replicate and to eliminate the bulls effect. Seven extenders were used: Tris 20 % egg yolk extender with 7 ml glycerol as a control (T1, and substitution of whole egg yolk with 4, 6, 8, 10, 12 and 15 % low density lipoprotein (LDL, T2 – T6, respectively. Semen was diluted to 80 x106 sperm/ml, packaged into 0.25 ml straws, cooled, held at 5.C for 4 h, and then frozen in liquid nitrogen (LN and stored at -196.C for at least one month. Sperm progressive motility, intact acrosome and plasma membrane integrity were assesd at post dilution, equilibration, post-thawing (at 37.C for 30 sec. and after 30 days storage in LN. This study reveled that LDL extenders were more effective in preservation of progressive motility, intact acrosome and integrity of the plasma membrane of buffalo spermatozoa than whole egg yolk extender. Sperm progressive, intact acrosome and plasma membrane integrity were much higher (P < 0.05 in the 12% LDL extender (63.3, 77.17 and 71.3% respectively vs. 35, 40.8 and 34.7% in the control 20% EY extender at post-thawing process, respectively. Fertility rates were higher in extender containing 12% LDLs compared with the control (72.7% vs. 50%, respectively. It was concluded that LDL (12% in extender improved the freezability and fertility of buffalo bull spermatozoa.

  11. Association of soybean-based extenders with field fertility of stored ram (Ovis aries) semen: a randomized double-blind parallel group design.

    Science.gov (United States)

    Khalifa, Tarek; Lymberopoulos, Aristotelis; Theodosiadou, Ekaterini

    2013-02-01

    Two consecutive randomized double-blind field fertility experiments were conducted over a 4-month period and aimed at evaluating the association of two commercial soybean lecithin-based extenders (AndroMed [Minitub, Tiefenbach, Germany] and BioXcell [IMV Technologies, L'Aigle, France]) with pregnancy rates of chilled-stored (CS) and frozen-thawed (FT) ram semen. Semen samples with more than 2 × 10(9) sperm per mL and 70% progressive motile spermatozoa were collected via an artificial vagina from twelve proven fertile Chios rams, split-diluted with the above mentioned extenders, packaged in 0.25 mL straws and either stored at 5 ± 1 °C for 30 to 36 hours or frozen and thawed. Non-lactating multiparous ewes were inseminated in progestagen-synchronized estrus either with CS (AndroMed: N = 212 and BioXcell: N = 206; intracervical AI) or with FT (AndroMed: N = 114 and BioXcell: N = 92; laparoscopic intrauterine AI) semen. Ovulation was confirmed in all ewes based on determination of blood plasma progesterone (>1 ng/mL) 8 days post AI. Ewes were screened for pregnancy diagnosis by transabdominal ultrasonography 65 days post AI. BioXcell was superior to AndroMed in preserving the fertilizing potential of CS (P semen. In AndroMed-stored semen, young rams (1.5-2.5 years old, N = 8) had a pregnancy rate (59.1%; 124/210) lower than that (72.4%; 84/116) of mature rams (4.5 to 5.5 years, N = 4; P ram semen in BioXcell extender improved pregnancy rates of CS (66.7%; 88/132 vs. 83.9%; 94/112; P ram semen (P > 0.05). Ram-by-extender interactions were significant for pregnancy rates of CS and FT semen. Irrespective of extenders, overall pregnancy rates after intracervical and intrauterine AI were 75.1% and 62.2%, respectively (P storage of ram semen. Selection of the ewes, farms, and extenders for intracervical AI programs can contribute to satisfactory fertility rates with semen preserved more than 24 hours at 5 °C. PMID:23219519

  12. A successful new approach to honeybee semen cryopreservation.

    Science.gov (United States)

    Wegener, Jakob; May, Tanja; Kamp, Günter; Bienefeld, Kaspar

    2014-10-01

    Honeybee biodiversity is under massive threat, and improved methods for gamete cryopreservation could be a precious tool for both the in situ- and ex situ-conservation of subspecies and ecotypes. Recent cryoprotocols for drone semen have improved the viability and fertility of frozen-thawed semen by using increased diluent:semen-ratios, but there is still much room for progress. As semen cryopreserved after dilution often appeared hyperactive, we speculated that the disruption of sperm-sperm interactions during dilution and cryopreservation could reduce the fertile lifespan of the cells. We therefore developed protocols to reduce admixture, or abolish it altogether by dialyzing semen against a hypertonic solution of cryoprotectant. Additionally, we tested methods to reduce the cryoprotectant concentration after thawing. Insemination of queens with semen cryopreserved after dialysis yielded 49%, 59% and 79% female (= stemming from fertilized eggs) pupae in three separate experiments, and the numbers of sperm found in the spermathecae of the queens were significantly higher than those previously reported. Post-thaw dilution and reconcentration of semen for cryoprotectant removal reduced fertility, but sizeable proportions of female brood were still produced. Workers stemming from cryopreserved semen did not differ from bees stemming from untreated semen with regard to indicators of fluctuating asymmetry, but were slightly heavier. Cryopreservation after dialysis tended to increase the proportion of cells with DNA-nicks, as measured by the TUNEL-assay, but this increase appears small when compared to the baseline variations of this indicator. Overall, we conclude that cryoprotectant-addition through dialysis can improve the quality of cryopreserved drone semen. Testing of offspring for vitality and genetic integrity should continue. PMID:25088062

  13. Clinical relevance of routine semen analysis and controversies surrounding the 2010 World Health Organization criteria for semen examination

    Scientific Electronic Library Online (English)

    Sandro C., Esteves.

    2014-08-01

    Full Text Available Semen analysis is the corner stone of infertility evaluation as it provides information on the functional status of the seminiferous tubules, epididymis and accessory sex glands. The methods on how the human semen should be evaluated are provided by the World Health Organization, which periodically [...] releases manuals that include specific protocols and reference standards. In 2010, the WHO published new criteria for human semen characteristics that were markedly lower than those previously reported. In this review initially it is discussed the limitations of semen analysis as a surrogate measure of a man’s ability to father a pregnancy. Secondly, it is analyzed methodology issues that could explain why the newly released reference values were different from those earlier reported. Thirdly, it is speculated on the likely effects of the 2010 WHO criteria in the management of male infertility. Due to the several inherent limitations of semen analysis as a surrogate marker of male infertility, physicians should exercise caution when interpreting results. A template for semen analysis reports that incorporates the distribution of the semen characteristics of recent fathers in centiles rather than solely the minimum thresholds could aid clinicians to better understand how a given patient results compare with the reference population. Importantly, a male infertility evaluation must go far beyond a simple semen analysis, as it has to be complemented with a proper physical examination, a comprehensive history taking, and relevant endocrine, genetic, and other investigations.

  14. The effect of semen collection method and level of egg yolk on capability of dilution and storage of buck semen

    Directory of Open Access Journals (Sweden)

    N.N. Dhaher

    2013-12-01

    Full Text Available The study was conducted to evaluate the effect of semen collection method for reduction of the deleterious interaction between the enzymes of bulbourethral gland and egg yolk during the dilution and storage of buck semen by three different level of egg yolk. Ten bucks were used in this study; the bucks were divided into two groups (five bucks in each group. Semen samples were collected once a week for four weeks from the bucks in first group using an artificial vagina, and from the animals in second group using an electroejaculator. The collected semen samples were diluted with sodium citrate extender with three different level of egg yolk (5, 10 and 20%. Extend semen samples were stored at 5 °C for three days. Computer assisted sperm analysis and Sperm Class Analyzer® were used for evaluation of the buck semen samples. Sperm motility parameters were evaluated which includes; percentage of motile sperm, percentage of progressive motile sperm, the value of the linear velocity (VSL, the value of the average velocity (VAP, the value of the curvilinear velocity (VCL, and the amplitude of lateral movement of the head (ALH. Results showed that all sperm motility parameters under the different level of egg yolk in semen samples that collected by artificial vagina were significantly higher than those which collected by electroejaculator. The percentage of motile sperm and progressive motile sperm of samples that collected by artificial vagina were higher at 10% of egg yolk, while these motility parameters were higher at 5% of egg yolk for semen samples that collected by electroejaculator. The differences between the two methods of semen collection in VCL and ALH were clear and the values were higher in samples that collected using the artificial vagina. The values of VSL, VAP and VCL of semen samples that collected by artificial vagina were higher at the second day than first day of semen storage under 10% of egg yolk. In conclusion, there are effects of the semen collection method on ability of dilution and storage of buck semen, and using of artificial vagina and 10% of egg yolk is recommended for buck semen dilution and storage.

  15. Testicular cancer and HPV semen infection

    Directory of Open Access Journals (Sweden)

    AlbertoFerlin

    2012-12-01

    In the last decades, its incidence showed a progressive increased probably due to genetic and environmental factors. Despite exposure to some viruses such as HIV, HCV, EBV and HPV is frequently related to cancer development, there are no studies aimed to evaluate the possible implication of viral infections in the pathogenesis of testicular cancer. In this study we analyzed sperm parameters and prevalence of HPV on sperm in 155 testicular cancer patients at diagnosis (T-1, after orchiectomy (T0 and after 12 months from surgery or from the end of adjuvant treatments (T12. All patients showed a significantly higher prevalence of semen infection than controls (9.5% and 2.4% respectively and altered sperm parameters both at T-1 and T0. Considering sperm parameters, at T-1 we observed a reduction of progressive motility, and after orchiectomy patients showed a reduction of sperm concentration and count and a further worsening of motility. Thereafter, patients were assigned to three groups on the basis of medical option after surgery: S = surveillance, R = radiotherapy and C = chemotherapy +/- radiotherapy. At T12, untreated patients had an improvement of sperm parameters while R group and even more C group had a strong decrease of sperm number (p<0.01 both vs T0 and S group. Moreover, patients who received radio and/or chemotherapy had a very high prevalence of HPV semen infection (S: 7.7%, R: 30.8% and C: 61.5%. In conclusion, patients with testicular cancer had frequently altered sperm parameters and higher prevalence of HPV semen infection that were worsened after radio and chemotherapy. Because HPV infection is a risk factor for cancer development and it may further reduce fertility, we suggest screening for HPV in testicular cancer patients at diagnosis and particularly after adjuvant treatments.

  16. Sperm Ubiquitination Correlation with Human Semen Quality

    Directory of Open Access Journals (Sweden)

    MR Sadeghi

    2008-07-01

    Full Text Available Background: Ubiquitin, an 8.5 kDa peptide that marks other proteins for proteasomal degradation, tags defective sperm during epididymal passage. Thus, sperm ubiquitination is a universal marker for sperm defects and can be used as a sperm function test. The objective of the present study was to examine the relationships between sperm ubiquitination and clinical semen parameters, using simplified immunofluorescence assays in order to establish ubiquitin as a biomarker of male infertility. Methods: Semen samples from 100 couples attending Avicenna Infertility Clinic, Tehran, Iran, were collected and analyzed according to WHO criteria. Each sample was washed and adjusted at 106 sperm/ml concentration. Sperm were coated on slides, using cytospin centrifugation and were fixed in buffered formaldehyde. Subsequently ubiquitinated spermatozoa were evaluated by direct immunofluorescence microscopy using FITC-labeled anti-ubiquitin antibodies. After counting at least 200 sperm per sample, while employing light microscopy, the percentage of ubiquitinated spermatozoa was recorded on the same fields through epifluorescence microscopy. Results: Negative correlations were obtained between sperm ubiquitination and sperm count (r=-0.278, P< 0.001, sperm concentration (r=-0.37, P< 0.001, viability (r=-0.407, P< 0.001, sperm morphology (r=-0.509, P< 0.001, rapid progressive motility (a (r=-0.246, P< 0.001 and slow progressive motility (b (r=-0.474, P< 0.001. There was a positive correlation between ubiquitinated sperm and the percentage of immotile spermatozoa (r=0.486, P< 0.000. Conclusion: Increased sperm ubiquitination is inversely associated with good semen quality parameters, supporting the use of ubiquitin as a biomarker for evaluation of human sperm quality.

  17. Interpretation of semen analysis among infertile couples.

    OpenAIRE

    Small, D. R.; Collins, J. A.; Wilson, E. H.; Wrixon, W.

    1987-01-01

    Among the male partners of 1074 infertile couples the mean results of semen analysis were sperm count 78 X 10(6)/ml, seminal volume 4.0 ml, proportion of progressively motile sperm 54%, proportion of sperm with normal morphologic features 81.4% and total motile sperm count 152.3 X 10(6) per ejaculate. After excluding 65 couples who chose donor insemination and 300 with known female causes of infertility, the cumulative pregnancy rates in the remaining 709 couples were higher with increasing s...

  18. Fertility of frozen-thawed stallion semen cannot be predicted by the currently used laboratory methods

    Directory of Open Access Journals (Sweden)

    Koskinen E

    2006-08-01

    Full Text Available Abstract The aim of the project was to use current simple and practical laboratory tests and compare results with the foaling rates of mares inseminated with commercially produced frozen semen. In Exp. 1, semen was tested from 27 and in Exp. 2 from 23 stallions; 19 stallions participated in both experiments. The mean number of mares per stallion in both experiments was 37 (min. 7, max. 121. Sperm morphology was assessed and bacterial culture performed once per stallion. In Exp. 1, progressive motility after 0, 1, 2, 3, and 4 h of incubation using light microscopy, motility characteristics measured with an automatic sperm analyzer, plasma membrane integrity using carboxyfluorescein diacetate/propidium iodide (CFDA/PI staining and light microscopy, plasma membrane integrity using PI staining and a fluorometer, plasma membrane integrity using a resazurin reduction test, and sperm concentration were evaluated. In Exp. 2, the same tests as in Exp. 1 and a hypo-osmotic swelling test (HOST using both light microscopy and a fluorometer were performed immediately after thawing and after a 3-h incubation. Statistical analysis was done separately to all stallions and to those having ? 20 mares; in addition, stallions with foaling rates 20 mares, the artificial insemination dose showed a correlation coefficient of -0.58 (p

  19. Elemental composition of human semen is associated with motility and genomic sperm defects among older men

    Science.gov (United States)

    Schmid, Thomas E.; Grant, Patrick G.; Marchetti, Francesco; Weldon, Rosana H.; Eskenazi, Brenda; Wyrobek, Andrew J.

    2013-01-01

    BACKGROUND Older men tend to have poorer semen quality and are generally at higher risks for infertility and abnormal reproductive outcomes. METHODS We employed proton-induced X-ray emission (PIXE, 3 MeV proton beam) to investigate the concentrations of zinc, copper, calcium, sulfur, chlorine, potassium, titanium, iron and nickel in washed sperm and seminal plasma from non-smoking groups of 10 older men (65–80 years old) and 10 younger men (22–28 years old) who were concurrently assayed for sperm function and genomicly defective sperm. RESULTS The older group showed elevated zinc, copper and calcium in sperm and elevated sulfur in seminal plasma compared with the younger men. The older group also showed reduced motility as well as increased sperm DNA fragmentation, achondroplasia mutations, DNA strand breaks and chromosomal aberrations. Sperm calcium and copper were positively associated with sperm DNA fragmentation (P < 0.03). Seminal sulfur was positively associated with sperm DNA fragmentation and chromosomal aberrations (P < 0.04), and negatively associated with sperm motility (P < 0.05). Sperm calcium was negatively associated with sperm motility, independent of male age (P = 0.01). CONCLUSIONS We identified major differences in elemental concentrations between sperm and seminal plasma and that higher sperm copper, sulfur and calcium are quantitatively associated with poorer semen quality and increased frequencies of genomic sperm defects. PMID:23042799

  20. PROSTAGLANDIN F2? SUPPLEMENTED SEMEN IMPROVES LANDRACE BOARS SPERM MOTILITY

    Directory of Open Access Journals (Sweden)

    NICOLETA IONESCU

    2009-05-01

    Full Text Available This study investigated whether the sperm motility from Landrace boars improveswhen PGF2? (Dinolytic®; 5 mg PGF2? /ml was added to diluted semen. Boars fromone large production unit, were manually collected; semen was either enriched withPGF2? (group 1, n=38, either untreated (group 2, n=32. Total volume of semencollected, percent of motility and number of obtained doses were recorded. Thehighest sperm volume collected from the two groups is corresponding to ejaculatesfrom Landrace boars with PGF2? supplemented semen (267.6 ml. Regardingmotility, the sperm collected from Landrace boars with PGF2? supplemented semenwas higher from the one collected from Landrace boars with untreated semen(81.37% and very significant differences were statistically determined. Theejaculates with highest number of obtained doses is corresponding to the onescollected from boars with PGF2? supplemented semen (25.21. Only boars from thefirst group (with PGF2? supplemented semen showed motility over 70% and even100%. The untreated semen showed motility values around 65-70%.

  1. Persistent organic pollutants and semen quality: The LIFE Study.

    Science.gov (United States)

    Mumford, Sunni L; Kim, Sungduk; Chen, Zhen; Gore-Langton, Robert E; Boyd Barr, Dana; Buck Louis, Germaine M

    2015-09-01

    Growing evidence suggests that persistent environmental chemicals such as polychlorinated biphenyls may adversely affect human fecundity. The purpose of this study was to evaluate associations between persistent environmental chemicals and semen quality among 501 male partners of couples discontinuing contraception for purposes of becoming pregnant. Men provided a blood specimen and two fresh semen samples collected approximately a month apart that underwent next day analysis for 35 semen quality endpoints. Serum samples were analyzed for 36 polychlorinated biphenyls (congeners #18, 28, 44, 49, 52, 66, 74, 87, 99, 101, 114, 118, 128, 138, 146, 149, 151, 153, 156, 157, 167, 170, 172, 177, 178, 180, 183, 187, 189, 194, 195, 196, 201, 206, 209); 1 polybrominated biphenyl (#153); 9 organochlorine pesticides; and 10 polybrominated diphenyl ethers (congeners #17, 28, 47, 66, 85, 99, 100, 153, 154183) using high resolution mass spectrometry. To estimate the effect of chemicals on semen quality, we regressed each semen marker on each chemical while adjusting for research site, age, body mass index, serum lipids, and cotinine levels. Males with chemical concentrations in the fourth quartile, as compared to the first quartile, showed significant associations for several individual chemicals in each chemical class and type of semen quality parameter indicating negative and positive associations with semen quality. Polybrominated diphenyl ethers in particular were associated with several measures of increased abnormal morphology. These exploratory results highlight the role of environmental influences on male fecundity, and are of particular interest given the ubiquitous exposures to these compounds. PMID:25441930

  2. Mycoplasma agalactiae detected in the semen of goat bucks.

    Science.gov (United States)

    de la Fe, C; Amores, J; Martín, A Gómez; Sánchez, A; Contreras, A; Corrales, J C

    2009-12-01

    Contagious agalactia (CA) is among the most significant diseases affecting small ruminant populations in Mediterranean countries. This study was designed to detect the excretion in semen of CA-causing mycoplasmas in goats (Capra hircus) reared in Spain, where the disease is considered endemic. Culture techniques and PCR were conducted on 147 semen samples collected from 113 goat bucks to detect mycoplasmas. No animal showed clinical symptoms of CA at the moment of the screening. M. agalactiae was identified using both diagnostic methods in three semen samples collected from three different bucks. These animals belonged to a group of animals in which semen had been analyzed twice and only the second sample proved positive, suggesting the possibility of intermittent excretion. This is the first report of the isolation of M. agalactiae from semen collected from naturally infected goats. Future studies should investigate whether semen could be a real source of CA infection by determining if the agent may be transmitted during natural service or when semen is used for artificial insemination. PMID:19773063

  3. Factors predicting early improvement in semen parameters following varicocele surgery

    Directory of Open Access Journals (Sweden)

    Shreeharsha Mallappa Awati

    2014-08-01

    Full Text Available Background: Varicocelectomy does not improve semen parameters and pregnancy rates in all cases. Various studies have been done to find out factors which predict better outcomes of varicocelectomy so that only such patients may be selected to undergo the surgery. The present study is an attempt to identify such factors by prospective cohort method. Methods: A prospective cohort study was conducted on 25 patients undergoing varicocelectomy for infertility at St John medical college hospital, Bangalore from 01-06-2012 to 31-05-2013. Clinical data, semen analysis, scrotal imaging and hormonal assays were done and postoperatively semen analysis was done after three months. The data was analysed to find out predicting factors for improvement of semen parameters. Results: Twenty five patients underwent varicocele surgery, all of them showed improvement of semen parameters. Fifteen of them had more than 50% of improvement. Serum FSH and testosterone levels were found to be predictive of semen parameter improvement. Conclusions: Preoperative low serum FSH and high testosterone concentration were factors predicting early improvement in semen parameters following varicocele surgery in infertile males. [Int J Reprod Contracept Obstet Gynecol 2014; 3(4.000: 1027-1032

  4. Semen cryopreservation protocols of Mangalarga Marchador stallions

    Directory of Open Access Journals (Sweden)

    Marcela Leite Candeias

    2012-09-01

    Full Text Available The effect of the utilization of three semen protocols (Inra 82®, Merck Gema and Botu-crio® and two filling techniques (0.25 and 0.50 mL straws in Mangalarga Marchador stallions were studied in this experiment. Sperm parameters were assessed during processing and post-freezing. No interactions between the protocols and type of filling were observed, so they were assessed separately. Sperm parameters were not altered when the extender was added to the centrifugation; however, there was reduction of motility and strength when freezing extenders were added. The Botu-crio® protocol preserved the parameters of total and progressive sperm motility, smoothed path velocity (µm/s, straight line velocity (µm/s, track velocity (µm/s and the average and fast spermatozoa percentage better than the others. No difference between the extenders for the percentage of sperm integrity was observed. There was no difference in the responses studied on the filling techniques. The stallions presented better freezing with the use of the Botu-crio® protocol. The best post-freezing viability results were found for semen frozen using the Botu-crio® protocol and there were no differences concerning the sperm quality comparing 0.25 and 0.50 mL straws.

  5. Semen cryopreservation protocols of Mangalarga Marchador stallions

    Scientific Electronic Library Online (English)

    Marcela Leite, Candeias; Marco Antonio, Alvarenga; Márcio Teoro do, Carmo; Heder Nunes, Ferreira; Mônica Russo Souto, Maior; Rodolpho de Almeida, Torres Filho; André Luís Rios, Rodrigues; Felipe Zandonadi, Brandão.

    1989-19-01

    Full Text Available The effect of the utilization of three semen protocols (Inra 82®, Merck Gema and Botu-crio®) and two filling techniques (0.25 and 0.50 mL straws) in Mangalarga Marchador stallions were studied in this experiment. Sperm parameters were assessed during processing and post-freezing. No interactions bet [...] ween the protocols and type of filling were observed, so they were assessed separately. Sperm parameters were not altered when the extender was added to the centrifugation; however, there was reduction of motility and strength when freezing extenders were added. The Botu-crio® protocol preserved the parameters of total and progressive sperm motility, smoothed path velocity (µm/s), straight line velocity (µm/s), track velocity (µm/s) and the average and fast spermatozoa percentage better than the others. No difference between the extenders for the percentage of sperm integrity was observed. There was no difference in the responses studied on the filling techniques. The stallions presented better freezing with the use of the Botu-crio® protocol. The best post-freezing viability results were found for semen frozen using the Botu-crio® protocol and there were no differences concerning the sperm quality comparing 0.25 and 0.50 mL straws.

  6. Exogenous melatonin does not improve the freezability of Blanca Andaluza goat semen over exposure to two months of short days.

    Science.gov (United States)

    Gallego-Calvo, L; Gatica, M C; Santiago-Moreno, J; Guzmán, J L; Zarazaga, L A

    2015-06-01

    This paper compares the effects of exposure to exogenous melatonin (MEL), short days (SD, 8h of light) and long days (LD, 16h of light), on reproductive activity, sperm motility and other reproductive variables, in Blanca Andaluza bucks. Fourteen males were spilt into two groups of seven animals (G1 and G2). They were subjected to five alternations of 2 months of LD followed by 2 months of SD or MEL before the experimental period of three consecutive intervals of: (1) 2 months of SD (G1, N=7) or MEL (G2, N=7); (2) 2 months of LD (G1+G2, N=14); and (3) 2 months of SD (G2, N=7) or MEL (G1, N=7). Plasma testosterone concentration, live weight, testicular weight and fresh semen quality were determined weekly. Semen was also cooled and frozen-thawed every fortnight, and the same quality variables measured as for fresh sperm. When the bucks were under LD treatment, the testosterone concentration was lower than when under MEL or SD treatment (P<0.01); values for the semen concentration and total number of sperm per ejaculate were also higher (P<0.001). No differences were observed between the MEL and SD treatments in terms of fresh, cooled or frozen-thawed sperm quality. Only some quality variables on fresh semen were improved by MEL and SD treatment (P<0.05). In conclusion the results of the present experiment showed that MEL improved the fresh semen motility variables, but this did not improve the motility of frozen-thawed sperm over that recorded for either SD or LD treatment. PMID:25840614

  7. Effect of pre-freeze semen quality, extender and cryoprotectant on the post-thaw quality of Asian elephant (Elephas maximus indicus) semen.

    Science.gov (United States)

    Imrat, P; Suthanmapinanth, P; Saikhun, K; Mahasawangkul, S; Sostaric, E; Sombutputorn, P; Jansittiwate, S; Thongtip, N; Pinyopummin, A; Colenbrander, B; Holt, W V; Stout, T A E

    2013-02-01

    Semen cryopreservation and artificial insemination (AI) are potentially valuable methods for supporting the breeding management of endangered species like the Asian elephant. Cryopreservation of Asian elephant semen has however proven problematic with respect to maintenance of both adequate semen quality and fertility post-thaw. In this study, nine ejaculates from three adult bulls were used to compare the influence of extender (TEST versus INRA96®) and penetrating cryoprotectants (3% glycerol, 5% glycerol and 4% methylformamide) on post-thaw semen quality. We demonstrate that not only the freezing process, but also the quality of the semen before freezing, significantly influences the freezability of Asian elephant semen. Pre-freeze motility, viability, semen volume, semen pH, sperm concentration and the incidence of sperm mid-piece and tail abnormalities all significantly (pAsian elephant bull ejaculates suitable for cryopreservation; stricter initial selection should improve the mean post-thaw quality. PMID:23168056

  8. Effect of oleic-linoleic acid and ?-sitosterol to freezing extender of bulls and stallions semen

    Directory of Open Access Journals (Sweden)

    Érika Saltiva Cruz Bender

    2015-06-01

    Full Text Available Addition of polyunsaturated fatty acids and/or cholesterol to a freezing diluent can modify the sperm plasma membrane composition, influencing its behavior during cryopreservation, thus, favoring seminal cryoresistance. The present study aimed to evaluate the effects of the addition of oleic-linoleic acid, (OLA; ?-sitosterol (?-sit, a plant analog of cholesterol; and OLA + ?-sit in combination to a freezing diluent, on the cryopreservation bull and stallion semen. The following variables were analyzed: motility/vigor, plasma and acrosomal membrane integrity (by Trypan Blue/Giemsa staining, mitochondrial activity (by DAB staining, and lipid peroxidation (by a TBARS assays. The lipids were added according to experimental treatments: C – control group, A1 and A2 – OLA at concentrations of 37 ?M and 74 ?M, B1 and B2 – ?-sit at concentrations of 1 ?g mL-1 and 2 ?g mL-1; AB1 and AB2 – OLA 37 ?M + ?-sit 1 ?g mL-1 and OLA 74 ?M + ?-sit 2 ?g mL-1, respectively. The study was divided into three experiments; in Experiment 1, the concentrations of the groups A1, B1, and AB1 were evaluated, whereas in Experiment 2 the concentrations of the groups A2, B2, and AB2 were analyzed, both experiments were performed with bull semen. We conducted Experiment 3 using equine semen with the addition of lipids at all of the concentrations described. Data were subjected to analysis of variance, using the GLM procedure of SAS, with treatment means compared by Duncan test considering 5% significance. These variables differed significantly after thawing the semen post-collection. However, there was no significant difference between treatments when variables were compared within the same time point, except for Experiment 2, where there was a decrease in motility and vigor decrease post-thaw in the groups following ?-sit addition (C – 51.0 ± 13.7%/2.9 ± 0.4; B2 – 35.8 ± 15.8%/2.3 ± 0.6; AB2 – 38.5 ± 16.6%/2.5 ± 0.5, respectively; p < 0.05. In conclusion, the tested concentrations of these lipids did not confer greater cryoresistance to the spermatozoa, and were not effective in preserving the structural integrity of plasma and acrosomal membranes after thawing. Furthermore, there was no change in the mitochondrial activity and lipid peroxidation due to lipids addition.

  9. EFFECT OF TWO PROTOCOLS OF CRYOPRESERVATION ON FERTILIZING CAPACITY OF STALLION (Equus caballus SEMEN EFECTO DE DOS PROTOCOLOS DE CRIOPRESERVACIÓN SOBRE LA CAPACIDAD FECUNDANTE DE SEMEN EQUINO (Equus caballus

    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo Betancur

    2012-06-01

    Full Text Available Abstract. Semen cryopreservation is a fundamental process for the development of biotechnologies for assisted reproduction in horses. The use of cryopreservation techniques with changes in concentrations and the nature of the cryoprotectant, as well as, the different types of vials for storage of semen, have become an alternative to improve the protocols used. The objective of this work was to evaluate the effect of two protocols of cryopreservation (freezing and vitrification on the fertilizing capacity of stallion semen. The study was conducted with horses of the Criollo Colombiano breed. For freezing was used a extender supplemented with egg yolk (4% and dimethyl formamide (5%, and 0.5 mL straws as vials, whereas for vitrification, the extender was supplemented with egg yolk (8% and dimethyl formamide (8%, and cryovials were used as carriers. As post thaw parameters were evaluated: progressive motility, vitality, normal morphology and integrity of the plasma membrane through the hypoosmotic swelling test (HOS. For statistical evaluation was fitted a generalized linear model (GLM and means were compared by the Tukey test. Were found average percentages of progressive motility, vitality, normal morphology and HOS of 41.6 ± 11.8 and 37 ± 8.5, 54.3 ± 10.2 and 52.3 ± 7.8, 83.1 ± 5.4 and 83.6 ± 5.8, 41.7 ± 9.8 and 38.9 ± 3.6, for cryopreserved semen by freezing and vitrification, respectively. There were no statistically significant differences (P ? 0.05 between treatments for any of the parameters evaluated. The fertilizing capacity of equine semen cryopreserved by vitrification is comparable to that obtained by conventional freezing.Resumen. La criopreservación de semen es un proceso fundamental en el desarrollo de biotecnologías para la reproducción asistida en equinos. El uso de diferentes técnicas de criopreservación con cambios en las concentraciones y la naturaleza de los crioprotectores, así como en los diferentes tipos de soportes para el almacenamiento del semen, se ha constituido en una alternativa para mejorar los protocolos empleados. El objetivo de este trabajo fue evaluar el efecto de dos protocolos de criopreservación (congelación y vitrificación, sobre la capacidad fecundante del semen equino. El estudio se realizó con equinos de la raza Criollo Colombiano. Para la congelación se empleó un diluyente suplementado con de yema de huevo (4% y dimetilformamida (5%, y pajillas de 0,5 mL como soportes; mientras que para la vitrificación, el diluyente fue suplementado con yema de huevo (8% y dimetilformamida (8% y se usaron crioviales como soportes. Post-descongelación, se evaluaron los parámetros: movilidad progresiva, vitalidad, morfología normal e integridad de la membrana plasmática (HOS. Para la evaluación estadística se ajustó un modelo lineal generalizado (GLM y las medias se compararon por la prueba de Tukey. Se encontraron porcentajes promedio de movilidad progresiva, vitalidad, morfología normal y HOS de 41,6±11,8 y 37,0±8,5, 54,3±10,2 y 52,3±7,8, 83,1±5,4 y 83,6±5,8, 41,7±9,8 y 38,9±3,6, para el semen criopreservado por congelación y vitrificación, respectivamente. No se encontraron diferencias estadísticamente significativas (P ? 0,05 entre los tratamientos para ninguno de los parámetros evaluados. La capacidad fecundante del semen equino criopreservado por vitrificación es equiparable a la obtenida por congelación convencional.

  10. Relación entre calidad del semen y la edad / Relationship between quality of semen and age

    Scientific Electronic Library Online (English)

    John, Chávez; José, Yarlequé; Elmer, Avalos; Ruth, Barrientos-Marka; MarcoAntonio, García.

    2012-07-01

    Full Text Available Objetivo: Determinar la relación entre la calidad del semen humano y la edad. Material y Métodos: El espermatograma se realizó siguiendo el Manual de Laboratorio de la OMS para el examen del Semen Humano y de la Interacción Moco Cervical y Semen (1999), de los exámenes realizados entre julio 2003 a [...] diciembre 2008. Se estudiaron 2 441 casos de varones que cumplen con los criterios de inclusión. Resultados: La motilidad A+B fue de 51,55% para varones de 20 a 29 años; los espermatozoides normales fue de 77,73% para varones mayores de 50 años; el recuento espermático (mill/ml) fue de 61,09 para varones mayores de 50 años.La evaluación de la motilidad espermática tuvo como coeficiente de correlación lineal múltiple de 0,222 y coeficiente de determinación de 0,049; en la morfología espermática, coeficiente de correlación lineal de 0,0622 y coeficiente de determinación de 0,0039; en el recuento espermático, coeficiente de correlación lineal múltiple de 0,465 y coeficiente de determinación de 0,216. Conclusiones: existe una tendencia inversa entre la motilidad y la edad, una tendencia directa entre el recuento espermático y la edad, y una tendencia constante entre morfología espermática y edad. Abstract in english Objectives: To determine the relationship between the quality of human semen and age. Methods: A spermatogram was performed following the WHO´s laboratory manual to evaluate human sperm and the interaction between cervical mucus and semen (1999) from July 2003 and December 2008. We studied 2441 male [...] cases that fulfilled the inclusion criteria. Results: A+B motility was 51.55% for 20-29 years of age male participants; normal spermatozoids were found in 77.73% of males above 50 years of age; the spermatic count (mill/ml) was 61.09 for males above 50 years of age. Spermatic motility had a multiple lineal correlation coefficient of 0.222 and a determination coefficient of 0.049; respective values for the spermatic count were 0.465 and 0.216. Conclusions: There is an inverse trend between motility and age, a direct trend between spermatic count and age, and a constant trend between spermatic morphology and age.

  11. Bull Semen Collection and Analysis for Artificial Insemination

    OpenAIRE

    Karolina Barszcz; Dariusz Wiesetek; Michal Wasowicz; Marta Kupczynska

    2012-01-01

    Insemination is acknowledged as a breeding method that contributes to improvement of farm animal populations, particularly of cattle. Artificial insemination allows for maximum use of the most valuable breeders and, at the same time, for significant increase of breeding advance. Moreover, using semen of proved quality reduces the spread of sexually transmitted diseases. The purpose of this study was to present the process of collection and analysis of bulls’ semen in the Mazovian Centre of An...

  12. Hormonal induction and semen characteristics of tambaqui Colossoma macropomum.

    Science.gov (United States)

    Maria, Alexandre Nizio; Azevedo, Hymerson Costa; Santos, Jadson Pinheiro; Carneiro, Paulo César Falanghe

    2012-02-01

    In the hatchery-bred tambaqui Colossoma macropomum, spontaneous semen release does not occur, and hand-stripping produces reduced semen volume. The goal of this work is to evaluate the effects of hormonal induction with carp pituitary extract (CPE) on both qualitative (visual aspect, pH, motility, viability and morphological abnormalities) and quantitative (volume, concentration and number of spermatozoa per ejaculate) traits of tambaqui semen. Eleven males were treated with CPE (induced), and 11 were left untreated as a control (non-induced). All analysed parameters except motility and percentage of viable spermatozoa presented significant differences (p < 0.05) between the induced and non-induced treatments. CPE induction resulted in a 25-fold increase in semen volume and a 10-fold increase in the number of spermatozoa collected. However, both sperm concentration and the frequency of sperm with morphological abnormalities (commonly detached heads or bent tails) were significantly lower in CPE-induced fish. The hormonal induction of tambaqui males with CPE is efficient and positively influences some qualitative and quantitative properties of semen. Additionally, semen collection via gentle abdominal massage occurs more readily in CPE-induced fish. PMID:21208496

  13. Human semen assays for workplace monitoring. [Monitoring of hazardous materials by determining effects on semen of personnel

    Energy Technology Data Exchange (ETDEWEB)

    Wyrobek, A.J.; Gledhill, B.L.

    1978-11-07

    Decades of human semen studies have yielded compelling evidence that sperm can be used to access reproductive potential and diagnose pathology. With these studies as background, the small number of detailed semen studies of men exposed to physical and chemical agents point with optimism to the application of human semen assays as efficient, effective means to monitor for reproductive hazards in the workplace. Sperm are the most accessible of human gonadal tissue and provide a means of monitoring exposure induced changes in the human testes, changes which may result in infertility and increased frequencies of genetically abnormal gametes. The focus on semen has precipitated the development of new sperm bioassays which use older conventional andrological methods (i.e., sperm counts, motility, and morphology) as well as recently developed high speed flow and scanning methods for automated cytological analyses. The status of these sperm assays for workplace surveillance is reviewed, procedures are suggested with examples of use, and their effectiveness is evaluated. The available mouse models of induced semen changes are briefly described and the importance of these models for evaluating the genetic implications of findings in human semen is discussed.

  14. SEMEN QUALITY ASSESSMENT OF NEW ZEALAND WHITE RABBIT BUCKS

    Directory of Open Access Journals (Sweden)

    Martyna B?aszczyk

    2013-02-01

    Full Text Available Rabbits have been extensively used as a model for large animals and humans. All the reproduction techniques employed with farm animals can be performed with the low-cost rabbit model, and certain placental membrane characteristics make them especially relevant for studies of human teratology. The purpose of this study was to assess semen quality of New Zealand White rabbits. The material represents semen samples collected from adult rabbits (n=30. The semen was obtained by means of artificial vagina. All samples were analyzed using CASA Sperm VisionTM system. To assessed spermatozoa morphology (the length and the width of head and tail; presence of abnormal spermatozoa we used QuickPhoto Micro system. Received data were statistically analyzed. Our research showed decrease of semen parameters value after one hour storage in 37°C. Correlation analysis showed negative correlation between presence of spermatozoa with separated flagellum and CASA parameters value e.g. motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, ALH and BCF. From among 3000 analyzed spermatozoa 14.2% posed abnormal forms. We observed negative influence of semen storage on its quality. Also negative correlations between all types of tail defect and motility of spermatozoa were detectedRabbits have been extensively used as a model for large animals and humans. All the reproduction techniques employed with farm animals can be performed with the low-cost rabbit model, and certain placental membrane characteristics make them especially relevant for studies of human teratology. The purpose of this study was to assess semen quality of New Zealand White rabbits. The material represents semen samples collected from adult rabbits (n=30. The semen was obtained by means of artificial vagina. All samples were analyzed using CASA Sperm VisionTM system. To assessed spermatozoa morphology (the length and the width of head and tail; presence of abnormal spermatozoa we used QuickPhoto Micro system. Received data were statistically analyzed. Our research showed decrease of semen parameters value after one hour storage in 37°C. Correlation analysis showed negative correlation between presence of spermatozoa with separated flagellum and CASA parameters value e.g. motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, ALH and BCF. From among 3000 analyzed spermatozoa 14.2% posed abnormal forms. We observed negative influence of semen storage on its quality. Also negative correlations between all types of tail defect and motility of spermatozoa were detected.

  15. EFFECT OF TWO PROTOCOLS OF CRYOPRESERVATION ON FERTILIZING CAPACITY OF STALLION (Equus caballus) SEMEN / EFECTO DE DOS PROTOCOLOS DE CRIOPRESERVACIÓN SOBRE LA CAPACIDAD FECUNDANTE DE SEMEN EQUINO (Equus caballus)

    Scientific Electronic Library Online (English)

    Giovanni, Restrepo Betancur; Juan Esteban, Duque Cortés; Juan David, Montoya Páez.

    2012-06-01

    Full Text Available Resumen. La criopreservación de semen es un proceso fundamental en el desarrollo de biotecnologías para la reproducción asistida en equinos. El uso de diferentes técnicas de criopreservación con cambios en las concentraciones y la naturaleza de los crioprotectores, así como en los diferentes tipos d [...] e soportes para el almacenamiento del semen, se ha constituido en una alternativa para mejorar los protocolos empleados. El objetivo de este trabajo fue evaluar el efecto de dos protocolos de criopreservación (congelación y vitrificación), sobre la capacidad fecundante del semen equino. El estudio se realizó con equinos de la raza Criollo Colombiano. Para la congelación se empleó un diluyente suplementado con de yema de huevo (4%) y dimetilformamida (5%), y pajillas de 0,5 mL como soportes; mientras que para la vitrificación, el diluyente fue suplementado con yema de huevo (8%) y dimetilformamida (8%) y se usaron crioviales como soportes. Post-descongelación, se evaluaron los parámetros: movilidad progresiva, vitalidad, morfología normal e integridad de la membrana plasmática (HOS). Para la evaluación estadística se ajustó un modelo lineal generalizado (GLM) y las medias se compararon por la prueba de Tukey. Se encontraron porcentajes promedio de movilidad progresiva, vitalidad, morfología normal y HOS de 41,6±11,8 y 37,0±8,5, 54,3±10,2 y 52,3±7,8, 83,1±5,4 y 83,6±5,8, 41,7±9,8 y 38,9±3,6, para el semen criopreservado por congelación y vitrificación, respectivamente. No se encontraron diferencias estadísticamente significativas (P ? 0,05) entre los tratamientos para ninguno de los parámetros evaluados. La capacidad fecundante del semen equino criopreservado por vitrificación es equiparable a la obtenida por congelación convencional. Abstract in english Abstract. Semen cryopreservation is a fundamental process for the development of biotechnologies for assisted reproduction in horses. The use of cryopreservation techniques with changes in concentrations and the nature of the cryoprotectant, as well as, the different types of vials for storage of se [...] men, have become an alternative to improve the protocols used. The objective of this work was to evaluate the effect of two protocols of cryopreservation (freezing and vitrification) on the fertilizing capacity of stallion semen. The study was conducted with horses of the Criollo Colombiano breed. For freezing was used a extender supplemented with egg yolk (4%) and dimethyl formamide (5%), and 0.5 mL straws as vials, whereas for vitrification, the extender was supplemented with egg yolk (8%) and dimethyl formamide (8%), and cryovials were used as carriers. As post thaw parameters were evaluated: progressive motility, vitality, normal morphology and integrity of the plasma membrane through the hypoosmotic swelling test (HOS). For statistical evaluation was fitted a generalized linear model (GLM) and means were compared by the Tukey test. Were found average percentages of progressive motility, vitality, normal morphology and HOS of 41.6 ± 11.8 and 37 ± 8.5, 54.3 ± 10.2 and 52.3 ± 7.8, 83.1 ± 5.4 and 83.6 ± 5.8, 41.7 ± 9.8 and 38.9 ± 3.6, for cryopreserved semen by freezing and vitrification, respectively. There were no statistically significant differences (P ? 0.05) between treatments for any of the parameters evaluated. The fertilizing capacity of equine semen cryopreserved by vitrification is comparable to that obtained by conventional freezing.

  16. The clinical significance of corrected seminal plasma prolactin level in men with asthenospermia

    International Nuclear Information System (INIS)

    Objective: To evaluate the clinical significance of corrected seminal prolactin assay in men with asthenospermia. Methods: Routine semen analysis and seminal plasma prolactin assay were performed on the men with asthenospermia, oligo-asthenospermia, normospermia. Prolactin was assessed by radioimmunoassay. The relationship between the level of corrected seminal plasma prolactin and the quality of semen was analyzed. Results: The mean level of the corrected seminal prolactin in the men with asthenospermia was (26.1±12.8) ?g/L and was significantly higher than that of the men with normospermia. Seminal plasma prolactin concentration showed linear increasing alongside with the decreasing of the semen motility and motility degrees. Conclusion: The detection of corrected seminal plasma prolactin level will provide an objective index for evaluating the semen quality of asthenospermic men

  17. Lifestyle and semen quality: role of modifiable risk factors.

    Science.gov (United States)

    Jurewicz, Joanna; Radwan, Micha?; Sobala, Wojciech; Ligocka, Danuta; Radwan, Pawe?; Bochenek, Micha?; Hanke, Wojciech

    2014-02-01

    The relationship between exposure to lifestyle factors and adverse effects on human reproductive health is debated in the scientific literature and these controversies have increased public and regulatory attention. The aim of the study was to examine the association between modifiable lifestyle factors and main semen parameters, sperm morphology, and sperm chromatin structure. The study population consisted of 344 men who were attending an infertility clinic for diagnostic purposes with normal semen concentration of 20-300?M/ml or with slight oligozoospermia (semen total concentration of 15-20?M/ml) [WHO 1999]. Participants were interviewed and provided semen samples. The interview included questions about demographics, socio-economic status, medical history, lifestyle factors (consumption of alcohol, tobacco, coffee intake, cell phone and sauna usage), and physical activity. The results of the study suggest that lifestyle factors may affect semen quality. A negative association was found between increased body mass index (BMI) and semen volume (p?=?0.03). Leisure time activity was positively associated with sperm concentration (p?=?0.04) and coffee drinking with the percentage of motile sperm cells, and the percentage of sperm head and neck abnormalities (p?=?0.01, p?=?0.05, and p?=?0.03, respectively). Drinking red wine 1-3 times per week was negatively related to sperm neck abnormalities (p?=?0.01). Additionally, using a cell phone more than 10 years decreased the percentage of motile sperm cells (p?=?0.02). Men who wore boxer shorts had a lower percentage of sperm neck abnormalities (p?=?0.002) and percentage of sperm with DNA damage (p?=?0.02). These findings may have important implications for semen quality and lifestyle. PMID:24074254

  18. Toxicity of cryoprotectants to honey bee semen and queens.

    Science.gov (United States)

    Wegener, J; Bienefeld, K

    2012-02-01

    Given the threats to the intraspecific biodiversity of Apis mellifera and the pressure on bee breeding to come up with disease-tolerant lines, techniques to cryopreserve drone semen are of great interest. Freeze-thawed drone semen of high viability and/or motility has repeatedly been obtained, but fertility of such semen, when it was measured, was always low. The cryoprotective agent (CPA) most frequently used with drone semen is dimethyl sulfoxide (DMSO), although this substance has been suspected of causing genetic damage in sperm. No form of sperm washing is currently performed. Using a membrane permeability assay, we measured the short-term toxicity of four possible replacements for DMSO, 1,3-propane diol, 2,3-butane diol, ethylene glycol, and dimethyl formamide. We also tested whether the practice of inseminating queens with CPA-containing semen affects sperm numbers in the storage organs of queens, or sperm fertility. Finally, we tested whether CPA-toxicity in vivo can be reduced by using mixtures of two CPAs, DMSO, and ethylene glycol. Our results show that, although short-term toxicity of all CPAs tested was low, the presence of single CPAs in insemination mixtures at concentrations required for slow freezing greatly reduced the number of sperm reaching the spermatheca. Contrary to earlier reports, this was also true for DMSO. Ethylene glycol was additionally shown to reduce the viability of spermatozoa reaching the storage organ. Mixtures of DMSO and EthGly performed better than either substance used singly at the same concentration. We conclude that the toxicity of CPAs, including DMSO, on honey bee semen and/or queens has been underestimated in the past. This could partly explain the discrepancy between in vitro and in vivo quality of cryopreserved drone semen, described by others. Combinations of several CPAs and techniques to partly remove CPAs after thawing could help to solve this problem. PMID:22115807

  19. EVALUATION OF CHROMOSOME BREAKAGE AND DNA INTEGRITY IN SPERM: AN INVESTIGATION OF REMOTE SEMEN COLLECTION CONDITIONS

    Science.gov (United States)

    Home collection of ejaculated semen would facilitate participation rates and geographic diversity in reproductive epidemiology studies. Our study addressed concerns that home collection and overnight mail return might induce chromosome/DNA damage. We collected semen from 10 hea...

  20. Semen parameters evaluation in men with normal sperm concentration and polyzoospermic men

    Directory of Open Access Journals (Sweden)

    S. Sh. Khayat

    2014-12-01

    Full Text Available We analyzed 10 178 semen samples from men in infertile couples within a retrospective clinical study (2007–2012. Basic semen parameters at different sperm concentrations were evaluated, immature germ cells in polyzoospermic men were estimated.

  1. Fertility of Cow in Using Locally Produced Chilled and Imported Frozen Semen

    Directory of Open Access Journals (Sweden)

    A. K. Das

    2002-01-01

    Full Text Available The experiment was carried out at Central Cattle Breeding Station and Dairy farm, Savar, Dhaka, and 3 sub- station and 9 points of Chandpur District in Bangladesh to evaluate the quality and fertilizing capacity of locally produced chilled and imported frozen semen. Motility, sperm concentration and mass activity of semen from different experimental bulls were almost similar. Quality of imported frozen semen was better than that of locally produced chilled semen in respect of motility, motile sperm/ Insemination dose and spermatozoa with normal head. Motility and pH value of semen decreased significantly for transportation and prolongation of preservation duration. Average conception rate of imported frozen semen (57.33 was found to be higher than locally produced chilled semen (45.33. But it was similar between imported frozen (57.33 and average of 1st & 2nd day preserved semen (57%.

  2. Deer Frozen Semen Quality in Tris Sucrose and Tris Glucose Extender with Different Glycerol Concentrations

    OpenAIRE

    Nalley, W. M. M.; Handarini, R.; Arifiantini, R. I.; Yusuf, T. L.; Purwantara, B.; Semiadi, G.

    2011-01-01

    In order to improve Timor deer (Cervus timorensis) frozen semen quality, the influence of sugar and glycerol concentration on semen characteristics of sperm was investigated. The semen was collected from five sexually mature Timor deer using an electroejaculator. The semen was evaluated and divided into six equal tubes and diluted with Tris sucrose glycerol 10% (TSG10); Tris sucrose glycerol 12% (TSG12); Tris sucrose glycerol 14% (TSG14); Tris glucose glycerol 10% (TGG10); Tris glucose glyce...

  3. Effects of Diluents, Cryoprotectants, Equilibration Time and Thawing Temperature on Cryopreservation of Duck Semen

    OpenAIRE

    X. F. Han; Z.Y. Niu; F.Z. Liu; C. S. Yang

    2005-01-01

    A series of sequential experiments were carried out to determine optimum diluents, cryoprotectants, equilibration time, and thawing temperature for frozen duck semen in order to set up the commercial semen cryopreservating techniques which could be applied to the conservation of genetic resources, breeding, and commercial production in domestic ducks. In experiment 1, the seven semen extenders were studied to determine efficacy of the diluent on cryopreservation of duck Semen. The result show...

  4. Effect of short-term semen storage in salmon (Oncorhynchus mykiss) on sperm functional parameters evaluated by flow cytometry.

    Science.gov (United States)

    Trigo, P; Merino, O; Figueroa, E; Valdebenito, I; Sánchez, R; Risopatrón, J

    2015-05-01

    The short-term storage of salmonid semen is a viable method for in vitro fertilisation. Previous studies have found that short-term storage affects sperm motility, compromising quality and fertilising capacity. However, the functional characteristics of the spermatozoa of O. mykiss during storage time and its relation to the spawning period are little known. This study was designed to evaluate the effects of in vitro short-term storage on sperm functional parameters in O. mykiss, determined by flow cytometry. Semen samples of the first spawning - undiluted (SSD) and diluted (SD) (Storfish(®) 1 : 2v/v; IMV AI solutions, France) - were stored at 4 °C for 14 days. Motility, viability (PMI: plasma membrane integrity) and mitochondrial membrane potential (??M) were assessed. On the fifth day of storage, spermatozoa showed a motility >70% (SSD: 78.3% versus SD 85.0%), PMI (81.5% SSD/87.2% SD) and ??M (72.5% SSD/SD 80.0%) (P < 0.05). However, a significant decline in the percentage of all functional parameters (P < 0.05) was observed after 5 days of storage for all samples of both undiluted (SSD) and diluted semen. In conclusion, the results here provide new data on O. mykiss sperm quality with respect to in vitro short-term storage evaluated by flow cytometry. PMID:24717099

  5. Relationships among frozen-thawed semen fertility, physical parameters, certain routine sperm characteristics and testosterone in breeding Murrah buffalo (Bubalus bubalis bulls

    Directory of Open Access Journals (Sweden)

    A. K. Singh

    2014-09-01

    Full Text Available Aim: The present study was carried out to examine the relationships among frozen-thawed semen fertility, physical parameters, seminal quality, and testosterone concentration in Murrah buffalo bulls. Materials and Methods: A total of 30 breeding Murrah buffalo bulls (either progeny tested or under progeny testing program were randomly selected from two government bull farms in Punjab. None of the bulls selected for this study had any preceding physical abnormality. A field fertility trial was conducted to determine the first service conception rate (FSCR. The number of females inseminated per bull semen was 10. All the bulls were inspected for structural soundness, measurement of scrotal circumference, testicular biometry, and internal pelvic area (IPA. Frozen-thawed semen was evaluated for total motility, progressive motility, viability, concentration, abnormality, and hypo-osmotic swelling test (HOST. Testosterone was estimated in blood plasma, seminal plasma as well as frozen-thawed semen extracts for establishing relationship. Results: The FSCR was 48% in the bulls having a scrotal circumference of ?44 cm, although, there was no significant correlation between FSCR and scrotal circumference. Similarly, no consistent relationship existed between sperm concentration and scrotal circumference. A positive correlation was observed between IPA and FSCR (r=0.294. Of the six post-thaw seminal components (total motility, progressive motility, viability, HOST (%, total abnormality and concentration only total motility had a high significant (p<0.01 correlation with FSCR (r=0.694. Varied correlations existed between other seminal parameters and fertility. Using a simple regression analysis, the post-thaw motility, IPA, prepuce length and testosterone (independent variables combined to explain approximately 62% of the variation in the FSCR (dependent variable. Conclusion: The present study indicated that despite low to high correlations between seminal characteristics, physical parameters, fertility, and testosterone; the observations support the importance of these components and their function in maintaining semen quality and subsequent fertility.

  6. Parental age at delivery and a man's semen quality

    DEFF Research Database (Denmark)

    Priskorn, Lærke; Jensen, Tina K

    2014-01-01

    STUDY QUESTION: Is parental age at delivery associated with a man's semen quality? In this large register-based study both mother's and father's age are found to have minimal effects on semen quality in men. BACKGROUND: Both maternal and paternal age have been associated with a range of adverse health effects in the offspring. Given the varied health effects of parental age upon offspring, and the sensitivity of genital development to external factors, it is plausible that the age of a man's mother and father at conception may impact his reproductive health. To our knowledge this is the first examination of the effects of parental age on semen quality. METHODS: The study was based on Danish men referred to the Copenhagen Sperm Analysis Laboratory due to infertility in their partnership. Men born from 1960 and delivering a semen sample until year 2000 were included. The men were linked to the Danish Civil Registration System to obtain information on parent's age at delivery. Logistic regression analyses were used to calculate odds ratios and 95% confidence intervals for impaired semen quality. Linear regression analyses were used to examine a relationship between semen parameters and paternal age. RESULTS: There were no convincing effect of either mother's or father's age on a man's semen quality. As no trends were noted, the few statistically significant results are likely attributable to chance. LIMITATIONS, REASONS FOR CAUTION: Information regarding individual subject characteristics which may impact sperm production (i.e. smoking, BMI) were not available. While our sample size was large, we cannot exclude the possibility that a trend may have been identified with a still larger sample. In addition, the Danish Civil Registration System is merely administrative and hence does not discriminate between biological and adopted children. However, the low rate of adoption (?2%) suggests that misclassification would have a minimal impact. The men were all referred to the laboratory for infertility problems in their partnership and, therefore, do not represent the general population. We, however, compared semen quality among men within the cohort, and it is therefore less important whether they, in fact, represent the general population. WIDER IMPLICATIONS OF THE FINDINGS: The current study found no link between parental age and a son's semen quality, suggesting other factors may explain recent impairments in men's reproductive health. STUDY FUNDING: This work was supported by the Hans and Nora Buchard's Fund and the Kirsten and Freddy Johansen's Fund.

  7. Occupational exposure to pesticides and consequences on male semen and fertility: a review.

    Science.gov (United States)

    Mehrpour, Omid; Karrari, Parissa; Zamani, Nasim; Tsatsakis, Aristides M; Abdollahi, Mohammad

    2014-10-15

    Exposure to pesticides affects many body organs including reproductive system. Disorder of the reproductive system leads to infertility and therefore has been in the center of attention within the recent decades. Pesticides are one of the compounds that might reduce the semen quality in the exposed workers according to current knowledge. Although many underlying mechanisms have been proposed, the mechanisms of action are not clarified yet. The object of the present review was to criticize all the results of studies which evaluated the pesticide effects on male reproductive system. Results indicate that semen changes are multifactorial in the workers exposed to pesticides as there are numerous factors affecting sperm quality in occupational exposures. Majority of pesticides including organophosphoruses affect the male reproductive system by mechanisms such as reduction of sperm density and motility, inhibition of spermatogenesis, reduction of testis weights, reduction of sperm counts, motility, viability and density, and inducing sperm DNA damage, and increasing abnormal sperm morphology. Reduced weight of testes, epididymis, seminal vesicle, and ventral prostate, seminiferous tubule degeneration, change in plasma levels of testosterone, follicle-stimulating hormone (FSH), and luteinizing hormone (LH), decreased level and activity of the antioxidant enzymes in testes, and inhibited testicular steroidogenesis are other possible mechanisms. Moreover, DDT and its metabolites have estrogenic effects on males. Although effect of pesticides on sperm quality is undeniable, well-designed long-term studies are needed to elucidate all the possible affecting variables such as socioeconomic, cultural, nutritional, occupational, physical, and clinical characteristics alongside pesticides. PMID:24487096

  8. Correlation between lead and cadmium concentration and semen quality.

    Science.gov (United States)

    Pant, N; Kumar, G; Upadhyay, A D; Gupta, Y K; Chaturvedi, P K

    2014-09-16

    There are contrary reports of association of lead and cadmium with the decline in semen quality. This study evaluates whether seminal lead (Pb) and cadmium (Cd) at environmental concentration are associated with altered semen quality. We conducted a study of healthy fertile and infertile men 20-43 years of age attending the Andrology Laboratory of Reproductive Biology Department for semen analysis. The semen analysis was carried out according to the WHO 2010 guidelines. Seminal lead and cadmium were estimated by ICP-AES. The lead and cadmium values were significantly higher in infertile subjects. A negative association between seminal lead or cadmium concentration and sperm concentration, sperm motility and per cent abnormal spermatozoa was found. This study shows that exposure to Pb (5.29-7.25 ?g dl(-1) ) and cadmium (4.07-5.92 ?g dl(-1) ) might affect semen profile in men. Age, diet, smoking and tobacco chewing habits may have an influence on the increase in exposure to Pb and Cd in the individual subjects. PMID:25228328

  9. Impact of diurnal scrotal temperature on semen quality

    DEFF Research Database (Denmark)

    Hjollund, Niels Henrik I; Storgaard, Lone

    2002-01-01

    A high scrotal temperature is a common finding in infertile patients and experimental studies indicate that specific types of heat exposure reduce semen quality. More and more men have a sedentary work position, which increases scrotal temperature. Semen and blood samples from 99 healthy men were analysed in relation to scrotal skin temperature obtained by a 24-h continuous monitoring protocol. Information on sedentary position at work and during spare time was collected by questionnaires. A negative correlation was found between high scrotal temperature and sperm output. Sperm concentration decreased 40% per 1 degrees C increment of median daytime scrotal temperature (95% CI: 8-71%). Similar results were found for total sperm count, FSH, and inhibin B. Motility, morphology, pH, and testosterone were not significantly associated with temperature. Only weak and inconsistent associations were found between sedentary position and semen quality. We conclude that scrotal temperature and semen quality are closely associated. Sedentary work position encountered in ordinary jobs, although a strong determinant of scrotal temperature, does not seem to have any effect on semen quality.

  10. Association of Vitamin E with Rapid Thawing on Goat Semen

    Science.gov (United States)

    Penitente-Filho, Jurandy Mauro; Oliveira, Fabrício Albani; Jimenez, Carolina Rodriguez; Dias, Júlio César Oliveira; Oliveira, Gisele Dias; Silveira, Renata Gomes; Silveira, Camila Oliveira; Torres, Ciro Alexandre Alves

    2014-01-01

    The aim of this study was to evaluate the effects of vitamin E associated with rapid thawing on cryopreserved goat semen. Two bucks were used and eight ejaculates per animal were collected using artificial vagina. Semen was diluted with the following treatments: BIOXCELL (control), BIOXCELL + Equex (sodium lauryl sulphate) and BIOXCELL + vitamin E 100??M. Semen was packaged into 0.25?mL straws and cooled at 5°C for 1 hour. Freezing was performed in liquid nitrogen vapor (?155°C) during 15 minutes. Then, the straws were immersed in liquid nitrogen (?196°C). Straws were thawed at 38°C/60 seconds or at 60°C/7 seconds with immediate sperm analysis. Hypoosmotic swelling test was performed adding a 20??L aliquot of thawed semen to 1?mL of hypoosmotic solution (100 mOsm·Kg?1) followed by incubation during 60 minutes in water bath (38°C). Vitamin E did not affect any studied parameters (P > 0.05). Nevertheless, defrosting rate of 60°C/7 seconds improved sperm membrane functional integrity (P < 0.05). Current knowledge about goat semen cryopreservation is not sufficient to ensure high post-thawing recovery rates; thus, this study brings important data about using antioxidants and different thawing rates on cryopreservation process. PMID:24955428

  11. Occurrence of mycoplasmas in semen samples of birds of prey.

    Science.gov (United States)

    Lierz, M; Hafez, H M

    2008-10-01

    Mycoplasmas are well-known pathogens in a variety of animals. In poultry it is known that some species can be transmitted by semen and infect the uterus of females. As the prevalence of mycoplasmas in birds of prey is very high and artificial insemination is a commonly used technique for reproduction, the possibility of transmission Mycoplasma spp. by contaminated semen in birds of prey was investigated. Isolation of mycoplasmas was possible in five out of 32 (15.6%) semen samples of different bird of prey species. Two additional semen samples were positive for mycoplasma DNA using a Mycoplasma-genus-specific polymerase chain reaction. The isolation of mycoplasmas from a testicular sample indicates the testis as the possible source of contamination. Sequencing of large parts (>90%) of the 16S rRNA gene of the isolated mycoplasmas suggests that all isolates belong to the same species. Alignment of the sequenced products with the 16S rRNA gene of Mycoplasma species in GenBank demonstrated a similarity of 97% to Mycoplasma verecundum, but serological testing by immunobinding assay failed to identify it as such. It is recommended that the semen of donor birds of prey is examined for mycoplasmas before its use in artificial insemination. PMID:18798023

  12. Metil-formamida na criopreservação de sêmen ovino / Methyl-formamide in ram semen cryopreservation

    Scientific Electronic Library Online (English)

    Carlos Pereira das, Graças; Alexandre In Piao Gomes, Lim; Andrei Antonioni Guedes, Fidelis; Júlio Roquete, Cardoso; Hélio, Blume; Rafael Gianella, Mondadori.

    2013-12-01

    Full Text Available Objetivou-se avaliar a eficácia da metil-formamida na criopreservação do sêmen ovino. O pool de sêmen utilizado no experimento foi obtido a partir da coleta, com vagina artificial, do sêmen de quatro carneiros mestiços Santa Inês, com idade aproximada de quatro anos. As coletas foram realizadas uma [...] vez por semana, por seis semanas consecutivas, correspondendo, cada semana, a uma repetição do experimento. As frações do pool foram diluídas em cinco diferentes meios de congelação: (1) tris-gema com 5,3% de glicerol (TG5,3G); (2) tris-gema com 3% de metil-formamida (TG3MF); (3) tris-gema com 5% de metilformamida (TG5MF); (4) tris-gema com 7% de metil-formamida (TG7MF); (5) tris-gema com 9% de metil-formamida (TG9MF). Foram avaliadas a motilidade progressiva e o vigor das células espermáticas e realizado o teste de termorresistência pós-descongelação. O tratamento que obteve maior motilidade foi o TG5,3G (50%), seguido do TG3MF (38%) e os tratamentos que apresentaram menor motilidade progressiva foram TG5MF (29%), TG7MF (1,0%), TG9MF (6,0%). Os meios contendo metil-formamida apresentaram resultados inferiores ao meio controle para preservar a integridade morfológica dos espermatozoides, sendo que nos meios TG7MF e TG9MF menos de 60% de espermatozóides apresentaram-se morfologicamente normais. Os espermatozoides do meio TG5,3G apresentaram motilidade (15%) e vigor (2,8) similares aos do meio TG3MF (15% e 2,6, respectivamente) no teste de termorresistência, mas o meio TG5,3G preservou melhor a integridade funcional da membrana plasmática. O glicerol foi mais eficiente como crioprotetor do que a metil-formamida na criopreservação de sêmen ovino. Abstract in english The aim of this study was to evaluate the efficacy of methyl-formamide in ram semen cryopreservation. The semen pool used in this experiment was obtained by artificial vagina collection from four mixed breed Santa Inês rams, around four years of age. Semen collection was performed once a week, durin [...] g six weeks. Each week corresponded to one experiment replication. The semen pool was divided in five fractions in order to be diluted in one of the following freezing media: (1) tris-egg yolk with 5.3% of glycerol (TG5.3G); (2) tris-egg yolk with 3% of methyl-formamide (TG3MF); tris-egg yolk with 5% of methyl-formamide (TG5MF); tris-egg yolk with 7% of methyl-formamide (TG7MF); tris-egg yolk with 9% of methyl-formamide (TG9MF). Semen progressive motility, vigor and thermoresistance were evaluated. The treatments TG5.3G (50%) and TG3MF (38%) showed higher progressive motility after thawing, while TG5MF (29%), TG7MF (1%) and TG9MF (6%) showerd lower motility. Freezing media containing methyl-formamide were less effective in preserving spermatozoa membrane integrity and morphology than control media. In TG7MF and TG9MF extenders, less than 60% spermatozoa showed normal morphology. After thermoresistance test, semen cryopreserved in TG3MF showed vigor (2.6) and motility (15%) statistically similar to TG5.3G media (15% and 2.8, respectively); however, the extender TG5.3G was more effective in preserving plasma membrane functional integrity. In conclusion, in the experimental conditions used, glycerol showed more cryoprotectant potential than methyl-formamide.

  13. La administración de selenio disminuye la lipoperoxidación en semen de toros Brahman

    Scientific Electronic Library Online (English)

    C., Flores; Y, Márquez; L., Vilanova; N., Matheus; A., López Ortega.

    2014-12-01

    Full Text Available La lipoperoxidación es uno de los efectos del estrés oxidativo, el cual cursa con alteraciones de motilidad y viabilidad espermática debido a cambios bioquímicos y estructurales de la membrana plasmática. El trastorno conduce a la infertilidad, por lo cual es menester estudiar las alternativas terap [...] éuticas para mejorar las condiciones reproductivas de los toros. En este estudio se determinó la acción antioxidante del selenio y sus efectos sobre la calidad seminal. Se emplearon toros Brahman sanos, de 15-18 meses de edad, divididos en dos grupos mantenidos a pastoreo. El grupo experimental recibió una dosis intramuscular de 0,22 mg/20 kg PV/ día durante 5 días. Las muestras fueron tomadas con electroeyaculador a los días cero, 15 y 30 post-tratamiento. Se evaluó la calidad seminal (espermatozoides móviles, porcentaje de motilidad progresiva, morfología, vitalidad y presencia de acrosomas) e indicadores de la peroxidación lipídica: dienos conjugados (DC, extraídos con isopropanol) y malondialdehído (MDA, por TBARS). Los datos fueron interpretados a través del análisis de la variancia (p=0,05). La calidad del semen no reveló diferencias significativas entre grupos. Los animales tratados no mostraron diferencias significativas en los DC a los 15 y 30 días con respecto al grupo control. Por su parte, el MDA presentó diferencias significativas a los 30 días de tratamiento, cuando el grupo experimental mostró valores más bajos (1,09 ±0,1 nmoles/mg de proteínas) con respecto al grupo control (1,58 ±0,2 nmoles/mg de proteínas). Se concluye que el selenio resulta eficaz para reducir la lipoperoxidación seminal y preservar la calidad del semen. Abstract in english Lipid peroxidation, one of the effects of oxidative stress, is associated with impaired sperm motility and viability because of biochemical and structural alterations of the plasma membrane which causes infertility. Of interest is the study of therapeutic alternatives for enhancing the reproductive [...] condition of the bulls. In this study the antioxidant action of selenium and its effect on semen quality was determined. Healthy grazing Brahman bulls with 15-18 months of age, divided into two groups, were used for the trial. The experimental group received an intramuscular dose of 0.22 mg/20 kg liveweight /day, during 5 days. The sample was taken with electroejaculator at day zero, 15 and 30 post-treatment. Diene conjugates (DC, extracted with isopropanol) and malondialdehyde (MDA TBARS) were measured. Semen quality (motile sperm, percentage of progressive motility, morphology, sperm vitality and presence of acrosomes) and indicators of lipid peroxidation were evaluated. Data were analyzed by ANOVA (p=0.05). In the study of semen, quality groups did not differ significantly. Compared to the control group, selenium-treated animals showed no significant differences in DC at 15 and 30 days. On the other hand, MDA revealed significant differences at 30 days post treatment, showing lower values (1.09 ±0.1 nmol/mg protein) compared to control group (1.58 ±0.2 nmoles/mg protein). In conclusion, seminal selenium decreases lipid peroxidation and preserves semen quality.

  14. Decreased levels of genuine large free hCG alpha in men presenting with abnormal semen analysis

    Directory of Open Access Journals (Sweden)

    Plas Eugen

    2011-08-01

    Full Text Available Abstract Background The pregnancy hormone human chorionic gonadotropin (hCG and its free subunits (hCG alpha, hCG beta are produced in the male reproductive tract and found in high concentrations in seminal fluid, in particular hCG alpha. This study aimed to elucidate changes in peptide hormone profiles in patients showing abnormal semen analyses and to determine the genuineness of the highly abundant hCG alpha. Methods Seminal plasma was obtained from 45 male patients undergoing semen analysis during infertility workups. Comprehensive peptide hormone profiles were established by a panel of immunofluorometric assays for hCG, hCG alpha, hCG beta and its metabolite hCG beta core fragment, placental lactogen, growth hormone and prolactin in seminal plasma of patients with abnormal semen analysis results (n = 29 versus normozoospermic men (n = 16. The molecular identity of large hyperglycosylated hCG alpha was analyzed by mass-spectrometry and selective deglycosylation. Results hCG alpha levels were found to be significantly lower in men with impaired semen quality (1346 +/- 191 vs. 2753 +/- 533 ng/ml, P = 0.022. Moreover, patients with reduced sperm count had reduced intact hCG levels compared with normozoospermic men (0.097 +/- 0.022 vs. 0.203 +/- 0.040 ng/ml, P = 0.028. Using mass-spectrometry, the biochemical identity of hCG alpha purified from seminal plasma was verified. Under non-reducing conditions in SDS-PAGE, hCG alpha isolated from seminal plasma migrated in a manner comparable with large free hCG alpha with an apparent molecular mass (Mr, app of 24 kDa, while hCG alpha dissociated from pregnancy-derived holo-hCG migrated at approximately 22 kDa. After deglycosylation with PNGase F under denaturing conditions, all hCG alpha variants showed an Mr, app of 15 kDa, indicating identical amino acid backbones. Conclusions The findings indicate a pathophysiological relevance of hCG, particularly its free alpha subunit, in spermatogenesis. The alternative glycosylation pattern on the free large hCG alpha in seminal plasma might reflect a modified function of this subunit in the male reproductive tract.

  15. Criopreservacion de semen suino en venezuela. Una revisión. Cryopreservation boar semen in Venezuela

    Directory of Open Access Journals (Sweden)

    A Review. Noris Roa

    2005-05-01

    Full Text Available La inseminación artificial en ganado porcino ha demostrado ser una técnica con buenos resultados reproductivos y una herramienta exitosa para el logro de rápidos progresos genético con capacidad de disminuir los costos de producción y facilitar el manejo. A raíz de esto surge la inquietud de estandarizar una técnica que permita la conservación del material seminal por largos períodos de tiempo sin sufrir daños en su estructura y sin perder la capacidad fecundante, lo que permitiría el transporte de dosis seminales sin mayores complicaciones alrededor del mundo con el fin de mejorar cada día más la calidad genética del rebaño porcino. Sin embargo, en la actualidad el manejo de semen congelado a nivel de granjas comerciales no es lo común en Venezuela; pero sí a nivel de granjas núcleo en países desarrollados se han logrado algunos avances para el mejoramiento genético de reproductores. Con la finalidad de conocer la situación de la criopreservación de semen porcino en Venezuela, describir el protocolo del proceso de congelación y descongelación y resumir algunos resultados obtenidos al utilizar esta técnica se ha realizado la presente revisión.

  16. Effects of Seasonal Changes and Shearing on Thermoregulation, Blood Constituents and Semen Characteristics of Desert Rams (Ovis aries

    Directory of Open Access Journals (Sweden)

    M. Abdelatif Abdalla

    2013-01-01

    Full Text Available This experiment was designed to study the effects of shearing in different seasons (winter vs. summer on thermoregulation, blood parameters and semen characteristics of desert rams. Eight intact healthy rams were randomly assigned into two groups (n = 4. The control group was kept unshorn (UN with intact pelage, the mean length of hair left was approximately 1.5 cm and the treated group was shorn (SH. Rectal temperature (Tr and Respiration Rate (RR measurements were carried out twice daily throughout the experimental period. Blood samples were collected once weekly for the evaluation of Packed Cell Volume (PCV, Total (TLC and Differential (DLC leukocyte count, Serum Total Protein (STP, Serum Albumin (SA, Serum Urea (SU and Plasma Glucose (PG concentration. Semen samples were collected once weekly for the determination of Ejaculate Volume (EV, Sperm Mass (SM and individual (SIM motility, Sperm Cell Concentration (SCC, live (LSP and abnormal (ABS sperm percent and semen pH. Scrotal Circumference (SC measurements were performed weekly. Shearing of desert rams significantly lowered the morning Tr in both seasons and the afternoon Tr during summer ,while RR was significantly lower in both seasons in the afternoon. The PCV was significantly lower in shorn rams during summer compared to winter and PG was significantly higher during winter compared to summer. In both seasons shearing significantly lowered SIM. It is concluded that shearing significantly affected thermoregulation, blood composition and semen characteristics during winter and summer. It is concluded that shearing in different season significantly affected thermoregulation, blood parameters and seminal traits of Desert Hamari rams.

  17. Enumeration and identification of bacteria in chicken semen.

    Science.gov (United States)

    Reiber, M A; McInroy, J A; Conner, D E

    1995-05-01

    Three experiments were conducted to determine the bacteriological quality of chicken semen. Semen was collected from donor males, diluted, and surface inoculated onto seven different bacteriological media, from which randomly selected colonies were identified. Bacterial counts in semen averaged 5.14 log10 cfu/mL. Tryptic soy agar (TSA) was the best medium for the isolation of Gram-positive bacteria, whereas TSA + .3% bile salts (TSABS) and violet red bile agar + 1% glucose (VRBAG) were the best media for the isolation of Gram-negative and enteric bacteria. The genera of bacteria that were isolated depended on the medium that was used for isolation. The most frequently isolated genera included Escherichia, Staphylococcus, Micrococcus, Enterococcus, and Salmonella. Most of the bacteria that were isolated were endemic to poultry and were common environmental bacteria. This indicates that the environment and feed are important sources of bacterial contamination in broilers. PMID:7603955

  18. The extent of increase in first calving age as a result of implementing various sexed semen breeding strategies

    Energy Technology Data Exchange (ETDEWEB)

    Joezy-Shekalgorabi, S.; Shadparvar, A. A.; Vries, A. de; Gay, K. D.

    2014-06-01

    A deterministic simulation was conducted to assess the effects of sexed semen utilization strategies on age at first calving (AFC). Four different strategies were implemented on dairy heifers: continuous use of conventional semen only (CC), continuous use of sexed semen only (SS), utilization of sexed semen for both the first and second services with conventional semen afterwards (S2), and utilization of sexed semen for the first service with conventional semen afterwards (S1). Results indicated that continuous utilization of sexed semen led to the greatest AFC; however at high conception rates, strategies displayed negligible differences on AFC. Increases in estrus detection rate had the greatest effects on decreasing AFC of the SS scenarios. Negative effect of sexed semen on AFC increased when the effect of low estrus detection rate was combined with low conception rate of sexed semen. Results indicated that in the case of access to sexed semen conception rate, prediction of AFC is possible by quadratic polynomial or exponential equations, depending to the applied breeding strategy. Simultaneous utilization of sexed and conventional semen in a herd did not make a substantial change in AFC when a low percentage of sexed semen was employed. Increasing the contribution of different sexed semen strategies led to higher AFC variation, especially for the SS strategy. AFC of strategies that utilize sexed semen is highly dependent on the conception rate, estrus detection rate and the contribution of sex sorted semen in the total number of inseminations of the heifer herd. (Author)

  19. Impact of pig insemination technique and semen preparation on profitability.

    Science.gov (United States)

    Gonzalez-Peña, D; Knox, R V; Pettigrew, J; Rodriguez-Zas, S L

    2014-01-01

    Artificial insemination technique and semen preparation impact boar utilization efficiency, genetic dissemination, and biosecurity. Intrauterine (IUI) and deep intrauterine (DUI) AI techniques require lower number of spermatozoa per dose compared to conventional (CON) AI. Frozen semen (FRO) has been associated with lower reproductive performance compared to fresh semen (FRE) preparation. The combined effects of 3 AI techniques (CON, IUI, and DUI) and 2 semen preparations (FRE and FRO) on the financial indicators of a pig crossbreeding system were studied. A 3-tier system was simulated in ZPLAN and the genetic improvement in a representative scenario was characterized. The cross of nucleus lines B and A generated 200,000 BA sows at the multiplier level. The BA sows were inseminated (CON, IUI, or DUI) with FRE or FRO from line C boars at the commercial level. Semen preparation and AI technique were represented by distinct sow:boar ratios in the C × BA cross. A range of farrowing rates (60 to 90%) and litter sizes (8 to 14 liveborn pigs) were tested. Genetic improvement per year for number born alive, adjusted 21-d litter weight, days to 113.5 kg, backfat, and ADG were 0.01 pigs per litter, 0.06 kg, -0.09 d, -0.29 mm, and 0.88 g, respectively. On average, the net profit for FRE (FRO) increased (P-value profit between techniques were driven by differences in costs. Differences in fixed costs between IUI and DUI relative to CON were -2.4 (-5.2%) and -3.4% (-7.4%), respectively. The differences in total costs between FRE and FRO were lower than -5%. The difference in variable costs between FRE and FRO ranged from -5.3 (CON) to -24.7% (DUI). Overall, insemination technique and semen preparation had a nonlinear effect on profit. The average relative difference in profit between FRE and FRO was less than 3% for the scenarios studied. PMID:24352964

  20. Environmental exposure to lead induces oxidative stress and modulates the function of the antioxidant defense system and the immune system in the semen of males with normal semen profile.

    Science.gov (United States)

    Kasperczyk, Aleksandra; Dobrakowski, Micha?; Czuba, Zenon P; Horak, Stanis?aw; Kasperczyk, S?awomir

    2015-05-01

    We investigated the associations between environmental exposure to lead and a repertoire of cytokines in seminal plasma of males with normal semen profile according to the WHO criteria. Based on the median lead concentration in seminal plasma, 65 samples were divided into two groups: low (LE) and high exposure to lead (HE). Differences in semen volume and the pH, count, motility and morphology of sperm cells were not observed between the examined groups. The total oxidant status value and the level of protein sulfhydryl groups as well as the activities of manganese superoxide dismutase and catalase were significantly higher in the HE group, whereas the total antioxidant capacity value and the activities of glutathione reductase and glutathione-S-transferase were depressed. IL-7, IL-10, IL-12, and TNF-? levels were significantly higher in the HE group compared with the LE group. Environmental exposure to lead is sufficient to induce oxidative stress in seminal plasma and to modulate antioxidant defense system. PMID:25771126

  1. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja DØvling; Bungum, Mona Berger Håkonsen

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses.

  2. Evaluación de dos formas de colección de semen en Alpacas

    Scientific Electronic Library Online (English)

    Rosa, Dávalos R; Juan, Olazábal L.

    2002-07-01

    Full Text Available [...] Abstract in english Semen was collected from 10 alpaca males aged 3-6 years, 3 times weekly for 3 weeks, followed by a week of rest, over a 3 month period. A heated artificial vagina was used together with a dummy model and a female in heat. Semen was collected from all 10 animals utilizing both procedures. Average cop [...] ulation time was 15.9 ± 0.6 and 16.8 ± 0.7 minutes using the dummy and the receptive female (p0.05). Sperm volume averaged 1.03 ± 0.04 and 1.73 ± 0.09 ml, (p

  3. New methods and media for the centrifugation of honey bee (Hymenoptera: Apidae) drone semen.

    Science.gov (United States)

    Wegener, Jakob; May, Tanja; Kamp, Günter; Bienefeld, Kaspar

    2014-02-01

    Centrifugation of Apis mellifera L. drone semen is a necessary step in the homogenization of semen pools for the enlargement of the effective breeding population, as well as in the collection of semen by the so-called washing technique. It is also of interest for the removal of cryoprotectants after cryopreservation. The adoption of methods involving semen centrifugation has been hampered by their damaging effect to sperm. Here, we tested four new diluents as well as three additives (catalase, hen egg yolk, and a protease inhibitor), using sperm motility and dual fluorescent staining as indicators of semen quality. Three of the new diluents significantly reduced motility losses after centrifugation, as compared with the literature standard. Values of motility and propidium iodide negativity obtained with two of these diluents were not different from those measured with untreated semen. The least damaging diluent, a citrate-HEPES buffer containing trehalose, was then tested in an insemination experiment with centrifuged semen. Most queens receiving this semen produced normal brood, and the number of sperm reaching the storage organ of the queen was not significantly different from that in queens receiving untreated semen. These results could improve the acceptance of techniques involving the centrifugation of drone semen. The diluent used in the insemination experiment could also serve as semen extender for applications not involving centrifugation. PMID:24665683

  4. Blood and Semen Selenium Concentrations and Semen Quality in Boars Fed Diets Supplemented with Organic or Inorganic Selenium

    Directory of Open Access Journals (Sweden)

    Theera Rukkwamsuk

    2012-01-01

    Full Text Available Effect of dietary supplementation of organic or inorganic selenium on blood and semen selenium concentrations and semen quality was determined in 10 boars. During the 4 weeks of pre-experimental period, all boars were fed a basal diet containing 0.15 mg kg-1 of inorganic selenium. Thereafter, all cows were randomly allocated into 2 groups of five boars which were fed a basal diet supplemented with either 0.3 mg kg-1 of inorganic selenium or 0.3 mg kg-1 of organic selenium for 84 days. Blood samples were collected from all boars to determine selenium concentrations at the end of pre-experimental period and at days 49 and 84 after supplementation. Semen samples were collected at the end of pre-experimental period and at days 35, 49, 63 and 84 to determine selenium concentrations and semen evaluation. For both inorganic and organic selenium groups, blood selenium concentrations at days 49 and 84 were higher than the concentration at day 0 and the concentrations did not differ between the two groups at all sampling periods. Semen selenium concentrations at days 35, 49, 63 and 84 were higher than the concentration at day 0 for both inorganic and organic selenium groups and the concentrations did not differ between the 2 groups at days 35, 49, 63 and 84. Sperm motility parameters including motility (%, progressive motility (%, Average Path velocity (VAP, ?m sec-1, Straight-line velocity (VSL, ?m sec-1 and Curvilinear velocity (VCL, ?m sec-1 did not differ between the 2 groups and among sampling periods. Results revealed that 0.3 mg kg-1 supplementation of either inorganic or organic selenium form in the basal diet containing 0.15 mg of selenium per kg could increase blood and semen selenium levels in the boars. With normally-fertile boars, both inorganic and organic form of selenium supplemented in the diet had similar effect on sperm motility characteristics in the boars.

  5. Seasonal variation in protein profiles and HSP70 of Holstein crossbred bull semen

    International Nuclear Information System (INIS)

    Since HSP70 is the stress response protein, the impact of heat stress on semen quality may be displayed through the expression of protein profile and HSP70. This study investigated the seasonal effects on the protein profiles and HSP70 in spermatozoa and seminal plasma of 10 Holstein crossbred bulls from an AI centre located in Lopburi, Thailand. Bull semen was collected weekly for 8 consecutive weeks during rainy (average THI 79.34), cool (average THI 75.27), and summer (average THI 80.10) seasons. Protein was extracted from both spermatozoa and seminal plasma using Laemmli's sample buffer. The protein profiles of spermatozoa and seminal plasma were subjected to one-dimensional SDSPAGE with 12% (w/v) acrylamide gel and 4.0% (w/v) acrylamide stacking gel for 120 min. at 8 mA. To visualize the protein profiles, gels were fixed in acetic acid: ethanol: H2O (7: 40: 53), stained with 0.125% (w/v) Coomassie blue R-250 in acetic acid: ethanol: H2O (7: 40: 53) for 60 min., and distained with acetic acid: ethanol: H2O (11: 26: 63) until the background was clear. Western blotting, as described by Kamaruddin et al. was conducted to determine HSP70 using anti-HSP70 monoclonal antibody. Proteins in the polyacrylamide gel were electrophoretically transferred, for 90 min. at 156 mA, to a PVDF membrane. The membrane was rinsed in PBS and blocked overnight in a blocking solution (advanced ECL blocking; Amersham Life Science Inc., Oakville, ON, Canada)m Life Science Inc., Oakville, ON, Canada). The membrane was then incubated for 1 h at room temperature with monoclonal anti-HSP70 (H5147 Sigma Chemical Supplies CO., LTD), incubated with anti-mouse IgG horse radish peroxidase conjugated for 1 h at room temperature, and then detection for immunoreactive bands using ECL detection reagents (Amersham Life Science Inc.) on scientific imaging film. It was found that the profiles of protein were not different among seasons in both sperm and seminal plasma. The profiles of spermatozoa protein range from 10 to 220 kDa while most of proteins found in seminal plasma were low molecular weight (14-30 kDa). The HSP70 was found in both sperm and seminal plasma. However, the amount of HSP70 in winter appears to be greater compare to those found in summer and rainy seasons

  6. A new method for the determination of the ABO blood type of semen by immunoblotting using anti-ABH antibodies following immunoprecipitation.

    Science.gov (United States)

    Sato, I; Hamabe, T; Yamazaki, K; Watanabe, Y

    1995-12-27

    A new method that enables the ABO blood type of semen to be determined by identifying the molecular weight of a blood group substance (BGS) has been developed. In order to produce an antibody against a BGS (p84) detected on the sperm plasma membrand (SPM), p84 was purified from seminal plasma, injected into a rabbit. When seminal plasma was immunoprecipitated with the anti-p84 antibody, SDS-PAGE analysis of the immune complex yielded three specific polypeptides with molecular masses of 84, 51 and 25 kDa. The first of these polypeptides, p84, showed ABH antigenic activity when subjected to immunoblotting. The 51 and 25 kDa proteins corresponded to rabbit IgG heavy and light chains, respectively. Using this method, ABH antigenic activity of a band with a molecular mass of 84 kDa was detected in 25 seminal plasma samples by immunoblotting. When serial two-fold dilutions of seminal plasma were analyzed using this method, clear immunoreactive 84 kDa bands were observed up to 60-fold dilution. When seminal plasma was mixed with vaginal fluid at varying ratios, ABH antigenic activity of 84 kDa immunoreactive bands could be detected until the seminal plasma: vaginal fluid mixture reached a ratio of 1:20. These results suggest that this method will be applicable to the analysis of forensic samples of semen contaminated by vaginal fluid, such as those obtained from victims of sexual assault. PMID:8551051

  7. Seasonal variation in semen quality of Dorper rams using different collection techniques

    Scientific Electronic Library Online (English)

    C.M., Malejane; J.P.C., Greyling; M.B., Raito.

    2014-01-01

    Full Text Available The aim of the study was to evaluate the seasonal variation in semen quality of Dorper rams using different semen collection techniques. The study was carried out from January 2012 to January 2013. A general management programme for health control was followed, with water being provided ad libitum t [...] hroughout the trial, and all rams being fed a 2.5 kg maintenance diet per day. Eleven mature Dorper rams, recording a mean body weight of 69.6 ± 9.2 kg and mean age of 18 ± 4.7 months, were used in the trial. A group of six rams were trained for semen collection with the aid of the artificial vagina (AV), while in the remaining five rams, semen was collected using the electro ejaculator (EE). Immediately after collection, ejaculates were evaluated macroscopically and microscopically for semen volume, semen colour, semen pH, semen wave motion, sperm motility, sperm cell concentration, sperm viability and morphology. The results of the trial generally showed that semen in Dorper rams may be collected using the AV or EE methods throughout the year. However, an overall significant better semen quality collected by the AV versus the EE collection method was recorded. Generally, semen of significantly higher quality was recorded in summer, autumn and spring (both collection techniques). The tendency in the current trial was that the EE technique of semen collection was the less reliable method. Consequently the AV is recommended as the more acceptable method of semen collection in the Dorper. Winter is not generally recommended for semen collection, especially when using the EE.

  8. Influence of addition of different antibiotics in semen diluent on viable bacterial count and spermatozoal viability of Awassi ram semen

    Directory of Open Access Journals (Sweden)

    O I Azawi

    2012-04-01

    Full Text Available The objectives of the present study were to determine the effects of six different antibiotics in controlling the growth of semen contaminating bacteria and if these antibiotics have any adverse effect on Awassi ram spermatozoa. Semen samples from six mature Awassi rams were used in this study. A total number of 120 ejaculates were collected from the rams using an artificial vagina once a week. Semen ejaculates were evaluated for volume, sperm concentration, mass motility, individual motility, percentage live sperm, sperm abnormalities, and viable bacterial count. Semen samples were diluted by sodium citrate-fructose-egg yolk. The diluted semen sample was divided into 7 parts. Six types of antibiotics were added to the semen diluent parts including; penicillin G 1000 IU ml-1 with streptomycin 1 mg ml-1, gentamicin sulphate 250 mg ml-1, tetracycline 0.5 mg ml-1, lincomycin 1 mg ml-1, cefoperazone sodium 1mg ml-1, cefdinir 1 mg ml-1 and the seventh part considered as a control group without antibiotic addition. The diluted semen samples were cooled and preserved at 5 Co for 5 days. Cooled diluted semen samples were examined for individual motility, percent of live sperm, sperm abnormalities, acrosomal defects and bacterial count every 24 h until 5 days. Comparing with the control, all the antibiotics examined were effective in controlling bacterial growth (P<0.05 from 24 h to 96 h of preservation at 5 Co. Cefdinir and cefoperazone sodium proved to be significantly (P<0.05 effective than other antibiotics in controlling bacterial growth at 96 h of preservation as the bacterial count were 23.3 ± 3.7 x 103 / ml and 25.4 ± 6.2 x 103 / ml, respectively. Lincomycin, gentamicin sulphate and tetracycline proved ineffective in controlling bacterial growth at 96 h of preservation as the bacterial count were 57.1 ± 20.1 x 103 / ml, 52.5 ± 29.4 x 103 / ml and 46.5 ± 8.8 x 103 / ml, respectively. The addition of tetracycline to diluted ram semen significantly reduced (P<0.05 sperm individual motility and percent live sperm and a significant increase (P<0.05 acrosomal defects was observed at 96 h of preservation in comparison to control and other antibiotics. Sperm viability was highly correlated with bacterial count in the control part of diluted semen (r = 0.794; P < 0.01. It could be concluded from the results of the present study that additions of cephalosporins (cefdinir or Cefoperazone sodium at the dose of 1 mg ml-1 were most effective amongst the antibiotics used in checking the bacterial growth and improving semen quality of Awassi ram. [Vet. World 2012; 5(2.000: 75-79

  9. Processing, selecting and ritualizing: ambivalent relationships to semen.

    Science.gov (United States)

    Murphy, Dean A

    2015-05-01

    Two articles on human immunodeficiency virus (HIV) and reproduction have recently been published in Reproductive BioMedicine Online, both describing developments that increase reproductive options for HIV-positive men. A study of a semen-processing technique used at a South African hospital found that two out of 103 processed samples tested positive for HIV DNA and none for RNA, indicating 98.1% and 100% effectiveness, respectively. The authors recommend semen processing followed by viral validation of processed sperm samples when providing assisted reproduction treatment to couples with an HIV-positive male partner. The other article reviews developments such as semen processing, antiretroviral (ARV) therapy and pre-exposure prophylaxis (PrEP), which have all reduced the risk of HIV transmission in the context of reproduction. The author also notes, however, that research on fertility in the context of HIV focuses almost exclusively on heterosexual couples, and has overlooked the links between reproduction, HIV and homosexuality. This article analyses the ambivalent role of semen - associated with both reproduction and infection - and how reproductive medicine and health care in different ways seek to 'get hold' of sperm. By taking this analytic approach, sex and parenthood can be thought of as two different but related kinds of intimacy and kinship. PMID:25773527

  10. Study on the effect of prostaglandin F2? treatment on semen characteristics and enzymatic activates of Awassi rams in breeding and non breeding seasons

    Directory of Open Access Journals (Sweden)

    Osama Ibrahim Azawi,

    2011-05-01

    Full Text Available The purpose of this research work was to determine the effects of PGF2?, given immediately before semen collection, on semen characteristics and libido in Awassi rams during breeding and non breeding season. The experiment was conducted in late summer to early autumn when major breeding activities commence and winter during the non breeding season at Mosul region in northern Iraq at the Animal Research and Practice Farm of the College of The Veterinary Medicine, University of Mosul. Twelve mature Awassi rams were used in this study. Animals were randomly allocated into two equal groups, the first group was administered 7.5 mg IM of PGF2?weekly and the second group as a control group received 1 ml of N-saline solution. Semen samples were collected from the Awassi rams 24 h after IM administration. Scrotal circumference (SC and testicular volume were measured weekly during the study period. Semen ejaculates were evaluated for semen volume, sperm concentration, sperm concentration/ejaculate, mass motility, individual motility, percentage live sperm, sperm abnormalities, and sperm acrosomal defects. Samples of seminal plasma were analyzed for the estimation of alanine amino transferase (ALT, aspartate amino transferase (AST, acid phosphatase (ACP, alkaline phosphatase (ALP and lactic dehydrogenase (LDH. Results of the present showed that PGF2? treatment to Awassi rams did not improve most semen characteristics in both breeding and non breeding seasons compared with the group. The only improvement of Awassi semen quality observed was in sperm concentration in the breeding season. The testicular volume showed a significant increase (P<0.05 in Awassi rams treated with PGF2? in breeding season compared to the control group and PGF2? treated group in the non breeding season. The mean activity of LDH enzyme estimated in the PGF2?treated group and control group showed a significant difference (P<0.05 between the two groups in the breeding season and non breeding season (52.34 ± 8.96 and 57.43 ± 19.9 vs. 117.02 ± 5.26 and 131.88 ± 5.01, respectively. Other enzymatic activities including ALT, AST, ACP and ALP showed no significant differences between Awassi rams treated with PGF2? and control groups in both breeding and non breeding seasons. In conclusion, PGF2?treatment of Awassi rams improved sperm concentration and testicular volume

  11. Effect of various levels of catalase antioxidant in semen extenders on lipid peroxidation and semen quality after the freeze-thawing bull semen

    Directory of Open Access Journals (Sweden)

    Reza Asadpour

    2011-11-01

    Full Text Available The objective of this study was to evaluate effect of different concentrations of catalase in two extenders on motility, viability and lipid peroxidation bull spermatozoa during semen freezing process. Thirty ejaculates collected from ten Holstein bulls were pooled and evaluated at 37 °C. Pool ejaculated was split into two main experimental groups, 1 and 2. In experiment 1, specimen was diluted to a final concentration of 30 × 106 spermatozoa with citrate-egg yolk and in experiment 2; specimen was diluted with tris-egg yolk extender to the same concentration. In both experiments diluted semen was divided into three aliquots, including a control and two test groups. Each aliquot was rediluted with an equal volume of extender either without (control or with one of the antioxidants contained one of the following antioxidants: catalase (CAT; 100 IU mL-1 catalase (CAT; 200 IU mL-1 and control group. No significant differences were observed in sperm viability and motility following addition of catalase enzyme at concentration of 100 IU mL-1 and 200 IU mL-1 to citrate-egg yolk extender. But the highest sperm viability was achieved by addition of 100 IU mL-1 and 200 IU mL-1 catalase to tris-egg yolk semen extender compared with the control group (P < 0.05. Malondialdehyde levels did not change with addition of catalase in both extenders compared with the control group. The obtained results provide a new approach to the cryopreservation of bull semen, and could positively contribute to intensive cattle production.

  12. Inseminación artificial de alpacas con semen colectado por aspiración vaginal y vagina artificial / Artificial insemination of alpacas with semen collected by vaginal aspiration and by artificial vagina

    Scientific Electronic Library Online (English)

    Virgilio, Alarcón B; Wilber, García V; P. Walter, Bravo.

    Full Text Available Semen de alpaca fue colectado por dos métodos: por aspiración de la vagina de la hembra después de la monta natural y con vagina artificial. El semen colectado fue evaluado y diluido con Tris tamponado, y luego usado en inseminacion artificial. Se trabajó con 160 alpacas hembras adultas de capacidad [...] reproductiva comprobada y 5 alpacas machos. Se colectó semen post cópula de los cinco machos en 10 hembras, y se hicieron 50 colecciones de semen con vagina artificial de estos machos, dos veces por semana. Se determinó volumen, motilidad, concentración espermática, porcentaje de espermatozoides vivos, viscosidad y color. Los resultados para semen colectado por aspiración de la vagina y con vaginal artificial fueron: volumen (3.6 y 1.5 mL), motilidad (73.4 y 69.0%), concentración espermática (75.2 y 80.3 millones/mL), espermatozoides vivos (75.3 y 70.8%), respectivamente, con diferencia entre métodos (p Abstract in english Semen from alpacas was collected by two methods: by aspiration from the female’s vagina following mating and with an artificial vagina. Semen was collected, evaluated and extended with Tris buffer, and then used in artificial insemination. Altogether 160 female alpacas with proven reproductive histo [...] ry and five males were used. Semen was collected by vaginal aspiration from 10 females using five males as semen donors; likewise, semen from the same males was collected with an artificial vagina twice a week 50 times. Volume, motility, spermatic concentration, live spermatozoa, viscosity and color was evaluated. Seminal characteristics of semen collected by aspiration and with an artificial vagina were: volume (3.6 and 1.5 mL), motility (73.4 and 69.0%), sperm concentration (75.2 and 80.3 million/mL), live spermatozoa (75.3 and 70.8%) respectively, with statistical difference between methods (p

  13. The influence of boar breed and season on semen parameters

    Scientific Electronic Library Online (English)

    D., Knecht; S., & #346; rodo& #324; ; K., Duzi& #324; ski.

    2014-01-01

    Full Text Available The aim of the present study was to demonstrate the influence of boar breed and season on semen parameters. The research material consisted of 31 boars: Polish Large White (PLW), Polish Landrace (PL), and Duroc x Pietrain (D x P), aged 8 to 24 months. The analysed material consisted of 1390 ejaculat [...] es, collected during the period January 2010 to October 2012. Semen samples were assessed in terms of semen volume (mL), sperm concentration (x 10(6) m/mL), total number of sperm (x 10(9)), total number of live sperm (x 10(9)) and number of insemination doses obtained from one ejaculate (n). In winter, an increase in sperm concentration was observed for the PLW breed. Moreover, an increase in the volume of semen produced for this breed was noted in summer and autumn. Differences between breeds for the total number of sperm and total number of live sperm were observed for the winter and spring periods. The largest semen volume was noted for the PLW breed (276.4 ± 9.66 mL). However, in the analysis of other sperm parameters, boars of this breed demonstrated the poorest results. The highest insemination dose was obtained from breed D x P in winter (26.0 ± 0.51). Correlation analyses indicated that PLW and D x P boars are the least resistant to higher ambient temperatures, and in summer and autumn this resulted in a reduction in sperm concentration (-0.26 and -0.20, respectively).

  14. Obtención y evaluación del semen de capibara Hydrochoerus hydrochaeris

    Directory of Open Access Journals (Sweden)

    José Rodríguez P.

    2012-08-01

    Full Text Available Objetivo. Determinar las características del semen y la morfometría de los espermatozoides del Capibara (Hydrochoerus hydrochaeris. Materiales y métodos. Se utilizaron 10 machos con peso entre 21-45 kg, los cuales fueron restringidos y anestesiados. El semen se obtuvo mediante electroeyaculación y se determinó el color, volumen, pH, motilidad en masa, motilidad individual, viabilidad, concentración y morfología. Se realizaron además mediciones de la cabeza y la cola de los espermatozoides. Resultados. Se obtuvo semen en el 100% (10/10 de los animales. El mayor número de eyaculaciones (80%; 8/10, se obtuvo con un voltaje máximo de 6V. El color fue blanco, de aspecto lechoso, los valores promedio fueron volumen 135.5±93.56 ?l, pH 8.14±0.38, motilidad masal 32.60±13.46%, motilidad individual 34±19.81%, viabilidad 51.3±19.42%, concentración espermática 127±59.01x106 espermatozoides/mL y morfología 51.3±19.42 espermatozoides normales. La longitud de la cabeza fue 5.41±0.7 ?m, el ancho de la cabeza 3.77±0.5 ?m y área de la cabeza 75.66±20.6 ?m2. La longitud de la cola fue 27.9±11.3 ?m. Conclusiones. La obtención del semen fue satisfactoria mediante electroeyaculación, sin presentar notables diferencias en las características del semen y morfología de los espermatozoides con otros roedores silvestres de menor tamaño, aunque se observó una alta variabilidad de estas características entre los animales muestreados posiblemente por la heterogeneidad de los animales experimentales.

  15. Air pollution and decreased semen quality: A comparative study of Chongqing urban and rural areas

    International Nuclear Information System (INIS)

    To investigate the association and effects of air pollution level on male semen quality in urban and rural areas, this study examines the outdoor concentrations of particulate matter (PM10), sulfur dioxide (SO2), nitrous dioxide (NO2) and semen quality outcomes for 1346 volunteers in both urban and rural areas in Chongqing, China. We found the urban area has a higher pollution level than the rural area, contrasted with better semen quality in the rural residents, especially for sperm morphology and computer assistant semen analysis (CASA) motility parameters. A multivariate linear regression analysis demonstrates that concentrations of PM10, SO2, and NO2 significantly and negatively are associated with normal sperm morphology percentage (P 10, SO2, and NO2 in urban ambient air may account for worse semen quality in urban males. - Highlights: • We investigate the distributions of PM10, SO2 and NO2 in urban and rural areas in Chongqing, China. • We explore the associations of air pollution and male semen quality. • The concentrations of PM10, SO2, and NO2 are significantly higher in urban areas. • Median values of some semen quality parameters in rural male were higher than urban male. • PM10, SO2, and NO2 were negatively associated with semen quality parameters. - Air pollution is higher in the urban area while there is better semen quality in rural males. Polluted air may thus account for worse semen quality in urban males

  16. Uso de dilutores hipertónicos en la criopreservación de semen ovino / Hypertonic extenders in the cryopreservation of ovine semen

    Scientific Electronic Library Online (English)

    Hernán, Guerrero V.; Wilfredo, Huanca L.; Fernando, Raymundo T.; Sandra, Huerta O.; Daphne, Ramos D..

    Full Text Available Se evaluó el efecto crioprotector de dos dilutores hipertónicos (Trealosa y Lactosa) sobre las características postdescongelamiento del semen ovino (n=4). La composición de los dilutores base incluyó Tris 27.1 g/l, ácido cítrico 14.0 g/l, fructosa 10.0 g/l, glicina 10.0 g/l, yema de huevo 10.0 % (v/ [...] v) y glicerol 6.5 % (v/v). El semen colectado con vagina artificial tuvo las siguientes características: volumen: 1.1 ± 0.1ml, concentración espermática: 3.5 ± 0.1 x 109/ml, motilidad individual: 87.0 ± 2.4%, motilidad masal (escala 0- 5): 4.4 ± 0.2, espermatozoides vivos: 90.2 ± 3.8% y anormales 1.8 ± 0.7%. El semen fue congelado en pajillas de 0.5 ml y conservado en nitrógeno líquido. Las pajillas fueron descongeladas luego de 3 meses para su evaluación. Se obtuvo una motilidad individual de 40.3 ± 5.9 y 30.0 ± 5.0% y un número de espermatozoides vivos de 34.4 ± 6.6 y 24.4 ± 5.0 para los dilutores Trealosa y Lactosa, respectivamente. El mejor resultado se obtuvo al utilizar el dilutor hipertónico Trealosa por tener mejores características de motilidad individual y espermatozoides vivos postdescongelamiento. Abstract in english The cryoprotectant effect of two hypertonic extenders (trehalose and lactose) on the post-thawing characteristics of ram semen (n=4) was evaluated. The extender composition included Tris 27.1 g/l, Citric acid 14.0 g/l, Fructose 10.0 g/l, Glycine 10.0 g/l, egg yolk 10.0% (v/v) and Glycerol 6.5% (v/v) [...] . Semen was collected in an artificial vagina. Seminal characteristics were: volume: 1.1 ± 0.1 ml, sperm concentration: 3.50 ± 0.1 x 109/ml, individual motility: 87.0 ± 2.4%, wave motility (scale 0-5): 4.4 ± 0.2, live sperms: 90.2 ± 3.8%, and abnormal sperms: 1.8 ± 0.7%. Semen was frozen in 0.5 ml straws and stored in liquid nitrogen. Straws were thawed after 3 months. Results of post-thawing evaluation were: individual motility: 40.3 ± 5.9 and 30.0 ± 5.0%, and live sperms: 34.4 ± 6.6 and 24.3 ± 5.0% for the Trehalose and Lactose extenders respectively. Results showed a better ram semen cryopreservation when the Trehalose extender was used.

  17. Obtención y evaluación del semen de capibara Hydrochoerus hydrochaeris / Collection and evaluation of semen from the Capybara Hydrochoerus hydrochaeris

    Scientific Electronic Library Online (English)

    José, Rodríguez P; Miguel, Peña J; Agustín, Góngora O; Ricardo, Murillo P.

    2991-29-01

    Full Text Available Objetivo. Determinar las características del semen y la morfometría de los espermatozoides del Capibara (Hydrochoerus hydrochaeris). Materiales y métodos. Se utilizaron 10 machos con peso entre 21-45 kg, los cuales fueron restringidos y anestesiados. El semen se obtuvo mediante electroeyaculación y [...] se determinó el color, volumen, pH, motilidad en masa, motilidad individual, viabilidad, concentración y morfología. Se realizaron además mediciones de la cabeza y la cola de los espermatozoides. Resultados. Se obtuvo semen en el 100% (10/10) de los animales. El mayor número de eyaculaciones (80%; 8/10), se obtuvo con un voltaje máximo de 6V. El color fue blanco, de aspecto lechoso, los valores promedio fueron volumen 135.5±93.56 µl, pH 8.14±0.38, motilidad masal 32.60±13.46%, motilidad individual 34±19.81%, viabilidad 51.3±19.42%, concentración espermática 127±59.01x106 espermatozoides/mL y morfología 51.3±19.42 espermatozoides normales. La longitud de la cabeza fue 5.41±0.7 µm, el ancho de la cabeza 3.77±0.5 µm y área de la cabeza 75.66±20.6 µm². La longitud de la cola fue 27.9±11.3 µm. Conclusiones. La obtención del semen fue satisfactoria mediante electroeyaculación, sin presentar notables diferencias en las características del semen y morfología de los espermatozoides con otros roedores silvestres de menor tamaño, aunque se observó una alta variabilidad de estas características entre los animales muestreados posiblemente por la heterogeneidad de los animales experimentales. Abstract in english Objective. Determine the characteristics of semen and morphometry of the Capybara (Hydrochoerus hydrochaeris) spermatozoid. Materials and methods. 10 males, weighing between 21-45 kg, which were restrained and anesthetized, were used in the study. The semen sample was obtained by electroejaculation [...] and the color, volume, pH, mass motility, individual motility, viability, concentration and morphology were determined. Measurements of the head and tail of spermatozoids were also conducted. Results. Semen was obtained from 100% (10/10) of the animals. The highest number of ejaculations (80%; 8/10) was obtained with a maximum voltage of 6V. The color was white, of a milky appearance, average values were volume 135.5 ± 93.56 µl, pH 8.14 ± 0.38, mass motility 32.60 ± 13.46%, individual motility 34 ± 19.81%, viability 19.42 ± 51.3%, sperm concentration 127 ± 59.01x106 spermatozoids / mL and morphology 51.3 ± 19.42 normal spermatozoids. The head length was 5.41 ± 0.7µm, the width of head 3.77 ± 0.5 and head area 75.66 ± 20.6 µm². The tail length was of 27.9 ± 11.3 µm. Conclusions. Semen collection by electro ejaculation was successful, without presenting significant differences in semen characteristics and spermatozoid morphology with other smaller wild rodents, although there was a high variability of these characteristics observed between the animals sampled, possibly due to the heterogeneity of the experimental animals.

  18. Evaluación del sistema antioxidante en el semen normal / Evaluation of antioxidant system in normal semen

    Scientific Electronic Library Online (English)

    Juan M., Gallardo.

    2007-02-01

    Full Text Available Antecedentes. Las especies reactivas del oxígeno (ERO), tienen la capacidad de alterar reversible o irreversiblemente la función celular. Se ha propuesto que las ERO modifican la bioquímica y la fisiología del espermatozoide. Por otro lado, los mecanismos antioxidativos pudieran proteger a los esper [...] matozoides del daño producido por las ERO. Objetivo. Determinar los valores normales para el superóxido dismutasa (SOD), glutatión peroxidasa (GPx), malondialdehído (MDA) y óxido nítrico (NOx) en el líquido seminal y espermatozoides de humanos sanos. Procedimientos. Se estudiaron 45 muestras de semen de sujetos aparentemente sanos. Las muestras se obtuvieron por masturbación y se colectaron en tubos estériles. Una vez centrifugadas, se fraccionaron en alícuotas para medir la concentración de SOD, GPx, MDA y NOx. El análisis de las muestras se realizó conforme a métodos bioquímicos ampliamente aceptados. Resultados. Las concentraciones de SOD y MDA en el líquido seminal como en los espermatozoides fueron similares (SOD 0.43 ± 0.09 en semen y 0.45 ± .07 U/mg prot. en espermatozoides, y MDA 0.33 ± .07 y 0.37 ± 0.10 nmoles/mg prot. en líquido seminal y espermatozoides, respectivamente. Con respecto a la GPx, está aumentada casi 13 veces más en los espermatozoides (2547.77 ± 48.59 U/mg prot.) que en el líquido seminal (197.54 ± 25.21 U/mg prot.), el NOx también se incrementa ligeramente en los espermatozoides (4.45 ± 0.43 µmol) cuando se compara con el líquido seminal (3.91 ± 0.16 µmol). Conclusiones. La medición de los antioxidantes y oxidantes pudieran servir para evaluar la infertilidad humana en aquellos casos donde los resultados de la espermatobioscopia aparezcan como normales. Abstract in english Background. Reactive oxygen species (ROS) formation have the ability to alter reversibly or irreversibly the cellular function in humans. It has been proposed that the ROS alters the biochemistry and the physiology of the sperm. On the other hand, the antioxidative mechanisms could protect the sperm [...] s from the damage produced by free radicals. Aim. To determine the normal values for superoxide dismutase (SOD), glutathione peroxidase (GPx), malondialdehyde (MDA) and nitric oxide (NOx) in the seminal liquid of healthy humans. Procedures. Semen samples from 45 healthy men (22 to 47 years of age) were studied. The samples were obtained by masturbation and were collected in conical sterile tubes. Once centrifuged at 4 °C they were divided in aliquots to measure the concentration of SOD, GPx, MDA, and NOx. The analysis of the samples was realized in conformity with biochemical widely accepted methods. Results. The concentrations of SOD and MDA both in the seminal liquid and in the spermatozoids were similar, SOD 0.43 ± 0.09 U/mg prot. in the seminal liquid and 0.45 ± 0.07 U/ mg prot. in spermatozoids, and MDA 0.33 ± 0.07 nmoles/mg prot. and 0.37 ± 0.10 nmoles/mg prot. in the seminal liquid and spermatozoids respectively. With regard to GPx it increased almost 13 times more in the spermatozoids (2547.77 ± 48.59 U/mg prot.) than in the seminal liquid (197.54 ± 25.21 U/mg prot.). The NOx also increased lightly in the spermatozoids (4.45 ± 0.43 \\imol) when compared with the seminal liquid (3.91 ± 0.16 \\imol). Conclusions. The measurement of the antioxidative and oxidative agents could serve to evaluate human infertility in those cases where the result of the spematobioscopy appears normal.

  19. Clinical and biochemical correlates of successful semen collection for cryopreservation from 12-18-year-old patients: a single-center study of 86 adolescents

    DEFF Research Database (Denmark)

    Hagenäs, Isabella; JØrgensen, Niels

    2010-01-01

    Cryopreservation of semen should be offered to adults before gonadotoxic treatment. However, the experience with semen collection in adolescents is still limited. The objective of this study was to evaluate potential correlates of successful semen sampling in adolescents.

  20. Impact of seminal trace element and glutathione levels on semen quality of Tunisian infertile men

    Directory of Open Access Journals (Sweden)

    Atig Fatma

    2012-03-01

    Full Text Available Abstract Background Growing evidence indicates that oxidative stress can be a primary cause of male infertility. Non-enzymatic antioxidants play an important protective role against oxidative damages and lipid peroxidation. Human seminal plasma is a natural reservoir of antioxidants. The aim of this study was to determine glutathione (GSH concentrations, trace element levels (zinc and selenium and the lipid peroxidation end product, malondialdehyde (MDA, in the seminal plasma of men with different fertility potentials. Methods Semen samples from 60 fertile men (normozoospermics and 190 infertile patients (74 asthenozoospermics, 56 oligozoospermics, and 60 teratozoospermics were analyzed for physical and biochemical parameters. Zinc (Zn and selenium (Se levels were estimated by atomic absorption spectrophotometry. Total GSH (GSHt, oxidized GSH (GSSG, reduced GSH (GSHr and MDA concentrations were measured spectrophotometrically. Results Zn and Se concentrations in seminal plasma of normozoospermics were more elevated than the three abnormal groups. Nevertheless, only the Zn showed significant differences. On the other hand, Zn showed positive and significant correlations with sperm motility (P = 0.03, r = 0.29 and count (P Conclusions This report revealed that decreased seminal GSH and trace element deficiencies are implicated in low sperm quality and may be an important indirect biomarker of idiopathic male infertility. Our results sustain that the evaluation of seminal antioxidant status in infertile men is necessary and can be helpful in fertility assessment from early stages.

  1. Functional characterisation of semen in honeybee queen (A.m.ligustica S. spermatheca and efficiency of the diluted semen technique in instrumental insemination

    Directory of Open Access Journals (Sweden)

    Andrea Galli

    2010-01-01

    Full Text Available Differences over time in the quality of semen present in the honey bee (Apis mellifera ligustica queen spermatheca werestudied. An increase in the non-vital spermatozoa was shown to be evident (P>0.05 between the 12th and 24th month.The study of semen viability demonstrated that the passage of the semen to the spermatheca is due to sperm motility.In the queen inseminated with non-viable spermatozoa, no semen was detected in the spermatheca. Queens inseminatedtwice with a Hyes solution/semen mixture (1:1 stored as many spermatozoa in their spermatheca as those inseminatedonce with the classic technique. Queen replacement, oviposition and other functional characteristics were similarto those observed in the classic insemination procedure.

  2. Influence of Deficiency or Supplementary Selenium and a- Tochopherol (Vitamin E) In The Diet of Pubertal Male Zaraibi Goats on Fertility, Semen Quality and Testicular Traits

    International Nuclear Information System (INIS)

    Twenty pubertal male Zaraibi goats (bucks) were randomly divided into four equal groups; fed deficient Se or vit. E, adequate Se, adequate vit. E and adequate Se + vit. E diets for 3 months to study the influence of deficient or adequate selenium (Se) and vitamin E (vit. E) in the diet of pubertal male Zaraibi goats on fertility, semen quantity and quality and some testicular traits. The results showed that the best values of semen quantity (the ejaculate volume, sperm concentration and total sperm output per ejaculate) and semen quality (percentage of progressive motility, percentage of live sperm, number of motile sperm per ejaculate, percentage of dead, abnormal spermatozoa and acrosomal abnormality) were observed in bucks fed diet supplemented with adequate Se combined with adequate vit. E. The lowest values of semen quantity and semen quality were observed in bucks suffering from deficiency of Se and/or vit. E in their diets. Testosterone level in seminal plasma was significantly higher in bucks fed adequate Se and/or vit. E than those fed diet deficient in Se and vit. E. Testosterone level was significantly higher in bucks fed diet adequate in Se + vit. E than those fed diet adequate with Se or vit. E alone. Se and vit. E deficiency in the diets was accompanied by a significant decrease in testosterone, T4 and T3 levels in seminal plasma. Selenium or vit. E each one alone supplementation led to increases of these hormones. T4 and T3 levels were significantly higher in bucks fed adequate Se or adequate Se + vit. E than in bucks fed diet with adequate vitamin E alone. Adequate Se alone and adequate Se + vit. E diets were accompanied by significant increases in Se in seminal plasma. Adequate vit. E and adequate Se + vit. E diets were accompanied by significant increase in vit. E level in the seminal plasma. It is clear that there was synergism between Se and vit. E in the biological role of Se, since the level of Se in bucks fed diet containing adequate Se + vit. E was higher than the level of Se in group fed Se alone. The highest values of scrotal circumference and scrotum length were observed in bucks fed adequate Se + vit. E and the lowest testicular traits and fertility were observed in bucks fed diet deficient with Se and vit. E.

  3. Efeitos do nível de nitrogênio na dieta sobre características do sêmen de ovinos / Effects of dietary nitrogen level on semen characteristics of sheep

    Scientific Electronic Library Online (English)

    Rodrigo Alonso, FORERO GONZALEZ; Carlos de Sousa, LUCCI; Carmen Neusa Martins, CORTADA; Paulo Henrique, MAZZA RODRIGUES; Renato Ranzini, RODRIGUES.

    Full Text Available No presente experimento foi pesquisada a influência do nível de nitrogênio ou de equivalente em proteína degradável no rúmen (PDR) da ração sobre características bioquímicas do sêmen e da congelação dos espermatozóides de carneiros deslanados. Empregaram-se 18 carneiros jovens divididos em três bloc [...] os de seis animais cada, conforme seus perímetros escrotais, e distribuídos ao acaso para três tratamentos: A (controle), alimentados com ração de manutenção, B e C alimentados com ração de manutenção e acréscimo de 20 g e 40 g de uréia (75% de PDR e 150% de PDR), respectivamente. Após três semanas de adaptação, coletaram-se amostras de sangue e sêmen (vagina artificial) de cada animal, semanalmente durante nove semanas, e determinados os níveis de uréia no plasma sangüíneo (UP) e de uréia, transaminases (AST, ALT), fosfatase ácida, frutose e ácido cítrico no sêmen. Durante seis semanas, foram determinadas as diferenças de motilidade, vigor, patologia de acrossoma e patologia total entre a pré e a pós-congelação de amostras de sêmen crioprotegido. Houve regressão linear (p Abstract in english The research looked upon the influence of dietary nitrogen level or equivalent ruminal degradable protein (RDP) on semen biochemistry characteristics and freezability of sheep spermatozoa. Eighteen young rams, were allocated in tree blocs of six animals each, according to scrotal circumference. The [...] rams were randomly distributed to three treatments: A (control) a maintenance diet, B and C, maintenance diet added 20 g and 40 g of urea (75% and 150% of RDP), respectively. Three weeks after dietary adaptation, blood and semen samples were collected every week for nine weeks, to analyze blood plasma and semen levels of urea, transaminases (AST and ALT), acid phosphatases, frutose and citric acid. Once a week for six weeks the motility percent, motility rates, abnormal acrosome percent and abnormal total percent between pre-freezing and post-thaw of cryoprotected semen samples were freezing, evaluated and calculated to mathematical difference. There was a linear regression (p

  4. Semen Characteristics of Three Strains of Local Cocks in the Humid Tropical Environment of Nigeria

    Directory of Open Access Journals (Sweden)

    F.O. Ajayi

    2011-06-01

    Full Text Available The study was conducted to determine the semen characteristics of three genotypes of Nigerian indigenous cocks. Thirty Six (36 local breeding cocks comprising of 12 frizzle, 12 normal and 12 naked neck selected randomly from the poultry breeding unit of the University of Port Harcourt Teaching and Research farm was used for this study. Semen were collected from them by abdominal massage and analyzed for semen characteristics. Semen concentration were significantly higher in naked- neck 4.86×109 ±0.03/mL (p0.05 of strains on semen pH, abnormal sperm and non-motile sperm. Morphological defects of the head, middle and tail was not significantly affected (p>0.05 by the genotypes. Variations on semen characteristics abound in the three Nigerian indigenous cocks sampled.

  5. Efecto de la adición de cafeína y lactato sobre la motilidad del semen equino diluido en leche descremada-glucosa / Effect of caffeine and lactate addition on the motility of equine semen diluted in skim-glucose milk

    Scientific Electronic Library Online (English)

    Oscar, R. Wilde; Adolfo C, de la Vega; Maria L., Cruz.

    2004-01-01

    Full Text Available En equinos la inseminación artificial se practica mayormente con semen refrigerado por las dificultades que plantea la criopreservación. Para mejorar las condiciones de conservación a 5ºC se debe considerar el deterioro espermático post-recolección, puesto que componentes del plasma seminal complica [...] n la supervivencia de los espermatozoides con procesos oxidativos. Algunos compuestos tienen propiedades antioxidantes y mejoran notablemente la motilidad y la supervivencia espermática. En esta experiencia se utilizó lactato de sodio (2mM) y cafeína (10 mM) incorporados al momento de la dilución del semen y a las 48 h de almacenaje a 5ºC, en un extender de base leche descremada-glucosa, con el propósito de estudiar los efectos de estos compuestos sobre los espermatozoides. Incorporados al momento de la dilución, el lactato y la cafeína indujeron movimientos más vigorosos que las muestras sin aditivos desde el inicio. Cuando se agregaron a las 48 h de almacenaje a 5ºC, ambos aditivos produjeron una notable recuperación en la motilidad (49% vs. 31%). Cuando estas mismas muestras fueron cultivadas a 37ºC, a los 30 minutos de incubación aquellas sin aditivos tuvieron escasas formas móviles (5%), frente a las adicionadas con lactato (29%) y cafeína (40%). A los 60 minutos las muestras sin aditivos casi no registraron movimiento, en tanto que las restantes mantuvieron porcentajes elevados. En los tres casos se encontraron diferencias estadísticas (P Abstract in english In equines, artificial insemination is practiced mostly with the use of refrigerated semen due to the difficulties that comes with the preservation of frozen semen. To improve the conservation conditions at 5ºC (refrigerated semen) it is necessary to consider the spermatic deterioration after the ga [...] thering, because components of the seminal plasma complicate the survival of the sperm with oxidative processes. Some components have antioxidant properties and improve notably the spermatic motility and survival. In this experience sodium lactate (2 mM) and caffeine (10 mM) were incorporated at the moment of the dilution of the semen, and at 48 h of conservation at 5ºC in a skim milk - glucose bases extender, with the purpose of studying their effects on the sperm. Incorporated at the moment of the dilution, the lactate and the caffeine induced more vigorous movements than the samples without additives. When they were added at 48 h of preservation at 5ºC, both additives produced a remarkable recovery in the motility (49% vs. 31%). When these same samples were cultivated at 37ºC, at 30 minutes of incubation those without additives had scarce mobile forms (5%), and different from those added with lactate (29%) and caffeine (40%). At 60 minutes, the samples without additives hardly registered movement while the rest maintained the former percentages. In the three cases, there were found statistical differences (P

  6. PCR Assessment of Chlamydia trachomatis Infection of Semen Specimens Processed for Artificial Insemination

    OpenAIRE

    Pannekoek, Yvonne; Westenberg, Steven M.; Vries, Jan; Repping, Sjoerd; Spanjaard, Lodewijk; Eijk, Paul P.; Ende, Arie; Dankert, Jacob

    2000-01-01

    In order to ascertain the microbiological quality of stored semen specimens processed for artificial insemination by a donor (AID), we developed a PCR assay targeting the chlamydial plasmid to detect Chlamydia trachomatis in semen. The lower limit of detection of this assay corresponded to 2.5 to 5 elementary bodies per ?l of semen. A total of 669 cryopreserved ejaculates from 97 asymptomatic donors were tested for C. trachomatis infection. Twelve ejaculates, originating from four donors, we...

  7. Embryo production with sex-sorted semen in superovulated dairy heifers and cows.

    Science.gov (United States)

    Kaimio, I; Mikkola, M; Lindeberg, H; Heikkinen, J; Hasler, J F; Taponen, J

    2013-11-01

    The aim of this study was to examine the effect of sex-sorted semen on the number and quality of embryos recovered from superovulated heifers and cows on commercial dairy farm conditions in Finland. The data consist of 1487 commercial embryo collections performed on 633 and 854 animals of Holstein and Finnish Ayrshire breeds, respectively. Superovulation was induced by eight intramuscular injections of follicle-stimulating hormone, at 12-hour intervals over 4 days, involving declining doses beginning on 9 to 12 days after the onset of standing estrus. The donors were inseminated at 9 to 15-hour intervals beginning 12 hours after the onset of estrus with 2 + 2 (+1) doses of sex-sorted frozen-thawed semen (N = 218) into the uterine horns or with 1 + 1 (+1) doses of conventional frozen-thawed semen (N = 1269) into the uterine corpus. Most conventional semen (222 bulls) straws contained 15 million sperm (total number 30-45 million per donor). Sex-sorted semen (61 bulls) straws contained 2 million sperm (total number 8-14 million per donor). Mean number of transferable embryos in recoveries from cows bred with sex-sorted semen was 4.9, which is significantly lower than 9.1 transferable embryos recovered when using conventional semen (P ? 0.001). In heifers, no significant difference was detected between mean number of transferable embryos in recoveries using sex-sorted semen and conventional semen (6.1 and 7.2, respectively). The number of unfertilized ova was higher when using sex-sorted semen than when using conventional semen in heifers (P insemination protocol used seemed to be adequate for heifers. In superovulated cows, an optimal protocol for using sex-sorted semen remains to be found. PMID:23998739

  8. Semen quality in welders before and after three weeks of non-exposure.

    OpenAIRE

    Bonde, J.P.

    1990-01-01

    In a cross sectional field study concerning the male reproductive system in metalworkers, the major findings were a moderate deterioration of semen quality in mild steel welders and less reliable changes in semen quality in low exposed stainless steel welders. In the present study, a longitudinal design was adopted to deal with methodological drawbacks inherent in the cross sectional approach. The study relies on the assumption that the effect of welding is causal and reversible. The semen qu...

  9. Effect of cushioned or single layer semen centrifugation before sex sorting on frozen stallion semen quality.

    Science.gov (United States)

    Mari, G; Bucci, D; Love, C C; Mislei, B; Rizzato, G; Giaretta, E; Merlo, B; Spinaci, M

    2015-04-01

    The aim of this study was to compare the effect of presorting centrifugation (cushioned [CC] or single-layer colloid [SLC]), with simple dilution (SD), on the quality of sex-sorted stallion semen before and after sorting and after freezing and thawing. Four ejaculates from each of two fertile stallions were collected 1 week apart and evaluated for percent total sperm motility (TM), percent viable acrosome-intact sperm (VAI), and DNA quality (percentage of DNA fragmentation index). Freezing caused, independently from CC and SLC treatments, a significant decrease of TM (P other hand, sorting did not impair TM and VAI and, interestingly, improved DNA quality in all treatments only before freezing (28 vs 13, 28 vs 10, 22 vs 7 in SD, CC, and SLC for unsorted vs sorted groups, respectively; P same samples after freezing and thawing, suggesting that the freezing process reduces the DNA quality of sex-sorted sperm. Our results suggest that CC and SLC are not able to select those spermatozoa that possess a better ability to withstand sperm processing associated with sperm sorting and freezing. PMID:25542457

  10. Efecto de dos dilutores sobre la motilidad e integridad de la membrana espermática en semen congelado de ovinos / Effects of two semen extenders on motility and integrity of sperm membrane in ovine frozen semen

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V; Javier, Orellana Ch; César, Pantoja A.

    2010-07-01

    Full Text Available El presente estudio tuvo como objetivo evaluar el efecto de dos dilutores, Tris- Fructosa-Yema de huevo (Tris) y Citrato-Glucosa-Yema de huevo (citrato), sobre la motilidad espermática e integridad de la membrana espermática (HOST) en semen congelado de ovinos bajo la forma de pellets. La investigac [...] ión se llevó a cabo en el Banco de Semen de la Universidad Nacional Agraria La Molina, Lima, empleándose 4 carneros (2 Blackbelly y 2 Assaf) de 3.5 a 4 años de edad. Se empleó el análisis de covariancia para analizar Motilidad Individual Progresiva (MIP), y bloques completamente randomizados para medir el efecto de los dilutores sobre la integridad de la membrana espermática. Para el congelamiento del semen se utilizó hielo seco y el descongelamiento se realizó a 38 ºC en tubos de ensayo. En ovinos Assaf, la MIP del semen descongelado fue de 63.77 y 61.11% utilizando Tris y citrato, respectivamente, encontrándose diferencias significativas (p Abstract in english The objective of the study was to evaluate the effects of two semen extenders: Tris- Fructose-egg yolk (Tris) and Citrate-Glucose-egg yolk (citrate) on motility and sperm membrane integrity (HOST) in ovine frozen semen in pellets. The study was carried out at the Semen Bank of the Agrarian Universit [...] y La Molina, in Lima, Peru, using 4 rams (2 Assaf and 2 Blackbelly) of 3.5 to 4 years old. A covariance analysis was used to evaluate the effect of the treatment and breed on Individual Progressive Motility (IPM), and randomized block design to evaluate the effect of extenders on sperm membrane integrity. Semen was frozen of dry ice and thawing was done in test tubes at 38 °C. In the Assaf breed, IPM of thawed semen was 63.77 and 61.11% when using Tris and citrate respectively, showing statistical difference (p

  11. Uso de midodrín y congelación de semen en el tratamiento de las alteraciones del transporte espermático.: Caso clínico / Use of Midodrine and frozen/thawed semen to treat semen transport disturbances.: Report of two cases

    Scientific Electronic Library Online (English)

    Raúl, Sánchez G; Patricio, Peña S; Eduardo, Villagrán V.

    2000-01-01

    Full Text Available [...] Abstract in english Retrograde ejaculation severely compromises male fertility. The use of sympathicomimetics for the treatment of this condition has poor results, except in patients with partial retrograde ejaculation, whose semen has a higher spermatozoa concentration. The semen of two patients with partial retrograd [...] e ejaculation was collected and frozen after the injection of a sympathicomimetic (Midodrine). The frozen/thawed samples were mixed with fresh semen recently ejaculated to obtain a minimal number of motile spermatozoa, and used for intrauterine insemination (> de 1 x 106 motile spermatozoa/ml). In both cases, pregnancies that developed satisfactorily, were obtained. (Rev Méd Chile 2000; 128: 93-97)

  12. Declining semen quality and increasing incidence of testicular cancer: is there a common cause?

    OpenAIRE

    Carlsen, E.; Giwercman, A.; Keiding, N.; Skakkebaek, N. E.

    1995-01-01

    Male reproduction has been given little attention in science and in medical practice. However, a recent metaanalysis on semen quality, which clearly pointed to a decrease over the past 50 years, has been repeatedly quoted. Three recent reports have found that semen quality has declined among candidate semen donors during the past 20 years. The evidence of decline in the quality of semen is not the only indicator that the human testis is at risk. During the past 50 years, cancer of the testis ...

  13. Effects of age, season and genetics on semen and sperm production in Apis mellifera drones

    OpenAIRE

    Rhodes, John; Harden, Steven; Spooner-hart, Robert; Anderson, Denis; Wheen, Gretchen

    2011-01-01

    Adult drone honey bees from 4 Australian breeding lines were reared under similar conditions and examined for semen and sperm production when 14, 21 and 35 days old, during spring, summer and autumn. Almost half (40.5%) of all drones examined did not release any semen when manually everted. For those that released semen, the average volume released per drone was 1.09 ?L (range 0.72 (±0.04)?1.12 (±0.04) ?L) and the average number of sperms in the semen per drone was 3.63 × 106 (range 1....

  14. Secretly connected? Anonymous semen donation, genetics and meanings of kinship

    OpenAIRE

    Speirs, Jennifer M.

    2008-01-01

    The use of donated human semen in the UK was developed by medical practitioners as a means of circumventing male infertility and helping childless women to achieve a pregnancy. Uncertainty about the legal status of donor-conceived children and moral concerns about the possible effects on the marital relationship of the recipients worked to maintain donor insemination (DI) as a largely hidden practice in which the donors remained anonymous to the recipients and unrevealed to any resulting dono...

  15. Effect of L-carnitine supplementation on drake semen quality

    Scientific Electronic Library Online (English)

    H.J., Al-Daraji; A.O., Tahir.

    2014-01-01

    Full Text Available This study was conducted to determine the effect on semen quality traits of supplementing the diets of Iraqi drakes with L-carnitine. Forty eight male Iraqi ducks, 30 weeks old, were randomly allocated to four treatments with 12 drakes per treatment group, replicated three times, with four drakes pe [...] r replicate. The treatment groups consisted of birds fed a diet free of L-carnitine (T1, control group); birds fed a diet containing 50 mg L-carnitine/kg diet (T2); birds fed a diet containing 100 mg L-carnitine/kg diet (T3); and birds fed a diet containing 150 mg L-carnitine/kg diet. The drakes were fed the experimental diets only during the experimental period, which lasted three months. The semen quality traits that were investigated were ejaculate volume, mass and individual motility of spermatozoa, spermatocrit, spermatozoa concentration, percentages of dead and abnormal spermatozoa and acrosomal abnormalities. Supplementing the diet of drakes with L-carnitine at the levels of 50 - 150 mg/kg diet significantly increased ejaculate volume, spermatocrit, mass and individual motility of spermatozoa, and concentration of spermatozoa, while percentages of dead and abnormal spermatozoa and acrosomal abnormalities were decreased. However, T4 (150 mg L-carnitine/kg diet) recorded the best results in relation to all semen quality traits included in this study. Dietary supplementation with L-carnitine improved the semen quality of local drakes; therefore L-carnitine can be used as an efficient feed additive to improve the reproductive performance of male ducks.

  16. Semen Parameters and Chromatin Packaging in Microsurgical Varicocelectomy Patients

    OpenAIRE

    Marziyeh Tavalaee; Homayon Abbasi; Mohammad Reza Deemeh

    2012-01-01

    Background: Varicocelectomy is considered as standard treatment for male infertility for clinicalvaricocele. The aim of this study is to address the effects of varicocelectomy on semen parameters,chromatin packaging, and pregnancy outcome.Materials and Methods: This retrospective study was carried out between June 2006 and February2011 on 145 infertile men with grade II or III varicocele. Microsurgical varicocelectomy wasperformed as part of patient management. Sperm count, motility, morpholo...

  17. Seasonality and freezability vs routine parameters in stallion semen

    OpenAIRE

    Rodri?guez, H.; Bustos-obrego?n, E.

    1996-01-01

    The fertilizing ability of stallion semen was analyzed using fresh and frozen samples, obtained before (June-July) or during (October-November) the breeding season. Thirty ejaculates obtained from 4 stallions, were used. The analysis comprises routine seminogram; ATP concentration (Comhaire et al., 1983); subjective and objective motility and sperm velocity (Makler, 1980). Freezing was done following the technique of Martin et al. (1979). Sperm velocity, ATP ...

  18. Glyph-Based Video Visualization for Semen Analysis.

    OpenAIRE

    Duffy, B.; Thiyagalingam, J.; Walton, S.; Smith, Dj; Trefethen, A.; Kirkman-brown, Jc; Gaffney, Ea; Chen, M.

    2013-01-01

    Existing efforts in computer assisted semen analysis have been focused on high speed imaging and automated image analysis of sperm motility. This results in a large amount of data, and is extremely challenging for clinical scientists and researchers to interpret, compare and correlate the multidimensional and time-varying measurements captured from video data. We use glyphs to encode a collection of numerical measurements taken at regular intervals and summarize spatio-temporal motion charact...

  19. Semen quality and sex hormones with reference to metal welding

    DEFF Research Database (Denmark)

    HjØllund, Niels Henrik Ingvar; Bonde, J P

    1998-01-01

    Welding may involve hazards to the male reproductive system, but previous studies of semen quality have produced inconsistent results. We studied the effects of welding on markers of semen quality in a Danish nationwide sample of 430 first-time pregnancy planners without earlier reproductive experience. Couples were recruited among members of the union of metal workers and three other trade unions and were followed from termination of birth control until pregnancy for a maximum of six menstrual cycles. The males provided semen samples in each cycle. Median sperm density for welders was 56 x 10(6)/mL (52.5 x 10(6)/mL and 50.0 x 10(6)/mL in two reference groups). No statistically significant differences attributable to welding were found in proportions of morphologically normal sperm, sperm motility assessed by computer-aided sperm analysis, or sex hormones (testosterone, follicle-stimulating hormone, and luteinizing hormone). These negative findings may not apply to populations with high-level exposure to welding fume or to welders exposed to other putative hazards, e.g., heat.

  20. Sperm banking for male cancer patients: social and semen profiles

    Directory of Open Access Journals (Sweden)

    Tatiana C.S. Bonetti

    2009-04-01

    Full Text Available PURPOSE: Report the characteristics of cryopreserved semen from a cohort of male cancer patients, attitudes towards cryopreservation and outcomes of semen samples based on a 12-year cryopreservation program. MATERIAL AND METHODS: Data from 98 male cancer patients whose sperm samples were banked were evaluated. Demographic parameters, semen characteristics, destination of sperm banked samples and questionnaires answered by the patients regarding cryopreservation time were evaluated. RESULTS: The cancer diagnoses were testicle (56.1%, prostate (15.3%, Hodgkin’s lymphomas (9.2%, non-Hodgkin’s lymphomas (7.1%, leukemia (3.1% and other malignancies (9.2%. The patients with testicular cancer presented lower sperm concentration (p < 0.001; however, there were no differences with the percentage of normozoospermic patients among cancer type groups (p = 0.185. A shorter time between cancer diagnosis and sperm banking was observed for testicular and prostate cancer patients (p < 0.001. Most of the patients (89.5% favored sperm banking as a fertility preservation method. CONCLUSIONS: Although less than 20% of banked sperm samples were disposed of, the majority of patients related sperm banking with safe for fertility preservation. Our results show that all male cancer patients of reproductive age facing cancer treatment could be offered sperm banking.

  1. Glyph-Based Video Visualization for Semen Analysis.

    Science.gov (United States)

    Duffy, Brian; Thiyagalingam, Jeyarajan; Walton, Simon; Smith, David J; Trefethen, Anne; Kirkman-Brown, Jackson C; Gaffney, Eamonn A; Chen, Min

    2013-12-12

    Existing efforts in computer assisted semen analysis have been focused on high speed imaging and automated image analysis of sperm motility. This results in a large amount of data, and is extremely challenging for clinical scientists and researchers to interpret, compare and correlate the multidimensional and time-varying measurements captured from video data. We use glyphs to encode a collection of numerical measurements taken at regular intervals and summarize spatio-temporal motion characteristics using static visual representations. The design of the glyphs addresses the needs for (a) encoding 20 variables using separable visual channels, (b) supporting scientific observation of interrelationships between different measurements and comparison between different sperm cells and their flagella, and (c) facilitating learning of encoding scheme by making use of appropriate visual abstractions and metaphors. We focus this work on video visualization for computer-aided semen analysis, which has a broad impact on both biological sciences and medical healthcare. We demonstrate glyph-based visualization can serve as a means of external memorization of video data as well as an overview of a large set of spatiotemporal measurements. It enables domain scientists to make observations in a cost-effective manner by reducing the burden of viewing videos repeatedly, while providing a new visual representation for conveying semen statistics. PMID:24344092

  2. Decreases in Human Semen Quality with Age Among Healthy Men

    Energy Technology Data Exchange (ETDEWEB)

    Eskenazi, B.; Wyrobek, A.J.; Kidd, S.A.; Moore, L.; Young, S.S.; Moore, D.

    2001-12-01

    The objective of this report is to characterize the associations between age and semen quality among healthy active men after controlling for identified covariates. Ninety-seven healthy, nonsmoking men between 22 and 80 years without known fertility problems who worked for or retired from a large research laboratory. There was a gradual decrease in all semen parameters from 22-80 years of age. After adjusting for covariates, volume decreased 0.03 ml per year (p = 0.001); sperm concentration decreased 2.5% per year (p = 0.005); total count decreased 3.6% per year of age (p < 0.001); motility decreased 0.7% per year (P < 0.001); progressive motility decreased 3.1% per year (p < 0.001); and total progressively motile sperm decreased 4.8% per year (p < 0.001). In a group of healthy active men, semen volume, sperm concentration, total sperm count, and sperm motility decrease continuously between 22-80 years of age, with no evidence of a threshold.

  3. Personality of semen donors and their social behaviour.

    Science.gov (United States)

    Taus, L; Gerzová, J

    1991-01-01

    The authors examined, using three generally accepted methods, the personality structure of 80 semen donors (Cattell's 16-factor questionnaire, 16PF, Eysenck's personality questionnaire, EOD, and Leary's method of interpersonal diagnosis of personality). The donors were selected by means of the Questionnaire of semen donors. The group is subdivided into four sub-groups by the grade of education, i.e. university graduates, men with secondary and elementary education and university students. All are 20-40 years old. The authors describe the assembled results in different sub-groups and in the group as a whole and compare them mutually and with the standardized norm. With regard to the specificity of individual methods and their application the findings are summarized. The donors are balanced personalities, slightly extrovert, emotionally well developed with a realistic outlook. They have positive, sensitive relations with their environment an behaviour towards other people, they are considerate, careful and disciplined. They respect social norms as regards preservation of originality of personality. They have a slight tendency of sheltering behaviour, they wish to be somewhat more aggressive. No pathological phenomena were observed in the donors. Their intelligence is above average. They make a favourable impression with regard to the demand of mental health and transmission of genetic information. The authors evaluate favourably the Questionnaire for semen donors as the method for selection of donors. PMID:1807935

  4. Effect of post-thaw addition of seminal plasma on motility, viability and chromatin integrity of cryopreserved donkey jack (Equus asinus) spermatozoa.

    Science.gov (United States)

    Sabatini, C; Mari, G; Mislei, B; Love, Cc; Panzani, D; Camillo, F; Rota, A

    2014-12-01

    Pregnancy rates in donkeys after artificial insemination with cryopreserved semen are still low, compared to the horse species. Addition of autologous seminal plasma to frozen-thawed semen appeared to improve pregnancy rates. The aims of this study were to evaluate (1) sperm motility and plasma membrane integrity after thawing (T0) and after one and 2 h (T1 and T2) of post-thaw incubation in either 0% (SP0) or 70% (SP70) autologous seminal plasma and (2) sperm motility, plasma membrane integrity and DNA quality (%COMP-?t) after thawing (T0) and after 2 and 4 h (T2 and T4) of post-thaw incubation in either 0% (SP0), 5% (SP5) or 20% (SP20) homologous seminal plasma. In experiment 1, seminal plasma decreased total and progressive sperm motility and plasma membrane intact spermatozoa immediately after dilution and at all following time points (p semen characteristics in vitro over time. PMID:25256158

  5. Effect of glycerol on the viability and fertility of cooled bovine semen.

    Science.gov (United States)

    Papa, Patricia M

    2015-01-01

    The aim of the present study was to compare the viability and fertility of bovine semen diluted in Botu-Bov (BB) commercial extender with and without the cryoprotectant glycerol then cooled at 5 degree C for 24 hours in the Botu-Flex passive cooling system and of semen diluted in BB with glycerol then frozen. One ejaculate of 30 Nelore Bos Taurus indicus bulls between 24 and 30 months of age was used for in vitro analysis. Sperm kinetics and cell viability were analyzed using computer-assisted sperm analysis and flow cytometry, respectively. Three Nelore bulls approximately 30 month old were used for in vivo test using fixed-time artificial insemination for the fertility analysis. The ejaculates were divided into three experimental groups: semen in BB extender with 7% glycerol cooled at 5 °C for 24 hours (cooled semen with cryoprotectant), semen in BB without glycerol cooled at 5 °C for 24 hours (cooled semen without cryoprotectant), and semen diluted in BB with 7% glycerol then subsequently frozen rather than cooled (frozen semen). For the fertility analysis, 762 Nelore cows (B taurus indicus) were randomly inseminated using fixed-time artificial insemination. For the groups corresponding to cooled semen with cryoprotectant, cooled semen without cryoprotectant, and frozen semen, 278, 268, and 216 cows were inseminated, respectively, and the resulting conception rates were 51% a, 44%ab and 41%b (P < 0.05), respectively. In conclusion, the fertility rates improved, when samples were cooled with glycerol at 5 °C for 24 hours compared with the frozen samples. PMID:25441498

  6. Comparison of different extenders and storage temperature on the sperm motility characteristics of Kolbroek pig semen

    Scientific Electronic Library Online (English)

    M.H., Mapeka; K.C., Lehloenya; T.L., Nedambale.

    Full Text Available Maintaining a successful pig artificial insemination programme depends on a number of factors, including evaluation of semen characteristics. This study compared the efficacy of different extenders on the sperm motility of Kolbroek semen during short term storage at 4 °C and 25 °C. Semen was collect [...] ed from Kolbroek boars using the gloved hand technique and transported to the laboratory for evaluation. Semen was pooled and randomly allocated to four groups and diluted at a ratio of 1:1 (v/v) with Beltsville thawing solution (BTS), Kobidil+, egg yolk citrate (EYC) and non-extended semen (Control). Each extender had two similar semen samples, making a total of eight samples. Extended and non-extended semen were stored at 4 °C and the other samples at 25 °C for 1 h. Data were analyzed using analysis of variance (ANOVA). The total sperm motility of semen stored at 25 °C was higher when semen was extended with BTS and Kobidil+ in comparison to the egg yolk citrate diluent. However, total sperm motility in the non-extended semen did not differ from the BTS and EYC group during storage at 25 °C. Sperm progressive motility was higher in the BTS group, compared to the Kobidil+ and non-extended groups. Sperm motility of Kolbroek semen at 4 °C did not differ between all extender treatments. Total motility rate was significantly higher when Kolbroek sperm were stored at 25 °C than at 4 °C. It can be concluded that Kolbroek sperm, extended with BTS, maintained their motility rate better for short term storage at 25 °C in comparison to 4 °C.

  7. Flora bacteriana del semen de toro antes y después de la congelación (Bacterial flora of bull semen before and after freezing process

    Directory of Open Access Journals (Sweden)

    Enrique A. Silveira Prado

    2005-10-01

    Full Text Available Se investigó por bacteriología general el semen fresco y después de la congelación de 50 toros de inseminación artificial y se efectuó el conteo total de unidades formadoras de colonias (UFC. A l5 de los toros se les realizó el examen bacteriológico de sus lavados prepuciales. En todas las muestras de semen fresco se obtuvo crecimiento bacteriano y los gérmenes más frecuentemente aislados fueron: Escherichia coli (50,0%, Staphylococcus aureus (36,0% y Staphylococcus coagulasa negativa (28,0%. En el semen congelado solamente se obtuvo crecimiento en el 20,0%. El 74,0% del semen fresco alcanzó conteos ? 1 x 104 UFC/mL antes de ser procesado; después de la congelación el 80,0% fue estéril. En el total de lavados prepuciales se obtuvo crecimiento y se detectó en mayor proporción el Staphylococcus coagulasa negativa (60,0%, microorganismo también aislado en el semen fresco de estos toros. Se concluyó que la adición de antibióticos al menstruo y posterior congelación en pastillas, disminuye notablemente la carga microbiana presente en el semen. It was investigated through general bacteriology both fresh semen and after the freezing process, carried out in 50 bulls of artificial insemination, total counting of colony forming units (CFU was made. A bacteriological analysis of the prepucial washing was made on 15 of these bulls. In all samples of fresh semen there was bacterial growing. The most frequently germs were: Escherichia coli (50,0%, Staphylococcus aureus (36,0% and coagulase negative Staphylococcus (28,0%. In samples of frozen semen growth was only obtained in the 20,0%. The 74,0% of samples of fresh semen reached counts ? 1 x 104 CFU/mL before being processed; after freezing 80,0% of the samples were sterile. In all prepucial washings it was obtained growth and mostly detected coagulase negative Staphylococcus (60.0%, was also isolated in the fresh semen of these bulls. We concluded that the addition of antibiotics to the menses and later freezing in pills, diminishes the load microbial present notably in the semen

  8. Successful artificial insemination in the Asian elephant (Elephas maximus) using chilled and frozen-thawed semen

    OpenAIRE

    Wongkalasin Warut; Boonprasert Khajornpat; Rungsri Ronnachit; Jansittiwate Saran; Angkawanish Taweepoke; Pinyopummin Anuchai; Kornkaewrat Kornchai; Pongsopavijitr Pornsawan; Thitaram Chatchote; Mahasawangkul Sittidet; Thongtip Nikorn; Homkong Pongpon; Dejchaisri Suthathip; Wajjwalku Worawit; Saikhun Kulnasan

    2009-01-01

    Abstract Background Artificial insemination (AI) using frozen-thawed semen is well established and routinely used for breeding in various mammalian species. However, there is no report of the birth of elephant calves following AI with frozen-thawed semen. The objective of the present study was to investigate the fertilizing ability of chilled and frozen-thawed semen in the Asian elephant following artificial insemination (AI). Methods Semen samples were collected by from 8 bulls (age range, 1...

  9. Bioactivity-Guided Fractionation Identifies Amygdalin as a Potent Neurotrophic Agent from Herbal Medicine Semen Persicae Extract

    OpenAIRE

    Chuanbin Yang; Jia Zhao; Yuanyuan Cheng; Xuechen Li; Jianhui Rong

    2014-01-01

    Herbal medicine Semen Persicae is widely used to treat blood stasis in Chinese medicine and other oriental folk medicines. Although little is known about the effects of Semen Persicae and its active compounds on neuron differentiation, our pilot study showed that Semen Persicae extract promoted neurite outgrowth in rat dopaminergic PC12 cells. In the present study, we developed a bioactivity-guided fractionation procedure for the characterization of the neurotrophic activity of Semen Persicae...

  10. Influence of the uterine inflammatory response after insemination with frozen-thawed semen on serum concentrations of acute phase proteins in mares.

    Science.gov (United States)

    Tuppits, U; Orro, T; Einarsson, S; Kask, K; Kavak, A

    2014-05-01

    The aim of this study was to investigate the clinical relevance of measuring blood concentrations of serum amyloid A (SAA), haptoglobin (Hp) and fibrinogen (Fib) in horse reproductive management, and changes in response to artificial insemination (AI) with frozen-thawed semen. Standardbred mares (n=18) with different reproductive status (eight healthy mares in first postpartum oestrus, five healthy barren mares and five mares with endometritis) were inseminated with frozen-thawed semen. Endometritis was evaluated during oestrus by bacteriological culture, cytology and presence of ultrasonically visible intrauterine fluid during oestrus. Concentrations of SAA, Hp and Fib were analysed in the blood in every 48h during oestrus and until 5, 6 or 7 days after AI. The day of sampling and number of blood samples varied between mares because of length of the oestrus and time of AI. Changes in concentrations of SAA, Hp and Fib were evaluated based on the day of sampling regard to AI and classification of the mares. There were no differences in SAA, Hp and Fib concentrations over time before or after AI or between the groups of mares. The insemination of mares with frozen-thawed semen did not increase the plasma concentrations of SAA, Hp and Fib above clinical threshold concentration and there were no differences between susceptible or healthy mares. PMID:24636940

  11. 9 CFR 98.38 - Restrictions on the importation of swine semen from the APHIS-defined EU CSF region.

    Science.gov (United States)

    2010-01-01

    ...of swine semen from the APHIS-defined EU CSF region. 98.38 Section 98.38 ...of swine semen from the APHIS-defined EU CSF region. In addition to meeting all...semen imported from the APHIS-defined EU CSF region must meet the following...

  12. Human semen quality in the new millennium : a prospective cross-sectional population-based study of 4867 men

    DEFF Research Database (Denmark)

    JØrgensen, Niels; Joensen, Ulla Nordström

    2012-01-01

    Considerable interest and controversy over a possible decline in semen quality during the 20th century raised concern that semen quality could have reached a critically low level where it might affect human reproduction. The authors therefore initiated a study to assess reproductive health in men from the general population and to monitor changes in semen quality over time.

  13. Comparison of Holstein service-sire fertility for heifer and cow breedings with conventional and sexed semen.

    Science.gov (United States)

    Sire conception rate (SCR), a service-sire fertility evaluation implemented in August 2008, is based on up to 7 conventional-semen breedings for parities 1 through 5 (Ccow). The same procedure was used to derive SCR for other types of breedings: sexed semen for cows (Scow) and conventional semen and...

  14. Influence of pre-cryopreservation pH and temperature on boar semen quality

    Science.gov (United States)

    The influence of shipping temperature and pH on semen quality parameters could determine the effectiveness of current National Animal Germplasm Program protocols. The purpose of this project is to determine associations between pH, shipping temperature, and boar semen quality: cell size, cell inte...

  15. Detection of human papillomavirus DNA in semen from patients with intrameatal penile warts.

    OpenAIRE

    Green, J.; Monteiro, E.; Gibson, P.

    1989-01-01

    Fifteen semen specimens from 10 men with intrameatal penile warts attending a genitourinary clinic were tested by Southern blot hybridisation for the presence of human papillomavirus (HPV) DNA. Five specimens were positive for HPV types 6/11. This observation may have implications for screening of semen used for artificial insemination by donor.

  16. Detection of Ureaplasma spp. in semen samples from sheep in Brazil

    Scientific Electronic Library Online (English)

    Sandra Batista dos, Santos; Orestes Luiz de, Souza Neto; Pedro Paulo Feitosa de, Albuquerque; André da Rocha, Mota; Pomy de Cássia Peixoto, Kim; Érica Paes Barreto Xavier de, Moraes; Elmiro Rosendo do, Nascimento; Rinaldo Aparecido, Mota.

    2013-09-01

    Full Text Available A study was conducted to verify the presence of mycoplasmas and ureaplasmas DNA in sheep semen samples from the State of Pernambuco. The PCR assay was conducted of according with standard protocols with generic primers. Mollicutes DNA was detected in 26.0% and Ureaplasma spp. in 12.0% of semen sampl [...] es.

  17. Tiempo de latencia para semen colectado de Colossoma macropomum “Gamitana” en solución sacarosa

    Directory of Open Access Journals (Sweden)

    Ehrlich Llasaca-Calizaya

    2015-01-01

    Full Text Available El objetivo fue estimar el tiempo de latencia (almacenamiento, para el semen de Colossoma macropomum, “gamitana” en solución de 400 mM de Sacarosa. Se consideró aceptable los niveles de motilidad superiores al 40%, lo cual garantiza eficientes tasas de fertilización. Para el desarrollo del experimento se colectó 2 lotes de semen inmótiles de gamitana (inducidos con Conceptal®, los cuales posteriormente fueron activados con agua destilada. El primer lote estuvo constituido por semen en sacarosa 400 mM, puro, a temperatura ambiente y refrigerado (4°C. La motilidad fue evaluada, cada hora, hasta la 7ma hora post colecta. El segundo lote con un semen en sacarosa 400mM a temperatura refrigerada y evaluada cada 12 horas. Los resultados del primer lote de semen demuestran que a partir de la 7ma hora hacia delante los índices de motilidad caen significativamente por debajo del 40%. Los resultados del segundo lote demuestran la viabilidad de utilizar solución de sacarosa, como medio de conservación, para mantener semen refrigerado por 2 días y activarlos con agua destilada. El proceso de extraer y colocar repetidas veces la misma muestra en refrigeración, limita el tiempo de viabilidad de semen con sacarosa en 8 horas aproximadamente. La utilización de sacarosa como medio para almacenar semen inmotil viable de gamitana, ayuda a conservar los espermatozoides por tiempos relativamente cortos.

  18. Effect of sexed semen on conception rate for Holsteins in the United States

    Science.gov (United States)

    Effect of sexed-semen breedings on conception rate was investigated using US Holstein field data from January 2006 through October 2008. Sexed-semen breeding status was determined by a National Association of Animal Breeders’ 500-series marketing code or by individual breeding information in a cow o...

  19. Applications and cost benefits of sexed semen in pasture-based dairy production systems.

    Science.gov (United States)

    Butler, S T; Hutchinson, I A; Cromie, A R; Shalloo, L

    2014-05-01

    Sexed semen technology is now commercially available in many countries around the world, and is primarily used in dairy cattle breeding. Sperm are sorted by flow cytometry on the basis of a 4% difference in DNA content between sperm containing X and Y chromosomes. Despite reliably producing a 90% gender bias, the fertility of the sexed semen product is compromised compared with conventional semen. The negative implications of the reduced fertility of sexed semen are amplified in seasonal systems of dairy production, as the importance of fertility is greater in these systems compared with year-round calving systems. A review of the literature indicates that conception rates (CR) to 1st service with frozen-thawed sexed semen are ~75% to 80% of those achieved with conventional frozen-thawed semen. Preliminary results from a large-scale field trial carried out in Ireland in 2013 suggest that significant improvements in the performance of sexed semen have been made, with CR of 87% of those achieved with conventional semen. The improved fertility of a sexed semen product that delivers a 90% gender bias has considerable implications for the future of breeding management in pasture-based dairy production systems. Sexed semen may facilitate faster, more profitable dairy herd expansion by increasing the number of dairy heifer replacements born. Biosecurity can be improved by maintaining a closed herd during the period of herd expansion. In a non-expansion scenario, sexed semen may be used to increase the value of beef output from the dairy herd. The replacement heifer requirements for a herd could be met by using sexed semen in the 1st 3 weeks of the breeding season, with the remaining animals bred to beef sires, increasing the sale value over that of a dairy bull calf. Alternatively, very short gestation sires could be used to shorten the calving interval. Market prices have a considerable effect on the economics of sexed semen use, and widespread use of sexed semen should be restricted to well managed herds that already achieve acceptable herd fertility performance. PMID:24679704

  20. Application of a quantitative 1H-NMR method for the determination of amygdalin in Persicae semen, Armeniacae semen, and Mume fructus.

    Science.gov (United States)

    Tanaka, Rie; Nitta, Akane; Nagatsu, Akito

    2014-01-01

    A quantitative (1)H-NMR method (qHNMR) was used to measure the amygdalin content of Persicae semen, Armeniacae semen, and Mume fructus, in each of which amygdalin constitutes a major component. The purity of amygdalin was calculated from the ratio of the intensity of the amygdalin H-2 signal at ? 6.50 ppm in pyridine-d 5 to that of the hexamethyldisilane (HMD) signal at 0 ppm. The HMD concentration was corrected by the International System of Units (SI) traceability with certified reference material (CRM)-grade bisphenol A. qHNMR revealed the amygdalin contents to be 2.72 and 3.13% in 2 lots of Persicae semen, 3.62 and 5.19% in 2 lots of Armeniacae semen, and 0.23% in Mume fructus. Thus, we demonstrated the utility of this method for the quantitative analysis of crude drugs. PMID:23744252

  1. Fertility of ewes following artificial insemination with semen frozen in pellets or straws, a preliminary report.

    Science.gov (United States)

    Maxwell, W M; Curnock, R M; Logue, D N; Reed, H C

    1980-08-01

    In two trials involving the artificial insemination of 194 ewes, the fertility of ram semen was examined following freezing, either in pellet form or in straws, and after storage in a chilled state (15 degrees C) for up to 16 hours. Estrus was synchronized in ewes by intravaginal sponge (MAP) treatment for 14 days. At sponge removal 600 IU PMSG was injected and the ewes received two inseminations 50 and 60 hours later. Fertility was assessed at lambing. In trial 1, the mean lambing rate of 52% (16/31) for semen frozen in pellets was higher than 29% (9/31) for semen frozen in straws but this difference was not significant. In trial 2, ewes inseminated with chilled semen and semen frozen in pellets had lambing rates of 83% (44/53) and 55% (44/79) respectively (P<0.001). PMID:16725514

  2. Toxoplasma gondii in experimentally infected Bos taurus and Bos indicus semen and tissues Toxoplasma gondii em semen e tecidos de Bos taurus and Bos indicus experimentalmente infectados

    OpenAIRE

    Leslie Scarpelli; Welber Daniel Zanetti Lopes; Matheus Migani; Katia Denise Saraiva Bresciani; Alvimar José da Costa

    2009-01-01

    Eighteen young steers were inoculated with Toxoplasma gondii and randomly distributed into three groups of six animals each: GI, 2.5x10(5) "P" strain oocysts, GII, 5.0x10(6) "RH" strain tachyzoites, and GIII (Control). Clinical, serological and parasitemia exams were realized. Parasite investigation by bioassay and PCR was realized on semen and fragments of skeletal musculature, lymph nodes, brain, retina, spleen, liver, lung, testicle, epididymis and seminal vesicle. Blood and semen samples ...

  3. EFFECT OF TWO DIFFERENT ANTIBIOTIC COMBINATIONS ON FERTILITY OF FROZEN BUFFALO AND SAHIW AL BULL SEMEN

    Directory of Open Access Journals (Sweden)

    S.M.H. Andrabi, N. Ahmad, A. Abbas and M. Anzar

    2001-09-01

    Full Text Available This study was carried out to identify the suitable antibiotic combinations in semen extender for improvement in fertility of frozen semen of buffalo and cow (Sahiwal bulls to obtain better pregnancy rate through artificial insemination (AI. For this study eight first ejaculates, four each from a buffalo and a cow (Sahiwal bull were used. The ejaculates were split-sampled and diluted with Tris-citric acid extender (at 37°C; 50x 106 spermatozoa/mI, containing either SP (streptomycin 1000 ~g/ml and penicillin 1000 IU/ml or GTLS (gentamycin 500 µg/ml, Tylosin 100 µg/ml and linco-spectin 300/600 µg/ml. There was no difference in post-thaw motility for these samples. Fertility test based on 75-days first service pregnancy rate was determined under field conditions. A total of 400 inseminations were recorded, 200 for each buffalo and cow (Sahiwal with J 00 of each antibiotic combination, respectively. Fertility rates for SP-based frozen semen of buffalo bull were 41.66% and were 55.2% for GTLS-containing frozen semen, respectively. The results for GTLS were higher (P<0.0001 than SP. Similarly, fertility rates were higher (P<0.0001 for GTLS-based frozen semen of Sahiwal bull (78.78% than SP-containing frozen semen (69.6% of the same specie. Fertility rates also differed due to species of donor bulls. They were better (P<0.0001 for the frozen Sahiwal bull semen than that of the buffalo bull in both SP and GTLS- based frozen semen samples, respectively. In conclusion. seminal quality measured by field fertility trial indicated GTLS combination of antibiotics added to the semen extender was better for improvement in the fertility of frozen buffalo and Sahiwal bull semen, by yielding better pregnancy rates through AI.

  4. Successful artificial insemination in the Asian elephant (Elephas maximus using chilled and frozen-thawed semen

    Directory of Open Access Journals (Sweden)

    Wongkalasin Warut

    2009-07-01

    Full Text Available Abstract Background Artificial insemination (AI using frozen-thawed semen is well established and routinely used for breeding in various mammalian species. However, there is no report of the birth of elephant calves following AI with frozen-thawed semen. The objective of the present study was to investigate the fertilizing ability of chilled and frozen-thawed semen in the Asian elephant following artificial insemination (AI. Methods Semen samples were collected by from 8 bulls (age range, 12-to 42-years by manual stimulation. Semen with high quality were either cooled to 4°C or frozen in liquid nitrogen (-196°C before being used for AI. Blood samples collected from ten elephant females (age range, 12-to 52-years were assessed for estrus cycle and elephants with normal cycling were used for AI. Artificial insemination series were conducted during 2003 to 2008; 55 and 2 AI trials were conducted using frozen-thawed and chilled semen, respectively. Pregnancy was detected using transrectal ultrasonography and serum progestagen measurement. Results One female (Khod inseminated with chilled semen became pregnant and gave birth in 2007. The gestation length was 663 days and the sex of the elephant calf was male. One female (Sao inseminated with frozen-thawed semen showed signs of pregnancy by increasing progestagen levels and a fetus was observed for 5 months by transrectal ultrasonography. Conclusion This is the first report showing pregnancy following AI with frozen-thawed semen in the Asian elephant. Successful AI in the Asian elephant using either chilled or frozen-thawed semen is a stepping stone towards applying this technology for genetic improvement of the elephant population.

  5. Evaluación de la flora bacteriana del semen de verracos en granjas porcinas de Venezuela / Evaluation of bacterial flora of boar semen in pig farms in Venezuela

    Scientific Electronic Library Online (English)

    Yuraima, Pineda; Jorge, Santander.

    2007-09-01

    Full Text Available RESUMEN Se realizaron estudios bacteriológicos de 226 muestras de semen de verracos sanos utilizados como reproductores procedentes de cinco granjas porcinas provenientes de dos estados de Venezuela. La evaluación bacteriológica del semen fresco y diluido indico la presencia de una amplia variedad d [...] e géneros bacterianos entre flora normal y potencialmente patógena. E. coli fue la bacteria más frecuentemente aislada seguida por Staphylococcus epidermidis, Proteus vulgaris, Streptococcus spp. ß hemolítico, Staphylococcus aureus y Psedomonas aeruginosa. Estos aislados fueron resistentes a los antimicrobianos utilizados en los diluentes comerciales de semen Abstract in english ABSTRACT A bacteriological study was performed on 226 semen samples from healthy boars collected from five pig farms in two Venezuelan states. The evaluation of fresh and diluted semen showed a wide variety of bacteria range from normal and potentially pathogenic flora. E. coli was the most common b [...] acteria isolated, followed by Staphylococcus epidermidis, Proteus vulgaris, Streptococcus spp. ? hemolytic, Staphylococcus aureus and Pseudomonas aeruginosa. The bacteria were found to be resistant to the antimicrobials normally used in commercial diluents semen

  6. Análisis de diluyentes comerciales de semen porcino refrigerado durante 4 días: resultados preliminares / Analysis of commercial extenders for porcine semen refrigerated for 4 days: preliminary results

    Scientific Electronic Library Online (English)

    P., Torres; M.L., Fischman; M., Acerbo; C., García; M., Míguez; J., Domínguez; H., Cisale.

    2014-09-01

    Full Text Available La utilización de semen enfriado en inseminación artificial (IA) porcina sigue siendo una limitante, ya que la respuesta frente a temperaturas menores a 16 ºC es aleatoria entre cerdos, y aún entre eyaculados del mismo cerdo. El objetivo del presente trabajo fue jerarquizar la capacidad para la cons [...] ervación de dosis refrigeradas durante 4 días de tres diluyentes comerciales (de larga o media duración) de semen porcino (Androstar Plus®, MRA® y MIII®), analizando: viabilidad, funcionalidad de membrana, integridad acrosomal y movilidad en 11 eyaculados procedentes de 3 verracos. No existieron diferencias (p>0,05) entre diluyentes por lo que sería similar su capacidad de conservación durante un período de 4 días. Abstract in english The use of cold preserved semen is still a limiting factor in artificial insemination, because of the random response of boar semen to temperatures below 16 ºC, even between ejaculates from the same male. The aim of this work was to analyze and rank three commercial (long and medium term) boar semen [...] extenders (Androstar Plus®, MRA® y MIII®), based on their capability to preserve refrigerated semen for four days analyzing: viability, membrane functionality acrosome integrity and motility. Eleven ejaculates were assessed. There were not differences (p>0.05) between extenders for any of the parameters studied, evidencing a similar preservation capability in a four-day period.

  7. VIABILIDAD ESPERMÁTICA E INTEGRIDAD DEL ACROSOMA EN SEMEN CONGELADO DE TOROS NACIONALES / SPERM VIABILITY AND ACROSOME INTEGRITY IN NATIONAL FROZEN BULL SEMEN

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V; César, Pantoja A.

    Full Text Available Se evaluó el deterioro de la membrana espermática e integridad del acrosoma como método para predecir la fertilidad en toros. Se trabajó con cuatro toros (2 Hosltein y 2 Brown Swiss) del Banco Nacional de Semen, Lima-Perú. Se evaluó integridad acrosomal, integridad de membrana espermática, motilidad [...] , espermatozoides vivos, volumen y concentración durante los procesos de refrigeración, congelación y descongelación de 10 eyaculados por animal. En semen fresco sin diluir se encontró un volumen de 4.33 ml, concentración espermática de 922.5 x 106/ml, y 78.5% de espermatozoides vivos. La motilidad individual progresiva en semen diluido fue de 82.7 a 86.0% con diferencia significativa entre toros (p Abstract in english The deterioration of the sperm membrane and acrosome integrity as a method for predicting fertility in bulls was evaluated. Four bulls (2 Holstein and 2 Brown Swiss) from the National Bank of Semen, Lima-Peru were used. Acrosome integrity, sperm membrane integrity, motility, live sperm cells, volume [...] , and sperm concentration during cooling, freezing and thawing was evaluated in 10 ejaculates per sire. In fresh semen, volume was 4.33 ml; sperm concentration was 922.5 x 106/ml and 78.5% of live cells. The individual progressive motility in diluted semen was 82.7 to 86.0% with significant difference between bulls (p

  8. Human immunodeficiency virus type-1 episomal cDNA in semen

    Directory of Open Access Journals (Sweden)

    Mayer Kenneth H

    2005-10-01

    Full Text Available Abstract Background Episomal 2-long terminal repeat (LTR HIV-1 cDNA, a by-product of HIV-1 infection, is used in clinical trials as a marker for ongoing viral replication. It would be useful to employ 2-LTR cDNA to monitor cryptic HIV-1 infection in the genital tract of men on antiretroviral therapy (ART to predict the evolution of sexually transmissible drug-resistant HIV-1, but studies thus far have failed to detect this marker in semen. The objectives of this study were: 1 to use a technique that maximizes DNA recovery from HIV-1 infected white blood cells in semen to determine if episomal 2-LTR cDNA is detectable in semen of ART-naïve men with other evidence of genital tract HIV-1 infection, and 2 to compare levels of HIV-1 2-LTR cDNA, RNA, and proviral DNA in semen from HIV-1+ men on ART. Results Using a somatic cell DNA extraction technique, 2-LTR cDNA was detected by PCR/ELISA in 4 out of 8 semen samples from ART-naïve men selected for other signs of seminal HIV-1 infection (positive controls. Southern blot and DNA sequencing confirmed that the amplified sequences were HIV-1 2-LTR cDNA; copy numbers ranged from 55 to 504 copies/sample. Two semen samples from a cohort of 22 HIV-1-infected men on dual nucleoside therapy, one with and one without detectable seminal HIV-1 RNA, were 2-LTR cDNA positive (336 and 8,560 copies/sample. Following addition of indinavir to the therapy regimen, no semen samples from 21 men with controlled peripheral and seminal viral loads were 2-LTR cDNA positive at 1 and 6 month time points, despite the persistence of HIV-1 proviral DNA+ semen cells and seminal cytomegalovirus (CMV shedding in some cases. However, one individual who failed indinavir therapy and later developed distinct protease inhibitor (PI drug resistance mutations in semen, maintained elevated levels of HIV-1 RNA and 2-LTR cDNA in semen. Conclusion 2-LTR HIV-1 cDNA is detectable in semen of HIV-1-infected men. Two men on ART had 2-LTR HIV-1 cDNA in semen, suggesting that this marker may prove to be useful to monitor HIV-1 infection in the genital tract of men on ART to predict the evolution of drug resistance mutations in semen.

  9. A Study of a Method to Assess the Purity of Sorted Bovine Semen Using Rapid Single-Sperm Sexing PCR

    Directory of Open Access Journals (Sweden)

    Weihua Du

    2011-01-01

    Full Text Available Sort reanalysis using flow cytometry is the most common method for determining the purity of X or Y enriched semen. The high cost of this technique (including the required expensive, proprietary machine limits efforts to improve the technique and to promote develop applications for the sorted semen. In this study, the sperm sex (the presence of the X or Y chromosome was identified by both rapid PCR and flow cytometry reanalysis. The rapid PCR results showed that the percentages of X and Y sperm were 48 and 52% in unsorted semen, 92 and 8% in X-enriched semen and 17 and 83% in Y-enriched semen, respectively. Reanalysis of the DNA content of the sorted samples revealed that the X and Y sperm frequencies were 92 and 8% in X-enriched semen and 15 and 85% in Y-enriched semen, respectively. The sex ratio of unsorted semen analyzed by PCR did not significantly deviate from the expected ratio of 1:1 and there was no significant difference between the sex ratios of sorted semen samples determined by PCR and flow cytometry reanalysis. These results indicate that we have established an effective, reliable and rapid PCR method to verify the purity of sorted semen. This method should contribute greatly to the improvement of sperm sorting techniques and the development of applications for sorted semen.

  10. Supplementation of soybean lecithin-based semen extender by antioxidants: complementary flowcytometric study on post-thawed ram spermatozoa.

    Science.gov (United States)

    Sharafi, Mohsen; Zhandi, Mahdi; Akbari Sharif, Abbas

    2015-06-01

    The purpose of the current study was to evaluate the effects of cysteine (C) and glutathione (G) on the post-thawed ram sperm quality. Collected semen samples from four mature rams were diluted with five soybean lecithin (SL)-based extenders containing: no antioxidant (SL-0), 5 mM cysteine (SL-C5), 10 mM cysteine (SL-C10), 5 mM glutathione (SL-G5) and 10 mM glutathione (SL-G10). After freeze-thawing process, motion and velocity parameters, plasma membrane integrity and functionality, morphological abnormality, lipid peroxidation, acrosomal status, mitochondria activity, and apoptosis status of post-thawed ram spermatozoa were assessed. The results showed that SL-C10 increased the total motility and plasma membrane integrity (p < 0.05) of post-thawed ram spermatozoa (55.86 ± 1.37 and 60.57 ± 1.34 %) compared to other extenders. Progressive motility was significantly higher in SL-C10 (24.71 ± 1.13 %) compared to SL-0 (20 ± 1.13 %) and SL-G10 (15 ± 1.13 %). Mitochondrial activity was significantly higher in SL-C10 (56.83 ± 2.29 %) compared to SL-G10 (38.75 ± 2.29 %). Capacitation and acrosomal status, lipid peroxidation, and the percentage of dead spermatozoa were not affected by different extenders. The percentage of live spermatozoa was higher in SL-C10 (56.33 ± 1.35 %) compared to other extenders. Also, SL-C10 resulted in a lower percentage of apoptotic spermatozoa (14.17 ± 0.53 %) compared to other extenders. The results of this study showed that supplementation of SL-based ram semen extender with 10 mM cysteine resulted in an improved quality of post-thawed ram spermatozoa. PMID:24907919

  11. Fixed-time insemination with frozen semen in mares: is it suitable for poorly fertile stallions?

    Science.gov (United States)

    Avanzi, Bruno Ribeiro; Ramos, Renata Dos Santos; Araujo, Gustavo Henrique Marques; Fioratti, Eduardo Gorzoni; Trinca, Luzia Aparecida; Dell'Aqua, José Antonio; Melo E Oña, Cely Marini; Zahn, Fabíola Soares; Martin, Ian; Alvarenga, Marco Antonio; Papa, Frederico Ozanam

    2015-06-01

    The purpose of the present study was to compare two protocols for equine frozen semen programs using either postovulation insemination or fixed-time insemination (FT), evaluating both pregnancy rates and intrauterine fluid (IUF) accumulation after artificial insemination with semen obtained from either highly or poorly fertile stallions. Six ejaculates from two stallions (n = 12) were processed. After thawing, semen samples were evaluated by computerized semen analysis. Fifteen mares (30 cycles) were inseminated with frozen semen from highly fertile stallion A, and 14 mares (28 cycles) were inseminated with frozen semen from poorly fertile stallion B. Ovulations were induced with 1 mg (intramuscular) of deslorelin acetate after the observation of a greater than 35 mm follicle and uterine edema. In postovulation insemination group, mares were inseminated once with 800 × 10(6) total sperm in a maximum 6-hour interval after ovulation. In FT group, mares were inseminated twice with 400 × 10(6) total sperm, 24 and 40 hours after induction. Mares were ultrasonographically examined for IUF accumulation 24 hours and for pregnancy diagnosis 14 days after the last insemination. Although IUF accumulation was more evident in mares inseminated once postovulation, pregnancy rates were similar for both protocols, regardless of the stallion, although a significant effect of the stallion was observed. These results indicated that FTs may be used for both highly and poorly fertile stallions as a practical tool to help spreading the use of frozen semen in equine reproduction programs. PMID:25805693

  12. APLIKASI PEMETAAN ALIRAN NILAI DI INDUSTRI KEMASAN SEMEN

    Directory of Open Access Journals (Sweden)

    Iwan Vanany

    2005-01-01

    Full Text Available This paper describes the application of Value Stream Mapping to identify the waste in cement-package industry on PT IHSG. The Value Stream Mapping is used to map the activity towards the company's supply chain with the result that the non-value adding activity could be identified. The result will be an important fundament for identifying the defect and time. The effort for identifying the company's improvement meet the problem priority and it has a significant impact so that the time and cost consuming could be avoided. Abstract in Bahasa Indonesia : Paper ini menggambarkan bagaimana aplikasi pemetaan aliran nilai dapat mengidentifikasi waste pada industri kemasan semen. Pemetaan aliran nilai digunakan untuk memetakan aktivitas pada rantai pasok perusahaan sehingga aktivitas yang tidak bernilai tambah dapat diketahui. Hasil pemetaan akan menjadi landasan penting didalam mengetahui cacat dan waktu tunggu. Upaya untuk mengidentifikasi perbaikan perusahaan sesuai dengan masalah prioritas yang ada dan memiliki dampak yang signifikan sehingga tidak terjadi pemborosan biaya dan waktu program perbaikan. Kata kunci: pemetaan aliran nilai, industri kemasan semen, waste.

  13. Laser researches on livestock semen and oocytes: A brief review

    Directory of Open Access Journals (Sweden)

    Z. Abdel-Salam

    2015-05-01

    Full Text Available This article presents a brief review of the past and present literature pertinent to laser effects on sperm motility parameters, improvement of oocyte maturation and characterization of semen in livestock. The aim was, on one hand, to make the readers aware of such knowledge and on the other hand to trigger the interest of the animal reproduction scientific community in attempting some laser techniques that have not yet been fully exploited in the field of artificial insemination. With respect to the conventional methods, laser is a more sensitive and less costly technology that can be used for improving artificial insemination and embryo production system. Since 1980s, laser treatment came on the biological samples scene; its applications have continuously been developed thereafter. Exploitation of laser light by various researchers for improving the reproductive efficiency of sperm cells and the maturation rate in different livestock is demonstrated herein. Laser irradiation, in principal, can increase the production of adenosine triphosphate (ATP and consequently increases the energy provided to the cell. Since sperm motility and oocyte maturation depend on the energy consumption, an increase in the energy supply to the cells will be of great importance. In addition, the authors also discuss the use of laser spectrochemical analytical techniques, such as laser induced breakdown spectroscopy (LIBS and laser induced fluorescence (LIF, in characterization of semen samples.

  14. An Outbreak of Porcine Reproductive and Respiratory Syndrome Virus in Switzerland Following Import of Boar Semen.

    Science.gov (United States)

    Nathues, C; Perler, L; Bruhn, S; Suter, D; Eichhorn, L; Hofmann, M; Nathues, H; Baechlein, C; Ritzmann, M; Palzer, A; Grossmann, K; Schüpbach-Regula, G; Thür, B

    2014-09-11

    An outbreak of porcine reproductive and respiratory syndrome virus (PRRSV) occurred in November 2012 in Switzerland (CH), traditionally PRRSV-free. It was detected after a German boar stud informed a semen importer about the detection of PRRSV during routine monitoring. Tracing of semen deliveries revealed 26 Swiss sow herds that had used semen from this stud after its last negative routine monitoring and 62 further contact herds. All herds were put under movement restrictions and examined serologically and virologically. As a first measure, 59 sows from five herds that had previously been inseminated with suspicious semen were slaughtered and tested immediately. Investigations in the stud resulted in 8 positive boars with recent semen deliveries to CH (Seven with antibodies and virus, one with antibodies only). In one boar out of six tested, virus was detected in semen. Of the 59 slaughtered sows, five from three herds were virus-positive. In one herd, the virus had spread, and all pigs were slaughtered or non-marketable animals euthanized. In the remaining herds, no further infections were detected. After confirmatory testings in all herds 3 weeks after the first examination gave negative results, restrictions were lifted in January 2013, and Switzerland regained its PRRSV-free status. The events demonstrate that import of semen from non-PRRS-free countries - even from negative studs - poses a risk, because monitoring protocols in boar studs are often insufficient to timely detect an infection, and infections of sows/herds occur even with low numbers of semen doses. The outbreak was eradicated successfully mainly due to the high disease awareness of the importer and because immediate actions were taken before clinical or laboratory diagnosis of a single case in the country was made. To minimize the risk of an introduction of PRRSV in the future, stricter import guidelines for boar semen have been implemented. PMID:25209832

  15. Improvement of the Shami goat semen quality by adding bovine serum albumin

    Directory of Open Access Journals (Sweden)

    O.I. Azawi

    2014-06-01

    Full Text Available The present study was aimed to improve the quality of Shami goat semen diluted with Tris diluent by adding bovine serum albumin. In the current study, six male goats were used. Semen was collected using artificial vagina of one ejaculate per week of every male included in this study. This study was performed during the breeding season from 1 \\ 10 \\ 2012 to 1 \\ 12 \\ 2012. In this study, two semen diluents were use first; Tris- fructose- egg yolk 2.5% and second Tris - fructose - 2.5% egg yolk with 1% of bovine serum albumin. Diluted semen samples were cooled gradually and stored at 5 ° C. Cooled diluted semen samples were examined every 24 h of storage to 144 h. These tests includes the proportion of live sperm and the percentage of secondary abnormalities of the sperm, the percentage of sperm acrosomal defects and percentage of progressive motility using a computer-aided sperm analysis. These results showed that the addition of bovine serum albumin with egg yolk to semen of male goats led to improved qualities of semen significantly (P<0.05 including the proportion of live sperm and the percentage of secondary abnormalities of the sperm, the percentage of sperm acrosomal defects and percentage of progressive motility. It could be concluded from the results of the current study, the possibility of storing goat semen for more than six days with alive sperm of more than 50% and the percentage of the progressive motility of more than 40% when adding bovine albumin serum to dilute goat semen at 1% level and this result has not reached by any previous study.

  16. Effect of the Type of Straw on the Spermatic Quality in the Freezing of Boar Semen

    Directory of Open Access Journals (Sweden)

    C.A. C?rdova-Jim?nez

    2006-01-01

    Full Text Available With the freezing boar semen, could have better options for the optimization of the reproductive handling in the swinish species as well as an alternative for the development of this cattle activity; using technologies like the implementation of banks of frozen of races with characteristic zootechnic of economic importance that guarantee the readiness of germinal material in the moment that is required, to have germinal material of males proven genetically, still when the animal no longer exists, to overcome certain intentional restrictions of transport of alive animals, for the problem of transmission of illnesses and, to overcome the restrictive of time of viability of the diluted fresh semen. In this work was examined the effect of the freezing boar semen in straws plastic of 0.5 and 5 mL on the Motility and the Acrosome Integrity (NAR. For it, 9 were used ejaculated of different animals, the experiment was carried out comparing fresh semen with thawing semen coming from straws of 0.5 and 5 mL. The results of percentages of motility and NAR for fresh and thawing semen, were of 86.19, 47.14 and 47.14, for straws of 0.5 mL and 75.62, 48.19 and 46.81, for straws of 5 mL. When carrying out the analysis of the variance and the test of multiple comparisons it was found that the freezing of the semen in both straws types, the percentages of motility and NAR reduce, with regard to the fresh semen; however, the macrotubes or straws of 5 mL, represent a good option in the artificial insemination using boar semen frozen-thawing.

  17. The reference values for semen parameters of 1213 fertile men in Guangdong Province in China

    Directory of Open Access Journals (Sweden)

    Yun-Ge Tang

    2015-04-01

    Full Text Available Semen samples were collected from 1213 fertile men whose partners had a time-to-pregnancy (TTP ?12 months in Guangdong Province in Southern China, and semen parameters including semen volume, sperm concentration, total counts, motility, and morphology were evaluated according to the World Health Organization (WHO 2010 guideline. All semen parameters analyzed were normal in ~62.2% of the total samples, whereas ~37.8% showed at least one of the semen parameters below normal threshold values. The fifth centiles (with 95% confidence intervals were 1.3 (1.2-1.5 ml for semen volume, 20 × 10 6 (18×10 6 -20×10 6 ml?1 for sperm concentration, 40 × 10 6 (38×10 6 -44×10 6 per ejaculate for total sperm counts, 48% (47%-53% for vitality, 39% (36%-43% for total motility, 25% (23%-27% for sperm progressive motility, 5.0% (4%-5% for normal morphology. The pH values ranged from 7.2 to 8.0 with the mean ± standard deviation at 7.32 ± 0.17. No effects of age and body mass index were found on semen parameters. Occupation, smoking and alcohol abuse, varicocele appeared to decrease semen quality. Sperm concentration, but not sperm morphology, is positively correlated with TTP, whereas vitality is negatively correlated with TTP. Our study provides the latest reference values for the semen parameters of Chinese fertile men in Guangdong Province, which are close to those described in the new WHO guidelines (5 th Edition.

  18. The reference values for semen parameters of 1213 fertile men in Guangdong Province in China.

    Science.gov (United States)

    Tang, Yun-Ge; Tang, Li-Xin; Wang, Qi-Ling; Song, Ge; Jiang, Yan-Jia; Deng, Shun-Mei; Jiang, Fang; Qin, Wei-Bing

    2015-01-01

    Semen samples were collected from 1213 fertile men whose partners had a time-to-pregnancy (TTP) ?12 months in Guangdong Province in Southern China, and semen parameters including semen volume, sperm concentration, total counts, motility, and morphology were evaluated according to the World Health Organization (WHO) 2010 guideline. All semen parameters analyzed were normal in ~62.2% of the total samples, whereas ~37.8% showed at least one of the semen parameters below normal threshold values. The fifth centiles (with 95% confidence intervals) were 1.3 (1.2-1.5) ml for semen volume, 20 × 10 6 (18×10 6 -20×10 6 ) ml-1 for sperm concentration, 40 × 10 6 (38×10 6 -44×10 6 ) per ejaculate for total sperm counts, 48% (47%-53%) for vitality, 39% (36%-43%) for total motility, 25% (23%-27%) for sperm progressive motility, 5.0% (4%-5%) for normal morphology. The pH values ranged from 7.2 to 8.0 with the mean ± standard deviation at 7.32 ± 0.17. No effects of age and body mass index were found on semen parameters. Occupation, smoking and alcohol abuse, varicocele appeared to decrease semen quality. Sperm concentration, but not sperm morphology, is positively correlated with TTP, whereas vitality is negatively correlated with TTP. Our study provides the latest reference values for the semen parameters of Chinese fertile men in Guangdong Province, which are close to those described in the new WHO guidelines (5 th Edition). PMID:25432502

  19. EFFECT OF DIFFERENT EXTENDERS ON SPERM VIABILITY OF EQUINE SEMEN COOLED IN TWO DIFFERENT CONTAINERS EFEITO DE DIFERENTES DILUENTES NA MANUTENÇÃO DAS CARACTERÍSTICAS DO SÊMEN EQÜINO EM DOIS SISTEMAS DE REFRIGERAÇÃO PASSIVA

    Directory of Open Access Journals (Sweden)

    José Antônio Dell'Aqua

    2008-10-01

    Full Text Available

    The use of equine cooled transported semen is increasing significantly in the whole world; this is in consequence of the advantages and improvement of the cooling semen technology. The aim of the present study was to compare three commercial extenders for cooling equine semen (Botusemen®; Botu-Turbo® e INRA 96® using two Brazilian commercial containers (Botu-Box® e Botutainer® for cooling and storage. Three ejaculates from four stallions from different breeds were used. The samples were evaluated at 0, 6, 12 and 24 hours using CASA for estimate the total and progressive motility and the plasma membrane integrity assessed using fluorescent probes. According to the results, there was no difference on sperm parameters (P>0.05 when comparing both the cooling/storage containers and the extenders used. Thus, is possible to conclude that the extenders and the containers were efficient on maintaining the motility and viability of semen cooled/stored during 24 hours, being a new proposal for equine cooled semen technology.

    KEY WORDS: Container, cooled semen, equine, extender.

    A utilização da biotecnologia de sêmen eqüino refrigerado e transportado tem apresentado um crescimento significativo na eqüideocultura mundial, no tocante às inúmeras vantagens e inovações que a técnica tem proporcionado. O presente experimento teve como objetivo avaliar diferentes meios de refrigeração (Botu-Semen®; Botu-Turbo® e INRA 96® em dois sistemas de transporte de sêmen refrigerado (Botu-Box® e Botutainer®. Foram utilizados três ejaculados de quatro garanhões de diferentes raças, submetidos à análise computadorizada da motilidade total e progressiva, bem como da integridade da membrana plasmática, pela técnica de epifluorescência, nos momentos 0, 6, 12 e 24 horas após a colheita. De acordo com os resultados obtidos para os parâmetros espermáticos, não se observaram diferenças significativas entre os sistemas de refrigeração e os meios testados, concluindo-se que tanto os sistemas de refrigeração como os diluentes foram eficazes na manutenção da motilidade e viabilidade espermática, apresentando-se como alternativas à biotecnologia de transporte de sêmen eqüino refrigerado.

    PALAVRAS-CHAVES: Diluente, eqüino, refrigeração de sêmen, sistema de transporte.

  20. Fertilization Capacity of Rooster Spermatozoa in Response to the Modification in the Semen Composition

    OpenAIRE

    Shoukry M. El-Tantawy; Marwa M. Ahmed; Essam A. El-Gendy; Shawki A. Ibrahim

    2012-01-01

    An experiment was carried out to study the changes in fertilization capacity of rooster sperms in response to the modification in the biochemical composition of the semen. Chickens of two lines (CE2 and CE4) were used. Seven treatments of semen were designed and included the incubation of sperm with the plasmid, with a mixture of the plasmid and lipofectin at 2.5 or 5% concentration and the incubation of spermatozoa with lipofectin and a semen extender (BPSE). The progenies were obtaine...

  1. Evaluation of Physical Semen Characteristics of Male Rabbits Exposed to Different Climatic Conditions and Lighting Regimes Using Nuclear Techniques

    International Nuclear Information System (INIS)

    The number of 20 mature males New Zealand White (NZW) rabbits, in the first production year was used in the present research. The study included two periods; each was of 2 months. The first period was under mild conditions (18.0 degree C) while the second one was during hot conditions (35.0 degree C). In each period, 10 males with the same age and average live body weight were used. Animals within each period were divided randomly into two equal groups, with nearly equal body weights. One of the two groups exposed to natural day light (NDL) which was 10:50 L: 13:10 D in winter and 13:40 L: 10:20 D in summer and was considered as photo period control and the other group was exposed to photo period treatment (Artificial photo period, AP). The treatment group was exposed to artificial long photo period (13:40 L: 10:20 D) during winter and artificial short photo period (10:50 L: 13:10 D) during hot conditions. In seminal plasma, T4, T3 and testosterone hormonal levels were significantly lower in heat stressed rabbits than those reared under mild conditions. In contrast, the hot condition was accompanied by significant increases in cortisol level. T3 and cortisol affected significantly while T4 and testosterone levels were not affected significantly due to change in period of lighting. Concerning physical semen characteristics i.e. ejaculate volume, sperm motility, sperm cell concentration, total sperm output and number of motile sperms per ejaculate were significantly lower under heat stress than under mild conditions. In contrast, hot conditions were accompanied by a significant increase in each of reaction time, dead sperm %, sperm abnormalities % and acrosomal abnormalities %. Exposure of male rabbits during winter to long lighting as compared to NDL caused significant increase in T3 (1.4 vs. 1.3 ng/ml), testosterone (3.2 vs. 2.8 ng/ml) and cortisol (1.8 vs. 1.5 ng/ml) levels as well as significant decline in semen quality, i.e., ejaculate volume (70 vs. 60 x 10-2 ml), sperm motility (76.8 vs. 70.8%), total number sperm-cell output per ejaculate (287.00 vs. 240.00 x106 ) and number of motility sperm output per ejaculate (220.42 vs. 169.92 x106 ). Exposure of male rabbits during summer to short lighting as compared to NDL caused significant increase in T3 (1.10 vs.0.90 ng/ml) and cortisol (2.8 vs. 2.3 ng/ml) in seminal plasma as well as significant decrease in sperm motility (64.8 vs. 60.8%) and significant increase in reaction time (11.6 vs. 12.8 seconds), ejaculate volume (50 vs. 58 x 10-2 ml) and total number sperm-cell output per ejaculate (190.00 vs. 208.80 x 106 ). Finally, correlations between physical semen characteristics and seminal plasma hormonal levels were carried out to evaluate the rabbit bucks semen using nuclear technique

  2. Estandarización del manejo y la criopreservación de semen de hembras masculinizadas de trucha arco iris (Oncorhynchus mykiss) / Standardization of handling and freezing sperm from masculinized females of rainbow trout (Oncorhynchus mykiss) / Padronizar a gestão ea criopreservação de sêmen de fêmeas de truta arco-íris (Oncorhynchus mykiss) sob masculinização

    Scientific Electronic Library Online (English)

    James J, Betancur L; Andrés F, Montoya; Tatiana, Mira; Francy A, Rojas; Martha, Olivera Ángel.

    2008-09-01

    Full Text Available A procura de linhas monosexo fêmeas na produção de trutas tem aumentado significativamente nos últimos anos, de modo tecnologias foram desenvolvidas com a finalidade de padronizar este processo como o uso do esperma de genética feminina submetido a reversão sexual. O objectivo do presente inquérito [...] foi para uniformizar a maturação in vitro e criopreservação de sêmen masculinização de fêmeas (neomachos XX) trutas arco-íris (Oncorhynchus mykiss) como uma estratégia para produzir descendentes de 100% do sexo feminino dos jogadores colombianos. Para a obtenção do esperma neomachos foram mortas e sêmen foi recuperado submetida a maturação processo normal de plasma seminal plasma seminal masculina ou artificiais. Para a criopreservação de sêmen foi testado crioprotectores dimethylsulphoxide 10% e 10% de metanol. O experimento foi evaluron mobilidade pós maturação e pós descongelamento e fertilidade do sêmen. O processo de maturação teve um efeito significativo sobre a porcentagem de mobilidade (p Abstract in spanish La demanda de líneas monosexo hembras en la producción de trucha ha incrementado significativamente en los últimos años, por lo que se han desarrollado tecnologías para estandarizar este proceso como el uso de semen de hembras genéticas sometidas a reversión sexual. El objetivo de la presente invest [...] igación fue estandarizar la maduración in vitro y la criopreservación de semen de hembras masculinizadas (neomachos XX) de trucha arco iris (Oncorhynchus mykiss) como estrategia para producir descendencias 100% hembras de reproductores colombianos. Para la obtención del semen los neomachos fueron sacrificados y el semen recuperado fue sometido a proceso de maduración con plasma seminal de machos normales o plasma seminal artificial. Para la criopreservación del semen se probaron los crioprotectores dimetilsulfóxido 10% y metanol 10%. En el experimento se evaluron la movilidad post maduración y post descongelación y la fertilidad del semen. El proceso de maduración tuvo un efecto significativo sobre el porcentaje de movilidad (p Abstract in english The demand of monosex female stocks in production of trout has significantly increased during the past years, which has led to develop new technologies to standardize this process. The usage of semen of genetic females submitted to sexual reversion is a good choice. The objective of this research wa [...] s to develop a methodology to mature in vitro and cryopreserved semen of sex-reversed rainbow trout (Oncorhynchus mykiss) females as strategy to produce lineage 100% Colombian trout female. The semen was directly obtained from the gonads after its surgical extraction of the slaughtered individuals, later it was submitted to maturation process implementing seminal plasma of normal males and artificial plasma. The semen was cryopreserved in two extender dimetyhyl sulfoxide 10% and methanol 10%. Postmaturation, postcriopreservation movility and sperm fertility were evaluated. Maturation process had a significative effect on movility, the highest movility was obtained with artificial seminal plasma (55 ± 10.4 %). Highest post criopreservation movility (29.9 ± 13.3%) and highest fertility rates (26.33 ± 7.53 %) were obtained with dimetyhyl sulfoxide 10%.

  3. Estandarización del manejo y la criopreservación de semen de hembras masculinizadas de trucha arco iris (Oncorhynchus mykiss Padronizar a gestão ea criopreservação de sêmen de fêmeas de truta arco-íris (Oncorhynchus mykiss sob masculinização Standardization of handling and freezing sperm from masculinized females of rainbow trout (Oncorhynchus mykiss

    Directory of Open Access Journals (Sweden)

    James J Betancur L

    2008-09-01

    Full Text Available La demanda de líneas monosexo hembras en la producción de trucha ha incrementado significativamente en los últimos años, por lo que se han desarrollado tecnologías para estandarizar este proceso como el uso de semen de hembras genéticas sometidas a reversión sexual. El objetivo de la presente investigación fue estandarizar la maduración in vitro y la criopreservación de semen de hembras masculinizadas (neomachos XX de trucha arco iris (Oncorhynchus mykiss como estrategia para producir descendencias 100% hembras de reproductores colombianos. Para la obtención del semen los neomachos fueron sacrificados y el semen recuperado fue sometido a proceso de maduración con plasma seminal de machos normales o plasma seminal artificial. Para la criopreservación del semen se probaron los crioprotectores dimetilsulfóxido 10% y metanol 10%. En el experimento se evaluron la movilidad post maduración y post descongelación y la fertilidad del semen. El proceso de maduración tuvo un efecto significativo sobre el porcentaje de movilidad (pA procura de linhas monosexo fêmeas na produção de trutas tem aumentado significativamente nos últimos anos, de modo tecnologias foram desenvolvidas com a finalidade de padronizar este processo como o uso do esperma de genética feminina submetido a reversão sexual. O objectivo do presente inquérito foi para uniformizar a maturação in vitro e criopreservação de sêmen masculinização de fêmeas (neomachos XX trutas arco-íris (Oncorhynchus mykiss como uma estratégia para produzir descendentes de 100% do sexo feminino dos jogadores colombianos. Para a obtenção do esperma neomachos foram mortas e sêmen foi recuperado submetida a maturação processo normal de plasma seminal plasma seminal masculina ou artificiais. Para a criopreservação de sêmen foi testado crioprotectores dimethylsulphoxide 10% e 10% de metanol. O experimento foi evaluron mobilidade pós maturação e pós descongelamento e fertilidade do sêmen. O processo de maturação teve um efeito significativo sobre a porcentagem de mobilidade (pThe demand of monosex female stocks in production of trout has significantly increased during the past years, which has led to develop new technologies to standardize this process. The usage of semen of genetic females submitted to sexual reversion is a good choice. The objective of this research was to develop a methodology to mature in vitro and cryopreserved semen of sex-reversed rainbow trout (Oncorhynchus mykiss females as strategy to produce lineage 100% Colombian trout female. The semen was directly obtained from the gonads after its surgical extraction of the slaughtered individuals, later it was submitted to maturation process implementing seminal plasma of normal males and artificial plasma. The semen was cryopreserved in two extender dimetyhyl sulfoxide 10% and methanol 10%. Postmaturation, postcriopreservation movility and sperm fertility were evaluated. Maturation process had a significative effect on movility, the highest movility was obtained with artificial seminal plasma (55 ± 10.4 %. Highest post criopreservation movility (29.9 ± 13.3% and highest fertility rates (26.33 ± 7.53 % were obtained with dimetyhyl sulfoxide 10%.

  4. Criopreservação do sêmen ovino em meio diluente à base de água de coco em pó (ACP-102c) / Cryopreservation of ram semen in powdered coconut water (ACP-102c) based extender

    Scientific Electronic Library Online (English)

    José Maurício Maciel, Cavalcante; Oscar Oliveira, Brasil; Cristiane Clemente de Mello, Salgueiro; Carminda Sandra Brito, Salmito-Vanderley; José Ferreira, Nunes.

    2014-09-01

    Full Text Available O objetivo deste trabalho foi avaliar o diluente ACP-102c na criopreservação do sêmen ovino em comparação com o diluidor tris-glicose-gema (TRIS) e o sêmen fresco. Foram coletados 48 ejaculados de quatro ovinos, sendo tomadas duas alíquotas por ejaculado para diluição e criopreservação em ACP-102c o [...] u TRIS e uma terceira alíquota utilizada para análise do sêmen fresco. O sêmen fresco e o criopreservado em ambos os diluidores foram avaliados para viabilidade, integridade de membrana plasmática e acrossomal, teste hiposmótico, fragmentação do DNA e de motilidade espermática. Após descongelamento, ambos os diluidores não diferiram para viabilidade espermática, integridade de membrana plasmática e acrossomal, fragmentação de DNA e nas variáveis quantitativas e qualitativas de velocidade espermática, mas diferiram no teste hiposmótico, motilidade total e progressiva e amplitude lateral da cabeça, bem como em todas as variáveis de motilidade avaliadas, exceto linearidade e progressividade, após duas horas de incubação à 37 ºC. Houve variabilidade entre reprodutores na motilidade total e progressiva do sêmen criopreservado em ACP-102c após descongelamento. O diluidor ACP-102c conferiu menor proteção aos espermatozoides ovinos contra danos do congelamento quando comparado ao TRIS, mas o aprimoramento de sua formulação e protocolos mais adequados de congelação poderão torná-lo uma alternativa na congelação do sêmen ovino. Abstract in english The aim of this study was to evaluate the ACP-102c extender in the cryopreservation of ram semen compared to tris-glucose-egg yolk (TRIS) extender and fresh semen. Forty-eight ejaculates were collected from four rams and two aliquots per ejaculate were taken for dilution and cryopreservation in ACP- [...] 102c or TRIS and a third aliquot used for the fresh semen analysis. Either the fresh semen and cryopreserved in both extenders were evaluated for viability, integrity of plasma and acrosomal membrane, hypoosmotic swelling test, DNA fragmentation and sperm motility. The extenders did not differ for sperm viability, acrosome and plasma membrane integrity, DNA fragmentation and quantitative and qualitative parameters of sperm velocity after thawing, but differed in hypoosmotic swelling test, total and progressive motility and lateral extent of the head as well as in all motility parameters evaluated (except linearity and straightness) after two hours of incubation at 37 ºC. There was variability among rams in total and progressive motility of semen cryopreserved in ACP-102c after thawing. The ACP-102c extender showed less protection in the cryopreservation of ram sperm when compared to TRIS, but the improvement in its formulation and freezing protocols may make it an alternative to freezing ram semen.

  5. Short communication: Transmission of border disease virus to seronegative cows inseminated with infected semen.

    Science.gov (United States)

    Braun, U; Frei, S; Schweizer, M; Zanoni, R; Janett, F

    2015-06-01

    The goal of this study was to investigate the transmissibility of border disease (BD) virus to seronegative cows via artificial insemination with cryopreserved semen from a bull persistently infected with BD virus. Five pestivirus naive cows were inseminated with BD virus-infected semen. Blood was collected for detection of pestivirus antibody by means of an ELISA on day 0 (day of insemination) and then every 7 days until day 56, at which time a serum neutralisation test (SNT) for differentiation of BD and BVD virus was carried out. Seroconversion was first noticed in two cows on day 14, in two cows on day 21 and in one cow on day 28. In the SNT, all cows had distinctly positive titres against BD virus. Therefore, BD virus is readily transmitted by infected semen, but none of the cows conceived, most likely because of poor semen quality. PMID:25863814

  6. Semen quality: variations among fathers and effects of moderate alcohol drinking

    Science.gov (United States)

    Cooper, Trevor G

    2015-01-01

    Semen analysis results from over 750 fathers in the USA demonstrated marked differences in the quality of semen from men at different locations and of different ethnic groups. Another paper failed to demonstrate any effects of moderate alcohol consumption during the week before provision of an ejaculate on semen quality and few on serum hormones, of over 8300 men in Europe and the USA. While these observations are interesting, the reasons for regional and ethnic differences in semen quality of fathers are unclear. Although, there was no attempt to confirm the participant-provided level of alcohol consumption, an increase in serum testosterone in the men at the higher end of alcohol intake is compatible with an alcohol effect on liver metabolism, although whether alcohol intake was the cause of higher testosterone, or men with higher androgen levels consume more alcohol, is not known. PMID:25337846

  7. Semen quality: variations among fathers and effects of moderate alcohol drinking

    Directory of Open Access Journals (Sweden)

    Trevor G Cooper

    2015-02-01

    Full Text Available Semen analysis results from over 750 fathers in the USA demonstrated marked differences in the quality of semen from men at different locations and of different ethnic groups. Another paper failed to demonstrate any effects of moderate alcohol consumption during the week before provision of an ejaculate on semen quality and few on serum hormones, of over 8300 men in Europe and the USA. While these observations are interesting, the reasons for regional and ethnic differences in semen quality of fathers are unclear. Although, there was no attempt to confirm the participant-provided level of alcohol consumption, an increase in serum testosterone in the men at the higher end of alcohol intake is compatible with an alcohol effect on liver metabolism, although whether alcohol intake was the cause of higher testosterone, or men with higher androgen levels consume more alcohol, is not known.

  8. Lincomycin and spectinomycin in the treatment of breeding rams with semen contaminated with ureaplasmas.

    Science.gov (United States)

    Marcus, S; Ziv, G; Glickman, A; Ozbonfil, D; Bartoov, B; Klein, A

    1994-11-01

    Ureaplasma species were isolated from semen samples collected sequentially from one Awassi and three Assaf breeding rams. Each ram was injected subcutaneously with an aqueous solution of lincomycin and spectinomycin for five consecutive days at a dose equivalent to 4.5 mg kg-1 lincomycin and 9.0 mg kg-1 spectinomycin daily. Serum and semen samples were collected at intervals during the treatment and assayed for lincomycin. No Ureaplasma species were isolated from semen samples collected during the course of the treatment and at intervals for 17 days after the last treatment. The concentration of lincomycin in semen ranged from 0.51 microgram ml-1 four hours after treatment to 0.08 microgram ml-1 24 hours after treatment, and these levels were three to nine times higher than the corresponding serum concentrations. PMID:7871264

  9. THE RESULTS OF BITCH ARTIFICIAL INSEMINATION AFTER THE USE OF TESTED FROZEN SEMEN

    Directory of Open Access Journals (Sweden)

    K. KOSINIAK-KAMYSZ

    2013-12-01

    Full Text Available Many problems in dog reproduction concern both dog male, its behaviour andsemen quality as well as the bitch which are connected with physiological factors asa time oestrus cycle, anatomical structure of reproductive organs, sexual behaviourand ovulation moment. The results of bitches’ artificial insemination (AI with theuse of frozen semen are lower in comparison to raw semen. In connection with thisthe research work was performed with an idea of explanation of the problemconnected to low effect of the use of dog frozen semen for AI. It was found that it ispossible to receive more satisfactory results (about 75% of pregnancy rate whendog semen is testified on the base of sperm concentration and motility and alkalinephosphatase activity (AP. On the other side it is necessary to perform bitchesexamination based on cytological and hormonal testes which allows establishing thepernicious time for AI.

  10. Effect of Air Space in Storage Vials on Motility of Spermatozoa in Chilled Buck Semen

    Directory of Open Access Journals (Sweden)

    Magnus Paul K and Lali F Anand 1

    Full Text Available This study was conducted in order to find out the effect of air space on the top of glass vial in which semen is stored, on the motility of spermatozoa. 45 samples collected from two bucks over a span of 6 months were used for experiment. Goat milk extender was the diluent used. Two ml each of diluted semen after noting their initial motility was stored in 2 ml and 5 ml vials. Samples were stored at 5°C and motility of spermatozoa noted at 24 and 48 hours. Semen without air space was found to preserve the motility better than semen with air space on 24 and 48 hours of incubation. This could be better attributed to reactive oxygen species production by the spermatozoa, but further investigation is needed in this aspect to confirm it. [Veterinary World 2010; 3(9.000: 421-423

  11. The Effect of Shelter on Semen Quality of “Peranakan Ettawa” Goat

    Directory of Open Access Journals (Sweden)

    A Qisthon

    2007-05-01

    Full Text Available The experiment was conducted to study the effect of shelter on semen quality of Peranakan Ettawa (PE Goats Eight PE goats were allocated into cross over design. Four PE goats were placed under no shelter (09.00-14.30 and another one was placed under shelter. The results of this research showed that semen volume, sperm motility, sperm concentration, and live sperm percentage of PE goat under shelter were higher (P<0.01 than those of PE goat under no shelter. On the other hand, sperm abnormality of PE goat under shelter was lower (P<0.01 than that of PE goat under no shelter. It was concluded that the use of shelter could improve semen quality. (Animal Production 9(2: 73-78 (2007 Key Words : Shelter, semen, goat

  12. Cryopreservation of tambaqui (Colossoma macropomum) semen: extenders, cryoprotectants, dilution ratios and freezing methods.

    Science.gov (United States)

    Carneiro, P C F; Azevedo, H C; Santos, J P; Maria, A N

    2012-01-01

    The tambaqui is an Amazonian fish of great economic and environmental importance to Brazil and other South American countries. Several semen cryopreservation methodologies have been tested for different Brazilian fish species; however, there is little information on the use of this technique on tambaqui semen. The aim of the present study was to investigate the effect of osmolarity and activation solutions on sperm kinetics and, glucose solutions, cryoprotectants, dilution ratios, egg yolk and freezing methods on tambaqui semen freezing. The osmolarity of 230 mOsm was suitable for simultaneously yielding higher sperm motility (85%) and motility time (54 sec.) and osmolarities above 360 mOsm maintain immobile tambaqui sperm. The tambaqui semen can be successfully cryopreserved when diluted 1:9 in freezing medium composed of 5 percent glucose solution (290 mOsm) with 10 percent methylglycol and 5 percent egg yolk, and frozen directly in a dry shipper container. PMID:23224371

  13. THE RESULTS OF BITCH ARTIFICIAL INSEMINATION AFTER THE USE OF TESTED FROZEN SEMEN

    Directory of Open Access Journals (Sweden)

    BITTMAR A.

    2007-01-01

    Full Text Available Many problems in dog reproduction concern both dog male, its behaviour andsemen quality as well as the bitch which are connected with physiological factors asa time oestrus cycle, anatomical structure of reproductive organs, sexual behaviourand ovulation moment. The results of bitches’ artificial insemination (AI with theuse of frozen semen are lower in comparison to raw semen. In connection with thisthe research work was performed with an idea of explanation of the problemconnected to low effect of the use of dog frozen semen for AI. It was found that it ispossible to receive more satisfactory results (about 75% of pregnancy rate whendog semen is testified on the base of sperm concentration and motility and alkalinephosphatase activity (AP. On the other side it is necessary to perform bitchesexamination based on cytological and hormonal testes which allows establishing thepernicious time for AI.

  14. The Effect of Phyto-Lecithin on Preservation and Cryopreservation of Semen: A Review

    Directory of Open Access Journals (Sweden)

    AS Aku

    2007-01-01

    Full Text Available Artificial insemination represents one of technologies in livestock reproduction that can be applied to cattle, sheep, goats and other livestock. Application of livestock reproduction technology includes artificial insemination to increase reproductive efficiency. Semen processing is one critical phase in an artificial insemination program. The use of animal origin ingredient for semen extenders, such as egg yolk and milk, presents a risk of microbial contamination, which lead to the search for alternatives. To increase standard of quality, researchers exploits phyto-lesitin for semen extender and the results showed no significant differences in motility, viability, and acrosomal status of spermatozoa with phyto-lesitin extender when compared to tris-egg yolk-containing extenders. (Animal Production 9(1: 49-52 (2007 Key Words : Phyto-Lechitin, preservation, cryopreservation, semen

  15. Exposure to perfluorinated compounds and human semen quality in arctic and European populations

    DEFF Research Database (Denmark)

    Toft, Gunnar; Jönsson, B A G

    2012-01-01

    Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality.

  16. Exposure to perfluorinated compounds and human semen quality in Arctic and European populations

    DEFF Research Database (Denmark)

    Toft, G; Jönsson, B A G

    2012-01-01

    Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality.

  17. Reproductive toxicity of chromium in adult bonnet monkeys (Macaca radiata Geoffrey). Reversible oxidative stress in the semen

    International Nuclear Information System (INIS)

    The present study was designed to test the hypothesis that oxidative stress mediates chromium-induced reproductive toxicity. Monthly semen samples were collected from adult monkeys (Macaca radiata), which were exposed to varying doses (50, 100, 200 and 400 ppm) of chromium (as potassium dichromate) for 6 months through drinking water. Chromium treatment decreased sperm count, sperm forward motility and the specific activities of antioxidant enzymes, superoxide dismutase and catalase, and the concentration of reduced glutathione in both seminal plasma and sperm in a dose- and duration-dependent manner. On the other hand, the quantum of hydrogen peroxide in the seminal plasma/sperm from monkeys exposed to chromium increased with increasing dose and duration of chromium exposure. All these changes were reversed after 6 months of chromium-free exposure period. Simultaneous supplementation of vitamin C (0.5 g/L; 1.0 g/L; 2.0 g/L) prevented the development of chromium-induced oxidative stress. Data support the hypothesis and show that chronic chromium exposure induces a reversible oxidative stress in the seminal plasma and sperm by creating an imbalance between reactive oxygen species and antioxidant system, leading to sperm death and reduced motility of live sperm

  18. The importance of semen analysis in the context of azoospermia

    Scientific Electronic Library Online (English)

    Nabil, Aziz.

    Full Text Available Azoospermia is a descriptive term referring to ejaculates that lack spermatozoa without implying a specific underlying cause. The traditional definition of azoospermia is ambiguous, which has ramifications on the diagnostic criteria. This issue is further compounded by the apparent overlap between t [...] he definitions of oligospermia and azoospermia. The reliable diagnosis of the absence of spermatozoa in a semen sample is an important criterion not only for diagnosing male infertility but also for ascertaining the success of a vasectomy and for determining the efficacy of hormonal contraception. There appears to be different levels of rigor in diagnosing azoospermia in different clinical situations, which highlights the conflict between scientific research and clinical practice in defining azoospermia.

  19. Semen characteristics of goats with subacute, acute and chronic besnoitiosis : research communication

    OpenAIRE

    M.J. Njenga; Munyua, S.J.M.; E.R. Mutiga; Gathuma, J M; E.K. Kang’ethe; O. Bwangamoi; Mugera, G. M.; Mitaru, B N

    2012-01-01

    A study on the semen obtained from breeding goats suffering from mild to severe chronic besnoitiosis revealed marked changes in semen volume, colour, density, concentration, mass and individual motility and percentage live. There were also many neutrophils and spermatozoa with primary and secondary defects, including missing tails and deformed heads and tails. The observed changes were considered to be severe enough to account for the infertility observed in the flock. Sections of testes obta...

  20. Male Fertility and Reduction in Semen Parameters: A Single Tertiary-Care Center Experience

    OpenAIRE

    Milardi, D.; Grande, G.; Sacchini, D.; Astorri, A. L.; Pompa, G.; Giampietro, A.; Marinis, L.; Pontecorvi, A.; Spagnolo, A. G.; Marana, R.

    2012-01-01

    Background. Infertility is both a clinical and a public problem, affecting the life of the couple, the healthcare services, and social environment. Standard semen analysis is the surrogate measure of male fertility in clinical practice. Objective. To provide information about the relationship between semen parameters and spontaneous conception. Methods. We evaluated retrospectively 453 pregnancies that occurred among 2935 infertile couples evaluated at an infertility clinic of a tertiary-...

  1. EFFECT OF TWO DIFFERENT ANTIBIOTIC COMBINATIONS ON FERTILITY OF FROZEN BUFFALO AND SAHIW AL BULL SEMEN

    OpenAIRE

    S M H Andrabi, N. Ahmad

    2001-01-01

    This study was carried out to identify the suitable antibiotic combinations in semen extender for improvement in fertility of frozen semen of buffalo and cow (Sahiwal) bulls to obtain better pregnancy rate through artificial insemination (AI). For this study eight first ejaculates, four each from a buffalo and a cow (Sahiwal) bull were used. The ejaculates were split-sampled and diluted with Tris-citric acid extender (at 37°C; 50x 106 spermatozoa/mI), containing either SP (streptomycin 1000 ...

  2. Evaluation of semen quality in 1808 university students, from Wuhan, Central China.

    Science.gov (United States)

    Rao, Meng; Meng, Tian-Qing; Hu, Si-Heng; Guan, Huang-Tao; Wei, Qin-Yu; Xia, Wei; Zhu, Chang-Hong; Xiong, Cheng-Liang

    2015-01-01

    The aim of this study was to evaluate the semen quality of university students in Wuhan, the largest city in the world in terms of the number of university students. All student sperm donors recorded in the Hubei Province Human Sperm Bank from 1 March 2010 to 31 December 2013 were screened. At last, a total of 3616 semen samples from 1808 university student sperm donors were eligible and retrospectively analyzed. Each donor's semen parameters were averaged over two samples and compared with the World Health Organization criteria, and a generalized linear regression model was used to examine several determinants of semen quality. We found that the mean and median values were 3.0 ml and 2.8 ml for semen volume, 50.2 × 10 6 ml-1 and 50.0 × 10 6 ml-1 for sperm concentration, 148.1 × 10 6 and 142.1 × 10 6 for total sperm count, and 58.6% and 60.0% for total sperm motility. About 85.0% of donors had parameters that were all normal. Season and duration of abstinence were critical factors affecting semen quality. We also found a decrease in sperm concentration during the 4 years observation; however, this may not be a strong evidence to confirm the declining trend of semen quality. In conclusion, semen quality of university students in Wuhan was not optimal and should be paid high attention, long-term observation and further study should be carried out to confirm the present situation. PMID:25337834

  3. Effects of Thawing on Frozen Semen Quality of Limousin and Brahman Bulls

    OpenAIRE

    wc Pratiwi; L Affandhy; D Ratnawati

    2009-01-01

    The success of Artificial Insemination (AI )influenced by many factor, there are nutrition, body condition and post thawing motility (PTM). The PTM influenced by liquid N2 storage, equilibration temperature and handling straw. The purpose of this research to compare the effect of thawing duration to frozen semen quality of Limousin and Brahman. This research was done in BIBD, Agriculture Official of Blora, Central Java and Laboratory of Beef Cattle Station Research, Grati. As semen source is ...

  4. Efecto del estrés oxidativo sobre la calidad del semen de pacientes infértiles con leucocitospermia

    Directory of Open Access Journals (Sweden)

    William Quintero Pérez

    2000-12-01

    Full Text Available La leucocitospermia se ha asociado con alteraciones de la calidad del semen. No obstante no se han precisado con exactitud los mecanismos implicados en este daño. El propósito de este trabajo fue conocer si la leucocitospermia así como su contribución al estrés oxidativo generado en el aparato reproductor pueden afectar la calidad del semen. Para esto se estudió una muestra de 52 pacientes, hombres miembros de parejas infértiles que acudieron a la consulta de infertilidad del Instituto Nacional de Endocrinología, en los años 1998 y 1999. Se les realizó el análisis seminal según los procedimientos habituales y además la determinación de malonildialdehído, catalasa y superóxido dismutasa. La actividad superóxido dismutasa se correlacionó negativamente con el número de leucocitos, y positivamente con la movilidad b y la movilidad a + b. El trabajo realizado permitió concluir que los leucocitos en semen pueden afectar el balance entre los factores que favorecen y los que previenen el estrés oxidativo. La protección contra el estrés oxidativo es beneficiosa para la calidad del semenLeucocytospermia has been associated with alterations of the quality of semen. However, the mechanisms involved in this damage have not been exactly determined yet. This paper was aimed at knowing whether leucocytospermia and its contribution to the oxidative stress generated in the reproductive system may affect the quality of semen. To this end, a sample of 52 male patients members of infertile couples that were attended in the department of infertility of the National Institute of Endocrinology, in 1998 and 1999, was studied. The semen was analyzed according to the habitual procedures. Malondialdehyde, catalase and superoxide dismutase were also determined. The superoxide dismutase activity was negatively correlated to the number of leucocytes and positively to the mobility b and the mobility a+ b. It was concluded that leucocytes may affect the balance between the factors that favor and prevent the oxidative stress. The protection against the oxidative stress is beneficial for the quality of semen

  5. Efecto del estrés oxidativo sobre la calidad del semen de pacientes infértiles con leucocitospermia

    Scientific Electronic Library Online (English)

    William, Quintero Pérez; Lorenzo, Mallea Sánchez; Ada J, Machado Curbelo; Niurka, Llópiz Janer; Ela, Céspedes Miranda; Giselle, Monzón Benítez; Sanda, Yepes Oliveros.

    2000-12-01

    Full Text Available La leucocitospermia se ha asociado con alteraciones de la calidad del semen. No obstante no se han precisado con exactitud los mecanismos implicados en este daño. El propósito de este trabajo fue conocer si la leucocitospermia así como su contribución al estrés oxidativo generado en el aparato repro [...] ductor pueden afectar la calidad del semen. Para esto se estudió una muestra de 52 pacientes, hombres miembros de parejas infértiles que acudieron a la consulta de infertilidad del Instituto Nacional de Endocrinología, en los años 1998 y 1999. Se les realizó el análisis seminal según los procedimientos habituales y además la determinación de malonildialdehído, catalasa y superóxido dismutasa. La actividad superóxido dismutasa se correlacionó negativamente con el número de leucocitos, y positivamente con la movilidad b y la movilidad a + b. El trabajo realizado permitió concluir que los leucocitos en semen pueden afectar el balance entre los factores que favorecen y los que previenen el estrés oxidativo. La protección contra el estrés oxidativo es beneficiosa para la calidad del semen Abstract in english Leucocytospermia has been associated with alterations of the quality of semen. However, the mechanisms involved in this damage have not been exactly determined yet. This paper was aimed at knowing whether leucocytospermia and its contribution to the oxidative stress generated in the reproductive sys [...] tem may affect the quality of semen. To this end, a sample of 52 male patients members of infertile couples that were attended in the department of infertility of the National Institute of Endocrinology, in 1998 and 1999, was studied. The semen was analyzed according to the habitual procedures. Malondialdehyde, catalase and superoxide dismutase were also determined. The superoxide dismutase activity was negatively correlated to the number of leucocytes and positively to the mobility b and the mobility a+ b. It was concluded that leucocytes may affect the balance between the factors that favor and prevent the oxidative stress. The protection against the oxidative stress is beneficial for the quality of semen

  6. CONTRIBUTIONS ON THE ATTENUATE OF THE CRYOGENICS RESPONSE OF CONSTITUENTS PROTEINS HOMEOSTASIS OF THE SEMEN MATERIAL

    Directory of Open Access Journals (Sweden)

    VERA GRANACI

    2013-12-01

    Full Text Available The evidence of cryogenics response of the semen proteins, the influence of BioR administration on homeostasis of constituent gametes proteomics and on the cryobiological indexes of bull semen material was studded. The investigation has been performed on bulls from the Black Spotted breed of Moldavian type, maintained during the investigation in adequate conditions from the point of view of microclimate and fodder. The biopreparation administration have been done daily during 10 days in volume of 0,2 ml/100 kg living mass/day. Structural proteins of gametes posed the resistance given the influence of ultra low temperature (-196°C, content of totals proteins in the bull semen material denote no difference between the value of this parameter in the raw and cry preserved-thawed bull gametes. Both, in the raw and thawed semen cells the most rate occupy the hydrophilic proteins, After semen conservation-thawing process, it was observed a tendency of the diminution of hydrophilic proteins (- 3,35% and an increase of the basophilic proteins (+ 2,78 %. In the raw gametes prevail ?-globulins rate; conservation and thawing process of the semen material was associated by an increase of the albumins rate (+ 34,63% in semen cells; the rate of other three proteomic fractions: ?-, ? - and ?-globulins was decreased given theirs value registered in raw gametes. After the intramuscular administration of BioR preparation during 10 days on the sire bulls have been certified any modification of the studded proteomic fractions rate in thawed bull semen cells; albumins rate was decreased with 30,14%, the ?- globulins rate was increased with 19,28% in the experimental group; the ?- and ?- globulins with 8,5% and 2,36%, respectively, given control group. The BioR has an evident influence on the cryobiological specifics features of spermatozoids, such as the seminal cells mobility, the longevity and the survival absolutly index what are intensely influenced.

  7. Effects of Stripping Frequency on Semen Quality of Endangered Caspian Brown Trout, Salmo trutta caspius

    Directory of Open Access Journals (Sweden)

    Saeed Hajirezaee

    2009-01-01

    Full Text Available Problem statement: Because of dramatic declines in stocks of endangered Caspian brown trout males, Salmo trutta caspius in Caspian Sea, each male brooder is stripped indispensably more than once during the spawning season in other to artificial insemination in hatchery. The aim of the present study was to assay the changes of indicators of semen quality (sperm motility, sperm production, semen volume and chemical composition of seminal fluid during these sequential strippings. Approach: The 11 tagged males were stripped four times every 12-14 days with beginning of spermiation period (2 December 2008 towards its end (10 January 2008. One-way Analysis Of Variance (ANOVA was employed to analyze differences between means of semen parameters. Also, the relationships between semen parameters were tested using the bivariate correlation coefficients of Pearson. Results: The semen volume, sperm density, osmolality and the concentrations of Na+, Cl-, K+, Ca2+, Mg2+ and total protein gradually decreased whereas the values of glucose and triglyceride had no significant changes during sequential strippings. Also, the values of semen pH, the percentage (5s post-activation and duration of motility were statistically stable until third stripping but a decrease was recorded for these parameters in the fourth stripping. As well as, significant positive correlations were found for sperm density vs. K+, Cl-, Na+, Ca2+, Mg2+, total protein, spermatocrit; the percentage of motile spermatozoa Vs Ca2+, Mg2+, K+, Cl-, Na+, total protein and also the duration of motility Vs K+, Cl-, total protein and pH. Conclusion: The semen quality of Caspian brown trout males decrease in successive strippings during spawning season. Also, the knowledge on values and correlations between the sperm motility characteristics and the composition of seminal fluid could be useful to formulation of a species-specific extender solution for cryopreservation of semen of Caspian brown trout.

  8. Possible negative effects of inbreeding on semen quality in Shetland pony stallions

    OpenAIRE

    P. van Eldik; Waaij, E.H., van der; Ducro, B.J.; Kooper, A.W.; Stout, T.A.E.; Colenbrander, B

    2006-01-01

    Inbreeding is widely believed to negatively affect reproductive performance. Indeed, in some species, high levels of inbreeding are thought to be the major cause of poor semen quality. It is, however, not clear whether inbreeding affects fertility in horses. In this study, the relationship between inbreeding and semen quality was examined in 285 immature Shetland pony stallions submitted for breeding soundness examination in March-April of the years 1992-1997. The majority of stallions examin...

  9. Fertility of frozen-thawed stallion semen cannot be predicted by the currently used laboratory methods

    OpenAIRE

    Koskinen E; Andersson M; Kuisma P; Katila T

    2006-01-01

    Abstract The aim of the project was to use current simple and practical laboratory tests and compare results with the foaling rates of mares inseminated with commercially produced frozen semen. In Exp. 1, semen was tested from 27 and in Exp. 2 from 23 stallions; 19 stallions participated in both experiments. The mean number of mares per stallion in both experiments was 37 (min. 7, max. 121). Sperm morphology was assessed and bacterial culture performed once per stallion. In Exp. 1, progressiv...

  10. The Effect of Shelter on Semen Quality of “Peranakan Ettawa” Goat

    OpenAIRE

    A Qisthon; S Suharyati

    2007-01-01

    The experiment was conducted to study the effect of shelter on semen quality of Peranakan Ettawa (PE) Goats Eight PE goats were allocated into cross over design. Four PE goats were placed under no shelter (09.00-14.30) and another one was placed under shelter. The results of this research showed that semen volume, sperm motility, sperm concentration, and live sperm percentage of PE goat under shelter were higher (P

  11. Estudio preliminar de colección de semen en oso de anteojos (Tremarctos ornatus)

    Scientific Electronic Library Online (English)

    Marco, Enciso H; Lizette, Bermúdez L.; Shirley, Evangelista V; Gianmarco, Rojas M.; Wilfredo, Huanca L..

    2006-01-01

    Full Text Available [...] Abstract in english Semen was collected in a Spectacled Bear (Tremarctos ornatus) reared in captivity using the electroejaculation technique. Four series of 6 volt discharges by 15 seconds each plus manual stimulation were carried out. An effective penis erection and small volume of ejaculate was obtained in the last s [...] eries of electrical stimulus. Seminal motility was 50%. Further studies are required to optimize the use of the electroejaculator in order to obtain higher volumes and better semen quality.

  12. Complications and the effect of varicocelectomy on semen analysis, fertility, early ejaculation and spontaneous abortion

    OpenAIRE

    Shamsa Ali; Nademi M; Aqaee M; Fard A; Molaei Mahmood

    2010-01-01

    Varicocele is still an enigma. Its effects on semen analysis, fertility and, more re-cently, early ejaculation and spontaneous abortion in spouses are not yet fully understood. In this retrospective study, we evaluated these four parameters (semen analysis, fertility, early ejacu-lation and spontaneous abortion among spouses) in relation to varicocele and varicocelectomy during a 13-year period. A total of 1,711 patients with varicocele underwent varicocelectomy by high inguinal method (251 c...

  13. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki: A preliminary study

    Directory of Open Access Journals (Sweden)

    M.S. Khairiah

    2012-10-01

    Full Text Available The Malayan gaur (Bos gaurus hubbacki or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN. The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM and electroejaculation (EEJ technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur.

  14. Effects of Thawing on Frozen Semen Quality of Limousin and Brahman Bulls

    Directory of Open Access Journals (Sweden)

    wc Pratiwi

    2009-01-01

    Full Text Available The success of Artificial Insemination (AI influenced by many factor, there are nutrition, body condition and post thawing motility (PTM. The PTM influenced by liquid N2 storage, equilibration temperature and handling straw. The purpose of this research to compare the effect of thawing duration to frozen semen quality of Limousin and Brahman. This research was done in BIBD, Agriculture Official of Blora, Central Java and Laboratory of Beef Cattle Station Research, Grati. As semen source is bull of Limousin and Brahman with age 2-3 years, body weight + 1200 kg. The data was observed such as: (1 pH, (2 Motility, (3 Live sperm, (4 Abnormality. The research use Randomized Complete Design (RCD one way there are time of thawing 0, 15, 30, 45 minutes with 10 time repetition. The result of this research showed that the highest motility and live sperm (P<0,05 at the treatment with the duration of thawing 0 minute, there are 41,50% and 66,50% (Limousin frozen semen; 40,00% and 39,58% (Brahman frozen semen. It was concluded that shortening the time of thawing could be repairing the PTM and S/C value. (Animal Production 11(1: 48-52 (2009 Key Words : semen quality, frozen semen, thawing

  15. Escitalopram treatment for premature ejaculation has a negative effect on semen parameters.

    Science.gov (United States)

    Koyuncu, H; Serefoglu, E C; Yencilek, E; Atalay, H; Akbas, N B; Sar?ca, K

    2011-01-01

    The aim of this study was to determine the impact of long-term escitalopram treatment on semen parameters of patients with lifelong premature ejaculation (PE). Between November 2008 and January 2010, patients admitted to urology outpatient clinic with a self-reported complaint of PE were evaluated. Medical and sexual history of patients were recorded and patients with lifelong PE (a total of 25 patients) who met the International Society of Sexual Medicine definition were asked to record their intravaginal ejaculatory latency time (IELT) for 1 month, complete Premature Ejaculation Diagnostic Tool (PEDT) questionnaire and give semen samples. Afterwards, patients received 10 mg escitalopram daily for 12 weeks and were invited for control visits at first and third month of treatment. During control visits, PEDT was administered again whereas IELTs were recorded and semen samples were re-examined. PEDT scores, arithmetic means of IELTs and results of semen analyses, which were recorded at baseline, first and third month were compared. At the third month of treatment, a significant increase in mean IELTs and a significant decrease in PEDT scores were detected. However there was a significant decrease in sperm concentration, motility and morphology when compared with the baseline semen measures. Daily escitalopram treatment effects the semen parameters of patients with lifelong PE. Further investigations with larger series are needed to see whether other serotonin reuptake inhibitors have similar side effects and to expose the exact mechanism underlying it. Different treatment modalities should be suggested to patients who desire fertility. PMID:21776003

  16. A commercial box for dog semen transport: What happens inside when the environmental temperature is increasing?

    Science.gov (United States)

    Cunha, I C N; Henning, H; Urhausen, C; Beyerbach, M; Günzel-Apel, A R

    2014-06-10

    Environmental temperatures may influence the temperature inside commercial transport boxes during semen shipment and thereby storage conditions of diluted dog semen. To evaluate the temperature changes inside boxes and their influence on sperm quality, split semen samples (n=8) were placed in Neopor boxes(®) exposed for 48h to room temperature (RT) (Box 1), 40°C for 6h and then kept at RT (Box 2) or 40°C (Box 3). A fourth subsample was kept at 4-5°C in a refrigerator (control). Inside Box 1 temperature initially decreased to Analysis of sperm motility (CASA) and viability (PI and FITC-PNA) after 24 and 48 h revealed marked sensitivity of dog spermatozoa to temperature fluctuations (Box 1). A constant storage temperature of 7-8°C (Box 2) provided the most desirable semen quality in terms of motility, viability, as well as osmotic resistance when samples were stored for 48 h. Furthermore, results indicate that during 24h preservation a storage temperature of 14-16°C may provide optimum conditions for maintenance of sperm viability and function. An increase of the inside temperature to >30°C (Box 3) resulted in an almost complete loss in sperm integrity. In conclusion, results suggest a revision of current recommendations for storage temperature of diluted dog semen. Boxes for semen transport should be prepared depending on the expected environmental temperatures. PMID:24794446

  17. Investigation the Effects of Dietary L-Carnitine Supplementation on Characteristics of Rooster Semen During Liquid Storage

    OpenAIRE

    Ahangari, Y. J.; Parizadian, B.; Zamani, M.

    2011-01-01

    The objective of present study was to investigate the effects of various levels of dietary L carnitine supplementation (0, 125, 250 and 500 mg kg?1) on rooster semen characteristics during liquid storage. Semen were collected from 16 rooster using abdominal massage and suitable samples were mixed together and sperm characteristics including percentage of motile, viable, abnormal, semen pH, volume and concentration were assessed. This experiment was carried out on the basis of complete...

  18. The Effect of Glycerolisation Time on the Sperm Motility of Local Ram Frozen Semen Diluted in Tris Egg Yolk Extender

    OpenAIRE

    Laswardi Yusuf, T.; Ri, Arifiantini; Mulyadi, Y.

    2006-01-01

    The aims of this experiment was to obtain the effects of different time of glycerolisation on the quality of frozen ram semen diluted in Tris Egg Yolk (TEY). Semen from seven sexually mature local rams were collected using artificial vagina weekly, evaluated macroscopically and microscopically. Good quality semen then diluted with TEY and 6% glycerol added in three different periods. The first step was diluted in room temperature ( treatment 1), the second glycerolisation was at the en...

  19. Viability and fertility of cooled equine semen diluted with skimmed milk or glycine egg yolk-based extenders

    Scientific Electronic Library Online (English)

    Guilherme, Pugliesi; Giovanni Ribeiro de, Carvalho; Daniel Macêdo, Rates; Pedro Gama, Ker; Manuela Pereira da, Matta; Renan Reis de, Oliveira; José Monteiro da, Silva Filho.

    2411-24-01

    Full Text Available Two semen extenders were compared for their ability to maintain viability of horse semen during 24 hours of cold preservation, and for the pregnancy rate after artificial insemination. In the experiment 1, five ejaculates from three stallions were split-diluted in either a skimmed milk-based extende [...] r (Kenney extender) or a glycine egg yolk-based extender (Foote extender) and cooled at 6-8 ºC for 24 hours. Semen samples stored in Kenney extender for 24 hours had higher motility and spermatic vigor compared with those stored in Foote extender. However, samples stored in Foote extender had higher number of reactive sperm by hypoosmotic test and greater viability by epifluorescence test compared with those in Kenney extender. In the experiment 2, 17 and 23 ejaculates from two stallions were split-diluted with Kenney extender and Foote extender. The sperm concentration in each extender was adjusted to 500 million viable sperms per insemination dose. Semen was cooled to 6-8 ºC and stored for 24 hours. Seventy-four cycles of crossbred mares were inseminated with either semen diluted in Kenney extender or semen diluted in Foote extender. The pregnancy rate was higher from semen diluted in Kenney extender than that from semen in Foote extender (0.553 vs. 0.306). The Kenney extender is effective in preserving the motility, vigor and fertility of stallion semen after 24 hours of cold storage, whereas the Foote extender is not acceptable.

  20. Viability and fertility of cooled equine semen diluted with skimmed milk or glycine egg yolk-based extenders

    Directory of Open Access Journals (Sweden)

    Guilherme Pugliesi

    2012-12-01

    Full Text Available Two semen extenders were compared for their ability to maintain viability of horse semen during 24 hours of cold preservation, and for the pregnancy rate after artificial insemination. In the experiment 1, five ejaculates from three stallions were split-diluted in either a skimmed milk-based extender (Kenney extender or a glycine egg yolk-based extender (Foote extender and cooled at 6-8 ºC for 24 hours. Semen samples stored in Kenney extender for 24 hours had higher motility and spermatic vigor compared with those stored in Foote extender. However, samples stored in Foote extender had higher number of reactive sperm by hypoosmotic test and greater viability by epifluorescence test compared with those in Kenney extender. In the experiment 2, 17 and 23 ejaculates from two stallions were split-diluted with Kenney extender and Foote extender. The sperm concentration in each extender was adjusted to 500 million viable sperms per insemination dose. Semen was cooled to 6-8 ºC and stored for 24 hours. Seventy-four cycles of crossbred mares were inseminated with either semen diluted in Kenney extender or semen diluted in Foote extender. The pregnancy rate was higher from semen diluted in Kenney extender than that from semen in Foote extender (0.553 vs. 0.306. The Kenney extender is effective in preserving the motility, vigor and fertility of stallion semen after 24 hours of cold storage, whereas the Foote extender is not acceptable.

  1. Características Bioquímicas del Plasma Seminal Fresco y Congelado/Descongelado de Alpaca (Vicugna pacos) / Biochemical characteristics of fresh and freeze/thawed seminal plasma of alpaca (Vicugna pacos)

    Scientific Electronic Library Online (English)

    Hugo, Díaz V; Juan, Espinoza B; Wilfredo, Huanca L; Bernardo, Lopez-Torres; José, Rodríguez G.

    2015-01-01

    Full Text Available El objetivo del estudio fue determinar y comparar las características bioquímicas del plasma seminal de alpacas en fresco y descongelado. Se recolectó semen, mediante electroeyaculación, de cuatro alpacas adultas, una vez por semana por cuatro semanas. El semen se centrifugó y el plasma seminal fue [...] separado. Una parte se analizó en fresco y la otra parte se almacenó en nitrógeno líquido por un mes. Se le hizo el análisis bioquímico a ambos juegos de muestras. Se determinaron los niveles de glucosa, colesterol total, colesterol-HDL, triglicéridos, proteínas totales, albúmina, calcio, fosfatasa alcalina, ALT y ?-GT. Solo los valores de triglicéridos descendieron significativamente por el proceso de congelación/descongelación (p Abstract in english The aim of this study was to determine and compare the biochemical characteristics of fresh and thawed seminal plasma of alpacas. Semen was collected by electroejaculation from four adult males, once a week per four weeks. Semen was centrifuged and the seminal plasma was separated. One part was anal [...] ysed fresh and other stored for one month on liquid nitrogen and then thawed and analysed. Levels of glucose, total cholesterol, HDL-cholesterol, triglycerides, total protein, albumin, calcium, alkaline phosphatase, ALT and ?-GT were determined. Only the triglycerides significantly decreased due to the process of freeze/thawed, where the values were 44.12 ± 7.38 and 27.31 ± 4.65 mg/dl in fresh and thawed respectively.

  2. The effect of mark enhancement techniques on the subsequent detection of semen/spermatozoa.

    Science.gov (United States)

    Simmons, Rory; Deacon, Paul; Phillips, Darren J; Farrugia, Kevin

    2014-11-01

    Fingermarks, footwear marks, blood and semen are amongst the most commonly encountered types of evidence at crime scenes. Previous work has extensively investigated fingermark and blood enhancement techniques and a sequence developed to maximise evidence recovery; however, there is limited research as to the effect of these techniques on the subsequent detection of body fluids such as semen. In this study, seven fingermark and blood enhancement techniques (e.g. powder suspension, cyanoacrylate fuming and acid violet 17) were employed followed by the subsequent detection of semen/spermatozoa. Other variables included in the study were the use of two substrates (white ceramic tiles and grey laminate flooring), a depletion series and ageing periods of 1, 7, 14 and 28 days. The effect these techniques had on the subsequent detection of semen was assessed by visual and fluorescence examination followed by presumptive and confirmatory testing for semen and spermatozoa. The results found that protein stains (acid violet 17 and acid yellow 7) caused a loss in presumptive test reactivity; however, sperm heads were still observed using microscopic examination after extraction and staining. The use of black magnetic powder, Bluestar(®) Forensic Magnum luminol, Lumicyano™ 4% and cyanoacrylate fuming followed by basic yellow 40 staining did not hinder subsequent presumptive and confirmatory tests for semen and sperm heads. Powder suspension caused a loss in both presumptive test reactivity and sperm heads from the substrate. In general, the enhancement techniques resulted in the improved visualisation of the semen stains under white and violet/blue light. The results from this study aim to provide a strategy to maximise evidence recovery and improve efficiency in an integrated forensic approach. PMID:25277520

  3. Seminal traits, suitability for semen preservation and fertility in the native Portuguese horse breeds Puro Sangue Lusitano and Sorraia: Implications for stallion classification and assisted reproduction

    OpenAIRE

    Gamboa, Sandra; Machado-faria, Manuel; Ramalho-santos, Joa?o

    2008-01-01

    The Puro Sangue Lusitano (PSL) is the major national breed of horse in Portugal, but no studies exist on its seminal characteristics, or on the possibility of conserving semen for future use. The aim of this study was to evaluate semen parameters, fertility and the aptness to semen preservation in Lusitano Stallions. In order to compare characteristics defined by a single or by multiple semen collections per stallion 152 ejaculates obtained from 152 Lusitano stallions presented at an annual b...

  4. Efecto de tres dilutores en la conservación del semen de alpacas

    Scientific Electronic Library Online (English)

    Fernando, Raymundo T.; Wilfredo, Huanca L.; Teodosio, Huanca M.; Sandra, Huerta O.; Aída, Cordero R.

    2006-07-01

    Full Text Available El presente trabajo tuvo el propósito de evaluar la eficiencia de tres dilutores: Tris-glucosa, Tris-fructosa y un dilutor comercial de cerdo, en la conservación del semen de alpaca. Se utilizaron 12 machos que fueron entrenados por un mes en la colección de semen con vagina artificial y frazadilla [...] eléctrica. Los animales fueron de la Sub-Estación Experimental Quimsachata del INIA, Puno. El semen tuvo las siguientes características: volumen de 2.7 ± 0.8 ml, viscosidad de 1.04 ± 0.3, motilidad de 54.0 ± 8.0%, pH con tendencia a la alcalinidad, concentración de 248,100 espermatozoides/ml, y el color que predominó fue el blanco lechoso. El tiempo promedio de cópula fue de 26.5 ± 3.8 minutos. Se utilizó un factor de dilución de 1 en 2 para semen y dilutor, respectivamente. Las diluciones fueron evaluadas considerando la motilidad individual como único parámetro para determinar la viabilidad espermática. El dilutor Tris-glucosa mostró una viabilidad promedio de 5.8 ± 1.1 horas, el Tris-fructosa de 6.1 ± 2.5 horas y el dilutor comercial de cerdo de 5.5 ± 1.0 horas, sin haber diferencia estadística significativa entre dilutores. Abstract in english The present work was carried out at the Experimental Research Station Quimsachata-INIA, Puno. The objective was to evaluate the efficiency of three semen extenders in alpaca semen: Tris-glucose, Tris-fructose and a pig´s commercial extender. Twelve animals were selected for semen collection using th [...] e artificial vagina. Males were trained for a month. Mean values for semen parameters were: volume of 2.7 ± 0.8 ml, viscosity of 1. 04 ± 0.3, motility of 54.0 ± 8.0%, pH towards to alkaline, concentration of 248,000 sperms/ml, and the most common color was milky white. The average time for the copula was 26.5 ± 3.8 minutes. Semen was diluted in 1:2 and the dilutions were evaluated on individual motility as the only parameter for sperm viability. The extender Tris-glucose had an average of 5.8 ± 1.1 hours viability, Tris-fructose had 6.1 ± 2.5 hours, and the commercial extender had 5.5 ± 1.0 hours, without statistical differences between extenders.

  5. Efecto del dilutor tris y citrato con yema de huevo de cordorniz sobre la viabilidad espermática en semen ovino congelado en pajillas / Effect of tris and citrate - quail eggyolk extenders on viability of ovine frozen semen in straws

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V.; Arturo, Ayulo L.; César, Pantoja A..

    2011-07-01

    Full Text Available Se evaluó el comportamiento de los dilutores Tris-yema y Citrato-yema en el congelamiento de semen de ovino y la integridad de la membrana espermática del semen congelado en pajillas. El estudio se realizó en el Banco Nacional de Semen UNALM con seis carneros de tres razas. El semen se colectó en va [...] gina artificial, se diluyó con Tris - glucosa - yema de huevo de Codorniz (Tris) o Citrato - glucosa - yema de huevo (Citrato), se almacenó en pajillas de 0.5 ml, y se congeló en nitrógeno líquido. El descongelamiento se realizó a 38 °C por 15 segundos. En semen refrigerado, la Motilidad Individual Progresiva (MIP) en semen diluido con Tris fue 82.3% y con Citrato de 79.2%, y los valores de la integridad de membrana (HOST) fueron de 78.0 ± 4.4 con Tris y 73.2 ± 5.8% con Citrato. En semen descongelado, la MIP fue de 62.0 y 56.8%, y HOST de 49.8 ± 3.9 y 41.3 ± 3.8% para los dilutores Tris y Citrato, respectivamente, existiendo diferencias significativas entre dilutores, carneros y momentos de procesamiento (p Abstract in english The study evaluated the performance of Tris-egg yolk and Citrate-egg-yolk as extenders for freezing ram semen in straws and the integrity of sperm membrane of frozen sperm at the National Semen Bank - UNALM, Lima, Peru using six ram semen donors of three breeds. The semen was collected in an artific [...] ial vagina, diluted with Tris - glucose - quail egg yolk (Tris) or with Citrate - glucose - egg yolk (Citrate), stored in 0.5 ml pellets, and frozen in liquid nitrogen. Thawing was done at 38 ºC for 15 seconds. In refrigerated semen, the Progressive Individual Motility (PIM) in diluted semen with Tris was 82.3% and with Citrate was 79.2%, and the integrity of the cytoplasmic membrane (HOST) was 78.0 ± 4.4 with Tris and 73.2 ± 5.8% with Citrate. In thawed semen, PIM was 62.0 and 56.8%, and HOST was 49.8 ± 3.9 and 41.3 ± 3.8% for Tris and Citrate respectively, with significant differences between extenders, rams and processing period (p

  6. Urinary metal concentrations in relation to semen quality: a cross-sectional study in China.

    Science.gov (United States)

    Zeng, Qiang; Feng, Wei; Zhou, Bin; Wang, Yi-Xin; He, Xiao-Sheng; Yang, Pan; You, Ling; Yue, Jing; Li, Yu-Feng; Lu, Wen-Qing

    2015-04-21

    Exposure to metals, including essential and nonessential elements, is widespread and may be associated with altered semen quality. This study aimed to examine the association between urinary metal concentrations and semen quality in a Chinese population. We measured semen quality parameters (sperm concentration, count, motility, normal morphology, and abnormal head) and 13 metals [arsenic (As), cadmium (Cd), cobalt (Co), chromium (Cr), copper (Cu), iron (Fe), lead (Pb), manganese (Mn), molybdenum (Mo), mercury (Hg), nickel (Ni), selenium (Se), and zinc (Zn)] in the urine of 394 men from an infertility clinic. Multivariable logistic and linear regressions were used to assess the relationship between the creatinine-adjusted urinary metal concentrations and semen quality parameters. We found a significant trend for decreased odds ratios (ORs) for below-reference sperm count with increasing Se quartiles (p for trend = 0.04) and a significant trend for increased sperm percent abnormal head with increasing Ni quartiles (p for trend = 0.03). These associations persisted, even when considering multiple metals. Our results suggest that Ni exposure may be associated with deteriorated sperm morphology and that Se exposure may be associated with better semen quality. However, our findings warrant further studies in a larger and general population. PMID:25827020

  7. Is maternal obesity related to semen quality in the male offspring? A pilot study.

    DEFF Research Database (Denmark)

    Ramlau-Hansen, C H; NØhr, Ellen Aagaard

    2007-01-01

    BACKGROUND: Obesity is a strong predictor of fecundity and maternal obesity may well program semen quality during pregnancy, but to our knowledge, no published studies have evaluated this hypothesis. METHODS: From a Danish pregnancy cohort established in 1984-87, 347 out of 5109 sons were selected for a follow-up study conducted from February 2005 to January 2006. Semen and blood samples were analyzed for conventional semen characteristics and reproductive hormones and related to information on maternal pre-pregnant body mass index (BMI) that was available for 328 men. Of these, 34 were sons of underweight, and 25 sons of overweight, mothers. RESULTS: Inhibin B decreased with increasing maternal BMI (P = 0.04) and the point estimates for sperm concentration, semen volume, percent motile sperm, testosterone and FSH suggested an impaired reproductive status among sons of overweight mothers, but none of the trends were statistically significant. CONCLUSIONS: The results suggest that there may be an effect of high maternal BMI on the sons' semen quality, but the study had only enough power to justify a critical evaluation of the hypothesis in a larger study. Udgivelsesdato: 2007-Oct

  8. Microsatellite analysis of cryopreserved stallion semen stored on FTA(R paper : research communication

    Directory of Open Access Journals (Sweden)

    M.L. Schulman

    2012-07-01

    Full Text Available The aim of this study was to establish and validate a method to permit microsatellite analysis of DNA profiles obtained from frozen-thawed stallion sperm cells. This would provide reliable and accurate verification of the identification of a semen donor. Ejaculates from 5 pony stallions were collected, processed and frozen in 0.5 m plastic straws. Aliquots of 100 m of the frozen-thawed semen thus obtained were either placed directly, or diluted (1 : 10 ; 1 : 100 ; and 1 : 1000 and placed on slides of FTA(R paper. Similarly, blood samples obtained from each of the stallions were placed onto slides of FTA(R paper. A punch was removed from each sample after drying. Each sample was mixed with FTA(R purification reagent, Dithiothreitol and Proteinase K before incubation and processing. All samples were processed with a set of 13 microsatellite markers. Further analysis permitted a comparison of the DNA profiles of the frozen-thawed semen and the blood samples. A full profile of markers was obtained from the 1 : 10 and 1 : 100 dilutions of the frozen-thawed semen samples as well as from the blood samples. The DNA profiles from the frozen-thawed semen and blood samples obtained from the stallions matched in all cases.

  9. Semen quality in welders before and after three weeks of non-exposure.

    Science.gov (United States)

    Bonde, J P

    1990-08-01

    In a cross sectional field study concerning the male reproductive system in metalworkers, the major findings were a moderate deterioration of semen quality in mild steel welders and less reliable changes in semen quality in low exposed stainless steel welders. In the present study, a longitudinal design was adopted to deal with methodological drawbacks inherent in the cross sectional approach. The study relies on the assumption that the effect of welding is causal and reversible. The semen quality of 19 mild steel welders, 18 stainless steel welders and 16 non-welding metal-workers, was examined before and three, five, and eight weeks after a three week break in exposure (summer vacation). No consistent improvement in any semen parameter in the follow up period relative to the prevacation period was found in either mild steel or stainless steel welders. The results indicate either a non-causal nature of reported associations between welding exposure and poor semen quality, or that the effect of welding is non-reversible within the rather short non-exposure period. PMID:2393629

  10. The combined use of embryos and semen for cryogenic conservation of mammalian livestock genetic resources

    Science.gov (United States)

    Boettcher, Paul J; Stella, Alessandra; Pizzi, Flavia; Gandini, Gustavo

    2005-01-01

    The objective of this empirical simulation study was to evaluate the use of a combination of semen and embryos in the creation of gene banks for reconstruction of an extinct breed. Such an approach was compared for banks with varying proportions of embryos on the basis of the amount of the material to be stored, time for reconstruction, maintenance of genetic variability, and probability of failure during reconstruction. Four types of populations were simulated, based on reproductive rate: single offspring, twinning, enhanced reproduction, and litter bearing. Reconstruction was simulated for banks consisting of different combinations of semen and reduced numbers of embryos (expressed as a percentage of the material needed for a bank containing exclusively embryos and ranging from 10 to 90%). The use of a combination of semen and embryos increased the number of insemination cycles needed for reconstruction and the level of genetic relatedness in the reconstructed population. The risk for extinction was unacceptably high when a very low proportion of embryos (< 20%) was used. However, combining semen with embryos could decrease costs, allowing for the conservation of more breeds, and specific strategies for semen use could decrease the level of relationships in the reconstructed breed. PMID:16277973

  11. Factores que afectan la producción de dosis de semen en centros de inseminación artificial porcina

    Directory of Open Access Journals (Sweden)

    G. Rocha

    2005-01-01

    Full Text Available Con el fin de determinar los factores que influyen en la producción de dosis de semen de calidad, se llevó a cabo el presente trabajo en centros de producción intensiva de semen. Un total de 8,420 eyaculados provenientes de 97 sementales alojados en dos diferentes postas del centro de la República Mexicana fueron evaluados para determinar sus parámetros de producción. De acuerdo a los datos analizados, la edad máxima en la que un semental puede ser utilizado para la colección de semen es de 36 meses y su ritmo de colección en la edad adulta es de una vez cada 5 días. Se encontró también que existe una moderada correlación negativa, entre temperatura ambiental y número de dosis obtenidas de cada semental (r = -0.534, P< .05. Por otro lado, se encontró una capacidad de producción dependiente de la línea genética, siendo los híbridos de Seghers los más productivos contra los sementales de la línea PIC, que resultaron con baja producción de semen. Otros parámetros analizados, fueron las causas de desecho de los sementales, siendo la principal la baja calidad de los eyaculados (hasta un 44.11%, seguido por edad avanzada (29%, problemas varios (atrofia de pene, uretra, entre otros: 12% y problemas de locomoción (6%. Los datos aquí encontrados permiten establecer estrategias para optimizar la producción de semen en las postas de sementales

  12. Evaluación de una solución inmovilizadora para criopreservación del semen de Colossoma macropomum, “Gamitana”

    Directory of Open Access Journals (Sweden)

    Ehrlich Llasaca-Calizaya

    2015-01-01

    Full Text Available El objetivo del trabajo fue la criopreservacion de semen, que permitirá constituir un banco genético, para lo cual se buscó obtener una solución  inactivadora de colecta para el semen de Colossoma macropomum  “gamitana”, que permita obtener espermatozoides, con buena motilidad de activación después de la descongelación, en nitrógeno líquido. Se utilizó semen de reproductores mantenidos, del Instituto de Investigaciones de la Amazonía Peruana (IIAP inducidos con Conceptal® y sin inducir mantenidos en el Centro de Acuicultura Nuevo Horizonte del Fondo Nacional de Desarrollo Pesquero (CANH - FONDEPES. El semen fue colectado en soluciones inactivadoras de 9% y 10% de NaCl, añadiendo 2 g/L, 4 g/L y 8 g/L de NaHCO3,  soluciones de sacarosa (300 mM, 400 mM y 500 mM sola o con 1,5 g/L, 1 g/L y 0,5 g/Lde NaCl. Se concluye que el tratamiento de 400 mM de sacarosa dio el mejor resultado, con una motilidad del 80% y 40 segundos de duración. También se evaluó la motilidad, después de una hora de almacenamiento a temperatura ambiente, con 60% de motilidad después de la activación y 20 segundos de duración. Este trabajo permitirá desarrollar  un protocolo de criopreservación para lotes de semen inmovilizados, con tiempo suficiente para preparar las pajuelas, congelarlas en nitrógeno líquido y optimizar el manejo de reproductores.

  13. Motilidad y fertilidad del semen de carnero descongelado a dos diferentes ritmos de temperatura

    Directory of Open Access Journals (Sweden)

    Rosa Bertha Angulo Mejorada

    1999-01-01

    Full Text Available El objetivo del presente trabajo fue comparar el efecto de dos temperaturas y tiempos de descongelación sobre la motilidad y fertilidad del semen del ovino. Se utilizó un total de 208 ovejas y 13 carneros de diferentes razas. El semen se obtuvo por medio de una vagina artificial. Se evaluó, se diluyó con Tris -ácido cítrico-fructosa-glicerol-yema de huevo y se centrifugó a 200 g/15 min; el paquete celular se resuspendió con el mismo diluyente. El semen diluido se congeló en pajillas francesas de 0.25 ml con 300 millones de espermatozoides mótiles. Se determinó la motilidad al descongelamiento en 212 pajillas descongeladas en baño María a 36ºC/8 seg (grupo 1 o a 70ºC/4 seg (grupo 2 y otras 208 dosis se utilizaron en la inseminación artificial de las ovejas por vía intracervical. Se determinó el porcentaje de ovejas paridas/ovejas inseminadas con semen descongelado a diferentes ritmos. La motilidad al descongelar fue de 51.28% y 47.98% en el semen descongelado de los grupos 1 y 2, respectivamente, y la fertilidad de 30.7% y 29.2%, para los mismos grupos, respectivamente, sin que existiera diferencia significativa entre grupos (C2; P>0.05. Se concluye que la descongelación de las pajillas a 36ºC durante 8 segundos es un método más práctico e inocuo.

  14. Comparação entre os sistemas automatizado e convencional de criopreservação de sêmen bovino / Comparison between the conventional and automated systems of semen bovine cryopreservation

    Scientific Electronic Library Online (English)

    Cátia Oliveira Guimarães, Abud; Lucas Jacomini, Abud; José Carvalho, Oliveira Neto; Margot Alves Nunes, Dode; José Robson Bezerra, Sereno; Carlos Frederico, Martins.

    2014-03-01

    Full Text Available O objetivo deste estudo foi comparar a eficiência do sistema automatizado (curva de resfriamento controlada eletronicamente) de congelação de sêmen bovino versus o sistema convencional (curva não controlada) por meio dos parâmetros de qualidade e viabilidade espermática no período pós-descongelação. [...] O sêmen de quatro touros azebuados adultos foram criopreservados simultaneamente em meio tris, gema e glicerol 7%. A avaliação computadorizada do sêmen descongelado detectou os seguintes parâmetros: MP 56,50±22,25%; VAP 34,77±4,25µm/s; VSL 28,17±4,25 µm/s; VCL 58,45±6,85µm/s; STR 82,00±2,31%; LIN 49,50±3,32%, para o sistema automatizado e MP. 57,00±13,11%; VAP 25,75±1,66µm/s; VSL 23,32±1,99µm/s; VCL 63,32±1,79µm/s; STR 82,25±3,59µm/s; LIN 50,00±4,97µm/s para o sistema convencional. Os valores médios das avaliações de integridade de membrana plasmática e integridade acrossomal foram de 54,72±12,55% e 36,13±22,20% para o sistema automatizado e 53,22±13,22% e 47,26±5,74% para o sistema convencional, respectivamente. Com os parâmetros avaliados foi possível identificar que não houve diferença estatística entre os sistemas de criopreservação. Desta forma, a escolha do método de criopreservação do sêmen bovino para utilização direta na propriedade fica a critério do técnico responsável, que deverá se basear na realidade de cada propriedade. Para tanto, sempre se deve considerar que o sistema convencional pode trazer mais variações que o sistema automatizado que, apesar do custo do equipamento, pode garantir repetibilidade nos resultados e consequente qualidade do sêmen bovino criopreservado. Abstract in english The objective of this study was to compare the efficiency of bovine semen cryopreservation using the controlled-rate freezing machine versus the conventional method (uncontrolled curve) by the parameters of sperm quality and viability in post-thaw period. Semen from four adult crossbreed bulls was c [...] ryopreserved in Tris-yolk-glycerol medium. The computer assisted analysis of thawed semen detected the following results: PM 56.50±22.25%; VAP 34.77±4.25µm/s; VSL 28.17±4.25µm/s; VCL 58.45±6.85µm/s; STR 82.00±2.31%; LIN 49.50±3.32%, to automated system and PM 57.00±13.11%; VAP 25.75±1.66µm/s; VSL 23.32±1.99µm/s; VCL 63.32±1.79µm/s; STR 82.25±3.59µm/s; LIN 50.00±4.97µm/s to conventional cryopreservation system. The results of plasma membrane and acrosome integrity evaluation were 54.7±12.55% and 36.13±22.20% for the automated system and 53.22±13.22% and 47.26±5.74% for the conventional system, respectively. The parameters evaluated demonstrated that there was no statistical difference between the cryopreservation systems. Thus, the choice of the bovine semen cryopreservation method to be used on a farm is a responsibility of the technician, and should be based on the reality of each farm. Therefore, it is always necessary to consider that the conventional system of bovine semen cryopreservation can vary more than the automated system, which, despite the cost of the equipment, can ensure repeatability of the results and consequent quality of cryopreserved bovine semen.

  15. Semen cryopreservation in fish: effects on sperm motility and fertility

    International Nuclear Information System (INIS)

    The cryopreservation of semen in fish, as in many species even shows effects that decrease sperm quality and directly engage cell ability to successfully participate in the processes of fertilization and embryonic development. the characteristics such as mobility and fertilizing capacity of fertilization of sperm are considered to be quality criteria that allow to measure the success or failure of the process, since they are considered integrative variables, being indicators that depend not on a single factor, but on the stability and welfare of all structures, enzymes and subcellular functional compounds that give place to these spermatic characteristics. membrane damage (Adenylate cyclase, ion channels, grouping of other proteins, among others) and their implication in the route of signaling pathway leading to spermatic activation, ATP degradation and fragmentation of nuclear and mitochondrial DNA (genome), degradation of kinase enzymes and other cytosolic proteins (proteome) are considered today, as some of the molecular factors that most affect during cryopreservation and markedly decreasing the fertilizing capacity and mobility of sperm in fish. Proposals on the molecular mechanisms, by which these subcellular factors interact and act as consequence of cryopreservation, are some of the topics covered in this review. Understanding the principles and factors that are involved in the origin of such damages, will allow to improved cryopreservation processes, making them less harmful and more efficient.

  16. Relation between semen quality and fertility : a population-based study of 430 first-pregnancy planners

    DEFF Research Database (Denmark)

    Bonde, Jens Peter; Ernst, Erik

    1998-01-01

    Semen analysis is part of the routine assessment of infertile couples. WHO defines a sperm concentration above 20x10(6) per mL seminal fluid as normal. We studied the association between semen quality and the probability of conception in a single menstrual cycle in Danish couples with no previous reproductive experience.

  17. 9 CFR 85.10 - Interstate movement of swine semen and swine embryos for insemination of or implantation into swine.

    Science.gov (United States)

    2010-01-01

    ...semen and swine embryos for insemination of or implantation into swine...semen and swine embryos for insemination of or implantation into swine...embryos moved interstate for insemination of swine or implantation...veterinarian stating that the donor swine are not known...

  18. SEMEN COLLECTION IN EMU (DROMAIUS NOVAEHOLLANDIAE BIRD BY NONTEASER METHOD AND ITS MACROSCOPICAL EVALUATION IN HUMID TROPICAL CLIMATE

    Directory of Open Access Journals (Sweden)

    Sundaresan, A*

    2015-03-01

    Full Text Available A study was conducted for collection and evaluation of emu bird semen by non teaser method. Ten adult male emu birds aged 3 to 4 years were selected and housed individually in a 10’ x 50’ pen constructed in parallel rows at emu unit, University Research Farm, TANUVAS, Chennai, Tamilnadu, India. The male birds were selected based on their readiness in accepting human beings without fear. All the birds were housed properly under standard managemental condition. An Isocaloric and Isonitrogenous standard emu breeder ration was fed to birds and portable drinking water were made available ad libitum. The selected male emus were trained for semen collection by non-teaser method. Out of 10 males, only seven males responded for semen collection. The raw semen collected from individual emu birds was evaluated for macroscopical seminal attributes namely volume, colour, consistency and pH. The overall mean values for volume and pH of individual male were 0.61? 0.02 ml and 7.40 ? 0.03 respectively. The individual males showed varied response and significant difference in seminal attributes. Creamy white thick consistency semen had significant (P?0.01 seminal attributes than yellow and watery semen. The temperament of male emu, sexual behavior and acceptance of the collector and courtship behavior by the male are the key factors for successful training of breeders. This study ensures the possibility of semen collection and facilitate further processing of semen.

  19. Cryopreservation of canine semen after cold storage in a Neopor box: effect of extender, centrifugation and storage time.

    Science.gov (United States)

    Hidalgo, M; Portero, J M; Demyda-Peyrás, S; Ortiz, I; Dorado, J

    2014-07-01

    The aim of this work was to assess the combined effect of sperm centrifugation, semen extender and storage time before freezing on post-thaw sperm quality and freezability on chilled stored canine semen in a Neopor box. Sperm parameters evaluated were total and progressive sperm motility by Computer-Assisted Sperm Analysis (CASA) and sperm viability and acrosome integrity using a triple fluorescent stain. Sperm quality and freezability indexes were also studied. First, the effect of centrifugation and two commercial extenders from Minitübe (Biladyl A and CaniPRO Freeze A) was evaluated in chilled semen after 24 and 45?hours of cold storage. No significant differences were observed between treatments in almost all the sperm parameters assessed. Secondly, chilled semen was frozen after 24 and 45?hours of cold storage in a Neopor box. The best results were obtained when semen was centrifuged, chilled with CaniPRO Freeze A and then frozen after 24?hours of cold storage, showing no differences in both post-thaw sperm quality and freezability in comparison with semen immediately frozen after collection. In conclusion, dog semen centrifuged after collection and extended with CaniPRO Freeze can be frozen after 24?hours of cold storage in a Neopor box, obtaining similar results to semen immediately frozen after collection. PMID:24799391

  20. In Situ Identification of Semen Stains on Common Substrates via Raman Spectroscopy,.

    Science.gov (United States)

    McLaughlin, Gregory; Lednev, Igor K

    2015-05-01

    The spectroscopic identification of body fluids in situ is a major objective in forensic science. This approach offers the confirmatory, nondestructive, rapid, and on-scene identification of various body fluids. Although Raman spectroscopy has shown tremendous promise toward this goal in prior proof-of-concept experiments, a significant challenge which still remains is substrate interference. Here, an approach for detecting semen stains in situ on various substrates using Raman spectroscopy is explored. Simulated semen evidence was prepared on skin, glass, and various fabrics. Raman data were accumulated from stains without any pretreatment using a common confocal mapping spectrometer using 785 nm laser excitation. The results demonstrate that the spectroscopic interferences encountered by substrates can be reduced and eliminated using a combination of existing subtraction techniques and chemometric models. Heterogeneous substrates proved most challenging, however, automatic subtraction treatment, and location of fluid hotspots was able to elucidate a clear spectroscopic signature of semen in every instance. PMID:25677855

  1. Review on the screening of semen by hypo-osmotic swelling test.

    Science.gov (United States)

    Zubair, M; Ahmad, M; Jamil, H

    2014-09-15

    The hypo-osmotic swelling test (HOST) is widely used as a valuable test for determining sperm quality by evaluating the membrane integrity of spermatozoa of various domestic animals including cattle, horses and swine. The HOST has also been used as an indicator of the fertilising capacity of spermatozoa. This test is based on the swelling ability when functional spermatozoa submitted to hypo-osmotic solutions. This test is commonly used as an important parameter for the evaluation of semen due to its strong correlation with semen evaluation parameters. The objective of this review was to analyse its significance in semen evaluation, swelling of spermatozoa under various osmolarities and variations in swelling percentage under different seasons. PMID:25220607

  2. Correlation between chemical composition of seminal plasma and sperm motility characteristics of Prussian carp (Carassius gibelio

    Directory of Open Access Journals (Sweden)

    M. Mehdi Taati

    2010-11-01

    Full Text Available The objectives of the present study were to determine the relationships between chemicalscompositions of seminal plasma with sperm motility traits in Prussian carp, Carassius gibelio (Bloch,1782. There were significant positive correlations between sperm movment duration and Ca+2 of semen.Also, a significant positive relationship was found between percentage of motile spermatozoa and Ca+2 ofsemen. On the other hand, Na+, Cl- and pH correlated negatively with sperm movment duration.Understanding of such correlations can be useful to evaluation of sperm quality and make media(extender for dilution of semen and improving sperm motility parameters of Prussian carp.

  3. Evaluation of three bovine Y specific microsatellite loci as an alternative biomarkers for semen quality traits in crossbred bull.

    Science.gov (United States)

    Deb, Rajib; Kumar, Sushil; Singh, Umesh; Tyagi, S; Mandal, D K; Sengar, G; Singh, Rani; Kumar, Mahesh; Sharma, Arjava

    2013-11-30

    Although some of the studies earlier reported that bovine semen parameters are associated with some candidate markers genes, but scanty of reports available regarding the effect of allelic variation in Y specific microsatellite markers on semen quality parameters in bulls. In the present study we have targeted three Y specific microsatellite markers (INRA126, INRA 189 and BM861) for their association ship analysis with some semen quality parameters among Frieswal (HF × Sahiwal) crossbred bulls of Indian origin. The polymorphic loci of INRA 126, bulls with 182 and 184 alleles had significantly (P<0.01) higher semen volume as compared to 186 allele, however, 186 allele showed significantly (P<0.01) higher concentration per ml of semen compared to 182 and 184. Interestingly our study also revealed that number of sperm/ejaculate is also significantly (P<0.05) higher in 184 allele compared to 182 and 186. Similarly, association analysis of INRA 189 major three alleles also revealed a significant difference in semen volume and concentration. Allele 89 and 96 having significantly (P<0.01) higher volume compared to 86, whereas allele 86 having significantly (P<0.01) higher concentration per volume of semen than 89 and 96. Again after association of two major alleles (160 and 164) of BM861 loci with semen parameters revealed no significant difference with any of the semen quality parameters chosen here. Therefore the present study may be for the first time revealed that the Y chromosomal microsatellite alleles are important male reproductive biomarkers for improving semen quality traits in bulls. PMID:24139760

  4. Comparison of Extraction Methods to Detect Porcine Circovirus-2 and Porcine Reproductive and Respiratory Syndrome Virus in Semen Samples

    Directory of Open Access Journals (Sweden)

    Won-Il Kim

    2012-01-01

    Full Text Available Since, Porcine Circo Virus-2 (PCV2 and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV are shed in semen for a long period of time after infection and artificial insemination is a common practice in pig farms, semen is an important source of spreading these viruses to naive populations. Therefore, rapid and accurate detection of PCV2 or PRRSV in semen could be critical at the standpoint of disease prevention and control. In this study, the performance of three different extraction methods on semen samples was compared to determine an optimal extraction method for semen samples to detect PCV2 or PRRSV. Seven or 115 semen samples were collected from the boars experimentally challenged with PRRSV or PCV2, respectively. These two sets of the semen samples were processed by three different extraction methods: High-Throughput Total Nucleic Acids Isolation kit (HT-TNA, High-Throughput Viral RNA Isolation kit with modified procedure (mHT-VR and DNeasy kit or RNeasy kit for PCV2 or PRRSV, respectively. Then, the efficiency of the extraction methods were compared by conducting the same real-time PCR for each virus. HT-TNA and mHT-VR kits were faster and more convenient to process semen samples and HT-TNA kit showed higher or compatible sensitivity as compared to the other two methods while all three methods demonstrated 100% specificity. In conclusion, the HT-TNA Extraction Method could significantly reduce testing time and effort to process semen samples and showed better sensitivity for detection of PCV2 and PRRSV in semen.

  5. Optimizing human semen cryopreservation by reducing test vial volume and repetitive test vial sampling

    DEFF Research Database (Denmark)

    S. Fuglesang Jensen, Christian; Ohl, Dana A

    2015-01-01

    OBJECTIVE: To investigate optimal test vial (TV) volume, utility and reliability of TVs, intermediate temperature exposure (-88°C to -93°C) before cryostorage, cryostorage in nitrogen vapor (VN2) and liquid nitrogen (LN2), and long-term stability of VN2 cryostorage of human semen. DESIGN: Prospective clinical laboratory study. SETTING: University assisted reproductive technology (ART) laboratory. PATIENT(S): A total of 594 patients undergoing semen analysis and cryopreservation. INTERVENTION(S): Semen analysis, cryopreservation with different intermediate steps and in different volumes (50-1,000 ?L), and long-term storage in LN2 or VN2. MAIN OUTCOME MEASURE(S): Optimal TV volume, prediction of cryosurvival (CS) in ART procedure vials (ARTVs) with pre-freeze semen parameters and TV CS, post-thaw motility after two- or three-step semen cryopreservation and cryostorage in VN2 and LN2. RESULT(S): Test vial volume of 50 ?L yielded lower CS than other volumes tested. Cryosurvival of 100 ?L was similar to thatof larger volumes tested. An intermediate temperature exposure (-88°C to -93°C for 20 minutes) during cryopreservation did not affect post-thaw motility. Cryosurvival of TVs and ARTVs from the same ejaculate were similar. Cryosurvival of the first TV in a series of cryopreserved ejaculates was similar to and correlated with that of TVs from different ejaculates within the same patient. Cryosurvival of the first TV was correlated with subsequent ARTVs. Long-term cryostorage in VN2 did not affect CS. CONCLUSION(S): This study provides experimental evidence for use of a single 100 ?L TV per patient to predict CS when freezing multiple ejaculates over a short period of time (<10 days). Additionally, semen cryostorage in VN2 provides a stable and safe environment over time.

  6. Semen and urine culture in the diagnosis of chronic bacterial prostatitis

    Scientific Electronic Library Online (English)

    L. R., Zegarra Montes; A. A., Sanchez Mejia; C. A., Loza Munarriz; E. Celis, Gutierrez.

    2008-02-01

    Full Text Available OBJECTIVE: To assess the diagnostic accuracy of semen and urine culture in the diagnosis of chronic bacterial prostatitis (CBP). MATERIALS AND METHODS: In 70 consecutive men suspected of having chronic bacterial prostatitis along with 17 asymptomatic controls, we obtained urine and semen cultures fo [...] llowed 1 week later by the Meares and Stamey test, our reference standard. The interpretation of each of the cultures was blind to the results of other tests. RESULTS: 139 men were referred for evaluation of chronic bacterial prostatitis and 70 received all tests. Additionally, 17 control men volunteered to participate. The Meares and Stamey Test was positive in 69 (79%) patients. The semen culture had a sensitivity of 45% and a specificity of 94%. The likelihood ratio associated with a positive semen culture was 8.1 (95% confidence interval (CI) 1.2 to 55.3); the likelihood ratio associated with a negative semen culture was 0.6 (95% CI 0.5 to 0.7). The urine culture had a sensitivity of 4% and a specificity of 100%. The likelihood ratio of a positive urine culture was infinity and of a negative urine culture was 0.96 (95% CI 0.9 to 1). CONCLUSIONS: While a positive semen culture in a symptomatic patient may suffice to select and start antibiotic treatment against chronic bacterial prostatitis, a negative culture does not rule out the condition. Urine cultures alone are not useful for diagnosing CBP. The Meares and Stamey test remains important for the diagnosis of CBP in practice.

  7. Semen and urine culture in the diagnosis of chronic bacterial prostatitis

    Directory of Open Access Journals (Sweden)

    L. R. Zegarra Montes

    2008-02-01

    Full Text Available OBJECTIVE: To assess the diagnostic accuracy of semen and urine culture in the diagnosis of chronic bacterial prostatitis (CBP. MATERIALS AND METHODS: In 70 consecutive men suspected of having chronic bacterial prostatitis along with 17 asymptomatic controls, we obtained urine and semen cultures followed 1 week later by the Meares and Stamey test, our reference standard. The interpretation of each of the cultures was blind to the results of other tests. RESULTS: 139 men were referred for evaluation of chronic bacterial prostatitis and 70 received all tests. Additionally, 17 control men volunteered to participate. The Meares and Stamey Test was positive in 69 (79% patients. The semen culture had a sensitivity of 45% and a specificity of 94%. The likelihood ratio associated with a positive semen culture was 8.1 (95% confidence interval (CI 1.2 to 55.3; the likelihood ratio associated with a negative semen culture was 0.6 (95% CI 0.5 to 0.7. The urine culture had a sensitivity of 4% and a specificity of 100%. The likelihood ratio of a positive urine culture was infinity and of a negative urine culture was 0.96 (95% CI 0.9 to 1. CONCLUSIONS: While a positive semen culture in a symptomatic patient may suffice to select and start antibiotic treatment against chronic bacterial prostatitis, a negative culture does not rule out the condition. Urine cultures alone are not useful for diagnosing CBP. The Meares and Stamey test remains important for the diagnosis of CBP in practice.

  8. Breed of boar influences the optimal concentration of gamma-oryzanol needed for semen cryopreservation.

    Science.gov (United States)

    Chanapiwat, P; Kaeoket, K

    2015-04-01

    The aim of this study was to investigate the influence of boar breed on the optimal concentration of gamma-oryzanol on the qualities of cryopreserved boar semen. Semen was collected from 20 boars (10 Duroc, 5 Large white and 5 Landrace boars). The semen sample was divided into five groups (A-E) according to the concentration of gamma-oryzanol in extender II, that is 0, 0.08, 0.16, 0.24 and 0.32 mM, respectively. The semen was cryopreserved by nitrogen vapour and storage in nitrogen tank (-196°C). After storage for a week, samples were thawed at 50°C for 12 s and evaluated for progressive motility, sperm viability and acrosome integrity. The results demonstrated that gamma-oryzanol significantly improved progressive motility, viability and acrosome integrity of frozen-thawed boar semen. Considering the influence of breeds on the optimal concentration of gamma-oryzanol, for Duroc boar, gamma-oryzanol at 0.16 mM (group C) yielded the highest percentage of progressive motility, sperm viability and acrosome integrity. For Large white and Landrace boars, gamma-oryzanol at 0.24 mM (group D) showed a significantly higher percentage of progressive motility, viability (not significant in Landrace) and acrosome integrity than other concentrations. In conclusion, the optimal concentration of gamma-oryzanol needed for boar semen cryopreservation in lactose-egg yolk (LEY) freezing extender is not only depended on individual boar but also breed of boar, that is 0.16 mM for Duroc and 0.24 mM for Large white and Landrace. PMID:25604719

  9. The effect of breed on the survivability and motility rate of cryopreserved cock semen

    Scientific Electronic Library Online (English)

    M.B., Makhafola; K.C., Lehloenya; M.L., Mphaphathi; A., Dinnyes; T.L., Nedambale.

    Full Text Available This study evaluated the effect of breed on the survivability and motility rate of cryopreserved cock semen. Semen from three cock breeds; White Leghorn (WL), Ovambo (OV) and Potchefstroom Koekoek (PK) was collected by means of the abdominal massage technique. Following semen collection, sperm were [...] analyzed for motility and survivability with the use of contrast light BHTU microscope (20 x magnification). The semen was diluted (1 : 2 v/v) with egg yolk citrate (EYC) (extender A) and thereafter with extender B (EYC + 5% DMSO). The equilibration after each dilution was 2 h at 5 ºC. The diluted samples were evaluated for sperm concentration, motility, survivability and pH. The samples were then loaded into straws and cooled in programmable freezer from 5 ºC to -20 ºC at the rate of 1 ºC/minute. Semen straws were then exposed to liquid nitrogen vapour (-80 ºC) for five minutes, plunged directly into liquid nitrogen (-196 ºC) and stored for a week or more. Frozen straws were thawed at 5 ºC and evaluated at 0, 30, 60 and 90 min post-thaw. From the results there was no significant effect of breed on the survival and motility of fresh-diluted and frozen-thawed semen at 30 and 90 min post-thaw in all breeds. The sperm survivability of the PK breed was significantly higher than that of the WL breed. However, there was no sperm survivability difference between PK and OV breed immediately after thawing. The cryopreservation and thawing processes affected the survivability and motility of sperm of all poultry breeds negatively.

  10. Semen quality of stallions challenged with the Kentucky 84 strain of equine arteritis virus.

    Science.gov (United States)

    Campos, Juliana R; Breheny, Patrick; Araujo, Reno R; Troedsson, Mats H T; Squires, Edward L; Timoney, Peter J; Balasuriya, Udeni B R

    2014-11-01

    Equine arteritis virus (EAV) is the causal agent of equine viral arteritis (EVA), a respiratory and reproductive disease of equids. Some strains of EAV can cause fever, leukopenia, and dependent edema of the limbs, scrotum, and preputium in the acutely infected stallion. We hypothesized that fever and scrotal edema observed during the acute phase of the infection, but not the presence of EAV, have an adverse effect on semen quality. A group of seven stallions were intranasally inoculated with the Kentucky 84 (KY84) strain of EAV. Stallions were monitored for clinical signs of EVA until 42 days postinoculation (dpi). Semen was collected every other day for the first 15 days and 2 times a week up to 79 dpi. Additional samples were collected at 147, 149, and 151 dpi. Semen from each stallion was evaluated on the basis of motion characteristics, total number of spermatozoa, membrane integrity, and morphology. Virus infectivity titers were determined in RK-13 cells. Significant decreases in sperm quality were observed between 9 and 76 dpi. LOWESS (locally weighted scatterplot smoothing) curves for each horse were fit and integrated to quantify spermatozoa exposure to fever, virus, and edema over a period of 67 days before each ejaculation. Linear mixed models were then fit to isolate the effects of each factor on semen quality. Scrotal edema and fever were found to exert independent effects on all the semen quality parameters (P ? 0.002), whereas virus seems to exert little to no direct effect, as virus titers remained high long after semen quality returned to baseline. PMID:25156969

  11. Semen quality and reproductive hormone levels in men from Southern Spain

    DEFF Research Database (Denmark)

    Fernandez, M F; Duran, I

    2012-01-01

    In North European countries, a significant difference in semen quality among young men has been shown. Men from the western countries, Denmark, Germany and Norway, have lower semen quality than men from the eastern countries Finland, Estonia and Lithuania. Similarly, men in the western countries have a higher risk of testicular cancer. According to the testicular dysgenesis syndrome (TDS) concept that suggests a link between risk of impaired semen quality and increased risk of testicular cancer, Spanish men would be expected to have a semen quality at a normal level because of their very low testis cancer risk. We therefore investigated 273 men from the Almeria region in the Southern Spain to test this hypothesis. The men delivered semen samples, underwent physical examinations, had a blood sample drawn and provided information on lifestyle and reproductive health parameters. The investigations took place from November 2001 to December 2002. Adjusting for effects of confounders, the median sperm concentrationand total sperm count were 62 (95% confidence interval 47-82) million/mL and 206 (153-278) million, respectively. The median numbers of motile and morphologically normal spermatozoa assessed according to strict criteria were 59% (57-62%) and 9.4% (8.6-10.0%), respectively. The median total testosterone and calculated free androgen index were 28 nm (26-30) and 95 (88-103), respectively. Assuming that the investigated men, to a large extent, are representative of the population of young men the Southern Spain, the results show that these have normal semen quality and reproductive hormone levels as expected in a population with a low incidence of testicular cancer.

  12. SEMEN PRODUCTION AND PRODUCTIVE LIFE OF SAHIWAL BULLS: RELATIONSHIP WITH GENETIC WORTH

    Directory of Open Access Journals (Sweden)

    M. S. KHAN, A. A. BHATTI, S. A. BHATTI1 AND M. ASHIQ2

    2007-01-01

    Full Text Available Objective of the present study was to document the semen producing ability, productive life and genetic ability for lactation milk yield of Sahiwal bulls used for artificial insemination (AI in Punjab and to find the impact of AI bulls on the improvement of Sahiwal cattle. Data from Semen Production Unit (SPU, Qadirabad, Sahiwal, Pakistan were used for this purpose. A repeatability animal model was used for estimation of breeding values for lactation milk yield. Productive life of a bull was calculated as a difference between culling age and the age at first ejaculation. Number of bulls brought to SPU varied from 9 to 102 for any year. Average number of doses of semen produced by any bull for a year varied from 724 to 5745. On the average, 238 bulls produced 17143 ± 1164 semen doses during their average stay of 5.4 ± 0.2 years. About 50% of the bulls stayed for less than four years at the SPU; with a maximum range of 14 years. Progeny tested bulls (n=90 produced 5000 and 10000 semen doses (Y in three and four years of stay (X, respectively (Y = 24.8 + 2.3635 X - 0.0112 X2. To produce 20,000 doses, it is predicted that bulls need to stay for six and a half years at the SPU. There was no association between breeding values for lactation milk yield estimated under a repeatability animal model (EBVs and number of semen doses produced (r = 0.17 and EBVs and number of daughters. Lack of genetic superiority of bulls used indicated that AI did not bring desired genetic improvement in Sahiwal cattle in the present situation. Modifications for judicious utilization of bulls are suggested along with improvements in data recording.

  13. Decline of semen quality and increase of leukocytes with cigarette smoking in infertile men

    Directory of Open Access Journals (Sweden)

    Zhi Hong Zhang

    2013-01-01

    Full Text Available Background: Previous researches about the effect of smoking on semen quality are contradictory, and the mechanism behind the harmful effect of smoking on semen quality still remains unclear until today. Objective: The objectives of this study are evaluation of the relationship between smoking and fertility, investigation of the effects of cigarette smoking on sperm parameters and detection of presence of leukocytes within the semen of idiopathic infertile men from Northeastern China. Materials and Methods: A retrospective study of 1512 infertile patients who visited affiliated hospitals of Jilin University from 2007-2010 were enrolled in this study. Patients were assigned into one non-smoking and one smoking group which was divided into mild, moderate and heavy subgroups. Sperm parameters (including leukocytes and sperm morphology analysis were performed using standard techniques. Results: Compared with non-smokers, smokers had a significant decrease in semen volumes (p=0.006, rapid progressive motility (p=0.002 and sperm viability (p=0.019; moreover, smokers had a significant increase in the levels of immotile sperms (p=0.005 and semen leukocytes (p=0.002; pH and sperm concentration were not statistically significant (p=0.789 and p=0.297 respectively. Sperm motion parameters were all lower in the smokers except for beat-cross frequency (Hz (BCF. Further, the percentage of normal morphology sperm was decreased significantly in smokers (p=0.003, the sperm morphology was worse with increasing degree of smoking. Conclusion: These findings suggest that smoking leads to a significant decline in semen quality and higher levels of leukocytes, thus smoking may affects the fertilization efficiency.

  14. Semen characteristics of goats with subacute, acute and chronic besnoitiosis : research communication

    Directory of Open Access Journals (Sweden)

    M.J. Njenga

    2012-07-01

    Full Text Available A study on the semen obtained from breeding goats suffering from mild to severe chronic besnoitiosis revealed marked changes in semen volume, colour, density, concentration, mass and individual motility and percentage live. There were also many neutrophils and spermatozoa with primary and secondary defects, including missing tails and deformed heads and tails. The observed changes were considered to be severe enough to account for the infertility observed in the flock. Sections of testes obtained for histopathology were characterised by massive blockage of the pampiniform plexus, degeneration of the germinal epithelium, tubular necrosis with an inflammatory infiltrate and, in some cases, accumulation of haemosiderin-like material in the tunica vaginalis.

  15. Survival of chlamydiae in human semen prepared for artificial insemination by donor.

    DEFF Research Database (Denmark)

    Thorsen, P; MØller, B R

    1991-01-01

    Semen specimens from 21 men with urethral infection with Chlamydia trachomatis were tested for the presence of the organism before and after cryopreservation for 3 weeks of storage at -196 degrees C. Five specimens were chlamydia-positive before preservation and four of them were still positive after storage when examined by enzyme immunoassay (Chlamydiazyme). When examined by cell culture, four proved chlamydia- positive before storage and two afterwards. The results indicate that testing for C. trachomatis has to be performed from the urethra of all donors of semen used for artificial insemination before the inoculation takes place. Udgivelsesdato: 1991

  16. The effect of cigarette smoking on semen quality of infertile men

    International Nuclear Information System (INIS)

    To evaluate the effects of cigarette smoking on semen quality of infertile men. Two hundred fourteen infertile men who had been smoking cigarette and one hundred thirty infertile non smokers men participated in this study. Seminal volume, sperm concentration, motility, viability, and morphology were examined. The quality of spermatozoa obtained from smokers were much lower than non-smokers (P<0.01). The sperm concentration, viability and forward progression were negatively correlated with cigarette smoking (P<0.01). Smoking does affect the semen quality of infertile men. (author)

  17. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction

    OpenAIRE

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa

    2014-01-01

    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-sp...

  18. Evaluation of buffalo semen by Trypan blue/Giemsa staining and related fertility in vitro

    OpenAIRE

    Gasparrini, B.; Mariotti, E.; Attanasio, L.; Rosa, A.; Di Palo, R.; Boccia, L.

    2010-01-01

    The aim of this work was to verify the feasibility of an easy, quick double staining technique for evaluation of frozen-thawed semen to predict the fertilizing capability in vitro of buffalo bulls. In Experiment 1, frozen-thawed semen from 6 bulls was stained with double Trypan blue/ Giemsa and the incidence of acrosome-intact live (AIL), acrosome-intact dead (AID), acrosome-lost live (ALL) and acrosome-lost dead (ALD) sperm was recorded. In Experiment 2, sperm from the same bulls were used t...

  19. Semen Characteristics of Vaccinated Shikabrown Cocks Challenged with a Velogenic Newcastle Disease Virus

    OpenAIRE

    Rwuaan, J. S.; Rekwot, P. I.; Abdu, P. A.; Eduvie, L. O.; Obidi, J. A.

    2009-01-01

    Twenty-five cocks consisting of 14 red and 11 white Shikabrown cocks selected on the basis of body weight and antibody titres were infected with 0.2 ml of 106.0 EID50 of a velogenic Kudu 113 strain of Newcastle disease virus intranasally and intraocularly. Twenty-five cocks consisting of 14 red and 11 white Shikabrown cocks served as controls. Cloacal temperatures, live weights and semen samples of both control and infected cocks were taken weekly for six weeks. Semen was collected by abdomin...

  20. Effect of Saffron on Semen Parameters of Infertile Men

    Directory of Open Access Journals (Sweden)

    Soudabeh Givrad

    2008-12-01

    Full Text Available

    Introduction: We conducted this study to determine the effects of saffron (Crocus sativus on the results of semen analysis in men with idiopathic infertility.

    Materials and Methods: In this clinical trial, 52 nonsmoker infertile men whose problem could not be solved surgically were enrolled. They were treated by saffron for 3 months. Saffron, 50 mg, was solved in drinking milk and administered 3 times a week during the study course. Semen analysis was done before and after the treatment and the results were compared.

    Results: The mean percentage of sperm with normal morphology was 26.50 ± 6.44% before the treatment which increased to 33.90 ± 10.45%, thereafter (P < .001. The mean percentage of sperm with Class A motility was 5.32 ± 4.57% before and 11.77 ± 6.07% after the treatment (P < .001. Class B and C motilities were initially 10.09 ± 4.20% and 19.79 ± 9.11% which increased to 17.92 ± 6.50% (P < .001 and 25.35 ± 10.22% (P < .001, respectively. No significant increase was detected in sperm count; the mean sperm count was 43.45 ± 31.29 × 106/mL at baseline and 44.92 ± 28.36× 106/mL after the treatment period (P = .30.

    Conclusion: Saffron, as an antioxidant, is positively effective on sperm morphology and motility in infertile men, while it does not increase sperm count. We believe further studies on larger sample sizes are needed to elucidate the potential role and mechanism of action of saffron and its ingredient in the treatment of male infertility.

  1. Semen Parameters and Chromatin Packaging in Microsurgical Varicocelectomy Patients

    Directory of Open Access Journals (Sweden)

    Marziyeh Tavalaee

    2012-01-01

    Full Text Available Background: Varicocelectomy is considered as standard treatment for male infertility for clinicalvaricocele. The aim of this study is to address the effects of varicocelectomy on semen parameters,chromatin packaging, and pregnancy outcome.Materials and Methods: This retrospective study was carried out between June 2006 and February2011 on 145 infertile men with grade II or III varicocele. Microsurgical varicocelectomy wasperformed as part of patient management. Sperm count, motility, morphology, and chromatinpackaging were assessed with a Makler counting chamber, light microscopy, Papanicoulaou andchromomycin A3 (CMA3 staining, respectively. In addition, we assessed spontaneous clinicalpregnancy and miscarriage rates.Results: The percentages of spontaneous cumulative pregnancies post-surgery were 33.1% (3months, 42.06% (6 months, 46.2% (9 months, 48.9% (12 months, and 55.8% (after 12 months.Percentages of spontaneous cumulative miscarriage post-surgery were 2.46% (3 months, 4.93%(6 months, 4.93% (9 months, 6.17% (12 months, and 6.17 % (after 12 months. Both spermparameters improved and the percentage of sperm protamine deficiency decreased significantlyafter varicocelectomy.Conclusion: These results confirm that varicocelectomy improves sperm parameters and chromatinpackaging, thereby improving the chance of pregnancy. Positive aspects of this study include thelarge number of patients studied, duration of follow up, one surgeon who performed all of thesurgeries, and type of surgery (microsurgery. The spontaneous pregnancy results also suggest thatif pregnancy is not achieved within twelve months post-surgery, an alternative approach such asassisted reproductive technology (ART treatment should be considered.

  2. Determinación de células peroxidasa positivas en líquido seminal: ¿es un parámetro confiable para el diagnóstico de infección genital asintomática? Determination of peroxidase positive cells in semen for the diagnosis of silent genital infections

    Directory of Open Access Journals (Sweden)

    Raúl Sánchez G

    2003-06-01

    Full Text Available Background: The presence of leukocytes, detected by peroxidase test in semen, can be a good indicator of infections in the male genital tract. Peroxidase positive cells have been positively correlated with elevated values of elastase, one of the major proteases liberated by granulocytes at the inflammation place. However, seminal granulocytes may not be adequately detected by the peroxidase test in comparison with immunological methods. Aim: To correlate the determination of peroxidase positive cells with the elastase level in the seminal plasma. Material and methods: Seminal plasma from 64 patients with a high number of round cells (>106/ml in semen, was studied. Correlation analysis was done using the Pearson correlation coefficient. Results: No correlation between the level of granulocyte elastase and the number of peroxidase positive cells (r=0.2237, p >0.05, or even the number of round cells (r=0.03934, p >0.05 was observed. Conclusions: Our results suggest that the determination of peroxidase positive cells is not a reliable indicator of leukocytes in the seminal plasma and their absence do not discard a silent genital tract infection (Rev Méd Chile 2003; 131: 613-616

  3. Determinación de células peroxidasa positivas en líquido seminal: ¿es un parámetro confiable para el diagnóstico de infección genital asintomática? / Determination of peroxidase positive cells in semen for the diagnosis of silent genital infections

    Scientific Electronic Library Online (English)

    Raúl, Sánchez G; Juana, Villegas M; Patricio, Peña S; Werner, Miska; Wolf, Bernhard Schill.

    2003-06-01

    Full Text Available [...] Abstract in english Background: The presence of leukocytes, detected by peroxidase test in semen, can be a good indicator of infections in the male genital tract. Peroxidase positive cells have been positively correlated with elevated values of elastase, one of the major proteases liberated by granulocytes at the infla [...] mmation place. However, seminal granulocytes may not be adequately detected by the peroxidase test in comparison with immunological methods. Aim: To correlate the determination of peroxidase positive cells with the elastase level in the seminal plasma. Material and methods: Seminal plasma from 64 patients with a high number of round cells (>106/ml) in semen, was studied. Correlation analysis was done using the Pearson correlation coefficient. Results: No correlation between the level of granulocyte elastase and the number of peroxidase positive cells (r=0.2237, p >0.05), or even the number of round cells (r=0.03934, p >0.05) was observed. Conclusions: Our results suggest that the determination of peroxidase positive cells is not a reliable indicator of leukocytes in the seminal plasma and their absence do not discard a silent genital tract infection (Rev Méd Chile 2003; 131: 613-616)

  4. Changes in motility, morphology, plasma membrane and acrosome integrity during stages of cryopreservation of buck sperm

    Scientific Electronic Library Online (English)

    Mushtaq, Ahmad; Rashad, Nasrullah; Hasan, Riaz; Abdul, Sattar; Nasim, Ahmad.

    2014-01-01

    Full Text Available Changes in sperm structure and function occur during the processing of semen. The present study was designed to investigate the effect on buck sperm during different stages of semen preparation including dilution, cooling, equilibration and freeze-thawing. Semen ejaculates from three mature bucks (r [...] eplicates = 5) were diluted with tris-citric acid egg yolk glycerol extender at 37 °C, cooled to 4 °C over 90 min, equilibrated at 4 °C for 2 h, transferred to 0.5 mL straws, placed in nitrogen vapour, frozen and thawed and then analysed. Sperm samples were assessed for percentage motility, acrosomal and plasma membrane integrity, live sperm, and morphology after dilution, cooling, equilibration and thawing. Mean percentage motility after dilution (86.0 ± 1.4%) was reduced significantly (p

  5. Vitamin E and reduced glutathione in Prochilodus lineatus (curimba semen cryopreservation (Characiformes: Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Daniella A. J. Paula

    2012-09-01

    Full Text Available This study investigated the addition of antioxidants vitamin E and reduced glutathione on curimba (Prochilodus lineatus semen cryopreservation and compared sodium bicarbonate solution and distilled water as activators. The experiment was conducted at the environmental station of CEMIG, in Itutinga-MG, Brazil, between December/2009 and January/2010. Semen samples (n = 7 with semen motility above 80% were diluted in cryoprotectant solutions composed of 10% methanol, 15% lactose and containing different concentrations of antioxidants: 50 (VE50, 100 (VE100 and 250 (VE250 µM of vitamin E, and 0.5 (RG0.5, 1.0 (RG1.0 and 1.5 (RG1.5 mM of reduced glutathione. A solution without antioxidants was used as a control. The semen was diluted at a ratio of 1:4 (100 ìL semen:400 ?L cryoprotectant solution. The toxicity of the solutions was evaluated by investigating semen motility after 10 min in the solution. The rest of the diluted semen was placed into 0.5 mL straws maintained in nitrogen vapour for 24 hours and packed into a nitrogen liquid cylinder for four days. The samples were thawed in a water bath at 60°C for 8 s and the rate (% and duration (s of semen activation with distilled water or sodium bicarbonate was evaluated. In the toxicity test, we found that vitamin E and reduced glutathione were not toxic to curimba semen at any of the tested concentrations (P>0.05. The duration of motility was longer (P0.05. Thus, the antioxidants vitamin E and reduced glutathione did not improve the quality of cryopreserved curimba semen, but they did not cause toxic effects to the semen in natura and they did not decrease its quality during cryopreservation.Este estudo avaliou a adição de antioxidantes vitamina E e glutationa reduzida no sêmen criopreservado de curimba (Prochilodus lineatus e comparou solução de bicarbonato de sódio e água destilada como ativadores. O experimento foi conduzido na estação ambiental da CEMIG, em Itutinga-MG, entre Dezembro/2009 e Janeiro/2010. Sêmen de sete animais, com motilidade espermática acima de 80%, foi diluído em soluções crioprotetoras compostas por metanol 10% e lactose 15% em diferentes concentrações de antioxidantes: 50 (VE50, 100 (VE100 e 250 (VE250 µM de vitamina E, 0,5 (RG5.5, 1,0 (RG1.0 e 1,5 (RG1.5 mM glutationa reduzida e uma solução controle sem antioxidante. O sêmen foi diluído na proporção de 1:4 (100 µL de sêmen: 400 µL de solução crioprotetora. A toxicidade das soluções foi avaliada pela motilidade espermática após de 10 minutos em solução. O restante do sêmen diluído foi armazenado em palhetas de 0,5 mL mantidos em vapor de nitrogênio por 24 horas e estocado em cilindro de nitrogênio líquido por quatro dias. As amostras foram descongeladas em banho-maria a 60°C por 8 segundos e avaliada a taxa (% e duração (s pela ativação do sêmen com água destilada e bicarbonato de sódio a 1%. No teste de toxicidade, observamos que os antioxidantes da vitamina E e glutationa, nas diferentes concentrações, não foram tóxicos para o sêmen do curimba (P>0,05. A duração da motilidade foi maior (P0,05. Assim, os antioxidantes vitamina E e glutationa reduzida não melhoram a qualidade do sêmen criopreservado de curimba, mas não causam efeitos tóxicos para o sêmen in natura e criopreservados por não diminuir sua qualidade durante a criopreservação.

  6. Vitamin E and reduced glutathione in Prochilodus lineatus (curimba) semen cryopreservation (Characiformes: Prochilodontidae)

    Scientific Electronic Library Online (English)

    Daniella A. J., Paula; Estefânia S., Andrade; Luis D. S., Murgas; Viviane O., Felizardo; Elissandra U., Winkaler; Walmes, Zeviani; Rilke T. F., Freitas.

    2012-09-01

    Full Text Available Este estudo avaliou a adição de antioxidantes vitamina E e glutationa reduzida no sêmen criopreservado de curimba (Prochilodus lineatus) e comparou solução de bicarbonato de sódio e água destilada como ativadores. O experimento foi conduzido na estação ambiental da CEMIG, em Itutinga-MG, entre Dezem [...] bro/2009 e Janeiro/2010. Sêmen de sete animais, com motilidade espermática acima de 80%, foi diluído em soluções crioprotetoras compostas por metanol 10% e lactose 15% em diferentes concentrações de antioxidantes: 50 (VE50), 100 (VE100) e 250 (VE250) µM de vitamina E, 0,5 (RG5.5), 1,0 (RG1.0) e 1,5 (RG1.5) mM glutationa reduzida e uma solução controle sem antioxidante. O sêmen foi diluído na proporção de 1:4 (100 µL de sêmen: 400 µL de solução crioprotetora). A toxicidade das soluções foi avaliada pela motilidade espermática após de 10 minutos em solução. O restante do sêmen diluído foi armazenado em palhetas de 0,5 mL mantidos em vapor de nitrogênio por 24 horas e estocado em cilindro de nitrogênio líquido por quatro dias. As amostras foram descongeladas em banho-maria a 60°C por 8 segundos e avaliada a taxa (%) e duração (s) pela ativação do sêmen com água destilada e bicarbonato de sódio a 1%. No teste de toxicidade, observamos que os antioxidantes da vitamina E e glutationa, nas diferentes concentrações, não foram tóxicos para o sêmen do curimba (P>0,05). A duração da motilidade foi maior (P0,05). Assim, os antioxidantes vitamina E e glutationa reduzida não melhoram a qualidade do sêmen criopreservado de curimba, mas não causam efeitos tóxicos para o sêmen in natura e criopreservados por não diminuir sua qualidade durante a criopreservação. Abstract in english This study investigated the addition of antioxidants vitamin E and reduced glutathione on curimba (Prochilodus lineatus) semen cryopreservation and compared sodium bicarbonate solution and distilled water as activators. The experiment was conducted at the environmental station of CEMIG, in Itutinga- [...] MG, Brazil, between December/2009 and January/2010. Semen samples (n = 7) with semen motility above 80% were diluted in cryoprotectant solutions composed of 10% methanol, 15% lactose and containing different concentrations of antioxidants: 50 (VE50), 100 (VE100) and 250 (VE250) µM of vitamin E, and 0.5 (RG0.5), 1.0 (RG1.0) and 1.5 (RG1.5) mM of reduced glutathione. A solution without antioxidants was used as a control. The semen was diluted at a ratio of 1:4 (100 ìL semen:400 ?L cryoprotectant solution). The toxicity of the solutions was evaluated by investigating semen motility after 10 min in the solution. The rest of the diluted semen was placed into 0.5 mL straws maintained in nitrogen vapour for 24 hours and packed into a nitrogen liquid cylinder for four days. The samples were thawed in a water bath at 60°C for 8 s and the rate (%) and duration (s) of semen activation with distilled water or sodium bicarbonate was evaluated. In the toxicity test, we found that vitamin E and reduced glutathione were not toxic to curimba semen at any of the tested concentrations (P>0.05). The duration of motility was longer (P0.05). Thus, the antioxidants vitamin E and reduced glutathione did not improve the quality of cryopreserved curimba semen, but they did not cause toxic effects to the semen in natura and they did not decrease its quality during cryopreservation.

  7. Use of computer-assisted semen analysis for evaluation of Rosy-faced lovebird (Agapornis roseicollis) semen collected in different periods of the year.

    Science.gov (United States)

    Dogliero, Andrea

    2015-01-01

    The seminal characteristics of the Rosy-faced lovebird (Agapornis roseicollis) were analyzed, both in and out of season, using a computer-aided sperm analyzer. Avian semen collection and artificial insemination techniques have great potential for captive breeding programs, and computer-aided sperm analyzer allows an objective and quantitative assessment of sperm motility and kinetics. Although Agapornis roseicollis is a largely diffuse species, its seminal parameters have never been fully investigated. Using the massage technique, 38 ejaculates were collected in the breeding season, and 6 ejaculates were collected outside of the breeding season. Semen color, volume, degree of contamination, spermatozoa concentration, total and progressive motility, and kinetics parameters were recorded. Seasonal significant differences were found in the ejaculate volume (1.6 ± 0.6 and 1.1 ± 0.2 mL in and out season, respectively, P donor for future assisted reproduction in captivity. PMID:25441497

  8. Influencia de los dilutores tris y ovine freezing sobre la integridad de la membrana citoplasmática durante la congelación de semen de ovinos en pajillas de 0.5 ml / Effect of tris and ovine freezing semen extenders on cytoplasmatic membrane integrity during ovine semen freezing in 0.5 ml straws

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V.; César, Pantoja A..

    2008-07-01

    Full Text Available Se analizó el efecto de los dilutores Tris-glucosa y Ovine Freezing Buffer (UA 466/005238) sobre la motilidad e integridad de la membrana citoplasmática de los espermatozoides durante el proceso de congelación de semen ovino. Se utilizó el semen de cinco carneros (2 Assaf, 2 Canela y 1 Black Belly). [...] El semen fresco fue de buena calidad y los valores de las características seminales estuvieron dentro de los parámetros de la especie. La motilidad individual progresiva (MIP) del semen refrigerado fue 86.0 ± 2.48 y 88.5 ± 4.8% y del semen congelado fue de 60.8 ± 1.9 y 62.9 ± 2.4% con los dilutores Tris y Ovine Freezing, respectivamente; mientras que la proporción de espermatozoides con membrana intacta, evaluada por la prueba de HOST (Hipo Osmotic Swelling Test) fue 77.9 ± 4.8 y 78.9 ± 4.0% para el semen refrigerado y de 39.9 ± 3.6 y 43.2 ± 2.9% para el semen congelado, utilizando los dilutores Tris y Ovine Freezing, respectivamente, existiendo diferencias altamente significativas entre dilutores, carneros y fases del proceso de congelación (p Abstract in english The effect of two semen extenders: Glucose Tris and Ovine Freezing Buffer (UA 466/005238) on the motility and cytoplasmic membrane integrity of spermatozoa during the freezing process was evaluated. Five rams (2 Assaf, 2 Cinnamon and 1 Black Belly) were used. The fresh semen was of good quality and [...] values of seminal characteristics were within the normal range for this species. The Progressive Individual Motility of the refrigerated semen was 86.0 ± 2.48 and 88.5 ± 4.8% and for frozen semen was 60.8 ± 1.9 and 62.9 ± 2.4% for Tris and Ovine Freezing, respectively; while the proportion of spermatozoa with intact membranes, evaluated by HOST (Hipo Osmotic Swelling Test), was 77.9 ± 4.8 and 78.9 ± 4.0% for refrigerated semen and 39.9 ± 3.6 and 43.2 ± 2.9% for frozen semen using the Tris and Ovine Freezing dilutors, respectively. There were highly significant differences between dilutors, rams and phases of the freezing process (p

  9. Infecciones de Transmisión Sexual en Semen: El Hombre como Vector de Transmisión Sexual Transmission Infections in Semen: Men as Vector Transmission

    Directory of Open Access Journals (Sweden)

    Tamara Viscarra A

    2013-03-01

    Full Text Available En los últimos años el estudio de las infecciones de transmisión sexual ha cobrado gran importancia debido principalmente al incremento de estas en parejas heterosexuales y hombres que tienen sexo con hombres. En mujeres existe mucha información de epidemiología y patogénesis de estas infecciones, sin embargo, en hombres la información es muy escasa debido a que la mayoría no presenta sintomatología. En los últimos años se ha evidenciado un creciente interés en el estudio del semen como vía de transmisión, debido principalmente a la afinidad de algunos patógenos con los espermatozoides. Dentro de los principales microorganismos infectantes en semen se encuentran Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Virus de la Inmunodeficiencia Humana tipos 1 y 2, Virus Herpes Simplex 1 y 2, Virus Papiloma Humano, Virus de la Hepatitis B y C, Citomegalovirus, Virus Epstein-Barr y Trichomonas vaginalis.Sexually transmitted infections study has become an important issue in these days, mainly due to the increment of heterosexual and men have sex with men partners of people. In women, there is a lot information about epidemiology and pathogenesis of these infections. However, the information is very limited in men, because most infected men are asymptomatic. In recent years, there has been an increasing interest in study of semen as a transmission way, due to the affinity of some pathogens to sperm. The most prevalent microorganisms infecting semen are: Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Human Immunodeficiency Virus Types 1 and 2 Herpes Simplex Virus 1 and 2, Human Papillomavirus, Hepatitis B and C virus, Cytomegalovirus, Epstein-Barr and Trichomonas vaginalis.

  10. Infecciones de Transmisión Sexual en Semen: El Hombre como Vector de Transmisión / Sexual Transmission Infections in Semen: Men as Vector Transmission

    Scientific Electronic Library Online (English)

    Tamara, Viscarra A; Priscilla, Brebi M; Alejandra, Andana V; Raúl, Sánchez G.

    2013-03-01

    Full Text Available En los últimos años el estudio de las infecciones de transmisión sexual ha cobrado gran importancia debido principalmente al incremento de estas en parejas heterosexuales y hombres que tienen sexo con hombres. En mujeres existe mucha información de epidemiología y patogénesis de estas infecciones, s [...] in embargo, en hombres la información es muy escasa debido a que la mayoría no presenta sintomatología. En los últimos años se ha evidenciado un creciente interés en el estudio del semen como vía de transmisión, debido principalmente a la afinidad de algunos patógenos con los espermatozoides. Dentro de los principales microorganismos infectantes en semen se encuentran Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Virus de la Inmunodeficiencia Humana tipos 1 y 2, Virus Herpes Simplex 1 y 2, Virus Papiloma Humano, Virus de la Hepatitis B y C, Citomegalovirus, Virus Epstein-Barr y Trichomonas vaginalis. Abstract in english Sexually transmitted infections study has become an important issue in these days, mainly due to the increment of heterosexual and men have sex with men partners of people. In women, there is a lot information about epidemiology and pathogenesis of these infections. However, the information is very [...] limited in men, because most infected men are asymptomatic. In recent years, there has been an increasing interest in study of semen as a transmission way, due to the affinity of some pathogens to sperm. The most prevalent microorganisms infecting semen are: Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Human Immunodeficiency Virus Types 1 and 2 Herpes Simplex Virus 1 and 2, Human Papillomavirus, Hepatitis B and C virus, Cytomegalovirus, Epstein-Barr and Trichomonas vaginalis.

  11. Obtención de cachorros mediante inseminación artificial con semen canino refrigerado.: Primera descripción en Chile / Puppies obtained using artificial insemination with chilled extended semen.: First report in Chile

    Scientific Electronic Library Online (English)

    A., Sánchez; J., Rubilar.

    Full Text Available Empleando una pareja de perros Siberian Husky, se describe, por primera vez en Chile, una inseminación artificial empleando semen canino refrigerado. El semen fue obtenido por manipulación digital y diluido con leche semidescremada UHT con antibióticos en relación 1:4 y refrigerado a 5ºC. Se practic [...] aron 3 inseminaciones a partir del tercer día del estro, el cual fue determinado mediante exámenes de citología vaginal, considerándose inicio del estro cuando las células superficiales constituían sobre el 80% del total de células vaginales en los frotis. Se inseminó con dosis refrigeradas por 24 y 48 horas y con una concentración promedio de 600 millones de espermatozoides totales. El diagnóstico de gestación, mediante ecógrafo de tiempo real, se realizó 28 días después de la última inseminación y la perra parió 4 cachorros vivos 61 días Abstract in english Using a couple of Husky Siberian, it is described for the first time in Chile a kind of artificial insemination using cooled canine semen. The semen was obtained by digital manipulation and was diluted with UHT semi-skimmed milk and antibiotics in relation 1:4 and cooled at 5ºC. There inseminations [...] were carried out on the third day of the oestrus which was determined through vaginal cytology, considering the beginning of the oestrus when the superficial cells constituted over the 80% of the total vaginal cells in the vaginal smear. Inseminated was carried out using cooled doses for 24 and 48 hours and with an average concentration of 600 x 10(6) spermatozoa. The pregnancy diagnosis, through a real time ultrasonography, was done 28 days after the last insemination and the bitch gave birth to 4 normal puppies 61 days after last insemination

  12. Obtención de cachorros mediante inseminación artificial con semen canino refrigerado.: Primera descripción en Chile Puppies obtained using artificial insemination with chilled extended semen.: First report in Chile

    Directory of Open Access Journals (Sweden)

    A. Sánchez

    2001-01-01

    Full Text Available Empleando una pareja de perros Siberian Husky, se describe, por primera vez en Chile, una inseminación artificial empleando semen canino refrigerado. El semen fue obtenido por manipulación digital y diluido con leche semidescremada UHT con antibióticos en relación 1:4 y refrigerado a 5ºC. Se practicaron 3 inseminaciones a partir del tercer día del estro, el cual fue determinado mediante exámenes de citología vaginal, considerándose inicio del estro cuando las células superficiales constituían sobre el 80% del total de células vaginales en los frotis. Se inseminó con dosis refrigeradas por 24 y 48 horas y con una concentración promedio de 600 millones de espermatozoides totales. El diagnóstico de gestación, mediante ecógrafo de tiempo real, se realizó 28 días después de la última inseminación y la perra parió 4 cachorros vivos 61 díasUsing a couple of Husky Siberian, it is described for the first time in Chile a kind of artificial insemination using cooled canine semen. The semen was obtained by digital manipulation and was diluted with UHT semi-skimmed milk and antibiotics in relation 1:4 and cooled at 5ºC. There inseminations were carried out on the third day of the oestrus which was determined through vaginal cytology, considering the beginning of the oestrus when the superficial cells constituted over the 80% of the total vaginal cells in the vaginal smear. Inseminated was carried out using cooled doses for 24 and 48 hours and with an average concentration of 600 x 10(6 spermatozoa. The pregnancy diagnosis, through a real time ultrasonography, was done 28 days after the last insemination and the bitch gave birth to 4 normal puppies 61 days after last insemination

  13. Alergia al plasma seminal humano: ¿mito o realidad?

    Scientific Electronic Library Online (English)

    Jenniffer, Puerta-Suárez; Walter, Cardona-Maya.

    Full Text Available Antecedentes: La hipersensibilidad al plasma seminal humano abarca una amplia variedad de manifestaciones clínicas que comprenden desde prurito local y reacciones dérmicas localizadas, hasta situaciones que ponen en riesgo la vida, como la anafilaxia. Objetivo: Caracterizar este fenómeno, para el es [...] tudio a profundidad del tema y enfatizar en un problema que no está siendo valorado debido al poco conocimiento del evento. Método: Revisión de la literatura empleando los términos "semen allergy" y "human seminal plasma allergy" y sus equivalentes en español en diferentes bases de datos. Resultados: Este desorden inmunológico es más frecuente entre los 23 y los 35 años de edad, en la mayoría de los casos los síntomas se inician dentro de la primera hora después de culminada la relación sexual o inmediatamente después de tener contacto con el semen. El método de prevención más eficaz es el condón, aunque no es una opción adecuada para las parejas que desean concebir. Conclusión: Se requiere estudiar y caracterizar mejor este fenómeno para mejorar tanto su diagnóstico como su tratamiento. Abstract in english Background: Human seminal plasma hypersensitivity includes a wide variety of clinical manifestations comprising itching and localized dermal reactions to situations that threaten life as anaphylaxis. Aims: To characterize this phenomenon, for in-depth study of the subject and emphasize a problem tha [...] t is not being assessed due to poor knowledge of the event. Method: Review of the literature using the terms "semen allergy" and "human seminal plasma allergy" and their spanish equivalents in different databases. Results: This immune disorder is more common between 23 and 35 years of age, in most cases the symptoms begin within the first hour after culminating intercourse or immediately after contact with the semen and most effective prevention method is the condom, although not an adequate solution for couples who want to conceive. Conclusion: Further studies are required to further characterize this phenomenon to improve both diagnosis as treatment.

  14. A comparison of conventional and computer-assisted semen analysis (CRISMAS software) using samples from 166 young Danish men

    DEFF Research Database (Denmark)

    Vested, Anne; Ramlau-Hansen, Cecilia

    2011-01-01

    The aim of the present study was to compare assessments of sperm concentration and sperm motility analysed by conventional semen analysis with those obtained by computer-assisted semen analysis (CASA) (Copenhagen Rigshospitalet Image House Sperm Motility Analysis System (CRISMAS) 4.6 software) using semen samples from 166 young Danish men. The CRISMAS software identifies sperm concentration and classifies spermatozoa into three motility categories. To enable comparison of the two methods, the four motility stages obtained by conventional semen analysis were, based on their velocity classifications, divided into three stages, comparable to the three CRISMAS motility categories: rapidly progressive (A), slowly progressive (B) and non-progressive (C+D). Differences between the two methods were large for all investigated parameters (P <0.001). CRISMAS overestimated sperm concentration and the proportion of rapidly progressive spermatozoa and, consequently, underestimated the percentages of slowly progressive and non-progressive spermatozoa, compared to the conventional method. To investigate whether results drifted according to time of semen analysis, results were pooled into quarters according to date of semen analysis. CRISMAS motility results appeared more stable over time compared to the conventional analysis; however, neither method showed any trends. Apparently, CRISMAS CASA results and results from the conventional method were not comparable with respect to sperm concentration and motility analysis. This needs to be accounted for in clinics using this software and in studies of determinants of these semen characteristics.

  15. Fases previa y postcongelación del semen de verraco en pajillas de 5 ml y capacidad de fecundación de los espermatozoides

    Directory of Open Access Journals (Sweden)

    A. C\\u00F3rdova Izquierdo

    2004-01-01

    Full Text Available El objetivo de este trabajo fue estudiar el efecto de las fases previa y posterior a la congelación del semen de verraco en pajillas de 5 ml sobre la capacidad de fecundación in vitro (FIV de los espermatozoides. Se utilizaron 21 eyaculados de siete animales diferentes, se compararon semen fresco, tratado (semen con todos los componentes necesarios para llevar a cabo la congelación, antes de ser sometido a la fase de vapores de nitrógeno líquido y semen congelado en pajillas de 5 ml. Los resultados obtenidos fueron 93.81, 87.23 y 78.47 % de penetración espermática; 81.57, 76.44 y 69.11 % de monospermia; 12.24, 10.79 y 9.36 % de polispermia; 84.76, 84.28 y 47.14 % de motilidad; 79.76, 73.33 y 44.81 % de acrosomas normales (NAR para semen fresco, tratado y descongelado, respectivamente. Al realizar el análisis de varianza y la prueba de comparaciones múltiples, se encontraron diferencias estadísticamente significativas (p<0.05 entre semen fresco, tratado y descongelado. Por lo tanto, la disminución en la respuesta de los espermatozoides a la FIV ya se observa desde la fase previa a la congelación. Sin embargo, los resultados obtenidos con la FIV monospérmica, son prometedores para el uso del semen de verraco descongelado en la inseminación artificial.

  16. Concurrent quantification and comparative pharmacokinetic analysis of bioactive compounds in the Herba Ephedrae-Semen Armeniacae Amarum herb pair.

    Science.gov (United States)

    Song, Shuai; Chen, Feilong; Xing, Xuefeng; Ren, Mengyue; Ma, Qinhai; Xie, Ying; Tang, Qingfa; Luo, Jiabo

    2015-05-10

    The Mahuang-Xingren herb-pair (MX), the combination of Herba Ephedrae (Mahuang in Chinese) and Semen Armeniacae Amarum (Xingren in Chinese), is a classical combination used in traditional Chinese Medicine to treat asthma and bronchitis. A simple and reliable ultra-performance liquid chromatography-tandem mass spectrometry method was developed to simultaneously quantify and compare the pharmacokinetics of 5 ephedra alkaloids and epimers of amygdalin and prunasin in rat plasma after oral administration of Mahuang, Xingren, and MX aqueous extracts. Samples were pretreated by a single-step protein precipitation with acetonitrile, and diphenhydramine hydrochloride and puerarin were used as internal standards. Pharmacokinetic parameters were investigated using DAS 3.2.2 (Mathematical Pharmacology Professional Committee of China, Shanghai, China). The validated method demonstrated adequate sensitivity, selectivity, and process efficiency for the bioanalysis of 8 compounds, including 3 pairs of epimers. MX administration improved the bioavailability of amygdalin and prunasin. Furthermore, MX facilitated intake of lower doses of ephedra alkaloids and increased elimination rates in comparison with Mahuang alone. These results illustrate the rationale behind the preferred use of the combination of Mahuang and Xingren. To our knowledge, this is the first report of stereo-selective metabolism of amygdalin. Further, the metabolic mechanism underlying this phenomenon merits future research attention. PMID:25766850

  17. Recent adverse trends in semen quality and testis cancer incidence among Finnish men

    DEFF Research Database (Denmark)

    JØrgensen, N; Vierula, M

    2011-01-01

    Impaired semen quality and testicular cancer may be linked through a testicular dysgenesis syndrome of foetal origin. The incidence of testis cancer has been shown to increase among Finnish men, whereas there is no recent publication describing temporal trends in semen quality. Therefore, we carried out a prospective semen quality study and a registry study of testis cancer incidence among Finnish men to explore recent trends. A total of 858 men were investigated in the semen quality study during 1998-2006. Median sperm concentrations were 67 (95% CI 57-80) million/mL, 60 (51-71) and 48 (39-60) for birth cohorts 1979-81, 1982-83 and 1987; total sperm counts 227 (189-272) million, 202 (170-240) and 165 (132-207); total number of morphologically normal spermatozoa 18 (14-23) million, 15 (12-19) and 11 (8-15). Men aged 10-59 years at the time of diagnosis with testicular cancer during 1954-2008 were included in the registry study, which confirmed the increasing incidence of testicular cancer in recent cohorts. These simultaneous and rapidly occurring adverse trends suggest that the underlying causes are environmental and, as such, preventable. Our findings necessitate not only further surveillance of male reproductive health but also research to detect and remove the underlying factors.

  18. Maternal folic acid supplement intake and semen quality in Danish sons: a follow-up study

    DEFF Research Database (Denmark)

    Jacobsen, Kristoffer; Ramlau-Hansen, Cecilia HØst

    2011-01-01

    OBJECTIVE: To examine whether maternal folic acid supplement intake during pregnancy is related to better semen quality in male offspring. DESIGN: A follow-up study. SETTING: Two major Danish municipalities, Aalborg and Odense. PATIENT(S): The study population included 347 singleton sons of mothers enrolled into the Healthy Habits for Two cohort when pregnant in 1984-87. INTERVENTION(S): Information on maternal folic acid supplement intake during pregnancy was provided by self-administered questionnaire in the 36th week of gestation. MAIN OUTCOME MEASURE(S): Semen characteristics and serum concentrations of sex hormones. RESULT(S): The distribution of semen characteristics among sons whose mothers took folic acid supplement during pregnancy (n = 88, 25%) did not differ from the distributions among those without (n = 75, 22%) or with unknown folic acid supplement intake (n = 84, 53%). On the contrary, serum levels of FSH and LH were significantly higher in the folic acid supplement group. CONCLUSION(S): The hypothesis that folic acid supplement intake during pregnancy will improve semen quality in male offspring was not corroborated by a follow-up study in young Danish men.

  19. Effect of boron supplementation on semen quality estimates in mature boars

    Science.gov (United States)

    The objective of the study was to determine the effect of dietary boron supplementation on sperm production and semen quality estimates in mature boars. Twelve crossbred boars (Landrace x Large White x Duroc x Hampshire) that were 2.5 +/- 0.2 years of age and 215 +/- 5 kg were randomly assigned to ...

  20. A comparative evaluation of semen parameters in pre- and post-Hurricane Katrina human population

    Directory of Open Access Journals (Sweden)

    Caner Baran

    2015-01-01

    Full Text Available A natural disaster leading to accumulation of environmental contaminants may have substantial effects on the male reproductive system. Our aim was to compare and assess semen parameters in a normospermic population residing in the Southern Louisiana, USA area pre- and post-Hurricane Katrina. We retrospectively evaluated semen analyses data (n = 3452 of 1855 patients who attended the Tulane University Andrology/Fertility Clinic between 1999 and 2013. The study inclusion criteria were men whose semen analyses showed ? 1.5 ml volume; ?15 million ml -1 sperm concentration; ?39 million total sperm count; ?40% motility; >30% morphology, with an abstinence interval of 2-7 days. After the inclusion criteria applied to the population, 367 normospermic patients were included in the study. Descriptive statistics and group-based analyses were performed to interpret the differences between the pre-Katrina (Group 1, 1999-2005 and the post-Katrina (Group 2, 2006-2013 populations. There were significant differences in motility, morphology, number of white blood cell, immature germ cell count, pH and presence of sperm agglutination, but surprisingly there were no significant differences in sperm count between the two populations. This long-term comparative analysis further documents that a major natural disaster with its accompanied environmental issues can influence certain semen parameters (e.g., motility and morphology and, by extension, fertility potential of the population of such areas.

  1. Revisiting the assessment of semen viscosity and its relationship to leucocytospermia.

    Science.gov (United States)

    Flint, M; du Plessis, S S; Menkveld, R

    2014-10-01

    With infertility challenges posing an obstacle to many couples, the extension of variables to assess male fertility is an important line of research. At the Reproductive Biology Unit where the study was undertaken, a considerable proportion of male patient's seeking fertility assessment presented with hyperviscous semen samples and elevated concentrations of leucocytes. Despite viscosity being included as part of a routine spermiogram, it raises a considerable amount of concern as it is assessed semiquantitatively. The study was undertaken to evaluate the quantification of semen viscosity in centipoise (cP) and to investigate whether a correlation exists between hyperviscosity and leucocytospermia. A total of 200 semen samples were assessed from a sample cohort of two population groups: 162 male patients undergoing fertility assessment and 38 volunteer donors. Semen viscosity was determined by measuring the filling time of a capillary-loaded Leja chamber and quantifying the viscosity in cP. Leucocytes were identified histochemically with a leucocyte peroxidase test. The viscosity when quantified in cP was significantly higher in the peroxidase positive sample group (9.01 ± 0.49 vs. 7.39 ± 0.23 cP; P < 0.005). The introduction of a more accurate method of quantifying viscosity may possibly help to identify, diagnose and treat patients suffering from leucocytospermia to ultimately enhance their fertility potential. PMID:24007306

  2. ANEUPLOIDY AND CHROMOSOME BREAKAGE IN SWIM-UP VERSUS UNPROCESSED SEMEN FROM TWENTY HEALTHY MEN

    Science.gov (United States)

    Toxicologic and epidemiologic studies have investigated a number of factors believed to induce cytogenetic damage in human sperm cells in order to estimate heritable risk to future generations. Most of these studies, however, have not enriched research semen specimens for fertil...

  3. A comparative evaluation of semen parameters in pre- and post-Hurricane Katrina human population.

    Science.gov (United States)

    Baran, Caner; Hellstrom, Wayne J; Sikka, Suresh C

    2015-01-01

    A natural disaster leading to accumulation of environmental contaminants may have substantial effects on the male reproductive system. Our aim was to compare and assess semen parameters in a normospermic population residing in the Southern Louisiana, USA area pre- and post-Hurricane Katrina. We retrospectively evaluated semen analyses data (n = 3452) of 1855 patients who attended the Tulane University Andrology/Fertility Clinic between 1999 and 2013. The study inclusion criteria were men whose semen analyses showed ? 1.5 ml volume; ?15 million ml -1 sperm concentration; ?39 million total sperm count; ?40% motility; >30% morphology, with an abstinence interval of 2-7 days. After the inclusion criteria applied to the population, 367 normospermic patients were included in the study. Descriptive statistics and group-based analyses were performed to interpret the differences between the pre-Katrina (Group 1, 1999-2005) and the post-Katrina (Group 2, 2006-2013) populations. There were significant differences in motility, morphology, number of white blood cell, immature germ cell count, pH and presence of sperm agglutination, but surprisingly there were no significant differences in sperm count between the two populations. This long-term comparative analysis further documents that a major natural disaster with its accompanied environmental issues can influence certain semen parameters (e.g., motility and morphology) and, by extension, fertility potential of the population of such areas. PMID:25677132

  4. Apoptotic markers in semen of infertile men: association with cigarette smoking

    Scientific Electronic Library Online (English)

    Nagla T., El-Melegy; Mohamed-Esam M., Ali.

    2011-08-01

    Full Text Available OBJECTIVES: (i) To examine the role of apoptosis in the pathogenesis of DNA damage in semen from infertile men. (ii) To assess the effects of smoking on apoptotic markers and seminal parameters among infertile men. (iii) To assess the correlation of apoptosis with conventional semen parameters. MATE [...] RIALS AND METHODS: The study was carried out on 70 men with idiopathic infertility, divided into two groups: thirty infertile non smokers and forty infertile smokers. In addition to 60 fertile men (30 non smokers and 30 smokers) as control group. Each subject provided semen for analysis of parameters, determination of % of DNA fragmentation, s-Fas, caspase-3 activity levels and cotinine levels. RESULTS: The results revealed that infertile men, particularly smokers have significantly lower semen variables and significantly higher levels of apoptotic variables (% of DNA fragmentation, s-Fas and caspase-3 activity) in addition to cotinine. CONCLUSIONS: The present findings provide additional evidence supporting the importance of the evaluation of apoptotic markers to test male infertility particularly among smokers.

  5. COTININE CONCENTRATIONS IN SEMEN, URINE AND BLOOD OF SMOKERS AND NONSMOKERS

    Science.gov (United States)

    The extent to which ambient exposures to environmental chemicals results in exposures to human genetic material is poorly understood. he purpose of the current study is to document the presence of cotinine, a metabolite of nicotine but not a known mutagen, in the semen of men exp...

  6. SEMEN QUALITY AND REPRODUCTIVE HEALTH OF YOUNG CZECH MEN EXPOSED TO SEASONAL AIR POLLUTION

    Science.gov (United States)

    Semen quality and reproductive health of young Czech men exposed to seasonal air pollution. Selevan SG, Borkovec L, Slott VL, Zudova Z, Rubes J, Evenson DP, Perreault SD. U.S. Environmental Protection Agency, Washington, DC 20460, USA. This study of male repr...

  7. The limits for detection of activated caspases of spermatozoa by western blot in human semen.

    Science.gov (United States)

    Brugnon, F; Pons-Rejraji, H; Artonne, C; Janny, L; Grizard, G

    2012-08-01

    Detection of activated caspases of spermatozoa could be helpful to evaluate male infertility. Although western blot is validated as a highly specific method to detect the proteins extracted from cells, the ability of this technique to detect activated sperm caspases in human semen may be limited. Indeed, round cells, which potentially contain some activated caspases, may be present in semen and interfere with the detection of activated sperm caspases. Moreover, it is necessary to evaluate the minimum amount of spermatozoa necessary to optimise the detection of activated caspases in semen samples. Our results showed that interference due to round cells contained in semen with activated caspase-3 requires separation of spermatozoa by density migration. This sperm preparation selects a mature sperm population that does not reflect the whole sperm population, and in infertile men with oligoasthenoteratozoospermia, the amount of spermatozoa thus selected is usually low. Moreover, the western blot technique's low detection sensitivity and the low level of caspase enzyme activity in human spermatozoa for activated caspase-3, -8 and -9 mean that large quantities of spermatozoa are needed to detect the expression of the activated caspases. These limitations prevent this method being used for routine analysis in clinical practice. PMID:22292703

  8. Soybean lecithin-based extender preserves spermatozoa membrane integrity and fertilizing potential during goat semen cryopreservation.

    Science.gov (United States)

    Chelucci, Sara; Pasciu, Valeria; Succu, Sara; Addis, Daniela; Leoni, Giovanni G; Manca, Maria E; Naitana, Salvatore; Berlinguer, Fiammetta

    2015-04-01

    Soybean lecithin may represent a suitable alternative to egg yolk for semen cryopreservation in livestock species. However, additional studies are needed to elucidate its effects on spermatozoa functional properties. Semen collected from five Sarda bucks was cryopreserved in Tris-based extender and glycerol (4% v:v) with different supplementations. In a preliminary experiment, different soybean lecithin concentrations were tested (1%-6% wt/vol) and results in terms of viability, percentages of progressive motile and rapid spermatozoa, and DNA integrity after thawing showed that the most effective concentration was 1%. In the second experiment, semen was frozen in a Tris-based extender with no supplementation (EXT), with 1% lecithin (EXT LC), and 20% egg yolk (EXT EY). The effectiveness of these extenders was also compared with a commercial extender. The EXT EY led to the highest viability and motility parameters after freezing and thawing (P commercial extender; P < 0.01). The present study demonstrated that lecithin can be considered as a suitable alternative to egg yolk in goat semen cryopreservation, because it ensures higher fertilization rates and a better protection from membrane damage by cold shock. PMID:25595356

  9. Efeito da centrifugação sobre a qualidade do sêmen canino Effect of centrifugation on quality of canine semen

    Directory of Open Access Journals (Sweden)

    I.C.N. Cunha

    2009-02-01

    Full Text Available Avaliou-se o efeito da centrifugação sobre a viabilidade do sêmen canino e compararam-se três meios de diluição pré-centrifugação. Utilizaram-se 10 ejaculados completos de 10 cães que, após a avaliação inicial, foram divididos em quatro porções (grupos. Uma das amostras, não centrifugada, formou o grupo-controle; as outras foram diluídas em três diferentes meios e centrifugadas a 800 x g por 15 minutos, formando os grupos: CPSA - constituído por sêmen centrifugado em plasma seminal autólogo; CLG - sêmen centrifugado em meio à base de leite desnatado e glicose (LG; e CPer- sêmen centrifugado em gradientes de Percoll (45% e 90%. Após a centrifugação e a eliminação do sobrenadante, procedeu-se à ressuspensão de todas as porções do ejaculado em LG e à imediata avaliação quanto à motilidade, vigor, aglutinação espermática e integridade das membranas espermáticas. Todas as suspensões foram, então, incubadas a 37ºC por 30 minutos e reavaliadas. O processo de centrifugação não causou danos aos espermatozoides e a centrifugação em meio LG melhorou a viabilidade espermática.The effect of the centrifugation process on canine sperm viability was evaluated using three different precentrifugation extenders in the process. After an initial evaluation, ten complete ejaculates from ten dogs were used and subdivided in four groups. One sample of semen was not centrifuged and was used as control and the remaining samples of semen were diluted in three different extenders and centrifuged at 800 x g per 15 minutes, performing groups: CPSA- centrifuged in autologous seminal fluid, CLGcentrifuged in skim milk plus glucose extender (LG, and CPer- centrifuged under Percoll gradient (45% and 90%. After centrifugation, the resulting pellets were diluted in LG and evaluated for motility, viability, sperm agglutination, and spermatic membrane integrity. All the samples were incubated at 37ºC for 30 minutes and the evaluations were performed again. Centrifugation procedures did not induce damage to canine spermatozoa and samples centrifuged and diluted in skim milk plus glucose extender remained with better viability.

  10. Efeito da centrifugação sobre a qualidade do sêmen canino / Effect of centrifugation on quality of canine semen

    Scientific Electronic Library Online (English)

    I.C.N., Cunha; M.D., Lopes.

    2009-02-01

    Full Text Available Avaliou-se o efeito da centrifugação sobre a viabilidade do sêmen canino e compararam-se três meios de diluição pré-centrifugação. Utilizaram-se 10 ejaculados completos de 10 cães que, após a avaliação inicial, foram divididos em quatro porções (grupos). Uma das amostras, não centrifugada, formou o [...] grupo-controle; as outras foram diluídas em três diferentes meios e centrifugadas a 800 x g por 15 minutos, formando os grupos: CPSA - constituído por sêmen centrifugado em plasma seminal autólogo; CLG - sêmen centrifugado em meio à base de leite desnatado e glicose (LG); e CPer- sêmen centrifugado em gradientes de Percoll (45% e 90%). Após a centrifugação e a eliminação do sobrenadante, procedeu-se à ressuspensão de todas as porções do ejaculado em LG e à imediata avaliação quanto à motilidade, vigor, aglutinação espermática e integridade das membranas espermáticas. Todas as suspensões foram, então, incubadas a 37ºC por 30 minutos e reavaliadas. O processo de centrifugação não causou danos aos espermatozoides e a centrifugação em meio LG melhorou a viabilidade espermática. Abstract in english The effect of the centrifugation process on canine sperm viability was evaluated using three different precentrifugation extenders in the process. After an initial evaluation, ten complete ejaculates from ten dogs were used and subdivided in four groups. One sample of semen was not centrifuged and w [...] as used as control and the remaining samples of semen were diluted in three different extenders and centrifuged at 800 x g per 15 minutes, performing groups: CPSA- centrifuged in autologous seminal fluid, CLGcentrifuged in skim milk plus glucose extender (LG), and CPer- centrifuged under Percoll gradient (45% and 90%). After centrifugation, the resulting pellets were diluted in LG and evaluated for motility, viability, sperm agglutination, and spermatic membrane integrity. All the samples were incubated at 37ºC for 30 minutes and the evaluations were performed again. Centrifugation procedures did not induce damage to canine spermatozoa and samples centrifuged and diluted in skim milk plus glucose extender remained with better viability.

  11. Differences in ability of jennies and mares to conceive with cooled and frozen semen containing glycerol or not.

    Science.gov (United States)

    Vidament, Marianne; Vincent, Pierrick; Martin, François-Xavier; Magistrini, Michele; Blesbois, Elisabeth

    2009-05-01

    A suitable method for the cryopreservation of donkey semen would be very valuable for the ex situ management of genetic diversity in this species. This report uses a variety of observation and trials to evaluate the effect of cryoprotectants in per-cycle pregnancy rates (PC) in equids females (jennies (donkey) and mares (horse)). This was explored by (1) comparing the results of insemination of jennies and mares with cooled or frozen donkey semen, (2) examining the possible toxic effect of the cryoprotectant (CPA) glycerol in these two species and (3) studying alternative solutions. Donkey and horse semen was either used immediately, or cooled according to some steps of the pre-freezing procedure or frozen and thawed. The pre-freezing procedure included semen dilution, centrifugation, resuspension in milk or in INRA82+2% egg yolk+various % CPA (expressed as final concentrations in extended semen (v/v)) and then cooling to 4 degrees C. PC was similar in mares and jennies inseminated with donkey semen cooled to 4 degrees C in milk. However, the PC was significantly higher in mares than in jennies when donkey semen was frozen with 2.2% glycerol (36%, n=50 cycles vs. 11%, n=38 cycles; Psemen resulted in a progressive decrease in mare PC (87, 53, 53, 13% (n=15 cycles for each concentration); Psemen decreased the PC measured in jennies to 0. The replacement of glycerol by 2% dimethylformamide increased the fertility obtained in jennies with cooled donkey semen (PC: 67%, n=12 cycles) but did not increase the fertility obtained with frozen-thawed donkey semen (PC: 11%, n=28 cycles with dimethylformamide vs. 0%, n=16 cycles with glycerol). In conclusion, this study clearly shows that the ability of jennies to conceive after AI with donkey frozen semen is lower than that of mares. Glycerol affects the fertility of donkey and stallion spermatozoa as early as during the pre-freezing procedure. In consequence, the glycerol level must be low in frozen equine semen to provide good fertility. The toxic dose of glycerol for donkey spermatozoa seems to be almost half that for stallion spermatozoa. Whether this greater sensitivity of donkey spermatozoa to glycerol is responsible for the low success of semen cryopreservation in jennies is not so obvious because replacement of glycerol by dimethylformamide was not much more effective in terms of fertility. PMID:18502059

  12. Cryopreservation of semen from functional sex-reversed genotypic females of the rainbow trout, Oncorhynchus mykiss

    Directory of Open Access Journals (Sweden)

    Alexandre Ninhaus-Silveira

    2006-01-01

    Full Text Available Cryopreservation of semen from sex-reversed females of rainbow trout aims at rationalizing the production of stocks composed by 100% females. Semen from normal males (M and two types of genotypic females (R and G, sex-reversed by the oral administration of 17alpha-methyltestosterone, were used. R was obtained by the fertilization of normal eggs with semen of sex-reversed females while G via gynogenetic reproduction. Semen was diluted in an extender solution (glucose 5,4 g, egg yolk 10 ml, dimetil sulfoxide 10 ml, water 80 ml at 1:3 ratio (semen/extender, stored in straws of 0.5 ml and freezed in a dry container Cryopac CP-65, at -180ºC. Thawing was performed with water at 70ºC for 3 seconds. There were no significant fertilization rate differences (P>0.05 among thawed semen groups (M = 73.1±11.5%; R = 67.2±23.6%; G = 64±5.8%, confirming that the freezing methodology used was efficient to cryopreserve semen of all three trout groups.A criopreservação do sêmen de fêmeas masculinizadas de truta arco-íris tem como objetivo a racionalização do processo de produção de estoques 100% femininos. Para tal, foi coletado sêmen de machos normais (M e de dois tipos de fêmeas genotípicas (R e G, masculinizadas pela administração oral de 17alfa-metiltestosterona. R foi obtido pela fertilização de ovócitos normais com sêmen de fêmeas masculinizadas enquanto G foi através de reprodução ginogenética. O sêmen foi diluído em uma solução crioprotetora (glicose 5,4 g, gema de ovo de galinha 10 ml, dimetil sulfóxido 10 ml, água destilada 80 ml na razão de 1:3 (sêmen/diluidor, envasado em palhetas de 0,5 ml e congelado em um "container" tipo "seco" Cryopac CP-65, à temperatura de -180ºC. A descongelação foi feita em água a 70ºC por 3 segundos. As taxas de fertilização obtidas, não revelaram diferença estatística significativa (P<0.05 entre os três grupos de sêmen descongelados (M = 73,1±11,5%; R = 67,2±23,6%; G = 64±5,8%, indicando que a metodologia de congelação utilizada foi eficaz, tanto na criopreservação do sêmen das trutas normais como para o das masculinizadas.

  13. Cryopreservation of semen from functional sex-reversed genotypic females of the rainbow trout, Oncorhynchus mykiss

    Scientific Electronic Library Online (English)

    Alexandre, Ninhaus-Silveira; Fausto, Foresti; Yara Aiko, Tabata; Marcos Guilherme, Rigolino; Rosicleire, Veríssimo-Silveira.

    2006-01-01

    Full Text Available A criopreservação do sêmen de fêmeas masculinizadas de truta arco-íris tem como objetivo a racionalização do processo de produção de estoques 100% femininos. Para tal, foi coletado sêmen de machos normais (M) e de dois tipos de fêmeas genotípicas (R e G), masculinizadas pela administração oral de 17 [...] alfa-metiltestosterona. R foi obtido pela fertilização de ovócitos normais com sêmen de fêmeas masculinizadas enquanto G foi através de reprodução ginogenética. O sêmen foi diluído em uma solução crioprotetora (glicose 5,4 g, gema de ovo de galinha 10 ml, dimetil sulfóxido 10 ml, água destilada 80 ml) na razão de 1:3 (sêmen/diluidor), envasado em palhetas de 0,5 ml e congelado em um "container" tipo "seco" Cryopac CP-65, à temperatura de -180ºC. A descongelação foi feita em água a 70ºC por 3 segundos. As taxas de fertilização obtidas, não revelaram diferença estatística significativa (P Abstract in english Cryopreservation of semen from sex-reversed females of rainbow trout aims at rationalizing the production of stocks composed by 100% females. Semen from normal males (M) and two types of genotypic females (R and G), sex-reversed by the oral administration of 17alpha-methyltestosterone, were used. R [...] was obtained by the fertilization of normal eggs with semen of sex-reversed females while G via gynogenetic reproduction. Semen was diluted in an extender solution (glucose 5,4 g, egg yolk 10 ml, dimetil sulfoxide 10 ml, water 80 ml) at 1:3 ratio (semen/extender), stored in straws of 0.5 ml and freezed in a dry container Cryopac CP-65, at -180ºC. Thawing was performed with water at 70ºC for 3 seconds. There were no significant fertilization rate differences (P>0.05) among thawed semen groups (M = 73.1±11.5%; R = 67.2±23.6%; G = 64±5.8%), confirming that the freezing methodology used was efficient to cryopreserve semen of all three trout groups.

  14. Studies on liquefaction and storage of ejaculated dromedary camel (Camelus dromedarius) semen.

    Science.gov (United States)

    Wani, N A; Billah, M; Skidmore, J A

    2008-12-01

    The purpose of this study was to evaluate seminal liquefaction and quality of ejaculated camel semen during storage in different extenders at room (23 degrees C) and refrigeration (4 degrees C) temperature. Semen was collected using an artificial vagina and diluted immediately (1:1), using a split-sample technique, in five extenders [(1) Tris-tes egg yolk, (2) Tris-lactose egg yolk, (3) citrate egg yolk, (4) sucrose egg yolk and (5) Tris-fructose egg yolk], while one fraction was kept without an extender to act as control. The semen was transported to the lab at 37 degrees C, in a portable incubator within half an hour, and thereafter liquefaction of semen was monitored every 15 min. After complete liquefaction of the semen it was evaluated for sperm concentration and morphology and then was extended to a final ratio of 1:3. Aliquots of each semen sample were then stored at refrigeration and room temperature. The average volume of an ejaculate was 4.3+/-0.4 mL and it had a very viscous consistency. The average concentration of spermatozoa was 230.4+/-10.7 x 10(6)mL(-1) and the proportion of spermatozoa with protoplasmic droplets averaged 1.02+/-0.2, while 2.7+/-0.6 and 9.7+/-2.9% had mid-piece and tail abnormalities, respectively. All extended semen samples liquefied within 1.5h at 37 degrees C, however, there was slow liquefaction in the sample without an added extender (control). Best liquefaction was observed in Tris-lactose extender followed by Tris-fructose and citrate egg yolk diluents whereas in the other two extenders there was head-to-head agglutination of the spermatozoa. There was no difference in the initial motility of the spermatozoa in extenders 1-5 after its liquefaction, however, after 24 and 48 h of storage a higher proportion of spermatozoa were motile in extenders 1, 2 and 4 (Pegg yolk, Tris-tes egg yolk and sucrose egg yolk diluents. However, best liquefaction and progressive sperm motility is achieved in Tris-lactose egg yolk extender. PMID:18082979

  15. Dietary ?-linolenic acid from flaxseed oil or eicosapentaenoic and docosahexaenoic acids from fish oil differentially alter fatty acid composition and characteristics of fresh and frozen-thawed bull semen.

    Science.gov (United States)

    Moallem, Uzi; Neta, Noam; Zeron, Yoel; Zachut, Maya; Roth, Zvi

    2015-04-15

    Incorporation rates of dietary omega-3 (n-3) fatty acids (FAs) from different sources into bull plasma and sperm and the effects on physiological characteristics of fresh and frozen-thawed semen were determined. Fifteen fertile bulls were assigned to three treatment groups and supplemented for 13 weeks with encapsulated fat: (1) SFA-360 g/d per bull saturated FA; (2) FLX-450 g/d per bull providing 84.2 g/d C18:3n-3 (?-linolenic acid) from flaxseed oil; and (3) FO-450 g/d per bull providing 8.7 g/d C20:5n-3 (eicosapentaenoic acid) and 6.5 g/d C22:6n-3 (docosahexaenoic acid, DHA) from fish oil. Blood samples were taken every 2 weeks and semen was collected weekly. With respect to the FA supplements, the proportion of ?-linolenic acid in plasma increased in the FLX bulls, whereas that of DHA was increased in the FO bulls, within 2 weeks. However, changes in the sperm FA fraction were first expressed in the sixth week of supplementation: in the FO and FLX bulls the DHA proportion increased (P DHA in sperm can be increased at the expense of DPAn-6 by either FO or FLX supplementation, indicating de novo elongation and desaturation of short- into longer-chain n-3 FAs in testes. Furthermore, the moderate exchange of DHA and DPAn-6 in the FLX group's sperm was associated with changes in the characteristics of both fresh and frozen-thawed semen, suggesting the importance of the ratio between these two FAs for sperm structure and function. PMID:25617988

  16. Semen quality, reproductive hormones and fertility of men operated for hypospadias

    DEFF Research Database (Denmark)

    Asklund, C; Jensen, Tina Kold

    2010-01-01

    The testicular function of men previously operated for hypospadias has been sparsely investigated. Therefore, we investigated semen quality and reproductive hormones of 92 men with isolated hypospadias (IH) and 20 with hypospadias and additional genital disorders (HAGD) and compared with similar results from young men from the general Danish population. All participants lived the Copenhagen area of Denmark. Additionally, fertility information on 1083 men registered as operated for hypospadias was retrieved from national registries. The semen quality of men with IH did not differ from controls, but was reduced in men with HAGD. Median values for IH and HAGD were, respectively: sperm concentration 52 and 32 million (mill)/mL (p = 0.02), total sperm counts 173 and 101 mill (p = 0.03), motile spermatozoa 70 and 58% (p = 0.007) and morphological normal spermatozoa 9 and 4% (p = 0.004). Men with IH had a slight increase in follicle stimulating hormone and luteinizing hormone levels, whereas men with HAGD had more pronounced disturbances. 24.0% of the 1083 men operated for hypospadias were registered as fathers to at least one child, whereas the corresponding number in the general age-matched population was 29.4% (p <0.01). In conclusion, the majority of men with IH had normal semen quality, whereas it was reduced for men with HAGD. However, reproductive hormone levels indicated a subtle impairment of testicular function also in men with IH. An observed lower number of fathers among men with hypospadias may be because of psychosocial aspects, sexual dysfunction or reduced semen quality or a combination of these factors. Our results should be reassuring for patients with mild forms of IH and their relatives. They can be informed that hypospadias in such cases is not generally associated with poor semen quality. Particularly among patients with HAGD, several may, however, need fertility treatment to reproduce.

  17. Use of cryotubes for the cryopreservation of tambaqui fish semen (Colossoma macropomum).

    Science.gov (United States)

    Maria, Alexandre Nizio; Carvalho, Allan Charles Marques; Araújo, Rafael Venâncio; Santos, Jadson Pinheiro; Carneiro, Paulo César Falanghe; Azevedo, Hymerson Costa

    2015-04-01

    Tambaqui (Colossoma macropomum) is a freshwater fish of great importance to aquaculture in several South American countries. Recent studies have developed a protocol for semen cryopreservation in 0.25 and 0.5 mL straws; however, this technique has limitations for fingerling production at a large scale due to the high fecundity of tambaqui. The main objective of this study was to evaluate the feasibility of using cryotubes (1.6 and 4.5 mL) for tambaqui semen cryopreservation. Semen samples were diluted in freezing solution (5% glucose solution, 10% methylglycol, 5% egg yolk), stored in 1.6 and 4.5 mL cryotubes, frozen in liquid nitrogen vapor at -175°C and transferred to a cryogenic container at -196°C. The cryotubes were thawed in a water bath at 60°C for 70 or 90 s and the motility (total motility - TM; progressive motility - PM; curvilinear velocity - VCL; straight line velocity - VSL and average path velocity - VAP) and the viability of sperm were evaluated. There was no significant difference in sperm motility and viability post-thawing between 1.6 and 4.5m L cryotubes, except for TM (47% and 40%, respectively). Thawing for 90 s provided better results, being used in fertilization trials. Although the fertilization rate did not differ between the cryotubes (41-45%), it was significantly lower than that for fresh semen (74%). A strong positive correlation was observed between the sperm motility and fertilization rate (r=0.69-0.89). We conclude that 1.6 and 4.5 mL cryotubes have high potential for tambaqui semen cryopreservation when thawed for a minimum time of 90 s at 60°C. PMID:25725470

  18. Genetic parameters and breeding values for semen characteristics in Hanoverian stallions.

    Science.gov (United States)

    Labitzke, D; Sieme, H; Martinsson, G; Distl, O

    2014-08-01

    The objectives of this study were to show whether semen traits of 30 Hanoverian stallions regularly used in AI may be useful for breeding purposes. Semen characteristics were studied using 15 149 ejaculates from 30 Hanoverian stallions of the State Stud Celle of Lower Saxony. Semen samples were collected between 2005 and 2009. Traits analysed were gel-free volume, sperm concentration, total and motile sperm number and progressive motility. A linear multivariate animal model was employed to estimate heritabilities and permanent environmental variances for stallions. The same model was used to predict breeding values for all traits simultaneously. Heritabilities were high for gel-free volume (h(2) = 0.43) and moderate for total number of sperm (h(2) = 0.29) and progressive motility (h(2) = 0.20). Gel-free volume, sperm concentration and total number of sperm were genetically negatively correlated with progressive motility. The effect of the permanent environment for stallions accounted for 9-55% of the trait variance. The total variance among stallions explained 37-69% of the trait variance. The average reliabilities of the breeding values were 0.43-0.76 for the 30 Hanoverian stallions. In conclusion, the study could demonstrate large effects of stallions, routinely employed in a breeding programme, on semen characteristics analysed here. We could demonstrate that estimated breeding values (EBV) with sufficient high reliabilities can be predicted using data from these stallions and these EBV are useful in horse breeding programmes to achieve genetic improvement in semen quality. PMID:24891229

  19. Effect of split ejaculation and seminal extenders on longevity of donkey semen preserved at 5° C

    Directory of Open Access Journals (Sweden)

    Mello S.L.V.

    2000-01-01

    Full Text Available The aim of this study was to evaluate the longevity of donkey sperm comparing the rich seminal fraction and the whole semen in two extenders, Kenney and modified Baken extenders. Semen of five donkeys were collected through an open-end artificial vagina once a week for five consecutive weeks. The two first jets (rich fraction of semen were collected separately from the rest of the ejaculate. Whole semen samples were obtained mixing proportionally part of the rich with part of the poor seminal fractions. Seminal samples were immediately diluted 1:1 in each extender and maintained at room temperature during sperm concentration analysis. Samples were further diluted to rich 50×10(6 sperm per ml, cooled in a refrigerator at the initial rate of -0.6° C/min and preserved at 5° C. Total motility (TM, progressive motility (PM and sperm vigor (V were examined after final dilution and cooling, and every 24 hours up to the decrease of total motility under 10%. Sperm morphology was evaluated using a phase contrast microscope directly after dilution, on days 3, 6 and 9 post collection. It was used a 2×2 factorial design in a randomised bloc experiment, and means were compared by Student?s t test. Longevity did not vary between the rich seminal fraction and the whole semen for both extenders used. TM, PM, V and sperm morphology were better preserved in the extender with egg yolk (modified Baken extender than in the one with skimmed milk (Kenney in both seminal fractions.

  20. Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad Micoplasma hominis, Ureaplasma urealyticum and aerobic bacteria present in the semen from men attending infertility service

    Directory of Open Access Journals (Sweden)

    Bertha Victoria Rodríguez Pendás

    2013-04-01

    Full Text Available Introducción: las infecciones en el semen humano pueden alterar la calidad espermática, y vincularse con problemas de infertilidad masculina. Objetivo: determinar la frecuencia de infecciones por Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad, e identificar si existe relación entre las infecciones encontradas y las alteraciones en las variables de calidad del semen. Métodos: se realizó un estudio descriptivo transversal, para evaluar muestras de semen de 140 hombres, con edades entre 20 y 45 años, provenientes de las consultas de infertilidad del Instituto Nacional de Endocrinología. Se realizó un espermograma completo, que incluyó leucocitospermia, siguiendo los lineamientos de la OMS, para determinar las variables cualitativas y cuantitativas del semen. Las muestras de semen fueron cultivadas en agar sangre y agar chocolate a 37° C en atmósfera de CO2 para investigar bacterias aeróbicas, y se utilizó un juego de reactivos (Mycoplasma System Plus que permite realizar el cultivo, la identificación, el conteo semicuantitativo y el antibiograma de micoplasmas/ureaplasma urogenitales. Se tuvo en cuenta los aspectos éticos, y los resultados obtenidos se analizaron mediante cálculo de por cientos y la aplicación de la prueba de chi cuadrado. Resultados: de las 140 muestras de semen evaluadas, 58 (41,4 % mostraron la presencia de infecciones, de ellas 37 correspondieron a Ureaplasma urealyticum (25,7 %, 2 a Micoplasma hominis (1,4 % y 19 a bacterias aeróbicas (13,8 %. Al comparar las variables cualitativas y cuantitativas del semen con los sujetos infectados y no infectados, no se observaron diferencias estadísticamente significativas en ninguna de las variables de calidad espermática evaluadas. Conclusiones: la frecuencia total de infecciones, en la muestra estudiada, fue relativamente alta, pero no asociada a alteraciones en las variables seminales.Introduction: human semen infections can alter the sperm quality and be associated to male infertility disorders. Objectives: to determine the frequency of infections from Micoplasma hominis, Ureaplasma urealyticum and other aerobic bacteria in the semen of men who attended the infertility service, and to identify whether there is some relation between the detected infections and the altered semen quality variables or not. Methods: a cross-sectional descriptive study was performed to evaluate semen samples from 140 men aged 20 to 45 years, who attended the infertility service at the National Institute of Endocrinology. According to the WHO guidelines, a complete spermiogram including leukocytospermia was performed in order to determine the qualitative and quantitative variables in the semen. The semen samples were cultured in blood agar and in chocolate agar at 37oC under CO2 environment to find out possible aerobic bacteria. To this end, a set of reagents known as Mycoplasma System Plus was used, allowing the culture, the identification, the semi-quantitative count and the antibiogram of urogenital mycoplasms/ureaplasms. The ethical aspects were allowed for; the results were analyzed through percentage estimations and the chi square test. Results: out of the 140 evaluated semen samples, 58 (41.4 % showed some infection, 37 of them were caused by Ureaplasma urealyticum (25.7 %, 2 by Micoplasma hominis (1.4 % and 19 by the aerobic bacteria (13.8 %. When making a comparison of the qualitative and quantitative variables of the semen from infected and non-infected subjects, there were not any statistically significant differences in the evaluated variables of the sperm quality. Conclusions: the total frequency of infections in the studied sample was relatively high, but was not associated to altered seminal variables.

  1. Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad / Micoplasma hominis, Ureaplasma urealyticum and aerobic bacteria present in the semen from men attending infertility service

    Scientific Electronic Library Online (English)

    Bertha Victoria, Rodríguez Pendás; Cecilia, Ortiz Rodríguez; Felipe, Santana Pérez; Emma, Domínguez Alonso; Blanca, Nurquez Guerra.

    2013-04-01

    Full Text Available Introducción: las infecciones en el semen humano pueden alterar la calidad espermática, y vincularse con problemas de infertilidad masculina. Objetivo: determinar la frecuencia de infecciones por Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan po [...] r infertilidad, e identificar si existe relación entre las infecciones encontradas y las alteraciones en las variables de calidad del semen. Métodos: se realizó un estudio descriptivo transversal, para evaluar muestras de semen de 140 hombres, con edades entre 20 y 45 años, provenientes de las consultas de infertilidad del Instituto Nacional de Endocrinología. Se realizó un espermograma completo, que incluyó leucocitospermia, siguiendo los lineamientos de la OMS, para determinar las variables cualitativas y cuantitativas del semen. Las muestras de semen fueron cultivadas en agar sangre y agar chocolate a 37° C en atmósfera de CO2 para investigar bacterias aeróbicas, y se utilizó un juego de reactivos (Mycoplasma System Plus) que permite realizar el cultivo, la identificación, el conteo semicuantitativo y el antibiograma de micoplasmas/ureaplasma urogenitales. Se tuvo en cuenta los aspectos éticos, y los resultados obtenidos se analizaron mediante cálculo de por cientos y la aplicación de la prueba de chi cuadrado. Resultados: de las 140 muestras de semen evaluadas, 58 (41,4 %) mostraron la presencia de infecciones, de ellas 37 correspondieron a Ureaplasma urealyticum (25,7 %), 2 a Micoplasma hominis (1,4 %) y 19 a bacterias aeróbicas (13,8 %). Al comparar las variables cualitativas y cuantitativas del semen con los sujetos infectados y no infectados, no se observaron diferencias estadísticamente significativas en ninguna de las variables de calidad espermática evaluadas. Conclusiones: la frecuencia total de infecciones, en la muestra estudiada, fue relativamente alta, pero no asociada a alteraciones en las variables seminales. Abstract in english Introduction: human semen infections can alter the sperm quality and be associated to male infertility disorders. Objectives: to determine the frequency of infections from Micoplasma hominis, Ureaplasma urealyticum and other aerobic bacteria in the semen of men who attended the infertility service, [...] and to identify whether there is some relation between the detected infections and the altered semen quality variables or not. Methods: a cross-sectional descriptive study was performed to evaluate semen samples from 140 men aged 20 to 45 years, who attended the infertility service at the National Institute of Endocrinology. According to the WHO guidelines, a complete spermiogram including leukocytospermia was performed in order to determine the qualitative and quantitative variables in the semen. The semen samples were cultured in blood agar and in chocolate agar at 37oC under CO2 environment to find out possible aerobic bacteria. To this end, a set of reagents known as Mycoplasma System Plus was used, allowing the culture, the identification, the semi-quantitative count and the antibiogram of urogenital mycoplasms/ureaplasms. The ethical aspects were allowed for; the results were analyzed through percentage estimations and the chi square test. Results: out of the 140 evaluated semen samples, 58 (41.4 %) showed some infection, 37 of them were caused by Ureaplasma urealyticum (25.7 %), 2 by Micoplasma hominis (1.4 %) and 19 by the aerobic bacteria (13.8 %). When making a comparison of the qualitative and quantitative variables of the semen from infected and non-infected subjects, there were not any statistically significant differences in the evaluated variables of the sperm quality. Conclusions: the total frequency of infections in the studied sample was relatively high, but was not associated to altered seminal variables.

  2. Qualidade espermática de sêmen de cães naturalmente infectados por Leishmania sp: / Semen quality of dogs naturally infected by Leishmania sp

    Scientific Electronic Library Online (English)

    É., Labat; J.T., Carreira; B.H., Matsukuma; M.T.A., Martins; V.M.F., Lima; S.R.M., Bomfim; S.H.V., Perri; M.B., Koivisto.

    2010-06-01

    Full Text Available Avaliaram-se alterações espermáticas associadas à infecção por leishmaniose no sêmen de cães naturalmente infectados, utilizando-se, durante oito semanas consecutivas, ejaculados de seis cães soronegativos e seis cães soropositivos. As amostras foram colhidas uma vez por semana e avaliadas quanto ao [...] volume, concentração, motilidade, vigor, morfologia espermática, integridade da cromatina, avaliação simultânea da integridade da membrana plasmática, acrossoma e potencial mitocondrial. Concomitantemente foram dosadas a proteína total do plasma seminal e sanguíneo. A leishmaniose visceral causou aumento dos defeitos maiores e menores nos espermatozoides dos animais acometidos pelo estágio moderado a severo da doença. Em estágios mais avançados da enfermidade, a integridade das membranas acrossomal e plasmática foi afetada negativamente. Não foi possível estabelecer um critério quanto à avaliação do potencial mitocondrial. A incidência de alterações morfológicas nos animais acometidos não promoveu aumento de injurias à cromatina. Todos os animais com leishmaniose apresentaram hiperproteinemia do sêmen. Abstract in english The spermatic changes associated with the natural infection in dogs by Leishmania sp was evaluated during eight consecutive weeks, using ejaculates of six seronegative and six seropositive dogs. The samples were collected once a week and evaluated for volume, concentration, motility, vigor, sperm mo [...] rphology, chromatin integrity, simultaneous evaluation of the plasmatic membrane integrity, acrosome, and mitochondrial potential. The total proteins of the seminal plasma and blood were measured. The visceral leishmaniasis caused increase of major and minor defects in spermatozoa of animals attacked by moderate to severe stages of the disease. In more advanced stages of the illness, the acrosomal and plasmatic membranes integrity was adversely affected. It was not possible to establish a pattern refering the evaluation of the mitochondrial potential. The incidence of morphological changes in the seropositive animals did not promote an increase of injuries to the chromatin. All animals with leishmaniasis presented hyperproteinemia of the semen.

  3. Qualidade espermática de sêmen de cães naturalmente infectados por Leishmania sp: Semen quality of dogs naturally infected by Leishmania sp

    Directory of Open Access Journals (Sweden)

    É. Labat

    2010-06-01

    Full Text Available Avaliaram-se alterações espermáticas associadas à infecção por leishmaniose no sêmen de cães naturalmente infectados, utilizando-se, durante oito semanas consecutivas, ejaculados de seis cães soronegativos e seis cães soropositivos. As amostras foram colhidas uma vez por semana e avaliadas quanto ao volume, concentração, motilidade, vigor, morfologia espermática, integridade da cromatina, avaliação simultânea da integridade da membrana plasmática, acrossoma e potencial mitocondrial. Concomitantemente foram dosadas a proteína total do plasma seminal e sanguíneo. A leishmaniose visceral causou aumento dos defeitos maiores e menores nos espermatozoides dos animais acometidos pelo estágio moderado a severo da doença. Em estágios mais avançados da enfermidade, a integridade das membranas acrossomal e plasmática foi afetada negativamente. Não foi possível estabelecer um critério quanto à avaliação do potencial mitocondrial. A incidência de alterações morfológicas nos animais acometidos não promoveu aumento de injurias à cromatina. Todos os animais com leishmaniose apresentaram hiperproteinemia do sêmen.The spermatic changes associated with the natural infection in dogs by Leishmania sp was evaluated during eight consecutive weeks, using ejaculates of six seronegative and six seropositive dogs. The samples were collected once a week and evaluated for volume, concentration, motility, vigor, sperm morphology, chromatin integrity, simultaneous evaluation of the plasmatic membrane integrity, acrosome, and mitochondrial potential. The total proteins of the seminal plasma and blood were measured. The visceral leishmaniasis caused increase of major and minor defects in spermatozoa of animals attacked by moderate to severe stages of the disease. In more advanced stages of the illness, the acrosomal and plasmatic membranes integrity was adversely affected. It was not possible to establish a pattern refering the evaluation of the mitochondrial potential. The incidence of morphological changes in the seropositive animals did not promote an increase of injuries to the chromatin. All animals with leishmaniasis presented hyperproteinemia of the semen.

  4. Evaluation of bison (Bison bison) semen from Yellowstone National Park, Montana, USA, bulls for Brucella abortus shedding.

    Science.gov (United States)

    Frey, Rebecca K; Clarke, P Ryan; McCollum, Matt P; Nol, Pauline; Johnson, Kammy R; Thompson, Brent D; Ramsey, Jennifer M; Anderson, Neil J; Rhyan, Jack C

    2013-07-01

    To determine if bison (Bison bison) bulls from Yellowstone National Park (YNP), Montana, USA, shed an infective dose of Brucella abortus in semen, 50 YNP bulls were captured on public lands in Montana during the winter and early spring (April-May) of 2010 and 2011. The bulls were immobilized, and blood and semen samples were collected for serology and Brucella culture. Thirty-five bulls (70%) were antibody-positive, and B. abortus was cultured from semen in three (9%) of the 35 antibody-positive or suspect bulls, though not at concentrations considered an infective dose. Eight bulls (six antibody-positive, two negative) had palpable lesions of the testes, epididymides, or seminal vesicles consistent with B. abortus infection. Breeding soundness exams and semen analysis suggested that antibody-positive bulls were more likely to have nonviable ejaculate (8/35; 23%) than bulls without detectable antibody (2/15; 13%). PMID:23778628

  5. Methylation loss at H19 imprinted gene correlates withmethylenetetrahydrofolate reductase gene promoter hypermethylation in semen samples from infertile males

    OpenAIRE

    Rotondo, John C; Selvatici, Rita; Di Domenico, Maura; Marci, Roberto; Vesce, Fortunato; Tognon, Mauro; Martini, Fernanda

    2013-01-01

    Aberrant methylation at the H19 paternal imprinted gene has been identified in different cohorts of infertile males. The causes of H19 methylation errors are poorly understood. In this study, we investigated the methylation status of the H19 gene in semen DNA samples from infertile males affected by MTHFR gene promoter hypermethylation. DNA from normal and abnormal semen samples harbouring MTHFR gene promoter hypermethylated, hmMTHFR-nor and hmMTHFR-abn, and without MTHFR methylation, MTHFR-n...

  6. Regional differences and temporal trends in male reproductive health disorders : semen quality may be a sensitive marker of environmental exposures

    DEFF Research Database (Denmark)

    Nordkap, Loa; Joensen, Ulla Nordström

    2012-01-01

    The decline in semen quality has been the subject of an animated debate. A recent prospective study now irrefutably shows a decline in semen quality in men from Finland, a country that previously boasted good semen quality. Semen quality has, in some countries, reached a level where a considerable fraction of young men are at risk of fertility problems. Impaired semen quality, testicular cancer, cryptorchidism and hypospadias are risk factors for each other, and the testicular dysgenesis syndrome (TDS) has been put forward to explain the observations. This syndrome implies that the four disease entities share the same patho-physiological etiology caused by disturbed testicular development in early fetal life. It seems likely that the rapid rise in TDS-associated conditions can, at least partly, be explained by environmental factors. Animal studies provide strong evidence that manmade chemicals can disrupt the hormone dependent pathways responsible for fetal gonadal development, subsequently leading to TDS-like symptoms. In humans, fetal exposure to endocrine disrupting substances may play a role, although genetic factors are probably also involved. Recent studies indicate that exposure to endocrine disrupters also in adulthood may affect semen quality and reproductive hormones. Causal relationships are inherently difficult to establish in humans, and a clear connection between the disorders and specific toxicants has not been established. It seems likely that the cumulative effects of various low-dose exposures to endocrine disrupters in our environment are responsible for the adverse effects in the male reproductive system. Semen quality may be the most sensitive marker of adverse environmental exposures, and we suggest that standardized surveillance studies of semen quality are continued or initiated to monitor the combined effects of various preventive actions.

  7. Human semen quality in the new millennium: a prospective cross-sectional population-based study of 4867 men

    DEFF Research Database (Denmark)

    JØrgensen, N; Joensen, Ulla Nordström

    2012-01-01

    Objectives Considerable interest and controversy over a possible decline in semen quality during the 20th century raised concern that semen quality could have reached a critically low level where it might affect human reproduction. The authors therefore initiated a study to assess reproductive health in men from the general population and to monitor changes in semen quality over time. Design Cross-sectional study of men from the general Danish population. Inclusion criteria were place of residence in the Copenhagen area, and both the man and his mother being born and raised in Denmark. Men with severe or chronic diseases were not included. Setting Danish one-centre study. Participants 4867 men, median age 19?years, included from 1996 to 2010. Outcome measures Semen volume, sperm concentration, total sperm count, sperm motility and sperm morphology. Results Only 23% of participants had optimal sperm concentration and sperm morphology. Comparing with historic data of men attending a Copenhagen infertility clinic in the 1940s and men who recently became fathers, these two groups had significantly better semen quality than our study group from the general population. Over the 15?years, median sperm concentration increased from 43 to 48?million/ml (p=0.02) and total sperm count from 132 to 151 million (p=0.001). The median percentage of motile spermatozoa and abnormal spermatozoa were 68% and 93%, and did not change during the study period. Conclusions This large prospective study of semen quality among young men of the general population showed an increasing trend in sperm concentration and total sperm count. However, only one in four men had optimal semen quality. In addition, one in four will most likely face a prolonged waiting time to pregnancy if they in the future want to father a child and another 15% are at risk of the need of fertility treatment. Thus, reduced semen quality seems so frequent that it may impair the fertility rates and further increase the demand for assisted reproduction.

  8. Effects of Stripping Frequency on Semen Quality of Endangered Caspian Brown Trout, Salmo trutta caspius

    OpenAIRE

    Saeed Hajirezaee; Bagher M. Amiri; Ali R. Mirvaghefi

    2009-01-01

    Problem statement: Because of dramatic declines in stocks of endangered Caspian brown trout males, Salmo trutta caspius in Caspian Sea, each male brooder is stripped indispensably more than once during the spawning season in other to artificial insemination in hatchery. The aim of the present study was to assay the changes of indicators of semen quality (sperm motility, sperm production, semen volume and chemical composition of seminal fluid) during these sequential strippings. Approach: The ...

  9. Effects of occupational exposure - is there a link between exposure based on an occupational questionnaire and semen quality?

    Science.gov (United States)

    Jurewicz, Joanna; Radwan, Micha?; Sobala, Wojciech; Radwan, Pawe?; Bochenek, Micha?; Hanke, Wojciech

    2014-08-01

    Several studies have suggested that human semen quality has declined over past decades and some have associated decline with occupational exposures. Many studies have been conducted in occupational settings, where exposure to occupational pollutants is intense. Our objective was to examine the association between exposure to occupational factors based on an occupational exposure questionnaire, and semen quality parameters (sperm concentration, motility, sperm morphology) and sperm chromatin structure. The study population consisted of 336 men who were attending an infertility clinic for diagnostic purposes and who had a normal semen concentration of ?15?mln/ml according to WHO criteria. All participants were interviewed and provided a semen sample. Additionally, a detailed questionnaire about the exposure to occupational factors was performed among the study participants. The results of the study suggest that occupational factors may affect semen quality. The exposure to noise during work was associated with decreased motility and increased DNA damage (p?=?0.005 and p?=?0.02, respectively). Exposure to polyvinyl chloride (PVC) decreased sperm concentration and motility (p?=?0.02 and p?=?0.03, respectively). Whereas exposure to high temperatures and sitting for more than 6 hours during work was positively associated with DNA fragmentation index (DFI) (p?=?0.03 and p?=?0.001, respectively). After applying the correction for multiple comparisons only the exposure to noise and sitting ?6 hours during work was associated with poorer semen quality (decreased motility and increased DFI, respectively). This study showed associations between self-reported occupational exposures and impaired semen parameters. The occupational exposure questionnaire may be useful in clinical practice for patients and physicians to identify the work factors associated with poorer semen quality. PMID:24702586

  10. TRIXcell+, a new long-term boar semen extender containing whey protein with higher preservation capacity and litter size

    OpenAIRE

    Den Berg, B. M.; Reesink, J.; Reesink, W.

    2014-01-01

    It was the aim of the present study to test whey as protective protein for the sperm cell in the long-term boar semen preservation medium TRIXcell. Analyses of sperm cell motility using computer-assisted semen analysis (CASA) indicated that the whey protein Porex has a similar protective effect as bovine serum albumin (BSA) in maintaining viability of stored boar sperm. Boar sperm diluted in TRIXcell+ maintains commercially acceptable motility (>60%) for 10 days, while swine sperm diluted in...

  11. Physical activity, fatness, educational level and snuff consumption as determinants of semen quality: findings of the ActiART study.

    Science.gov (United States)

    Pärn, Triin; Grau Ruiz, Raúl; Kunovac Kallak, Theodora; Ruiz, Jonatan R; Davey, Eva; Hreinsson, Julius; Wånggren, Kjell; Salumets, Andres; Sjöström, Michael; Stavreus-Evers, Anneli; Ortega, Francisco B; Altmäe, Signe

    2015-07-01

    In this study, the association between physical activity and other potential determinants, objectively measured by accelerometry, was examined. Sixty-two men attending an infertility clinic participated in the study. Obese men (body mass index ? 30) and those with a waist circumference 102?cm or more had lower semen volume than the other men (P educational level and snuff consumption are negatively related to semen quality. PMID:25999214

  12. Características seminales del macho cabrío Serrano Transmontano (Semen characteristics of the Serrano Transmontano buck

    Directory of Open Access Journals (Sweden)

    Almendra, L.

    2005-12-01

    Full Text Available Las características de producción espermática constituyen uno de los factores más importantes del desarrollo de programas de inseminación artificial. El objetivo del presente trabajo consistió en el estudio de algunas de las características del semen producido a lo largo del año por machos cabríos de la raza Serrana Ecotipo Transmontano. Fueron estudiados 8 animales (4 adultos datando la primera recogida de semen con más de 18 meses y 4 machos jóvenes con 6-10 meses de edad. Las variables analizadas fueron el volumen (n=378; 0,859 ± 0,337 ml, la concentración (n=227; 4,791 x 106 ± 1,694 espermatozóides/ml, la motilidad masal (n=314; 3,7 ± 0,8 y la motilidad individual (n=308; 69,2 ± 14,1 %. Se observó una influencia muy significativa (P0,05. A pesar de las variaciones observadas, las características seminales (volumen de eyaculado y motilidad espermática, no parecen constituir un factor adverso en la utilización del semen en inseminación artificial, cualquiera que sea la época del año. Sperm production is one of the most important factors for the development of artificial insemination programs. The objective of this study was the evaluation of some characteristics of semen produced throughout the year by bucks of the breed Serrana ecotype Transmontano. Eight male goats were studied (4 adult males, more than 18 months old at the first semen collection and 4 young males 6-10 months old. Variables studied were volume of ejaculate (n=378; 0.859 ± 0.337 ml, sperm number (n=227; 4.791 x 106 ± 1.694 sperm cells/ml, sperm mass motility (n=314; 3.7 ± 0.8 and sperm individual motility (n=308; 69.2 ± 14.1 %. Age of males influenced significantly (P0,05. In spite of the observed variations, the seminal characteristics (volume of the ejaculate and sperm motility don't seem to constitute an adverse factor to the use of the semen in artificial insemination in any season throughout the year

  13. Selenium–vitamin E supplementation in infertile men: effects on semen parameters and pregnancy rate

    Directory of Open Access Journals (Sweden)

    Mohammad K Moslemi

    2011-01-01

    Full Text Available Mohammad K Moslemi1,2, Samaneh Tavanbakhsh31Highly Specialized Jihad Daneshgahi Infertility Center, Qom Branch (ACECR, Qom, Iran; 2Department of Urology, 3School of Medicine, Qom University of Medical Sciences, Qom, IranObjectives: Infertility is an important medical and social problem that has an impact on well-being. A significant development in the last 10 years in the study of human infertility has been the discovery that oxidative sperm DNA damage has a critical role in the etiology of poor semen quality and male infertility. Selenium (Se is an essential element for normal testicular development, spermatogenesis, and spermatozoa motility and function. The predominant biochemical action of Se in both humans and animals is to serve as an antioxidant via the Se-dependent enzyme glutathione peroxidase and thus protect cellular membranes and organelles from peroxidative damage. We explored the efficacy of Se in combination with vitamin E for improving semen parameters and pregnancy rates in infertile men.Materials and methods: The study included 690 infertile men with idiopathic asthenoteratospermia who received supplemental daily Se (200 µg in combination with vitamin E (400 units for at least 100 days. The mean age of cases was 28.5 years (range 20–45, and the median age was 30 years. These cases had presented with male factor infertility (primary or secondary for at least 1 year. The longest and shortest duration of infertility was 10 years and 1 year, respectively. The median time of diagnosis of infertility was 1 year with a mean of 2.5 years.Results: We observed 52.6% (362 cases total improvement in sperm motility, morphology, or both, and 10.8% (75 cases spontaneous pregnancy in comparison with no treatment (95% confidence interval: 3.08 to 5.52. No response to treatment occurred in 253 cases (36.6% after 14 weeks of combination therapy. Mean difference between semen analyses of cases before and after treatment was 4.3% with a standard deviation of 4.29. On the basis of paired t-test results, combination therapy with oral Se and vitamin E was effective for treatment of asthenospermia or asthenoteratospermia or induction of spontaneous pregnancy (P ? 0.001.Conclusions: Supplemental Se and vitamin E may improve semen quality and have beneficial and protective effects, especially on sperm motility. We advocate their use for the treatment of idiopathic male infertility diagnosed with asthenoteratospermia or asthenospermia in semen analysis.Keywords: asthenospermia, sperm, semen, teratospermia, infertility, male, selenium, vitamin E

  14. Inseminación intrauterina vía laparoscópica de ovejas Black Belly con semen congelado

    Scientific Electronic Library Online (English)

    Edwin, Mellisho S.; René, Pinazo H.; Lilia, Chauca F.; Próspero, Cabrera V.; Victoria, Rivas P..

    2006-07-01

    Full Text Available El estudio tuvo por objetivo evaluar la tasa de preñez de ovejas Black Belly criadas de forma estabulada en la costa peruana y que fueron inseminadas intrauterinamente vía laparoscópica con semen congelado. Los animales fueron divididos de acuerdo a su edad e historia reproductiva en borreguillas (n [...] = 21) y ovejas (n = 17). La sincronización del estro se realizó con esponjas intravaginales (60 mg de acetato de medroxiprogesterona) por 13 días y la aplicación de 300 UI de gonadotropina coriónica equina al retiro de las esponjas. La inseminación se realizó a tiempo fijo (62-65 h del retiro de la esponja intravaginal) usando un pellet de semen congelado (0.4 ml con 40 x 106 espermatozoides) en el lumen de cada cuerno uterino. No se utilizaron sedantes ni tranquilizantes. El diagnóstico de preñez por ecografía transrectal se hizo 35 días después de la inseminación artificial. No se encontraron diferencias significativas en la tasa de preñez a los 35 días después de la inseminación laparoscópica entre las borreguillas (71.4%) y las ovejas (64.7%). Las altas tasas de preñez obtenidas al inseminar ovejas vía laparascópica con semen congelado hacen elegible esta técnica para reproducir carneros élite. Abstract in english The present study was carried out to evaluate the pregnancy rate of Black Belly ewes reared under the conditions of the Peruvian coast, that were laparoscopic intrauterine inseminated with frozen-thawed pellet semen. Females were divided according to age and reproductive history in nulliparous (n = [...] 21) and ewes (n = 17). Estrous synchronization was done using vaginal sponges (60 mg medroxyprogesterone acetate) for 13 days and the injection of 300 IU equine chorionic gonadotrophin upon sponge removal. The intrauterine insemination was conducted at fixed time (62-65 h post withdrawal of vaginal sponge) using a semen dose (0.4 ml, 40 x 106 spermatozoa) into the lumen of each uterine horn. Sedatives or tranquilizers were not used. Ultrasound pregnancy diagnosis was performed at day 35 after insemination. No significant differences were found in pregnancy rates between nulliparous (71.4%) and ewes (64.7%). The high pregnancy rates when using laparoscopic intrauterine insemination with frozen-thawed semen in Black Belly females supports the use of this technique for breeding elite animals.

  15. Investigation the Effects of Dietary L-Carnitine Supplementation on Characteristics of Rooster Semen During Liquid Storage

    Directory of Open Access Journals (Sweden)

    Y.J. Ahangari

    2011-01-01

    Full Text Available The objective of present study was to investigate the effects of various levels of dietary L carnitine supplementation (0, 125, 250 and 500 mg kg?1 on rooster semen characteristics during liquid storage. Semen were collected from 16 rooster using abdominal massage and suitable samples were mixed together and sperm characteristics including percentage of motile, viable, abnormal, semen pH, volume and concentration were assessed. This experiment was carried out on the basis of completely randomized design. Results showed that during liquid storage, the effect of L carnitine on motility and viability percentage of sperm in beltsville extender were significant (p1 L-carnitine supplementation. Semen characteristics such as volume, pH and abnormal percentage of sperm did not differ significantly (p>0.05. Furthermore, semen concentration of birds fed dietary carnitine significantly differ from controls during experiment (p1 L-carnitine. Therefore, use of L-carnitine supplementation (250 mg kg?1 in broiler breeder male feeding is recommended to improve quality of rooster semen.

  16. Bioactivity-guided fractionation identifies amygdalin as a potent neurotrophic agent from herbal medicine Semen Persicae extract.

    Science.gov (United States)

    Yang, Chuanbin; Zhao, Jia; Cheng, Yuanyuan; Li, Xuechen; Rong, Jianhui

    2014-01-01

    Herbal medicine Semen Persicae is widely used to treat blood stasis in Chinese medicine and other oriental folk medicines. Although little is known about the effects of Semen Persicae and its active compounds on neuron differentiation, our pilot study showed that Semen Persicae extract promoted neurite outgrowth in rat dopaminergic PC12 cells. In the present study, we developed a bioactivity-guided fractionation procedure for the characterization of the neurotrophic activity of Semen Persicae extract. The resultant fractions were assayed for neurite outgrowth in PC12 cells based on microscopic assessment. Through liquid-liquid extraction and reverse phase HPLC separation, a botanical glycoside amygdalin was isolated as the active compound responsible for the neurotrophic activity of Semen Persicae extract. Moreover, we found that amygdalin rapidly induced the activation of extracellular-signal-regulated kinase 1/2 (ERK1/2). A specific ERK1/2 inhibitor PD98059 attenuated the stimulatory effect of amygdalin on neurite outgrowth. Taken together, amygdalin was identified as a potent neurotrophic agent from Semen Persicae extract through a bioactivity-guided fractional procedure. The neurotrophic activity of amygdalin may be mediated by the activation of ERK1/2 pathway. PMID:25050339

  17. Efecto del método de obtención de semen de ovino sobre la calidad espermática (Effect of the method of obtaining of ovine semen on the spermatic quality

    Directory of Open Access Journals (Sweden)

    Córdova-Izquierdo, Alejandro1*; ; ; y

    2006-08-01

    Full Text Available La colecta del semen del ganado ovino, ayuda a identificar problemas relacionados con el desempeño reproductivo de estos animales. Se han utilizado diferentes pruebas laboratoriales, para valorar la calidad seminal de los ovinos y poder realizar predicciones indirectas del potencial reproductivo de los machos reproductores; no obstante, su naturaleza subjetiva, no asegura el poder de fecundación de los machos. El objetivo de este trabajo fue valorar el efecto del método de obtención del semen de ovinos sobre la calidad espermática. Se empelaron 10 machos ovinos de la raza Suffolk de una Unidad de Producción Ovina, ubicada en el Estado de México, México. Para la recolección seminal se utilizó vagina artificial y directamente de la vagina, después de la monta natural. El semen fue valorado macro y microscópicamente. Los resultados promedios fueron, para vagina artificial: volumen 1.11 ml, pH 6.62, motilidad 64.5 %, concentración de espermatozoides/ml 206.4 x106, vivos 68.5 %, Muertos 31.87% y anormalidades 23.96%; directamente de la vagina: volumen 0.57 ml, pH 6.75, motilidad 60.4%, concentración de espermatozoides/ml 176.02 x 106, vivos 62.62 %, muertos 37.27% y anormalidades 11.12%. Los resultados indican que los resultados obtenidos con vagina artificial fueron los mejores. The collection of the semen of the livestock ovine, helps to identify problems related with the reproductive acting of these animals. They have been used different you prove laboratories, to value the seminal quality of the ovines and power to carry out indirect predictions of the reproductive potential of the reproductive males; nevertheless, its subjective nature, doesn't assure the power of fecundation of the males. The objective of this work was to value the effect of the method of obtaining of the ovines semen on the spermatic quality. You empelaron 10 male ovines of the race Suffolk of a Unit of Production Ovine, located in the State of Mexico, Mexico. For the seminal gathering artificial vagina was used and directly of the vagina, after it mounts it natural. The semen was valued macro and microscopically. The results averages were, for artificial vagina: volume 1.11 ml, pH 6.62, motility 64.5%, concentration of sperms/ml 206.4 x106, alive 68.5%, Dead 31.87% and abnormalities 23.96%; directly of the vagina: volume 0.57 ml, pH 6.75, motility 60.4%, sperms/ml concentration 176.02 x 106, alive 62.62%, dead 37.27% and abnormalities 11.12%. The results indicate that the results obtained with artificial vagina were the best.

  18. Cloned embryos from semen. Part 2: Intergeneric nuclear transfer of semen-derived eland (Taurotragus oryx) epithelial cells into bovine oocytes

    Science.gov (United States)

    Nel-Themaat, L.; Gomez, M.C.; Pope, C.E.; Lopez, M.; Wirtu, G.; Jenkins, J.A.; Cole, A.; Dresser, B.L.; Bondioli, K.R.; Godke, R.A.

    2008-01-01

    The production of cloned offspring by nuclear transfer (NT) of semen-derived somatic cells holds considerable potential for the incorporation of novel genes into endangered species populations. Because oocytes from endangered species are scarce, domestic species oocytes are often used as cytoplasts for interspecies NT. In the present study, epithelial cells isolated from eland semen were used for intergeneric transfer (IgNT) into enucleated bovine oocytes and compared with bovine NT embryos. Cleavage rates of bovine NT and eland IgNT embryos were similar (80 vs. 83%, respectively; p > 0.05); however, development to the morula and blastocyst stage was higher for bovine NT embryos (38 and 21%, respectively; p < 0.0001), than for eland IgNT embryos (0.5 and 0%, respectively). DNA synthesis was not observed in either bovine NT or eland IgNT cybrids before activation, but in 75 and 70% of bovine NT and eland igNT embryos, respectively, cell-cycle resumption was observed at 16 h postactivation (hpa). For eland IgNT embryos, 13% had ???8 cells at 84 hpa, while 32% of the bovine NT embryos had ???8 cells at the same interval. However, 100 and 66% of bovine NT and eland IgNT embryos, respectively, that had ???8 cells synthesized DNA. From these results we concluded that (1) semen-derived epithelial cell nuclei can interact and be transcriptionally controlled by bovine cytoplast, (2) the first cell-cycle occurred in IgNT embryos, (3) a high frequency of developmental arrest occurs before the eight-cell stage in IgNT embryos, and (4) IgNT embryos that progress through the early cleavage stage arrest can (a) synthesize DNA, (b) progress through subsequent cell cycles, and (c) may have the potential to develop further. ?? 2008 Mary Ann Liebert, Inc.

  19. Effect of Estrus-AI interval on timed AI pregnancy rates in beef cows inseminated with fresh extended or frozen thawed semen

    OpenAIRE

    R. K. Kasimanickam and W. D. Whittier

    2011-01-01

    We hypothesize that insemination with fresh extended semen will improve the AI pregnancy rate due to its prolonged longevity in female reproductive tract compared to frozen thawed semen. The objective of this trial was to determine the effect of fresh and frozen semen on fixed-time AI pregnancy rate in beef cows synchronized with progesterone based CO-Synch protocols and inseminated at different estrus-AI intervals. Angus cross beef cows (N=180) were synchronized with CO-Synch-CIDR protocols ...

  20. Semen quality in men from subfertile couples from the region of ?ód? (Poland) according to the new reference values recommended by WHO 2010

    OpenAIRE

    RÓ?A?SKI, WALDEMAR; Szymczak, Wies?aw; Wójt, Ma?gorzata; Sobakiewicz, S?awomir; LIPI?SKI, MAREK; Marchlewska, Katarzyna; Go??b-Lipi?ska, Ma?gorzata; Oszukowska, El?bieta

    2011-01-01

    The semen analysis is the main diagnostic tool for evaluating the male fertility potential. The standard semen analysis includes evaluation of the sperm concentration, motility, and their morphology. The most important question is whether the results from semen analysis may be accurate markers for male fertility. Therefore, we retrospectively studied sperm quality among men attending the infertility clinic due to reproductive problems consistent with the WHO manual from 1999, which were reass...

  1. Cryopreservation of rabbit semen: effectiveness of different permeable and non-permeable cryoprotectants on post-thaw sperm quality and reproductive performances

    OpenAIRE

    Di Iorio, Michele

    2015-01-01

    Rabbit breeding for meat production is based mainly on artificial insemination (AI) programs. In order to obtain many of potential advantages of AI, improvement of the storage of rabbit semen is necessary. Therefore, meat rabbit farming would greatly benefit if semen could be stored after collection and subsequently used for AI without affecting fertility. The rabbit sperm can be stored by refrigeration (in liquid or solid extenders) or freezing. The use of frozen semen would provide more p...

  2. PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

    Scientific Electronic Library Online (English)

    Francisca Elda Ferreira, Dias; Cáris Marone, Nunes; Tânia Vasconcelos, Cavalcante; Andréa Azevedo Pires de, Castro; Jorge Luis, Ferreira; José Fernando, Garcia.

    2013-09-01

    Full Text Available Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas [...] à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial. Abstract in english This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by pheno [...] l/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

  3. Two new types of chromosomal rearrangements in the swine species induced by semen irradiation

    International Nuclear Information System (INIS)

    In the present experiment were used one boar and 5 descendent of Landrace and Large White cross-breeding were used, all the animals were healthy concerning to the reproductive aspect and chromosome constitution. Initially semen was collected from the boar through the glove hand method, diluted and submitted to gamma irradiation. The total applied dose was of 800 R, with an exposition period of 3,76 min. The artificial insemination of the females with the treated semen was performed from the time of observation of positive tolerance reflex, with each animal receiving 2 inseminations with a 12 hour interval in between. after birth, the piglets had their blood aseptically collected for karyotype preparation and analysis. From 17 piglets born and cytogenetically analysed, 2 chromosomal rearrangements were detected, namely, a reciprocal translocation or insertion, 8q-; 14p+ in a female a pericentric inversion in chromosome 1 in a male. (author). 18 refs, 2 figs

  4. Age-related changes in quality and fertility of porcine semen

    Scientific Electronic Library Online (English)

    Ioannis A, Tsakmakidis; Tarek AA, Khalifa; Costas M, Boscos.

    Full Text Available The aim of this study was to investigate the effect of boar age on quality traits and fertility of liquid-stored semen. Boars were allocated into 3 age groups: 7-10 months (young), 18-33 months (mature), 51-61 months (old). Ejaculates of > 200x10(6) sperm/ml and 85% total motile sperm were extended [...] to 30x10(6) sperm/ml, stored at 17-18 °C and used within 12-24 h for artificial insemination (AI) of 2062 multiparous sows. After 24 h of storage, aliquots of diluted semen were assessed for sperm progressive motility (SPM), incidence of sperm chromatin instability (SCI), proportion of live morphologically normal sperm (LMNS) and head morphometry of LMNS. The results showed that young boars had higher percentages of SCI and lower proportions of LMNS than those of the mature (p

  5. Cryobiology and a new look at the preservation of stallion semen

    DEFF Research Database (Denmark)

    Grout, Brian William Wilson; Lehn-Jensen, Henrik

    2009-01-01

      During freeze-preservation of high-viability ejaculates of horse semen the duration of the equilibration time for nucleated straws (achieved at -7 0C following induced nucleation and during controlled, slow cooling to -60 0C) has little impact on viability, measured using propidium iodide staining to indicate cells that have lost osmotic competence.  Further, relatively high viability is retained if direct plunging into liquid nitrogen (LN) replaces the controlled protocol, and the sample can withstand several cycles of repeated freezing. The data suggests that populations of spermatozoa with a high viability have a large cohort of extremely durable, freeze-tolerant cells. Preliminary observations suggest that populations with low overall viability may not behave, qualitatively, in the same way, suggesting fundamental cellular differences. The cryobiology underlying these observations is discussed and new approaches for successful cryopreservation of semen of low viability are considered.   Keywords Equine spermatozoa; Cryopreservation; Nucleation; Osmotic stress; Repeated freezing

  6. The potential transmission of infectious agents by semen packaging during storage for artificial insemination.

    Science.gov (United States)

    Russell, P H; Lyaruu, V H; Millar, J D; Curry, M R; Watson, P F

    1997-07-01

    Plastic straws, of a type widely used for semen cryopreservation, sealed using three different methods, (PVA powder, plastic spheres and plasticine modelling clay) were tested for leakage of low molecular weight dye (methylene blue), bacteria (Escherichia coli) and virus (Newcastle disease virus). Leakage was found to be dependent on the method used to fill the straws. Straws filled using a traditional 'dip and wipe' method and sealed with PVA powder demonstrated a significant degree of methylene blue leakage (0.0269% of the total straw contents) probably associated with contamination of the powder sealing plug. Straws filled using an aseptic filling technique showed no detectable leakage of any agent with any of the sealing methods. This study highlights the need to establish good-practice guidelines for the packaging of semen collected for freezing and future AI from non-domestic livestock where disease-free status cannot be guaranteed and unsophisticated technology is used. PMID:9360772

  7. COMPUTER-ASSISTED SEMEN ANALYSIS OF RAT SPERMATOZOA AFTER AN INTRAPERITONEAL ADMINISTRATION OF INSECTICIDE DIAZINON

    Directory of Open Access Journals (Sweden)

    R. TOMAN

    2013-12-01

    Full Text Available The aim of this study was to reveal the effect of diazinon on the rat spermatozoa motility characteristics using the computer-assisted semen analysis (CASA. Motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, STR, LIN, WOB, ALH, and BCF after the diazinon i.p. administration of 20 mg/kg b.w. were evaluated. 36 hours after the diazinon administration, only slight decrease in VCL, DCL and increase in percentage of progressive motility in the diazinon-treated group. Significant decrease (P<0.01 was only observed in BCF in diazinon-treated group. Computer-assisted semen analysis (CASA of rat sperm motility showed that acute diazinon administration slightly affected the rat sperm motility which can be the first step in the decreased fertilization capacity caused by pesticides. Further investigation of reproductive effects of diazinon is needed.

  8. HPLC-DPPH Screening Method for Evaluation of Antioxidant Compounds Extracted from Semen Oroxyli

    Directory of Open Access Journals (Sweden)

    Renyi Yan

    2014-04-01

    Full Text Available Semen Oroxyli, derived from the seed of Oroxylum indicum L., is a commonly used Traditional Chinese Medicine with beneficial effects against several respiratory disorders. Antioxidative flavonoids may be partly responsible for its medicinal functions. The aim of this study was to rapidly determine the antioxidants in Semen Oroxyli based on a HPLC-DPPH method. Four major flavonoids, baicalein-7-O-gentiobioside, baicalein-7-O-glucoside, baicalein, and baicalin, were identified as the active components against DPPH free radicals, which is in accord with the results of our former traditional activity-guided phytochemical study. The oxidative products of the four antioxidant flavonoids were studied in the DPPH spiking HPLC assay, it was suggested that the three active flavonoid glycosides were converted into 5,6-dihydroxy-7-methoxyflavone, which implied that an additional hydroxyl at C-6 in 5,7-dihydroxyflavones plays an important role in the DPPH assay.

  9. Effects of whole-body, ionizing radiation on the semen in beagle dogs

    International Nuclear Information System (INIS)

    Six beagle dogs were exposed to a total dose of 183 R of gamma radiation at a dose rate of 1 R/day, while three other dogs were exposed to a single dose of 100 R. Weekly semen analysis was performed on all irradiated dogs plus four nonirradiated dogs. Semen volume, sperm concentration, total sperm count, sperm motility and sperm head morphometry were examined. Dogs exposed to chronic radiation showed a severe decline in sperm numbers, detected after seven weeks of exposure. Sperm concentration and total sperm count were the first parameters affected and were the only parameters consistently affected. The dogs exposed to 100 R as a single dose, did not show a significant decline in sperm numbers. During a 36 week recovery period, the chronically irradiated dogs did show a slight increase in sperm numbers, but they never approached pre-exposure levels

  10. BLOOD SERUM TESTOSTERONE LEVEL AND ITS RELATIONSHIP WITH SCROTAL CIRCUMFERENCE AND SEMEN CHARACTERISTICS IN NILI-RAVI BUFFALO BULLS

    Directory of Open Access Journals (Sweden)

    M. SAJJAD, S. ALI, N. ULLAH1, M. ANWAR1, S. AKHTER AND S. M. H. ANDRABI1

    2007-04-01

    Full Text Available This study was aimed at determining the blood serum testosterone level and its relationship with scrotal circumference and physical characteristics of semen in Nili-Ravi buffalo bulls. Semen samples were collected weekly from three buffalo bulls of 14 years age for 12 weeks and were evaluated for physical characteristics i.e. ejaculatory volume, sperm motility, sperm concentration, pH and sperm abnormalities. Jugular blood samples were collected from each bull at weekly intervals and analyzed for serum testosterorse concentrations. Mean (+ SE blood serum testosterone level (ng/ml, scrotal circumference (cm, semen volume (ml, progressive sperm motility (%, sperm concentration (106/µl, semen pH and total sperm abnormalities (% observed were 0.69 ± 0.12, 34.6 ± 0.9, 3.59 ± 0.41, 51.53 ± 2.23, 0.99 ± 0.07, 7.01 ± 0.08 and 11.67 ± 0.90, respectively. Positive correlations between testosterone level and scrotal circumference (r=0.414 and ejaculatory volume (r=0.348 were observed. However, no correlation of testosterone level with sperm motility (r=0.145, sperm concentration (r=0.264, semen pH (r=-0.208 and total sperm abnormalities (r=-0.242 was found. Similary, ejaculatory volume did not show any correlation with sperm motility percentage (r=0.115, sperm concentration (r=0.045, semen pH (r=-0.015 and total sperm abnormalities (r=-0.135. Sperm motility percentage had positive correlation with sperm concentration (r=0.347 and negative correlation with semen pH (r=-0.670. Sperm concentration was negatively correlated with semen pH (r=-0.501. It was concluded that in 14 years old buffalo bulls the level of serum testosterone and scrotal circumference and ejaculatory volume were positively correlated. The other semen quality parameters including sperm motility, sperm concentration, semen pH and sperm abnormalities were not related with serum testosterone level.

  11. Semen analysis parameters: Experiences and insight into male infertility at a tertiary care hospital in Punjab

    International Nuclear Information System (INIS)

    Objective: To determine the prevalence of low sperm count including oligospermia and azoospermia in male infertile population, and to assess the pattern and distribution of abnormal semen parameters in infertile men. Methods: The descriptive cross-sectional survey was carried out at the Department of Gynaecology and Obstetrics, Sharif Medical City Hospital, Lahore, from June 2009 to June 2010. A total of 500 consecutively consenting male partners of women fulfilling the inclusion criteria between 20 and 40 years of age were approached. Semen analysis was performed according to methods and standards defined by the World Health Organisation (WHO). Samples were categorised into normospermia, oligospermia and azoospermia on the basis of sperm count. After exclusion of azoospermic samples, normospermic and oligospermic samples were compared for ejaculated volume, pus cells, motility and morphology. SPSS 10 was used for statistical analysis. Results: Out of the 500 males approached, 104 (20.8%) had to be left out either because of their unwillingness or inability to pass semen. The study sample comprised of 396 (response rate 79.2%); normospermia was observed in 293 (73.99%) males, azoospermia in 59 (14.89%), and oligospermia in 44 (11.11%). The oligospermic samples had low ejaculated volume, but significantly higher percentage of non-motile sperms 62%+-23.9% and abnormal morphology 55%+-15.6% in comparison to normospermic samples (p 0.0001). Asthenospermia was observed in p 0.0001). Asthenospermia was observed in 37 (25.81%), teratospermia in 11 (3.26%) and oligoasthenoteratospermia in 4 (9.09%) of samples. Conclusion: Semen analysis is the cornerstone for the evaluation of infertility in men. Sperm concentration, motility and morphology are related to each other, factors that cause deterioration of one of them usually also have negative impact on the other two as well. (author)

  12. Complete Genome Sequence and Annotation of Corynebacterium singulare DSM 44357, Isolated from a Human Semen Specimen.

    Science.gov (United States)

    Merten, Madlen; Brinkrolf, Karina; Albersmeier, Andreas; Kutter, Yvonne; Rückert, Christian; Tauch, Andreas

    2015-01-01

    Corynebacterium singulare DSM 44357 is a urease-positive microorganism isolated from human semen. The complete genome sequence of C. singulare DSM 44357 comprises 2,830,519 bp with a mean G+C content of 60.12% and 2,581 protein-coding genes. The deduced antibiotic resistance pattern of this strain includes macrolides, lincosamides, aminoglycosides, chloramphenicol, and tetracyline. PMID:25814602

  13. Entrenamiento de carneros para recolección de semen mediante vagina artificial, utilizando como estímulo objetos inanimados

    OpenAIRE

    Virginio Aguirre Flores; Reyes V\\u00E1zquez Rosales; Agust\\u00EDn Orihuela Trujillo

    2005-01-01

    Con el fi n de desarrollar una metodología para entrenar carneros en la recolección de semen con vagina artifi cial (VA), montando un objeto inanimado, se utilizaron nueve animales que se sometieron a cuatro etapas de preparación. La primera con el propósito de lograr la manifestación del repertorio sexual natural, y el resto para llevar a cabo un programa de condicionamiento operante: cuando la respuesta correcta (monta) sucedía, en un inicio provocada por un estado de m...

  14. Normal reference ranges for semen quality and their relations to fecundity

    DEFF Research Database (Denmark)

    Skakkebaek, Niels E

    2010-01-01

    Several recent studies have shown that the fecundity of a man decreases progressively with sperm concentrations below 40 million spermatozoa per mL. Therefore, it is unfortunate that the new World Health Organization guidelines for semen analysis recommend lowering the lower cutoff value for normal sperm concentration from 20 to 15 million spermatozoa per mL. As a result large groups of subfertile men across the world may not receive appropriate andrological help in the future.

  15. Effects of Methanolic Extract of Moringa Oleifera Leaves on Semen and biochemical Parameters in Cryptorchid Rats

    OpenAIRE

    Afolabi, Ayobami Oladele; Aderoju, Hameed Adeola; Alagbonsi, Isiaka Abdullateef

    2013-01-01

    While anti-oxidant effects of Moringa oleifera in much oxidative stress related diseases have been well reported, cryptorchidism on the other hand has been shown to cause oxidative stress. However, study is scanty on the likely role of Moringa oleifera in reducing cryptorchidism-induced oxidative stress in rats has not been studied. The present study looked into the effects of methanolic extract of Moringa oleifera leaves (MEMO) on semen and biochemical parameters in cryptorchid rats. Twenty ...

  16. Semen analysis in 21st century medicine: the need for sperm function testing

    OpenAIRE

    Lamb, Dolores J.

    2010-01-01

    Sperm function testing, once commonly performed for the infertile couple before employing assisted reproductive technology (ART), has fallen out of favour in many reproductive medicine centers throughout the world. Indeed, the most recent addition of the 'World Health Organisation (WHO) Laboratory Manual for the Examination and Processing of Human Semen' now groups many of these procedures into a section termed Research Procedures. In large part, this reflects the current clinical practice of...

  17. The combined use of embryos and semen for cryogenic conservation of mammalian livestock genetic resources

    OpenAIRE

    Pizzi Flavia; Stella Alessandra; Boettcher Paul J; Gandini Gustavo

    2005-01-01

    Abstract The objective of this empirical simulation study was to evaluate the use of a combination of semen and embryos in the creation of gene banks for reconstruction of an extinct breed. Such an approach was compared for banks with varying proportions of embryos on the basis of the amount of the material to be stored, time for reconstruction, maintenance of genetic variability, and probability of failure during reconstruction. Four types of populations were simulated, based on reproductive...

  18. Sclerotherapy of hydroceles and spermatoceles with alcohol: results and effects on the semen analysis

    OpenAIRE

    Chen Jen Shan; Antonio Marmo Lucon; Rodrigo Pagani; Miguel Srougi

    2011-01-01

    PURPOSE: To evaluate the success rates of sclerotherapy of the tunica vaginalis with alcohol for the treatment of hydroceles and/or spermatoceles, as well as, evaluation of pain, formation of hematomas, infection and its effects in spermatogenesis . MATERIALS AND METHODS: A total of 69 patients, with offsprings and diagnosis of hydrocele and/or spermatocele, were treated during the period from April 2003 to June 2007. Semen analysis was obtained from patients who were able to provide us with ...

  19. Purchase examinations and importation requirements for European performance horses and their semen entering the United States.

    Science.gov (United States)

    Harland, Malte M; Stewart, Allison J; Böse, Reinhard

    2011-11-01

    A comprehensive purchase examination is expected by American clients intent on importing a horse from a foreign country. American veterinarians may be involved in performing purchase examinations in foreign countries or, more often, interpreting findings from foreign veterinarians for their American clients. Exportation and importation requirements for horses and semen vary from country to country. Detailed knowledge of the requirements by all involved veterinarians is essential for efficient and successful international equine travel. PMID:22101451

  20. The Relationship of Urinary Metabolites of Carbaryl/Naphthalene and Chlorpyrifos with Human Semen Quality

    OpenAIRE

    Meeker, John D.; Barr, Dana B; Deborah H. Bennett; Bravo, Roberto; Ryan, Louise Marie; Herrick, Robert F; Hauser, Russ B.

    2004-01-01

    Most of the general population is exposed to carbaryl and other contemporary-use insecticides at low levels. Studies of laboratory animals, in addition to limited human data, show an association between carbaryl exposure and decreased semen quality. In the present study we explored whether environmental exposures to 1-naphthol (1N), a metabolite of carbaryl and naphthalene, and 3,5,6-trichloro-2-pyridinol (TCPY), a metabolite of chlorpyrifos and chlorpyrifos-methyl, are associated with decrea...

  1. Increased prevalence of leukocytes and elevated cytokine levels in semen from Schistosoma haematobium-infected individuals

    DEFF Research Database (Denmark)

    Leutscher, Peter D C; Pedersen, Mette

    2005-01-01

    In this study, we investigated the seminal inflammatory response to egg infestation of the urogenital organs in 240 semen-donating men aged 15-49 years living in a Schistosoma haematobium-endemic area of Madagascar. In 29 subjects (12%) with excretion of > or =5 ova/ejaculate, leukocytospermia (>10(6) leukocytes/mL) and the presence of seminal lymphocytes and eosinophil leukocytes were each significantly more prevalent than in 74 subjects (31%) who were S. haematobium negative (P

  2. Clinical Study of the Effects of Juglandis Semen Pharmacopuncture Therapy on Shoulder Pain

    OpenAIRE

    Han-Na Choi; Seoung-Whon Lee; Cheol-Hong Kim; Hyun-Min Yoon; Kyung-Jeon Jang

    2011-01-01

    Objectives: The purpose of this study is to examine the effects of Juglandis Semen Pharmaco-puncture Therapy on Shoulder Pain. Methods & Results: Clinical studies on shoulder pain were carried out on 34 patients who were treated at Department of Acupuncture & Moxibusition, Samse Oriental Medical Hospital from June to October, 2009. Patients were divided into two groups, i.e.Sample group(Group A) and Control group(Group B). Group B were treated by body acupuncture and cupping therapies whil...

  3. Does the duration of infertility affect semen parameters and pregnancy rate after varicocelectomy?: a retrospective study

    OpenAIRE

    Al-Ghazo, Mohammed A.; Ibrahim Fathi Ghalayini; Al-Azab, Rami S.; Ibrahim Bani-Hani; Mohammad S. Daradkeh

    2011-01-01

    OBJECTIVES: The most common indication for treatment of varicocele is still male subfertility. The aim of this study was to explore the effect of infertility duration on semen parameters and spontaneous pregnancy rate after varicocelectomy. MATERIALS AND METHODS: The medical records of 183 infertile patients with clinical varicocele were retrospectively reviewed. The patients were divided into three groups according to the duration of infertility (group I, 1-3 years, group II, 3-6 years and g...

  4. DEVELOPING THE USE OF EPIDIDYMAL SEMEN FOR FARM ANIMAL CRYOBANKS AND SOME FIELD APPLICATIONS

    OpenAIRE

    Turri, Federica

    2012-01-01

    The aim of this thesis was to increase our knowledge in the use of epididymal semen for the creation of cryobanks for farm animal genetic resources, and more generally to contribute to the area of conservation and sustainable use of farm animal genetic resources (AnGR).Three experiments were conducted in cattle and goat species. In cattle the effects of two epididymal sperm extraction methods, the float-up and the retrograde flushing technique were compared in terms of quality of epididym...

  5. Urinary bisphenol A levels in young men : association with reproductive hormones and semen quality

    DEFF Research Database (Denmark)

    Lassen, Tina Harmer; Frederiksen, Hanne

    2014-01-01

    BACKGROUND: Few human studies have examined bisphenol A (BPA) exposure in relation to semen quality and reproductive hormones in men, and results are divergent. OBJECTIVES: We examined associations between urinary BPA concentration and reproductive hormones, as well as semen quality, in young men from the general population. METHODS: Our study population consisted of 308 young men from the general population. Urinary BPA concentration was measured by isotope dilution TurboFlow-liquid chromatography-tandem mass spectrometry. We used multiple linear regression analysis to estimate associations between BPA concentration and reproductive hormones and semen quality, adjusting for confounding factors. RESULTS: We found that 98% of the men had detectable urinary levels of BPA. Median (5th-95th percentiles) BPA concentration was 3.25 ng/mL (0.59-14.89 ng/mL). Men with BPA concentrations above the lowest quartile had higher concentrations of serum testosterone, luteinizing hormone (LH), estradiol, and free testosterone compared with the lowest quartile (p trend ? 0.02). Men in the highest quartile of BPA excretion had on average 18% higher total testosterone (95% CI: 8, 28%), 22% higher LH (95% CI: 6, 39%), and 13% higher estradiol (95% CI: 4, 24%) compared with lowest quartile. Men in the highest quartile of BPA also had significantly lower percentage progressive motile spermatozoa compared with men in the lowest quartile (-6.7 percentage points, 95% CI: -11.76, -1.63). BPA was not associated with other semen parameters. Adjusting for dietary patterns did not influence the results. CONCLUSIONS: The pattern of associations between BPA and reproductive hormones could indicate an antiandrogenic or antiestrogenic effect, or both, of BPA on the hypothalamic-pituitary-gonadal hormone feedback system, possibly through a competitive inhibition at the receptor level. However, additional research is needed to confirm our findings and to further test the suggested potential mechanisms.

  6. Effect of homeopathic treatment used in commercial boar semen diluent on sperm viability

    OpenAIRE

    Mayra Assunpção; Marcelo Goissis; Nilson Roberti Benites; Flavia Regina Barros; Sergio de Azevedo; Leoni Villano Bonamin; Erlete Rosalina Vuaden; Cidéli de Paula Coelho; Francisco Rafael Soto; José Antonio Visitin; Mariana Grocke Marques

    2012-01-01

    Background: It has been speculated that the homeopathic treatment of sperm cells in order to improve semen quality could be promising. However, few data is available and its use in spermatozoa requires investigation. It is well established that mitochondrial membrane potential is an important viability parameter of spermatozoa and it is intimately related to reproductive efficiency. In this manner, new technologies in order to improve the activity of sperm cells and, finally, the fecundity of...

  7. A glimpse at male infertility based on semen analyses in Brunei Darussalam.

    Directory of Open Access Journals (Sweden)

    Siti Zurainah ABDUL HAMID

    2010-09-01

    Full Text Available Introduction: Infertility is defined as the inability to conceive children and the causes are equally divided between males and females. Considerable advances have been made in treatment of infertility amongst women, especially with the introduction of in-vitro fertilisation. However there is very little progress made in treating the male infertility. Male causes of infertility can be categorised into pre-testicular, testicular and post-testicular. This study looked at the causes of infertility amongst the males, based on the semen analysis in our local setting. Materials and Methods: From 2006-2008, 1,242 semen specimens were received for analysis. Subjects were instructed on proper semen collection using the World Health Organisation criteria, where the specimen is collected following three days of abstinence and sent to the laboratory within one hour of collection. Semen samples were examined microscopically for morphology, motility and the concentration. Results: Interestingly, 109 subjects (8.8% had normal spermatozoa (normal analyses and this included 38 patients (34.2% whose initial analyses were abnormal. 57 (4.6% subjects were azoospermic. 730 (58.8% men had more than two abnormalities in spermatozoa and a further 217 (17.5% men had abnormal morphology alone. Among patients with two or more abnormalities, a majority had three abnormalities and this was consistently seen in all age groups. There was a trend towards less severe abnormalities from 2006 to 2008. Conclusions: Majority had more than two abnormalities and abnormal morphology and they may not be able to father a child normally. However they may be able to have an offspring by assisted reproductive methods. Only a minority was azoospermic and they will not be able to father any children even with assisted reproductive techniques. Interestingly, 8.8% had normal analyses suggesting other causes of infertility such their female partners or improper techniques.

  8. Induction of Heat Shock Protein Expression in Cervical Epithelial Cells by Human Semen

    Directory of Open Access Journals (Sweden)

    S. S. Witkin

    1999-01-01

    Full Text Available Objective: The 70kD heat shock protein (Hsp70, induced when cells are subjected to environmental stress, prevents the denaturation and incorrect folding of polypeptides and may expedite replication and transmission of DNA and RNA viruses. We analyzed whether messenger RNA (mRNA for Hsp70 was expressed following exposure of a cultured human cervical cell line (HeLa cells to human semen or in cervical cells from sexually active women.

  9. Criopreservación de semen canino por congelación rápida con glicerol y Dimetilformamida

    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo Betancur

    2011-01-01

    Full Text Available Introducción. Diversos factores influyen sobre la capacidad fertilizante del semen canino criopreservado. Las alteraciones estructurales, y los efectos osmóticos y tóxicos sobre los espermatozoides, han centrado el interés en desarrollar nuevas técnicas de criopreservación y crioprotectores con mayor potencial para la conservación de la capacidad fertilizante del semen. Objetivo. Comparar el efecto de la congelación rápida con glicerol y dimetilformamida sobre la calidad post-descongelación del semen canino. Materiales y métodos. En un proceso de criopreservación por congelación rápida, fueron implementados cuatro tratamientos (glicerol al 3% y 5%, y dimetilformamida al 3% y 5%. Posterior a la descongelación, fueron evaluados para cada tratamiento, la movilidad individual, la morfología espermática y la integridad de membrana de los espermatozoides. La evaluación estadística se realizó mediante un análisis de varianza y una prueba de diferencia significativa mínima de Fisher. Resultados. Para la movilidad individual se encontró superioridad del glicerol 5% (58%±7.8 sobre DMF 5% (44.5%±17.7, glicerol 3% (18%±10.1, y DMF 3% (11.8%±10.5. Para la integridad de membrana, DMF 5% obtuvo el mayor promedio (33.4%±9.7, siendo superior a glicerol 3% (27.5%±4.3 y DMF 3% (24.2%±5.3, pero sin diferencia estadística sobre glicerol 5% (31.4%±3.8. Para la morfología espermática no se encontró diferencia estadística entre glicerol 5% (67%±11.9, glicerol 3% (65.6±12.5, y DMF 5% (60%±16.5, pero sí hubo diferencia entre estos y DMF 3% (50.1%±18.3. Conclusiones. El glicerol y la DMF en concentraciones del 5% proveen una protección similar del semen canino durante la criopreservación por congelación rápida.

  10. Sexual behavior and its relationship with semen quality parameters in Sahiwal breeding bulls

    Directory of Open Access Journals (Sweden)

    Shushant Singh

    2015-06-01

    Full Text Available Aim: The study was conducted at Artificial Breeding Research Centre, NDRI, Karnal, to determine the sexual behavior and its relationship with semen quality parameters in Sahiwal breeding bulls. Materials and Methods: A total of 63 ejaculates were collected from six adult Sahiwal bulls (age ~47 mo and bwt ~466 kg, to study the relationship of sexual behavior and semen quality. The degree of association between different variables was estimated by Pearson’s correlation coefficient method. Results: The results depicted that, sexual aggressiveness showed significantly high positive correlation with libido score (LS and sexual behavior score (SBS. Reaction time (RT and total time taken in mounts (TTTM had a significant negative correlation with LS and SBS. Penile erection score and penile protrusion score (PPS both had a significant positive correlation with ejaculatory thrust score, mating ability score, and SBS. Results of correlation among seminal attributes and with sexual behavior depicted that ejaculate volume had positive significant correlation with initial progressive motility (IPM, sperm concentration (SCON, head abnormality, total abnormality, hypo-osmotic swelling test (HOST, acrosomal integrity (AI whereas, mass activity had positive significant correlation with IPM, SCON, non-eosinophilic spermatozoa count (NESC, HOST, AI, RT and TTTM and IPM had positive significant correlation with SCON, NESC, HOST, AI, and TTTM, whereas and HOST had positive significant correlation with AI. Among seminal attributes, SCON had a positive significant correlation with PPS where as head abnormalities had a positive significant correlation with RT and TTTM. Conclusion: It can be concluded that the relationship of sexual behavior and semen quality parameters are reflecting that the sexual behavior of individual bulls is important to harvest good quality and quantity of semen as desired type of sexual preparation can be provided.

  11. Male facial attractiveness and masculinity may provide sex- and culture-independent cues to semen quality.

    Science.gov (United States)

    Soler, C; Kekäläinen, J; Núñez, M; Sancho, M; Álvarez, J G; Núñez, J; Yaber, I; Gutiérrez, R

    2014-09-01

    Phenotype-linked fertility hypothesis (PLFH) predicts that male secondary sexual traits reveal honest information about male fertilization ability. However, PLFH has rarely been studied in humans. The aim of the present study was to test PLFH in humans and to investigate whether potential ability to select fertile partners is independent of sex or cultural background. We found that on the contrary to the hypothesis, facial masculinity was negatively associated with semen quality. As increased levels of testosterone have been demonstrated to impair sperm production, this finding may indicate a trade-off between investments in secondary sexual signalling (i.e. facial masculinity) and fertility or status-dependent differences in investments in semen quality. In both sexes and nationalities (Spanish and Colombian), ranked male facial attractiveness predicted male semen quality. However, Spanish males and females estimated facial images generally more attractive (gave higher ranks) than Colombian raters, and in both nationalities, males gave higher ranks than females. This suggests that male facial cues may provide culture- and sex-independent information about male fertility. However, our results also indicate that humans may be more sensitive to facial attractiveness cues within their own populations and also that males may generally overestimate the attractiveness of other men to females. PMID:25056484

  12. Influence of antisperm antibodies in the semen on intracytoplasmic sperm injection outcome

    Scientific Electronic Library Online (English)

    Sandro C., Esteves; Danielle T., Schneider; Sidney, Verza Jr..

    2007-12-01

    Full Text Available OBJECTIVE: The aim of this study was to analyze the influence of autoantibodies against spermatozoa present in the semen on the outcome of in vitro fertilization with intracytoplasmic sperm injection (ICSI). MATERIALS AND METHODS: We performed a retrospective analysis of clinical and laboratorial da [...] ta from a six year-period ICSI cycles. Screening for the presence of ASA in the semen, by using the direct immunobeads test (IBT), was available for 351 cycles. According to the percentage of antibody-bound spermatozoa in the semen, we divided the cycles in four groups: I (n = 194): 0%-10% ASA; II (n = 107): 11%-20%; III (n = 33): 21%-50% and IV (n = 17): 51%-100% ASA. Additionally, a group of 349 ICSI cycles performed with ejaculated spermatozoa from oligo/asthenozoospermic men who had insufficient number of motile sperm available for ASA screening was included for comparison. ICSI outcomes were compared among groups and included fertilization rate (2 PN), cleavage rate, cleavage velocity, embryo quality, clinical pregnancy and miscarriage rates. Data were examined statistically, with an alpha level of 5% considered significant. RESULTS: Fertilization, cleavage rate and velocity, percentage of good quality embryos, as well as clinical pregnancy and miscarriage rates did not differ among different ASA levels groups. ICSI outcomes in men exhibiting different levels of autoimmunity against spermatozoa did not differ from those with severely abnormal seminal parameters. CONCLUSIONS: Our data indicate that intracytoplasmic sperm injection (ICSI) outcomes are not influenced by ASA levels on sperm.

  13. Influence of antisperm antibodies in the semen on intracytoplasmic sperm injection outcome

    Directory of Open Access Journals (Sweden)

    Sandro C. Esteves

    2007-12-01

    Full Text Available OBJECTIVE: The aim of this study was to analyze the influence of autoantibodies against spermatozoa present in the semen on the outcome of in vitro fertilization with intracytoplasmic sperm injection (ICSI. MATERIALS AND METHODS: We performed a retrospective analysis of clinical and laboratorial data from a six year-period ICSI cycles. Screening for the presence of ASA in the semen, by using the direct immunobeads test (IBT, was available for 351 cycles. According to the percentage of antibody-bound spermatozoa in the semen, we divided the cycles in four groups: I (n = 194: 0%-10% ASA; II (n = 107: 11%-20%; III (n = 33: 21%-50% and IV (n = 17: 51%-100% ASA. Additionally, a group of 349 ICSI cycles performed with ejaculated spermatozoa from oligo/asthenozoospermic men who had insufficient number of motile sperm available for ASA screening was included for comparison. ICSI outcomes were compared among groups and included fertilization rate (2 PN, cleavage rate, cleavage velocity, embryo quality, clinical pregnancy and miscarriage rates. Data were examined statistically, with an alpha level of 5% considered significant. RESULTS: Fertilization, cleavage rate and velocity, percentage of good quality embryos, as well as clinical pregnancy and miscarriage rates did not differ among different ASA levels groups. ICSI outcomes in men exhibiting different levels of autoimmunity against spermatozoa did not differ from those with severely abnormal seminal parameters. CONCLUSIONS: Our data indicate that intracytoplasmic sperm injection (ICSI outcomes are not influenced by ASA levels on sperm.

  14. Effect of cryoprotectant on the cryopreservation of South African Kolbroek pig semen

    Scientific Electronic Library Online (English)

    M.H, Mapeka; K.C., Lehloenya; T.L., Nedambale; B., Sutherland.

    Full Text Available The study evaluated the effect of different cryoprotectants on post-thaw survival and motility of Kolbroek sperm. Semen from Kolbroek boars was collected with the gloved hand technique. Ejaculates were diluted with Beltsville thawing solution (BTS) at a ratio of 1 : 1 prior to freezing. Semen was di [...] luted with egg yolk tris; thereafter, one of the three cryoprotectants (14% glycerol, 14% DMSO or 7% glycerol + 7% DMSO) were added. Diluted samples were then loaded into 0.5 mL straws and cooled with a programmable freezer. Thereafter the semen straws were plunged directly into liquid nitrogen (-196 ºC) and stored for 48 h. Frozen straws were thawed at 39 ºC for a minute and evaluated for sperm motility and survival at 0, 30, 60 and 90 min post-thaw. The post-thaw sperm survival frozen using glycerol as a cryoprotectant was significantly higher immediately after thawing, compared to DMSO, however, similar to the combination of glycerol and DMSO. There was no significant difference on motility rate immediately (0 min) post-thaw between the three cryoprotectants. Sperm cryopreserved with glycerol exhibited a significantly higher percentage motility at 30, 60 and 90 min post-thaw than in the other cryoprotectants. Based on sperm motility, glycerol was a better cryoprotectant for cryopreservation of Kolbroek boar sperm.

  15. Complications and the effect of varicocelectomy on semen analysis, fertility, early ejaculation and spontaneous abortion

    Directory of Open Access Journals (Sweden)

    Shamsa Ali

    2010-01-01

    Full Text Available Varicocele is still an enigma. Its effects on semen analysis, fertility and, more re-cently, early ejaculation and spontaneous abortion in spouses are not yet fully understood. In this retrospective study, we evaluated these four parameters (semen analysis, fertility, early ejacu-lation and spontaneous abortion among spouses in relation to varicocele and varicocelectomy during a 13-year period. A total of 1,711 patients with varicocele underwent varicocelectomy by high inguinal method (251 cases, subinguinal method (1,375 cases, scrotal method (34 cases, and subinguinal method with local anesthesia (38 cases. Our complication rate was acceptable. Sperm count, motility and morphology increased three months post operation in 55, 51, and 46%, respectively (P value 0.000, 0.000, and 0.015, respectively. Paternity was 56% after one year of post varicocelectomy follow-up. Only 7 out of 82 azoospermic men had sperm in their semen after varicocelectomy and only one of them with mild spermatogenic hypoplasia became a father. The spontaneous abortion rate in the spouses of respondents was 59%. Early ejaculation improved in 75% of the respondents. In conclusion, varicocelectomy does not improve sperm parameters in all men, but it improves pregnancy rate, early ejaculation, and scrotal pain.

  16. Evaluation of buffalo semen by Trypan blue/Giemsa staining and related fertility in vitro

    Directory of Open Access Journals (Sweden)

    B. Gasparrini

    2010-02-01

    Full Text Available The aim of this work was to verify the feasibility of an easy, quick double staining technique for evaluation of frozen-thawed semen to predict the fertilizing capability in vitro of buffalo bulls. In Experiment 1, frozen-thawed semen from 6 bulls was stained with double Trypan blue/ Giemsa and the incidence of acrosome-intact live (AIL, acrosome-intact dead (AID, acrosome-lost live (ALL and acrosome-lost dead (ALD sperm was recorded. In Experiment 2, sperm from the same bulls were used to fertilize in vitro matured oocytes. The data obtained confirm that there is a strong “bull effect” in buffalo species, with differences in the percentage of AIL sperm at thawing, in cleavage and blastocyst rates among bulls. Interestingly, it was found that this staining technique can be used for a preliminary screening to select semen to use for IVF, as shown by the correlation existent between the percentages of acrosome-intact viable sperm cells at thawing and the blastocyst yields for 4/6 bulls.

  17. Effects of Alpha Lipoic Acids on Cattle Sperm Kinetics Using Computer Assisted Semen Analysis

    Directory of Open Access Journals (Sweden)

    Amat Aswadi Abd Karim

    2012-01-01

    Full Text Available This study investigated the protective effect of Alpha Lipoic Acid (ALA on animal sperm quality using Computer Assisted Semen Analysis (CASA. Fresh semen sample collected from adult Limousin bulls. The experiment involved five test groups and a control. Alpha lipoic acid with different concentrations (0.1, 0.05, 0,025, 0.0125 and 0.00625 mmol mL-1 incubated into semen from all test groups. They were cryopreserved and thawed after 1 h. CASA analysis prior to cryopresevation confirmed the baseline condition. While post-thawed investigation determined the changes in sperm quality between the various groups. CASA parameters used were percent motility, Average Path Velocity (VAP, ? sec-1, Curvilinear Velocity (VCL, ? sec-1, Straight Line Velocity (VSL, ? sec-1, Amplitude of Lateral Head displacement (ALH, ?, Beat Cross Frequency (BCF, Hz, Linearity (LIN, ratio of VSL/VCL and Straightness (STR, ratio of VSL/VAP. ALA statistically improved VAP, VCL, VSL, ALH and BCF particularly for ALA concentration > 0.05 mmol L-1. On the other hand, it did not influenced LIN and STR. As a conclusion, ALA influences semicircular sperm motion and increases velocity. It might be useful as an additive in the extender or cryoprotectant agent to improve sperm motility.

  18. Semen characteristics of transwomen referred for sperm banking before sex transition: a case series.

    Science.gov (United States)

    Hamada, A; Kingsberg, S; Wierckx, K; T'Sjoen, G; De Sutter, P; Knudson, G; Agarwal, A

    2014-10-01

    Transwomen (TW) can now turn to cryopreserve spermatozoa before gender reassignment (GR). The objective is to assess semen quality of TW and evaluate adequacy for assisted reproduction technology (ART). Pre-freezing (PF) and post-thaw (PT) semen parameters of 2 and PF data of 27 TW who were referred for sperm banking in Cleveland Clinic/USA and Ghent Center/Belgium, before GR, were retrospectively analysed. The study period was between February, 2003 and October, 2011. We also evaluated adequacy of 24-h PT data for ART. PF data of 29 TW, mean age of 28.9 years, showed high incidence of oligozoospermia (27.58%), asthenozoospermia (31%) and teratozoospermia (31%). Mean sperm concentration was 46.9 × 10(6) /ml, mean per cent motility was 42.9 and mean per cent sperm morphology (Kruger's) was 7.98. The 24-h PT data, for 2 TW, showed mean motility 22.4%, mean total motile sperm count 13.7 × 10(6) and total motile sperm concentration 8.7 × 106/ml. Single patient had used the frozen spermatozoon for intrauterine insemination (IUI) of a surrogate mother resulting in birth of healthy newborn. It is concluded that poor PF and 24-h PT semen quality is frequently seen among TW. As such, considerable proportion of TW should use more expensive method of ART, for example IVF/ICSI rather than inexpensive IUI. PMID:25269748

  19. Pregnancy rates with intrauterine insemination: comparing 1999 and 2010 World Health Organization semen analysis norms.

    Science.gov (United States)

    Papillon-Smith, J; Baker, S E; Agbo, C; Dahan, M H

    2015-04-01

    Over the past 30 years, The World Health Organization has serially measured norms for human sperm. In this study, 1999 and 2010 semen analysis norms as predictors of pregnancy were compared during intrauterine insemination (IUI). A retrospective cohort study was conducted using data collected from the Stanford Fertility Center, between 2005 and 2007, with 981 couples undergoing 2231 IUI cycles. Collected semen was categorized according to total motile sperm counts (TMSC): 'normal (N.) 1999 TMSC', 'abnormal (AbN.) 1999/N. 2010 TMSC', or 'AbN. 2010 TMSC'. Sample comparison was also based on individual semen parameters: 'N. 1999 WHO', 'AbN. 1999/N. 2010 WHO', or 'AbN. 2010 WHO'. Pregnancy (defined by beta-HCG concentration) rates were calculated. Data were compared using correlation coefficients, t-tests and chi-squared tests, with and without adjusting for confounders. Pregnancy rate comparison based on TMSC ('N. 1999 TMSC', 'AbN. 1999/N. 2010 TMSC' and 'AbN. 2010 TMSC') showed a negative correlation (r = -0.41, P = 0.05). Pregnancy rate did not differ when comparisons were based on the presence of abnormal parameters, even when controlling for confounders. Therefore, TMSC based on the 1999 parameters shows best correlation with pregnancy rate for IUI; updating these norms in 2010 has little clinical implication in infertile populations. PMID:25682304

  20. Clinical Study of the Effects of Juglandis Semen Pharmacopuncture Therapy on Shoulder Pain

    Directory of Open Access Journals (Sweden)

    Han-Na Choi

    2011-12-01

    Full Text Available Objectives: The purpose of this study is to examine the effects of Juglandis Semen Pharmaco-puncture Therapy on Shoulder Pain. Methods & Results: Clinical studies on shoulder pain were carried out on 34 patients who were treated at Department of Acupuncture & Moxibusition, Samse Oriental Medical Hospital from June to October, 2009. Patients were divided into two groups, i.e.Sample group(Group A and Control group(Group B. Group B were treated by body acupuncture and cupping therapies while Group A were added juglandis semen pharmacopuncture therapy to therapies of Group A. All patients of both groups were treated three times a week for three weeks. In order to evaluate pain degree, we apply Shoulder Pain and Disability Index(SPADI, Visual Analogue Scale(VAS and the tool developed by Japan’s Industrial Hygienics Society and modified by Korean Doctor. Evaluations were done after first week, second week and third week during period of treatment. Results: Both groups showed significant pain decreasing tendencies. But Group A showed more efficiency comparing to Group B. Conclusions: According to the above-mentioned results, it seems that Juglandis Semen pharmacopuncture therapy could be applied as the effective method for reducing shoulder pain.

  1. Addition of Antioxidants in the Diluter for the Conservation in Fresh of Boar Semen

    Directory of Open Access Journals (Sweden)

    J.C. Ramos Jimenez

    2007-01-01

    Full Text Available The objective of this research was to value the effect of the addition of vitamins C, E and the combination C+E in diluted fresh boar semen on motility and acrosome integrity (NAR. Were used ejaculated coming from a boar of the race Pietrain with two year-old age three months, with weight of 350 kg. were carried out three experiments. The first with vitamin C, the second with vitamin E and the third with vitamin C+E; with concentration of 5 mg mL 1 of diluter of each vitamin for each experiment; a witness, only with diluted semen, were conserved at 18?C in a period of seven days, every other day the motility and acrosome integrity were evaluated. They were carried out 3 repetitions for experiment and the obtained results went for spermatic motility to the seven days of conservation, tha treatment with the vitamin E (46.6%, with vitamin C (0% and with vitamins C+E (1.08, comparison with the witness (64.1%. For NAR, the following results were had, with Vitamin E (62%, with vitamin C (57.6% and with vitamins C+E (60.6%, in comparison with the witness (70.8%. When carrying out the variance analysis, they were differences statistically significant (p1 of diluter, it requires of more investigation in the area of the conservation of the hog semen in fresh, using vitamins E, C and their combination, vitamins E+C.

  2. Effect of Camellia sinensis supplementation and increasing holding time on quality of cryopreserved boar semen.

    Science.gov (United States)

    Gale, I; Gil, L; Malo, C; González, N; Martínez, F

    2015-06-01

    Cryopreservation of boar semen is still considered suboptimal due to the low fertility when compared with fresh semen. This study was performed to evaluate the effects of green tea (Camellia sinensis) supplementation of the freezing extender at different concentration (0, 2.5%, 5%, 10%) and also to determine the influence of increasing holding time from 2 to 24 h at 15 °C. Seventeen ejaculates from nine boars were used to make pools of three of them and then cryopreserved. Sperm motility, viability, acrosome integrity, membrane functionality (HOST) and capacitation status were determined before freezing and at 0, 30, 60, 90 and 120 min after thawing. Lipid peroxidation was evaluated just after thawing. The main findings emerging from this study were the following: (i) no improvement in quality of thawed spermatozoa with addition of tea to the freezing extender, (ii) no improvement in quality of thawed spermatozoa with prolonged holding time, (iii) lower peroxidation rate in presence of tea 5% and (iv) a decrease in the number of uncapacited viable spermatozoa with any tea supplementation. We conclude that amplification of holding time in semen cryopreservation process does not vary results, facilitating freezing protocol. Tea supplementation reduces lipoxidation but did not improve quality parameters. PMID:24909203

  3. Current status of semen preservation in the ram, boar and stallion.

    Science.gov (United States)

    Graham, E F; Crabo, B G; Pace, M M

    1978-01-01

    From the studies cited it was concluded that short and long term preservation of stallion semen has encountered major obstacles. Fertilizing capacity of extended or extended and cooled spermatozoa has been impaired. With the hydrogen ion extenders, the fertility was depressed either with or without glycerol when the semen was inseminated immediately after extension. With the cream-gel extender, fertility was not impaired when inseminated immediately after extension, but was impaired after storage at 5 C for 24 hr or in the presence of glycerol. The fertilizing capacity of extended frozen spermatozoa particularly from some stallions has been more adversely affected than that of others. These studies show that the pregnancy rate range was from 50 to 80% for raw semen from the same stallion used in the frozen studies. Pregnancy rate with this magnitude of difference must be carefully weighed in applying the results from a few stallions to the population. Sufficient information has been generated to suggest that the preservation of stallion spermatozoa is possible but the fertilizing capacity is impaired. Causes of this impairment must be further investigated. When this is accomplished, the number of motile spermatozoa needed per insemination and the frequency of insemination required for optimal fertilization reported in this review must then be reevaluated. PMID:45480

  4. The combined use of embryos and semen for cryogenic conservation of mammalian livestock genetic resources

    Directory of Open Access Journals (Sweden)

    Pizzi Flavia

    2005-11-01

    Full Text Available Abstract The objective of this empirical simulation study was to evaluate the use of a combination of semen and embryos in the creation of gene banks for reconstruction of an extinct breed. Such an approach was compared for banks with varying proportions of embryos on the basis of the amount of the material to be stored, time for reconstruction, maintenance of genetic variability, and probability of failure during reconstruction. Four types of populations were simulated, based on reproductive rate: single offspring, twinning, enhanced reproduction, and litter bearing. Reconstruction was simulated for banks consisting of different combinations of semen and reduced numbers of embryos (expressed as a percentage of the material needed for a bank containing exclusively embryos and ranging from 10 to 90%. The use of a combination of semen and embryos increased the number of insemination cycles needed for reconstruction and the level of genetic relatedness in the reconstructed population. The risk for extinction was unacceptably high when a very low proportion of embryos (

  5. Influence of BHT inclusion on post-thaw attributes of human semen.

    Science.gov (United States)

    Ghorbani, Marzieh; Amiri, Iraj; Khodadadi, Iraj; Fattahi, Amir; Atabakhsh, Mojgan; Tavilani, Heidar

    2015-01-01

    The aim of this study was to determine the effect of butylated hydroxytoluene (BHT) supplemented cryopreservation medium on sperm parameters during the freeze-thaw process. In addition, sperm lipid peroxidation, DNA damage, and the amount of reactive oxygen species (ROS) were determined. Semen samples were obtained from 75 donors. Fifteen semen samples were used for optimizing BHT concentration and incubation time and 60 samples were used for the final experiments. After the determination of basic parameters, groups of three sample with similar parameters were pooled and processed by Pure Sperm gradient centrifugation. The semen samples were then diluted with normal freezing medium (control) or a medium containing 0.5?mM BHT (test) for 5 minute and stored in liquid nitrogen. Frozen cryovials were thawed individually for 20 seconds in a water bath (37°C) for evaluation. Freezing extenders supplemented with 0.5?mM BHT led to higher sperm motility and viability compared with control samples (p?

  6. The impact of male overweight on semen quality and outcome of assisted reproduction

    DEFF Research Database (Denmark)

    Thomsen, Lise; Humaidan, Peter

    2014-01-01

    It is well-documented that male overweight and obesity causes endocrine disorders that might diminish the male reproductive capacity; however, reports have been conflicting regarding the influence of male body mass index (BMI) on semen quality and the outcome of assisted reproductive technology (ART). The aim of this study was to investigate whether increased male BMI affects sperm quality and the outcome of assisted reproduction in couples with an overweight or obese man and a non-obese partner. Data was prospectively collected from 612 infertile couples undergoing ART at a Danish fertility center. Self-reported information on paternal height and weight were recorded and BMI was calculated. The men were divided into four BMI categories: underweight BMI 30 kg m-2 . Conventional semen analysis was performed according to the World Health Organization guideline and sperm DNA integrity was analyzed by the Sperm Chromatin Structure Assay (SCSA). No statistically significant effect of male BMI was seen on conventional semen parameters (sperm concentration, total sperm count, seminal volume and motility) or on SCSA-results. Furthermore, the outcome of ART regarding fertilization rate, number of good quality embryos (GQE ), implantation and pregnancy outcome was not influenced by the increasing male BMI.

  7. Semen quality in men with chronic kidney disease and its correlation with chronic kidney disease stages.

    Science.gov (United States)

    Lehtihet, M; Hylander, B

    2014-12-01

    The aim of this study was to assess whether chronic kidney disease (CKD) has any impact on semen quality parameters in men with CKD stage 1-5. Results were collected from 66 men with different CKD stages (age 18-50 years). Age and BMI (body mass index) were recorded for each male. Higher CKD stage had a significant negative linear trend on semen volume (P < 0.05), progressive motility (P < 0.01), nonprogressive motility (P < 0.001), sperm concentration (P < 0.01), total sperm number (P < 0.01), cytoplasmic droplets (P < 0.01), teratozoospermia index (P < 0.05) and accessory gland markers, ?-glucosidase activity (P < 0.05), zinc (P < 0.01) and fructose (P < 0.01). BMI per se had no significant effect on semen volume, sperm number, sperm concentration, morphology, ?-glucosidase activity, fructose concentration or zinc level. A significant negative correlation between BMI and sexual-hormone-binding globulin (SHBG) (P < 0.01) was observed but not with other sex hormones. Age per se was related to a significant decrease of sperm concentration (P < 0.05), normal forms (P < 0.01) and testosterone level (P < 0.05). Our results indicate that CKD stage per se is a factor determining the number of spermatozoa available in the epididymis for ejaculation, in part independent of age-related decrease of testosterone level and BMI. PMID:25487067

  8. Semen characteristics, scrotal circumference and bacterial isolates of fine wool range rams.

    Science.gov (United States)

    Wiemer, K E; Ruttle, J L

    1987-11-01

    During 1983, 887 fine wool rams were subjected to breeding soundness evaluation to determine effects of age and scrotal circumference on semen characteristics. Of rams evaluated, 94.4, 84.8, and 81.9% of young (6 yr), respectively, were rated as satis-factory. Old rams had fewer (P /=36.7 cm) testis had more (P < 0.10) abnormal cells than those in the same age groups with smaller testis. Scrotal circumference was positively correlated (P < 0.10) to volume and motility in mature and old rams, while motility was negatively correlated (P < 0.01) to percentage of abnormal cells in all age groups. Previous semen testing reduced (P < 0.05) the percentage of mature rams with leucocytes. Vaccination against epididymitis reduced (P < 0.05) the incidence of mature rams with leucocytes and testicular lesions. Brucella ovis was recovered from 54 (67.5%) of 80 ejaculates cultured. Among rams infected with B . ovis , only three (5.6%) were vaccinated against B . ovis and had their semen tested previously. PMID:16726345

  9. Coenzyme Q10 and soyphosphatidylcholine in EK extender on preservation of Rhode Island Red poultry semen

    Directory of Open Access Journals (Sweden)

    Amit Kumar Nath

    2015-06-01

    Full Text Available The objective of this study was to evaluate the efficacy of EK extender alone or incorporation with CoenzymeQ10 (CoQ10 and/or soyphosphatidylcholine (SPC in poultry semen and their effects on seminal traits during temporal storage at 4?C for different time intervals (12 h, 24 h, and 36 h. Heterospermic pooled semen samples diluted (1:4 with EK, EK + SPC, EK+ CoQ10 and EK + SPC + CoQ10 extenders separately, preserved and different spermiogram were assessed. Various seminal traits within the same extender differ significantly (p<0.05 among different groups and with different time intervals of storage. CoQ10 and SPC in the EK extender exhibited favorable synergistic effect on sperm quality and were able to protect the male gametes against cold-stress up to 36h at 4?C. In this study, we concluded that incorporation of SPC and CoQ10 together in EK extender possess novel potentiality to maintain seminal quality during liquid storage of poultry semen at 4?C and for their safe transportation and further use for Artificial Reproductive technologies (ARTs.

  10. [Dimensions of the personality of semen donors and their social behavior].

    Science.gov (United States)

    Taus, L; Gerzová, J

    1991-02-22

    The authors examined using three generally accepted methods, the personality structure of 80 semen donors (Cattell's 16-factor questionnaire, 16PF, Eysenck's personality questionnaire EOD and Leary's method of interpersonal diagnosis of personality). The donors were selected by means of the Questionnaire of semen donors. The group is subdivided into four subgroups by the grade of education, i.e. university graduates, men with secondary and elementary education and university students. All are 20-40 years old. The authors describe the assembled results in different sub-groups and in the group as a whole and compare them mutually and with the standardized norm. With regard to the specificity of individual methods and their application the findings are summarized. The donors are balanced personalities, slightly extrovert, emotionally well developed with a realistic outlook. They have positive, sensitive relations with their environment an behaviour towards other people, they are considerate, careful and disciplined. They respect social norms as regards preservation of originality of personality. They have a slight tendency of sheltering behaviour, they wish to be somewhat more aggressive. No pathological phenomena were observed in the donors. Their intelligence is above average. They make a favourable impression with regard to the demand of mental health and transmission of genetic information. The authors evaluate favourably the Questionnaire for semen donors as the method for selection of donors. PMID:2025897

  11. Complications and the effect of varicocelectomy on semen analysis, fertility, early ejaculation and spontaneous abortion.

    Science.gov (United States)

    Shamsa, Ali; Nademi, M; Aqaee, M; Fard, A Nouraee; Molaei, Mahmood

    2010-11-01

    Varicocele is still an enigma. Its effects on semen analysis, fertility and, more recently, early ejaculation and spontaneous abortion in spouses are not yet fully understood. In this retrospective study, we evaluated these four parameters (semen analysis, fertility, early ejaculation and spontaneous abortion among spouses) in relation to varicocele and varicocelectomy during a 13-year period. A total of 1,711 patients with varicocele underwent varicocelectomy by high inguinal method (251 cases), subinguinal method (1,375 cases), scrotal method (34 cases), and subinguinal method with local anesthesia (38 cases). Our complication rate was acceptable. Sperm count, motility and morphology increased three months post operation in 55, 51, and 46%, respectively (P value 0.000, 0.000, and 0.015, respectively). Paternity was 56% after one year of post varicocelectomy follow-up. Only 7 out of 82 azoospermic men had sperm in their semen after varicocelectomy and only one of them with mild spermatogenic hypoplasia became a father. The spontaneous abortion rate in the spouses of respondents was 59%. Early ejaculation improved in 75% of the respondents. In conclusion, varicocelectomy does not improve sperm parameters in all men, but it improves pregnancy rate, early ejaculation, and scrotal pain. PMID:21060180

  12. The protective effect of antioxidants on liquid and frozen stored ram semen

    Directory of Open Access Journals (Sweden)

    Csilla Budai

    2014-05-01

    Full Text Available This systematic review is focusing on the current literature in order to give an overview of the protective role of antioxidants in ram semen preservation. Throughout the sperm conservation process the unsaturated fatty acids of the spermatozoa membrane binds oxygen and evolves numerous peroxide bonds. The lipid peroxidation leads to unbalanced oxidative stress that causes different impairments of sperm cells, and acrosome loss. ,,Cold shock” also induces caspase cascade involved in apoptosis, DNA fragmentation and in overall it has a detrimental effect on the fertilizing capacity of spermatozoa. Nowadays the cryopreservation of semen is considered as a routine procedure in cattle. Despite the various advantages of the method, the recovery rate of live and intact spermatozoa still remains low in boar, dog and ram samples. Previously several studies highlighted that the addition of antioxidants could improve the survival and motility rates, because antioxidants acted as free radical scavengers and protected spermatozoa against reactive oxygen species (ROS. Enzymatic antioxidants as superoxide dismutase (SOD, catalase, glutathione peroxidase (GPX and non-enzymatic antioxidant molecules like tocopherol, ascorbic acid, pyruvate, resveratrol have a protective effect against membrane damage that occurs during semen preservation process.

  13. Genital Tract Infection in Asymptomatic Infertile Men and Its Effect on Semen Quality

    Directory of Open Access Journals (Sweden)

    M Golshani

    2006-07-01

    Full Text Available Male urogenital tract infection plays an important role in men infertility. Asymptomatic bacteriospermia has been paid attention as a major cause of male infertility. The aim of this study was to microbiological investigation of semen sample of infertile men attending to infertility clinic and evaluation of the effects of bacteriospermia on semen quality. Eighty eight infertile men were evaluated by standard bacterial culture method. Standard semen analysis was performed according to WHO guidelines. Among total cases, 35.22% (31 cases showed at least one pathogen: 10.22% E.coli, 9.09% Coagulase Negative Staphylococci (Saprophyticcus, 6.81% Group B Streptococci, 5.88% Entrococci, 5.68% Candida sp., 2.27% Gonococci, 2.27% Staphylococcus aureus, 1.13% Klebsiella sp. and 1.13% Providencia sp. There was a significant relation between the bacteriospermia and the rate of no motile and morphologically abnormal sperms (P0.05. It seems that leukocytospermia is a poor marker to predict bacteriospermia.

  14. Psychological factors in male partners of infertile couples: relationship with semen quality and early miscarriage.

    Science.gov (United States)

    Zorn, B; Auger, J; Velikonja, V; Kolbezen, M; Meden-Vrtovec, H

    2008-12-01

    In this study we sought to evaluate whether psychological factors in males affect semen quality and pregnancy. In 1076 men of infertile couples, psychological factors, i.e. exposure to acute stress, coping with stress, the WHO (five) Well-Being Index and the Zung's Anxiety Scale Inventory scores were assessed by a questionnaire at the time of semen analysis. Relationships between psychological factors and semen quality (sperm concentration, rapid and progressive motility and normal morphology) were assessed. In 353 men with infertility duration of or =5 x 10(6) sperm/mL and a female partner with a laparoscopically confirmed tubal patency, we looked prospectively for relations between psychological factors and the occurrence of a natural pregnancy at a 6-month follow-up (n = 124), and first-trimester loss (n = 18). Anxiety trait, found in 19% of men, was related to previous in vitro fertilization/intracytoplasmic sperm injection attempts (p = 0.014), cigarette intake (p = 0.006), alcohol intake (p = 0.026) and sexual difficulties (p coping with stress was related to the occurrence of a first-trimester miscarriage (p = 0.016) in the female partner. Possible depression in males is related to decreased sperm concentration, and poor coping with stress is associated with increased occurrence of early miscarriage. PMID:17651396

  15. INFLUENCE OF INSULIN IN THE FREEZING OF THE OVINE SEMEN NFLUÊNCIA DA INSULINA NA CONGELABILIDADE DO SÊMEN DE OVINO

    Directory of Open Access Journals (Sweden)

    Angelo José Burla Dias

    2008-10-01

    Full Text Available

    Insulin is present on seminal plasma and it can be involved on sperm capacitation and sperm autocrine metabolism (AQUILA et al., 2005. It was verified the effect of insulin addition on ovine frozen semen extender. The parameters analyzed were sperm motility, sperm cinematic, acrossoma integrity and membrane functionality. Insulin was added to fraction B of TRIS-yolk extender in different concentrations. Sperm motility and cinematic were evaluated 0, 3 and 6 hours after thawing while acrossoma integrity and membrane functionality were evaluated 0 and 6 hours after thawing. The addition of 3 UI/mL of insulin increased amplitude lateral of head (5.42±0.97; C:4.75±0.47 and acrossoma integrity (153.67±16.98; C:134.00±18.08. The addition of 0.3 UI/mL of insulin improved retilinearity tree hours after thawing (83.17±2.71; C:78.67±4.97. It was verified a increase on linearity values on treatments with 0.3 e 3 UI/mL (52.17±2.14; 51.67±3.14; C:46.83±3.60, respectively tree hours after thawing. Treatment with 0.3 e 3 UI/ml showed higher acrossoma integrity than control (146.17±10.91; 146.33±16.02; C:117.00±17.80. Addiction of insulin on ovine frozen semen extender improved sperm motility, sperm cinematic and acrossoma integrity.

    KEY WORDS: Freezing, insulin, ovine, spermetozoa.

    A insulina está presente no plasma seminal e pode envolver-se em eventos da capacitação e metabolismo autócrino do espermatozóide (AQUILA et al., 2005. Assim, estudaram-se os efeitos da insulina adicionada ao diluente de congelamento para sêmen e sua conseqüência na criopreservação, integridade de acrossoma e funcionalidade de membrana de espermatozóide ovino. A insulina foi adicionada na fração B do diluente TRIS-gema em diferentes concentrações. As avaliações da motilidade e cinemática realizaram-se às 0, 3 e 6 horas, enquanto a funcionalidade e integridade de membrana foram avaliadas às 0 e 6 horas após o descongelamento. A adição de 3,0 UI/mL de insulina aumentou (P>0,05 a amplitude lateral de cabeça (5,42±0,97; C:4,75±0,47 e acrossomas íntegros (153,67±16,98; C:134,00±18,08. A concentração de 0,3 UI/mL de insulina melhorou a retilinearidade, quando verificada no período de 3 horas (83,17±2,71; C:78,67±4,97. Nesse mesmo período, observou-se uma elevação nos valores de linearidade nas concentrações de 0,3 e 3,0 UI/mL de insulina (52,17±2,14; 51,67±3,14; C:46,83±3,60, respectivamente. Seis horas após o descongelamento, os tratamentos com 0,3 e 3,0 UI/mL apresentaram valores de acrossomas íntegros mais elevados (146,17±10,91; 146,33±16,02; C:117,00±17,80, respectivamente. A adição de insulina ao diluente aumentou a motilidade, cinemática e integridade de acrossoma do sêmen ovino congelado.

    PALAVRAS-CHAVES: Congelamento, espermatozóides, insulina, ovino.

  16. RNA/DNA co-analysis from human saliva and semen stains--results of a third collaborative EDNAP exercise

    DEFF Research Database (Denmark)

    Haas, Claus; Hanson, E

    2013-01-01

    A third collaborative exercise on RNA/DNA co-analysis for body fluid identification and STR profiling was organized by the European DNA Profiling Group (EDNAP). Twenty saliva and semen stains, four dilution series (10-0.01 µl saliva, 5-0.01 µl semen) and, optionally, bona fide or mock casework samples of human or non-human origin were analyzed by 20 participating laboratories using an RNA extraction or RNA/DNA co-extraction method. Two novel mRNA multiplexes were used: a saliva triplex (HTN3, STATH and MUC7) and a semen pentaplex (PRM1, PRM2, PSA, SEMG1 and TGM4). The laboratories used different chemistries and instrumentation and a majority (16/20) were able to successfully isolate and detect mRNA in dried stains. The simultaneous extraction of RNA and DNA from individual stains not only permitted a confirmation of the presence of saliva/semen (i.e. tissue/fluid source of origin), but allowed an STR profile of the stain donor to be obtained as well. The method proved to be reproducible and sensitive, with aslittle as 0.05 µl saliva or semen, using different analysis strategies. Additionally, we demonstrated the ability to positively identify the presence of saliva and semen, as well as obtain high quality DNA profiles, from old and compromised casework samples. The results of this collaborative exercise involving an RNA/DNA co-extraction strategy support the potential use of an mRNA based system for the identification of saliva and semen in forensic casework that is compatible with current DNA analysis methodologies.

  17. Enriching the captive elephant population genetic pool through artificial insemination with frozen-thawed semen collected in the wild.

    Science.gov (United States)

    Hildebrandt, T B; Hermes, R; Saragusty, J; Potier, R; Schwammer, H M; Balfanz, F; Vielgrader, H; Baker, B; Bartels, P; Göritz, F

    2012-10-01

    The first successful AI in an elephant was reported in 1998, using fresh semen. Since then almost 40 calves have been produced through AI in both Asian and African elephants worldwide. Following these successes, with the objective of enriching the captive population with genetic material from the wild, we evaluated the possibility of using frozen-thawed semen collected from wild bulls for AI in captivity. Semen, collected from a 36-yr-old wild African savanna elephant (Loxodonta africana) in South Africa was frozen using the directional freezing technique. This frozen-thawed semen was used for four inseminations over two consecutive days, two before and two after ovulation, in a 26-yr-old female African savanna elephant in Austria. Insemination dose of 1200 × 10(6) cells per AI with 61% motility resulted in pregnancy, which was confirmed through ultrasound examination 75, 110 and 141 days after the AI procedure. This represents the first successful AI using wild bull frozen-thawed semen in elephants. The incorporation of AI with frozen-thawed semen into the assisted reproduction toolbox opens the way to preserve and transport semen between distant individuals in captivity or, as was done in this study, between wild and captive populations, without the need to transport stressed or potentially disease-carrying animals or to remove animals from the wild. In addition, cryopreserved spermatozoa, in combination with AI, are useful methods to extend the reproductive lifespan of individuals beyond their biological lifespan and an important tool for genetic diversity management and phenotype selection in these endangered mammals. PMID:22898009

  18. Infectious pathogens potentially transmitted by semen of the black variety of the Manchega sheep breed: Health constraints for conservation purposes.

    Science.gov (United States)

    Ruiz-Fons, Francisco; González-Barrio, David; Aguilar-Ríos, Fernando; Soler, Ana J; Garde, José Julián; Gortázar, Christian; Fernández-Santos, María Del Rocío

    2014-10-01

    Conservation of genetic resources from endangered breeds may be conducted through germinal banks. Preservation of healthy samples is paramount to avoid preserving pathogens shed with germinal products. The black variety of Manchega sheep (BMS), and endangered breed endemic to south-central Spain, is the subject of a conservation program; a germinal bank has been recently established. However, several pathogens circulating in BMS flocks may be shed with semen and threaten BMS preservation. Therefore, we investigated the sanitary status of BMS flocks and semen samples from 4 of the 17 flocks in which this variety is bred worldwide. A serological screening for Maedi-Visna virus, bluetongue virus, Pestivirus spp., Brucella spp., Coxiella burnetii, Chlamydophila spp., Mycobacterium tuberculosis complex, Mycobacterium avium paratuberculosis, Anaplasma spp., Mycoplasma agalactiae, Toxoplasma gondii and Neospora caninum was performed to assess for pathogens potentially shed by semen. Semen samples from 11 of the 35 BMS rams and 4 samples from coexisting rams of the white variety (WMS) were analyzed by PCR to detect Maedi-Visna virus, C. burnetii, Anaplasma marginale, Anaplasma phagocytophilum and T. gondii. Maedi-Visna virus RNA was detected in 3 semen samples (2 BMS and 1 WMS) while C. burnetii DNA was detected in 3 samples from WMS rams. Pathogens that can be transmitted by semen were present in BMS flocks, and Maedi-Visna virus and C. burnetii showed the highest potential for transmission by artificial insemination. Our results point to the need of testing semen samples kept for conservation purposes of BMS before using them for artificial insemination. PMID:25066603

  19. TRIXcell+, a new long-term boar semen extender containing whey protein with higher preservation capacity and litter size

    Directory of Open Access Journals (Sweden)

    B.M. van den Berg

    2014-02-01

    Full Text Available It was the aim of the present study to test whey as protective protein for the sperm cell in the long-term boar semen preservation medium TRIXcell. Analyses of sperm cell motility using computer-assisted semen analysis (CASA indicated that the whey protein Porex has a similar protective effect as bovine serum albumin (BSA in maintaining viability of stored boar sperm. Boar sperm diluted in TRIXcell+ maintains commercially acceptable motility (>60% for 10 days, while swine sperm diluted in the semen preservation medium Beltsville Thawing Solution (BTS maintains commercially acceptable motility (>60% for 3-5 days for most boars. To test the on-farm fertility performance of TRIXcell+ compared to BTS, inseminations were started on 35 commercial pig production farms in the summer of 2006. During the period of July 2006 until July 2012 for each farm and each calendar year the mean farrowing rate and litter size for semen diluted in TRIXcell+ and stored for 3-5 days was found higher than that of semen stored for 1-2 days in BTS. Based on data gained from a total of 583.749 sows inseminated through the years 2006-2012, the mean farrowing rate for semen diluted in TRIXcell+ and BTS was 90.4 ± 4.0 and 87.9 ± 3.6, respectively, which is not significantly different. Based on the same data, the mean total number of piglets born alive for semen diluted in TRIXcell+ and BTS was 14.2 ± 0.7 and 13.6 ± 0.6, respectively, which is significantly different. We conclude that whey protein can effectively be used in the long-term preservation medium TRIXcell resulting in a higher litter size.

  20. Factors affecting sperm recovery rates and survival after centrifugation of equine semen.

    Science.gov (United States)

    Ferrer, M S; Lyle, S K; Eilts, B E; Eljarrah, A H; Paccamonti, D L

    2012-11-01

    Conventional centrifugation protocols result in important sperm losses during removal of the supernatant. In this study, the effect of centrifugation force (400 or 900 × g), duration (5 or 10 min), and column height (20 or 40 mL; Experiment 1); sperm concentration (25, 50, and 100 × 10(6)/mL; Experiment 2), and centrifugation medium (EZ-Mixin CST [Animal Reproduction Systems, Chino, CA, USA], INRA96 [IMV Technologies, Maple Grove, MN, USA], or VMDZ [Partnar Animal Health, Port Huron, MI, USA]; Experiment 3) on sperm recovery and survival after centrifugation and cooling and storage were evaluated. Overall, sperm survival was not affected by the combination of centrifugation protocol and cooling. Total sperm yield was highest after centrifugation for 10 min at 400 × g in 20-mL columns (95.6 ± 5%, mean ± SD) or 900 × g in 20-mL (99.2 ± 0.8%) or 40-mL (91.4 ± 4.5%) columns, and at 900 × g for 5 min in 20-mL columns (93.8 ± 8.9%; P yield followed a similar pattern (P yields were not significantly different among samples centrifuged at various sperm concentrations. However, centrifugation at 100 × 10(6)/mL resulted in significantly lower total sperm yield (83.8 ± 10.7%) and TMY (81.7 ± 6.8%) compared with noncentrifuged semen. Centrifugation in VMDZ resulted in significantly lower TMY (69.3 ± 22.6%), progressively motile sperm yield (63.5 ± 18.2%), viable yield (60.9 ± 36.5%), and survival of progressively motile sperm after cooling (21 ± 10.8%) compared with noncentrifuged semen. In conclusion, centrifuging volumes of ? 20 mL minimized sperm losses with conventional protocols. With 40-mL columns, it may be recommended to increase the centrifugal force to 900 × g for 10 min and dilute the semen to a sperm concentration of 25 to 50 × 10(6)/mL in a milk- or fractionated milk-based medium. The semen extender VMDZ did not seem well suited for centrifugation of equine semen. PMID:22975232

  1. Estudio comparativo de dos tratamientos con antibióticos sobre la calidad bacteriológica y espermática del semen bovino.

    Directory of Open Access Journals (Sweden)

    Trujillo A Luis Emilio

    2002-06-01

    Full Text Available Para investigar el efecto antibacteriano y sobre la calidad del semen bovino se aplicaron dos tratamientos con antibióticos al diluyente de conservación. Una terapia consideró el uso de una nueva combinación de antibióticos (100 ?g/ml de tilosina, 500 ?g/ml de gentamicina, 300 ?g/ml de lincomicina y 600 ?gl/ml de espectinomicina y la otra utilizó la combinación tradicional de 1000 Ul/ml de penicilina y 1 ?g/ml de sulfato de estreptomicina. La investigacion se realizó en el Laboratorio de Procesamiento de Semen de San Pablo de la Universidad Nacional de Colombia Sede Medellín bajo condiciones bioclimáticas correspondientes a una zona de vida de bosque húmedo montano bajo (bh-MB. El semen recibió el tratamiento antibiótico en la fracción A del diluyente a una temperatura de 32?C y se le permitió interactuar por espacio de 10 minutos antes de darse inicio al descenso de la temperatura hasta 5?C, momento en el cual se adicionó la fracción B del diluyente con el crioprotector, se estabilizó durante tres horas y se congeló en pajillas francesas de 0,5 ml. Para efecto de la evaluación del crecimiento bacterial e identificación de las colonias las muestras fueron sometidas a cultivo y aislamiento en agar sangre y agar MacConkey. La calidad seminal se evaluó por el porcentaje de espermas móviles, porcentaje de espermas vivos y morfología espermática. El efecto de los tratamientos se analizó por análisis de varianza y los promedios fueron comparados por la prueba de los rangos múltiples de Duncan. El 62,5% de las muestras presentaron contaminación bacteriana por Escherichia coli, Proteus spp o Klebsiella spp.y el promedio de unidades formadoras de colonias (UFC en las muestras contaminadas fue de 6,416 UFC/ml de semen, variando entre cero (0 y 30.000. Los dos tratamientos con antibióticos ejercieron un efecto bactericida que permaneció durante el proceso de congelación y descongelación del semen. No se presentaron efectos de los tratamientos sobre las características movilidad, vitalidad y morfología espermáticas.

  2. Effect of homeopathic treatment used in commercial boar semen diluent on sperm viability

    Directory of Open Access Journals (Sweden)

    Mayra Assunpção

    2012-09-01

    Full Text Available Background: It has been speculated that the homeopathic treatment of sperm cells in order to improve semen quality could be promising. However, few data is available and its use in spermatozoa requires investigation. It is well established that mitochondrial membrane potential is an important viability parameter of spermatozoa and it is intimately related to reproductive efficiency. In this manner, new technologies in order to improve the activity of sperm cells and, finally, the fecundity of swine herds are of extremely importance. Due to the lack of knowledge of homeopathic treatment effect on spermatozoa, the aim of the present study was to verify the effect of three different homeopathic treatments on viability of boar sperm cells. Methods: semen samples were obtained from two sexually mature boars (18 mo of age. The boars were cross bred, with similar genetics of Pietrain versus Duroc, BP 450 progeny from a supplier company of similar reproductive performance animals. The animals were maintained in individual stalls, study conducted in Sao Paulo - Brazil. Three homeopathic treatments: Pulsatilla 6CH, Avena 6 CH or both, compared to placebo treatment (sucrose, the homeopathic medicaments or the control were administrated as globules manipulated according Brazilian Homeopathic Pharmacology. Each globule weighted 30 mg and contained sucrose as vehicle. One dose of two globules was added per 100 mL of diluted boar semen, which were chilled for 24 or 48 hours. All samples were labeled in codes in order to allow all laboratory analysis and evaluations being performed as a blind test. Data were tested for normality of residues and homogeneity of variances using the Guided Data Analysis software. Variables and interactions were analyzed by the PROC MIXED of the SAS package (SAS Institute Ins. Cary, NC. Adjusted least squares means (LSMEANS of treatments were compared using the Tukey Test. Results: The different treatments contributed to maintain acrossome integrity for prolonged periods of cooling over 48 hours. The use of Pulsatilla was effective in maintaining high sperm mitochondria activity up to 24 hours from harvesting. Conclusion: Homeopathic medications can be used in artificial insemination in order to improve the quality of cooled and stored pig semen [1]. Keywords: homeopathy, swine semen, sperm viability. Reference [1] Soto, F. R. M.; Vuaden, E. R.; Coelho, C. P.; Bonamin, L. V.; Azevedo, S. S. A.; Benites, N. R.; Barros, F. R. O.; Goissis, M. D.; Assumpção, M. E. O. D.; Visintin, J. A.; Marques, M. G. Effects of the utilization of homeopathic elements in commercial diluent on swine sperm viability. In Vitro Cell.Dev.Biol.—Animal. 47:205–209, 2011.

  3. Predictive value of semen parameters and age of the couple in pregnancy outcome after Intrauterine insemination

    Directory of Open Access Journals (Sweden)

    Marjan Sabbaghian

    2013-11-01

    Full Text Available Background: Intrauterine insemination (IUI is one the most common methods in infertility treatment, but its efficiency in infertile couples with male factor is controversial. This study is a retrospective study about correlation between semen parameters and male and female age with successful rate of IUI in patients attending to Royan Institute.Methods: A total of 998 consecutive couples in a period of 6 months undergoing IUI were included. They were classified into two groups: couples with successful and unsuccessful pregnancy. Main outcome was clinical pregnancy. Data about male and female ages and semen analysis including concentration, total sperm motility, class A motility, class B motility, class A+B motility and normal morphology was extracted from patients’ records. Semen samples were collected by masturbation or coitus after 2 to 7 days of abstinence. Their female partners were reported to have no chronic medi-cal conditions and have normal menstrual cycles.Results: One hundred and fifty seven of total 998 cycles (15.7% achieved pregnancy. The average of female age in successful and unsuccessful group was 28.95±4.19 and 30.00±4.56 years, respectively. Mean of male age was 33.97±4.85 years in successful group and 34.44±4.62 years in unsuccessful group. In successful and unsuccessful groups, average of sperm concentration was 53.62±38.45 and 46.26±26.59 (million sperm/ml, normal morphology of sperm was 8.98±4.31 (% and 8.68±4.81 (%, sperm total motility was 47.24±18.92 (% and 43.70±20.22 (% and total motile sperm count was 80.10±63.61 million and 78.57±68.22 million, respectively.Conclusion: There was no significant difference in mean of females’ age and males’ age between successful and unsuccessful groups (P<0.05. In addition, there was no significant difference in semen parameters including concentration, total sperm motility, class A motility, class B motility, class A+B motility and normal morphology between two groups. It was shown that common semen analysis and male and female ages cannot predict IUI outcome.

  4. The Semen Quantity and Quality of Two Fowl Strains Supplemented with Vitamin E (?–Tocopherol

    Directory of Open Access Journals (Sweden)

    AG Nataamijaya

    2005-05-01

    Full Text Available The study on semen quantity and quality of Kampung and Arab fowl under various levels of vitamin E supplementation was conducted, using 2x4 factorial Completely Randomized Design with 4 replicates. Analysis of variance followed by Duncan New Multiple Range Test were used to analyze the data. Levels of vitamin E given orally were 0 IU (control; 2 IU (t1; 4 IU (t2 and 8 IU (t3 per bird daily. The results showed that semen volume was not affected by genotype (Kampung: 0.26 ± 0.05 ml Vs. Arab: 0.22 ± 0.05 ml while the vitamin E treatments significantly (P<0.05 affected the semen volume i.e. 0.16 ± 0.06 ml (control; 0.27 ± 0.04 ml (t1; 0.28 ± 0.03 ml (t2 and 0.23 ± 0.03 ml (t3. Semen viscosity was not affected by genotype, but was substantially affected by vitamin E treatments. The semen pH was not influenced by all treatments given, spermatozoa concentration of Kampung (1.80 ± 0.39 billion/ml was not significantly different with that of Arab (1.86 ± 0.16 billion/ml. Vitamin E treatments resulted in different (P<0.05 spermatozoa concentration among control (1.50 ± 0.16 billion/ml, t1 (1.98 ± 0.14 billion/ml, t2 (2.01 ± 0.09 billion/ml and t3 (1.87 ± 0.18 billion/ml. No significant different found on semen mass movement between Kampung and Arab, also among vitamin E treatments. The spermatozoa motility of Kampung and Arab was not statistically different, however vitamin E improved motility significantly (P<0.05; control (2.90 ± 0.59; t1 (3.5 ± 0.16; t2 (3.54 ± 0.25 and t3 (3.44 ± 0.48. Percentage of dead spermatozoa of Kampung and Arab were 18.24 ± 1.98% and 17.35 ± 2.74%, while vitamin E supplementation results were as follows 18.10 ± 3.03% (control; 18.54 ± 2.01% (t1; 17.72 ± 1.47% (t2 and 16.82 ± 2.87% (t3 no significant different was found. Percentage of abnormal spermatozoa of Kampung (4.35 ± 0.80% and Arab (4.64 ± 0.87% was not different statistically. Among the vitamin E treatme