WorldWideScience

Sample records for semen plasma glycerylphosphorylcholine

  1. Efecto del plasma seminal sobre el estado redox del semen equino criopreservado / Effect of seminal plasma on the redox state of cryopreserved stallion semen

    Scientific Electronic Library Online (English)

    Edison, Pizarro L; Giovanni, Restrepo B; José, Echeverry Z; Benjamín, Rojano.

    2013-12-01

    Full Text Available Objetivo. Determinar el efecto del plasma seminal sobre la generación de especies reactivas de oxígeno (ERO) y la peroxidación lipídica de semen equino criopreservado y su asociación con parámetros de calidad seminal. Materiales y métodos. El semen de cinco caballos de la raza criollo colombiano (do [...] s eyaculados cada uno), fue criopreservado mediante un protocolo de congelación rápida, empleando un diluyente leche-yema de huevo, suplementado con 0%, 10% y 20% de plasma seminal equino. En muestras de semen fresco y criopreservado se evaluó la generación de ERO y la peroxidación lipídica por espectrofluorimetría, y los parámetros de calidad seminal de movilidad progresiva, vitalidad e integridad de membrana, mediante microscopia de contraste de fase. Para el análisis estadístico se ajustaron modelos mixtos y se realizaron análisis de regresión y correlación. Resultados. Se hallaron promedios post-descongelación de movilidad progresiva, vitalidad e integridad de membrana de 37.8%±20.2, 50.6% ± 14.6 y 37.8% ± 15.5, respectivamente. Para el semen fresco y criopreservado suplementado con 0%, 10% y 20% de plasma seminal, los promedios de producción de ERO (URF) fueron de 13.34±10.7, 16.15 ± 13.5, 17.32 ± 16 y 22.98 ± 19.4, respectivamente; mostrando un incremento estadísticamente significativo (p?0.05) en la producción de ERO por efecto de la criopreservación y la suplementación con plasma seminal. Los promedios de peroxidación lipídica (nmolMDA/ml) para estos mismos tratamientos, fueron de 0.41 ± 0.25, 0.72±0.37, 0.51 ± 0.29 y 0.47±0.26, respectivamente; mostrando una reducción significativa (p?0.05) de la peroxidación lipídica del semen suplementado con 10% y 20% de plasma seminal, respecto al semen no suplementado (0%). Conclusiones. El plasma seminal reduce la peroxidación lipídica del semen equino criopreservado. Abstract in english Objective. Determine the effect of seminal plasma on the generation of reactive oxygen species (ROS) and lipid peroxidation of cryopreserved stallion semen, and its association with semen quality parameters. Materials and methods. The semen of five stallions of Colombian creole breed (two ejaculates [...] each) was cryopreserved by a rapid freezing protocol, using a milk-egg yolk extender supplemented with 0%, 10% and 20% of equine seminal plasma. The samples of fresh and cryopreserved semen were evaluated for ROS generation and lipid peroxidation by spectrofluorimetry, and semen quality parameters of progressive motility, vitality and membrane integrity using phase contrast microscopy. Mixed models were adjusted for statistical, regression, and correlation analysis. Results. Post-thaw averages of progressive motility, vitality and integrity of membrane of 37.8% ± 20.2, 50.6% ± 14.6 and 37.8 ± 15.5%, respectively were found. For fresh and cryopreserved semen supplemented with 0%, 10% and 20% of seminal plasma, the averages of ROS production (RFU) were 13.34 ± 10.7, 16.15 ± 13.5, 17.32 ± 16 and 22.98 ± 19.4, respectively; showing a statistically significant increase (p?0.05) of ROS production by effect of cryopreservation and seminal plasma supplementation. The averages of lipid peroxidation (nmolMDA / ml) for these same treatments were 0.41 ± 0.25, 0.72 ± 0.37, 0.51 ± 0.29 and 0.47 ± 0.26, respectively; showing a significant decrease (p?0.05) of lipid peroxidation of semen supplemented with 10% and 20% of seminal plasma compared to unsupplemented semen (0%). Conclusions. Seminal plasma reduces lipid peroxidation of stallion cryopreserved semen.

  2. Efecto de la adición de plasma seminal en el semen equino descongelado Effect of seminal plasma addition on frozen-thawed equine semen

    Directory of Open Access Journals (Sweden)

    D. Lozano Benito

    2011-09-01

    Full Text Available Antecedentes y objetivos: El semen criopreservado ofrece beneficios adicionales no presentes en el semen refrigerado. Sin embargo, varios factores afectan al éxito en la inseminación artificial con semen congelado de caballos. El objetivo del trabajo es evaluar si la adición de plasma seminal a diferentes concentraciones, sobre espermatozoides equinos descongelados, afecta a la motilidad espermática, viabilidad y a nivel de membrana. Material y métodos: Se utilizaron diferentes razas, cuatro sementales de silla, y dos sementales de tiro. En un primer experimento el semen descongelado se centrifugó, mientras en el segundo no se centrifugó. A continuación, se adicionó el plasma seminal al 10, 20, 30% suspendido en solución tampón fosfato y plasma seminal puro (100%. Resultados: En los caballos de silla el plasma seminal no afectó a los parámetros estudiados (p>0,05, pero se apreció un posible efecto tóxico del plasma seminal puro sobre las características espermáticas. En las muestras con plasma seminal de los caballos de tiro, se observaron unos índices mejores en espermatozoides vivos con acrosoma intacto que en las muestras control. Asimismo se obtuvo un porcentaje menor en espermatozoides reaccionados que en las muestras control, encontrando en esta categoría una diferencia significativa (pBackground and objectives: Stallion sperm cryopreservation offers benefits not available in cooled semen. However various factors affect the success of artificial insemination with frozen-thawed equine semen. This study aims to evaluate if adding different concentrations of seminal plasma on frozen-thawed equine spermatozoa affects sperm motility, viability and membrane status. Material and Methods: Different breeds were used; four saddle stallions and two draft stallions. In the first experiment thawed semen was centrifuged and in the second one it was not. Subsequent to that, the spermatozoa resuspended with 10, 20, 30% seminal plasma in phosphate buffered saline and pure seminal plasma (100%. Results: semen parameters of saddle stallions were not affected (p>0,05, but a possible toxic effect of pure seminal plasma was observed on sperm characteristics. Seminal plasma samples in draft breed got better rates in viable sperm with intact acrosome. A lower percentage was also found on spermatozoa with acrosome reaction than in control samples. This category showed signif icant differences (p<0,05. Conclusions: Post-thawing spermatozoa incubation with seminal plasma can stop acrosome reaction, due to the low percentage of spermatozoa suffering true acrosome reaction.

  3. Efecto de la adición de plasma seminal en el semen equino descongelado / Effect of seminal plasma addition on frozen-thawed equine semen

    Scientific Electronic Library Online (English)

    D., Lozano Benito; L., Gil Huerta; C., Álvarez San Martín.

    2011-09-01

    Full Text Available Antecedentes y objetivos: El semen criopreservado ofrece beneficios adicionales no presentes en el semen refrigerado. Sin embargo, varios factores afectan al éxito en la inseminación artificial con semen congelado de caballos. El objetivo del trabajo es evaluar si la adición de plasma seminal a dife [...] rentes concentraciones, sobre espermatozoides equinos descongelados, afecta a la motilidad espermática, viabilidad y a nivel de membrana. Material y métodos: Se utilizaron diferentes razas, cuatro sementales de silla, y dos sementales de tiro. En un primer experimento el semen descongelado se centrifugó, mientras en el segundo no se centrifugó. A continuación, se adicionó el plasma seminal al 10, 20, 30% suspendido en solución tampón fosfato y plasma seminal puro (100%). Resultados: En los caballos de silla el plasma seminal no afectó a los parámetros estudiados (p>0,05), pero se apreció un posible efecto tóxico del plasma seminal puro sobre las características espermáticas. En las muestras con plasma seminal de los caballos de tiro, se observaron unos índices mejores en espermatozoides vivos con acrosoma intacto que en las muestras control. Asimismo se obtuvo un porcentaje menor en espermatozoides reaccionados que en las muestras control, encontrando en esta categoría una diferencia significativa (p Abstract in english Background and objectives: Stallion sperm cryopreservation offers benefits not available in cooled semen. However various factors affect the success of artificial insemination with frozen-thawed equine semen. This study aims to evaluate if adding different concentrations of seminal plasma on frozen- [...] thawed equine spermatozoa affects sperm motility, viability and membrane status. Material and Methods: Different breeds were used; four saddle stallions and two draft stallions. In the first experiment thawed semen was centrifuged and in the second one it was not. Subsequent to that, the spermatozoa resuspended with 10, 20, 30% seminal plasma in phosphate buffered saline and pure seminal plasma (100%). Results: semen parameters of saddle stallions were not affected (p>0,05), but a possible toxic effect of pure seminal plasma was observed on sperm characteristics. Seminal plasma samples in draft breed got better rates in viable sperm with intact acrosome. A lower percentage was also found on spermatozoa with acrosome reaction than in control samples. This category showed signif icant differences (p

  4. Efecto del plasma seminal sobre el estado redox del semen equino criopreservado

    Directory of Open Access Journals (Sweden)

    Edison Pizarro L.

    2013-10-01

    Full Text Available Objetivo. Determinar el efecto del plasma seminal sobre la generación de especies reactivas de oxígeno (ERO y la peroxidación lipídica de semen equino criopreservado y su asociación con parámetros de calidad seminal. Materiales y métodos. El semen de cinco caballos de la raza criollo colombiano (dos eyaculados cada uno, fue criopreservado mediante un protocolo de congelación rápida, empleando un diluyente leche-yema de huevo, suplementado con 0%, 10% y 20% de plasma seminal equino. En muestras de semen fresco y criopreservado se evaluó la generación de ERO y la peroxidación lipídica por espectrofluorimetría, y los parámetros de calidad seminal de movilidad progresiva, vitalidad e integridad de membrana, mediante microscopia de contraste de fase. Para el análisis estadístico se ajustaron modelos mixtos y se realizaron análisis de regresión y correlación. Resultados. Se hallaron promedios post-descongelación de movilidad progresiva, vitalidad e integridad de membrana de 37.8%±20.2, 50.6% ± 14.6 y 37.8% ± 15.5, respectivamente. Para el semen fresco y criopreservado suplementado con 0%, 10% y 20% de plasma seminal, los promedios de producción de ERO (URF fueron de 13.34±10.7, 16.15 ± 13.5, 17.32 ± 16 y 22.98 ± 19.4, respectivamente; mostrando un incremento estadísticamente significativo (p?0.05 en la producción de ERO por efecto de la criopreservación y la suplementación con plasma seminal. Los promedios de peroxidación lipídica (nmolMDA/ml para estos mismos tratamientos, fueron de 0.41 ± 0.25, 0.72±0.37, 0.51 ± 0.29 y 0.47±0.26, respectivamente; mostrando una reducción significativa (p?0.05 de la peroxidación lipídica del semen suplementado con 10% y 20% de plasma seminal, respecto al semen no suplementado (0%. Conclusiones. El plasma seminal reduce la peroxidación lipídica del semen equino criopreservado.

  5. Relationship of zinc concentrations in blood and seminal plasma with various semen parameters in infertile subjects

    International Nuclear Information System (INIS)

    To find out relationship of zinc concentrations in blood and seminal plasma with various semen parameters between fertile and infertile men. (JPMC), Karachi and Department of Biochemistry. Basic Medical Sciences Institute, JPMC, Karachi. Fifty eight primary infertile male subjects, without any treatment, who had regular unprotected intercourse for at least 12 months without conception with their partners, aged 20-40 years, were selected from Infertility Clinic Jinnah Postgraduate Medical Center, Karachi. After semen analyses they were grouped as, oligospermic (30), and azoospermic (28). Twenty five known fertile male selected from general population and after semen analysis were taken as normospermic control group. Semen analyzed according to WHO criteria. Serum and seminal plasma zinc were estimated by 5Br. PAPS Colorimetric method. This study showed significant difference in serum and seminal zinc levels in normospermic, oligospermic (p<0.05) and azoospermic (p<0.005). Seminal plasma zinc showed a positive correlation with sperm count and negative with sperm motility in normospermic and oligospermic and negative correlation with volume, pH, WBC concentration in all three groups. There was no correlation found with sperm morphology. On the basis of the findings of this study and those of other reports, zinc may contribute to fertility through its significant effects on various semen parameters. It seems that the estimation of seminal plasma zinc may help in investigation and treatment of infertile males. (author)

  6. Primary study on the clinical significance of measurement of epidermal growth factor (EGF) and NPY concentrations in human semen plasma

    International Nuclear Information System (INIS)

    Objective: To investigate the difference between the semen plasma contents of EGF and NPY in fertile and non-fertile males with the relevant sperm count and motility. Methods: Semen plasma contents of EGF and NPY were determined with RIA in 110 non-fertile males. Simultaneous semen analysis revealed (1) Group A, n=45, with normal sperm count, (2) Group B, n=34 low sperm count (0-20) x 106/ml and (3) Group C n=31, with aspermia. White blood cell/HPF was examined in all the semen specimens and sperm motile rate and motility were examined in Group A specimens. Results: The semen plasma contents of EGF and NPY in non-fertile males were significantly higher than those in fertile males (P 1 x 106/ml) were significantly lower than those in specimens with more white blood cells (P<0.05). Conclusion: Higher semen plasma contents of EGF and NPY might exert toxic effect on the sperms, contributing to the development of infertility. (authors)

  7. Effect of seminal plasma and egg yolk concentration on freezability of goat semen

    Scientific Electronic Library Online (English)

    Valéria da Silva, Ferreira; Marco Roberto Bourg de, Mello; Carlos Elysio Moreira da, Fonseca; Állan César Ferreira, Dias; Jéssica Machado, Cardoso; Rebecca Barbosa, Silva; Wagner Pereira, Martins Júnior.

    2014-10-01

    Full Text Available The objective of this study was to evaluate the effects of egg yolk and seminal plasma on the viability of cryopreserved goat semen. To this end, four fertile Saanen bucks, aged between 10 months and 1 year, and weighing 18 to 25 kg, were used. Semen was collected from each buck by the artificial va [...] gina method at the end of breeding season (June-July). The extender used was the yolk citrate, which was split into two equal aliquots: 5% egg yolk (2.5 mL egg yolk: 47.5 mL citrate solution) were added to one of the samples and 10% egg yolk (5.0 mL egg yolk: 45.0 mL citrate solution) were added to another. The sperm motility and vigor after thawing and post thermal resistance test (TRT) were evaluated and the data were subjected to analysis of variance and means were compared by the F test at 5.0% probability. The observed values for motility and vigor after thawing and post thermal resistance test (TRT), fast and slow, according to the presence of seminal plasma and egg yolk percentage were: 5% egg yolk with plasma (25.0% and 3.3; 1.60% and 0.7; 12.36% and 1.6, respectively); 5% egg yolk without plasma (23.61% and 3.1; 1.25% and 0.2; 9.93% and 1.3, respectively); 10% egg yolk with plasma (30.8% and 3.3; 4.4% and 1.9; 19.5% and 2.7, respectively); and 10% egg yolk without plasma (13.4% and 2.5; 4.1% and 0.5; 17.0% and 1.0, respectively). There were significant differences between the analyzed data in relation to semen with or without plasma at different percentages of egg yolk, and the group that presented the best results was 10% egg yolk citrate in extender with plasma. The presence of seminal plasma and higher concentration of egg yolk in extender provide a higher viability of cryopreserved goat semen.

  8. Relationship between seminal plasma zinc and semen quality in a subfertile population

    Directory of Open Access Journals (Sweden)

    DMAB Dissanayake

    2010-01-01

    Full Text Available Rationale : Current knowledge on the relationship between seminal zinc levels and different parameters of human semen is inconsistent. Objectives : To assess the relationship between seminal plasma zinc and semen quality using two markers; zinc concentration (Zn-C and total zinc per ejaculate (Zn-T. Design : The study was carried out as a cross-sectional study. Subjects and Methods : Semen parameters of 152 healthy men undergoing evaluation for subfertility were assessed. Seminal plasma zinc levels were determined using flame atomic absorption spectrometry. Zn-C, expressed as ?g/mL, was multiplied by ejaculated volume to calculate Zn-T. Mann Whitney U test and Chi-square test were used to compare the zinc levels between different seminal groups when appropriate. Correlations were observed with Pearson?s correlation of coefficient. Analysis was carried out using SPSS 10.0 for windows software. Results : Zn-C was low in 23 (15% samples, while in 32 (21% of the samples Zn-T was abnormal. The number of subnormal samples was high in the low-zinc groups compared with the normal-zinc groups, 15 vs. 8 (P > 0.05 for Zn-C and 28 vs. 4 (P < 0.001 for Zn-T. Zn-C was significantly high in the asthenozoospermics compared with the normal motile group; 138.11 ?g/mL (83.92 vs. 110.69 11 ?g/mL (54.59 (P < 0.05. Zn-T was significantly low in samples with hyperviscosity compared with samples with normal viscosity; 220.06 ?g (144.09 vs. 336.34 ?g (236.33 (P < 0.05. Conversely, Zn-T was high in samples with low viability compared with those with normal viability; 437.67 ?g (283.88 vs. 305.15 ?g (221.19 (P < 0.05. Weak correlations were found between Zn and some semen parameters. However, the correlation was negative between pH and Zn-C (r = -0.193, P < 0.05 as well as Zn-T (r = -0.280, P < 0.01. On the other hand, correlations were positive between Zn-T and sperm count (r = 0.211, P < 0.05. Conclusion : Count, motility, viability, pH and viscosity are affected by variations of seminal plasma zinc. Seminal plasma Zn-T is the better marker for assessing the relationship between zinc and semen quality.

  9. Clinical significance of determination of semen plasma IL-2, IL-6, IL-8 and TNF-? contents in infertile males

    International Nuclear Information System (INIS)

    Objective: To explore the influence of high semen plasma contents of the cytokines (IL-2, IL-6, IL-8, TNF-?) on male fertility. Methods: Semen plasma levels of IL-2, IL-6, IL-8, and TNF-? were determined with RIA in 126 infertile and 20 fertile males. Results: Semen plasma contents of the 4 cytokines in infertile subjects were significantly higher than those in fertile ones (p4/HP, n=15) had significantly higher contents of cytokines than those without leucocytospermia (WBC<4/HP, n=111). Besides, TNF-? contents in subjects with lower sperm activity and less motility rate as well as IL-8 contents in subjects with less sperm motility rate were both significantly higher than those in subjects with more normal sperms (p<0.01, p<0.05). Conclusion: High semen plasma cytokines contents represent existing local infection and enhanced auto-immune status, both damaging to sperms. Infertility would be the inevitable consequence. Monitoring of changes of the cytokine contents should be a part of fertility studies

  10. Selenium in blood, semen, seminal plasma and spermatozoa of stallions and its relationship to sperm quality.

    Science.gov (United States)

    Bertelsmann, H; Keppler, S; Höltershinken, M; Bollwein, H; Behne, D; Alber, D; Bukalis, G; Kyriakopoulos, A; Sieme, H

    2010-01-01

    The essential trace element selenium is indispensable for male fertility in mammals. Until now, little data existed regarding the relationship between selenium and sperm quality in the stallion. Selenium, or selenium-dependent glutathione peroxidase activity, was determined in red blood cells, semen, seminal plasma and spermatozoa, and the percentages of spermatozoa with progressive motility (PMS), intact membranes (PMI), altered (positive) acrosomal status (PAS) and detectable DNA damage, determined by the sperm chromatin structure assay, were evaluated in 41 healthy stallions (three samples each). The pregnancy rate per oestrus cycle (PRC) served as an estimation of fertility. An adverse effect on stallion fertility caused by low dietary selenium intake was excluded, as all stallions had sufficient selenium levels in their blood. Interestingly, no significant correlations (P > 0.05) between the selenium level in blood and the selenium level in seminal plasma or spermatozoa were found, suggesting that the selenium level in blood is no indicator of an adequate selenium supply for spermatogenesis. The selenium level in spermatozoa (nmol billion(-1)) was correlated with PMI, PMS and PAS (r = 0.40, r = 0.31 and r = -0.42, respectively; P

  11. Effect of seminal plasma vesicular structures in canine frozen-thawed semen.

    Science.gov (United States)

    Goericke-Pesch, S; Hauck, S; Failing, K; Wehrend, A

    2015-12-01

    Membrane vesicles (MVs) in the ejaculate have been identified in various species and are considered to affect membrane fluidity due to their characteristic molecular composition. Addition of MV to human frozen semen has been shown to improve post-thaw motility. Similarly, a beneficial effect has been suggested for frozen equine semen. As post-thaw canine semen quality varies widely between dogs, the aim of our study was to test for the effect of addition of canine MV on post-thaw semen quality in dogs. Semen samples from 10 male dogs were purified from MV and prepared for freezing. In experiment 1, three groups were compared: sperm frozen (1) with MV (S1); (2) without MV, but MV added immediately after thawing (S2); and (3) without MV (C). Semen analysis included computer-assisted sperm analysis of motility parameters immediately after thawing (t0), after 10 (t10) and 30 minutes (t30), % living sperm, % membrane intact, % morphologically normal sperm (all t0 and t30). Computer-assisted sperm analysis motility distance and velocity parameters (all P < 0.05) and % living sperm (P < 0.001) were significantly affected by treatment with a temporary increase of distance and velocity parameters at t0 to t10, but a significant decrease of the aforementioned parameters at t30 in samples with MV. In experiment 2, different MV protein concentrations added after thawing were compared: 0.05 mg, 0.1 mg, and 0.2 mg/mL. Computer-assisted sperm motility analysis was performed at t0, t10, and t30. No differences between MV concentrations were identified, only a significant interaction between effect of treatment and time for progressive motility (P < 0.01). Our study identified a short-term beneficial effect of canine MV on post-thaw distance and velocity parameters, whereas at t30 progressive motility, motility parameters and % living sperm were reduced in samples with MV compared to C. The results point to species-specific differences regarding the MV effect on frozen semen and indicate the need for further studies using different semen and MV purification protocols and more frequent analyses. At the moment, addition of MV is not an option to improve post-thaw semen quality in dogs. PMID:26296522

  12. Selección Espermática en Semen Congelado/Descongelado de Equino: Evaluación de las Membranas Plasmática, Acrosomal y Potencial de Membrana Mitocondrial / Sperm Selection in Frozen/Thawed Semen of Equine: Evaluation of Plasma, Acrosome Membranes and Mitochondrial Membrane Potential

    Scientific Electronic Library Online (English)

    Paulina, Cabrera; Raúl, Sánchez; Jennie, Risopatrón.

    2014-06-01

    Full Text Available Los procedimientos de criopreservación inducen cambios morfofuncionales en los espermatozoides. Es importante post descongelación espermática utilizar procedimientos de selección que permitan recuperar espermatozoides altamente funcionales. El objetivo del presente estudio fue comparar la eficiencia [...] del Swim-up y Equipure® en la selección de espermatozoides funcionales en semen descongelado de equino. Semen de 4 potros reproductores Criollos Chilenos (A, B, C y D), fueron descongelados separadamente y procesados (n=15) por: I.- Swim-up (SU) y II.- Equipure® (EQ). Post descongelación se determinó por citometría de flujo la viabilidad e integridad de membrana plasmática (SYBR-14/PI), potencial de membrana mitocondrial (YDm; JC-1), integridad de la membrana acrosomal (FITC-PSA/PI). La motilidad progresiva (%) en dos animales fue más alta (P Abstract in english Freeze-thaw procedures induce structural and functional changes in sperm. It is important to use post thaw sperm selection procedures that can retrieve highly functional sperm. The aim of this study was to compare the efficiency of the Swim-up and Equipure® in the selection of functional sperm of th [...] awed equine semen. Semen of four Chilean Criollo reproductive stallions (A, B , C and D) were frozen and thawed using a standard protocol and processed separately (n = 15) : I. Swim-up (SU) and II. Equipure® (EQ). Post sperm selection,was determined by flow cytometry. Viability and plasma membrane integrity (SYRB-14/PI), mitochondrial membrane potential (YDm, JC -1), acrosome membrane integrity (FITC-PSA/PI). Progressive motility (%) was higher (P

  13. Calcium, Magnesium and Total Antioxidant Capacity (TAC in Seminal Plasma of Water Buffalo (Bubalus Bubalis Bulls and their Relationships with Semen Characteristics

    Directory of Open Access Journals (Sweden)

    Mohammad-Hassan Khadem Ansari

    2010-06-01

    Full Text Available In order to determine calcium (Ca, magnesium (Mg content and total antioxidant capacity (TAC of seminal plasma in buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls; semen quality was evaluated, seminal plasma was then harvested by centrifugation and its Ca and Mg content were estimated and its TAC determined. The Ca and Mg content of the seminal plasma (Mean ± SEM were recorded as 22.36 ± 0.52 mg dl-1 and 11.94 ± 0.36 mg dl-1 respectively, while, its mean TAC value was 1.50 ± 0.02 mmol L-1. The mean Ca value was highly associated with sperm progressive motility, gross motility, viability (P = 0.000 for all, negatively with semen volume (P = 0.01, and with Mg and TAC values (P = 0.000 for both. The mean Mg values was highly associated with sperm progressive motility, gross motility and viability and seminal plasma Ca and TAC (P = 0.000 for all and negatively associated with semen volume (P = 0.014. The mean TAC values was highly associated with sperm progressive motility, gross motility and viability and seminal plasma Ca and Mg (P = 0.000 for all. For further clarification of these associations, the data was categorized in three groups of excellent (Ex, >90% motile, n = 33, good (Go, 80-89% motile, n = 15 and moderate (Mo, <79% motile, n = 6 according to their percentage of sperm motility. The mean progressive motility in Ex group was 92.24 ± 0.51%, in Go group it was 81.66 ± 0.62 %, and in Mo group it was 71.66 ± 1.05 %. The mean Ca, Mg and TAC values were respectively recorded as 25.12 ± 0.29 mg dl-1, 13.78 ± 0.20 mg dl-1, and 1.57 ± 0.009 mmol L-1 in Ex, 18.74 ± 0.63 mg dl-1, 9.14 ± 0.33mg dl-1, and 1.42 ± 0.044 mmol L-1 in Go, and 17.34 ± 0.18 mg dl-1, 8.06 ± 0.25 mg dl-1, and 1.23± 0.05 mmol L-1 in Mo groups. The associations in groups are discussed. These results show that seminal plasma Ca and Mg content and TAC are associated with semen characteristics, and synergistically have an effect on motility and viability of the spermatozoa after ejaculation, which are important factors in semen fertility.

  14. Alergia al semen / Semen allergy

    Scientific Electronic Library Online (English)

    Laura, Franco Cuadros; Jenniffer, Puerta Suárez; Ángela, Cadavid Jaramillo; Walter, Cardona Maya.

    2013-12-01

    Full Text Available La alergia al semen comprende una variedad de síntomas tanto locales como sistémicos causados por reacciones de hipersensibilidad inmediata y caracterizados por títulos elevados de IgE. El objetivo de este estudio es describir el caso de una paciente con alergia al semen: mujer de 21 años de edad qu [...] e presenta ardor y sensación de quemazón en el área genital luego de tener contacto con el semen de su pareja. El análisis seminal del compañero sexual no presenta ningún tipo de alteración. Los síntomas desaparecen con el uso de condón o con la práctica del coito interrumpido. La alergia al semen es una alteración, que si bien es poco frecuente, puede afectar los deseos de concepción de las mujeres que la presentan, es un fenómeno poco estudiado por lo que se requieren más reportes para su caracterización. Abstract in english Semen allergy includes several local and systemic symptoms caused by immediate hypersensitivity reactions and it is characterized by high levels of IgE. The objective of this study was to describe the case of a patient with semen allergy. A 21 year-old woman experienced itching and burning sensation [...] in the genital area after contact with the semen of her sexual partner. Semen analysis was normal. Symptoms disappear with the use of condom or the practice of coitus interruptus. Semen allergy is a condition, although rare, can affect the desire of conceiving in women who suffers it. It is a briefly studied phenomenon which requires more reports for proper characterization.

  15. Crioprotetor para sêmen de carneiro a base de plasma de gema mantém membrana acrossomal intacta após a descongelação / Ram semen cryoprotector based on egg yolk plasma maintain the viability of acrosomal membrane

    Scientific Electronic Library Online (English)

    Ivo Walter dos, Santos; Jandui Escarião da, Nóbrega Junior; Matheus Pedrotti de, Cesaro; Gustavo Freitas, Ilha; Monique Tomazele, Rovani; Paulo Bayard Dias, Gonçalves.

    2015-06-01

    Full Text Available O presente estudo teve como objetivo avaliar a capacidade crioprotetora das lipoproteínas de baixa densidade (LDL) presentes no plasma de gema de ovo, adicionado ao trihidroxiaminometano (TRIS) para congelar sêmen ovino. Trinta e seis ejaculados foram coletados para formar 12 "pool". Cada alíquota d [...] e sêmen foi diluída em TRIS-gema de ovo (TRISG) ou TRIS- plasma de gema de ovo (TRISP) antes de congelar o sêmen. Para a obtenção do plasma da gema de ovo, foi utilizado o método de ultracentrifugação. Após o descongelamento, não houve diferença entre os dois extensores em relação aos parâmetros seminais (motilidade, viabilidade, membrana acrossômica e plasma). No entanto, no Teste de Termo Resistência Lenta (TTRL - 4h/38°C), o sêmen congelado com TRISP resultou no aumento do número de espermatozoides com acrossoma intacto (P Abstract in english The present study aimed to evaluate the cryoprotectant low-density lipoprotein (LDL) present in the plasma of egg yolk added to the extender trihidroxiaminometano (TRIS) for freezing ram semen. Thirty-six ejaculates were collected to form 12 pool. Each aliquot of semen was diluted in TRIS-egg yolk ( [...] TRISG) or TRIS-egg yolk plasma (TRISP) before freezing the semen. The plasma of egg yolk was obtained by ultracentrifugation. After thawing, no difference was detected between the two extenders in relation to seminal parameters (motility, viability, plasma membrane and acrosome). However, in the thermal resistance slow test (4h in a water bath at 38°C), the semen frozen with TRISP resulted in higher number of sperm with intact acrosome than those with TRISG (P

  16. Effect of heterologous seminal plasma and semen extenders on motility of frozen-thawed ram spermatozoa

    Directory of Open Access Journals (Sweden)

    G.A. Mataveia

    2010-05-01

    Full Text Available Ram seminal plasma increases the fertility of frozen-thawed ram spermatozoa deposited into the cervix. The aim of the current study was to compare the effect of ram seminal plasma to that of bull seminal plasma, dog prostatic fluid, protein-free TALP, TrilEq (Triladyl with 0.5 m? of Equex STM paste added to each 100 m? and heat-treated skim milk on longevity and percentages of progressively motile and aberrantly motile frozen-thawed ram spermatozoa. Three ejaculates from each of 6 rams were extended in TrilEq, pooled and frozen in straws as a single batch per ram. One hundred and eight straws (3 straws from each ram for each fluid were thawed in random order. Once thawed, a straw was emptied into a tube with 0.85m? of the appropriate fluid at 37 °C and kept at that temperature for 6 h. Motility was assessed at x200 magnification immediately (time zero and 2, 4 and 6 h after thawing. Progressive motility decreased from each time to the next (P < 0.05 and was 39.0% (0 h, 26.0% (2 h, 19.6% (4 h and 12.6% (6 h; SEM 1.24, n=108 for each group. Ram seminal plasma resulted in higher progressive motility than bull seminal plasma, lower than milk, and similar to the other fluids. Ram seminal plasma resulted in lower aberrant motility than protein-free TALP and similar aberrant motility to other fluids. The effect of ram seminal plasma and dog prostatic fluid was very similar. The effect of ram seminal plasma on the fertility of frozen-thawed ram spermatozoa deposited into the cervix is not due an exceptionally beneficial effect on the motility of spermatozoa.

  17. Localization and characterization of glutathione peroxidase (GPx) in boar accessory sex glands, seminal plasma, and spermatozoa and activity of GPx in boar semen.

    Science.gov (United States)

    Jelezarsky, L; Vaisberg, Ch; Chaushev, T; Sapundjiev, E

    2008-01-15

    Boar ejaculate owes its characteristic large volume mainly to accessory sex gland (ASG) secretions. These are main contributors to the protective functions of seminal plasma, especially against oxidative damage. Numerous antioxidants have been detected in ASG secretions, and, respectively, in seminal plasma. However, as regards one key antioxidant protector -- the Se-dependent enzyme glutathione peroxidase (GPx) -- there is no agreement yet among researchers as to its presence in boar seminal plasma. Nevertheless, the beneficial effect of dietary Se supplementation on male fertility has been widely recognized. The aim of the present study was to investigate the localization and characterization of GPx in boar ASGs, seminal plasma, and spermatozoa, as well as to evaluate GPx activity in boar semen. Immunohistochemical assays demonstrated GPx presence in the epithelial cells, vacuole membranes, and vascular endothelium of boar seminal vesicle, prostate and bulbourethral glands. Western blot analysis demonstrated the presence of a monomer form of GPx with MW 20 kDa in lysates from seminal vesicle, prostate, bulbourethral glands, and spermatozoa, but not in seminal plasma. Surprisingly, peroxidase activity detected in seminal plasma from normal ejaculates was nearly three times as high as in spermatozoa. Our findings confirmed the presence of immunoreactive GPx in the boar reproductive tract, while further investigation is still warranted to uncover the exact protein forms involved and their function. PMID:17964641

  18. Phospholipase A1-catalyzed hydrolysis of soy phosphatidylcholine to prepare l-?-glycerylphosphorylcholine in organic-aqueous media.

    Science.gov (United States)

    Bang, Hyo-Jeong; Kim, In-Hwan; Kim, Byung Hee

    2016-01-01

    This study aimed to optimize the preparation of L-?-glycerylphosphorylcholine (l-?-GPC) via phospholipase A1 (Lecitase Ultra)-catalyzed hydrolysis of soy phosphatidylcholine (PC). The reaction was performed in n-hexane-water biphasic media in a stirred batch reactor, and modeling and optimization were conducted using response surface methodology. Optimal conditions to completely hydrolyze PC to L-?-GPC were: temperature, 50 °C; reaction time, 30 h; water content, 69 g/100 g of PC weight; and enzyme loading, 13 g/100 g of PC weight. The optimal n-hexane-to-water ratio in the medium was 5.8:1 (v/v), and 21.3g of PC was treated as the substrate in 100 mL of the medium. L-?-GPC with purity 99.3 g/100 g was obtained from the reaction products after diethyl ether extraction and silica column chromatography. These findings suggest that the use of n-hexane-water media increases the productivity of l-?-GPC compared to the aqueous media used in enzymatic reaction systems in other published studies. PMID:26212962

  19. Efeito de proteínas do plasma seminal eqüino com massa superior a 10 kDa concentradas 10 vezes sobre a congelabilidade do sêmen Effect of high concentration of protein of the equine seminal plasma on semen cryopreservation

    Directory of Open Access Journals (Sweden)

    Marcus Antonio Pessanha Barreto

    2008-12-01

    Full Text Available Objetivou-se avaliar os efeitos da adição de concentrados de proteínas do plasma seminal (PPS no diluente de congelamento sobre a congelabilidade do sêmen eqüino. Foram avaliados três tratamentos: um controle, no qual o sêmen foi congelado no diluente Botu-Crio®; e outros dois, com adição de 10% ou 20% (v/v de proteínas do plasma seminal ao diluente. As maiores médias de motilidades total e progressiva foram observadas no tratamento controle, que foram superiores às obtidas com adição de 20% de proteínas, mas não diferiram das obtidas com adição de 10% de PPS. Os resultados do teste hiposmótico e do número de espermatozóides vivos obtidos com o congelamento do sêmen no diluente (controle foram superiores aos encontrados com a adição de 10% de PPS, que, por sua vez, foram melhores que os observados com a adição de 20% de PPS ao diluente. A adição do concentrado de proteínas do plasma seminal não melhora os parâmetros espermáticos do sêmen eqüino.The aim of this study was to evaluate the effect of increasing the concentration of protein of the seminal plasma in the extender used for frozing equine semen. Three treatments were compared: The conventional one, defined by using only the Botu-Crio® extender for frozing semen; and other two defined by adding 10% (v/v or 20% (v/v of seminal plasma proteins to Botu-Crio® extender. Averages of total and progressive motility were statistically higher in the conventional treatment than in that defined by adding 20% (v/v of seminal plasma proteins but they did not differ from those obtained by adding 10% (v/v of seminal plasma proteins to Botu-Crio® extender. The best results for the hypoosmotic test and the number of live spermatozoa were obtained in the conventional treatment, and results for adding 10% (v/v of seminal plasma proteins were better than those obtained by adding 20% (v/v of seminal plasma proteins to Botu-Crio® extender. These results indicate that the addition of concentrated protein of the seminal plasma to the extender did not improve the cryopreservation of equine semen.

  20. Efeito de proteínas do plasma seminal eqüino com massa superior a 10 kDa concentradas 10 vezes sobre a congelabilidade do sêmen / Effect of high concentration of protein of the equine seminal plasma on semen cryopreservation

    Scientific Electronic Library Online (English)

    Marcus Antonio Pessanha, Barreto; José Frederico Straggiotti, Silva; Bruno, Fagundes; José Renato Costa, Caiado; Guilherme Valente de, Souza; Aldo, Shimoya.

    2008-12-01

    Full Text Available Objetivou-se avaliar os efeitos da adição de concentrados de proteínas do plasma seminal (PPS) no diluente de congelamento sobre a congelabilidade do sêmen eqüino. Foram avaliados três tratamentos: um controle, no qual o sêmen foi congelado no diluente Botu-Crio®; e outros dois, com adição de 10% ou [...] 20% (v/v) de proteínas do plasma seminal ao diluente. As maiores médias de motilidades total e progressiva foram observadas no tratamento controle, que foram superiores às obtidas com adição de 20% de proteínas, mas não diferiram das obtidas com adição de 10% de PPS. Os resultados do teste hiposmótico e do número de espermatozóides vivos obtidos com o congelamento do sêmen no diluente (controle) foram superiores aos encontrados com a adição de 10% de PPS, que, por sua vez, foram melhores que os observados com a adição de 20% de PPS ao diluente. A adição do concentrado de proteínas do plasma seminal não melhora os parâmetros espermáticos do sêmen eqüino. Abstract in english The aim of this study was to evaluate the effect of increasing the concentration of protein of the seminal plasma in the extender used for frozing equine semen. Three treatments were compared: The conventional one, defined by using only the Botu-Crio® extender for frozing semen; and other two define [...] d by adding 10% (v/v) or 20% (v/v) of seminal plasma proteins to Botu-Crio® extender. Averages of total and progressive motility were statistically higher in the conventional treatment than in that defined by adding 20% (v/v) of seminal plasma proteins but they did not differ from those obtained by adding 10% (v/v) of seminal plasma proteins to Botu-Crio® extender. The best results for the hypoosmotic test and the number of live spermatozoa were obtained in the conventional treatment, and results for adding 10% (v/v) of seminal plasma proteins were better than those obtained by adding 20% (v/v) of seminal plasma proteins to Botu-Crio® extender. These results indicate that the addition of concentrated protein of the seminal plasma to the extender did not improve the cryopreservation of equine semen.

  1. INAA determination of selenium via sup(77m)Se in plasma, semen and hair samples from beef and dairy bulls

    International Nuclear Information System (INIS)

    Interest in the element selenium with respect to its biological significance has been steadily increasing for the last ten years. Neutron activation analysis has long been used for the accurate determination of selenium in biological samples usually via 75Se. More recently activation analysts having access to high flux reactors with rapid delivery pneumatic tube facilities; have successfully employed sup(77m)Se. This approach, which is much faster, is particularly well suited to the Missouri University Research Reactor (MURR). The specific interest concerning bulls has to do with the involvement of selenium in the reproductive system. Selenium analysis methodology and data on plasma, semen and 22 tissues from both beef and dairy bulls are presented. (author)

  2. Evaluation of inductively coupled plasma mass spectrometry for determining Ca, Cu, Fe, Mg, Mn, Se and Zn in bovine semen samples using a simple sample dilution method

    Scientific Electronic Library Online (English)

    Giovanna F. M., Aguiar; Bruno L., Batista; Jairo L., Rodrigues; Pedro O., Luccas; Fernando, Barbosa Jr..

    2012-03-01

    Full Text Available Um método simples e rápido para a determinação de Ca, Cu, Fe, Mg, Mn, Se e Zn em sêmen bovino por espectrometria de massas com plasma indutivamente acoplado (q-ICP-MS) é descrito. Previamente as análises, 200 µL de amostras foram diluídas 1:50 em solução contendo Triton® X-100 (0,01% v/v) e ácido ní [...] trico (0,5% v/v). Os limites de detecção foram de 0,3, 0,03, 0,2, 0,04, 0,04, 0,03 e 0,03 µg L-1 para 44Ca, 63Cu, 57Fe, 24Mg, 64Zn, 82Se e 55Mn, respectivamente. Para efeitos de comparação e validação do método, quatro amostras de sêmen bovino foram analisadas por ICP-MS pelo método proposto e por espectrometria de absorção atômica com chama (FAAS) ou espectrometria de absorção atômica em forno de grafite (GF AAS), e não foram encontradas diferenças estatísticas entre as técnicas com aplicação do teste-t (95% de confiança). Então, o método proposto foi aplicado na determinação de Ca, Cu, Fe, Mg, Mn, Se e Zn em amostras de sêmen bovino coletadas de diferentes raças, as quais são usadas em programas de reprodução animal e inseminação artificial. Abstract in english A simple and fast method for the determination of Ca, Cu, Fe, Mg, Mn, Se and Zn in bovine semen by quadrupole inductively coupled plasma spectrometry (q-ICP-MS) is described. Prior to analysis, samples (200 µL) were diluted 1:50 in a solution containing 0.01% v/v Triton® X-100 and 0.5% v/v nitric ac [...] id and directly analyzed by ICP-MS. The limits of detection of the method are 0.3, 0.03, 0.2, 0.04, 0.04, 0.03 and 0.03 µg L-1 for 44Ca, 63Cu, 57Fe, 24Mg, 64Zn, 82Se and 55Mn, respectively. For purposes of comparison and method validation, four ordinary bovine semen samples were directly analyzed by ICP-MS and by flame atomic absorption spectrometry (FAAS) or graphite furnace atomic absorption spectrometry (GF AAS), with no statistical difference between the techniques at the 95% level when applying the t-test. Then, the proposed method was applied in the determinations of Ca, Cu, Fe, Mg, Mn, Se and Zn in collected samples of bovine semen from different breeds, which are used in reproduction programs and artificial insemination.

  3. Adição de plasma seminal ao sêmen descongelado e taxa de prenhez de ovelhas inseminadas em tempo fixo / Addition of seminal plasma to frozen-thawed semen and pregnancy rate of fixed time inseminated ewes

    Scientific Electronic Library Online (English)

    O.R., Prado; G.M., Bastos; A.L.G., Monteiro; B.B., Saab; S., Gilaverte; C.C., Pierobom; F., Hentz; L.H.S., Martins; C.J.A., Silva; G.S., Dranca; T.S.S., Stivari; G., Cerqueira.

    2013-02-01

    Full Text Available Avaliou-se o efeito da adição de plasma seminal ovino ao sêmen descongelado sobre a taxa de prenhez de ovelhas em rebanho comercial. Cento e setenta e quatro ovelhas cruza Texel foram distribuídas em quatro tratamentos: T1) inseminação artificial cervical (IAC) com sêmen descongelado (SD) diluído em [...] solução tampão fosfato salino (PBS); T2) IAC com SD e adição de plasma seminal ovino; T3) grupo-controle I: IAC com sêmen fresco diluído em PBS; T4) grupo-controle II: inseminação artificial por laparoscopia com SD diluído em PBS. Para indução de cio, utilizaram-se esponjas impregnadas com acetato de medroxiprogesterona (MAP) por 12 dias, com aplicação intramuscular de 400 UI de eCG (Novormon®) e de 37,5µg de cloprostenol sódico (Sincrocio®), no dia da retirada das esponjas. O aparecimento de cio foi monitorado com rufiões vasectomizados a partir da retirada das esponjas até a inseminação artificial em tempo fixo - 54 a 60 horas. A taxa de prenhez do tratamento com adição de plasma seminal ao sêmen descongelado (7,0%) não diferiu (P>0,05) do tratamento sem adição de plasma (4,3%), entretanto foi menor (P Abstract in english The effect of seminal plasma addition to thawed-frozen ram semen on the pregnancy rate of commercial herd ewes was evaluated. One hundred and seventy-four crossbred Texel sheep were allocated to four treatments: T1) cervical artificial insemination (CAI) using frozen-thawed semen (FTS) diluted in ph [...] osphate buffered saline solution (PBS); T2) CAI using FTS diluted in ovine seminal plasma; T3) control group I: CAI using fresh semen diluted in PBS; T4) control group II: laparoscopic insemination using FTS diluted in PBS. Estrus induction was performed with medroxiprogesterone acetate (MAP) impregnated sponges for 12 days, followed by intramuscular injection of 400 IU of eCG (Novormon®) and 37.5µg of sodium cloprostenol (Sincrocio®) on the day of sponge removal. Estrus was monitorated with vasectomized rams, beginning at the time of the sponge removal until the fixed time artificial insemination - 54 to 60 hours. The pregnancy rate of FTS diluted in seminal plasma treatment (7.0%) did not differ (P>0.05) for the treatment without addition of seminal plasma (4.3%), however it was lower (P

  4. Caracterização de proteínas do plasma seminal e sua relação com parâmetros de qualidade do sêmen criopreservado em ovinos Characterization of seminal plasma proteins and its relationship with quality parameters of frozen semen in ram

    Directory of Open Access Journals (Sweden)

    Priscilla Pereira Moura

    2010-05-01

    Full Text Available Os objetivos deste trabalho foram analisar o perfil proteico do plasma seminal ovino e identificar proteínas relacionadas com a congelabilidade do sêmen que possam ser utilizadas como marcadores para essa característica. Foram utilizados os ejaculados de cinco reprodutores, nos quais foram realizadas avaliações espermáticas e dos quais os plasmas seminais obtidos por centrifugação foram submetidos à eletroforese bidimensional em gel de poliacrilamida. Foram identificados 92 spots, considerando todos os animais analisados. A avaliação dos dados obtidos evidenciou variações significativas nos resultados das análises do sêmen dos animais e uma variabilidade no perfil proteico no plasma seminal dos carneiros. As proteínas 03 (7,9kDa; pI 6,35, 23 (13,6kDa; pI 5,01 e 31 (21,4kDa; pI 4,75 se destacaram, por apresentarem maior expressão e relações com as características espermáticas. Sugere-se que mais estudos sejam realizados para verificar se as proteínas 03, 23 e 31 podem ser utilizadas como marcadores da capacidade criopreservadora do sêmen.The objective of this study was to analyze the protein profile of ram seminal plasma and to identify proteins associated with semen freezability, which could be used as marker for predicting this feature. Semen from five rams was used. The sperm analysis was held and the seminal plasma obtained by centrifugation was submitted to two-dimensional electrophoresis using acrylamide gel. Ninety two spots were identified considering the analyzed animals. The results showed a significant variation among sperm analysis of the animals and variability in the protein profile of the seminal plasma of the rams. The proteins 03 (7.9kDa; pI 6.35, 23 (13.6kDa; pI 5.01 e 31 (21.4kDa; pI 4.75 stood out because they showed higher expression and because of its relationship with the sperm characteristics. It is suggested more studies to verify if proteins 03, 23 and 31 could be used as markers of semen freezability.

  5. Caracterização de proteínas do plasma seminal e sua relação com parâmetros de qualidade do sêmen criopreservado em ovinos / Characterization of seminal plasma proteins and its relationship with quality parameters of frozen semen in ram

    Scientific Electronic Library Online (English)

    Priscilla Pereira, Moura; Maurício Machaim, Franco; Thiago Antônio de Souza Nascimento, Silva; Thales Lima, Rocha; Diogo Ramos, Leal; Pedro Ivo Braga, Passos; Jairo Pereira, Neves.

    2010-05-01

    Full Text Available Os objetivos deste trabalho foram analisar o perfil proteico do plasma seminal ovino e identificar proteínas relacionadas com a congelabilidade do sêmen que possam ser utilizadas como marcadores para essa característica. Foram utilizados os ejaculados de cinco reprodutores, nos quais foram realizada [...] s avaliações espermáticas e dos quais os plasmas seminais obtidos por centrifugação foram submetidos à eletroforese bidimensional em gel de poliacrilamida. Foram identificados 92 spots, considerando todos os animais analisados. A avaliação dos dados obtidos evidenciou variações significativas nos resultados das análises do sêmen dos animais e uma variabilidade no perfil proteico no plasma seminal dos carneiros. As proteínas 03 (7,9kDa; pI 6,35), 23 (13,6kDa; pI 5,01) e 31 (21,4kDa; pI 4,75) se destacaram, por apresentarem maior expressão e relações com as características espermáticas. Sugere-se que mais estudos sejam realizados para verificar se as proteínas 03, 23 e 31 podem ser utilizadas como marcadores da capacidade criopreservadora do sêmen. Abstract in english The objective of this study was to analyze the protein profile of ram seminal plasma and to identify proteins associated with semen freezability, which could be used as marker for predicting this feature. Semen from five rams was used. The sperm analysis was held and the seminal plasma obtained by c [...] entrifugation was submitted to two-dimensional electrophoresis using acrylamide gel. Ninety two spots were identified considering the analyzed animals. The results showed a significant variation among sperm analysis of the animals and variability in the protein profile of the seminal plasma of the rams. The proteins 03 (7.9kDa; pI 6.35), 23 (13.6kDa; pI 5.01) e 31 (21.4kDa; pI 4.75) stood out because they showed higher expression and because of its relationship with the sperm characteristics. It is suggested more studies to verify if proteins 03, 23 and 31 could be used as markers of semen freezability.

  6. ALKALINE PHOSPHATASE ACTIVITY AS A MARKER OF DOG SEMEN FREEZABILITY

    Directory of Open Access Journals (Sweden)

    KOSINIAK-KAMYSZ K.

    2007-01-01

    Full Text Available The investigation was performed to evaluate the dog semen freezability and itsquality after thawing allowing its use for artificial insemination (AI. On the basis ofsperm motility, concentration and alkaline phosphatase (AP activity in semenplasma it was possible to establish that AP activity corresponds with the basic factorof semen examination. Significant statistical differences occurred between thequality of ejaculates which were qualified or disqualified to deep freezing and AI.These results show that AP activity in raw dog semen plasma can be used as amarker for the dog semen qualification for deep freezing and AI with 95%probability of the prognosis of the results.

  7. Total Antioxidant Capacity and Lipid Peroxidation in Semen of Patient with Hyperviscosity

    OpenAIRE

    Layali, Issa; Tahmasbpour, Eisa; Joulaei, Manijeh; Jorsaraei, Seyed Gholam Ali; Farzanegi, Parvin

    2015-01-01

    Semen hyperviscosity (SHV) is one of the factors involved in deficiency in sperm function. This research aimed to evaluate seminal plasma total antioxidant capacity (TAC) and malondialdehyde (MDA) levels in infertile patients with hyperviscous and non-hyperviscous semen samples to understand whether hyperviscous semen is associated with oxidative damage in infertile subjects. In this cross sectional study, 59 semen samples were provided by fertile (n=12) individuals as control, infer...

  8. EFECTO DE LA ADICIÓN DE PLASMA SEMINAL SOBRE LA ELIMINACIÓN DE GOTAS CITOPLÁSMICAS EN SEMEN DE SUS SCROFA LINAEUS, 1758 / EFFECTS OF ADITION OF SE MINAL PLASMA ON THE ELIMINATION OF CYTOPLASMIC DROPLETS IN OF SUS SCROFA LINAEUS, 1758 BOAR SEMEN

    Scientific Electronic Library Online (English)

    Francisco Javier, Henao Uribe; Julián Alonso, Valencia Giraldo; Orlando, Díaz Franco; Marcos Yesid, Rangel Sierra.

    2011-12-01

    Full Text Available Las gotas citoplásmicas (GCs) son remanentes del citoplasma que quedan adheridos al espermatozoide después de la espermatogénesis, constituyen la anormalidad espermática más frecuente en porcinos, y se relacionan claramente con baja fertilidad. Hay serios indicios de que la fructosa y el AMPc del pl [...] asma seminal intervienen en la maduración espermática, en el desprendimiento de las GCs, y en la reacción acrosómica. El objetivo del presente estudio fue evaluar el efecto de la adición de plasma seminal, en el desprendimiento de las GCs en machos con diagnóstico de persistencia de las mismas. En el estudio se emplearon tres verracos (dos con persistencia de GCs y uno normal) de tres a cinco años de edad, alojados en la granja Montelindo de la Universidad de Caldas; a los cuales se les realizaron análisis seminales semanales, completos, durante cuatro meses. Se llevó a cabo un arreglo factorial 3x3x2 (adición a la FR de los machos con persistencia de GCs de 0%, 20% de PSMS y 20% de PSMGCs; 0, 60 y 120 minutos de incubación, y 16 y 37ºC de temperaturas de incubación) en un diseño de bloques completos al azar, analizado mediante análisis de varianza y prueba de Tukey. La incubación del semen de machos con persistencia de GCs con PSMGCs redujo más del 4% las GCs respecto a la incubación sin PS y con PSMS; igualmente se registró reducción de aproximadamente el 5% en las GCs, al aumentar el tiempo de incubación de 0 a 120 minutos, y alrededor de 2% al llevar la temperatura de incubación de 16 a 37ºC. Abstract in english The cytoplasmic droplets (CDs) are remnants of the cytoplasm that are attached to the sperm after spermatogenesis. CDs constitute the most frequent sperm abnormality in pigs and are clearly related to low fertility. There are serious indications that fructose and the seminal plasma AMPc are involved [...] in sperm maturation in the CDs detachment and in the acrosome reaction. The objective of this study was to evaluate the effect of the addition of seminal plasma in the CDs detachment in males with diagnosis of persistence of such detachment. Three boars (two with persistence of CDs and one normal) from three to five years of age, housed in the Montelindo farm at Universidad de Caldas were used in the study. These boars were performed complete seminal analysis weekly during four months. A factorial arrangement 3x3x2 (addition to the males FR with CDs persistence of 0%, 20% of SPHM and 20% of SPMCDs; 0, 60 and 120 minutes incubation, and 16, and 37ºC incubation temperature) was carried out in a randomized complete blocks design, analyzed through variance analysis and Tukey's test. Incubation of males semen with persistence of CDs with SPMCDs decreased more than 4% the CDS with regards to incubation without SP and SPHM; similarly, there was reduction of approximately 5% in CDs when increasing incubation time from 0 to 120 minutes, and about 2% when increasing incubation temperature from 16 to 37ºC.

  9. Pengaruh Berbagai Konsentrasi Dimethylsulfoxide terhadap Kualitas Semen Beku Ayam Hutan Hijau Post Thawing

    Directory of Open Access Journals (Sweden)

    Wayan Bebas

    2015-06-01

    Full Text Available The process of freezing and thawing on semen can lead to physical stress, often called cold shock, and couses the structural and biochemical damage that affecting cell function and ultimately lead to the death of the cell The aim of this study was to know the effect of the addition of various concentrations of dimethylsulfoxide (DMSO as the intracellular cryoprotectant in phosphate yolk diluent on the post thowing quality of the green jungle fowl semen. The study used eight green jungle fowl semens which were collected with massage techniques. Semen was evaluated macroscopically and microscopically. Good quality semen was diluted with phosphate yolk which was added four different concentration of DMSO, namely 4%, 6%, 8%, and 10%. Semen was then filled and sealed in a mini straw (0.25 mL with the concentration of 150.106 cells, and equilibrated at 4oC for 4 hours. The semen freezing was processed using conventional method. Evaluation was performed on post thawing semen. The evaluation of semen quality included the progressive motility and plasma membrane intact. Data were analyzed by analysis of variance. If there were any significant differences, the data were futher analyzed by Duncan test. The results showed that addition of DMSO concentration of 6% has resulted the progressive motility and intact plasma membrane higher significantly (P <0.05 than those of the addition of DMSO concentration 4%, 8%, and 10%.

  10. Between male variation in semen characteristics and preliminary results on the dilution of semen in the ostrich

    Scientific Electronic Library Online (English)

    M., Bonato; P.K., Rybnik; I.A., Malecki; C.K., Cornwallis; S.W.P., Cloete.

    Full Text Available This study is part of an ongoing project on artificial insemination in ostriches. The physical output of neat semen from four ostrich males was investigated and the effect of reconstituting semen with: 1) seminal plasma of the same male (SPS); 2) seminal plasma of another male (SPD), and 3) Dulbecco [...] 's Modified Eagles Medium (DMEM). Semen was collected daily from one or two pairs of males using the dummy female method, each pair being replicated twice. Spermatozoa viability in neat semen, SPS, SPD and DMEM was assessed using nigrosin-eosin staining and the proportions of live normal, live abnormal and dead sperm were determined. Semen volume (mean ± SE) was 1.27 ± 0.13 mL, the concentration of spermatozoa 3.68 ± 0.17 x 10(9) /mL and the number of spermatozoa 4.92 ± 0.64 x 10(9) /ejaculate. Furthermore, the live normal, live abnormal and dead spermatozoa in the neat semen were 61.2 ± 4.5%, 21.2 ± 2.7% and 17.7 ± 4.3% respectively. The ejaculate volume and the number of dead spermatozoa were not affected by collection time. However, the number of live abnormal spermatozoa increased through the day causing a reduction in live normal spermatozoa. Furthermore, re-suspending spermatozoa in DMEM reduced the number of live normal (31.4 ± 4.6%) and live abnormal spermatozoa (11.0 ± 2.7%) and increased the number of dead spermatozoa (57.6 ± 4.4%). In contrast, numbers of live spermatozoa were higher when suspended in seminal plasma and similar in SPS (53.9 ± 4.6%) and SPD (50.7 ± 4.6%). These are the first crucial steps to determining the optimum semen collection time and to improving the viability of diluted spermatozoa.

  11. Reología del semen humano

    OpenAIRE

    Mendeluk, Gabriela R.; Bregni, Carlos; Blanco, Ana M.

    1996-01-01

    El cuadro denominado astenozoospermia posee origen multifactorial y se visualiza como el daño a una de las características funcionales más importantes del espermatozoide humano. la movilidad progresiva lineal rápida (grado a), siendo la consistencia seminal aumentada la condición biofísica de mayor compromiso. En el presente trabajo se estudió la correlación de la consistencia seminal con la viscosidad del semen humano, determinada con los viscosímetros rotacionales Wells- Brookfield y de Ost...

  12. Relationship of semen hyperviscosity with IL-6, TNF-?, IL-10 and ROS production in seminal plasma of infertile patients with prostatitis and prostato-vesiculitis.

    Science.gov (United States)

    Castiglione, R; Salemi, M; Vicari, L O; Vicari, E

    2014-12-01

    Changes in levels of oxidative damage products in semen and their relationship to seminal fluid viscosity (SFV) have recently received increasing research interest. We analysed whether SFV was associated with ROS generation, levels of cytokines TNF-alpha (TNF-?), IL-6 and IL-10 and seminal leucocyte concentration, and whether ROS production was related to the extent of infections/inflammations at one (prostatitis) or two (prostato-vesiculitis) male accessory glands. We studied 169 infertile patients, with chronic bacterial prostatitis (PR, n = 74) and/or bilateral prostato-vesiculitis (PV, n = 95), as diagnosed by the ultrasound (US) criteria. Healthy fertile men (n = 42) served as controls. In the PV patient group, SFV, semen characteristics and ROS production had median values that were significantly higher than those found in PR patients and controls, although other sperm variables had values significantly lower than those found in PR patients or controls. In PV infertile patients, ROS generation and pro-inflammatory cytokines levels were higher than those found in PR infertile patients and controls, although seminal IL-10 levels in PV and PR patients were lower than those found in the controls. In PR patients, the levels of SFV were positively related to TNF-? (r = 0.67; P oxidative stress in infertile men and increased pro-inflammatory interleukins in patients with male accessory gland infection, more when the infection was extended to the seminal vesicles. PMID:24329571

  13. Semen quality assessments and their significance in reproductive technology.

    Science.gov (United States)

    Kordan, W; Fraser, L; Wysocki, P; Strzezek, R; Lecewicz, M; Mogielnicka-Brzozowska, M; Dzieko?ska, A; Soliwoda, D; Koziorowska-Gilun, M

    2013-01-01

    Semen quality assessment methods are very important in predicting the fertilizing ability of persevered spermatozoa and to improve animal reproductive technology. This review discusses some of the current laboratory methods used for semen quality assessments, with references to their relevance in the evaluation of male fertility and semen preservation technologies. Semen quality assessment methods include sperm motility evaluations, analyzed with the computer-assisted semen analysis (CASA) system, and plasma membrane integrity evaluations using fluorescent stains, such as Hoechst 33258 (H33258), SYBR-14, propidium iodide (PI), ethidium homodimer (EthD) and 6-carboxyfluorescein diacetate (CFDA), and biochemical tests, such as the measurement of malondialdehyde (MDA) level. This review addresses the significance of specific fluorochromes and ATP measurements for the evaluation of the sperm mitochondrial status. Laboratory methods used for the evaluation of chromatin status, DNA integrity, and apoptotic changes in spermatozoa have been discussed. Special emphasis has been focused on the application of proteomic techniques, such as two-dimensional (2-D) gel electrophoresis and liquid chromatography mass spectrometry (LC-MS/MS), for the identification of the properties and functions of seminal plasma proteins in order to define their role in the fertilization-related processes. PMID:24597323

  14. Zinc, magnesium and calcium in human seminal fluid : relations to other semen parameters and fertility

    DEFF Research Database (Denmark)

    SØrensen, M B; Bergdahl, I A

    1999-01-01

    The effects of zinc, magnesium and calcium in seminal plasma on time-to-pregnancy (TTP) in healthy couples, on conventional semen parameters and computer-assisted semen analysis (CASA) parameters were evaluated. The localization of chelatable zinc ions in seminal plasma and spermatozoa were assessed by autometallography (AMG). Differences in chelatable zinc localization in samples with high and low total zinc were evaluated. Semen samples from 25 couples with short TTP and 25 couples with long TTP were subjected to conventional semen analysis, CASA, zinc and magnesium measurements by inductively coupled plasma mass spectrometry, and calcium by flame atomic absorption spectrometry. The cations were strongly inter-correlated, but no correlation with TTP or conventional semen parameters was found. Semen samples with high zinc concentrations exhibited statistically significant poorer motility assessed by the CASA parameters straight line velocity and linearity than samples with low zinc content. Calcium concentration also showed statistically significant differences for the same parameters, but the effect was removed by entering zinc concentration into a multiple regression model. Semen samples with high total zinc exhibited stronger staining of the seminal plasma at AMG. It is suggested that high seminal zinc concentrations have a suppressing effect on progressive motility of the spermatozoa ('quality of movement'), but not on percentage of motile spermatozoa ('quantity of movement').

  15. Total antioxidant capacity and lipid peroxidation in semen of patient with hyperviscosity.

    Science.gov (United States)

    Layali, Issa; Tahmasbpour, Eisa; Joulaei, Manijeh; Jorsaraei, Seyed Gholam Ali; Farzanegi, Parvin

    2015-01-01

    Semen hyperviscosity (SHV) is one of the factors involved in deficiency in sperm function. This research aimed to evaluate seminal plasma total antioxidant capacity (TAC) and malondialdehyde (MDA) levels in infertile patients with hyperviscous and non-hyperviscous semen samples to understand whether hyperviscous semen is associated with oxidative damage in infertile subjects. In this cross sectional study, 59 semen samples were provided by fertile (n=12) individuals as control, infertile patients with normal viscosity (n=25) and infertile patients with hyperviscosity (n=22). After semen parameters examination, semen viscosity was studied by glass pipettes. Seminal plasma TAC and MDA levels were measured by ferric reducing of antioxidant power (FRAP) and thiobarbituric acid reaction (TBAR) methods, respectively. A probability less than 0.05 was considered statistically significant throughout the article. The mean of sperm parameters including: counts, motility and normal morphology in patients with hyperviscosity were significantly lower than those in non-hyperviscosity patients (pMDA value was estimated for hyperviscous group compared with non-hyperviscous (1.01 ± 0.41 nmol/ml vs. 0.94 ± 0.28 nmol/l); however, it was nonsignificant. Hyperviscous semen impairs seminal plasma TAC which is eventually associated with sperm membrane lipid peroxidation. PMID:25685746

  16. Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection / Parâmetros seminais e perfis bioquímicos e proteicos do plasma seminal de cães com hyperplasia prostática benigna após a administração intra-prostática de toxina botulínica tipo A

    Scientific Electronic Library Online (English)

    Tathiana Ferguson, Motheo; Aracélle Elisane, Alves; Giuliano Queiroz, Mostachio; Maricy, Apparício; Alexandre Pinto, Ribeiro; Fabiana Ferreira de, Souza; Maria Denise, Lopes; Wilter Ricardo Russiano, Vicente.

    2014-06-01

    Full Text Available O objetivo do presente estudo foi determinar a ação de diferentes concentrações de toxina botulínica tipo A (TB-A) sobre os parâmetros seminais, perfis bioquímicos e proteicos do plasma seminal de cães com hiperplasia prostática benigna (HPB). Dezoito cães hígidos, não orquiectomizados com HPB foram [...] divididos em três grupos, os quais foram submetidos à injeção intra-prostática de solução salina (grupo controle - GC), 250UI (GI) ou 500UI (GII) de TB-A. Amostras seminais foram coletadas previamente aos tratamentos e após 2, 4 e 8 semanas. Os parâmetros seminais assim como os valores de pH e concentrações de proteínas totais (TP), cloretos totais (CT), cálcio (Ca), potássio (K), sódio (Na) do plasma seminal foram mensurados após as coletas. O perfil proteico do fluido prostático foi estabelecido por meio de eletroforese SDS-PAGE. Não foram constatadas diferenças significativas quanto aos parâmetros espermáticos e perfil bioquímico do plasma seminal intragrupos e intergrupos (P>0,05). À SDS-PAGE foram identificadas 31 bandas proteicas com pesos moleculares de 3,9 a 106,2kDA, em todos os tratamentos e durante todo o período de avaliação. Dessa forma, concluiu-se que, independentemente da dose utilizada, a injeção intra-prostática de TB-A não altera os parâmetros seminais, assim como os perfis bioquímico e proteico do plasma seminal de cães com HPB. Abstract in english This study aimed to determine the effects of different concentrations of botulinum toxin type A (BT-A) on semen parameters, and seminal plasma biochemical and protein profiles of dogs with benign prostatic hyperplasia (BPH). Eighteen sexually intact male dogs with BPH were randomly divided in three [...] groups, and received an intraprostatic injection of saline solution (control group - CG), 250UI (GI) or 500UI (GII) of BT-A under transabdominal ultrasound guidance. Semen was collected at baseline, 2, 4 and 8 weeks after treatment. Semen parameters were determined and seminal plasma pH, total protein (TP), total chlorides (TC), calcium (Ca), potassium (K), and sodium (Na) concentrations were assessed. One-dimensional sodium dodecyl sulfatepolyacrilamide gel eletrophoresis (SDS- PAGE) was performed to determine seminal plasma protein profile. Sperm parameters and seminal plasma pH, TP, TC, Ca and K mean values did not change significantly at any time point and among treated groups (P>0.05). The SDS-PAGE analysis of the pooled fractions identified 31 protein bands with molecular weights ranging from 3.9 to 106.2kDA in all treatment groups during the entire evaluation period. Regardless the used dose, intraprostatic BT-A injection do not alter semen parameters and seminal plasma biochemical and protein profiles of dogs with BPH.

  17. Concentration, activity and biochemical characterization of myeloperoxidase in fresh and post-thaw equine semen and their implication on freezability.

    Science.gov (United States)

    Ponthier, J; Franck, T; Parrilla-Hernandez, S; Niesten, A; de la Rebiere, G; Serteyn, D; Deleuze, S

    2014-04-01

    Myeloperoxidase (MPO) is a pro-oxidant enzyme associated with decreased motility in thawed equine semen. This study aimed to describe MPO concentration, activity and subunits in raw and thawed semen and to correlate these data with motilities in raw and thawed semen. Semen samples from five stallions were collected four times. Motilities were assessed in raw and thawed semen. MPO assays were performed in raw seminal plasma, raw sperm-rich pellet and thawed semen. Total and active MPO concentrations were, respectively, assayed by enzyme-linked immunosorbent assay and specific immunological extraction followed by enzymatic detection. MPO subunits present in semen were characterized by Western blot. Purified active MPO was added in saline solution and freezing extender to control its activity during freezing procedure. Differences between medians were determined using Kruskal-Wallis test, and correlations were determined using Spearman's test for nonparametric data. Active MPO concentration was low in seminal plasma and thawed semen, but high in pellet (p = 0.0058), as the opposite relation was observed for total MPO concentration (p < 0.0001). In seminal plasma and post-thaw semen, inactive 86-kDa MPO precursor was mainly observed. Purified MPO activity was decreased in the extender (p = 0.0286). MPO activity in pellet was highly correlated with thawed progressive motility (r = -0.5576, p = 0.0086). Inactive MPO precursor and unknown low molecular weight inactive MPO precursor subunits explain low MPO activity in semen. Major MPO activity was observed in pellet, and post-thaw loss of activity is partially explained by MPO inactivation in extender. Thawed semen motility was negatively correlated with MPO activity in pellet, becoming a potential freezability predictor. PMID:24479950

  18. Kualitas Semen Beku Kuda dalam Pengencer Susu Skim dan Dimitropoulos dengan Dimetilformamida Sebagai Krioprotektan

    Directory of Open Access Journals (Sweden)

    I. Arifiantini

    2007-08-01

    Full Text Available Equine semen are far less tolerant in the freezing and thawing process than bull semen. The stallion spermatozoa are known susceptible to cold-shock relating with the content of their fatty acid on the plasma membrane. The extender is one of determining factors in the success of stallion semen cryopreservation, as an energy source and protector the cell from harmfull effect of cold shock. The common cryoprotective agent (CPA for mammalian spermatozoa was glycerol, but for stallion semen cryopreservation, dimethyl formamide (DMF was more suitable. This research was conducted to compare the success of the stallion semen cryopreservation in skim milk and dimitropoulos (DV extender with DMF as cryoprotectant. Semen from three sexualy mature stallions was collected twice a week using an artificial vagina. Semen was evaluated macro- and microscopically and then divided into two tubes, diluted each of them with skim milk dan DV extender (1:1, centrifuged at 3 000 rpm for 15 minutes. The supernatant was removed and the pellet (spermatozoa was re-diluted in skim DMF (SDMF and DVDMF extender with the concentration of spermatozoa was 200x106 ml-1. The semen then packed in 0.3ml minitub straw equilibrated for two hours at 4-5oC and frezee in liquid N2 vapor for 10 minutes. The assessment of sperm quality was conducted based on the percentage of sperm motility and viability. In this research, post-thawed semen in DVDMF showed the percentages of the motility (36.2% and the viability (59.3% higher (P<0.05 than SDMF (28.5 and 48.0 %. In conclusion, the DVDMF extender provided better post-thawed semen quality than SDMF.

  19. Exposure to Environmental Ozone Alters Semen Quality

    OpenAIRE

    Sokol, Rebecca Z; Kraft, Peter; Fowler, Ian M.; Mamet, Rizvan; Kim, Elizabeth; Berhane, Kiros T

    2005-01-01

    Idiopathic male infertility may be due to exposure to environmental toxicants that alter spermatogenesis or sperm function. We studied the relationship between air pollutant levels and semen quality over a 2-year period in Los Angeles, California, by analyzing repeated semen samples collected by sperm donors. Semen analysis data derived from 5,134 semen samples from a sperm donor bank were correlated with air pollutant levels (ozone, nitrogen dioxide, carbon monoxide, and particulate matter <...

  20. Stainless steel welding and semen quality

    DEFF Research Database (Denmark)

    Jelnes, J E; Knudsen, Lisbeth E.

    1988-01-01

    Questionnaire studies of patients from fertility clinics suggest that welders may have an increased risk of reduced semen quality. In this study, welders and nonwelders from the same plants were asked to provide blood, urine, and semen samples. Urine was analyzed for chromium and nickel, and for mutagenic activity and metal concentration; blood for metal concentrations, immunoglobulin G, total protein, and measures of genotoxicity in lymphocytes; and semen was evaluated by standard semen analysi...

  1. Semen quality and sedentary work position

    DEFF Research Database (Denmark)

    Støy, Julie; Hjøllund, Niels Henrik Ingvar; Mortensen, Jens Tølbøll; Burr, Hermann; Bonde, Jens Peter

    2004-01-01

    Increased scrotal temperature can, in experimental settings, markedly disturb the production of semen. Sedentary work position may increase the temperature of the scrotum, but previous studies have failed to determine whether changes in scrotal temperature caused by sedentary work actually do affect semen quality. This study was carried out to elucidate the possible harmful effects of sedentary work on sperm count and other semen characteristics. In 1981-1983 a semen sample was obtained from 311...

  2. Total Antioxidant Capacity and Lipid Peroxidation in Semen of Patient with Hyperviscosity

    Directory of Open Access Journals (Sweden)

    Issa Layali

    2015-01-01

    Full Text Available Semen hyperviscosity (SHV is one of the factors involved in deficiency in sperm function. This research aimed to evaluate seminal plasma total antioxidant capacity (TAC and malondialdehyde (MDA levels in infertile patients with hyperviscous and non-hyperviscous semen samples to understand whether hyperviscous semen is associated with oxidative damage in infertile subjects. In this cross sectional study, 59 semen samples were provided by fertile (n=12 individuals as control, infertile patients with normal viscosity (n=25 and infertile patients with hyperviscosity (n=22. After semen parameters examination, semen viscosity was studied by glass pipettes. Seminal plasma TAC and MDA levels were measured by ferric reducing of antioxidant power (FRAP and thiobarbituric acid reaction (TBAR methods, respectively. A probability less than 0.05 was considered statistically significant throughout the article. The mean of sperm parameters including: counts, motility and normal morphology in patients with hyperviscosity were significantly lower than those in non-hyperviscosity patients (p<0.05, p<0.01 and p<0.001, respectively. The mean of seminal plasma TAC value in seminal plasma of non-hyperviscosity patients (1710.31 ± 458.67 ?mol/l was significantly (p<0.01 higher than that of hyperviscosity group (1230.25 ± 352 ?mol/l. A trend toward a higher mean of seminal plasma MDA value was estimated for hyperviscous group compared with non-hyperviscous (1.01 ± 0.41 nmol/ml vs. 0.94 ± 0.28 nmol/l; however, it was nonsignificant. Hyperviscous semen impairs seminal plasma TAC which is eventually associated with sperm membrane lipid peroxidation.

  3. Banking North American buffalo semen.

    Science.gov (United States)

    Lessard, C; Danielson, J; Rajapaksha, K; Adams, G P; McCorkell, R

    2009-04-15

    The purpose of this study was to develop a procedure to collect and preserve semen from wood bison (Bison bison athabascae) and plains bison (Bison bison bison). Semen samples from three wood and three plains bison bulls were collected by electroejaculation from June through October. In addition, sperm was collected from the cauda epididymis of seven plains bison. Semen was cryopreserved using two commercially available cryopreservation media, an egg yolk-based medium (Triladyl), and a medium free of products of animal origin (Andromed). Sperm morphology and motility were recorded on fresh and post-thawed semen samples. Total sperm motility was not different between plains and wood bison for the months of June (50%), July (69%) and October (54%). However, total sperm motility for wood bison was higher (Pbison for the months of August and September (August: 80% vs 55%; September: 73% vs 40%). Plains and wood bison did not differ in mean total and mean progressive motility (35 and 15%, respectively) of frozen-thawed sperm samples. The post-thaw motility of Triladyl-treated sperm was higher (Pbison semen, and cryopreserved it for future needs. PMID:19181375

  4. Histochemical demonstration of zinc ions in ejaculated human semen

    DEFF Research Database (Denmark)

    Stoltenberg, M; SØrensen, M B

    1997-01-01

    A revised in-vitro technique for autometallographic demonstration of chelatable zinc in the human ejaculate is presented, and the localization of the loosely bound pool of zinc ions is described in semen smears and at the ultrastructural level. In semen smears, black autometallographic (AMG) grains indicated the presence of zinc ions dispersed between the spermatozoa. These AMG grains have the same size as grains associated with the sperm tail and may have the same origin. EM analysis of AMG-developed smears fixed in osmium suggested that the detected zinc ions might be related to huge protein molecules present in semen and adhering to the surface of the spermatozoa. Spermatozoa in AMG-stained smears exhibited zinc ions in the midpiece and head, and also joined to the membrane of the tail. Washed spermatozoa exhibited zinc ions only within the midpiece. Ultrastructurally, they were found located in the helecine mitochondria. A few grains were found in the acrosome of the washed spermatozoa. Treatment with thechelating agent DEDTC resulted in complete bleaching of the zinc staining. These findings and the fact that calcium EDTA acid blocks the plasma and surface staining, but not the acrosomal and mitochondrial staining, suggest that chelatable zinc ions exist in two separate pools in human semen.

  5. Use of immobilized cryopreserved bovine semen in a blind artificial insemination trial.

    Science.gov (United States)

    Standerholen, Fride Berg; Waterhouse, Karin Elisabeth; Larsgard, Anne Guro; Garmo, Randi Therese; Myromslien, Frøydis Deinboll; Sunde, Jan; Ropstad, Erik; Klinkenberg, Geir; Kommisrud, Elisabeth

    2015-08-01

    To make timing of artificial insemination (AI) relative to ovulation less critical, methods for prolonging shelf life of spermatozoa in vivo after AI have been attempted to be developed. Encapsulation of sperm cells is a documented technology, and recently, a technology in which sperm cells are embedded in alginate gel has been introduced and commercialized. In this study, standard processed semen with the Biladyl extender (control) was compared with semen processed by sperm immobilization technology developed by SpermVital AS in a blind field trial. Moreover, in vitro acrosome and plasma membrane integrity was assessed and compared with AI fertility data for possible correlation. Semen from 16 Norwegian Red young bulls with unknown fertility was collected and processed after splitting the semen in two aliquots. These aliquots were processed with the standard Biladyl extender or the SpermVital extender to a final number of 12 × 10(6) and 25 × 10(6) spermatozoa/dose, respectively. In total, 2000 semen doses were produced from each bull, divided equally by treatment. Artificial insemination doses were set up to design a blinded AI regime; 5 + 5 straws from each extender within ejaculates in ten-straw goblets were distributed to AI technicians and veterinarians all over Norway. Outcomes of the inseminations were measured as 56-day nonreturn rate (NRR). Postthaw sperm quality was assessed by flow cytometry using propidium iodide and Alexa 488-conjugated peanut agglutinin to assess the proportion of plasma membrane and acrosome-intact sperm cells, respectively. In total, data from 14,125 first inseminations performed over a 12-month period, 7081 with Biladyl and 7044 with SpermVital semen, were used in the statistical analyses. There was no significant difference in 56-day NRR for the two semen categories, overall NRR being 72.5% and 72.7% for Biladyl and SpermVital, respectively. The flow cytometric results revealed a significant higher level of acrosome-intact live spermatozoa in Biladyl-processed semen compared to SpermVital semen. The results indicate that the level of acrosome-intact live spermatozoa in the AI dose did not affect the 56-day NRR for the two semen processing methods. In conclusion, this study has showed that immobilized spermatozoa provide equal fertility results as standard processed semen when AI is performed in a blinded field trial, although the immobilization procedure caused increased sperm damage evaluated in vitro compared to standard semen processing procedure. PMID:25922170

  6. Efecto de dos métodos de congelación sobre la viabilidad espermática de semen de verraco / Effect of two freezing methods on sperm viability of boar semen

    Scientific Electronic Library Online (English)

    Mateo, Carpio C.; José, Cadillo C.; Edwin, Mellisho S..

    2008-01-01

    Full Text Available El objetivo del presente trabajo fue evaluar el efecto de dos métodos de congelación sobre la viabilidad espermática de semen de verraco. Se utilizaron seis eyaculados (dos por macho), de tres verracos adultos de las razas Hampshire, Duroc y Landrace. Se evaluó el volumen, motilidad y concentración [...] espermática de cada eyaculado. Posteriormente, el semen fue diluido con solución BTS (Beltsville Thawing Solution) y centrifugado a 1500 rpm por 10 min para retirar el plasma. El pellet (porción espermática) obtenido fue extendido con dilutor de congelación (A y B), enfriado y equilibrado a 5 °C por 2 horas previas a la congelación. El semen equilibrado fue criopreservado usando dos métodos de congelamiento: a) en pellets colocando alícuotas de 0.25 ml de semen equilibrado en agujeros preparados en la superficie del bloque de hielo seco manteniéndolo por 2 min y luego vertiéndolo al nitrógeno líquido; y b) en pajillas de 0.5 ml, exponiéndolas al vapor de nitrógeno líquido a 7 cm de altura por 10 min (dentro de una caja de tecnopor) para luego verterlas al nitrógeno liquido. No se encontró diferencias significativas entre la motilidad individual y proporción de espermatozoides vivos del semen congelado en pellets (40.1 y 48.8%) vs. pajillas (34.5 y 40.7%), respectivamente. Abstract in english The objective of this experiment was to evaluate the effect of two freezing methods on the spermatic viability of boar semen. Six collects (2 ejaculates per male) of three adult boars (Hampshire, Duroc and Landrace) were used. Immediately after the collection, volume, motility and spermatic concentr [...] ation of each ejaculate were evaluated. Then, the semen was diluted with BTS solution (Beltsville Thawing Solution) and centrifuged at 1500 rpm for 10 min for plasma withdrawal. The pellet (spermatic portion) was diluted with freezing dilutor (A and B), cooled and equilibrated at 5 °C for two hours before freezing. The equilibrated semen was cryopreserved using two freezing methods: a) in pellets placing 0.25 ml aliquota of semen in holes prepared on the surface of a dry ice block for 20 min and then, pouring them in liquid nitrogen; and b) in straws of 0.5 ml exposing them at 7 cm over liquid nitrogen steam for 10 min (in a styrofoam box). The results showed no statistically differences amongst individual motility and live spermatozoa percentage in semen frozed in pellets (40.1 and 48.8%) as compared to straws (34.5 and 40.7%).

  7. Semen Allergy Manifesting As Chronic Pruritus Vulva

    Directory of Open Access Journals (Sweden)

    Pavithran K

    1997-01-01

    Full Text Available A young woman of 24 with personal and family history of atopy development pruritus vulva each time after sexual intercourse with her husband. History of urticaria of sites of contact with semen on her thighs gave suspicion of contact urticaria. Positive wheal and flare response to pin prick test with semen, excellent therapeutic response to topical steroid and oral Cetirizine and non- recurrence of the problem after using condom by her husband confirmed the diagnosis of semen allergy.

  8. Cryopreservation of Mirror Carp Semen

    OpenAIRE

    AKÇAY, Ergun

    2004-01-01

    The effects of different extenders and cryoprotectants on the viability and fertilizing ability of frozen spermatozoa from the mirror carp, Cyprinus carpio L. (1758), were investigated. Semen was collected from anesthesized males by the abdominal massage method. Having determined the main spermatological properties (volume, motility, duration of motility, total spermatozoa number, concentration and pH), the pooled ejaculates were diluted with 3 extenders containing different cryoprotectants (...

  9. Detection of HIV and HCV RNA in semen from Brazilian coinfected men using multiplex PCR before and after semen washing / Detecção do RNA do HIV e HCV em sêmen de homens brasileiros, usando PCR multiplex antes e depois do "semen washing"

    Scientific Electronic Library Online (English)

    Cynthia Liliane Motta do, Canto; Aluisio C., Segurado; Cláudio, Pannut; Agnaldo, Cedenho; Miguel, Srougi; Deborah, Spaine; Silvana, Fernandes; Nadily, Carretiero; Maria Carolina, Bernal; José Eduardo, Levi.

    2006-08-01

    Full Text Available O aumento da sobrevida dos pacientes que utilizam terapêutica antiretroviral altamente eficaz (HAART- Highly Active Antiretroviral Therapy) trouxe uma nova demanda de casais sorodiscordantes que desejam filhos. Como esses casais não podem abandonar o uso de preservativos, torna-se indispensável trat [...] ar o sêmen infectado com técnicas laboratoriais eficazes que além de isolar os melhores espermatozóides, reduzam a carga viral do HIV e HCV a níveis indetectáveis. Para isso, são utilizadas técnicas de semen washing, associadas a testes ultra sensíveis de biologia molecular. Após análise seminal, sêmen de 20 pacientes co-infectados HIV-HCV foram submetidos a fracionamento celular e isolamento de espermatozóides móveis através de método de densidade de gradiente descontínuo e swim-up. Posteriormente, testes para detecção do RNA do HIV e HCV foram aplicados nos sêmens totais e frações seminais obtidas. Em fase pré semen washing, o HIV foi detectado em 100% dos semens totais. Contrariamente, o HCV foi detectado em apenas uma amostra. Em fase pós semen washing, o HIV e HCV não foram detectados em nenhuma das frações seminais. A redução do HIV e do HCV através de semen washing mostra-se um método eficaz a indivíduos co-infectados HIV-HCV, apesar do encontro do HCV no sêmen ser raro. Abstract in english INTRODUCTION: Prolonged survival of patients under HAART has resulted in new demands for assisted reproductive technologies. HIV serodiscordant couples wish to make use of assisted reproduction techniques in order to avoid viral transmission to the partner or to the newborn. It is therefore essentia [...] l to test the effectiveness of techniques aimed at reducing HIV and HCV loads in infected semen using molecular biology tests. METHODS: After seminal analysis, semen samples from 20 coinfected patients were submitted to cell fractioning and isolation of motile spermatozoa by density gradient centrifugation and swim-up. HIV and HCV RNA detection tests were performed with RNA obtained from sperm, seminal plasma and total semen. RESULTS: In pre-washing semen, HIV RNA was detected in 100% of total semen samples, whereas HCV RNA was concomitantly amplified in only one specimen. Neither HIV nor HCV were detected either in the swim-up or in the post-washing semen fractions. CONCLUSIONS: Reduction of HIV and/or HCV shedding in semen by density gradient centrifugation followed by swim-up is an efficient method. These findings lead us to believe that, although semen is rarely found to contain HCV, semen processing is highly beneficial for HIV/HCV coinfected individuals.

  10. Assessment of semen quality in Swamp Buffalo AI Bulls in Thailand

    Directory of Open Access Journals (Sweden)

    S. Koonjaenak

    2010-02-01

    Full Text Available Characteristic of Thai swamp buffalo bulls semen used for artificial insemination (AI in Thailand, aspects relevance in freezing and thawing of semen are review. Semen and sperm characteristics were evaluated included sperm count, motility (assessed subjectively and by CASA, morphology (using phase-contrast light microscopy and SEM, plasma membrane integrity (PMI (using a hypo-osmotic swelling test [HOST] and SYBR- 14/propidium iodide [PI], plasma membrane stability (PMS (using Annexin-V/PI and deoxyribonucleic acid (DNA integrity (using SCSA and flow cytometry [FCM]. The average ejaculate volume was about 3.0–4.0 mL, with good viability (PMI measured by the HOST and motility (>65% and >70%, respectively. Sperm concentration ranged from 1.1 to 1.2 billion/mL, being also affected by bull age. Whereas semen quality (including sperm output, pH and initial sperm motility did not differ between the seasons. Few spermatozoa (<15%/ ejaculate had abnormal morphology with abnormalities resembling those in other bovidae. In FT semen, PMI (using SYBR-14/PI and PMS were highest in winter. Across seasons, ~50% of post-thaw spermatozoa depicted linear motility, a proportion that decreased to ~35% during incubation (38oC for 60 minutes, without marking any seasonal difference. The sperm DNA was hardly damaged (with <3% fragmentation, expressed as DNA fragmentation index [DFI], among seasons.

  11. Relation between semen quality and fertility

    DEFF Research Database (Denmark)

    Bonde, Jens Peter; Ernst, Erik; Jensen, Tina Kold; Hjollund, N H; Kolstad, Henrik A.; Henriksen, T B; Scheike, Thomas Harder; Giwercman, Aleksander; Olsen, J; Skakkebaek, N E

    1998-01-01

    Semen analysis is part of the routine assessment of infertile couples. WHO defines a sperm concentration above 20x10(6) per mL seminal fluid as normal. We studied the association between semen quality and the probability of conception in a single menstrual cycle in Danish couples with no previous reproductive experience.

  12. Alternatives to Antibiotics in Semen Extenders: A Review

    OpenAIRE

    Morrell, Jane M; Wallgren, Margareta

    2014-01-01

    Antibiotics are added to semen extenders to be used for artificial insemination (AI) in livestock breeding to control bacterial contamination in semen arising during collection and processing. The antibiotics to be added and their concentrations for semen for international trade are specified by government directives. Since the animal production industry uses large quantities of semen for artificial insemination, large amounts of antibiotics are currently used in semen extenders. Possible alt...

  13. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen

    OpenAIRE

    G.V. Aguiar; M.F. van Tilburg; A.G.V. Catunda; C.K.S. Celes; I.C.S. Lima; A.C.N. Campos; A.A.A. Moura; Araújo, A.A.

    2013-01-01

    The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile (fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity) were analyzed. It was observed a reduction (P

  14. Effect of platelet activating factor (PAF) supplementation in semen extender on viability and ATP content of cryopreserved canine spermatozoa.

    Science.gov (United States)

    Kordan, W; Lecewicz, M; Strzezek, R; Dzieko?ska, A; Fraser, L

    2010-01-01

    The aim of this study was to investigate the effect of platelet activating factor (PAF) on the quality characteristics of cryopreserved canine spermatozoa. Cryopreserved semen of 5 mixed-breed dogs was treated with different concentrations of exogenous PAF (1 x 10(-3) M, 1 x 10(-4) M, 1 x 10(-5) M and 1 x 10(-6) M) and examined at different time intervals (0, 30, 60 and 120 min). Cryopreserved semen treated without PAF was used as the control. Sperm quality was evaluated for motility (computer-assisted semen analysis, CASA), mitochondrial function (JC-1/PI assay) and plasma membrane integrity (SYBR-14/PI assay and Hoechst 33258). Also, ATP content of spermatozoa was determined using a bioluminescence assay. Treatment of cryopreserved semen with 1 x 10(-3) M PAF at 120 min of incubation resulted in significantly higher total sperm motility compared with the control. It was observed that PAF-improved total sperm motility was concurrent with enhanced sperm motility patterns after treatment of cryopreserved semen. Treatment of cryopreserved semen with PAF did not improve either sperm mitochondrial function or plasma membrane integrity, as monitored by different fluorescent membrane markers. Furthermore, ATP content of cryopreserved spermatozoa was significantly higher when PAF was used at a concentration of 1 x 10(-3) M compared with the control and other PAF treatments, regardless of the incubation time. The findings of this study indicated that treatment with 1 x 10(-3) M PAF at 120 min of incubation rendered better quality of cryopreserved canine semen, which was associated with improved sperm motility parameters and ATP content. It can be suggested that exogenous PAF addition is beneficial as a supplement for canine semen extender used for cryopreservation. PMID:21370733

  15. Effects of dietary supplementation with polyunsaturated fatty acids and antioxidants on biochemical characteristics of boar semen.

    Science.gov (United States)

    Strzezek, Jerzy; Fraser, Leyland; Kukli?ska, Magda; Dzieko?ska, Anna; Lecewicz, Marek

    2004-11-01

    The aim of this study was to investigate the effect of providing a supplement containing polyunsaturated fatty acids and antioxidants (PROSPERM) on the biochemical characteristics of boar semen. Two sexually mature boars were fed a standard diet with PROSPERM (250 g daily) for a 24-week period. Ejaculates collected prior to supplementation were used as the control. Semen quality and biochemical parameters were analyzed. The dietary supplementation enhanced sperm characteristics, including the percentage of spermatozoa with intact plasma membrane and osmotic resistance of the acrosomal membrane. Higher production of malondialdehyde was concurrent with increased activity of superoxide dismutase in the seminal plasma and spermatozoa after 8 weeks of supplementation. These changes were accompanied by a high content of total protein and low-molecular antioxidants of the seminal plasma. It was observed that PROSPERM supplementation enhanced the survivability of boar spermatozoa during storage in a standard semen extender supplemented with lipoprotein fractions, isolated from hen egg yolk or ostrich egg yolk, at 5 degrees C and 16 degrees C. These results indicate that PROSPERM supplementation of boars had a beneficial effect on the biological characteristics of the spermatozoa, which could be useful for semen preservation at different temperatures. PMID:15592586

  16. A validation study of the Nucleix DSI-Semen kit--a methylation-based assay for semen identification.

    Science.gov (United States)

    LaRue, Bobby L; King, Jonathan L; Budowle, Bruce

    2013-03-01

    The detection of semen can assist in reconstructing the events of a sexual assault and impact the outcome of legal dispositions. Many methods currently are used for detecting the presence of semen, but they all have limitations with regards to specificity, sample degradation/consumption, stability of biomolecule assayed, and/or incompatibility with downstream individual identification assays. DNA is routinely collected at sexual assault crime scenes and is widely used for individual identification. The DNA also carries methylation patterns that are tissue specific. To date, however, assays designed to exploit methylation patterns suffer from complex chemistries and unwieldy analyses. DSI-Semen™ kit uses a novel approach involving CpG methylation-sensitive restriction endonuclease digestion coupled to a multiplexed polymerase chain reaction (PCR) to generate an amplicon profile that makes it possible to determine whether the tissue source of a DNA sample was semen or non-semen. The assay returned an appropriate positive result for semen with neat semen, semen stains, and semen/non-semen tissue mixtures. The assay is robust and reliable, with a positive result for semen given as little as 31 pg of template DNA input. Low levels of semen were detected in mixtures of semen and other body fluids. UV-exposed samples and those in the presence of limited concentrations of known PCR inhibitors were typeable. The DSI-Semen™ kit provides a reliable tool for the determination of DNA being derived from semen. PMID:22895803

  17. Effect of initial seminal plasma fructose concentration on goat semen storage at 5ºC / Efeito da concentração inicial de frutose sobre a conservação a 5 ºC do sêmen caprino

    Scientific Electronic Library Online (English)

    B.G., Matos-Brito; I.C.S., Lima; J.F., Pereira; F.M., Barboza; M.A.B., Linard; G.V., Aguiar; A.G.V., Catunda; A.A.A., Moura; J.F., Nunes; A.C.N., Campos.

    2013-03-01

    Full Text Available Foram coletadas 24 amostras de sêmen caprino. Cada ejaculado foi dividido em 4 alíquotas, e foram diluídas em citrato-gema de ovo (CG), TRIS-gema de ovo (TG) e água de coco industrializada-gema de ovo (ACI-G), a quarta, foi centrifugada para determinação da concentração de frutose e atividade da FLA [...] 2 no PS. O sêmen foi conservado a 5 ºC e avaliado a fresco, 2, 24 e 48 h, em cada tempo foi avaliado o vigor, motilidade e alterações morfológicas. Os reprodutores foram divididos em dois grupos: grupo I-concentração de frutose >710 mg/dL e o grupo II-concentração de frutose Abstract in english Twenty-four goat semen samples were collected and divided into four aliquots, diluted with the citrate-egg yolk (CY), TRIS-egg yolk (TY) or industrialized coconut water with egg yolk (ICW-Y) extenders. The fourth aliquot was centrifuged to analyze fructose concentration and PLA2 activity on SP. The [...] semen was stored at 5ºC and evaluated at times fresh, 2, 24 and 48 h, in each time was evaluated the vigor, sperm motility and total morphological alterations. The animals were divided into two groups: group Ifructose concentration >710 mg/dL and group IIfructose concentration

  18. Update on sexed semen technology in cattle.

    Science.gov (United States)

    Seidel, G E

    2014-05-01

    The technology in current use for sexing sperm represents remarkable feats of engineering. These flow cytometer/cell sorters can make over 30 000 consecutive evaluations of individual sperm each second for each nozzle and sort the sperm into three containers: X-sperm, Y-sperm and unsexable plus dead sperm. Even at these speeds it is not economical to package sperm at standard numbers per inseminate. However, with excellent management, pregnancy rates in cattle with 2 million sexed sperm per insemination dose are about 80% of those with conventional semen at normal sperm doses. This lowered fertility, in part due to damage to sperm during sorting, plus the extra cost of sexed semen limits the applications that are economically feasible. Even so, on the order of 2 million doses of bovine semen are sexed annually in the United States. The main application is for dairy heifers to have heifer calves, either for herd expansion or for sale as replacements, often for eventual export. Breeders of purebred cattle often use sexed semen for specific matings; thawing and then sexing frozen semen and immediately using the few resulting sexed sperm for in vitro fertilization is done with increasing frequency. Beef cattle producers are starting to use sexed semen to produce crossbred female replacements. Proprietary improvements in sperm sexing procedures, implemented in 2013, are claimed to improve fertility between 4 and 6 percentage points, or about 10%. PMID:24680061

  19. 9 CFR 98.34 - Import permits for poultry semen and animal semen.

    Science.gov (United States)

    2010-01-01

    ...address of the importer; the species, breed, quantity of animal semen to...are lesions of TB in the test positive pigs, the whole group will be ineligible as...no lesions are found, the rest of the pigs will be eligible as semen donors with...

  20. 19 CFR 12.32 - Honeybees and honeybee semen.

    Science.gov (United States)

    2010-04-01

    ...Duties 1 2010-04-01 2010-04-01 false Honeybees and honeybee semen. 12.32 Section 12.32 Customs Duties... Wild Animals, Birds, and Insects § 12.32 Honeybees and honeybee semen. (a) Honeybees from...

  1. Methods of cryopreservation of Tambaqui semen, Colossoma macropomum.

    Science.gov (United States)

    Varela Junior, A S; Goularte, K L; Alves, J P; Pereira, F A; Silva, E F; Cardoso, T F; Jardim, R D; Streit, D P; Corcini, C D

    2015-06-01

    This study compared three different techniques for sperm cryopreservation of Tambaqui (Colossoma macropomum). Semen was diluted in Beltsville Thawing Solution with the addition of dimethyl sulfoxide (DMSO) at various concentrations (5%, 10%, 15% and 20%). Cryopreservation was performed using three methods: Box Conditioner Method with straws at a 5 cm distance from liquid nitrogen vapor (N2L); Dry Shipper Method placing the straws inside the machine; Vitrification Method placing the straws directly into N2L, amounting to 12 treatments (four DMSO concentrations×three freezing methods). The samples were evaluated for analysis of sperm quality in vivo and in vitro. Use of the Vitrification Method at different concentrations of DMSO provided the least values in the different evaluations. Fertilization, hatching rates and plasma membrane integrity using the Box Conditioner Method with 5% and 10% DMSO did not differ (P>0.05) but use of the concentration of 5% DMSO resulted in greater values than the other treatments (PTambaqui semen quality with freeze concentrations of 5% and 10% DMSO. PMID:25906678

  2. EFFECTS OF SELENOMETHIONINE AND VITAMIN C ON SEMEN.

    Directory of Open Access Journals (Sweden)

    Cristiane A Alvarez e Gentil Vanini de Moraes

    2006-06-01

    Full Text Available Spermatozoa are susceptible to peroxidative damages due to the high concentration of polyunsaturated fatty acids in its cytoplasmic membranes. Studies have shown that the spermatozoa and seminal leukocytes are capable to generate high levels of reactive oxygen species (ROSs that may reduce the viability and fertility of spermatozoa. However, small quantities of ROSs are necessary to initiation of the function of spermatozoa, as well as, capacitation and induction of the acrosomic reaction. Thus an equilibrium between the production of ROSs and antioxidative protection is necessary to assure the spermatic function. The antioxidative protection of the semen is supplied by enzymes such as superoxide dismutase, glutathione peroxidase (GPx, catalase, vitamin C, vitamin E and other substances (albumine, glutathione, taurine, hypotaurine found inside of spermatic cells or in seminal plasma. Thus, the objective of this revision is characterize how reactive oxygen species cause irreparable damages to spermatozoa membranes and the importance of the antioxidative protection of the semen that can be promoted by the addition of simple minerals like selenium and vitamins (e.g. ascorbic acid.

  3. Characterization and usage of sexed semen from US field data

    Science.gov (United States)

    The objectives were to characterize sexed semen available and its usage from US field data. This included investigating active Holstein proven bulls with sexed semen available, as well as percentages and frequencies of sexed semen matings for heifers and cows. Herds were also characterized for the...

  4. Effects of Exogenous Glutathione Supplementation in Biocell® Extender on Quality of Cryopreserved Buffalo (Bubalus bubalis Semen

    Directory of Open Access Journals (Sweden)

    Tohid Rezaei Topraggaleah

    2012-01-01

    Full Text Available The study was designed to investigate the effect of exogenous glutathione supplementation in soybean based extender Bioxcell® extender on post thaw semen quality of buffalo (Bubalus bubalis. Split pooled ejaculates (n = 6, possessing >70% visual sperm motility were extended at 37°C with different levels of glutathione (0.0, 0.5, 1 and 2 mM in Bioxcell® extender. Semen was cooled to 4°C in 2 h, equilibrated at 4°C for 4 h, filled in 0.5 mL straws and frozen in a programmable cell freezer before plunging into liquid nitrogen. Thawing of frozen semen was performed after 72 h at 37°C for 30 sec. Sperm motion characteristics, viability, plasma membrane integrity, acrosome morphology of each semen sample immediately after thawing and incubation for 2 h were assessed by using Computer assisted semen analyzer (SCA, eosin-nigrosin staining, Hypo Osmotic Swelling (HOS assay and phase contrast microscope, respectively. Results revealed that the addition 0.5 and 1.0 Mm of glutathione in Bioxcell® extender did not present any significant effect on overall and progressive motility as well as sperm motility characteristics (VAP, VSL, VCL, LIN and ALH, compared to the control groups (p>0.05. Immediately after thawing the proportion of post thaw sperm viability, plasma membrane integrity and normal apical ridge remained similar in all groups. However, glutathione supplementation of the extender with 2.0 mM concentration decreased sperm motility, viability at 0 and 2 h after thawing in a dose dependent manner compared to the control (p0.05. These results revealed that supplementation of the new commercial in soybean based extender Bioxcell® with glutathione did not improve sperm post thaw motility or acrosomal integrity.

  5. Semen quality in Peruvian pesticide applicators: association between urinary organophosphate metabolites and semen parameters

    Directory of Open Access Journals (Sweden)

    Gasco Manuel

    2008-11-01

    Full Text Available Abstract Background Organophosphates are broad class of chemicals widely used as pesticides throughout the world. We performed a cross-sectional study of associations between dialkylphosphate metabolites of organophosphates and semen quality among pesticide applicators in Majes (Arequipa, Peru. Methods Thirty-one men exposed to organophosphate (OP pesticides and 31 non-exposed were recruited (age, 20–60 years. In exposed subjects, semen and a blood sample were obtained one day after the last pesticide application. Subjects were grouped according to levels of OP metabolites in urine. Semen samples were analyzed for sperm concentration, percentage of sperm motility, percentage of normal morphology, semen leucocytes and concentrations of fructose and zinc. Exposure to OP was assessed by measuring six urinary OP metabolites (dimethyl and diethyl phosphates and thiophosphates by gas chromatography using a single flame photometric detector. Results Diethyldithiophosphate (p = 0.04 and diethylthiophosphate (p = 0.02 better reflected occupational pesticide exposure than other OP metabolites. Semen analysis revealed a significant reduction of semen volume and an increase in semen pH in men with OP metabolites. Multiple regression analysis showed that both occupational exposure to pesticides and the time of exposure to pesticides were more closely related to alterations in semen quality parameters than the single measurement of OP metabolites in urine. Conclusion The study demonstrated that occupational exposure to OP pesticides was more closely related to alterations in semen quality than a single measurement of urine OP metabolites. Current measurement of OP metabolites in urine may not reflect the full risk.

  6. Inseminación artificial a tiempo fijo con semen ovino refrigerado / Timed artificial insemination with ram chilled semen

    Scientific Electronic Library Online (English)

    P., Naim; M., Cueto; A., Gibbons.

    2009-09-01

    Full Text Available Se evaluó la preñez resultante de la inseminación artificial sistemática cervical (IASC) con semen ovino refrigerado a 5ºC durante 12 o 24 h y dosis de 150 o 300 millones de espermatozoides. Doscientas ovejas adultas Merino se dividieron al azar en grupos de 40 animales, según arreglo factorial de l [...] os tratamientos (2x2) más un grupo control. En la estación reproductiva, los estros fueron sincronizados mediante 14 días con esponjas intravaginales con 60 mg acetato de medroxiprogesterona y 200 UI de eCG al retirar las esponjas. A las 12 y 24 h previas a la IASC se colectaron, diluyeron y refrigeraron los eyaculados. La dilución del semen se realizó con OviPro (Minitüb®, Alemania) en una relación 1:2 (semen/ diluyente). El grupo control fue inseminado con semen fresco sin diluir y dosis de 100 millones de espermatozoides. La IASC se realizó en el orificio uterino externo a las 54-56 h después del tratamiento progestacional. La preservación seminal durante 12 h alcanzó el 25% (10/40) y 38% (15/ 39) de preñez con dosis de 150 y 300 millones de espermatozoides. El semen preservado durante 24 h determinó el 3% (1/37) y 19% (7/37) de preñez con dosis inseminantes de 150 y 300 millones de espermatozoides, respectivamente. El porcentaje de preñez del grupo control (59%) evidenció que las condiciones de la majada no estuvieron afectadas por el estado nutricional o de manejo. La IASC con semen refrigerado ovino durante 12 h y una dosis de inseminación de 300 millones de espermatozoides, permitió obtener una preñez aceptable (38%) considerando el beneficio de poder transportar semen a largas distancias y su bajo costo operativo. Abstract in english We evaluated pregnancy by timed artificial insemination (TAI) with ram semen chilled at 5ºC during 12 or 24 h and insemination doses of 150 or 300 millions spermatozoa. Two hundred adult Merino sheep were randomly divided in 4 groups of 40 animals each, according to a factorial arrangement (2x2) plu [...] s a control group. During the breeding season, estrus were synchronized with intravaginal sponges impregnated with 60 mg of medroxyprogesterone acetate inserted for 14 days and administration of 200 UI PMSG at sponge removal. Twelve and 24 h before insemination, semen from adult Merino rams was collected, and after the ejaculates were diluted and chilled. Semen was diluted with the Ovipro extender (Minitüb®, Alemania) using a dilution rate of 1:2 (semen/extender). Control group was inseminated with fresh semen without diluent and an insemination dose of 100 millions spermatozoa. For every group, cervical TAI was performed 54-56 hours after progestational treatment. Preserved semen during 12 hours obtained 25% and 38% pregnancy with an insemination dose of 150 and 300 millions spermatozoa. Semen preserved for 24 hours caused 3% and 19% pregnancy with an insemination dose of 150 and 300 millions spermatozoa respectively. Control group showed a pregnancy of 59%, which evidenced that flock fertility was not affected by nutritional status or management. TAI with ram chilled semen during 12 h, with an insemination dose of 300 millions spermatozoa, was found to provide an acceptable fertility (38%), considering the benefit of carryng semen for long distances and the low operative cost for its implementation.

  7. Demonstration of organ-characteristic glycoproteins in human semen.

    Science.gov (United States)

    Uhlenbruck, G; Herrmann, W P; Steinhausen, G

    1977-01-01

    Tridacnin M, a galactosyl-specific reagent prepared from the bivalve clam Tridacna maxima (Röding) was used for the demonstration of 2 different glycosubstances with terminal galactosido units in human semen. The results obtained by immunodiffusion tests indicate that the seminal plasma contains a water-soluble glycoprotein with two carbohydrate chains, one of them having a terminal beta-galatosyl group whereas the other one seems to have a terminal N-acetyl-neuraminic acid group and a subterminal beta-galactosyl group. This glycoprotein is a secretion product of the seminal vesicles and, therefore, of diagnostic significance: it is absent in cases of bilateral occlusion of the ampullae. Another glycosubstance with terminal galactosido-residues could be demonstrated on the surface of sperm cells by agglutination reactions. This glycosubstance is an integral part of the spermatozoan membrane because it cannot be removed by repeated washings. PMID:407814

  8. Semen quality in Peruvian pesticide applicators: association between urinary organophosphate metabolites and semen parameters

    OpenAIRE

    Gasco Manuel; Yucra Sandra; Rubio Julio; Gonzales Gustavo F

    2008-01-01

    Abstract Background Organophosphates are broad class of chemicals widely used as pesticides throughout the world. We performed a cross-sectional study of associations between dialkylphosphate metabolites of organophosphates and semen quality among pesticide applicators in Majes (Arequipa), Peru. Methods Thirty-one men exposed to organophosphate (OP) pesticides and 31 non-exposed were recruited (age, 20–60 years). In exposed subjects, semen and a blood sample were obtained one day after the la...

  9. Correlation of phthalate exposures with semen quality

    International Nuclear Information System (INIS)

    Phthalates are widely used man-made chemical released in the environment and human exposure is mainly through diet. As the phthalate plasticizers are not covalently bound to PVC, they can leach, migrate or evaporate into the environment and as a result have become ubiquitously contaminants. The present study investigates the correlation, if any, between the phthalate esters (DEP, DEHP, DBP, DMP, DOP) and sperm mitochondrial status, ROS, LPO, SCSA, and sperm quality. The study was conducted in the urban/rural population of Lucknow visiting Obstetrics and Gynecology Department, CSMMU, Lucknow. Semen analysis was performed according to the WHO guidelines while phthalate analysis by HPLC and LPO by spectrophotometer and the sperm mitochondrial status, ROS, SCSA using flow cytometry. The questionnaire data showed no significant difference in the demographic characteristics among the groups. In general, urban population was found to have statistically significant higher levels of phthalate esters than the rural. Further, infertile men showed statistically significant (p < 0.05) higher levels of pollutants in the semen than fertile men. A negative correlation between semen phthalate level viz DEHP and sperm quality and positive association with depolarized mitochondria, elevation in ROS production and LPO, DNA fragmentation was established. The findings are suggestive that phthalates might be one among the contributing factors associated with the deterioration in semen quality and these adverse effects might be ROS, LPO and mitochondrial dysfunction mediated

  10. Effects of herbal preparation on libido and semen quality in boars.

    Science.gov (United States)

    Frydrychová, S; Opletal, L; Macáková, K; Lustyková, A; Rozkot, M; Lipenský, J

    2011-08-01

    The objective of this study was to investigate the effects of a preparation from herbal extracts (PHE) on libido and semen quality in breeding artificial insemination boars. Ten fertile boars were divided into control and experimental groups according to significant difference of libido. There were no differences in semen quality between groups. Animals were fed a commercial feeding mixture for boars. The feeding mixture for the experimental group was enriched with PHE, which was prepared from Eurycoma longifolia, Tribulus terrestris and Leuzea carthamoides. Duration of the experiment was 10 weeks. Samples of ejaculate were collected weekly. Libido was evaluated according to a scale of 0-5 points. Semen volume, sperm motility, percentage of viable spermatozoa, sperm concentration, morphologically abnormal spermatozoa, daily sperm production and sperm survival were assessed. Amounts of mineral components and free amino acids were analysed in seminal plasma. Significant differences were found in these parameters: libido (4.05 ± 0.22 vs 3.48 ± 0.78; p < 0.001), semen volume (331.75 ± 61.91 vs 263.13 ± 87.17 g; p < 0.001), sperm concentration (386.25 ± 107.95 vs 487.25 ± 165.50 × 10(3) /mm(3); p < 0.01), morphologically abnormal spermatozoa (15.94 ± 11.08 vs 20.88 ± 9.19%; p < 0.001) and Mg concentration (28.36 ± 11.59 vs 20.27 ± 13.93 mm; p < 0.05). The experimental group's libido was increased by 20% in comparison with the beginning of the experiment. Results of this study showed positive effect of PHE on libido and some parameters of boar semen quality. PMID:21092065

  11. Role of various sugars in improving frozen semen quality of Garut ram

    Directory of Open Access Journals (Sweden)

    Muhammad Rizal

    2012-02-01

    Full Text Available Ram spermatozoa are sensitive to extreme changes in temperature during the freeze-thawed process. The present study was conducted to examine the effects of addition of various sugars in Tris extender on sperm cryosurvival of Garut ram. Semen was collected using an artificial vagina from three mature rams once a week. Immediately after initial evaluation, semen was divided into five parts and diluted with Tris extender (control, Tris extender + 0.4% dextrose, Tris extender + 0.4% raffinose, Tris extender + 0.4% trehalose, and Tris extender + 0.4% sucrose, respectively. Semen was loaded in to 0.25 ml mini straw with the concentration of 200 million or 800 million motile spermatozoa per ml. Semen was equilibrated at 5oC for three hours, then frozen and stored in liquid nitrogen for seven days. Quality of processed-semen including percentages of motile spermatozoa (MS, live spermatozoa (LS, intact acrosome cap (IAC, and intact plasma membrane (IPM were evaluated after dilution, equilibration, and thawing, respectively. Data were analyzed using completely randomized design with five treatments and six replicates. Means were compared significant difference test at 0.05 significant level. Results of this research showed that there was no significantly difference (P>0.05 between treatments for all sperm quality parameters after dilution and equilibration. Mean percentages of post thawing MS, LS, IAC, and IPM for dextrose (54.00; 68.00; 66.60, and 57.83%, raffinose (50.00; 64.33; 61.80, and 61.75%, trehalose (50.83; 65.67; 61.40 and 57.75%, and sucrose (49.00; 66.80; 58.50 and 58.50% were significantly (P<0.05 higher than control (40.83; 52.67; 54.60, and 49.40% respectively. In conclusion, addition of 0.4% dextrose, raffinose, trehalose or sucrose in Tris extender are effective in improving frozen semen quality of Garut ram. Key Words: Sugars, Tris extender, Frozen Semen Quality, Garut Ram

  12. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen / Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen

    Scientific Electronic Library Online (English)

    G.V., Aguiar; M.F., van Tilburg; A.G.V., Catunda; C.K.S., Celes; I.C.S., Lima; A.C.N., Campos; A.A.A., Moura; A.A., Araújo.

    2013-02-01

    Full Text Available Verificou-se as características seminais de caprinos durante a época seca e a chuvosa no Nordeste brasileiro e a influência da época no resfriamento do sêmen. Foram mensurados volume, concentração espermática, porcentagem de espermatozoides móveis, vigor, morfologia espermática e características bio [...] químicas (frutose, ácido cítrico, fósforo, magnésio, proteínas totais e atividade da fosfolipase A2). Observou-se redução (P Abstract in english The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile ( [...] fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity) were analyzed. It was observed a reduction (P

  13. Communication requested: Boar semen transport through the uterus and possible consequences for insemination.

    Science.gov (United States)

    Rath, D; Knorr, C; Taylor, U

    2016-01-01

    Recent insemination techniques bypass the interactions between sperm and the uterine wall because the semen is deposited deep into the tip of uterine horn or directly into the oviduct. Such techniques allow high dilution of the ejaculates. After normal mating, semen entering the uterus communicates with the uterine milieu. Intact sperm of high mitochondrial membrane potential bind to uterine epithelial cells, whereas most of the unbound sperm in the uterine lumen have damaged membranes. Lectins are the most likely factors to mediate these sperm-uterine interactions. The lectin wheat germ agglutinin is known to induce the strongest binding of sperm, whereas binding is impaired when sialic acid receptors are blocked by wheat germ agglutinin. This suggests that sialic acid is involved in porcine sperm-endometrium interactions, and it is hypothesized that the use of a semen extender supplemented with sialidase would allow insemination with reduced sperm numbers. A lack of contact of sperm and seminal plasma with the uterine wall, as a result of deep insemination, may adversely affect (1) events during ovulation, (2) induction of immunologic tolerance against paternal antigens, (3) preparation of the endometrium for implantation and placentation, and (4) immunologic support required for the fetus during pregnancy. Seminal plasma is known to signal post-insemination changes in the uterine endometrium involving the redistribution of leukocytes. This may involve migration of leukocytes from the uterine wall to the ovary, as seminal plasma particularly increases the appearance of the major histocompatibility complex class II-positive cells. Uterine epithelial cells respond to sperm binding by the production of pro- or anti-inflammatory cytokines. These cytokines may include synchronizing substances, transferred through a counter-current pathway to the ipsilateral ovary, thereby accelerating the final maturation of preovulatory follicles and advancing time of ovulation. In several species, an ovulation-inducing factor exists in seminal plasma, first identified as ß-nerve growth factor in camelid semen, indicating another pathway that influences the hypothalamic-pituitary-gonadal axis. In summary, low-dose inseminations may not necessarily require semen deposition deep into the uterine horn, as binding inhibitors can circumvent the binding of sperm to the uterine wall. However, subsequent immune-relevant events that control ovulation and prepare the uterine milieu for the developing embryo should be taken into account. PMID:26462662

  14. Microbiology of semen specimens from males attending a fertility clinic

    DEFF Research Database (Denmark)

    Kjærgaard, Niels; Kristensen, B; Hansen, Estrid Stæhr; Farholt, S; Schønheyder, H C; Madsen, Hans; Uldbjerg, N

    1997-01-01

    The relationship between semen quality, pyospermia and bacteriology was studied in 201 semen specimens from male patients attending a fertility clinic. Semen quality parameters were within normal limits in 115 (57%) patients, slightly reduced in 60 (30%), and 26 (13%) had findings indicating reduced fertility. Twelve patients (6%) had pyospermia. In 182 patients, 552 microorganisms were detected, including Enterobacteriaceae (2.8%), Gardnerella vaginalis (9.6%), Chlamydia trachomatis (1.6%), Myc...

  15. Métodos de colección de semen en camélidos sudamericanos

    Directory of Open Access Journals (Sweden)

    Pacheco Curie, Joel Iván

    2008-05-01

    Full Text Available La colección de semen depende de una buena y constante producciónespermática para que la calidad del semen sea buena. Las técnicas decolección de semen están bastante desarrolladas en otros animales,especialmente en rumiantes domésticos en los cuales ya es unprocedimiento de rutina, pero en camélidos, dadas las especialescaracterísticas reproductivas, anatómicas y fisiológicas de estas especies, esta colección es bastante dificultosa y no existe un protocolo recomendado y una técnica optima, así como su manejo posterior.

  16. Semen quality of Italian local pig breeds

    Directory of Open Access Journals (Sweden)

    G. Gandini

    2010-01-01

    Full Text Available From 1996 to 1999 a conservation programme was carried out within the framework of EC contract “European gene banking project for the pig genetic resources” (Ollivier et al., 2001 in the Italian local pig breeds. The aims of the program included the primary characterization of the breeds, i.e. information on the organization in charge of the breed, breeding population numbers, breed description and qualifications, and field trials on productive and reproductive performances. In this context the “Semen Bank of Italian local pig breeds” was built. A total of 30,835 straws of four Italian local pig breeds (Cinta Senese, Casertana, Mora Romagnola and Nero Siciliano, collected from 42 sires, have been stored. In this work semen quality traits, lipid composition and freezability of the four Italian local pig breeds are reported.

  17. Environmental exposure to arsenic may reduce human semen quality: associations derived from a Chinese cross-sectional study

    Directory of Open Access Journals (Sweden)

    Xu Weipan

    2012-07-01

    Full Text Available Abstract Background Recent observations in in vitro and in vivo models suggest that arsenic (As is an endocrine disruptor at environmentally-relevant levels. When exposed to As, male rats and mice show steroidogenic dysfunction that can lead to infertility. However, the possible effects of As on human male semen quality remain obscure. Methods We monitored the profile of As species in the urine of a reproductive-age human cohort and assessed its association with semen quality. Men (n?=?96 were recruited in an infertility clinic from July 2009 to August 2010 in the Affiliated Hospital of Chongqing Institute for Population and Family Planning. Five urinary As species were analyzed by high-performance liquid chromatography coupled with inductively coupled plasma mass spectrometry (HPLC-ICP-MS. Clinical information on the semen volume, sperm concentration and motility was employed to catalogue and evaluate semen quality according to WHO guidelines. As species concentrations in addition to other continuous variables were dichotomized by the medians and modelled as categorical variables in order to explore using the binary logistic regression possible associations between As exposure and semen quality. Results Urinary concentrations (geometric mean ± SD, ?g g-1 creatinine of different As species were 7.49 (±24.8 for AsB, 20.9 (±13.7 for DMA, 2.77 (±3.33 for MMA, and 4.03 (±3.67 for Asi (AsiIII and AsiV. DMA concentrations above the median were significantly associated with below-reference sperm concentrations (P =0.02 after adjusting for age, body mass index (BMI, abstinence, smoking and drinking habits. In addition, smoking was positively associated with MMA. Conclusion Reduced parameters in human semen quality are positively associated with As exposure in a reproductive-age Chinese cohort.

  18. Evaluation of semen parameters in semen donors in a ten-year period in the city of São Paulo

    OpenAIRE

    Sidney Glina; Thiago Nova; Vera Beatriz Fehér Brand; Erica Molina; Andrea Giannotti Galuppo; Nadeje Regina Correa; Frederico Rafael Moreira

    2010-01-01

    Objective: To evaluate sperm concentration, morphology and motility of Brazilian semen donors from 1992 to 2003, in the city of São Paulo. Methods: Retrospective study analyzing 182 donor semen samples from 1992 to 2003. The first and the second donated sample were analyzed for each donor. Donor average age was 30.8 years. Means with standard errors, medians with minimum and maximum values, and interquartile ranges were calculated for age, sperm concentration, semen volume, oval morphology an...

  19. Métodos de coleccion de semen en camélidos sudamericanos - Methods of semen collection in south american camelids

    Directory of Open Access Journals (Sweden)

    Pacheco Curie, Joel Iván;

    2008-04-01

    Full Text Available ResumenLa colección de semen depende de una buena y constante producciónespermática para que la calidad del semen sea buena. Las técnicas decolección de semen están bastante desarrolladas en otros animales,especialmente en rumiantes domésticos en los cuales ya es unprocedimiento de rutina, pero en camélidos, dadas las especialescaracterísticas reproductivas, anatómicas y fisiológicas de estasespecies, esta colección es bastante dificultosa y no existe un protocolo recomendado y una técnica optima, así como su manejo posterior. Las características seminales son también muy variables y dependen de la forma de colección y existen varios factores que afectan su calidad, así como frecuencia de colección, edad, época, etc., por lo que también se evaluaron y desarrollaron diferentes técnicas de degelificar, diluir, conservar y congelar estas células espermáticas, de acuerdo a la técnica de colección y la especie, así como la utilización de dilutores y crioprotectores utilizados para otras especies, pudiéndose posteriormente utilizar en la evaluación reproductiva de los machos.SummaryThe collection of semen depends on a good and constant spermaticproduction so that the quality of the semen is good. The techniques ofcollection of semen enough developed in other animals are, especially in ruminant domestic in which is already a routine procedure, but incamélids, given the special ones characteristic reproductive, anatomical and physiologic of these species, this collection is quite difficult and it doesn't exist a recommended protocol and a good technique, as well as its later handling. The seminal characteristics are also very variable and they depend in the collection way and several factors that affect their quality, exist as well as collection frequency, age, time, etc, for what too were also evaluated and they developed different techniques of degelification, to dilute, to conserve and to freeze these spermatic cells,according to the collection technique and the species, as well as theextenders use and crioprotectors used for other species, being able tolater on to use in the reproductive evaluation of the males.

  20. Porcine semen as a vector for transmission of viral pathogens.

    Science.gov (United States)

    Maes, Dominiek; Van Soom, Ann; Appeltant, Ruth; Arsenakis, Ioannis; Nauwynck, Hans

    2016-01-01

    Different viruses have been detected in porcine semen. Some of them are on the list of the World Organization for Animal Health (OIE), and consequently, these pathogens are of socioeconomic and/or public health importance and are of major importance in the international trade of animals and animal products. Artificial insemination (AI) is one of the most commonly used assisted reproductive technologies in pig production worldwide. This extensive use has enabled pig producers to benefit from superior genetics at a lower cost compared to natural breeding. However, the broad distribution of processed semen doses for field AI has increased the risk of widespread transmission of swine viral pathogens. Contamination of semen can be due to infections of the boar or can occur during semen collection, processing, and storage. It can result in reduced semen quality, embryonic mortality, endometritis, and systemic infection and/or disease in the recipient female. The presence of viral pathogens in semen can be assessed by demonstration of viable virus, nucleic acid of virus, or indirectly by measuring serum antibodies in the boar. The best way to prevent disease transmission via the semen is to assure that the boars in AI centers are free from the disease, to enforce very strict biosecurity protocols, and to perform routine health monitoring of boars. Prevention of viral semen contamination should be the primary focus because it is easier to prevent contamination than to eliminate viruses once present in semen. Nevertheless, research and development of novel semen processing treatments such as single-layer centrifugation is ongoing and may allow in the future to decontaminate semen. PMID:26506911

  1. Criopreservação de sêmen suíno: avanços tecnológicos e perspectivas / Cryopreservation of boar semen: progress and perspectives / Criopreservación de semen de verraco: avances y perspectivas tecnológicas

    Scientific Electronic Library Online (English)

    Tainã, Figueiredo Cardoso; Estela, Fernandes e Silva; Carine, Dahl Corcini.

    2013-07-01

    Full Text Available Resumo A criopreservação de sêmen suíno é uma técnica ainda não consolidada devido à alta sensibilidade do espermatozoide da espécie ao processo de congelamento e descongelamento. Ainda assim, a utilização do sêmen criopreservado é altamente desejável para o intercâmbio genético e manutenção da bios [...] segurança. Esta revisão tem como objetivo ressaltar alguns fatores limitantes do processo e apontar os consideráveis avanços desenvolvidos nos últimos anos, principalmente devido ao aperfeiçoamento das técnicas já existentes, como caracterização das proteínas do ejaculado, ajustes na remoção do plasma seminal e uso de adjuvantes na confecção dos diluentes. Todas estas técnicas tornarão a criopreservação do sêmen suíno mais aplicável nos próximos anos para que possa ser finalmente uma técnica de uso comercial. Abstract in spanish Resumen La criopreservación del semen de porcino es una técnica aún no consolidada debido a la alta sensibilidad del espermatozoide de esta especie al proceso de congelación y descongelación, aun así, el uso de semen criopreservado es altamente deseable para el intercambio genético y el mantenimient [...] o de la bioseguridad. Esta revisión tiene por objeto poner de relieve algunos factores limitantes del proceso y señalar las importantes avances desarrollados en los últimos años, debido principalmente al mejoramiento de las técnicas existentes, entre ellas, la caracterización de las proteínas de la eyaculación, los ajustes de extracción del plasma seminal y el uso de adyuvantes en la producción de los diluyentes. Todas estas técnicas harán que la criopreservación del semen de porcino sea más aplicable en los próximos años, para ser finalmente una técnica de uso comercial. Abstract in english Abstract Biotechnology of boar semen cryopreservation has not succeeded due to the high sensitivity of swine sperm to the freezing and thawing process. However, its use is highly desirable for genetic improvement and maintenance of biosecurity. This review aims to highlight some limitations of the p [...] rocess and point out important advances obtained in recent years, including the improvement of existing techniques, such as protein characterization of the ejaculate, adjustments in the removal of seminal plasma, and use of adjuvants in the manufacture of diluents; all of which will make cryopreservation commercially available in the near future.

  2. Thermal manipulation during embryogenesis improves certain semen parameters in layer breeder chicken during hot climatic conditions.

    Science.gov (United States)

    Shanmugam, M; Vinoth, A; Rajaravindra, K S; Rajkumar, U

    2015-10-01

    Thermal manipulation during incubation has been shown to improve post hatch performance in poultry. The aim of the present experiment was to evaluate thermal manipulation on semen quality of roosters during hot climatic conditions. Eggs obtained after artificial insemination from Dahlem Red layer breeders were randomly divided into two groups control (C) and heat exposed (HE). C group eggs were incubated at 37.5°C throughout the incubation period while the HE group eggs were exposed to higher temperature 40.5°C from 15th to 17th day of incubation for 3h each day. The relative humidity was maintained at 65% in both the groups throughout incubation. The chicks hatched were reared separately under standard husbandry conditions. During high ambient temperature semen from roosters (45 weeks of age) was collected and evaluated for different gross parameters, sperm chromatin integrity and sperm HSP27 and HSP70 gene expression by real-time PCR. The seminal plasma was evaluated for lipid peroxidation, ferric ion reducing antioxidant power (FRAP), triiodothyronine (T3) and matrix metalloproteinase-2 (MMP-2) activity. The shed average Temperature Humidity Index (THI) during the experiment period was 78.55. The percent live sperm and FRAP level were significantly (Pthermal manipulation during incubation improves certain semen parameters of roosters at high ambient temperature. PMID:26386679

  3. Model Perencanaan Pengangkutan dan Distribusi Semen di Wilayah Indonesia Timur

    Directory of Open Access Journals (Sweden)

    Windra Iswidodo

    2013-03-01

    Full Text Available Pertumbuhan ekonomi dan pembangunan di wilayah Indonesia timur dalam 5 tahun terakhir mengalami peningkatan yang cukup signifikan. Perkembangan infrastruktur di wilayah Indonesia timur merukapak salah satu faktor yang menyebabkan meningkatnya permintaan semen. Akan tetapi peningkatan permintaan semen ini tidak didukung oleh pola distribusi yang baik. Oleh karena itu, diperlukannya suatu solusi untuk memenuhi permintaan semen di wilayah Indonesia timur, salah satunya adalah dengan merencanakan pengangkutan dan distribusi semen dengan jaringan transportasi yang sesuai dengan karekteristik di wilayah Indonesia timur. Tugas akhir ini bertujuan untuk merencanakan rute distribusi semen di wilayah Indonesia timur untuk menghasilkan biaya transportasi yang minimum. Perbandingan antara konsep direct port dengan konsep multiport diharpakan dapat menentukan pola jaringan distribusi semen menuju wilayah Indonesia timur dengan biaya transportasi yang minimum diantara kedua konsep tersebut. Dari hasil pengembangan skenario terdapat titik tujuan yang belum terpenuhi, sehingga rute antisipasi untuk memenuhi permintaan semen pada titik tujuan dengan pola operasi kapal charter. Hasil perhitungan menunjukkan bahwa seluruh titik tujuan distribusi dapat terpenuhi oleh kapal perintis cargo passanger dan kapal charter . Konsep multiport lebih murah dibandingkan direct port, dengan selisih biaya transportasi sebesar  33% untuk contoh rute Ambon-Amahai-Geser-Banda. Sehingga konsep multiport lebih baik diterapakan untuk distribusi semen di wilayah Indonesia timur.

  4. 9 CFR 98.34 - Import permits for poultry semen and animal semen.

    Science.gov (United States)

    2010-01-01

    ... imported; the purpose of the importation; individual animal identification (except poultry) which includes... accompanied by a statement by such veterinarian showing the identification of the donor animal and the dates... ejaculate of semen collected shall be submitted to FADDL for pathogen isolation tests for FMD,...

  5. AZF Microdeletions in Human Semen Infected with Bacteria

    Directory of Open Access Journals (Sweden)

    Hayfa H Hassani

    2011-11-01

    Full Text Available Bacterial infections are associated with infertility in men. This study was aimed to investigate microdeletions on Yq chromosome in semen infected with bacteria by using bacteriological, biochemical, and serological assays. The investigation showed that 107 of 300 (84.80% semen samples collected from infertile men with primary or secondary infertility were infected with different species of bacteria. Chlamydia trachomatis and Neisseria gonorrheae were the most frequently diagnosed bacteria in the infected semen samples. The percentages of infections of semen samples with C. trachomatis and N. gonorrhea were 42.31% and 35.28% respectively. Genomic DNA from each semen sample infected with predominant bacteria was analyzed for AZF deletions by using multiplex PCR. Different patterns of AZF microdeletions were obtained. It can be concluded that sexually transmitted bacteria may contribute in microdeletions of Yq chromosome by indirectly producing reactive oxygen species and causing gene defect in AZF regions.

  6. Hormonal induction and semen characteristics of tambaqui Colossoma macropomum.

    Science.gov (United States)

    Maria, Alexandre Nizio; Azevedo, Hymerson Costa; Santos, Jadson Pinheiro; Carneiro, Paulo César Falanghe

    2012-02-01

    In the hatchery-bred tambaqui Colossoma macropomum, spontaneous semen release does not occur, and hand-stripping produces reduced semen volume. The goal of this work is to evaluate the effects of hormonal induction with carp pituitary extract (CPE) on both qualitative (visual aspect, pH, motility, viability and morphological abnormalities) and quantitative (volume, concentration and number of spermatozoa per ejaculate) traits of tambaqui semen. Eleven males were treated with CPE (induced), and 11 were left untreated as a control (non-induced). All analysed parameters except motility and percentage of viable spermatozoa presented significant differences (p tambaqui males with CPE is efficient and positively influences some qualitative and quantitative properties of semen. Additionally, semen collection via gentle abdominal massage occurs more readily in CPE-induced fish. PMID:21208496

  7. Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities.

    Science.gov (United States)

    Liu, Te; Cheng, Weiwei; Gao, Yongtao; Wang, Hui; Liu, Zhixue

    2012-09-01

    MicroRNAs (miRNAs) play a crucial role in tissue development and the pathology of many diseases, however, the effects and roles of miRNAs in the development of semen abnormalities in infertile males have not yet been investigated. In this study, we analyzed and compared the miRNA expression profiles of abnormal semen from 86 infertile males with normal semen from 86 healthy males using an miRNA microarray. In total, 52 miRNAs were differentially expressed between the abnormal semen of infertile males and the normal semen of healthy males. The differential expression of selected miRNAs was validated by real time qRT-PCR and northern blotting: miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b were upregulated (fold change>1.5, p<0.001) and miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a were downregulated (fold change<0.667, p<0.001) in the semen of infertile males with semen abnormalities. In conclusion, this study provides new insights into specific miRNAs that are associated with semen abnormalities in infertile males. PMID:22735917

  8. Clinical relevance of routine semen analysis and controversies surrounding the 2010 World Health Organization criteria for semen examination

    Scientific Electronic Library Online (English)

    Sandro C., Esteves.

    2014-08-01

    Full Text Available Semen analysis is the corner stone of infertility evaluation as it provides information on the functional status of the seminiferous tubules, epididymis and accessory sex glands. The methods on how the human semen should be evaluated are provided by the World Health Organization, which periodically [...] releases manuals that include specific protocols and reference standards. In 2010, the WHO published new criteria for human semen characteristics that were markedly lower than those previously reported. In this review initially it is discussed the limitations of semen analysis as a surrogate measure of a man’s ability to father a pregnancy. Secondly, it is analyzed methodology issues that could explain why the newly released reference values were different from those earlier reported. Thirdly, it is speculated on the likely effects of the 2010 WHO criteria in the management of male infertility. Due to the several inherent limitations of semen analysis as a surrogate marker of male infertility, physicians should exercise caution when interpreting results. A template for semen analysis reports that incorporates the distribution of the semen characteristics of recent fathers in centiles rather than solely the minimum thresholds could aid clinicians to better understand how a given patient results compare with the reference population. Importantly, a male infertility evaluation must go far beyond a simple semen analysis, as it has to be complemented with a proper physical examination, a comprehensive history taking, and relevant endocrine, genetic, and other investigations.

  9. Effect of psychological stress on the L-arginine-nitric oxide pathway and semen quality

    Directory of Open Access Journals (Sweden)

    S. Eskiocak

    2006-05-01

    Full Text Available It has been reported that mental stress causes abnormality of spermiogram parameters. We investigated the effect of psychological stress on the L-arginine-nitric oxide (NO pathway. Semen samples were collected from 29 healthy fourth semester medical students just before (stress and 3 months after (non-stress the final examinations. Psychological stress was measured by the State Anxiety Inventory questionnaire. After standard semen analysis, arginase activity and NO concentration were measured spectrophotometrically in the seminal plasma. Measurements were made in duplicate. During the stress period, sperm concentration (41.28 ± 3.70 vs 77.62 ± 7.13 x 10(6/mL, rapid progressive motility of spermatozoa (8.79 ± 1.66 vs 20.86 ± 1.63% and seminal plasma arginase activity (0.12 ± 0.01 vs 0.22 ± 0.01 U/mL were significantly lower than in the non-stress situation, whereas seminal plasma NO (17.28 ± 0.56 vs 10.02 ± 0.49 µmol/L was higher compared to the non-stress period (P < 0.001 for all. During stress there was a negative correlation between NO concentration and sperm concentration, the percentage of rapid progressive motility and arginase activity (r = -0.622, P < 0.01; r = -0.425, P < 0.05 and r = -0.445, P < 0.05, respectively. These results indicate that psychological stress causes an increase of NO level and a decrease of arginase activity in the L-arginine-NO pathway. Furthermore, poor sperm quality may be due to excessive production of NO under psychological stress. In the light of these results, we suggest that the arginine-NO pathway, together with arginase and NO synthase, are involved in semen quality under stress conditions.

  10. Semen A Altshuler: scientist, mentor, teacher

    Science.gov (United States)

    Kochelaev, Boris I.

    2011-10-01

    International Conference `Resonances in Condensed Matter' is devoted to 100 years of the birthday of the Corresponding member of Academy of Sciences of the USSR, Professor of the Kazan University Semen Alexandrovich Altshuler (1911-1983). He is well known by pioneer works on EPR, the prediction and grounds for an existence of the neutron magnetic moment, the prediction and the theory of the acoustic paramagnetic resonance, and as a founder of the Kazan scientific school `Magnetic radiospectroscopy of condensed matter' (with E K Zavoiskii and B M Kozyrev)

  11. Semen A Altshuler: scientist, mentor, teacher

    International Nuclear Information System (INIS)

    International Conference 'Resonances in Condensed Matter' is devoted to 100 years of the birthday of the Corresponding member of Academy of Sciences of the USSR, Professor of the Kazan University Semen Alexandrovich Altshuler (1911–1983). He is well known by pioneer works on EPR, the prediction and grounds for an existence of the neutron magnetic moment, the prediction and the theory of the acoustic paramagnetic resonance, and as a founder of the Kazan scientific school 'Magnetic radiospectroscopy of condensed matter' (with E K Zavoiskii and B M Kozyrev)

  12. The effect of semen collection method and level of egg yolk on capability of dilution and storage of buck semen

    Directory of Open Access Journals (Sweden)

    N.N. Dhaher

    2013-12-01

    Full Text Available The study was conducted to evaluate the effect of semen collection method for reduction of the deleterious interaction between the enzymes of bulbourethral gland and egg yolk during the dilution and storage of buck semen by three different level of egg yolk. Ten bucks were used in this study; the bucks were divided into two groups (five bucks in each group. Semen samples were collected once a week for four weeks from the bucks in first group using an artificial vagina, and from the animals in second group using an electroejaculator. The collected semen samples were diluted with sodium citrate extender with three different level of egg yolk (5, 10 and 20%. Extend semen samples were stored at 5 °C for three days. Computer assisted sperm analysis and Sperm Class Analyzer® were used for evaluation of the buck semen samples. Sperm motility parameters were evaluated which includes; percentage of motile sperm, percentage of progressive motile sperm, the value of the linear velocity (VSL, the value of the average velocity (VAP, the value of the curvilinear velocity (VCL, and the amplitude of lateral movement of the head (ALH. Results showed that all sperm motility parameters under the different level of egg yolk in semen samples that collected by artificial vagina were significantly higher than those which collected by electroejaculator. The percentage of motile sperm and progressive motile sperm of samples that collected by artificial vagina were higher at 10% of egg yolk, while these motility parameters were higher at 5% of egg yolk for semen samples that collected by electroejaculator. The differences between the two methods of semen collection in VCL and ALH were clear and the values were higher in samples that collected using the artificial vagina. The values of VSL, VAP and VCL of semen samples that collected by artificial vagina were higher at the second day than first day of semen storage under 10% of egg yolk. In conclusion, there are effects of the semen collection method on ability of dilution and storage of buck semen, and using of artificial vagina and 10% of egg yolk is recommended for buck semen dilution and storage.

  13. Influences of a diet supplemented with linseed oil and antioxidants on quality of equine semen after cooling and cryopreservation during winter.

    Science.gov (United States)

    Schmid-Lausigk, Yvonne; Aurich, Christine

    2014-04-15

    Seasonal changes in the reproductive physiology of stallions contribute to a decrease in the quality of frozen-thawed semen during late winter. Changes in the lipid composition of the sperm plasma membrane may contribute to this phenomenon. In the present study, we have, therefore, investigated the effects of adding linseed oil (LO) in combination with antioxidants to the diet of breeding stallions on the motility and membrane integrity of cooled-stored and cryopreserved semen. Starting in November, the diet of LO stallions (n = 6) but not control (C) stallions (n = 5) was supplemented with LO (100 mL once daily) plus an antioxidant (Myostem Protect; Audevard, Clichy, France) for a total of 84 days. Before (November) and at the end of this period (February), ejaculates were processed for cryopreservation (n = 3 ejaculates per stallion) and cooled shipping at 5 °C. Frozen-thawed and cooled-shipped semen was sent to the laboratory for computer-assisted semen analysis of total motility, progressive motility, and velocity parameters (average path velocity [VAP], curved line velocity [VCL], and straight-line velocity [VSL]) and evaluation of membrane integrity. The quality of frozen-thawed semen decreased (P 0.05). A decrease in the velocity parameters VAP, VCL, and VSL was more pronounced in LO stallions than in C stallions (e.g., VSL: November LO 67 ± 1 ?m/s, C 64 ± 2 ?m/s; February LO 59 ± 2 ?m/s, C 63 ± 2 ?m/s; interaction month by treatment, P cooled-stored semen, total motility, progressive motility, and membrane integrity were lower in February than in November (P cooled storage = 24 hours after semen collection: total motility in November LO 88 ± 1% and C 87 ± 3%; in February LO 83 ± 2% and C 73 ± 11%; interaction month by treatment: P cooled-stored stallion semen during winter. This may improve the fertility of cooled-shipped semen. In contrast, the treatment did not counteract the decrease in quality of frozen-thawed semen that occurs in late winter. PMID:24576708

  14. Use of factor scores for determining the relationship between body measurements and semen traits of cocks

    OpenAIRE

    Udeh Ifeanyichukwu

    2012-01-01

    Semen evaluation is required to predict fertility. In most rural African communities, facilities for microscopic evaluation of semen are not available. Therefore, an indirect method of predicting semen traits of cocks is required by poultry farmers. The objective of this study was to use factor scores derived from factor analysis of body measurements to predict some semen traits of cocks. Correlation matrix was obtained by calculating the correlations between body measurements and semen trait...

  15. Semen cryopreservation protocols of Mangalarga Marchador stallions

    Scientific Electronic Library Online (English)

    Marcela Leite, Candeias; Marco Antonio, Alvarenga; Márcio Teoro do, Carmo; Heder Nunes, Ferreira; Mônica Russo Souto, Maior; Rodolpho de Almeida, Torres Filho; André Luís Rios, Rodrigues; Felipe Zandonadi, Brandão.

    2012-09-01

    Full Text Available The effect of the utilization of three semen protocols (Inra 82®, Merck Gema and Botu-crio®) and two filling techniques (0.25 and 0.50 mL straws) in Mangalarga Marchador stallions were studied in this experiment. Sperm parameters were assessed during processing and post-freezing. No interactions bet [...] ween the protocols and type of filling were observed, so they were assessed separately. Sperm parameters were not altered when the extender was added to the centrifugation; however, there was reduction of motility and strength when freezing extenders were added. The Botu-crio® protocol preserved the parameters of total and progressive sperm motility, smoothed path velocity (µm/s), straight line velocity (µm/s), track velocity (µm/s) and the average and fast spermatozoa percentage better than the others. No difference between the extenders for the percentage of sperm integrity was observed. There was no difference in the responses studied on the filling techniques. The stallions presented better freezing with the use of the Botu-crio® protocol. The best post-freezing viability results were found for semen frozen using the Botu-crio® protocol and there were no differences concerning the sperm quality comparing 0.25 and 0.50 mL straws.

  16. Semen cryopreservation protocols of Mangalarga Marchador stallions

    Directory of Open Access Journals (Sweden)

    Marcela Leite Candeias

    2012-09-01

    Full Text Available The effect of the utilization of three semen protocols (Inra 82®, Merck Gema and Botu-crio® and two filling techniques (0.25 and 0.50 mL straws in Mangalarga Marchador stallions were studied in this experiment. Sperm parameters were assessed during processing and post-freezing. No interactions between the protocols and type of filling were observed, so they were assessed separately. Sperm parameters were not altered when the extender was added to the centrifugation; however, there was reduction of motility and strength when freezing extenders were added. The Botu-crio® protocol preserved the parameters of total and progressive sperm motility, smoothed path velocity (µm/s, straight line velocity (µm/s, track velocity (µm/s and the average and fast spermatozoa percentage better than the others. No difference between the extenders for the percentage of sperm integrity was observed. There was no difference in the responses studied on the filling techniques. The stallions presented better freezing with the use of the Botu-crio® protocol. The best post-freezing viability results were found for semen frozen using the Botu-crio® protocol and there were no differences concerning the sperm quality comparing 0.25 and 0.50 mL straws.

  17. Persistent organic pollutants and semen quality: The LIFE Study.

    Science.gov (United States)

    Mumford, Sunni L; Kim, Sungduk; Chen, Zhen; Gore-Langton, Robert E; Boyd Barr, Dana; Buck Louis, Germaine M

    2015-09-01

    Growing evidence suggests that persistent environmental chemicals such as polychlorinated biphenyls may adversely affect human fecundity. The purpose of this study was to evaluate associations between persistent environmental chemicals and semen quality among 501 male partners of couples discontinuing contraception for purposes of becoming pregnant. Men provided a blood specimen and two fresh semen samples collected approximately a month apart that underwent next day analysis for 35 semen quality endpoints. Serum samples were analyzed for 36 polychlorinated biphenyls (congeners #18, 28, 44, 49, 52, 66, 74, 87, 99, 101, 114, 118, 128, 138, 146, 149, 151, 153, 156, 157, 167, 170, 172, 177, 178, 180, 183, 187, 189, 194, 195, 196, 201, 206, 209); 1 polybrominated biphenyl (#153); 9 organochlorine pesticides; and 10 polybrominated diphenyl ethers (congeners #17, 28, 47, 66, 85, 99, 100, 153, 154183) using high resolution mass spectrometry. To estimate the effect of chemicals on semen quality, we regressed each semen marker on each chemical while adjusting for research site, age, body mass index, serum lipids, and cotinine levels. Males with chemical concentrations in the fourth quartile, as compared to the first quartile, showed significant associations for several individual chemicals in each chemical class and type of semen quality parameter indicating negative and positive associations with semen quality. Polybrominated diphenyl ethers in particular were associated with several measures of increased abnormal morphology. These exploratory results highlight the role of environmental influences on male fecundity, and are of particular interest given the ubiquitous exposures to these compounds. PMID:25441930

  18. Evaluation of sperm chromatin structure in boar semen

    Directory of Open Access Journals (Sweden)

    Banaszewska Dorota

    2015-06-01

    Full Text Available This study was an attempt to evaluate sperm chromatin structure in the semen of insemination boars. Preparations of semen were stained with acridine orange, aniline blue, and chromomycin A3. Abnormal protamination occurred more frequently in young individuals whose sexual development was not yet complete, but may also be an individual trait. This possibility is important to factor into the decision regarding further exploitation of insemination boars. Thus a precise assessment of abnormalities in the protamination process would seem to be expedient as a tool supplementing morphological and molecular evaluation of semen. Disruptions in nucleoprotein structure can be treated as indicators of the biological value of sperm cells.

  19. EFFECT OF TWO PROTOCOLS OF CRYOPRESERVATION ON FERTILIZING CAPACITY OF STALLION (Equus caballus SEMEN EFECTO DE DOS PROTOCOLOS DE CRIOPRESERVACIÓN SOBRE LA CAPACIDAD FECUNDANTE DE SEMEN EQUINO (Equus caballus

    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo Betancur

    2012-06-01

    Full Text Available Abstract. Semen cryopreservation is a fundamental process for the development of biotechnologies for assisted reproduction in horses. The use of cryopreservation techniques with changes in concentrations and the nature of the cryoprotectant, as well as, the different types of vials for storage of semen, have become an alternative to improve the protocols used. The objective of this work was to evaluate the effect of two protocols of cryopreservation (freezing and vitrification on the fertilizing capacity of stallion semen. The study was conducted with horses of the Criollo Colombiano breed. For freezing was used a extender supplemented with egg yolk (4% and dimethyl formamide (5%, and 0.5 mL straws as vials, whereas for vitrification, the extender was supplemented with egg yolk (8% and dimethyl formamide (8%, and cryovials were used as carriers. As post thaw parameters were evaluated: progressive motility, vitality, normal morphology and integrity of the plasma membrane through the hypoosmotic swelling test (HOS. For statistical evaluation was fitted a generalized linear model (GLM and means were compared by the Tukey test. Were found average percentages of progressive motility, vitality, normal morphology and HOS of 41.6 ± 11.8 and 37 ± 8.5, 54.3 ± 10.2 and 52.3 ± 7.8, 83.1 ± 5.4 and 83.6 ± 5.8, 41.7 ± 9.8 and 38.9 ± 3.6, for cryopreserved semen by freezing and vitrification, respectively. There were no statistically significant differences (P ? 0.05 between treatments for any of the parameters evaluated. The fertilizing capacity of equine semen cryopreserved by vitrification is comparable to that obtained by conventional freezing.Resumen. La criopreservación de semen es un proceso fundamental en el desarrollo de biotecnologías para la reproducción asistida en equinos. El uso de diferentes técnicas de criopreservación con cambios en las concentraciones y la naturaleza de los crioprotectores, así como en los diferentes tipos de soportes para el almacenamiento del semen, se ha constituido en una alternativa para mejorar los protocolos empleados. El objetivo de este trabajo fue evaluar el efecto de dos protocolos de criopreservación (congelación y vitrificación, sobre la capacidad fecundante del semen equino. El estudio se realizó con equinos de la raza Criollo Colombiano. Para la congelación se empleó un diluyente suplementado con de yema de huevo (4% y dimetilformamida (5%, y pajillas de 0,5 mL como soportes; mientras que para la vitrificación, el diluyente fue suplementado con yema de huevo (8% y dimetilformamida (8% y se usaron crioviales como soportes. Post-descongelación, se evaluaron los parámetros: movilidad progresiva, vitalidad, morfología normal e integridad de la membrana plasmática (HOS. Para la evaluación estadística se ajustó un modelo lineal generalizado (GLM y las medias se compararon por la prueba de Tukey. Se encontraron porcentajes promedio de movilidad progresiva, vitalidad, morfología normal y HOS de 41,6±11,8 y 37,0±8,5, 54,3±10,2 y 52,3±7,8, 83,1±5,4 y 83,6±5,8, 41,7±9,8 y 38,9±3,6, para el semen criopreservado por congelación y vitrificación, respectivamente. No se encontraron diferencias estadísticamente significativas (P ? 0,05 entre los tratamientos para ninguno de los parámetros evaluados. La capacidad fecundante del semen equino criopreservado por vitrificación es equiparable a la obtenida por congelación convencional.

  20. Ebola Persists for Extended Period in Survivors' Semen

    Science.gov (United States)

    ... nlm.nih.gov/medlineplus/news/fullstory_155146.html Ebola Persists for Extended Period in Survivors' Semen: Study ... 2015 WEDNESDAY, Oct. 14, 2015 (HealthDay News) -- The Ebola virus is capable of hiding out in the ...

  1. Relación entre calidad del semen y la edad / Relationship between quality of semen and age

    Scientific Electronic Library Online (English)

    John, Chávez; José, Yarlequé; Elmer, Avalos; Ruth, Barrientos-Marka; MarcoAntonio, García.

    2012-07-01

    Full Text Available Objetivo: Determinar la relación entre la calidad del semen humano y la edad. Material y Métodos: El espermatograma se realizó siguiendo el Manual de Laboratorio de la OMS para el examen del Semen Humano y de la Interacción Moco Cervical y Semen (1999), de los exámenes realizados entre julio 2003 a [...] diciembre 2008. Se estudiaron 2 441 casos de varones que cumplen con los criterios de inclusión. Resultados: La motilidad A+B fue de 51,55% para varones de 20 a 29 años; los espermatozoides normales fue de 77,73% para varones mayores de 50 años; el recuento espermático (mill/ml) fue de 61,09 para varones mayores de 50 años.La evaluación de la motilidad espermática tuvo como coeficiente de correlación lineal múltiple de 0,222 y coeficiente de determinación de 0,049; en la morfología espermática, coeficiente de correlación lineal de 0,0622 y coeficiente de determinación de 0,0039; en el recuento espermático, coeficiente de correlación lineal múltiple de 0,465 y coeficiente de determinación de 0,216. Conclusiones: existe una tendencia inversa entre la motilidad y la edad, una tendencia directa entre el recuento espermático y la edad, y una tendencia constante entre morfología espermática y edad. Abstract in english Objectives: To determine the relationship between the quality of human semen and age. Methods: A spermatogram was performed following the WHO´s laboratory manual to evaluate human sperm and the interaction between cervical mucus and semen (1999) from July 2003 and December 2008. We studied 2441 male [...] cases that fulfilled the inclusion criteria. Results: A+B motility was 51.55% for 20-29 years of age male participants; normal spermatozoids were found in 77.73% of males above 50 years of age; the spermatic count (mill/ml) was 61.09 for males above 50 years of age. Spermatic motility had a multiple lineal correlation coefficient of 0.222 and a determination coefficient of 0.049; respective values for the spermatic count were 0.465 and 0.216. Conclusions: There is an inverse trend between motility and age, a direct trend between spermatic count and age, and a constant trend between spermatic morphology and age.

  2. Semen quality in relation to biomarkers of pesticide exposure.

    OpenAIRE

    Swan, Shanna H; Kruse, Robin L.; Liu, Fan; Barr, Dana B; Drobnis, Erma Z; Redmon, J. Bruce; Wang, Christina; Brazil, Charlene; Overstreet, James W

    2003-01-01

    We previously reported reduced sperm concentration and motility in fertile men in a U.S. agrarian area (Columbia, MO) relative to men from U.S. urban centers (Minneapolis, MN; Los Angeles, CA; New York, NY). In the present study we address the hypothesis that pesticides currently used in agriculture in the Midwest contributed to these differences in semen quality. We selected men in whom all semen parameters (concentration, percentage sperm with normal morphology, and percentage motile sperm)...

  3. Semen quality in Schistosoma haematobium infected men in Madagascar

    DEFF Research Database (Denmark)

    Leutscher, Peter; Høst, Erik; Reimert, Claus M

    2009-01-01

    The seminal vesicles and the prostate are frequently affected by egg-induced inflammation in Schistosoma haematobium infected men. The objective of this study was to assess the semen quality in men with male genital schistosomiasis (MGS). The examination of the semen samples was performed in men aged 15 to 49 years living an S. haematobium endemic area in Madagascar prior to anti-schistosoma treatment with praziquantel and five months later. Men from the high endemic Sirama sugarcane plantation ...

  4. Effect of Conjugated Linoleic Acid on Boar Semen Quality After Long-term Refrigeration at 17°C.

    Science.gov (United States)

    Teixeira, Smp; Chaveiro, A; Moreira da Silva, F

    2015-08-01

    In this study, the effect of conjugated linoleic acid (10 trans, 12 cis) (CLA) on refrigerated boar sperm quality parameters up to 14 days at 17°C was assessed. Semen was extended in Androhep and divided into four treatments supplemented with CLA (25, 50, 100 and 200 ?m) and control group, then kept for 2 h at 22°C. Afterwards an aliquot of each treatment was removed, and mitochondrial activity, viability, lipid membrane peroxidation (LPO) and stability of the sperm plasma membrane were assessed by flow cytometry. The remaining extended semen was maintained at 17°C until 336 h, repeating the same analysis every 48 h. Regarding percentage of live spermatozoa, no statistical differences were observed among treatments up to 96 h. After this time, viability decreased significantly (p refrigerated boar spermatozoa. PMID:25976112

  5. New Approaches to Boar Semen Evaluation, Processing and Improvement.

    Science.gov (United States)

    Sutovsky, P

    2015-07-01

    The improvement of boar reproductive performance may be the next frontier in reproductive management of swine herd in Unites States, facilitated by better understanding of boar sperm function and by the introduction of new advanced instrumentation in the andrology field. Objective single ejaculate evaluation and individual boar fertility prediction may be possible by introducing automated flow cytometric semen analysis with vital stains (e.g. acrosomal integrity and mito-potential), DNA fragmentation analysis and biomarkers (ubiquitin, PAWP, ALOX15, aggresome) associated with normal or defective sperm phenotypes. Measurement of sperm-produced reactive oxygen species (ROS) is a helpful indicator of normal semen sample. Semen ROS levels could be managed by the addition of ROS-scavenging antioxidants. Alternative energy regeneration substrates and sperm stimulants such as inorganic pyrophosphate and caffeine could increase sperm lifespan in extended semen and within the female reproductive system. Such technology could be combined with timed sperm release in the female reproductive system after artificial insemination. Sperm phenotype analysis by the image-based flow cytometry will go hand in hand with the advancement of swine genomics, linking aberrant sperm phenotype to the fertility influencing gene polymorphisms. Finally, poor-quality ejaculates could be rescued and acceptable ejaculates improved by semen purification methods such as the nanoparticle-based semen purification and magnetic-activated sperm sorting. Altogether, these scientific and technological advances could benefit swine industry, provided that the challenges of new technology adoption, dissemination and cost reduction are met. PMID:26174914

  6. Functional characterisation of semen in honeybee queen (A.m.ligustica S.) spermatheca and efficiency of the diluted semen technique in instrumental insemination

    OpenAIRE

    Andrea Galli; Donatella Balduzzi; Marco Lodesani

    2010-01-01

    Differences over time in the quality of semen present in the honey bee (Apis mellifera ligustica) queen spermatheca werestudied. An increase in the non-vital spermatozoa was shown to be evident (P>0.05) between the 12th and 24th month.The study of semen viability demonstrated that the passage of the semen to the spermatheca is due to sperm motility.In the queen inseminated with non-viable spermatozoa, no semen was detected in the spermatheca. Queens inseminatedtwice with a Hyes solution/semen...

  7. Human semen assays for workplace monitoring. [Monitoring of hazardous materials by determining effects on semen of personnel

    Energy Technology Data Exchange (ETDEWEB)

    Wyrobek, A.J.; Gledhill, B.L.

    1978-11-07

    Decades of human semen studies have yielded compelling evidence that sperm can be used to access reproductive potential and diagnose pathology. With these studies as background, the small number of detailed semen studies of men exposed to physical and chemical agents point with optimism to the application of human semen assays as efficient, effective means to monitor for reproductive hazards in the workplace. Sperm are the most accessible of human gonadal tissue and provide a means of monitoring exposure induced changes in the human testes, changes which may result in infertility and increased frequencies of genetically abnormal gametes. The focus on semen has precipitated the development of new sperm bioassays which use older conventional andrological methods (i.e., sperm counts, motility, and morphology) as well as recently developed high speed flow and scanning methods for automated cytological analyses. The status of these sperm assays for workplace surveillance is reviewed, procedures are suggested with examples of use, and their effectiveness is evaluated. The available mouse models of induced semen changes are briefly described and the importance of these models for evaluating the genetic implications of findings in human semen is discussed.

  8. SEMEN QUALITY ASSESSMENT OF NEW ZEALAND WHITE RABBIT BUCKS

    Directory of Open Access Journals (Sweden)

    Martyna B?aszczyk

    2013-02-01

    Full Text Available Rabbits have been extensively used as a model for large animals and humans. All the reproduction techniques employed with farm animals can be performed with the low-cost rabbit model, and certain placental membrane characteristics make them especially relevant for studies of human teratology. The purpose of this study was to assess semen quality of New Zealand White rabbits. The material represents semen samples collected from adult rabbits (n=30. The semen was obtained by means of artificial vagina. All samples were analyzed using CASA Sperm VisionTM system. To assessed spermatozoa morphology (the length and the width of head and tail; presence of abnormal spermatozoa we used QuickPhoto Micro system. Received data were statistically analyzed. Our research showed decrease of semen parameters value after one hour storage in 37°C. Correlation analysis showed negative correlation between presence of spermatozoa with separated flagellum and CASA parameters value e.g. motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, ALH and BCF. From among 3000 analyzed spermatozoa 14.2% posed abnormal forms. We observed negative influence of semen storage on its quality. Also negative correlations between all types of tail defect and motility of spermatozoa were detectedRabbits have been extensively used as a model for large animals and humans. All the reproduction techniques employed with farm animals can be performed with the low-cost rabbit model, and certain placental membrane characteristics make them especially relevant for studies of human teratology. The purpose of this study was to assess semen quality of New Zealand White rabbits. The material represents semen samples collected from adult rabbits (n=30. The semen was obtained by means of artificial vagina. All samples were analyzed using CASA Sperm VisionTM system. To assessed spermatozoa morphology (the length and the width of head and tail; presence of abnormal spermatozoa we used QuickPhoto Micro system. Received data were statistically analyzed. Our research showed decrease of semen parameters value after one hour storage in 37°C. Correlation analysis showed negative correlation between presence of spermatozoa with separated flagellum and CASA parameters value e.g. motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, ALH and BCF. From among 3000 analyzed spermatozoa 14.2% posed abnormal forms. We observed negative influence of semen storage on its quality. Also negative correlations between all types of tail defect and motility of spermatozoa were detected.

  9. Quantification of damage at different stages of cryopreservation of endangered North American bison (Bison bison) semen and the effects of extender and freeze rate on post-thaw sperm quality.

    Science.gov (United States)

    Hussain, S A; Lessard, C; Anzar, M

    2011-12-01

    Semen cryopreservation is an important technique for the banking of animal germplasm from endangered species and exploitation of genetically superior sires through artificial insemination. Being a member of bovidae family, bison semen has poor freezing ability as compared to dairy and beef bulls' semen. This study was designed to quantify the damage to bison sperm at different stages of cryopreservation, and to determine the effects of extender (commercial Triladyl(®) vs. custom made tris-citric acid [TCA]) and freeze rate (-10, -25 and -40°C/min) on post-thaw quality of bison semen. Semen was collected from five bison bulls (three woods and two plains) via electroejaculation. In Experiment 1, semen was diluted in Triladyl® extender and frozen with freeze rate -10°C/min. Sperm motility characteristics were recorded in fresh, diluted, cooled (4°C) and freeze-thawed semen using computer-assisted sperm analyzer (CASA). In Experiment 2, semen was diluted in Triladyl® or TCA extender, and frozen with three different freeze rates, i.e. -10, -25 or -40°C/min. Thawing was performed at 37°C for 60s. Post-thaw sperm motility characteristics were assessed using CASA, and sperm structural characteristics (plasma membrane, mitochondrial membrane potential and acrosomes) were evaluated using flow cytometer, at 0 and 3h while incubating semen at 37°C. In Experiment 1, total and progressive motilities did not differ among pre-freeze stages of cryopreservation (P>0.05). However, sperm total and progressive motilities declined (Pbison semen was frozen at -40°C/min. Likewise, the percent change in post-thaw sperm total and progressive motilities, during 3h incubation at 37°C, was less (Pbison semen frozen at -40°C/min. All post-thaw bison sperm characteristics decreased (Pbison sperm occurred during freeze-thaw processes. Post-thaw total and progressive motilities of bison sperm were greater in Triladyl® at 0h whereas sperm survival was greater in TCA extender during 3h post-thaw incubation. Bison sperm had greater survival (P<0.05) when frozen at -40°C/min freeze rate. PMID:22240453

  10. EFFECT OF TWO PROTOCOLS OF CRYOPRESERVATION ON FERTILIZING CAPACITY OF STALLION (Equus caballus) SEMEN / EFECTO DE DOS PROTOCOLOS DE CRIOPRESERVACIÓN SOBRE LA CAPACIDAD FECUNDANTE DE SEMEN EQUINO (Equus caballus)

    Scientific Electronic Library Online (English)

    Giovanni, Restrepo Betancur; Juan Esteban, Duque Cortés; Juan David, Montoya Páez.

    2012-06-01

    Full Text Available Resumen. La criopreservación de semen es un proceso fundamental en el desarrollo de biotecnologías para la reproducción asistida en equinos. El uso de diferentes técnicas de criopreservación con cambios en las concentraciones y la naturaleza de los crioprotectores, así como en los diferentes tipos d [...] e soportes para el almacenamiento del semen, se ha constituido en una alternativa para mejorar los protocolos empleados. El objetivo de este trabajo fue evaluar el efecto de dos protocolos de criopreservación (congelación y vitrificación), sobre la capacidad fecundante del semen equino. El estudio se realizó con equinos de la raza Criollo Colombiano. Para la congelación se empleó un diluyente suplementado con de yema de huevo (4%) y dimetilformamida (5%), y pajillas de 0,5 mL como soportes; mientras que para la vitrificación, el diluyente fue suplementado con yema de huevo (8%) y dimetilformamida (8%) y se usaron crioviales como soportes. Post-descongelación, se evaluaron los parámetros: movilidad progresiva, vitalidad, morfología normal e integridad de la membrana plasmática (HOS). Para la evaluación estadística se ajustó un modelo lineal generalizado (GLM) y las medias se compararon por la prueba de Tukey. Se encontraron porcentajes promedio de movilidad progresiva, vitalidad, morfología normal y HOS de 41,6±11,8 y 37,0±8,5, 54,3±10,2 y 52,3±7,8, 83,1±5,4 y 83,6±5,8, 41,7±9,8 y 38,9±3,6, para el semen criopreservado por congelación y vitrificación, respectivamente. No se encontraron diferencias estadísticamente significativas (P ? 0,05) entre los tratamientos para ninguno de los parámetros evaluados. La capacidad fecundante del semen equino criopreservado por vitrificación es equiparable a la obtenida por congelación convencional. Abstract in english Abstract. Semen cryopreservation is a fundamental process for the development of biotechnologies for assisted reproduction in horses. The use of cryopreservation techniques with changes in concentrations and the nature of the cryoprotectant, as well as, the different types of vials for storage of se [...] men, have become an alternative to improve the protocols used. The objective of this work was to evaluate the effect of two protocols of cryopreservation (freezing and vitrification) on the fertilizing capacity of stallion semen. The study was conducted with horses of the Criollo Colombiano breed. For freezing was used a extender supplemented with egg yolk (4%) and dimethyl formamide (5%), and 0.5 mL straws as vials, whereas for vitrification, the extender was supplemented with egg yolk (8%) and dimethyl formamide (8%), and cryovials were used as carriers. As post thaw parameters were evaluated: progressive motility, vitality, normal morphology and integrity of the plasma membrane through the hypoosmotic swelling test (HOS). For statistical evaluation was fitted a generalized linear model (GLM) and means were compared by the Tukey test. Were found average percentages of progressive motility, vitality, normal morphology and HOS of 41.6 ± 11.8 and 37 ± 8.5, 54.3 ± 10.2 and 52.3 ± 7.8, 83.1 ± 5.4 and 83.6 ± 5.8, 41.7 ± 9.8 and 38.9 ± 3.6, for cryopreserved semen by freezing and vitrification, respectively. There were no statistically significant differences (P ? 0.05) between treatments for any of the parameters evaluated. The fertilizing capacity of equine semen cryopreserved by vitrification is comparable to that obtained by conventional freezing.

  11. Fertility of Cow in Using Locally Produced Chilled and Imported Frozen Semen

    Directory of Open Access Journals (Sweden)

    A. K. Das

    2002-01-01

    Full Text Available The experiment was carried out at Central Cattle Breeding Station and Dairy farm, Savar, Dhaka, and 3 sub- station and 9 points of Chandpur District in Bangladesh to evaluate the quality and fertilizing capacity of locally produced chilled and imported frozen semen. Motility, sperm concentration and mass activity of semen from different experimental bulls were almost similar. Quality of imported frozen semen was better than that of locally produced chilled semen in respect of motility, motile sperm/ Insemination dose and spermatozoa with normal head. Motility and pH value of semen decreased significantly for transportation and prolongation of preservation duration. Average conception rate of imported frozen semen (57.33 was found to be higher than locally produced chilled semen (45.33. But it was similar between imported frozen (57.33 and average of 1st & 2nd day preserved semen (57%.

  12. Expected net present value of pure and mixed sexed semen artificial insemination strategies in dairy heifers.

    Science.gov (United States)

    Olynk, N J; Wolf, C A

    2007-05-01

    Sexed semen has been a long-anticipated tool for dairy farmers to obtain more heifer calves, but challenges exist for integrating sexed semen into commercial dairy farm reproduction programs. The decreased conception rates (CR) experienced with sexed semen make virgin heifers better suited for insemination with sexed semen than lactating dairy cows. This research sought to identify when various sexed semen breeding strategies provided higher expected net present value (NPV) than conventional artificial insemination (AI) breeding schemes, indicating which breeding scheme is advisable under various scenarios. Budgets were developed to calculate the expected NPV of various AI breeding strategies incorporating conventional (non-sexed) and sexed semen. In the base budgets, heifer and bull calf values were held constant at $500 and $110, respectively. The percentage of heifers expected to be born after breeding with conventional and sexed semen used was 49.2 and 90%, respectively. Breeding costs per AI were held constant at $15.00 per AI for conventional semen and $45.00 per AI for sexed semen of approximately the same genetic value. Conventional semen CR of 58 and 65% were used, and an AI submission rate was set at 100%. Breeding strategies with sexed semen were assessed for breakeven heifer calf values and sexed semen costs to obtain a NPV equal to that achieved with conventional semen. Breakeven heifer calf values for pure sexed semen strategies with a constant 58 and 65% base CR in which sexed semen achieved 53% of the base CR are $732.11 and $664.26, respectively. Breakeven sexed semen costs per AI of $17.16 and $22.39, compared with $45.00 per AI, were obtained to obtain a NPV equal to that obtained with pure conventional semen for base CR of 58 and 65%, respectively. The strategy employing purely sexed semen, with base CR of both 58 and 65%, yielded a lower NPV than purely conventional semen in all but the best-case scenario in which sexed semen provides 90% of the CR of conventional semen. Other potential advantages of sexed semen that were not quantified in the scenarios include biosecurity-related concerns, decreased dystocia due to increased numbers of heifer calves, and implications for internal herd growth. PMID:17430962

  13. Effects of Diluents, Cryoprotectants, Equilibration Time and Thawing Temperature on Cryopreservation of Duck Semen

    OpenAIRE

    Han, X. F.; Z.Y. Niu; F.Z. Liu; Yang, C.S.

    2005-01-01

    A series of sequential experiments were carried out to determine optimum diluents, cryoprotectants, equilibration time, and thawing temperature for frozen duck semen in order to set up the commercial semen cryopreservating techniques which could be applied to the conservation of genetic resources, breeding, and commercial production in domestic ducks. In experiment 1, the seven semen extenders were studied to determine efficacy of the diluent on cryopreservation of duck Semen. The result show...

  14. Recent adverse trends in semen quality and testis cancer incidence among Finnish men

    DEFF Research Database (Denmark)

    Jorgensen, N.; Vierula, M.; Jacobsen, R.; Pukkala, E.; Perheentupa, A.; Virtanen, H. E.; Skakkebk, N. E.; Toppari, J.

    2011-01-01

    Impaired semen quality and testicular cancer may be linked through a testicular dysgenesis syndrome of foetal origin. The incidence of testis cancer has been shown to increase among Finnish men, whereas there is no recent publication describing temporal trends in semen quality. Therefore, we carried out a prospective semen quality study and a registry study of testis cancer incidence among Finnish men to explore recent trends. A total of 858 men were investigated in the semen quality study durin...

  15. Parental age at delivery and a man's semen quality

    DEFF Research Database (Denmark)

    Priskorn, Lærke; Jensen, Tina K

    2014-01-01

    STUDY QUESTION: Is parental age at delivery associated with a man's semen quality? In this large register-based study both mother's and father's age are found to have minimal effects on semen quality in men. BACKGROUND: Both maternal and paternal age have been associated with a range of adverse health effects in the offspring. Given the varied health effects of parental age upon offspring, and the sensitivity of genital development to external factors, it is plausible that the age of a man's mother and father at conception may impact his reproductive health. To our knowledge this is the first examination of the effects of parental age on semen quality. METHODS: The study was based on Danish men referred to the Copenhagen Sperm Analysis Laboratory due to infertility in their partnership. Men born from 1960 and delivering a semen sample until year 2000 were included. The men were linked to the Danish Civil Registration System to obtain information on parent's age at delivery. Logistic regression analyses were used to calculate odds ratios and 95% confidence intervals for impaired semen quality. Linear regression analyses were used to examine a relationship between semen parameters and paternal age. RESULTS: There were no convincing effect of either mother's or father's age on a man's semen quality. As no trends were noted, the few statistically significant results are likely attributable to chance. LIMITATIONS, REASONS FOR CAUTION: Information regarding individual subject characteristics which may impact sperm production (i.e. smoking, BMI) were not available. While our sample size was large, we cannot exclude the possibility that a trend may have been identified with a still larger sample. In addition, the Danish Civil Registration System is merely administrative and hence does not discriminate between biological and adopted children. However, the low rate of adoption (?2%) suggests that misclassification would have a minimal impact. The men were all referred to the laboratory for infertility problems in their partnership and, therefore, do not represent the general population. We, however, compared semen quality among men within the cohort, and it is therefore less important whether they, in fact, represent the general population. WIDER IMPLICATIONS OF THE FINDINGS: The current study found no link between parental age and a son's semen quality, suggesting other factors may explain recent impairments in men's reproductive health. STUDY FUNDING: This work was supported by the Hans and Nora Buchard's Fund and the Kirsten and Freddy Johansen's Fund.

  16. In Vitro Measures for Assessing Boar Semen Fertility.

    Science.gov (United States)

    Jung, M; Rüdiger, K; Schulze, M

    2015-07-01

    Optimization of artificial insemination (AI) for pig production and evaluation of the fertilizing capacity of boar semen are highly related. Field studies have demonstrated significant variation in semen quality and fertility. The semen quality of boars is primarily affected by breed and season. AI centres routinely examine boar semen to predict male fertility. Overall, the evaluation of classical parameters, such as sperm morphology, sperm motility, sperm concentration and ejaculate volume, allows the identification of ejaculates corresponding to poor fertility but not high-efficiency prediction of field fertility. The development of new sperm tests for measuring certain sperm functions has attempted to solve this problem. Fluorescence staining can categorize live and dead spermatozoa in the ejaculate and identify spermatozoa with active mitochondria. Computer-assisted semen analysis (CASA) provides an objective assessment of multiple kinetic sperm parameters. However, sperm tests usually assess only single factors involved in the fertilization process. Thus, basing prediction of fertilizing capacity on a selective collection of sperm tests leads to greater accuracy than using single tests. In the present brief review, recent diagnostic laboratory methods that directly relate to AI performance as well as the development of a new boar fertility in vitro index are discussed. PMID:26174915

  17. Effect of short-term semen storage in salmon (Oncorhynchus mykiss) on sperm functional parameters evaluated by flow cytometry.

    Science.gov (United States)

    Trigo, P; Merino, O; Figueroa, E; Valdebenito, I; Sánchez, R; Risopatrón, J

    2015-05-01

    The short-term storage of salmonid semen is a viable method for in vitro fertilisation. Previous studies have found that short-term storage affects sperm motility, compromising quality and fertilising capacity. However, the functional characteristics of the spermatozoa of O. mykiss during storage time and its relation to the spawning period are little known. This study was designed to evaluate the effects of in vitro short-term storage on sperm functional parameters in O. mykiss, determined by flow cytometry. Semen samples of the first spawning - undiluted (SSD) and diluted (SD) (Storfish(®) 1 : 2v/v; IMV AI solutions, France) - were stored at 4 °C for 14 days. Motility, viability (PMI: plasma membrane integrity) and mitochondrial membrane potential (??M) were assessed. On the fifth day of storage, spermatozoa showed a motility >70% (SSD: 78.3% versus SD 85.0%), PMI (81.5% SSD/87.2% SD) and ??M (72.5% SSD/SD 80.0%) (P < 0.05). However, a significant decline in the percentage of all functional parameters (P < 0.05) was observed after 5 days of storage for all samples of both undiluted (SSD) and diluted semen. In conclusion, the results here provide new data on O. mykiss sperm quality with respect to in vitro short-term storage evaluated by flow cytometry. PMID:24717099

  18. Semen from scrapie-infected rams does not transmit prion infection to transgenic mice.

    Science.gov (United States)

    Sarradin, Pierre; Melo, Sandrine; Barc, Céline; Lecomte, Céline; Andréoletti, Olivier; Lantier, Frédéric; Dacheux, Jean-Louis; Gatti, Jean-Luc

    2008-03-01

    Scrapie is the most common transmissible spongiform encephalopathy (TSE) in livestock. Natural contamination in sheep flocks is presumed to occur by maternal transmission to offspring. However, horizontal prion transmission from animal to animal exists and may be significant in sustaining and spreading contagion in the field. Artificial insemination is widely used in modern farming, and as large amounts of prion protein have been found in sheep sperm membrane, epididymal fluid and seminal plasma, horizontal transmission by this route was hypothesized since no clear information has been obtained on possible sexual transmission of TSE. We therefore tested the contamination levels of semen from scrapie-infected rams at different stages of incubation, including the clinical phase of the disease. We report here that under our experimental conditions ram semen did not transmit infectivity to scrapie-susceptible transgenic mice overexpressing the V(136)R(154)Q(171) allele of the sheep prion (PRNP) gene. These results suggest that artificial insemination and natural mating have a very low or negligible potential for the transmission of scrapie in sheep flocks. PMID:18299435

  19. Semen characteristics and refrigeration in free-ranging giant anteaters (Myrmecophaga tridactyla).

    Science.gov (United States)

    Luba, Camila do Nascimento; Boakari, Yatta Linhares; Costa Lopes, Alexandre Martins; da Silva Gomes, Marcelo; Miranda, Flávia Regina; Papa, Frederico Ozanan; Ferreira, João Carlos Pinheiro

    2015-12-01

    The giant anteater (Myrmecophaga tridactyla) is considered vulnerable to extinction. Scientific data on the reproductive parameters of this species are scarce. Semen from eight free-ranging giant anteaters was collected to establish its characteristics and the effects of cooling and storage at 5 °C after dilution with the BotuCrio extender without cryoprotectant. The ejaculate presented two distinct sequential fractions, including a whitish fraction, which was milky and rich in sperm cells, and a gel fraction, which was colorless, viscous, and azoospermic. The mean ± standard error of the mean values of the seminal characteristics were as follows: volume of the first fraction, 0.75 ± 0.1 mL; motility, 75 ± 2.9%; vigor, 3.2 ± 0.3; sperm motility index, 68.8 ± 4.3; concentration, 108.5 ± 13.4 × 10(6)/mL; plasma membrane integrity index, 71 ± 4.0%; spermatic defects detected using modified Karras staining, 35.5 ± 3.3%; and spermatic alterations identified by differential interference contrast microscopy, 48.3 ± 6.8%. During refrigeration, the semen presented decreasing motility from 0 to 18 hours, sperm motility index decreased from 0 to 24 hours, and vigor did not change in the first 6 hours and then decreased to 18 hours. PMID:26376226

  20. Metil-formamida na criopreservação de sêmen ovino / Methyl-formamide in ram semen cryopreservation

    Scientific Electronic Library Online (English)

    Carlos Pereira das, Graças; Alexandre In Piao Gomes, Lim; Andrei Antonioni Guedes, Fidelis; Júlio Roquete, Cardoso; Hélio, Blume; Rafael Gianella, Mondadori.

    2013-12-01

    Full Text Available Objetivou-se avaliar a eficácia da metil-formamida na criopreservação do sêmen ovino. O pool de sêmen utilizado no experimento foi obtido a partir da coleta, com vagina artificial, do sêmen de quatro carneiros mestiços Santa Inês, com idade aproximada de quatro anos. As coletas foram realizadas uma [...] vez por semana, por seis semanas consecutivas, correspondendo, cada semana, a uma repetição do experimento. As frações do pool foram diluídas em cinco diferentes meios de congelação: (1) tris-gema com 5,3% de glicerol (TG5,3G); (2) tris-gema com 3% de metil-formamida (TG3MF); (3) tris-gema com 5% de metilformamida (TG5MF); (4) tris-gema com 7% de metil-formamida (TG7MF); (5) tris-gema com 9% de metil-formamida (TG9MF). Foram avaliadas a motilidade progressiva e o vigor das células espermáticas e realizado o teste de termorresistência pós-descongelação. O tratamento que obteve maior motilidade foi o TG5,3G (50%), seguido do TG3MF (38%) e os tratamentos que apresentaram menor motilidade progressiva foram TG5MF (29%), TG7MF (1,0%), TG9MF (6,0%). Os meios contendo metil-formamida apresentaram resultados inferiores ao meio controle para preservar a integridade morfológica dos espermatozoides, sendo que nos meios TG7MF e TG9MF menos de 60% de espermatozóides apresentaram-se morfologicamente normais. Os espermatozoides do meio TG5,3G apresentaram motilidade (15%) e vigor (2,8) similares aos do meio TG3MF (15% e 2,6, respectivamente) no teste de termorresistência, mas o meio TG5,3G preservou melhor a integridade funcional da membrana plasmática. O glicerol foi mais eficiente como crioprotetor do que a metil-formamida na criopreservação de sêmen ovino. Abstract in english The aim of this study was to evaluate the efficacy of methyl-formamide in ram semen cryopreservation. The semen pool used in this experiment was obtained by artificial vagina collection from four mixed breed Santa Inês rams, around four years of age. Semen collection was performed once a week, durin [...] g six weeks. Each week corresponded to one experiment replication. The semen pool was divided in five fractions in order to be diluted in one of the following freezing media: (1) tris-egg yolk with 5.3% of glycerol (TG5.3G); (2) tris-egg yolk with 3% of methyl-formamide (TG3MF); tris-egg yolk with 5% of methyl-formamide (TG5MF); tris-egg yolk with 7% of methyl-formamide (TG7MF); tris-egg yolk with 9% of methyl-formamide (TG9MF). Semen progressive motility, vigor and thermoresistance were evaluated. The treatments TG5.3G (50%) and TG3MF (38%) showed higher progressive motility after thawing, while TG5MF (29%), TG7MF (1%) and TG9MF (6%) showerd lower motility. Freezing media containing methyl-formamide were less effective in preserving spermatozoa membrane integrity and morphology than control media. In TG7MF and TG9MF extenders, less than 60% spermatozoa showed normal morphology. After thermoresistance test, semen cryopreserved in TG3MF showed vigor (2.6) and motility (15%) statistically similar to TG5.3G media (15% and 2.8, respectively); however, the extender TG5.3G was more effective in preserving plasma membrane functional integrity. In conclusion, in the experimental conditions used, glycerol showed more cryoprotectant potential than methyl-formamide.

  1. La administración de selenio disminuye la lipoperoxidación en semen de toros Brahman

    Scientific Electronic Library Online (English)

    C., Flores; Y, Márquez; L., Vilanova; N., Matheus; A., López Ortega.

    2014-12-01

    Full Text Available La lipoperoxidación es uno de los efectos del estrés oxidativo, el cual cursa con alteraciones de motilidad y viabilidad espermática debido a cambios bioquímicos y estructurales de la membrana plasmática. El trastorno conduce a la infertilidad, por lo cual es menester estudiar las alternativas terap [...] éuticas para mejorar las condiciones reproductivas de los toros. En este estudio se determinó la acción antioxidante del selenio y sus efectos sobre la calidad seminal. Se emplearon toros Brahman sanos, de 15-18 meses de edad, divididos en dos grupos mantenidos a pastoreo. El grupo experimental recibió una dosis intramuscular de 0,22 mg/20 kg PV/ día durante 5 días. Las muestras fueron tomadas con electroeyaculador a los días cero, 15 y 30 post-tratamiento. Se evaluó la calidad seminal (espermatozoides móviles, porcentaje de motilidad progresiva, morfología, vitalidad y presencia de acrosomas) e indicadores de la peroxidación lipídica: dienos conjugados (DC, extraídos con isopropanol) y malondialdehído (MDA, por TBARS). Los datos fueron interpretados a través del análisis de la variancia (p=0,05). La calidad del semen no reveló diferencias significativas entre grupos. Los animales tratados no mostraron diferencias significativas en los DC a los 15 y 30 días con respecto al grupo control. Por su parte, el MDA presentó diferencias significativas a los 30 días de tratamiento, cuando el grupo experimental mostró valores más bajos (1,09 ±0,1 nmoles/mg de proteínas) con respecto al grupo control (1,58 ±0,2 nmoles/mg de proteínas). Se concluye que el selenio resulta eficaz para reducir la lipoperoxidación seminal y preservar la calidad del semen. Abstract in english Lipid peroxidation, one of the effects of oxidative stress, is associated with impaired sperm motility and viability because of biochemical and structural alterations of the plasma membrane which causes infertility. Of interest is the study of therapeutic alternatives for enhancing the reproductive [...] condition of the bulls. In this study the antioxidant action of selenium and its effect on semen quality was determined. Healthy grazing Brahman bulls with 15-18 months of age, divided into two groups, were used for the trial. The experimental group received an intramuscular dose of 0.22 mg/20 kg liveweight /day, during 5 days. The sample was taken with electroejaculator at day zero, 15 and 30 post-treatment. Diene conjugates (DC, extracted with isopropanol) and malondialdehyde (MDA TBARS) were measured. Semen quality (motile sperm, percentage of progressive motility, morphology, sperm vitality and presence of acrosomes) and indicators of lipid peroxidation were evaluated. Data were analyzed by ANOVA (p=0.05). In the study of semen, quality groups did not differ significantly. Compared to the control group, selenium-treated animals showed no significant differences in DC at 15 and 30 days. On the other hand, MDA revealed significant differences at 30 days post treatment, showing lower values (1.09 ±0.1 nmol/mg protein) compared to control group (1.58 ±0.2 nmoles/mg protein). In conclusion, seminal selenium decreases lipid peroxidation and preserves semen quality.

  2. Relationships among frozen-thawed semen fertility, physical parameters, certain routine sperm characteristics and testosterone in breeding Murrah buffalo (Bubalus bubalis bulls

    Directory of Open Access Journals (Sweden)

    A. K. Singh

    2014-09-01

    Full Text Available Aim: The present study was carried out to examine the relationships among frozen-thawed semen fertility, physical parameters, seminal quality, and testosterone concentration in Murrah buffalo bulls. Materials and Methods: A total of 30 breeding Murrah buffalo bulls (either progeny tested or under progeny testing program were randomly selected from two government bull farms in Punjab. None of the bulls selected for this study had any preceding physical abnormality. A field fertility trial was conducted to determine the first service conception rate (FSCR. The number of females inseminated per bull semen was 10. All the bulls were inspected for structural soundness, measurement of scrotal circumference, testicular biometry, and internal pelvic area (IPA. Frozen-thawed semen was evaluated for total motility, progressive motility, viability, concentration, abnormality, and hypo-osmotic swelling test (HOST. Testosterone was estimated in blood plasma, seminal plasma as well as frozen-thawed semen extracts for establishing relationship. Results: The FSCR was 48% in the bulls having a scrotal circumference of ?44 cm, although, there was no significant correlation between FSCR and scrotal circumference. Similarly, no consistent relationship existed between sperm concentration and scrotal circumference. A positive correlation was observed between IPA and FSCR (r=0.294. Of the six post-thaw seminal components (total motility, progressive motility, viability, HOST (%, total abnormality and concentration only total motility had a high significant (p<0.01 correlation with FSCR (r=0.694. Varied correlations existed between other seminal parameters and fertility. Using a simple regression analysis, the post-thaw motility, IPA, prepuce length and testosterone (independent variables combined to explain approximately 62% of the variation in the FSCR (dependent variable. Conclusion: The present study indicated that despite low to high correlations between seminal characteristics, physical parameters, fertility, and testosterone; the observations support the importance of these components and their function in maintaining semen quality and subsequent fertility.

  3. Effects of Seasonal Changes and Shearing on Thermoregulation, Blood Constituents and Semen Characteristics of Desert Rams (Ovis aries

    Directory of Open Access Journals (Sweden)

    M. Abdelatif Abdalla

    2013-01-01

    Full Text Available This experiment was designed to study the effects of shearing in different seasons (winter vs. summer on thermoregulation, blood parameters and semen characteristics of desert rams. Eight intact healthy rams were randomly assigned into two groups (n = 4. The control group was kept unshorn (UN with intact pelage, the mean length of hair left was approximately 1.5 cm and the treated group was shorn (SH. Rectal temperature (Tr and Respiration Rate (RR measurements were carried out twice daily throughout the experimental period. Blood samples were collected once weekly for the evaluation of Packed Cell Volume (PCV, Total (TLC and Differential (DLC leukocyte count, Serum Total Protein (STP, Serum Albumin (SA, Serum Urea (SU and Plasma Glucose (PG concentration. Semen samples were collected once weekly for the determination of Ejaculate Volume (EV, Sperm Mass (SM and individual (SIM motility, Sperm Cell Concentration (SCC, live (LSP and abnormal (ABS sperm percent and semen pH. Scrotal Circumference (SC measurements were performed weekly. Shearing of desert rams significantly lowered the morning Tr in both seasons and the afternoon Tr during summer ,while RR was significantly lower in both seasons in the afternoon. The PCV was significantly lower in shorn rams during summer compared to winter and PG was significantly higher during winter compared to summer. In both seasons shearing significantly lowered SIM. It is concluded that shearing significantly affected thermoregulation, blood composition and semen characteristics during winter and summer. It is concluded that shearing in different season significantly affected thermoregulation, blood parameters and seminal traits of Desert Hamari rams.

  4. Karakteristik Semen Segar dan Kualitas Semen Cair Kuda dalam Pengencer Dimitropoulos yang Disuplementasi dengan Fruktosa, Trehalosa dan Rafinosa

    Directory of Open Access Journals (Sweden)

    Yudi

    2007-12-01

    Full Text Available The objective of the experiment was to study the characteristics of stallion fresh semen and the quality of sperm preserved in Dimitropoulos extender (DV supplemented with different concentration of fructose, trehalose and raffinose. Semen were collected using artificial vagina from three stallions. Semen characteristics and quality were evaluated macro- and microscopically. Prior to extension, semen were centrifugated at 3000 rpm for 20 minutes. The condensed sperm were re-suspended in DV supplemented with different types of carbohydrate to meet the concentration of 200 million spz/ml. All samples were stored at room and chilled temperature, and were evaluated for motility and viability every 3 h and 12 h. The results of the experiments indicated that fresh semen characteristics were fair good; the volume, consistency, motility, live-dead ratio, concentration (106/ml, total spermatozoa (109/ejaculate and abnormality were 29.25±9.33 ml, watery, 7.00±0.12, 67.08±9.08%, 77.89±6.46%, 211.88±21.15, 6.28±2.45 and 27.26±4.64%, respectively. The supplementation of different type and concentration of carbohydrates did not significantly affect the motility and viability. However, the supplementation of 50 mM fructose significantly increased the motility and viability of the sperm compared to the control. In conclusion, carbohydrate supplementation in DV may not maintain the sperm quality, particularly in the medium with the osmolarity higher than 400 mOsm/kg.

  5. Evaluation of semen parameters in semen donors in a ten-year period in the city of São Paulo

    Directory of Open Access Journals (Sweden)

    Sidney Glina

    2010-12-01

    Full Text Available Objective: To evaluate sperm concentration, morphology and motility of Brazilian semen donors from 1992 to 2003, in the city of São Paulo. Methods: Retrospective study analyzing 182 donor semen samples from 1992 to 2003. The first and the second donated sample were analyzed for each donor. Donor average age was 30.8 years. Means with standard errors, medians with minimum and maximum values, and interquartile ranges were calculated for age, sperm concentration, semen volume, oval morphology and motility. The relation between each characteristic of the semen samples and the year of donation, as well as donor age and season of the year were studied by linear and multiple regression analysis. Results: Linear regression analysis showed that the sperm concentration (R2 = 19.1%, R2 = 20.2%, p < 0.0001 respectively and the oval morphology (R2 = 13%; R2 = 13.5%; p < 0.0001, respectively decreased significantly, even when the first or the second sperm collection is considered. The ejaculated volume showed slight increase during the period for both samples (R2 = 2.2%, p = 0.048; R-sq = 2.4%. p = 0.038, respectively. All characteristics did not depend on the donors’ age or season of the year when the samples were obtained. Conclusions: There was a decrease in spermatic concentration and percentage of oval sperm of semen donors samples from 1992 to 2003, in the city of São Paulo.

  6. Impact of pig insemination technique and semen preparation on profitability.

    Science.gov (United States)

    Gonzalez-Peña, D; Knox, R V; Pettigrew, J; Rodriguez-Zas, S L

    2014-01-01

    Artificial insemination technique and semen preparation impact boar utilization efficiency, genetic dissemination, and biosecurity. Intrauterine (IUI) and deep intrauterine (DUI) AI techniques require lower number of spermatozoa per dose compared to conventional (CON) AI. Frozen semen (FRO) has been associated with lower reproductive performance compared to fresh semen (FRE) preparation. The combined effects of 3 AI techniques (CON, IUI, and DUI) and 2 semen preparations (FRE and FRO) on the financial indicators of a pig crossbreeding system were studied. A 3-tier system was simulated in ZPLAN and the genetic improvement in a representative scenario was characterized. The cross of nucleus lines B and A generated 200,000 BA sows at the multiplier level. The BA sows were inseminated (CON, IUI, or DUI) with FRE or FRO from line C boars at the commercial level. Semen preparation and AI technique were represented by distinct sow:boar ratios in the C × BA cross. A range of farrowing rates (60 to 90%) and litter sizes (8 to 14 liveborn pigs) were tested. Genetic improvement per year for number born alive, adjusted 21-d litter weight, days to 113.5 kg, backfat, and ADG were 0.01 pigs per litter, 0.06 kg, -0.09 d, -0.29 mm, and 0.88 g, respectively. On average, the net profit for FRE (FRO) increased (P-value profit between techniques were driven by differences in costs. Differences in fixed costs between IUI and DUI relative to CON were -2.4 (-5.2%) and -3.4% (-7.4%), respectively. The differences in total costs between FRE and FRO were lower than -5%. The difference in variable costs between FRE and FRO ranged from -5.3 (CON) to -24.7% (DUI). Overall, insemination technique and semen preparation had a nonlinear effect on profit. The average relative difference in profit between FRE and FRO was less than 3% for the scenarios studied. PMID:24352964

  7. The extent of increase in first calving age as a result of implementing various sexed semen breeding strategies

    Energy Technology Data Exchange (ETDEWEB)

    Joezy-Shekalgorabi, S.; Shadparvar, A. A.; Vries, A. de; Gay, K. D.

    2014-06-01

    A deterministic simulation was conducted to assess the effects of sexed semen utilization strategies on age at first calving (AFC). Four different strategies were implemented on dairy heifers: continuous use of conventional semen only (CC), continuous use of sexed semen only (SS), utilization of sexed semen for both the first and second services with conventional semen afterwards (S2), and utilization of sexed semen for the first service with conventional semen afterwards (S1). Results indicated that continuous utilization of sexed semen led to the greatest AFC; however at high conception rates, strategies displayed negligible differences on AFC. Increases in estrus detection rate had the greatest effects on decreasing AFC of the SS scenarios. Negative effect of sexed semen on AFC increased when the effect of low estrus detection rate was combined with low conception rate of sexed semen. Results indicated that in the case of access to sexed semen conception rate, prediction of AFC is possible by quadratic polynomial or exponential equations, depending to the applied breeding strategy. Simultaneous utilization of sexed and conventional semen in a herd did not make a substantial change in AFC when a low percentage of sexed semen was employed. Increasing the contribution of different sexed semen strategies led to higher AFC variation, especially for the SS strategy. AFC of strategies that utilize sexed semen is highly dependent on the conception rate, estrus detection rate and the contribution of sex sorted semen in the total number of inseminations of the heifer herd. (Author)

  8. The Relationship between Occupation and Semen Quality

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Vaziri

    2011-01-01

    Full Text Available Background: Infertility can be a major concern for couples trying to conceive, and occupationalhazards may constitute a main cause of infertility in men. Studies conducted throughout the worldindicate that physical and chemical hazards in the workplace can have a negative impact on malefertility. The main objective of this study was to determine the frequency of occupational categoriesof men who attended an infertility clinic, and to evaluate the differences in the semen qualityparameters among occupational categories.Materials and Methods: This cross-sectional study was conducted on 1164 males who werereferred to the Infertility Research Center in Tehran for treatment of infertility in order to evaluatethe effects of certain occupations on infertility. The participants were divided into several categoriesaccording to their occupations and evaluated by means of a questionnaire for duration of infertility,BMI, sperm count, percentage of normal sperm morphology and percentages of sperm with class Aand class B motilities. Descriptive statistics, analysis of variance, and correlations were conductedusing SPSS 16.0 for Windows.Results: There were no statistically significant differences in the mean sperm count or spermmorphology between occupational categories. Assessment of the differences in the frequency ofsperm motility classes between occupational categories revealed a significant difference only inthe frequency of sperm with class B motility. The lowest mean percentages of sperm with class Bmotility were seen in those involved in the transportation industry, a finding in agreement with anumber of other researches.Conclusion: Our findings revealed an association between occupation and sperm motility. Sinceour study population was relatively small and in many cases exposures to work hazards were brief,a larger study group must be evaluated in order to support the preliminary results of this study.

  9. Evaluación de dos formas de colección de semen en Alpacas

    Scientific Electronic Library Online (English)

    Rosa, Dávalos R; Juan, Olazábal L.

    2002-07-01

    Full Text Available [...] Abstract in english Semen was collected from 10 alpaca males aged 3-6 years, 3 times weekly for 3 weeks, followed by a week of rest, over a 3 month period. A heated artificial vagina was used together with a dummy model and a female in heat. Semen was collected from all 10 animals utilizing both procedures. Average cop [...] ulation time was 15.9 ± 0.6 and 16.8 ± 0.7 minutes using the dummy and the receptive female (p0.05). Sperm volume averaged 1.03 ± 0.04 and 1.73 ± 0.09 ml, (p

  10. Parental infertility and semen quality in male offspring

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia Høst; Thulstrup, Ane Marie; Bonde, Jens Peter; Olsen, Jørn

    2007-01-01

    Jensen et al. (Am J Epidemiol 2007;165:583-90) reported for the first time that men whose mothers had received fertility treatment had poor semen quality. This result could be confounded by the mothers' body mass index. Obesity is a strong predictor of fecundity and could have a programming effect on semen quality through hormonal factors or links to fetal growth. The authors of the current study tried to replicate the finding of Jensen et al. after controlling for maternal body mass index and o...

  11. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja DØvling; Bungum, Mona Berger Håkonsen

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses.

  12. Effects of Vitamin E Addition to Chicken Semen on Sperm Quality During in Vitro Storage of Semen

    Directory of Open Access Journals (Sweden)

    Saleh Tabatabaei

    2011-06-01

    Full Text Available The purpose of this study was to evaluate the probable effects of the vitamin E addition in different levels to the extender of chicken semen on spermatozoa quality during storage of semen at 4°C for 0, 3, 6, 10 and 24 hours. Eight young Ross broiler breeder strain 308 roosters were used in this experiment. The collected semen from all roosters was mixed together and diluted with modified a Ringer’s solution. The diluted pooled semen was divided into 5 treatments (T. T1 was a control group without any vitamin E addition. For T2 to T5 groups 0.5 %, 1 %, 2 % and 3 % vitamin E (w/v, were added respectively. Treatments were evaluated for sperm motility, sperm viability and probable morphological defects after 0, 3, 6, 10 and 24 hours of incubation at 4°C. The evaluations of spermatozoa immediately after semen collection, were revealed no significant differences among values of treatment groups, whereas after incubating the treatments for different spans of time, the sperm progressive motility and viability rates for groups supplemented with vitamin E were significantly (P < 0.05 higher than that of the control group. In addition, morphological defect rates of chicken spermatozoa in the groups supplemented with different levels of vitamin E were significantly (P < 0.05 lower than that in control group. According to the results of this study we conclude that, the most excellent level of vitamin E for supplementation to the extended semen of chicken in order to improve the sperm motility and viability plus to reduce the morphological defect rates of the spermatozoa up to 24 hours storage time at 4°C is 2 % (w/v.

  13. Blood and Semen Selenium Concentrations and Semen Quality in Boars Fed Diets Supplemented with Organic or Inorganic Selenium

    Directory of Open Access Journals (Sweden)

    Theera Rukkwamsuk

    2012-01-01

    Full Text Available Effect of dietary supplementation of organic or inorganic selenium on blood and semen selenium concentrations and semen quality was determined in 10 boars. During the 4 weeks of pre-experimental period, all boars were fed a basal diet containing 0.15 mg kg-1 of inorganic selenium. Thereafter, all cows were randomly allocated into 2 groups of five boars which were fed a basal diet supplemented with either 0.3 mg kg-1 of inorganic selenium or 0.3 mg kg-1 of organic selenium for 84 days. Blood samples were collected from all boars to determine selenium concentrations at the end of pre-experimental period and at days 49 and 84 after supplementation. Semen samples were collected at the end of pre-experimental period and at days 35, 49, 63 and 84 to determine selenium concentrations and semen evaluation. For both inorganic and organic selenium groups, blood selenium concentrations at days 49 and 84 were higher than the concentration at day 0 and the concentrations did not differ between the two groups at all sampling periods. Semen selenium concentrations at days 35, 49, 63 and 84 were higher than the concentration at day 0 for both inorganic and organic selenium groups and the concentrations did not differ between the 2 groups at days 35, 49, 63 and 84. Sperm motility parameters including motility (%, progressive motility (%, Average Path velocity (VAP, ?m sec-1, Straight-line velocity (VSL, ?m sec-1 and Curvilinear velocity (VCL, ?m sec-1 did not differ between the 2 groups and among sampling periods. Results revealed that 0.3 mg kg-1 supplementation of either inorganic or organic selenium form in the basal diet containing 0.15 mg of selenium per kg could increase blood and semen selenium levels in the boars. With normally-fertile boars, both inorganic and organic form of selenium supplemented in the diet had similar effect on sperm motility characteristics in the boars.

  14. New methods and media for the centrifugation of honey bee (Hymenoptera: Apidae) drone semen.

    Science.gov (United States)

    Wegener, Jakob; May, Tanja; Kamp, Günter; Bienefeld, Kaspar

    2014-02-01

    Centrifugation of Apis mellifera L. drone semen is a necessary step in the homogenization of semen pools for the enlargement of the effective breeding population, as well as in the collection of semen by the so-called washing technique. It is also of interest for the removal of cryoprotectants after cryopreservation. The adoption of methods involving semen centrifugation has been hampered by their damaging effect to sperm. Here, we tested four new diluents as well as three additives (catalase, hen egg yolk, and a protease inhibitor), using sperm motility and dual fluorescent staining as indicators of semen quality. Three of the new diluents significantly reduced motility losses after centrifugation, as compared with the literature standard. Values of motility and propidium iodide negativity obtained with two of these diluents were not different from those measured with untreated semen. The least damaging diluent, a citrate-HEPES buffer containing trehalose, was then tested in an insemination experiment with centrifuged semen. Most queens receiving this semen produced normal brood, and the number of sperm reaching the storage organ of the queen was not significantly different from that in queens receiving untreated semen. These results could improve the acceptance of techniques involving the centrifugation of drone semen. The diluent used in the insemination experiment could also serve as semen extender for applications not involving centrifugation. PMID:24665683

  15. Técnicas complementarias para la evaluación de semen porcino / Boar semen: complementary techniques for its evaluation

    Scientific Electronic Library Online (English)

    L.O., González; M.L., Fischman; M, Boquet; M.C., Acerbo; M.S., Miguez; H.O., Cisale; M.R, Ferrari.

    2014-06-01

    Full Text Available Los parámetros del núcleo espermático (morfología, maduración y grado de condensación), la capacidad funcional de los espermatozoides (respuesta de la membrana al medio hipoosmótico y la resistencia térmica) y la calidad del semen se evaluaron en dieciséis cerdos sanos, sexualmente maduros y fértile [...] s. Los núcleos espermáticos se colorearon con la reacción de Feulgen para observar su morfología, con Azul de Anilina para determinar la maduración de la cromatina y con Azul de Toluidina para determinar su condensación. El porcentaje y error estándar de los núcleos normales en las tres pruebas fue: 96.6±0.8, 98.1±1.1. 99.6±0.2 respectivamente. El porcentaje de espermatozoides con movilidad total antes de la prueba de resistencia térmica fue 62.3±3.9. mientras que la movilidad progresiva 35.0±4.6 y las células positivas a la prueba Hipoosmótica (células HOS +) 53.3±2.5. Luego de la incubación térmica el porcentaje de espermatozoides con movilidad total era 37.3±3.5, el de espermatozoides con movilidad progresiva 13.4±3.6 y el de las células HOS+ 37.7±3.5. Los parámetros nucleares no se correlacionaron entre sí ni con los demás parámetros estudiados. La movilidad total presentó correlación con: la movilidad progresiva, la viabilidad espermática, la prueba hipoosmótica y luego de la prueba de resistencia térmica con la movilidad total y la prueba hipoosmótica. Por consiguiente, la combinación de técnicas complementarias podría mejorar la estimación de la calidad del semen porcino. Abstract in english Nuclear parameters of the spermatozoa (morphology, maturation and condensation degree), sperm functional capacity (membrane response to hypoosmotic medium and sperm resistance to heat incubation) and semen quality were evaluated in sixteen healthy, sexually mature and fertile boars. Sperm nuclei wer [...] e stained with the Feulgen reaction to observe morphology, with Aniline Blue to determine chromatin maturation, and with Toluidine Blue to determine chromatin condensation. The mean percentage and standard error of normal nuclei in each of the three tests was: 96.6±0.8, 98.1±1.1 and 99.6±0.2 respectively. The percentage of sperm with total motility before heat incubation was 62.3±3.9, whereas that of sperm with progressive motility was 35.0±4.6 and that of Hypoosmotic Swelling Test+ (HOS+) cells 53.3±2.5. After heat incubation (Thermoresistance Test), the percentage of sperm with total motility was 37.3±3.5, that of sperm with progressive motility 13.4±3.6, and that of HOS+ cells 37.7±3.5. Nuclear parameters did not correlate significantly between each other or with the other sperm parameters studied. Total motility had correlation with: progressive motility, sperm viability, HOS test and total motility and HOS test after Thermoresistance Test. Consequently, combining different complementary tests would improve estimations of semen boar quality.

  16. Effects of Feeding on Semen Production in Native Cock in Bangladesh

    Directory of Open Access Journals (Sweden)

    S.K. Das

    2002-01-01

    Full Text Available To determine the effects of feeding on semen production 24 native cocks (Gallus domesticus were studied under cage method in BAU poultry farm. Among 24 birds, 6 were fed once daily, 6 were fed twice daily, 6 were fed thrice daily and another 6 were fed adlibitumly. Semen was collected by abdominal massage method avoiding any fear and disturbance to the birds. Experiment showed that birds fed once daily produce less amount at semen than the birds fed twice daily, semen of which also less than the birds fed thrice daily and finally the adlibitum group produce the highest amount of semen. Thus the present study revealed that semen production in native cock is positively correlated to feeding. Furthermore, semen production is also related to the age of the cocks.

  17. Selected qualitative and biochemical parameters of cryopreserved semen of Holstein-Friesian (HF) AI bulls.

    Science.gov (United States)

    Lecewicz, M; Hering, D M; Kami?ski, S; Majewska, A; Kordan, W

    2015-01-01

    Selected qualitative and biochemical parameters were determined in cryopreserved semen used for artificial insemination, sampled from 120 bulls reared at the Animal Breeding and Insemination Center in Bydgoszcz. The total average motility of the analyzed sperm samples was determined at 62.51%. The percentage of motile spermatozoa displaying progressive forward motility was 21.65%. Analyzed samples were characterized by a high percentage of sperm cells with a intact plasma membrane (71.21%) and active mitochondria (71.32%). High efficiency of the enzymatic antioxidant system of the evaluated sperm cells was demonstrated by high activity of CAT, GPx and SOD (494.37, 2847.83 and 5.31U/1x10(9) spermatozoa, respectively) values and low values of the DNA Fragmentation Index (9.32). The results of the study, obtained with the involvement of advanced analytical methods, indicate a high fertilizing capability of the analyzed sperm samples. PMID:25928933

  18. Seasonal variation in protein profiles and HSP70 of Holstein crossbred bull semen

    International Nuclear Information System (INIS)

    Since HSP70 is the stress response protein, the impact of heat stress on semen quality may be displayed through the expression of protein profile and HSP70. This study investigated the seasonal effects on the protein profiles and HSP70 in spermatozoa and seminal plasma of 10 Holstein crossbred bulls from an AI centre located in Lopburi, Thailand. Bull semen was collected weekly for 8 consecutive weeks during rainy (average THI 79.34), cool (average THI 75.27), and summer (average THI 80.10) seasons. Protein was extracted from both spermatozoa and seminal plasma using Laemmli's sample buffer. The protein profiles of spermatozoa and seminal plasma were subjected to one-dimensional SDSPAGE with 12% (w/v) acrylamide gel and 4.0% (w/v) acrylamide stacking gel for 120 min. at 8 mA. To visualize the protein profiles, gels were fixed in acetic acid: ethanol: H2O (7: 40: 53), stained with 0.125% (w/v) Coomassie blue R-250 in acetic acid: ethanol: H2O (7: 40: 53) for 60 min., and distained with acetic acid: ethanol: H2O (11: 26: 63) until the background was clear. Western blotting, as described by Kamaruddin et al. was conducted to determine HSP70 using anti-HSP70 monoclonal antibody. Proteins in the polyacrylamide gel were electrophoretically transferred, for 90 min. at 156 mA, to a PVDF membrane. The membrane was rinsed in PBS and blocked overnight in a blocking solution (advanced ECL blocking; Amersham Life Science Inc., Oakville, ON, Canada). The membrane was then incubated for 1 h at room temperature with monoclonal anti-HSP70 (H5147 Sigma Chemical Supplies CO., LTD), incubated with anti-mouse IgG horse radish peroxidase conjugated for 1 h at room temperature, and then detection for immunoreactive bands using ECL detection reagents (Amersham Life Science Inc.) on scientific imaging film. It was found that the profiles of protein were not different among seasons in both sperm and seminal plasma. The profiles of spermatozoa protein range from 10 to 220 kDa while most of proteins found in seminal plasma were low molecular weight (14-30 kDa). The HSP70 was found in both sperm and seminal plasma. However, the amount of HSP70 in winter appears to be greater compare to those found in summer and rainy seasons

  19. Seasonal variation in semen quality of Dorper rams using different collection techniques

    Scientific Electronic Library Online (English)

    C.M., Malejane; J.P.C., Greyling; M.B., Raito.

    2014-01-01

    Full Text Available The aim of the study was to evaluate the seasonal variation in semen quality of Dorper rams using different semen collection techniques. The study was carried out from January 2012 to January 2013. A general management programme for health control was followed, with water being provided ad libitum t [...] hroughout the trial, and all rams being fed a 2.5 kg maintenance diet per day. Eleven mature Dorper rams, recording a mean body weight of 69.6 ± 9.2 kg and mean age of 18 ± 4.7 months, were used in the trial. A group of six rams were trained for semen collection with the aid of the artificial vagina (AV), while in the remaining five rams, semen was collected using the electro ejaculator (EE). Immediately after collection, ejaculates were evaluated macroscopically and microscopically for semen volume, semen colour, semen pH, semen wave motion, sperm motility, sperm cell concentration, sperm viability and morphology. The results of the trial generally showed that semen in Dorper rams may be collected using the AV or EE methods throughout the year. However, an overall significant better semen quality collected by the AV versus the EE collection method was recorded. Generally, semen of significantly higher quality was recorded in summer, autumn and spring (both collection techniques). The tendency in the current trial was that the EE technique of semen collection was the less reliable method. Consequently the AV is recommended as the more acceptable method of semen collection in the Dorper. Winter is not generally recommended for semen collection, especially when using the EE.

  20. Association between nitric oxide and 8-hydroxydeoxyguanosine levels in semen of diabetic men.

    Science.gov (United States)

    Amiri, Iraj; Karimi, Jamshid; Piri, Hossein; Goodarzi, Mohammad Taghi; Tavilani, Heidar; Khodadadi, Iraj; Ghorbani, Marziye

    2011-12-01

    The incidence of diabetes mellitus is rapidly increasing in the world. One of the complications of diabetes includes disturbance of the reproductive tract, such as infertility, erectile dysfunction, and endocrine disruption. Nitric oxide (NO) is a free radical produced by most cells including the human male and female reproductive tracts. NO has a dual role where low concentrations are essential for homeostatic cellular biology and physiology, but high levels have detrimental effects relating to cellular damage from this reactive oxygen species (ROS). 8-hydroxydeoxyguanosine (8-OHdG) is an oxidized nucleoside of DNA that is currently used as a biomarker of cellular oxidative stress, where urinary levels can correlate with diabetic nephropathy and retinopathy. Our aim was to investigate the relationship between nitrate/nitrite levels and 8-OHdG levels in the semen of diabetic and non-diabetic men. Concentrations of nitrate/nitrite and 8-OHdG were examined in seminal plasma of 32 diabetic and 35 non-diabetic men. The level of nitrate/nitrite was assayed by colorimetric reaction and 8-OHdG was measured by ELISA. Our results showed that the seminal plasma nitrate/nitrite levels were significantly higher in the diabetic group (p?diabetic men compared to non-diabetic men (p?diabetic men, nitrate/nitrite levels correlated well with 8-OHdG levels (r?=?0.64, p?sperm parameters was not observed. Our data suggests that high levels of nitrate/nitrite in the semen of diabetic men is suggestive of reactive oxygen species induced DNA damage that is correlated with 8-OHdG levels but not sperm parameters. These results support the further investigation of NO and 8-OHdG as biomarkers for assessing male infertility. PMID:22047525

  1. Excretion of lumpy skin disease virus in bull semen.

    Science.gov (United States)

    Irons, P C; Tuppurainen, E S M; Venter, E H

    2005-03-15

    This work was done to establish the incidence and duration of excretion of lumpy skin disease virus (LSDV) in semen of experimentally infected susceptible bulls. Six serologically negative bulls 11-20 months of age were experimentally infected with a virulent field isolate (strain V248/93) of LSDV. Animals were observed for the development of clinical signs, blood was collected until day 90 after infection, and semen was collected every second day until day 18, then twice a week till day 63 and twice a month until three consecutive samples were negative when tested for LSDV by polymerase chain reaction (PCR). An aliquot of each sample which tested positive using PCR was inoculated onto cell monolayers for the recovery of virus. Two bulls developed severe lumpy skin disease (LSD), two bulls showed mild signs and two bulls showed a transient fever only. Multiple samples were positive on PCR from both of the severely affected bulls and one of the mildly affected bulls; between days 10 and 159, days 8 and 132, and days 10 and 21 respectively. Only one sample from each of the other three bulls was positive on PCR. Virus was only isolated from two samples from one of the severely affected bulls and from five semen samples from the other. This study confirmed the excretion of LSDV in bovine semen for prolonged periods, even when obvious clinical signs of the disease were no longer apparent. PMID:15725437

  2. Processing, selecting and ritualizing: ambivalent relationships to semen.

    Science.gov (United States)

    Murphy, Dean A

    2015-05-01

    Two articles on human immunodeficiency virus (HIV) and reproduction have recently been published in Reproductive BioMedicine Online, both describing developments that increase reproductive options for HIV-positive men. A study of a semen-processing technique used at a South African hospital found that two out of 103 processed samples tested positive for HIV DNA and none for RNA, indicating 98.1% and 100% effectiveness, respectively. The authors recommend semen processing followed by viral validation of processed sperm samples when providing assisted reproduction treatment to couples with an HIV-positive male partner. The other article reviews developments such as semen processing, antiretroviral (ARV) therapy and pre-exposure prophylaxis (PrEP), which have all reduced the risk of HIV transmission in the context of reproduction. The author also notes, however, that research on fertility in the context of HIV focuses almost exclusively on heterosexual couples, and has overlooked the links between reproduction, HIV and homosexuality. This article analyses the ambivalent role of semen - associated with both reproduction and infection - and how reproductive medicine and health care in different ways seek to 'get hold' of sperm. By taking this analytic approach, sex and parenthood can be thought of as two different but related kinds of intimacy and kinship. PMID:25773527

  3. THE CURRENT STATE OF SEMEN STORAGE AND AI TECHNOLOGY

    Science.gov (United States)

    Turkeys are the only commercial livestock species completely dependent upon artificial insemination (AI) for fertile egg production. Given that every breeder hen must be inseminated weekly during egg production, AI is both time and labor-intensive. Methods for the timing, frequency, semen dosage a...

  4. [Comparison of phospholipid in crude and fried semen Dolichos Lablab].

    Science.gov (United States)

    Xu, Y; Wang, Y; Tao, C

    1991-09-01

    A study of the chemical changes of phospholipid in crude and fried semen Dolichos Lablab was carried out by molybdenum blue colorimetry and TLC scanning. The result shows that both the total phospholipid contents and the molar fraction of phosphatidylcholine in the fried samples are decreased as compared with the crude ones. PMID:1804199

  5. Effect of various levels of catalase antioxidant in semen extenders on lipid peroxidation and semen quality after the freeze-thawing bull semen

    Directory of Open Access Journals (Sweden)

    Reza Asadpour

    2011-11-01

    Full Text Available The objective of this study was to evaluate effect of different concentrations of catalase in two extenders on motility, viability and lipid peroxidation bull spermatozoa during semen freezing process. Thirty ejaculates collected from ten Holstein bulls were pooled and evaluated at 37 °C. Pool ejaculated was split into two main experimental groups, 1 and 2. In experiment 1, specimen was diluted to a final concentration of 30 × 106 spermatozoa with citrate-egg yolk and in experiment 2; specimen was diluted with tris-egg yolk extender to the same concentration. In both experiments diluted semen was divided into three aliquots, including a control and two test groups. Each aliquot was rediluted with an equal volume of extender either without (control or with one of the antioxidants contained one of the following antioxidants: catalase (CAT; 100 IU mL-1 catalase (CAT; 200 IU mL-1 and control group. No significant differences were observed in sperm viability and motility following addition of catalase enzyme at concentration of 100 IU mL-1 and 200 IU mL-1 to citrate-egg yolk extender. But the highest sperm viability was achieved by addition of 100 IU mL-1 and 200 IU mL-1 catalase to tris-egg yolk semen extender compared with the control group (P < 0.05. Malondialdehyde levels did not change with addition of catalase in both extenders compared with the control group. The obtained results provide a new approach to the cryopreservation of bull semen, and could positively contribute to intensive cattle production.

  6. Effect of various levels of catalase antioxidant in semen extenders on lipid peroxidation and semen quality after the freeze-thawing bull semen

    OpenAIRE

    Reza Asadpour; Razi Jafari; Hossein Tayefi - Nasrabadi

    2011-01-01

    The objective of this study was to evaluate effect of different concentrations of catalase in two extenders on motility, viability and lipid peroxidation bull spermatozoa during semen freezing process. Thirty ejaculates collected from ten Holstein bulls were pooled and evaluated at 37 °C. Pool ejaculated was split into two main experimental groups, 1 and 2. In experiment 1, specimen was diluted to a final concentration of 30 × 106 spermatozoa with citrate-egg yolk and in experiment 2; specime...

  7. Inseminación artificial de alpacas con semen colectado por aspiración vaginal y vagina artificial / Artificial insemination of alpacas with semen collected by vaginal aspiration and by artificial vagina

    Scientific Electronic Library Online (English)

    Virgilio, Alarcón B; Wilber, García V; P. Walter, Bravo.

    Full Text Available Semen de alpaca fue colectado por dos métodos: por aspiración de la vagina de la hembra después de la monta natural y con vagina artificial. El semen colectado fue evaluado y diluido con Tris tamponado, y luego usado en inseminacion artificial. Se trabajó con 160 alpacas hembras adultas de capacidad [...] reproductiva comprobada y 5 alpacas machos. Se colectó semen post cópula de los cinco machos en 10 hembras, y se hicieron 50 colecciones de semen con vagina artificial de estos machos, dos veces por semana. Se determinó volumen, motilidad, concentración espermática, porcentaje de espermatozoides vivos, viscosidad y color. Los resultados para semen colectado por aspiración de la vagina y con vaginal artificial fueron: volumen (3.6 y 1.5 mL), motilidad (73.4 y 69.0%), concentración espermática (75.2 y 80.3 millones/mL), espermatozoides vivos (75.3 y 70.8%), respectivamente, con diferencia entre métodos (p Abstract in english Semen from alpacas was collected by two methods: by aspiration from the female’s vagina following mating and with an artificial vagina. Semen was collected, evaluated and extended with Tris buffer, and then used in artificial insemination. Altogether 160 female alpacas with proven reproductive histo [...] ry and five males were used. Semen was collected by vaginal aspiration from 10 females using five males as semen donors; likewise, semen from the same males was collected with an artificial vagina twice a week 50 times. Volume, motility, spermatic concentration, live spermatozoa, viscosity and color was evaluated. Seminal characteristics of semen collected by aspiration and with an artificial vagina were: volume (3.6 and 1.5 mL), motility (73.4 and 69.0%), sperm concentration (75.2 and 80.3 million/mL), live spermatozoa (75.3 and 70.8%) respectively, with statistical difference between methods (p

  8. The influence of boar breed and season on semen parameters

    Scientific Electronic Library Online (English)

    D., Knecht; S., & #346; rodo& #324; ; K., Duzi& #324; ski.

    2014-01-01

    Full Text Available The aim of the present study was to demonstrate the influence of boar breed and season on semen parameters. The research material consisted of 31 boars: Polish Large White (PLW), Polish Landrace (PL), and Duroc x Pietrain (D x P), aged 8 to 24 months. The analysed material consisted of 1390 ejaculat [...] es, collected during the period January 2010 to October 2012. Semen samples were assessed in terms of semen volume (mL), sperm concentration (x 10(6) m/mL), total number of sperm (x 10(9)), total number of live sperm (x 10(9)) and number of insemination doses obtained from one ejaculate (n). In winter, an increase in sperm concentration was observed for the PLW breed. Moreover, an increase in the volume of semen produced for this breed was noted in summer and autumn. Differences between breeds for the total number of sperm and total number of live sperm were observed for the winter and spring periods. The largest semen volume was noted for the PLW breed (276.4 ± 9.66 mL). However, in the analysis of other sperm parameters, boars of this breed demonstrated the poorest results. The highest insemination dose was obtained from breed D x P in winter (26.0 ± 0.51). Correlation analyses indicated that PLW and D x P boars are the least resistant to higher ambient temperatures, and in summer and autumn this resulted in a reduction in sperm concentration (-0.26 and -0.20, respectively).

  9. New extender for cryopreservation of Siberian sturgeon (Acipenser baerii) semen.

    Science.gov (United States)

    Judycka, S; Szczepkowski, M; Ciereszko, A; Dietrich, G J

    2015-04-01

    The goal of this study was to develop a simple glucose-methanol extender for cryopreservation of Siberian sturgeon (Acipenser baerii) semen. Semen quality was assessed by determining post-thaw sperm motility and fertilizing ability at hatching stage. We tested the effect of glucose concentration (0, 0.10, 0.15, 0.20 and 0.30 M) in a methanol extender on post-thaw sperm motility. Sperm motility parameters and fertilizing ability of semen cryopreserved in 0.1 M glucose in 15% methanol (GM) were compared to previously described Tris-sucrose-KCl in 10% - methanol extender (TSKM). Additionally, sperm motility and fertilizing ability in relation to 30 min equilibration in GM extender before cryopreservation and 30 min of post-thaw storage were determined. The beneficial effect of the glucose for semen cryopreservation was related to its concentration with a quite narrow optimum of 0.1 to -0.15 M. The fertilization rates of frozen/thawed sperm were similar for both (TSKM and GM) tested extenders. The sperm motility and fertilization rate were not affected either by 30 min equilibration in GM extender or by 30 min of post-thaw storage. Our work indicates that the use a simple extender consisting of 0.1M glucose in 15% methanol can be an alternative cryopreservation method to those previously described for sturgeons. The use of an equilibration period and the possibility of post-thaw semen storage can improve organization of hatchery work and help with logistics of large-scale hatchery operations. PMID:25725469

  10. Study on the effect of prostaglandin F2? treatment on semen characteristics and enzymatic activates of Awassi rams in breeding and non breeding seasons

    Directory of Open Access Journals (Sweden)

    Osama Ibrahim Azawi,

    2011-05-01

    Full Text Available The purpose of this research work was to determine the effects of PGF2?, given immediately before semen collection, on semen characteristics and libido in Awassi rams during breeding and non breeding season. The experiment was conducted in late summer to early autumn when major breeding activities commence and winter during the non breeding season at Mosul region in northern Iraq at the Animal Research and Practice Farm of the College of The Veterinary Medicine, University of Mosul. Twelve mature Awassi rams were used in this study. Animals were randomly allocated into two equal groups, the first group was administered 7.5 mg IM of PGF2?weekly and the second group as a control group received 1 ml of N-saline solution. Semen samples were collected from the Awassi rams 24 h after IM administration. Scrotal circumference (SC and testicular volume were measured weekly during the study period. Semen ejaculates were evaluated for semen volume, sperm concentration, sperm concentration/ejaculate, mass motility, individual motility, percentage live sperm, sperm abnormalities, and sperm acrosomal defects. Samples of seminal plasma were analyzed for the estimation of alanine amino transferase (ALT, aspartate amino transferase (AST, acid phosphatase (ACP, alkaline phosphatase (ALP and lactic dehydrogenase (LDH. Results of the present showed that PGF2? treatment to Awassi rams did not improve most semen characteristics in both breeding and non breeding seasons compared with the group. The only improvement of Awassi semen quality observed was in sperm concentration in the breeding season. The testicular volume showed a significant increase (P<0.05 in Awassi rams treated with PGF2? in breeding season compared to the control group and PGF2? treated group in the non breeding season. The mean activity of LDH enzyme estimated in the PGF2?treated group and control group showed a significant difference (P<0.05 between the two groups in the breeding season and non breeding season (52.34 ± 8.96 and 57.43 ± 19.9 vs. 117.02 ± 5.26 and 131.88 ± 5.01, respectively. Other enzymatic activities including ALT, AST, ACP and ALP showed no significant differences between Awassi rams treated with PGF2? and control groups in both breeding and non breeding seasons. In conclusion, PGF2?treatment of Awassi rams improved sperm concentration and testicular volume

  11. plasmas

    Science.gov (United States)

    Zhang, H. Y.; Jin, C. G.; Yang, Y.; Ye, C.; Zhuge, L. J.; Wu, X. M.

    2014-12-01

    As-deposited HfO2 films were modified by CHF3, C4F8, and mixed C4F8/O2 plasmas in a dual-frequency capacitively coupled plasma chamber driven by radio frequency generators of 60 MHz as the high frequency (HF) source and 2 MHz as the low frequency source (60/2 MHz). The influences of various surface plasma treatments under CHF3, C4F8, and C4F8/O2 were investigated in order to understand the chemical and structural changes in thin-film systems, as well as their influence on the electrical properties. Fluorine atoms were incorporated into the HfO2 films by either CHF3 or C4F8 plasma treatment; meanwhile, the C/F films were formed on the surface of the HfO2 films. The formation of C/F layers decreased the k value of the gate stacks because of its low dielectric constant. However, the addition of O2 gas in the discharge gases suppressed the formation of C/F layers. After thermal annealing, tetragonal HfO2 phase was investigated in both samples treated with CHF3 and C4F8 plasmas. However, the samples treated with O-rich plasmas showed monoclinic phase, which indicated that the addition of O plasmas could influence the Hf/O ratio of the HfO2 films. The mechanism of the t-HfO2 formation was attributed to oxygen insufficiency generated by the incorporation of F atoms. The capacitors treated with C4F8/O2 plasmas displayed the highest k value, which ascribed that the C/F layers were suppressed and the tetragonal phase of HfO2 was formed. Good electrical properties, especially on the hysteresis voltage and frequency dispersion, were obtained because the bulk traps were passivated by the incorporation of F atoms. However, the H-related traps were generated during the CHF3 plasma treatments, which caused the performance degradation. All the treated samples showed lower leakage current density than the as-deposited HfO2 films at negative bias due to the reduced trap-assisted tunneling by the incorporation of F to block the electrons transferring from metal electrode to the trap level.

  12. Uso de dilutores hipertónicos en la criopreservación de semen ovino / Hypertonic extenders in the cryopreservation of ovine semen

    Scientific Electronic Library Online (English)

    Hernán, Guerrero V.; Wilfredo, Huanca L.; Fernando, Raymundo T.; Sandra, Huerta O.; Daphne, Ramos D..

    Full Text Available Se evaluó el efecto crioprotector de dos dilutores hipertónicos (Trealosa y Lactosa) sobre las características postdescongelamiento del semen ovino (n=4). La composición de los dilutores base incluyó Tris 27.1 g/l, ácido cítrico 14.0 g/l, fructosa 10.0 g/l, glicina 10.0 g/l, yema de huevo 10.0 % (v/ [...] v) y glicerol 6.5 % (v/v). El semen colectado con vagina artificial tuvo las siguientes características: volumen: 1.1 ± 0.1ml, concentración espermática: 3.5 ± 0.1 x 109/ml, motilidad individual: 87.0 ± 2.4%, motilidad masal (escala 0- 5): 4.4 ± 0.2, espermatozoides vivos: 90.2 ± 3.8% y anormales 1.8 ± 0.7%. El semen fue congelado en pajillas de 0.5 ml y conservado en nitrógeno líquido. Las pajillas fueron descongeladas luego de 3 meses para su evaluación. Se obtuvo una motilidad individual de 40.3 ± 5.9 y 30.0 ± 5.0% y un número de espermatozoides vivos de 34.4 ± 6.6 y 24.4 ± 5.0 para los dilutores Trealosa y Lactosa, respectivamente. El mejor resultado se obtuvo al utilizar el dilutor hipertónico Trealosa por tener mejores características de motilidad individual y espermatozoides vivos postdescongelamiento. Abstract in english The cryoprotectant effect of two hypertonic extenders (trehalose and lactose) on the post-thawing characteristics of ram semen (n=4) was evaluated. The extender composition included Tris 27.1 g/l, Citric acid 14.0 g/l, Fructose 10.0 g/l, Glycine 10.0 g/l, egg yolk 10.0% (v/v) and Glycerol 6.5% (v/v) [...] . Semen was collected in an artificial vagina. Seminal characteristics were: volume: 1.1 ± 0.1 ml, sperm concentration: 3.50 ± 0.1 x 109/ml, individual motility: 87.0 ± 2.4%, wave motility (scale 0-5): 4.4 ± 0.2, live sperms: 90.2 ± 3.8%, and abnormal sperms: 1.8 ± 0.7%. Semen was frozen in 0.5 ml straws and stored in liquid nitrogen. Straws were thawed after 3 months. Results of post-thawing evaluation were: individual motility: 40.3 ± 5.9 and 30.0 ± 5.0%, and live sperms: 34.4 ± 6.6 and 24.3 ± 5.0% for the Trehalose and Lactose extenders respectively. Results showed a better ram semen cryopreservation when the Trehalose extender was used.

  13. Critical sources of bacterial contamination and adoption of standard sanitary protocol during semen collection and processing in Semen Station

    Directory of Open Access Journals (Sweden)

    Chandrahas Sannat

    2015-05-01

    Full Text Available Aim: The present investigation was conducted to locate the critical sources of bacterial contamination and to evaluate the standard sanitation protocol so as to improve the hygienic conditions during collection, evaluation, and processing of bull semen in the Semen Station. Materials and Methods: The study compared two different hygienic procedures during the collection, evaluation and processing of semen in Central Semen Station, Anjora, Durg. Routinely used materials including artificial vagina (AV inner liner, cone, semen collection tube, buffer, extender/diluter, straws; and the laboratory environment like processing lab, pass box and laminar air flow (LAF cabinet of extender preparation lab, processing lab, sealing filling machine, and bacteriological lab were subjected to bacteriological examination in two phases of study using two different sanitary protocols. Bacterial load in above items/environment was measured using standard plate count method and expressed as colony forming unit (CFU. Results: Bacterial load in a laboratory environment and AV equipments during two different sanitary protocol in present investigation differed highly significantly (p<0.001. Potential sources of bacterial contamination during semen collection and processing included laboratory environment like processing lab, pass box, and LAF cabinets; AV equipments, including AV Liner and cone. Bacterial load was reduced highly significantly (p<0.001 in AV liner (from 2.33±0.67 to 0.50±0.52, cone (from 4.16±1.20 to 1.91±0.55, and extender (from 1.33±0.38 to 0 after application of improved practices of packaging, handling, and sterilization in Phase II of study. Glasswares, buffers, and straws showed nil bacterial contamination in both the phases of study. With slight modification in fumigation protocol (formalin @600 ml/1000 ft3, bacterial load was significantly decreased (p<0.001 up to 0-6 CFU in processing lab (from 6.43±1.34 to 2.86±0.59, pass box (from 12.13±2.53 to 3.78±0.79, and nil bacterial load was reported in LAFs. Conclusion: Appropriate and careful management considering critical points step by step starting right from collection of semen to their processing can significantly minimize bacterial contamination.

  14. Air pollution and decreased semen quality: A comparative study of Chongqing urban and rural areas

    International Nuclear Information System (INIS)

    To investigate the association and effects of air pollution level on male semen quality in urban and rural areas, this study examines the outdoor concentrations of particulate matter (PM10), sulfur dioxide (SO2), nitrous dioxide (NO2) and semen quality outcomes for 1346 volunteers in both urban and rural areas in Chongqing, China. We found the urban area has a higher pollution level than the rural area, contrasted with better semen quality in the rural residents, especially for sperm morphology and computer assistant semen analysis (CASA) motility parameters. A multivariate linear regression analysis demonstrates that concentrations of PM10, SO2, and NO2 significantly and negatively are associated with normal sperm morphology percentage (P 10, SO2, and NO2 in urban ambient air may account for worse semen quality in urban males. - Highlights: • We investigate the distributions of PM10, SO2 and NO2 in urban and rural areas in Chongqing, China. • We explore the associations of air pollution and male semen quality. • The concentrations of PM10, SO2, and NO2 are significantly higher in urban areas. • Median values of some semen quality parameters in rural male were higher than urban male. • PM10, SO2, and NO2 were negatively associated with semen quality parameters. - Air pollution is higher in the urban area while there is better semen quality in rural males. Polluted air may thus account for worse semen quality in urban males

  15. Evaluación del sistema antioxidante en el semen normal / Evaluation of antioxidant system in normal semen

    Scientific Electronic Library Online (English)

    Juan M., Gallardo.

    2007-02-01

    Full Text Available Antecedentes. Las especies reactivas del oxígeno (ERO), tienen la capacidad de alterar reversible o irreversiblemente la función celular. Se ha propuesto que las ERO modifican la bioquímica y la fisiología del espermatozoide. Por otro lado, los mecanismos antioxidativos pudieran proteger a los esper [...] matozoides del daño producido por las ERO. Objetivo. Determinar los valores normales para el superóxido dismutasa (SOD), glutatión peroxidasa (GPx), malondialdehído (MDA) y óxido nítrico (NOx) en el líquido seminal y espermatozoides de humanos sanos. Procedimientos. Se estudiaron 45 muestras de semen de sujetos aparentemente sanos. Las muestras se obtuvieron por masturbación y se colectaron en tubos estériles. Una vez centrifugadas, se fraccionaron en alícuotas para medir la concentración de SOD, GPx, MDA y NOx. El análisis de las muestras se realizó conforme a métodos bioquímicos ampliamente aceptados. Resultados. Las concentraciones de SOD y MDA en el líquido seminal como en los espermatozoides fueron similares (SOD 0.43 ± 0.09 en semen y 0.45 ± .07 U/mg prot. en espermatozoides, y MDA 0.33 ± .07 y 0.37 ± 0.10 nmoles/mg prot. en líquido seminal y espermatozoides, respectivamente. Con respecto a la GPx, está aumentada casi 13 veces más en los espermatozoides (2547.77 ± 48.59 U/mg prot.) que en el líquido seminal (197.54 ± 25.21 U/mg prot.), el NOx también se incrementa ligeramente en los espermatozoides (4.45 ± 0.43 µmol) cuando se compara con el líquido seminal (3.91 ± 0.16 µmol). Conclusiones. La medición de los antioxidantes y oxidantes pudieran servir para evaluar la infertilidad humana en aquellos casos donde los resultados de la espermatobioscopia aparezcan como normales. Abstract in english Background. Reactive oxygen species (ROS) formation have the ability to alter reversibly or irreversibly the cellular function in humans. It has been proposed that the ROS alters the biochemistry and the physiology of the sperm. On the other hand, the antioxidative mechanisms could protect the sperm [...] s from the damage produced by free radicals. Aim. To determine the normal values for superoxide dismutase (SOD), glutathione peroxidase (GPx), malondialdehyde (MDA) and nitric oxide (NOx) in the seminal liquid of healthy humans. Procedures. Semen samples from 45 healthy men (22 to 47 years of age) were studied. The samples were obtained by masturbation and were collected in conical sterile tubes. Once centrifuged at 4 °C they were divided in aliquots to measure the concentration of SOD, GPx, MDA, and NOx. The analysis of the samples was realized in conformity with biochemical widely accepted methods. Results. The concentrations of SOD and MDA both in the seminal liquid and in the spermatozoids were similar, SOD 0.43 ± 0.09 U/mg prot. in the seminal liquid and 0.45 ± 0.07 U/ mg prot. in spermatozoids, and MDA 0.33 ± 0.07 nmoles/mg prot. and 0.37 ± 0.10 nmoles/mg prot. in the seminal liquid and spermatozoids respectively. With regard to GPx it increased almost 13 times more in the spermatozoids (2547.77 ± 48.59 U/mg prot.) than in the seminal liquid (197.54 ± 25.21 U/mg prot.). The NOx also increased lightly in the spermatozoids (4.45 ± 0.43 \\imol) when compared with the seminal liquid (3.91 ± 0.16 \\imol). Conclusions. The measurement of the antioxidative and oxidative agents could serve to evaluate human infertility in those cases where the result of the spematobioscopy appears normal.

  16. Functional characterisation of semen in honeybee queen (A.m.ligustica S. spermatheca and efficiency of the diluted semen technique in instrumental insemination

    Directory of Open Access Journals (Sweden)

    Andrea Galli

    2010-01-01

    Full Text Available Differences over time in the quality of semen present in the honey bee (Apis mellifera ligustica queen spermatheca werestudied. An increase in the non-vital spermatozoa was shown to be evident (P>0.05 between the 12th and 24th month.The study of semen viability demonstrated that the passage of the semen to the spermatheca is due to sperm motility.In the queen inseminated with non-viable spermatozoa, no semen was detected in the spermatheca. Queens inseminatedtwice with a Hyes solution/semen mixture (1:1 stored as many spermatozoa in their spermatheca as those inseminatedonce with the classic technique. Queen replacement, oviposition and other functional characteristics were similarto those observed in the classic insemination procedure.

  17. Clinical and biochemical correlates of successful semen collection for cryopreservation from 12-18-year-old patients: a single-center study of 86 adolescents

    DEFF Research Database (Denmark)

    Hagenäs, Isabella; JØrgensen, Niels

    2010-01-01

    Cryopreservation of semen should be offered to adults before gonadotoxic treatment. However, the experience with semen collection in adolescents is still limited. The objective of this study was to evaluate potential correlates of successful semen sampling in adolescents.

  18. Semen Characteristics of Three Strains of Local Cocks in the Humid Tropical Environment of Nigeria

    Directory of Open Access Journals (Sweden)

    F.O. Ajayi

    2011-06-01

    Full Text Available The study was conducted to determine the semen characteristics of three genotypes of Nigerian indigenous cocks. Thirty Six (36 local breeding cocks comprising of 12 frizzle, 12 normal and 12 naked neck selected randomly from the poultry breeding unit of the University of Port Harcourt Teaching and Research farm was used for this study. Semen were collected from them by abdominal massage and analyzed for semen characteristics. Semen concentration were significantly higher in naked- neck 4.86×109 ±0.03/mL (p0.05 of strains on semen pH, abnormal sperm and non-motile sperm. Morphological defects of the head, middle and tail was not significantly affected (p>0.05 by the genotypes. Variations on semen characteristics abound in the three Nigerian indigenous cocks sampled.

  19. Influence of Deficiency or Supplementary Selenium and a- Tochopherol (Vitamin E) In The Diet of Pubertal Male Zaraibi Goats on Fertility, Semen Quality and Testicular Traits

    International Nuclear Information System (INIS)

    Twenty pubertal male Zaraibi goats (bucks) were randomly divided into four equal groups; fed deficient Se or vit. E, adequate Se, adequate vit. E and adequate Se + vit. E diets for 3 months to study the influence of deficient or adequate selenium (Se) and vitamin E (vit. E) in the diet of pubertal male Zaraibi goats on fertility, semen quantity and quality and some testicular traits. The results showed that the best values of semen quantity (the ejaculate volume, sperm concentration and total sperm output per ejaculate) and semen quality (percentage of progressive motility, percentage of live sperm, number of motile sperm per ejaculate, percentage of dead, abnormal spermatozoa and acrosomal abnormality) were observed in bucks fed diet supplemented with adequate Se combined with adequate vit. E. The lowest values of semen quantity and semen quality were observed in bucks suffering from deficiency of Se and/or vit. E in their diets. Testosterone level in seminal plasma was significantly higher in bucks fed adequate Se and/or vit. E than those fed diet deficient in Se and vit. E. Testosterone level was significantly higher in bucks fed diet adequate in Se + vit. E than those fed diet adequate with Se or vit. E alone. Se and vit. E deficiency in the diets was accompanied by a significant decrease in testosterone, T4 and T3 levels in seminal plasma. Selenium or vit. E each one alone supplementation led to increases of these hormones. T4 and T3 levels were significantly higher in bucks fed adequate Se or adequate Se + vit. E than in bucks fed diet with adequate vitamin E alone. Adequate Se alone and adequate Se + vit. E diets were accompanied by significant increases in Se in seminal plasma. Adequate vit. E and adequate Se + vit. E diets were accompanied by significant increase in vit. E level in the seminal plasma. It is clear that there was synergism between Se and vit. E in the biological role of Se, since the level of Se in bucks fed diet containing adequate Se + vit. E was higher than the level of Se in group fed Se alone. The highest values of scrotal circumference and scrotum length were observed in bucks fed adequate Se + vit. E and the lowest testicular traits and fertility were observed in bucks fed diet deficient with Se and vit. E.

  20. Efecto de la adición de cafeína y lactato sobre la motilidad del semen equino diluido en leche descremada-glucosa / Effect of caffeine and lactate addition on the motility of equine semen diluted in skim-glucose milk

    Scientific Electronic Library Online (English)

    Oscar, R. Wilde; Adolfo C, de la Vega; Maria L., Cruz.

    2004-01-01

    Full Text Available En equinos la inseminación artificial se practica mayormente con semen refrigerado por las dificultades que plantea la criopreservación. Para mejorar las condiciones de conservación a 5ºC se debe considerar el deterioro espermático post-recolección, puesto que componentes del plasma seminal complica [...] n la supervivencia de los espermatozoides con procesos oxidativos. Algunos compuestos tienen propiedades antioxidantes y mejoran notablemente la motilidad y la supervivencia espermática. En esta experiencia se utilizó lactato de sodio (2mM) y cafeína (10 mM) incorporados al momento de la dilución del semen y a las 48 h de almacenaje a 5ºC, en un extender de base leche descremada-glucosa, con el propósito de estudiar los efectos de estos compuestos sobre los espermatozoides. Incorporados al momento de la dilución, el lactato y la cafeína indujeron movimientos más vigorosos que las muestras sin aditivos desde el inicio. Cuando se agregaron a las 48 h de almacenaje a 5ºC, ambos aditivos produjeron una notable recuperación en la motilidad (49% vs. 31%). Cuando estas mismas muestras fueron cultivadas a 37ºC, a los 30 minutos de incubación aquellas sin aditivos tuvieron escasas formas móviles (5%), frente a las adicionadas con lactato (29%) y cafeína (40%). A los 60 minutos las muestras sin aditivos casi no registraron movimiento, en tanto que las restantes mantuvieron porcentajes elevados. En los tres casos se encontraron diferencias estadísticas (P Abstract in english In equines, artificial insemination is practiced mostly with the use of refrigerated semen due to the difficulties that comes with the preservation of frozen semen. To improve the conservation conditions at 5ºC (refrigerated semen) it is necessary to consider the spermatic deterioration after the ga [...] thering, because components of the seminal plasma complicate the survival of the sperm with oxidative processes. Some components have antioxidant properties and improve notably the spermatic motility and survival. In this experience sodium lactate (2 mM) and caffeine (10 mM) were incorporated at the moment of the dilution of the semen, and at 48 h of conservation at 5ºC in a skim milk - glucose bases extender, with the purpose of studying their effects on the sperm. Incorporated at the moment of the dilution, the lactate and the caffeine induced more vigorous movements than the samples without additives. When they were added at 48 h of preservation at 5ºC, both additives produced a remarkable recovery in the motility (49% vs. 31%). When these same samples were cultivated at 37ºC, at 30 minutes of incubation those without additives had scarce mobile forms (5%), and different from those added with lactate (29%) and caffeine (40%). At 60 minutes, the samples without additives hardly registered movement while the rest maintained the former percentages. In the three cases, there were found statistical differences (P

  1. Efecto de dos dilutores sobre la motilidad e integridad de la membrana espermática en semen congelado de ovinos / Effects of two semen extenders on motility and integrity of sperm membrane in ovine frozen semen

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V; Javier, Orellana Ch; César, Pantoja A.

    2010-07-01

    Full Text Available El presente estudio tuvo como objetivo evaluar el efecto de dos dilutores, Tris- Fructosa-Yema de huevo (Tris) y Citrato-Glucosa-Yema de huevo (citrato), sobre la motilidad espermática e integridad de la membrana espermática (HOST) en semen congelado de ovinos bajo la forma de pellets. La investigac [...] ión se llevó a cabo en el Banco de Semen de la Universidad Nacional Agraria La Molina, Lima, empleándose 4 carneros (2 Blackbelly y 2 Assaf) de 3.5 a 4 años de edad. Se empleó el análisis de covariancia para analizar Motilidad Individual Progresiva (MIP), y bloques completamente randomizados para medir el efecto de los dilutores sobre la integridad de la membrana espermática. Para el congelamiento del semen se utilizó hielo seco y el descongelamiento se realizó a 38 ºC en tubos de ensayo. En ovinos Assaf, la MIP del semen descongelado fue de 63.77 y 61.11% utilizando Tris y citrato, respectivamente, encontrándose diferencias significativas (p Abstract in english The objective of the study was to evaluate the effects of two semen extenders: Tris- Fructose-egg yolk (Tris) and Citrate-Glucose-egg yolk (citrate) on motility and sperm membrane integrity (HOST) in ovine frozen semen in pellets. The study was carried out at the Semen Bank of the Agrarian Universit [...] y La Molina, in Lima, Peru, using 4 rams (2 Assaf and 2 Blackbelly) of 3.5 to 4 years old. A covariance analysis was used to evaluate the effect of the treatment and breed on Individual Progressive Motility (IPM), and randomized block design to evaluate the effect of extenders on sperm membrane integrity. Semen was frozen of dry ice and thawing was done in test tubes at 38 °C. In the Assaf breed, IPM of thawed semen was 63.77 and 61.11% when using Tris and citrate respectively, showing statistical difference (p

  2. A Review of the Phytochemistry and Pharmacological Activities of Raphani Semen

    OpenAIRE

    Daniel Kam-Wah Mok; Shun-Wan Chan; Chi-On Chan; Yam-Fung Ng; Tung-Ting Sham; Ailsa Chui-Ying Yuen

    2013-01-01

    The dried ripe seed of Raphanus sativus L., commonly known as radish seed (or Raphani Semen), is used as traditional Chinese medicine (TCM) to treat constipation, chronic tracheitis, and hypertension. The major active compounds in Raphani Semen are alkaloids, glucosinolates, brassinosteroids, and flavonoids. Fatty acids are its main nutritional contents. Raphani Semen has been demonstrated to have beneficial effects on hypertension, obesity, diabetes mellitus, constipation, and cough. So far,...

  3. Is prenatal exposure to tobacco smoking a cause of poor semen quality?

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia Høst; Thulstrup, Ane Marie; Storgaard, Lone; Toft, Gunnar; Olsen, Jørn; Bonde, Jens Peter

    2007-01-01

    A few studies indicate that exposure to maternal smoking during fetal life decreases semen quality in adult life, but the results are inconsistent and retrospectively collected smoking data were used in most studies. From a Danish pregnancy cohort established in 1984-1987, 347 of 5,109 sons were selected according to their exposure to tobacco smoke in fetal life. From February 2005 to January 2006, a semen sample from the 347 men was analyzed for conventional semen characteristics according to s...

  4. The in vitro effect of leptin on semen quality of water b uffalo ( Bubalus bubalis ) bulls

    OpenAIRE

    Amir Khaki; Rooz Ali Batavani; Gholamreza Najafi

    2013-01-01

    The purpose of this study was to evaluate the probable effects of leptin addition indifferentlevels to the semen extender on sperm quality (motility and motility parameters,viability,sperm membrane integrity, and DNA damage). Semen specimens were evaluatedimmediately after leptin addition, equilibration time and after thawing the frozen semen.Fivehealthy buffalo bulls (5 ejaculates from each bull) were used.Each ejaculate was diluted at 37 ?Cwith tris-based extender containing 0 (control), 10...

  5. Semen quality and reproductive hormone levels in men from Southern Spain

    DEFF Research Database (Denmark)

    Fernandez, M F; Duran, I; Olea, N; Avivar, C; Vierula, M; Toppari, J; Skakkebaek, N E; Jørgensen, N

    2012-01-01

    In North European countries, a significant difference in semen quality among young men has been shown. Men from the western countries, Denmark, Germany and Norway, have lower semen quality than men from the eastern countries Finland, Estonia and Lithuania. Similarly, men in the western countries have a higher risk of testicular cancer. According to the testicular dysgenesis syndrome (TDS) concept that suggests a link between risk of impaired semen quality and increased risk of testicular cancer,...

  6. Selenium in Pig Nutrition and Reproduction: Boars and Semen Quality—A Review

    OpenAIRE

    Surai, Peter F; Fisinin, Vladimir I.

    2015-01-01

    Selenium plays an important role in boar nutrition via participating in selenoprotein synthesis. It seems likely that selenoproteins are central for antioxidant system regulation in the body. Se-dependent enzyme glutathione peroxidase (GSH-Px) is the most studied selenoprotein in swine production. However, roles of other selenoproteins in boar semen production and maintenance of semen quality also need to be studied. Boar semen is characterised by a high proportion of easily oxidized long cha...

  7. Human semen quality in relation to dietary pesticide exposure and organic diet

    DEFF Research Database (Denmark)

    Juhler, R. K.; Larsen, S. B.; Meyer, Otto A.; Jensen, N. D.; Spanò, M.; Givercman, A.; Bonde, J. P.

    1999-01-01

    The objective of the study was to corroborate or refute the hypothesis that farmers having a high intake of organic grown commodities have a high semen quality due to their expected lower level of dietary pesticides intake. Food frequency data and semen were collected from 256 farmers (171 traditional farmers and 85 organic farmers, overall participation rate: 32%) who were selected from central registers. Each farmer delivered one semen sample before the spraying season started. The farmers wer...

  8. Semen collection and evaluation of captive coatis (Nasua nasua

    Directory of Open Access Journals (Sweden)

    R.C.R. Paz

    2012-04-01

    Full Text Available Semen samples (n=105 were collected through eletroejaculation from six adult male coatis (Nasua nasua between January 2007 and December 2008 at Universidade Federal de Mato Grosso Zoo, Cuiabá, Brazil. Mean values were: volume (mL; concentration (sperm/mL; total motility (%; progressive sperm motility (scale, 0-5; live spermatozoa (%; acrossome integrity (%; primary defects (%; and secondary defects (%. There was high correlation between total motility and live sperm; total motility and progressive sperm motility; total motility and acrossome integrity; live sperm and progressive motility; live sperm and acrossome integrity and volume and concentration. The method for semen collection was considered safe and efficient. It can be used for the evaluation of breeding potential of coati in captivity and for the establishment of new assisted reproductive technology (ART for threatened neotropical carnivores species.

  9. Effects of age, season and genetics on semen and sperm production in Apis mellifera drones

    OpenAIRE

    Rhodes, John; Harden, Steven; Spooner-Hart,Robert; Anderson, Denis; Wheen, Gretchen

    2011-01-01

    Adult drone honey bees from 4 Australian breeding lines were reared under similar conditions and examined for semen and sperm production when 14, 21 and 35 days old, during spring, summer and autumn. Almost half (40.5%) of all drones examined did not release any semen when manually everted. For those that released semen, the average volume released per drone was 1.09 ?L (range 0.72 (±0.04)?1.12 (±0.04) ?L) and the average number of sperms in the semen per drone was 3.63 × 106 (range 1.88 (±0....

  10. Role of Semen on Vaginal HIV-1 Transmission and Maraviroc Protection.

    Science.gov (United States)

    Council, Olivia D; Swanson, Michael D; Spagnuolo, Rae Ann; Wahl, Angela; Garcia, J Victor

    2015-12-01

    We used bone marrow/liver/thymus (BLT) humanized mice to establish the effect of semen on vaginal HIV infection and on the efficacy of topically applied maraviroc. Our results demonstrate that vaginal transmission of cell-free HIV occurs efficiently in the presence of semen and that topically applied maraviroc efficiently prevents HIV transmission in the presence of semen. We also show that semen has no significant effect on the transmission of transmitted/founder viruses or cell-associated viruses. PMID:26392489

  11. Secretly connected? Anonymous semen donation, genetics and meanings of kinship

    OpenAIRE

    Speirs, Jennifer M

    2008-01-01

    The use of donated human semen in the UK was developed by medical practitioners as a means of circumventing male infertility and helping childless women to achieve a pregnancy. Uncertainty about the legal status of donor-conceived children and moral concerns about the possible effects on the marital relationship of the recipients worked to maintain donor insemination (DI) as a largely hidden practice in which the donors remained anonymous to the recipients and unrevealed to any resulting dono...

  12. Self-inflicted Chronic Bacterial Keratoconjunctivitis Using Self Semen

    OpenAIRE

    Eom, Youngsub; Kim, Young-Ho; Kim, Seung-hyun; Kim, Hyo Myung; Song, Jong-Suk

    2013-01-01

    This case report describes a case of self-inflicted chronic bacterial keratoconjunctivitis involving the patient's own semen. A 20-year-old male soldier was referred to our clinic for the evaluation of refractory chronic bacterial conjunctivitis. Over the previous 4 months, he had been treated for copious mucous discharge, conjunctival injection, and superficial punctate keratitis in both eyes at an army hospital and a local eye clinic. Despite the use of topical and systemic antibiotics acco...

  13. Effect of L-carnitine supplementation on drake semen quality

    Scientific Electronic Library Online (English)

    H.J., Al-Daraji; A.O., Tahir.

    2014-01-01

    Full Text Available This study was conducted to determine the effect on semen quality traits of supplementing the diets of Iraqi drakes with L-carnitine. Forty eight male Iraqi ducks, 30 weeks old, were randomly allocated to four treatments with 12 drakes per treatment group, replicated three times, with four drakes pe [...] r replicate. The treatment groups consisted of birds fed a diet free of L-carnitine (T1, control group); birds fed a diet containing 50 mg L-carnitine/kg diet (T2); birds fed a diet containing 100 mg L-carnitine/kg diet (T3); and birds fed a diet containing 150 mg L-carnitine/kg diet. The drakes were fed the experimental diets only during the experimental period, which lasted three months. The semen quality traits that were investigated were ejaculate volume, mass and individual motility of spermatozoa, spermatocrit, spermatozoa concentration, percentages of dead and abnormal spermatozoa and acrosomal abnormalities. Supplementing the diet of drakes with L-carnitine at the levels of 50 - 150 mg/kg diet significantly increased ejaculate volume, spermatocrit, mass and individual motility of spermatozoa, and concentration of spermatozoa, while percentages of dead and abnormal spermatozoa and acrosomal abnormalities were decreased. However, T4 (150 mg L-carnitine/kg diet) recorded the best results in relation to all semen quality traits included in this study. Dietary supplementation with L-carnitine improved the semen quality of local drakes; therefore L-carnitine can be used as an efficient feed additive to improve the reproductive performance of male ducks.

  14. Semen study of papaya workers exposed to ethylene dibromide

    Energy Technology Data Exchange (ETDEWEB)

    Ratcliffe, J.M.; Schrader, S.M.; Steenland, K.; Clapp, D.; Turner, T.

    1984-01-01

    A cross sectional semen and cytogenetic study was performed on male workers exposed to ethylene-dibromide (EDB) in the papaya fumigation industry in Hawaii. Semen analyses were conducted on 46 men in six fumigation facilities with an average length of employment of 5 years and airborne exposures to EDB ranging from 16 to 213 parts per billion. Statistically significant decreases in sperm count per ejaculate and the percentage of viable and motile sperm and increases in the proportion of specific morphological abnormalities were observed among exposed men when compared with controls. Semen volume and sperm concentration were also lower in the exposed group. No effect of exposure to EDB on sperm velocity, the overall proportion of sperm with normal morphology or YFF bodies was noted. The authors conclude that based on the decreases in sperm count, viability and motility and increases in certain types of morphological abnormalities among workers exposed to EDB, EDB may increase the risk of reproductive impairment in workers at exposure levels near the NIOSH recommended limit of 45 parts per billion and far below the current OSHA standard of 20 parts per million.

  15. Semen quality and sex hormones with reference to metal welding

    DEFF Research Database (Denmark)

    HjØllund, Niels Henrik Ingvar; Bonde, J P

    1998-01-01

    Welding may involve hazards to the male reproductive system, but previous studies of semen quality have produced inconsistent results. We studied the effects of welding on markers of semen quality in a Danish nationwide sample of 430 first-time pregnancy planners without earlier reproductive experience. Couples were recruited among members of the union of metal workers and three other trade unions and were followed from termination of birth control until pregnancy for a maximum of six menstrual cycles. The males provided semen samples in each cycle. Median sperm density for welders was 56 x 10(6)/mL (52.5 x 10(6)/mL and 50.0 x 10(6)/mL in two reference groups). No statistically significant differences attributable to welding were found in proportions of morphologically normal sperm, sperm motility assessed by computer-aided sperm analysis, or sex hormones (testosterone, follicle-stimulating hormone, and luteinizing hormone). These negative findings may not apply to populations with high-level exposure to welding fume or to welders exposed to other putative hazards, e.g., heat.

  16. Glyph-Based Video Visualization for Semen Analysis.

    Science.gov (United States)

    Duffy, Brian; Thiyagalingam, Jeyarajan; Walton, Simon; Smith, David J; Trefethen, Anne; Kirkman-Brown, Jackson C; Gaffney, Eamonn A; Min Chen

    2015-08-01

    The existing efforts in computer assisted semen analysis have been focused on high speed imaging and automated image analysis of sperm motility. This results in a large amount of data, and it is extremely challenging for both clinical scientists and researchers to interpret, compare and correlate the multidimensional and time-varying measurements captured from video data. In this work, we use glyphs to encode a collection of numerical measurements taken at a regular interval and to summarize spatio-temporal motion characteristics using static visual representations. The design of the glyphs addresses the needs for (a) encoding some 20 variables using separable visual channels, (b) supporting scientific observation of the interrelationships between different measurements and comparison between different sperm cells and their flagella, and (c) facilitating the learning of the encoding scheme by making use of appropriate visual abstractions and metaphors. As a case study, we focus this work on video visualization for computer-aided semen analysis, which has a broad impact on both biological sciences and medical healthcare. We demonstrate that glyph-based visualization can serve as a means of external memorization of video data as well as an overview of a large set of spatiotemporal measurements. It enables domain scientists to make scientific observation in a cost-effective manner by reducing the burden of viewing videos repeatedly, while providing them with a new visual representation for conveying semen statistics. PMID:26357260

  17. Decreases in Human Semen Quality with Age Among Healthy Men

    Energy Technology Data Exchange (ETDEWEB)

    Eskenazi, B.; Wyrobek, A.J.; Kidd, S.A.; Moore, L.; Young, S.S.; Moore, D.

    2001-12-01

    The objective of this report is to characterize the associations between age and semen quality among healthy active men after controlling for identified covariates. Ninety-seven healthy, nonsmoking men between 22 and 80 years without known fertility problems who worked for or retired from a large research laboratory. There was a gradual decrease in all semen parameters from 22-80 years of age. After adjusting for covariates, volume decreased 0.03 ml per year (p = 0.001); sperm concentration decreased 2.5% per year (p = 0.005); total count decreased 3.6% per year of age (p < 0.001); motility decreased 0.7% per year (P < 0.001); progressive motility decreased 3.1% per year (p < 0.001); and total progressively motile sperm decreased 4.8% per year (p < 0.001). In a group of healthy active men, semen volume, sperm concentration, total sperm count, and sperm motility decrease continuously between 22-80 years of age, with no evidence of a threshold.

  18. Persistence of DNA from laundered semen stains: Implications for child sex trafficking cases.

    Science.gov (United States)

    Brayley-Morris, Helen; Sorrell, Amber; Revoir, Andrew P; Meakin, Georgina E; Court, Denise Syndercombe; Morgan, Ruth M

    2015-11-01

    In sexual assault cases, particularly those involving internal child sex trafficking (ICST), victims often hide their semen-stained clothing. This can result in a lag time of several months before the items are laundered and subsequently seized during a criminal investigation. Although it has been demonstrated previously that DNA can be recovered from clothing washed immediately after semen deposition, laundered items of clothing are not routinely examined in ICST cases, due to the assumption that the time delay and washing would result in no detectable DNA. The aim of this study was to examine whether viable DNA profiles could be recovered from laundered semen stains where there has been a significant lag time between semen deposition from one or more individuals and one or more washes of the stained clothing. Items of UK school uniform (T-shirts, trousers, tights) were stained with fresh semen (either from a single donor or a 1:1 mixture from two donors) and stored in a wardrobe for eight months. Stained and unstained items (socks) were then washed at 30°C or 60°C and with non-biological or biological detergent. DNA samples extracted from the semen-stained sites and from the unstained socks were quantified and profiled. High quantities of DNA, (6-18?g) matching the DNA profiles of the semen donors, were recovered from all semen-stained clothing that had been laundered once, irrespective of wash conditions. This quantity,and profile quality,did not decline significantly with multiple washes. The two donor semen samples yielded ?10-fold more DNA from the T-shirts than from the trousers. This disparity resulted in the T-shirts yielding a ?1:1 mixture of DNA from the two donors, whereas the trousers yielded a major DNA profile matching only that of the second donor. The quantities of DNA recovered from the unstained socks were an order of magnitude lower, with most of the DNA being attributable to the donor of the semen on the stained clothing within the same wash, demonstrating the transfer of semen-derived DNA among items of clothing in the washing machine. This study demonstrates that complete DNA profiles can be obtained from laundered semen stains on school uniform-type clothing, with an eight-month lag time between semen deposition and laundering, despite multiple washes and stains from two semen donors. These data emphasise the need to recover and examine the clothing of victims for semen and DNA evidence, even if the clothing has been stored for several months or washed multiple times since the sexual offence took place. PMID:26232275

  19. Effect of species, breed, and age on bacterial load in bovine and bubaline semen

    Directory of Open Access Journals (Sweden)

    Chandrahas Sannat

    2015-04-01

    Full Text Available Aim: The present study was conducted to investigate the effect of species, breed and age on bacterial load in fresh and frozen semen of Cattle and Buffalo bull. Materials and Methods: Present study covered 56 cow and 10 buffalo bulls stationed at Central Semen Station Anjora, Durg (Chhattisgarh. Impact of breeds on bacterial load in semen was assessed using six breeds of cattle viz. Sahiwal, Gir, Red Sindhi, Tharparkar, Jersey and Holstein Friesian (HF cross. Cow bulls were categorized into four different groups based on their age ( 6 years to study variation among age groups. Bacterial load was measured in fresh and frozen semen samples from these bulls using the standard plate count (SPC method and count was expressed as colony forming unit (CFU per ml of semen. Results: Higher bacterial load was reported in fresh (2.36 × 104 ± 1943 CFU/ml and frozen (1.00 × 10 ± 90 CFU/ml semen of cow bulls as compared to buffalo bulls (1.95 × 104 ± 2882 and 7.75 × 102 ± 160 CFU/ml in fresh and frozen semen, respectively. Jersey bull showed significantly higher bacterial count (p < 0.05 both in fresh (4.07 × 104 ± 13927 CFU/ ml and frozen (1.92 × 103 ± 178 CFU/ml semen followed by HF cross, Sahiwal, Gir, Red Sindhi and Tharparkar bull. Bulls aged < 4 years and more than 6 years yielded increased bacterial load in their semen. Although a minor variation was reported between species and among age groups, no significant differences were measured. Conclusion: Bacterial load in semen did not differ significantly between species and age groups; however significant variation was reported among different breeds. Bulls of Jersey breed showed significantly higher bacterial load in semen as compared to the crossbred and indigenous bull.

  20. Survey of carnitine content of human semen using a semiquantitative auxanographic method: decreased semen total carnitine concentration in patients with azoospermia or severe oligozoospermia.

    Science.gov (United States)

    Soffer, Y; Shalev, D P; Weissenberg, R; Orenstein, H; Nebel, L; Lewin, L M

    1981-01-01

    A microbiological method, using the carnitine-requiring yeast, Torulopsis bovina ATCC 26014, was developed to identify samples of human semen which contained low levels (less than 250 micron M) of total carnitine. Of 399 semen samples from a male infertility clinic which were tested, 30 (7.5%) were low in carnitine. Of these, 14 were azoospermic and 16 were severely oligozoospermic. Some azoospermic samples (19 = 58%) and severely oligozoospermic samples (51 = 79%) did not give evidence of low carnitine concentrations. These results indicate that decreased total carnitine concentration in semen occurs in certain classes of azoospermic and severely oligozoospermic patients. PMID:7198393

  1. Flora bacteriana del semen de toro antes y después de la congelación (Bacterial flora of bull semen before and after freezing process

    Directory of Open Access Journals (Sweden)

    Enrique A. Silveira Prado

    2005-10-01

    Full Text Available Se investigó por bacteriología general el semen fresco y después de la congelación de 50 toros de inseminación artificial y se efectuó el conteo total de unidades formadoras de colonias (UFC. A l5 de los toros se les realizó el examen bacteriológico de sus lavados prepuciales. En todas las muestras de semen fresco se obtuvo crecimiento bacteriano y los gérmenes más frecuentemente aislados fueron: Escherichia coli (50,0%, Staphylococcus aureus (36,0% y Staphylococcus coagulasa negativa (28,0%. En el semen congelado solamente se obtuvo crecimiento en el 20,0%. El 74,0% del semen fresco alcanzó conteos ? 1 x 104 UFC/mL antes de ser procesado; después de la congelación el 80,0% fue estéril. En el total de lavados prepuciales se obtuvo crecimiento y se detectó en mayor proporción el Staphylococcus coagulasa negativa (60,0%, microorganismo también aislado en el semen fresco de estos toros. Se concluyó que la adición de antibióticos al menstruo y posterior congelación en pastillas, disminuye notablemente la carga microbiana presente en el semen. It was investigated through general bacteriology both fresh semen and after the freezing process, carried out in 50 bulls of artificial insemination, total counting of colony forming units (CFU was made. A bacteriological analysis of the prepucial washing was made on 15 of these bulls. In all samples of fresh semen there was bacterial growing. The most frequently germs were: Escherichia coli (50,0%, Staphylococcus aureus (36,0% and coagulase negative Staphylococcus (28,0%. In samples of frozen semen growth was only obtained in the 20,0%. The 74,0% of samples of fresh semen reached counts ? 1 x 104 CFU/mL before being processed; after freezing 80,0% of the samples were sterile. In all prepucial washings it was obtained growth and mostly detected coagulase negative Staphylococcus (60.0%, was also isolated in the fresh semen of these bulls. We concluded that the addition of antibiotics to the menses and later freezing in pills, diminishes the load microbial present notably in the semen

  2. Effect of sexed semen on conception rate for Holsteins in the United States

    Science.gov (United States)

    Effect of sexed-semen breedings on conception rate was investigated using US Holstein field data from January 2006 through October 2008. Sexed-semen breeding status was determined by a National Association of Animal Breeders’ 500-series marketing code or by individual breeding information in a cow o...

  3. Detection of human papillomavirus DNA in semen from patients with intrameatal penile warts.

    OpenAIRE

    Green, J.; Monteiro, E; GIBSON, P

    1989-01-01

    Fifteen semen specimens from 10 men with intrameatal penile warts attending a genitourinary clinic were tested by Southern blot hybridisation for the presence of human papillomavirus (HPV) DNA. Five specimens were positive for HPV types 6/11. This observation may have implications for screening of semen used for artificial insemination by donor.

  4. A PROTOCOL FOR THE SHORT-TERM STORAGE OF ATLANTIC STURGEON SEMEN

    Science.gov (United States)

    Short-term, liquid-phase storage trials were conducted in 2009 on Atlantic sturgeon semen obtained from captive males, held at the U.S. Fish and Wildlife Service, Northeast Fish Technology Center and wild males, collected ripe on the spawning grounds from the Hudson River. Semen samples collected, c...

  5. Virus de transmisión sexual: relación semen y virus / Virus of Sexual transmission: Semen and virus relationship

    Scientific Electronic Library Online (English)

    J.W., Zea-Mazo; Y.A., Negrette-Mejía; W., Cardona-Maya.

    2010-12-01

    Full Text Available Introducción: Actualmente, existe debate sobre la posibilidad de «infección»/interacción de los espermatozoides con diferentes virus, inclusive para algunos virus se intentan dilucidar mecanismos y receptores que podrían estar involucrados en esta interacción. Adicionalmente, se ha reportado la pres [...] encia de algunos genomas virales en el DNA espermático, planteando la posibilidad de transmitir la infección a la pareja y a la descendencia. Objetivo: En la presente revisión se pretende describir los mecanismos de infección de algunos virus a las fracciones seminales, pretendiendo mediante una revisión bibliográfica, responder a la pregunta ¿cómo los virus de transmisión sexual infectan al semen? Materiales y métodos: Se realizo una búsqueda bibliográfica sobre la interacción de virus y espermatozoides. Resultados: Algunos virus pueden interactuar con los espermatozoides y estos podrían transferir el virus a la descendencia; sin embargo, en la mayoría de los casos, los receptores que permiten esta interacción no están claramente descritos. Conclusiones: A pesar de la información actual, nuevos estudios experimentales son necesarios para determinar el papel de los espermatozoides en la diseminación de la infecciones de transmisión sexual. Abstract in english Introduction: The possible "infection"/interaction processes between sperm and different microorganisms are being under discussion nowadays. This process might include some viruses and even recent investigations are aiming to elucidate the mechanisms and the receptors that may be involved in this in [...] teraction. Furthermore, it has been reported the presence of some viral genomes within the sperm DNA, raising the possibility of transmitting the infection to the partner and offspring. Objective: The aim of this review is to describe the mechanisms by how viruses could possibly infect some seminal fractions. This is pursued by performing a literature review for answering the question: how the sexually transmitted virus could be infecting sperm? Materials and methods: We carried out a bibliographic review about sperm and virus interaction. Results: Some viruses interact with sperm cells; and sperm cells could transfer the viruses to offspring, however, in most cases, the receptors that allow this interaction are not clearly described. Conclusions: Based on the current information, new in vitro studies are needed to determine the role of sperm in spreading viruses of sexually transmitted infections.

  6. Application of a quantitative 1H-NMR method for the determination of amygdalin in Persicae semen, Armeniacae semen, and Mume fructus.

    Science.gov (United States)

    Tanaka, Rie; Nitta, Akane; Nagatsu, Akito

    2014-01-01

    A quantitative (1)H-NMR method (qHNMR) was used to measure the amygdalin content of Persicae semen, Armeniacae semen, and Mume fructus, in each of which amygdalin constitutes a major component. The purity of amygdalin was calculated from the ratio of the intensity of the amygdalin H-2 signal at ? 6.50 ppm in pyridine-d 5 to that of the hexamethyldisilane (HMD) signal at 0 ppm. The HMD concentration was corrected by the International System of Units (SI) traceability with certified reference material (CRM)-grade bisphenol A. qHNMR revealed the amygdalin contents to be 2.72 and 3.13% in 2 lots of Persicae semen, 3.62 and 5.19% in 2 lots of Armeniacae semen, and 0.23% in Mume fructus. Thus, we demonstrated the utility of this method for the quantitative analysis of crude drugs. PMID:23744252

  7. Freezing African Elephant Semen as a New Population Management Tool

    Science.gov (United States)

    Hermes, Robert; Saragusty, Joseph; Göritz, Frank; Bartels, Paul; Potier, Romain; Baker, Barbara; Streich, W. Jürgen; Hildebrandt, Thomas B.

    2013-01-01

    Background The captive elephant population is not self-sustaining and with a limited number of breeding bulls, its genetic diversity is in decline. One way to overcome this is to import young and healthy animals from the wild. We introduce here a more sustainable alternative method - importation of semen from wild bulls without removing them from their natural habitat. Due to the logistics involved, the only practical option would be to transport cryopreserved sperm. Despite some early reports on African elephant semen cryopreservation, the utility of this new population management tool has not been evaluated. Methodology/Principal Findings Semen was collected by electroejaculation from 14 wild African savanna elephant (Loxodonta africana) bulls and cryopreserved using the directional freezing technique. Sperm treatments evaluated included the need for centrifugation, the use of hen or quail yolk, the concentration of glycerol (3%, 5% or 7%) in the extender, and maintenance of motility over time after thawing. Our results suggest that dilution in an extender containing hen yolk and 7% glycerol after centrifugation best preserved post-thaw sperm motility when compared to all other treatments (P?0.012 for all). Using this approach we were able to achieve after thawing (mean ± SD) 54.6±3.9% motility, 85.3±2.4% acrosome integrity, and 86.8±4.6% normal morphology with no decrease in motility over 1 h incubation at 37°C. Sperm cryopreserved during this study has already lead to a pregnancy of a captive female elephant following artificial insemination. Conclusions/Significance With working techniques for artificial insemination and sperm cryopreservation of both African and Asian elephants in hand, population managers can now enrich captive or isolated wild elephant populations without removing valuable individuals from their natural habitat. PMID:23483917

  8. VIABILIDAD ESPERMÁTICA E INTEGRIDAD DEL ACROSOMA EN SEMEN CONGELADO DE TOROS NACIONALES / SPERM VIABILITY AND ACROSOME INTEGRITY IN NATIONAL FROZEN BULL SEMEN

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V; César, Pantoja A.

    Full Text Available Se evaluó el deterioro de la membrana espermática e integridad del acrosoma como método para predecir la fertilidad en toros. Se trabajó con cuatro toros (2 Hosltein y 2 Brown Swiss) del Banco Nacional de Semen, Lima-Perú. Se evaluó integridad acrosomal, integridad de membrana espermática, motilidad [...] , espermatozoides vivos, volumen y concentración durante los procesos de refrigeración, congelación y descongelación de 10 eyaculados por animal. En semen fresco sin diluir se encontró un volumen de 4.33 ml, concentración espermática de 922.5 x 106/ml, y 78.5% de espermatozoides vivos. La motilidad individual progresiva en semen diluido fue de 82.7 a 86.0% con diferencia significativa entre toros (p Abstract in english The deterioration of the sperm membrane and acrosome integrity as a method for predicting fertility in bulls was evaluated. Four bulls (2 Holstein and 2 Brown Swiss) from the National Bank of Semen, Lima-Peru were used. Acrosome integrity, sperm membrane integrity, motility, live sperm cells, volume [...] , and sperm concentration during cooling, freezing and thawing was evaluated in 10 ejaculates per sire. In fresh semen, volume was 4.33 ml; sperm concentration was 922.5 x 106/ml and 78.5% of live cells. The individual progressive motility in diluted semen was 82.7 to 86.0% with significant difference between bulls (p

  9. Análisis de diluyentes comerciales de semen porcino refrigerado durante 4 días: resultados preliminares / Analysis of commercial extenders for porcine semen refrigerated for 4 days: preliminary results

    Scientific Electronic Library Online (English)

    P., Torres; M.L., Fischman; M., Acerbo; C., García; M., Míguez; J., Domínguez; H., Cisale.

    2014-09-01

    Full Text Available La utilización de semen enfriado en inseminación artificial (IA) porcina sigue siendo una limitante, ya que la respuesta frente a temperaturas menores a 16 ºC es aleatoria entre cerdos, y aún entre eyaculados del mismo cerdo. El objetivo del presente trabajo fue jerarquizar la capacidad para la cons [...] ervación de dosis refrigeradas durante 4 días de tres diluyentes comerciales (de larga o media duración) de semen porcino (Androstar Plus®, MRA® y MIII®), analizando: viabilidad, funcionalidad de membrana, integridad acrosomal y movilidad en 11 eyaculados procedentes de 3 verracos. No existieron diferencias (p>0,05) entre diluyentes por lo que sería similar su capacidad de conservación durante un período de 4 días. Abstract in english The use of cold preserved semen is still a limiting factor in artificial insemination, because of the random response of boar semen to temperatures below 16 ºC, even between ejaculates from the same male. The aim of this work was to analyze and rank three commercial (long and medium term) boar semen [...] extenders (Androstar Plus®, MRA® y MIII®), based on their capability to preserve refrigerated semen for four days analyzing: viability, membrane functionality acrosome integrity and motility. Eleven ejaculates were assessed. There were not differences (p>0.05) between extenders for any of the parameters studied, evidencing a similar preservation capability in a four-day period.

  10. Human immunodeficiency virus type-1 episomal cDNA in semen

    Directory of Open Access Journals (Sweden)

    Mayer Kenneth H

    2005-10-01

    Full Text Available Abstract Background Episomal 2-long terminal repeat (LTR HIV-1 cDNA, a by-product of HIV-1 infection, is used in clinical trials as a marker for ongoing viral replication. It would be useful to employ 2-LTR cDNA to monitor cryptic HIV-1 infection in the genital tract of men on antiretroviral therapy (ART to predict the evolution of sexually transmissible drug-resistant HIV-1, but studies thus far have failed to detect this marker in semen. The objectives of this study were: 1 to use a technique that maximizes DNA recovery from HIV-1 infected white blood cells in semen to determine if episomal 2-LTR cDNA is detectable in semen of ART-naïve men with other evidence of genital tract HIV-1 infection, and 2 to compare levels of HIV-1 2-LTR cDNA, RNA, and proviral DNA in semen from HIV-1+ men on ART. Results Using a somatic cell DNA extraction technique, 2-LTR cDNA was detected by PCR/ELISA in 4 out of 8 semen samples from ART-naïve men selected for other signs of seminal HIV-1 infection (positive controls. Southern blot and DNA sequencing confirmed that the amplified sequences were HIV-1 2-LTR cDNA; copy numbers ranged from 55 to 504 copies/sample. Two semen samples from a cohort of 22 HIV-1-infected men on dual nucleoside therapy, one with and one without detectable seminal HIV-1 RNA, were 2-LTR cDNA positive (336 and 8,560 copies/sample. Following addition of indinavir to the therapy regimen, no semen samples from 21 men with controlled peripheral and seminal viral loads were 2-LTR cDNA positive at 1 and 6 month time points, despite the persistence of HIV-1 proviral DNA+ semen cells and seminal cytomegalovirus (CMV shedding in some cases. However, one individual who failed indinavir therapy and later developed distinct protease inhibitor (PI drug resistance mutations in semen, maintained elevated levels of HIV-1 RNA and 2-LTR cDNA in semen. Conclusion 2-LTR HIV-1 cDNA is detectable in semen of HIV-1-infected men. Two men on ART had 2-LTR HIV-1 cDNA in semen, suggesting that this marker may prove to be useful to monitor HIV-1 infection in the genital tract of men on ART to predict the evolution of drug resistance mutations in semen.

  11. Relative Merits of Homo and Heterospermic Bull Semen in Respect of Preservation Quality

    Directory of Open Access Journals (Sweden)

    S.A. Azmal

    2004-01-01

    Full Text Available The experiment was conducted to compare the relative efficiency of homo and heterospermic bull semen in terms of preservation quality. Spermatozoa from three different breeds of bull namely Holstein Friesian (HF, Red Chittagong (RC and Sahiwal (SL were mixed in equal number and preserved for 3 days. The quality of semen in terms of mass motility, normal and live sperm content of homo and heterospermic semen were studied at various preservation periods. In total 312 samples were included in the analysis. The average (% mass motility, normal and live sperm of homospermic semen were 51.77 ± 0.49, 77.55 ± 0.45 and 78.73 ± 0.44 respectively and for heterospermic semen the corresponding values were 59.94 ± 0.85, 83.55 ± 0.78 and 83.69?0.76. The significantly (p<0.001 highest mass motility, normal and live sperm percentages were observed in heterospermic semen as compared to homospermic semen. The quality of semen between homo and heterospermic semen in terms of mass motility, normal and live sperm percentage did not differ significantly (p>0.05 between groups at first day but differed significantly (p<0.001 at second and third day of preservation. Mass motility of homo and heterospermic semen at first day were 60.77?0.55 and 62.31?0.95%, respectively. The corresponding values at third day were 44.04 ± 0.44 and 57.12 ± 0.77%. Normal sperm of homo and heterospermic semen at first day were 86.50 ± 0.43 and 86.31 ± 0.74%, respectively. The corresponding values at third day were 70.36 ± 0.38 and 81.00 ± 0.66%. Live sperm of homo and heterospermic semen at first day were 86.56 ± 0.43 and 86.54 ± 0.75%, respectively. The corresponding values at third day were 71.54 ± 0.46 and 81.42 ± 0.79%. From the above results, it was concluded that heterospermic semen could be better preserved in terms of mass motility, normal and live sperm percentage compared to homospermic ones.

  12. A Study of a Method to Assess the Purity of Sorted Bovine Semen Using Rapid Single-Sperm Sexing PCR

    Directory of Open Access Journals (Sweden)

    Weihua Du

    2011-01-01

    Full Text Available Sort reanalysis using flow cytometry is the most common method for determining the purity of X or Y enriched semen. The high cost of this technique (including the required expensive, proprietary machine limits efforts to improve the technique and to promote develop applications for the sorted semen. In this study, the sperm sex (the presence of the X or Y chromosome was identified by both rapid PCR and flow cytometry reanalysis. The rapid PCR results showed that the percentages of X and Y sperm were 48 and 52% in unsorted semen, 92 and 8% in X-enriched semen and 17 and 83% in Y-enriched semen, respectively. Reanalysis of the DNA content of the sorted samples revealed that the X and Y sperm frequencies were 92 and 8% in X-enriched semen and 15 and 85% in Y-enriched semen, respectively. The sex ratio of unsorted semen analyzed by PCR did not significantly deviate from the expected ratio of 1:1 and there was no significant difference between the sex ratios of sorted semen samples determined by PCR and flow cytometry reanalysis. These results indicate that we have established an effective, reliable and rapid PCR method to verify the purity of sorted semen. This method should contribute greatly to the improvement of sperm sorting techniques and the development of applications for sorted semen.

  13. Laser researches on livestock semen and oocytes: A brief review

    Directory of Open Access Journals (Sweden)

    Z. Abdel-Salam

    2015-05-01

    Full Text Available This article presents a brief review of the past and present literature pertinent to laser effects on sperm motility parameters, improvement of oocyte maturation and characterization of semen in livestock. The aim was, on one hand, to make the readers aware of such knowledge and on the other hand to trigger the interest of the animal reproduction scientific community in attempting some laser techniques that have not yet been fully exploited in the field of artificial insemination. With respect to the conventional methods, laser is a more sensitive and less costly technology that can be used for improving artificial insemination and embryo production system. Since 1980s, laser treatment came on the biological samples scene; its applications have continuously been developed thereafter. Exploitation of laser light by various researchers for improving the reproductive efficiency of sperm cells and the maturation rate in different livestock is demonstrated herein. Laser irradiation, in principal, can increase the production of adenosine triphosphate (ATP and consequently increases the energy provided to the cell. Since sperm motility and oocyte maturation depend on the energy consumption, an increase in the energy supply to the cells will be of great importance. In addition, the authors also discuss the use of laser spectrochemical analytical techniques, such as laser induced breakdown spectroscopy (LIBS and laser induced fluorescence (LIF, in characterization of semen samples.

  14. The reference values for semen parameters of 1213 fertile men in Guangdong Province in China.

    Science.gov (United States)

    Tang, Yun-Ge; Tang, Li-Xin; Wang, Qi-Ling; Song, Ge; Jiang, Yan-Jia; Deng, Shun-Mei; Jiang, Fang; Qin, Wei-Bing

    2015-01-01

    Semen samples were collected from 1213 fertile men whose partners had a time-to-pregnancy (TTP) ?12 months in Guangdong Province in Southern China, and semen parameters including semen volume, sperm concentration, total counts, motility, and morphology were evaluated according to the World Health Organization (WHO) 2010 guideline. All semen parameters analyzed were normal in ~62.2% of the total samples, whereas ~37.8% showed at least one of the semen parameters below normal threshold values. The fifth centiles (with 95% confidence intervals) were 1.3 (1.2-1.5) ml for semen volume, 20 × 10 6 (18×10 6 -20×10 6 ) ml-1 for sperm concentration, 40 × 10 6 (38×10 6 -44×10 6 ) per ejaculate for total sperm counts, 48% (47%-53%) for vitality, 39% (36%-43%) for total motility, 25% (23%-27%) for sperm progressive motility, 5.0% (4%-5%) for normal morphology. The pH values ranged from 7.2 to 8.0 with the mean ± standard deviation at 7.32 ± 0.17. No effects of age and body mass index were found on semen parameters. Occupation, smoking and alcohol abuse, varicocele appeared to decrease semen quality. Sperm concentration, but not sperm morphology, is positively correlated with TTP, whereas vitality is negatively correlated with TTP. Our study provides the latest reference values for the semen parameters of Chinese fertile men in Guangdong Province, which are close to those described in the new WHO guidelines (5 th Edition). PMID:25432502

  15. Effect of preputial washing on bacterial load and preservability of semen in Murrah buffalo bulls

    Directory of Open Access Journals (Sweden)

    G. S. Meena

    2015-06-01

    Full Text Available Aim: To study the effect of preputial washing on bacterial load, preservability and semen quality in Murrah buffalo bulls Materials and Methods: A total of 36 collections of three Murrah buffalo bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal, were collected at weekly intervals from each bull without preputial washing and latter ejaculates from same bull with preputial washing by infusing normal saline (0.85%, KMnO4 (0.02% and savlon (2.0% to first, second and third bull, respectively. The microbial load and semen quality were evaluated during different hours of storage at refrigerated temperature (0, 24 and 48 h and after thrawing of cryopreserved (at ?196°C semen. Results: The results of preservation of semen at refrigerated temperature showed that bacterial load was markedly lower in ejaculates of bulls subjected to preputial washing. Semen preserved at refrigerator temperature and cryopreserved, the effect of washing solution was significant for individual motility (IM, non-eosiniphilic count, hypo-osmotic swelling reactivity (HOST, total plate count (TPC and acrosome integrity. KMnO4 was found to be the best in lowering bacterial load, sperm abnormalities and in improving semen quality such as motility, non-eosinophilic count, HOST and acrosome integrity even up to 48 h of preservation and cryopreserved semen. Effect of duration of preservation and stage of cryopreservation was also significant for IM, non-eosiniphilic count, HOST, sperm abnormalities and acrosome integrity. Conclusion: Overall the results suggested that preputial washing with KMnO4 solution improved the semen quality and reduced microbial load of Murrah buffalo bull’s semen preserved at refrigerated temperature and cryopreservation.

  16. The reference values for semen parameters of 1213 fertile men in Guangdong Province in China

    Directory of Open Access Journals (Sweden)

    Yun-Ge Tang

    2015-04-01

    Full Text Available Semen samples were collected from 1213 fertile men whose partners had a time-to-pregnancy (TTP ?12 months in Guangdong Province in Southern China, and semen parameters including semen volume, sperm concentration, total counts, motility, and morphology were evaluated according to the World Health Organization (WHO 2010 guideline. All semen parameters analyzed were normal in ~62.2% of the total samples, whereas ~37.8% showed at least one of the semen parameters below normal threshold values. The fifth centiles (with 95% confidence intervals were 1.3 (1.2-1.5 ml for semen volume, 20 × 10 6 (18×10 6 -20×10 6 ml?1 for sperm concentration, 40 × 10 6 (38×10 6 -44×10 6 per ejaculate for total sperm counts, 48% (47%-53% for vitality, 39% (36%-43% for total motility, 25% (23%-27% for sperm progressive motility, 5.0% (4%-5% for normal morphology. The pH values ranged from 7.2 to 8.0 with the mean ± standard deviation at 7.32 ± 0.17. No effects of age and body mass index were found on semen parameters. Occupation, smoking and alcohol abuse, varicocele appeared to decrease semen quality. Sperm concentration, but not sperm morphology, is positively correlated with TTP, whereas vitality is negatively correlated with TTP. Our study provides the latest reference values for the semen parameters of Chinese fertile men in Guangdong Province, which are close to those described in the new WHO guidelines (5 th Edition.

  17. Improvement of the Shami goat semen quality by adding bovine serum albumin

    Directory of Open Access Journals (Sweden)

    O.I. Azawi

    2014-06-01

    Full Text Available The present study was aimed to improve the quality of Shami goat semen diluted with Tris diluent by adding bovine serum albumin. In the current study, six male goats were used. Semen was collected using artificial vagina of one ejaculate per week of every male included in this study. This study was performed during the breeding season from 1 \\ 10 \\ 2012 to 1 \\ 12 \\ 2012. In this study, two semen diluents were use first; Tris- fructose- egg yolk 2.5% and second Tris - fructose - 2.5% egg yolk with 1% of bovine serum albumin. Diluted semen samples were cooled gradually and stored at 5 ° C. Cooled diluted semen samples were examined every 24 h of storage to 144 h. These tests includes the proportion of live sperm and the percentage of secondary abnormalities of the sperm, the percentage of sperm acrosomal defects and percentage of progressive motility using a computer-aided sperm analysis. These results showed that the addition of bovine serum albumin with egg yolk to semen of male goats led to improved qualities of semen significantly (P<0.05 including the proportion of live sperm and the percentage of secondary abnormalities of the sperm, the percentage of sperm acrosomal defects and percentage of progressive motility. It could be concluded from the results of the current study, the possibility of storing goat semen for more than six days with alive sperm of more than 50% and the percentage of the progressive motility of more than 40% when adding bovine albumin serum to dilute goat semen at 1% level and this result has not reached by any previous study.

  18. Genetic gain in dairy cattle populations is increased using sexed semen in commercial herds

    DEFF Research Database (Denmark)

    SØrensen, Morten Kargo; Andersen, Jakob Voergaard

    2011-01-01

    Using stochastic simulation, the effect of using sexed semen to cow dams (CD) in a dairy cattle breeding scheme, with or without use of multiple ovulation and embryo transfer (MOET) to bull dams (BD), on annual genetic gain at the population level was examined. Three levels of sexed semen were combined with three levels of MOET: no sexed semen, sexed semen to the best CD and sexed semen to all heifers, combined with no MOET, MOET on all BD and MOET randomly on 20% of the BD. In total, nine scenarios were compared. The simulated population was monitored for 30 years and included 450 herds with 100 cows each. Each year 50 young bulls (YB), 10 active sires and 215 BD were selected on best linear unbiased prediction estimated breeding values by truncation selection across the simulated population, and the YB were tested within the population. Use of sexed semen alone gave a positive increase in the annual genetic gain of 2.1% when used on the best CD and 2.7% when used on all heifers, but only the latter was statistically significant. The increased annual genetic gain was caused by a larger contribution from the CD to the BD. Use of sexed semen together with MOET on BD increased the annual genetic gain by 1.8–2.5% compared with schemes without sexed semen and MOET on all BD. Performing MOET on all BD enables selection of offspring with high Mendelian deviations, which increase the annual genetic gain. Use of sexed semen decreased the genetic lag between the sires and the CD by 12–14% when used on the best CD and by 6% when used to all heifers. The decrease in the genetic lag is caused by the increased selection intensity of the cow dams

  19. Effect of the Type of Straw on the Spermatic Quality in the Freezing of Boar Semen

    Directory of Open Access Journals (Sweden)

    C.A. C?rdova-Jim?nez

    2006-01-01

    Full Text Available With the freezing boar semen, could have better options for the optimization of the reproductive handling in the swinish species as well as an alternative for the development of this cattle activity; using technologies like the implementation of banks of frozen of races with characteristic zootechnic of economic importance that guarantee the readiness of germinal material in the moment that is required, to have germinal material of males proven genetically, still when the animal no longer exists, to overcome certain intentional restrictions of transport of alive animals, for the problem of transmission of illnesses and, to overcome the restrictive of time of viability of the diluted fresh semen. In this work was examined the effect of the freezing boar semen in straws plastic of 0.5 and 5 mL on the Motility and the Acrosome Integrity (NAR. For it, 9 were used ejaculated of different animals, the experiment was carried out comparing fresh semen with thawing semen coming from straws of 0.5 and 5 mL. The results of percentages of motility and NAR for fresh and thawing semen, were of 86.19, 47.14 and 47.14, for straws of 0.5 mL and 75.62, 48.19 and 46.81, for straws of 5 mL. When carrying out the analysis of the variance and the test of multiple comparisons it was found that the freezing of the semen in both straws types, the percentages of motility and NAR reduce, with regard to the fresh semen; however, the macrotubes or straws of 5 mL, represent a good option in the artificial insemination using boar semen frozen-thawing.

  20. Use of Spermac® Staining Technique in the Determination of Acrosomal Defects in Cat Semen

    OpenAIRE

    Baran, Alper; ?AH?N, B. Evrim; EVECEN, Mithat; DEM?R, Kamber; ?LER?, ?. Kamuran

    2004-01-01

    The types and rates of acrosome and other (head, mid-piece and tail) abnormal spermatozoon types were determined by the Spermac® staining technique. Semen from 5 stray tom cats under the same management conditions was used. Semen collection was performed under general anesthesia by electro-ejaculator once a week for 5 weeks. After ejaculation the semen was diluted by 100 µl of 0.9% NaCl solution and stained with Spermac® stain for morphological evaluation. The morphological criteria were acr...

  1. Motilidad y fertilidad del semen de carnero descongelado a dos diferentes ritmos de temperatura

    OpenAIRE

    Rosa Bertha Angulo Mejorada; Antonio Ortiz Hern\\u00E1ndez; Jos\\u00E9 Manuel Berruecos Villalobos; Deborah Feldman Steel; Javier Valencia M\\u00E9ndez

    1999-01-01

    El objetivo del presente trabajo fue comparar el efecto de dos temperaturas y tiempos de descongelación sobre la motilidad y fertilidad del semen del ovino. Se utilizó un total de 208 ovejas y 13 carneros de diferentes razas. El semen se obtuvo por medio de una vagina artificial. Se evaluó, se diluyó con Tris -ácido cítrico-fructosa-glicerol-yema de huevo y se centrifugó a 200 g/15 min; el paquete celular se resuspendió con el mismo diluyente. El semen diluido se congeló en pajill...

  2. Effects of Alpha Lipoic Acids on Cattle Sperm Kinetics Using Computer Assisted Semen Analysis

    OpenAIRE

    Amat Aswadi Abd Karim; Mohd Iswadi Ismail; Nor Azlina Zakaria; Siti Fatimah Ibrahim; Khairul Osman; Zawawi Ismail

    2012-01-01

    This study investigated the protective effect of Alpha Lipoic Acid (ALA) on animal sperm quality using Computer Assisted Semen Analysis (CASA). Fresh semen sample collected from adult Limousin bulls. The experiment involved five test groups and a control. Alpha lipoic acid with different concentrations (0.1, 0.05, 0,025, 0.0125 and 0.00625 mmol mL-1) incubated into semen from all test groups. They were cryopreserved and thawed after 1 h. CASA analysis prior to cryopresevation confirmed the ba...

  3. Semen quality in men with chronic kidney disease and its correlation with chronic kidney disease stages.

    Science.gov (United States)

    Lehtihet, M; Hylander, B

    2015-12-01

    The aim of this study was to assess whether chronic kidney disease (CKD) has any impact on semen quality parameters in men with CKD stage 1-5. Results were collected from 66 men with different CKD stages (age 18-50 years). Age and BMI (body mass index) were recorded for each male. Higher CKD stage had a significant negative linear trend on semen volume (P BMI per se had no significant effect on semen volume, sperm number, sperm concentration, morphology, ?-glucosidase activity, fructose concentration or zinc level. A significant negative correlation between BMI and sexual-hormone-binding globulin (SHBG) (P BMI. PMID:25487067

  4. Evaluation of Physical Semen Characteristics of Male Rabbits Exposed to Different Climatic Conditions and Lighting Regimes Using Nuclear Techniques

    International Nuclear Information System (INIS)

    The number of 20 mature males New Zealand White (NZW) rabbits, in the first production year was used in the present research. The study included two periods; each was of 2 months. The first period was under mild conditions (18.0 degree C) while the second one was during hot conditions (35.0 degree C). In each period, 10 males with the same age and average live body weight were used. Animals within each period were divided randomly into two equal groups, with nearly equal body weights. One of the two groups exposed to natural day light (NDL) which was 10:50 L: 13:10 D in winter and 13:40 L: 10:20 D in summer and was considered as photo period control and the other group was exposed to photo period treatment (Artificial photo period, AP). The treatment group was exposed to artificial long photo period (13:40 L: 10:20 D) during winter and artificial short photo period (10:50 L: 13:10 D) during hot conditions. In seminal plasma, T4, T3 and testosterone hormonal levels were significantly lower in heat stressed rabbits than those reared under mild conditions. In contrast, the hot condition was accompanied by significant increases in cortisol level. T3 and cortisol affected significantly while T4 and testosterone levels were not affected significantly due to change in period of lighting. Concerning physical semen characteristics i.e. ejaculate volume, sperm motility, sperm cell concentration, total sperm output and number of motile sperms per ejaculate were significantly lower under heat stress than under mild conditions. In contrast, hot conditions were accompanied by a significant increase in each of reaction time, dead sperm %, sperm abnormalities % and acrosomal abnormalities %. Exposure of male rabbits during winter to long lighting as compared to NDL caused significant increase in T3 (1.4 vs. 1.3 ng/ml), testosterone (3.2 vs. 2.8 ng/ml) and cortisol (1.8 vs. 1.5 ng/ml) levels as well as significant decline in semen quality, i.e., ejaculate volume (70 vs. 60 x 10-2 ml), sperm motility (76.8 vs. 70.8%), total number sperm-cell output per ejaculate (287.00 vs. 240.00 x106 ) and number of motility sperm output per ejaculate (220.42 vs. 169.92 x106 ). Exposure of male rabbits during summer to short lighting as compared to NDL caused significant increase in T3 (1.10 vs.0.90 ng/ml) and cortisol (2.8 vs. 2.3 ng/ml) in seminal plasma as well as significant decrease in sperm motility (64.8 vs. 60.8%) and significant increase in reaction time (11.6 vs. 12.8 seconds), ejaculate volume (50 vs. 58 x 10-2 ml) and total number sperm-cell output per ejaculate (190.00 vs. 208.80 x 106 ). Finally, correlations between physical semen characteristics and seminal plasma hormonal levels were carried out to evaluate the rabbit bucks semen using nuclear technique

  5. Karakterisasi Ball Mill Import pada Industri Semen di Indonesia

    Directory of Open Access Journals (Sweden)

    Ratna Kartikasari

    2007-01-01

    Full Text Available The purpose of this research is to investigate the characteristics of import Ball Mill which is used at cement mills in Indonesia. There were two kind of import Ball Mill from PT. Semen Gresik, Tbk that used in this research which are A type (Ø 30 mm and B type (Ø 40 mm. Visual investigation, chemistry composition, distribution of hardness, and microstructure photograph was conducted characterize these ball mill. Visually, the import Ball Mill has rough surface, white coloring when cut off, and small cracks at all specimens. Type A ball mill contains of 2,934% C, 11,231% Cr, and 0,177% Mo, where type B Ball Mill contains of 2,693% C, 12,31% Cr, and 1,103% Mo. Both are martensitic white cast iron ASTM A532 Class II type A. The surface are harder then the its core. The highest hardness on the surface are 720,82 kg/mm2 (type A and 746,5 kg/mm2 (type B, where as lowest hardness on the core are 631,1 kg/mm2 (type A and 544,0 kg/mm2 (type B. Microstructure investigation shows Perlit, Cementit, and Martensit. Abstract in Bahasa Indonesia : Penelitian ini bertujuan untuk mengetahui karakteristik Ball Mill import yang digunakan oleh pabrik semen di Indonesia. Bahan yang digunakan adalah ball mill import di PT. Semen Gresik, Tbk dari 2 merk berbeda, yaitu merk A (f 30 mm dan merk B (f 40 mm. Karakterisasi Ball Mill import dilakukan dengan pengamatan visual, uji komposisi kimia, uji distribusi kekerasan dan foto struktur mikro. Secara visual terlihat bahwa Ball Mill import memiliki permukaan kasar, hasil potongan berwarna keputihan dan terdapat retakan-retakan kecil pada semua specimen. Hasil uji komposisi kimia menunjukkan bahwa Ball Mill import f 30 mm mengandung 2,934% C, 11,231% Cr, dan 0,117% Mo sedangkan f 40 mm mengandung 2,693% C, 12,313% Cr dan 1,103 Mo, termasuk dalam kelompok Martensitic white cast iron ASTM A532 Class II Type A. Hasil uji distribusi kekerasan menunjukkan bagian permukaan lebih keras dibandingkan bagian pusat dengan nilai kekerasan tertinggi 720,82 kg/mm2 (f 30 mm dan 746,5 kg/mm2 (f 40 mm sedangkan nilai kekerasan terendah 631,1 kg/mm2 (f 30 mm dan 544,0 kg/mm2 (f 40 mm. Hasil pengamatan foto struktur mikro menunjukkan bahwa struktur terdiri dari Perlit, Cementit dan Martensit. Kata kunci: ASTM A532, bola penggiling, besi tuang putih martensitik.

  6. Liquid storage of boar semen: Current and future perspectives on the use of cationic antimicrobial peptides to replace antibiotics in semen extenders.

    Science.gov (United States)

    Schulze, M; Dathe, M; Waberski, D; Müller, K

    2016-01-01

    Antibiotics are of great importance in boar semen extenders to ensure long shelf life of spermatozoa and to reduce transmission of pathogens into the female tract. However, the use of antibiotics carries a risk of developing resistant bacterial strains in artificial insemination laboratories and their spread via artificial insemination. Development of multiresistant bacteria is a major concern if mixtures of antibiotics are used in semen extenders. Minimal contamination prevention techniques and surveillance of critical hygiene control points proved to be efficient in reducing bacterial load and preventing development of antibiotic resistance. Nevertheless, novel antimicrobial concepts are necessary for efficient bacterial control in extended boar semen with a minimum risk of evoking antibiotic resistance. Enhanced efforts have been made in recent years in the design and use of antimicrobial peptides (AMPs) as alternatives to conventional antibiotics. The male genital tract harbors a series of endogenic substances with antimicrobial activity and additional functions relevant to the fertilization process. However, exogenic AMPs often exert dose- and time-dependent toxic effects on mammalian spermatozoa. Therefore, it is important that potential newly designed AMPs have only minor impacts on eukaryotic cells. Recently, synthetic magainin derivatives and cyclic hexapeptides were tested for their application in boar semen preservation. Bacterial selectivity, proteolytic stability, thermodynamic resistance, and potential synergistic interaction with conventional antibiotics propel predominantly cyclic hexapeptides into highly promising, leading candidates for further development in semen preservation. The time scale for the development of resistant pathogens cannot be predicted at this moment. PMID:26264695

  7. Estandarización del manejo y la criopreservación de semen de hembras masculinizadas de trucha arco iris (Oncorhynchus mykiss) / Standardization of handling and freezing sperm from masculinized females of rainbow trout (Oncorhynchus mykiss) / Padronizar a gestão ea criopreservação de sêmen de fêmeas de truta arco-íris (Oncorhynchus mykiss) sob masculinização

    Scientific Electronic Library Online (English)

    James J, Betancur L; Andrés F, Montoya; Tatiana, Mira; Francy A, Rojas; Martha, Olivera Ángel.

    2008-09-01

    Full Text Available A procura de linhas monosexo fêmeas na produção de trutas tem aumentado significativamente nos últimos anos, de modo tecnologias foram desenvolvidas com a finalidade de padronizar este processo como o uso do esperma de genética feminina submetido a reversão sexual. O objectivo do presente inquérito [...] foi para uniformizar a maturação in vitro e criopreservação de sêmen masculinização de fêmeas (neomachos XX) trutas arco-íris (Oncorhynchus mykiss) como uma estratégia para produzir descendentes de 100% do sexo feminino dos jogadores colombianos. Para a obtenção do esperma neomachos foram mortas e sêmen foi recuperado submetida a maturação processo normal de plasma seminal plasma seminal masculina ou artificiais. Para a criopreservação de sêmen foi testado crioprotectores dimethylsulphoxide 10% e 10% de metanol. O experimento foi evaluron mobilidade pós maturação e pós descongelamento e fertilidade do sêmen. O processo de maturação teve um efeito significativo sobre a porcentagem de mobilidade (p Abstract in spanish La demanda de líneas monosexo hembras en la producción de trucha ha incrementado significativamente en los últimos años, por lo que se han desarrollado tecnologías para estandarizar este proceso como el uso de semen de hembras genéticas sometidas a reversión sexual. El objetivo de la presente invest [...] igación fue estandarizar la maduración in vitro y la criopreservación de semen de hembras masculinizadas (neomachos XX) de trucha arco iris (Oncorhynchus mykiss) como estrategia para producir descendencias 100% hembras de reproductores colombianos. Para la obtención del semen los neomachos fueron sacrificados y el semen recuperado fue sometido a proceso de maduración con plasma seminal de machos normales o plasma seminal artificial. Para la criopreservación del semen se probaron los crioprotectores dimetilsulfóxido 10% y metanol 10%. En el experimento se evaluron la movilidad post maduración y post descongelación y la fertilidad del semen. El proceso de maduración tuvo un efecto significativo sobre el porcentaje de movilidad (p Abstract in english The demand of monosex female stocks in production of trout has significantly increased during the past years, which has led to develop new technologies to standardize this process. The usage of semen of genetic females submitted to sexual reversion is a good choice. The objective of this research wa [...] s to develop a methodology to mature in vitro and cryopreserved semen of sex-reversed rainbow trout (Oncorhynchus mykiss) females as strategy to produce lineage 100% Colombian trout female. The semen was directly obtained from the gonads after its surgical extraction of the slaughtered individuals, later it was submitted to maturation process implementing seminal plasma of normal males and artificial plasma. The semen was cryopreserved in two extender dimetyhyl sulfoxide 10% and methanol 10%. Postmaturation, postcriopreservation movility and sperm fertility were evaluated. Maturation process had a significative effect on movility, the highest movility was obtained with artificial seminal plasma (55 ± 10.4 %). Highest post criopreservation movility (29.9 ± 13.3%) and highest fertility rates (26.33 ± 7.53 %) were obtained with dimetyhyl sulfoxide 10%.

  8. Cryopreservation of tambaqui (Colossoma macropomum) semen: extenders, cryoprotectants, dilution ratios and freezing methods.

    Science.gov (United States)

    Carneiro, P C F; Azevedo, H C; Santos, J P; Maria, A N

    2012-01-01

    The tambaqui is an Amazonian fish of great economic and environmental importance to Brazil and other South American countries. Several semen cryopreservation methodologies have been tested for different Brazilian fish species; however, there is little information on the use of this technique on tambaqui semen. The aim of the present study was to investigate the effect of osmolarity and activation solutions on sperm kinetics and, glucose solutions, cryoprotectants, dilution ratios, egg yolk and freezing methods on tambaqui semen freezing. The osmolarity of 230 mOsm was suitable for simultaneously yielding higher sperm motility (85%) and motility time (54 sec.) and osmolarities above 360 mOsm maintain immobile tambaqui sperm. The tambaqui semen can be successfully cryopreserved when diluted 1:9 in freezing medium composed of 5 percent glucose solution (290 mOsm) with 10 percent methylglycol and 5 percent egg yolk, and frozen directly in a dry shipper container. PMID:23224371

  9. Exposure to perfluorinated compounds and human semen quality in Arctic and European populations

    DEFF Research Database (Denmark)

    Toft, G; Jönsson, B A G

    2012-01-01

    Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality.

  10. Exposure to perfluorinated compounds and human semen quality in arctic and European populations

    DEFF Research Database (Denmark)

    Toft, Gunnar; Jönsson, B A G

    2012-01-01

    Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality.

  11. Dioxins in the semen of men with infertility.

    Science.gov (United States)

    Galimova, E F; Amirova, Z K; Galimov, Sh N

    2015-10-01

    The purpose of the present study was to assess ejaculate contamination by polychlorinated dibenzo-p-dioxins/furans in male infertility. The database of 168 infertile and 49 fertile men was included in the study. Dioxin content was determined using gas chromatography/high-resolution mass spectrometry (GC/HRMS). In the ejaculate of infertile men, the content of dioxins and furans was 2.2-2.3 times higher than in fertile donors. The maximum level of the most toxic dioxin congener was detected in pathospermia. Contamination of semen of infertile men by polychlorinated dibenzo-p-dioxins/furans supports the hypothesis about the relationship between environmental factors and reproductive health. PMID:24894758

  12. The importance of semen analysis in the context of azoospermia

    Scientific Electronic Library Online (English)

    Nabil, Aziz.

    Full Text Available Azoospermia is a descriptive term referring to ejaculates that lack spermatozoa without implying a specific underlying cause. The traditional definition of azoospermia is ambiguous, which has ramifications on the diagnostic criteria. This issue is further compounded by the apparent overlap between t [...] he definitions of oligospermia and azoospermia. The reliable diagnosis of the absence of spermatozoa in a semen sample is an important criterion not only for diagnosing male infertility but also for ascertaining the success of a vasectomy and for determining the efficacy of hormonal contraception. There appears to be different levels of rigor in diagnosing azoospermia in different clinical situations, which highlights the conflict between scientific research and clinical practice in defining azoospermia.

  13. EFFECTS OF GOSSYPOL ON SEMEN CHARACTERISTICS IN TEDDY MALE GOATS

    Directory of Open Access Journals (Sweden)

    I.A. Zahid, L.A. Lodhi1, N. Ahmad1, Z.I. Qureshi1, N.U. Rehman1 and M.S. Akhtar2

    2003-12-01

    Full Text Available In the present study, the effects of gossypol on semen characteristics in Teddy male goats were studied. Nine Teddy male goats were randomly divided into three equal groups named A, B and C. Animals in all groups were fed concentrated ration without cottonseed cakes (CSC at the rate of 3% of their liveweight for a period of 30 days and it was named as pre-treatment period. Just after the completion of this period, animals in group A were fed control ration (without gossypol, those in group B were fed ration which contained unboiled CSC as a source of free and bound gossypol, while animals in group C were given ration containing CSC boiled at 100?C for 1 hour as a source of bound gossypol These experimental rations were fed to animals of respective groups at the rate of 3% of their liveweight for a period of 90 days and it was named as treatment period. Feeding of ration containing gossypol to Teddy male goats did not affect the colour, volume, mass activity, sperm concentration, percentage of dead spermatozoa, liveability and absolute index of liveability of spermatozoa at 37°C. However, it affected significantly (P<0.05 the pH, per cent motility of spermatozoa and percentage of morphologically abnormal spermatozoa. The Teddy male goats fed rations containing a combination of free and bound gossypol showed a significant (P<0.05 increase in the pH and a decrease in motility of spermatozoa which was statistically lower than those fed control diet or diet containing bound gossypol. It was concluded that rations containing a combination of free and bound gossypol (unboiled CSC or bound gossypol only (boiled CSC adversely affected the semen quality of Teddy male goats in terms of sperm motility and morphologically abnormal spermatozoa in ejaculates.

  14. Effects of dietary n-6:n-3 fatty acid ratio and vitamin E on semen quality, fatty acid composition and antioxidant status in boars.

    Science.gov (United States)

    Liu, Q; Zhou, Y F; Duan, R J; Wei, H K; Jiang, S W; Peng, J

    2015-11-01

    The aim of the present study was to evaluate the effects of dietary n-6:n-3 fatty acid (FA) ratio and vitamin E on the semen quality, FA composition and antioxidant status of boars. Forty-eight Landrace boars were randomly distributed in a 3×2 factorial design with three n-6:n-3 FA ratios (14.4, 6.6 and 2.2) by the inclusion of three oil sources (soybean, fish/soybean, fish) and two vitamin E levels (200 and 400mg/kg). During the 8 weeks of treatment, semen parameters were evaluated. Serum, sperm and seminal plasma samples were taken at 0 and 8 weeks to monitor the FA composition and antioxidant status. Results showed that the 6.6 and 2.2 dietary ratios very effectively increased docosahexaenoic acid (DHA) and n-3 polyunsaturated fatty acid (PUFA) and decreased docosapentaenoic acid (DPA) and n-6:n-3 ratio in spermatozoa. The 6.6 dietary ratio contributed to a greater progressive sperm motility (Pvitamin E, 400mg/kg supplementation of vitamin E increased the progressive sperm motility, SOD of sperm, TAC and SOD of seminal plasma and serum, and decreased sperm malondialdehyde (MDA) (Pvitamin E supplementation improve progressive sperm motility by modifying the sperm FA composition and antioxidant status. PMID:26417649

  15. Criopreservação do sêmen ovino em meio diluente à base de água de coco em pó (ACP-102c) / Cryopreservation of ram semen in powdered coconut water (ACP-102c) based extender

    Scientific Electronic Library Online (English)

    José Maurício Maciel, Cavalcante; Oscar Oliveira, Brasil; Cristiane Clemente de Mello, Salgueiro; Carminda Sandra Brito, Salmito-Vanderley; José Ferreira, Nunes.

    2014-09-01

    Full Text Available O objetivo deste trabalho foi avaliar o diluente ACP-102c na criopreservação do sêmen ovino em comparação com o diluidor tris-glicose-gema (TRIS) e o sêmen fresco. Foram coletados 48 ejaculados de quatro ovinos, sendo tomadas duas alíquotas por ejaculado para diluição e criopreservação em ACP-102c o [...] u TRIS e uma terceira alíquota utilizada para análise do sêmen fresco. O sêmen fresco e o criopreservado em ambos os diluidores foram avaliados para viabilidade, integridade de membrana plasmática e acrossomal, teste hiposmótico, fragmentação do DNA e de motilidade espermática. Após descongelamento, ambos os diluidores não diferiram para viabilidade espermática, integridade de membrana plasmática e acrossomal, fragmentação de DNA e nas variáveis quantitativas e qualitativas de velocidade espermática, mas diferiram no teste hiposmótico, motilidade total e progressiva e amplitude lateral da cabeça, bem como em todas as variáveis de motilidade avaliadas, exceto linearidade e progressividade, após duas horas de incubação à 37 ºC. Houve variabilidade entre reprodutores na motilidade total e progressiva do sêmen criopreservado em ACP-102c após descongelamento. O diluidor ACP-102c conferiu menor proteção aos espermatozoides ovinos contra danos do congelamento quando comparado ao TRIS, mas o aprimoramento de sua formulação e protocolos mais adequados de congelação poderão torná-lo uma alternativa na congelação do sêmen ovino. Abstract in english The aim of this study was to evaluate the ACP-102c extender in the cryopreservation of ram semen compared to tris-glucose-egg yolk (TRIS) extender and fresh semen. Forty-eight ejaculates were collected from four rams and two aliquots per ejaculate were taken for dilution and cryopreservation in ACP- [...] 102c or TRIS and a third aliquot used for the fresh semen analysis. Either the fresh semen and cryopreserved in both extenders were evaluated for viability, integrity of plasma and acrosomal membrane, hypoosmotic swelling test, DNA fragmentation and sperm motility. The extenders did not differ for sperm viability, acrosome and plasma membrane integrity, DNA fragmentation and quantitative and qualitative parameters of sperm velocity after thawing, but differed in hypoosmotic swelling test, total and progressive motility and lateral extent of the head as well as in all motility parameters evaluated (except linearity and straightness) after two hours of incubation at 37 ºC. There was variability among rams in total and progressive motility of semen cryopreserved in ACP-102c after thawing. The ACP-102c extender showed less protection in the cryopreservation of ram sperm when compared to TRIS, but the improvement in its formulation and freezing protocols may make it an alternative to freezing ram semen.

  16. Reproductive toxicity of chromium in adult bonnet monkeys (Macaca radiata Geoffrey). Reversible oxidative stress in the semen

    International Nuclear Information System (INIS)

    The present study was designed to test the hypothesis that oxidative stress mediates chromium-induced reproductive toxicity. Monthly semen samples were collected from adult monkeys (Macaca radiata), which were exposed to varying doses (50, 100, 200 and 400 ppm) of chromium (as potassium dichromate) for 6 months through drinking water. Chromium treatment decreased sperm count, sperm forward motility and the specific activities of antioxidant enzymes, superoxide dismutase and catalase, and the concentration of reduced glutathione in both seminal plasma and sperm in a dose- and duration-dependent manner. On the other hand, the quantum of hydrogen peroxide in the seminal plasma/sperm from monkeys exposed to chromium increased with increasing dose and duration of chromium exposure. All these changes were reversed after 6 months of chromium-free exposure period. Simultaneous supplementation of vitamin C (0.5 g/L; 1.0 g/L; 2.0 g/L) prevented the development of chromium-induced oxidative stress. Data support the hypothesis and show that chronic chromium exposure induces a reversible oxidative stress in the seminal plasma and sperm by creating an imbalance between reactive oxygen species and antioxidant system, leading to sperm death and reduced motility of live sperm

  17. Estudio preliminar de colección de semen en oso de anteojos (Tremarctos ornatus)

    Scientific Electronic Library Online (English)

    Marco, Enciso H; Lizette, Bermúdez L.; Shirley, Evangelista V; Gianmarco, Rojas M.; Wilfredo, Huanca L..

    2006-01-01

    Full Text Available [...] Abstract in english Semen was collected in a Spectacled Bear (Tremarctos ornatus) reared in captivity using the electroejaculation technique. Four series of 6 volt discharges by 15 seconds each plus manual stimulation were carried out. An effective penis erection and small volume of ejaculate was obtained in the last s [...] eries of electrical stimulus. Seminal motility was 50%. Further studies are required to optimize the use of the electroejaculator in order to obtain higher volumes and better semen quality.

  18. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men

    DEFF Research Database (Denmark)

    Mocevic, Emina; Specht, Ina O; Marott, Jacob Louis; Giwercman, Aleksander; Jönsson, Bo Ag; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens

    2012-01-01

    Several animal studies indicate that mercury is a male reproductive toxicant, but human studies are few and contradictory. We examined semen characteristics and serum levels of reproductive hormones in relation to environmental exposure to mercury. Blood and semen samples were collected from 529 male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml(-1) in Gr...

  19. Efecto del estrés oxidativo sobre la calidad del semen de pacientes infértiles con leucocitospermia

    Directory of Open Access Journals (Sweden)

    William Quintero Pérez

    2000-12-01

    Full Text Available La leucocitospermia se ha asociado con alteraciones de la calidad del semen. No obstante no se han precisado con exactitud los mecanismos implicados en este daño. El propósito de este trabajo fue conocer si la leucocitospermia así como su contribución al estrés oxidativo generado en el aparato reproductor pueden afectar la calidad del semen. Para esto se estudió una muestra de 52 pacientes, hombres miembros de parejas infértiles que acudieron a la consulta de infertilidad del Instituto Nacional de Endocrinología, en los años 1998 y 1999. Se les realizó el análisis seminal según los procedimientos habituales y además la determinación de malonildialdehído, catalasa y superóxido dismutasa. La actividad superóxido dismutasa se correlacionó negativamente con el número de leucocitos, y positivamente con la movilidad b y la movilidad a + b. El trabajo realizado permitió concluir que los leucocitos en semen pueden afectar el balance entre los factores que favorecen y los que previenen el estrés oxidativo. La protección contra el estrés oxidativo es beneficiosa para la calidad del semenLeucocytospermia has been associated with alterations of the quality of semen. However, the mechanisms involved in this damage have not been exactly determined yet. This paper was aimed at knowing whether leucocytospermia and its contribution to the oxidative stress generated in the reproductive system may affect the quality of semen. To this end, a sample of 52 male patients members of infertile couples that were attended in the department of infertility of the National Institute of Endocrinology, in 1998 and 1999, was studied. The semen was analyzed according to the habitual procedures. Malondialdehyde, catalase and superoxide dismutase were also determined. The superoxide dismutase activity was negatively correlated to the number of leucocytes and positively to the mobility b and the mobility a+ b. It was concluded that leucocytes may affect the balance between the factors that favor and prevent the oxidative stress. The protection against the oxidative stress is beneficial for the quality of semen

  20. Detection of human papillomavirus DNA by PCR in semen from patients with and without penile warts.

    OpenAIRE

    Green, J.; Monteiro, E; Bolton, V N; Sanders, P.; Gibson, P. E.

    1991-01-01

    OBJECTIVES--To determine the prevalence of urethral HPV infection, as indicated by the presence of HPV DNA in semen, in males with and without penile warts. DESIGN--Prevalence study of HPV types 6/11 and 16 DNA using PCR and Southern blot hybridisation analysis of semen. SETTING--Department of Genitourinary Medicine, Blundell Street Clinic, Leeds General Infirmary and the Assisted Conception Unit (ACU) Kings' College, London. SUBJECTS--Patients attending the Genitourinary Clinic for treatment...

  1. Optimizing human semen cryopreservation by reducing test vial volume and repetitive test vial sampling

    DEFF Research Database (Denmark)

    S. Fuglesang Jensen, Christian; Ohl, Dana A; Parker, Walter R; da Rocha, Andre M; Keller, Laura M; Schuster, Timothy G; Sonksen, Jens; Smith, Gary D

    2015-01-01

    OBJECTIVE: To investigate optimal test vial (TV) volume, utility and reliability of TVs, intermediate temperature exposure (-88°C to -93°C) before cryostorage, cryostorage in nitrogen vapor (VN2) and liquid nitrogen (LN2), and long-term stability of VN2 cryostorage of human semen. DESIGN: Prospective clinical laboratory study. SETTING: University assisted reproductive technology (ART) laboratory. PATIENT(S): A total of 594 patients undergoing semen analysis and cryopreservation. INTERVENTION(S):...

  2. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men

    DEFF Research Database (Denmark)

    Mocevic, Emina; Specht, Ina; Marott, Jacob L; Giwercman, Aleksander; Jönsson, Bo Ag; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens

    2013-01-01

    Several animal studies indicate that mercury is a male reproductive toxicant, but human studies are few and contradictory. We examined semen characteristics and serum levels of reproductive hormones in relation to environmental exposure to mercury. Blood and semen samples were collected from 529 male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml(-1) in Gr...

  3. Effects of Stripping Frequency on Semen Quality of Endangered Caspian Brown Trout, Salmo trutta caspius

    Directory of Open Access Journals (Sweden)

    Saeed Hajirezaee

    2009-01-01

    Full Text Available Problem statement: Because of dramatic declines in stocks of endangered Caspian brown trout males, Salmo trutta caspius in Caspian Sea, each male brooder is stripped indispensably more than once during the spawning season in other to artificial insemination in hatchery. The aim of the present study was to assay the changes of indicators of semen quality (sperm motility, sperm production, semen volume and chemical composition of seminal fluid during these sequential strippings. Approach: The 11 tagged males were stripped four times every 12-14 days with beginning of spermiation period (2 December 2008 towards its end (10 January 2008. One-way Analysis Of Variance (ANOVA was employed to analyze differences between means of semen parameters. Also, the relationships between semen parameters were tested using the bivariate correlation coefficients of Pearson. Results: The semen volume, sperm density, osmolality and the concentrations of Na+, Cl-, K+, Ca2+, Mg2+ and total protein gradually decreased whereas the values of glucose and triglyceride had no significant changes during sequential strippings. Also, the values of semen pH, the percentage (5s post-activation and duration of motility were statistically stable until third stripping but a decrease was recorded for these parameters in the fourth stripping. As well as, significant positive correlations were found for sperm density vs. K+, Cl-, Na+, Ca2+, Mg2+, total protein, spermatocrit; the percentage of motile spermatozoa Vs Ca2+, Mg2+, K+, Cl-, Na+, total protein and also the duration of motility Vs K+, Cl-, total protein and pH. Conclusion: The semen quality of Caspian brown trout males decrease in successive strippings during spawning season. Also, the knowledge on values and correlations between the sperm motility characteristics and the composition of seminal fluid could be useful to formulation of a species-specific extender solution for cryopreservation of semen of Caspian brown trout.

  4. CONTRIBUTIONS ON THE ATTENUATE OF THE CRYOGENICS RESPONSE OF CONSTITUENTS PROTEINS HOMEOSTASIS OF THE SEMEN MATERIAL

    Directory of Open Access Journals (Sweden)

    VERA GRANACI

    2013-12-01

    Full Text Available The evidence of cryogenics response of the semen proteins, the influence of BioR administration on homeostasis of constituent gametes proteomics and on the cryobiological indexes of bull semen material was studded. The investigation has been performed on bulls from the Black Spotted breed of Moldavian type, maintained during the investigation in adequate conditions from the point of view of microclimate and fodder. The biopreparation administration have been done daily during 10 days in volume of 0,2 ml/100 kg living mass/day. Structural proteins of gametes posed the resistance given the influence of ultra low temperature (-196°C, content of totals proteins in the bull semen material denote no difference between the value of this parameter in the raw and cry preserved-thawed bull gametes. Both, in the raw and thawed semen cells the most rate occupy the hydrophilic proteins, After semen conservation-thawing process, it was observed a tendency of the diminution of hydrophilic proteins (- 3,35% and an increase of the basophilic proteins (+ 2,78 %. In the raw gametes prevail ?-globulins rate; conservation and thawing process of the semen material was associated by an increase of the albumins rate (+ 34,63% in semen cells; the rate of other three proteomic fractions: ?-, ? - and ?-globulins was decreased given theirs value registered in raw gametes. After the intramuscular administration of BioR preparation during 10 days on the sire bulls have been certified any modification of the studded proteomic fractions rate in thawed bull semen cells; albumins rate was decreased with 30,14%, the ?- globulins rate was increased with 19,28% in the experimental group; the ?- and ?- globulins with 8,5% and 2,36%, respectively, given control group. The BioR has an evident influence on the cryobiological specifics features of spermatozoids, such as the seminal cells mobility, the longevity and the survival absolutly index what are intensely influenced.

  5. Semen quality in Schistosoma haematobium infected men in Madagascar

    DEFF Research Database (Denmark)

    Leutscher, Peter Derek Christian; Høst, Erik; Reimert, Claus Michael

    2009-01-01

    The seminal vesicles and the prostate are frequently affected by egg-induced inflammation in Schistosoma haematobium infected men. The objective of this study was to assess the semen quality in men with male genital schistosomiasis (MGS). The examination of the semen samples was performed in men aged 15 to 49 years living an S. haematobium endemic area in Madagascar prior to anti-schistosoma treatment with praziquantel and five months later. Men from the high endemic Sirama sugarcane plantation ...

  6. Escitalopram treatment for premature ejaculation has a negative effect on semen parameters.

    Science.gov (United States)

    Koyuncu, H; Serefoglu, E C; Yencilek, E; Atalay, H; Akbas, N B; Sar?ca, K

    2011-01-01

    The aim of this study was to determine the impact of long-term escitalopram treatment on semen parameters of patients with lifelong premature ejaculation (PE). Between November 2008 and January 2010, patients admitted to urology outpatient clinic with a self-reported complaint of PE were evaluated. Medical and sexual history of patients were recorded and patients with lifelong PE (a total of 25 patients) who met the International Society of Sexual Medicine definition were asked to record their intravaginal ejaculatory latency time (IELT) for 1 month, complete Premature Ejaculation Diagnostic Tool (PEDT) questionnaire and give semen samples. Afterwards, patients received 10 mg escitalopram daily for 12 weeks and were invited for control visits at first and third month of treatment. During control visits, PEDT was administered again whereas IELTs were recorded and semen samples were re-examined. PEDT scores, arithmetic means of IELTs and results of semen analyses, which were recorded at baseline, first and third month were compared. At the third month of treatment, a significant increase in mean IELTs and a significant decrease in PEDT scores were detected. However there was a significant decrease in sperm concentration, motility and morphology when compared with the baseline semen measures. Daily escitalopram treatment effects the semen parameters of patients with lifelong PE. Further investigations with larger series are needed to see whether other serotonin reuptake inhibitors have similar side effects and to expose the exact mechanism underlying it. Different treatment modalities should be suggested to patients who desire fertility. PMID:21776003

  7. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki): A preliminary study.

    Science.gov (United States)

    Iswadi, M I; Ann, Z F; Hafiz, M M; Hafiz, M D; Fahrul, F J; Hajarian, H; Wahid, H; Zawawi, I; Khairiah, M S; Mazni, O A

    2012-01-01

    The Malayan gaur (Bos gaurus hubbacki) or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN). The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM) and electroejaculation (EEJ) technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur. PMID:26623302

  8. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki: A preliminary study

    Directory of Open Access Journals (Sweden)

    M.S. Khairiah

    2012-10-01

    Full Text Available The Malayan gaur (Bos gaurus hubbacki or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN. The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM and electroejaculation (EEJ technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur.

  9. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki): A preliminary study

    Science.gov (United States)

    Iswadi, M.I.; Ann, Z.F.; Hafiz, M.M.; Hafiz, M.D.; Fahrul, F.J.; Hajarian, H.; Wahid, H.; Zawawi, I.; Khairiah, M.S.; Mazni, O.A.

    2012-01-01

    The Malayan gaur (Bos gaurus hubbacki) or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN). The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM) and electroejaculation (EEJ) technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur.

  10. Human semen quality in the new millennium: a prospective cross-sectional population-based study of 4867 men

    DEFF Research Database (Denmark)

    Jørgensen, N; Joensen, Ulla Nordström; Jensen, TK; Jensen, MB; Almstrup, Kristian; Olesen, IA; Juul, A; Andersson, A; Carlsen, E; Petersen, Jørgen Holm; Toppari, J; Skakkebæk, Niels Erik

    2012-01-01

    Objectives Considerable interest and controversy over a possible decline in semen quality during the 20th century raised concern that semen quality could have reached a critically low level where it might affect human reproduction. The authors therefore initiated a study to assess reproductive health in men from the general population and to monitor changes in semen quality over time. Design Cross-sectional study of men from the general Danish population. Inclusion criteria were place of residen...

  11. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen.

    OpenAIRE

    van Engelenburg, F A; Maes, R. K.; van Oirschot, J T; Rijsewijk, F A

    1993-01-01

    We developed a polymerase chain reaction (PCR) assay to detect bovine herpesvirus type 1 (BHV-1) in bovine semen. Since bovine semen contains components that inhibit PCR amplification, a protocol was developed to purify BHV-1 DNA from bovine semen. To identify failures of PCR amplification, we used an internal control template that was coamplified by the same PCR primers. When separated fractions of BHV-1-contaminated semen were analyzed by the PCR, we found that more than 90% of the BHV-1 DN...

  12. Rapid detection of bovine herpesvirus 1 in the semen of infected bulls by a nested polymerase chain reaction assay.

    OpenAIRE

    Masri, S A; Olson, W; Nguyen, P. T.; Prins, S.; Deregt, D

    1996-01-01

    A nested polymerase chain reaction (PCR) assay was developed for the detection of bovine herpesvirus 1 (BHV-1) in bovine semen and compared with the virus isolation method. When extended semen, commonly used in the bovine artificial insemination industry, was inoculated with BHV-1, the PCR assay detected BHV-1 DNA in semen inoculated at 0.25-2.5 TCID50 per 0.5 mL. In contrast, the lower limit of detection for virus isolation was 250 TCID50 of BHV-1 inoculated in 0.5 mL of extended semen. Thes...

  13. Viability and fertility of cooled equine semen diluted with skimmed milk or glycine egg yolk-based extenders

    Scientific Electronic Library Online (English)

    Guilherme, Pugliesi; Giovanni Ribeiro de, Carvalho; Daniel Macêdo, Rates; Pedro Gama, Ker; Manuela Pereira da, Matta; Renan Reis de, Oliveira; José Monteiro da, Silva Filho.

    2012-12-01

    Full Text Available Two semen extenders were compared for their ability to maintain viability of horse semen during 24 hours of cold preservation, and for the pregnancy rate after artificial insemination. In the experiment 1, five ejaculates from three stallions were split-diluted in either a skimmed milk-based extende [...] r (Kenney extender) or a glycine egg yolk-based extender (Foote extender) and cooled at 6-8 ºC for 24 hours. Semen samples stored in Kenney extender for 24 hours had higher motility and spermatic vigor compared with those stored in Foote extender. However, samples stored in Foote extender had higher number of reactive sperm by hypoosmotic test and greater viability by epifluorescence test compared with those in Kenney extender. In the experiment 2, 17 and 23 ejaculates from two stallions were split-diluted with Kenney extender and Foote extender. The sperm concentration in each extender was adjusted to 500 million viable sperms per insemination dose. Semen was cooled to 6-8 ºC and stored for 24 hours. Seventy-four cycles of crossbred mares were inseminated with either semen diluted in Kenney extender or semen diluted in Foote extender. The pregnancy rate was higher from semen diluted in Kenney extender than that from semen in Foote extender (0.553 vs. 0.306). The Kenney extender is effective in preserving the motility, vigor and fertility of stallion semen after 24 hours of cold storage, whereas the Foote extender is not acceptable.

  14. Differential expression of novel biomarkers (TLR-2, TLR-4, COX-2, and Nrf-2) of inflammation and oxidative stress in semen of leukocytospermia patients.

    Science.gov (United States)

    Hagan, S; Khurana, N; Chandra, S; Abdel-Mageed, A B; Mondal, D; Hellstrom, W J G; Sikka, S C

    2015-09-01

    Chronic genitourinary inflammation results in Leukocytospermia (LCS), an elevated number of white blood cells (WBCs) in semen, which, in association with oxidative stress, may suppress sperm function, and manifest as male factor infertility. The current clinical diagnosis of LCS employs manual enumeration of WBCs and requires complex staining and laboratory skills or measurement of inflammatory cytokines and chemokines levels. Many patients with idiopathic infertility are asymptomatic. In search of better inflammatory markers for LCS, we evaluated expression of toll-like receptors 2 and 4 (TLR-2/4), cyclooxygenase-2 (COX-2), and nuclear factor (erythroid-derived 2)-like 2 (Nrf-2) in semen samples of age-matched infertile patients with and without LCS. We employed the usage of specific Western blot evaluation, cytokine array; immunofluorescence microscopy (IFM) followed by computer-based analysis, and other molecular approaches. As compared with non-LCS patients (n = 38), semen samples from LCS patients (n = 47) displayed significantly lower total sperm count (p LCS samples. Western blot analysis of LCS seminal plasma (n = 15) also showed a significant increase in expression of TLR-2 (p LCS patients (n = 15). Computer-based objective IFM analysis of spermatozoa from LCS patients showed increased expression of TLR-4 (p LCS samples. Altogether, these observations suggest that TLR-2/4, COX-2, and Nrf-2 can serve as novel biomarkers of inflammation and oxidative stress. Therefore, developing a rapid assay for these biomarkers may facilitate early diagnosis and management of LCS especially in idiopathic and asymptomatic male infertility patients. PMID:26227162

  15. Seminal plasma protein profiles of ejaculates obtained by internal artificial vagina and electroejaculation in Brahman bulls.

    Science.gov (United States)

    Rego, J P A; Moura, A A; Nouwens, A S; McGowan, M R; Boe-Hansen, G B

    2015-09-01

    The present study was conducted to investigate if differences exist in the seminal plasma protein profile from mature Brahman bulls using two methods of semen collection: internal artificial vagina (IAV) and electroejaculation (EEJ). Semen was collected four times from three bulls on the same day and parameters were assessed immediately post-collection. Seminal plasma proteins were evaluated by 2-D fluorescence difference gel electrophoresis and identified by mass spectrometry. Semen volume was greater (Ptransferrin, albumin, epididymal secretory glutathione peroxidase, among others. Thirty-three spots, corresponding to 26 proteins, had a greater volume (P<0.05) in gels derived from EEJ samples. These proteins were identified as spermadhesin-1, Bovine Sperm Protin 1, 3 and 5 isoforms, angiogenin-1, alpha-1B-glycoprotein, clusterin, nucleobindin-1, cathepsins, spermadhesin Z13, annexins, among others. Thus, proteins in greater amounts in samples obtained by IAV and EEJ were mainly of epididymal origin and accessory sex glands, respectively. PMID:26282524

  16. Association between a biomarker of exposure to polycyclic aromatic hydrocarbons and semen quality

    Directory of Open Access Journals (Sweden)

    Joanna Jurewicz

    2013-10-01

    Full Text Available Objectives: Growing evidence supports the reproductive and developmental toxicity of polycyclic aromatic hydrocarbons (PAHs from prenatal and postnatal exposure, but the results of epidemiological studies regarding harmful effects of PAHs exposure on male reproductive system still remain limited and inconclusive. The aim of the present study was to investigate the relationship between 1-hydroxypyrene, a biomarker of polycyclic aromatic hydrocarbons exposure and semen quality. Materials and Methods: The study population consisted of 277 men attending an infertility clinic for diagnostic purposes and having normal semen concentration of 20-300 mln/ml or slight oligozoospermia (semen concentration: 15-20 mln/ml (WHO 1999. All the men were healthy and under 45 years of age. All participants were interviewed and provided a semen sample. The interview included questions concerning demographics, socio-economic status, medical history related to past diseases which may have an impact on semen quality, lifestyle factors and occupational information. Concentrations of 1-hydroxypyrene (1-OHP in the urine samples were analyzed using high performance liquid chromatography (HPLC. Results: A positive association was found between the level of 1-OHP in urine and sperm neck abnormalities as well as the percentage of static sperm cells (p = 0.001, p = 0.018, respectively. Additionally, exposure to PAHs measured by 1-OHP in urine decreased semen volume and the percentage of motile sperm cells (p = 0.014, p = 0.0001, respectively. Conclusions: Presented findings indicate that the environmental level of PAHs exposure adversely affects male semen quality. The future large-scale studies should incorporate different biomarkers to generate a more accurate and full assessment of the effects of PAHs exposure on male fertility.

  17. Liquid semen storage in elephants (Elephas maximus and Loxodonta africana): species differences and storage optimization.

    Science.gov (United States)

    Kiso, Wendy K; Brown, Janine L; Siewerdt, Frank; Schmitt, Dennis L; Olson, Deborah; Crichton, Elizabeth G; Pukazhenthi, Budhan S

    2011-01-01

    Artificial insemination plays a key role in the genetic management of elephants in zoos. Because freshly extended semen is typically used for artificial insemination in elephants, it has become imperative to optimize conditions for liquid storage and semen transport. The objectives of this study were to examine the interactions between different extenders and storage temperatures on sperm total motility, progressive motility, and acrosomal integrity in Asian (Elephas maximus) and African (Loxodonta africana) elephants. Ejaculates were collected by rectal massage, diluted using a split-sample technique in 5 semen extenders: TL-Hepes (HEP), Modena (MOD), Biladyl (BIL), TEST refrigeration medium (TES), and INRA96 (INR), maintained at 35°C, 22°C, or 4°C. At 0, 4, 6, 12, and 24 hours, aliquots were removed and assessed for sperm total motility, progressive motility, and acrosomal integrity. After 24 hours of storage, African elephant spermatozoa exhibited greater longevity and higher values in sperm quality parameters compared with those of Asian elephants. In both species, semen storage at 35°C resulted in a sharp decline in all sperm quality parameters after 4 hours of storage, whereas storage at 22°C and 4°C facilitated sperm survival. In Asian elephants, MOD and HEP were most detrimental, whereas BIL, TES, and INR maintained motility up to 12 hours when spermatozoa were cooled to 22°Cor4°C. In African elephants, there were no differences among extenders. All media maintained good sperm quality parameters at 22°C or 4°C. However, although MOD, BIL, and INR were most effective at lower temperatures, HEP and TES maintained sperm motility at all storage temperatures. This study demonstrated sperm sensitivity to components of various semen extenders and storage temperatures and offers recommendations for semen extender choices for liquid semen storage for both Asian and African elephants. PMID:21127305

  18. Boar semen bacterial contamination in Italy and antibiotic efficacy in a modified extender

    Directory of Open Access Journals (Sweden)

    Carla Bresciani

    2014-02-01

    Full Text Available The aims of the study were to identify microbial flora in boar semen under field conditions in northern Italy, to investigate antibiotic resistance and sensitivity of isolated bacteria, and to evaluate elimination of bacteria after storage in two types of extenders added with different antibiotics (amikacin vs gentamicin. A total of 60 boars were collected in 13 pig farms. Bacteriological and mycological investigations were performed immediately on raw semen samples, then at 48 and 120 h of storage on semen diluted randomly in a new short-term modified extender (ME-S or in a commercial one (CRONOSTM. Bacterial contamination was found in 63% of raw semen samples and different bacterial species were isolated: E.coli, Serratia marcescens, Staphylococcus epidermidis and aureus, Proteus spp., Streptococcus spp. and Pseudomonas aeruginosa. E. coli was the most isolated contaminant (53%; Pseudomonas aeruginosa was found only in one semen sample. The analysis of variance of factors affecting contamination levels was significant for the farm of origin (P<0.05 and not significant for the breed. Antibiotic resistance of these bacteria was assessed using different antibiotics. Significant differences (P<0.05 between observed and expected frequencies of bacterial isolates resistant or not to the antibiotics contained in the extenders were found. At 48 h of storage a reduction of aerobic contamination was found after ME-S dilution by 85.3% and after CRONOSTM by 63.8%. This paper proved the presence of pathogenic bacteria in semen. We thus believe it is highly advisable to perform periodic microbiological screening of boar semen in the swine industry to avoid the use of low sperm quality.

  19. Effect of L-(+-Ergothioneine (EGT on Freezability of Ram Semen

    Directory of Open Access Journals (Sweden)

    U.C. Ari

    2012-12-01

    Full Text Available The aim of this study was to investigate freezability of ram semen extended with different L-(+-Ergothioneine (EGT doses. For this aim, semen from four ram were collected with artificial vagina (44°C and then pooled. Pooled semen was divided five aliquots and extended with skim milk based extender containing 0 mmol/L (EGT0: Control, 1 mmol/L (EGT1, 2 mmol/L (EGT2, 5 mmol/L (EGT5 and 10 mmol/L (EGT10 EGT, respectively. After equilibration (+5°C/2 h, the extended aliquots of semen in straws were cryopreserved in Liquid Nitrogen (LN2 vapour (-120°C/15 min and stored in LN2 (-196°C until examination date. Totally two straws from 17 replications (trials in each experimental group were thawed in water bath (37°C/1 min and percentages of progressive motility, sperm viability, abnormality, acrosome and membrane integrity were determined and statistically assessed with SPSS. In the result, it was determined that different doses of EGT did not affect freezability of ram semen when seventeen replications considered (p>0.05. However, when separated trials according to good (?20% for motility in control groups; 8 in 17 replications or poor (<20% for motility in control groups; 9 in 17 replications freezability were statistically analyzed, beneficial effects of 10 mmol/L concentration of EGT on progressive motility and membrane integrity were determined in poor freezability trials, compared with control (p<0.05. In conclusion, addition of EGT in semen extenders may be considered to improve freezability of ram semen, if there is a situation of poor-freezability.

  20. Prediction of fertility of bovine semen: Preliminary studies with the hamster egg penetration test.

    Science.gov (United States)

    Eaglesome, M D; Miller, S A

    1989-03-01

    The ability of liposome-treated fresh and frozen spermatozoa from two bulls to interact with zona-free hamster oocytes was examined to show whether the in vitro test results would correspond with in vivo fertility as indicated by the 60 to 90 d nonreturn to service rates which, using frozen semen, were 77 and 59%, respectively. The motility of spermatozoa in washed suspensions was also rated. Hamster test results were obtained using three ejaculates from each bull both as fresh and frozen semen. The results with frozen semen corresponded with fertility. The averages of three hamster tests for oocyte penetration rates and mean number of spermatozoa per penetrated oocyte comparing spermatozoa from the bull with the higher fertility with spermatozoa from the bull with the lower fertility were 91% and 2.7 versus 56% and 1.4, respectively. Spermatozoa washed from frozen semen from the bull with the higher fertility interacted with hamster oocytes at the higher rate even when sperm motility was rated the same for both bulls. By contrast, fresh spermatozoa from the lower fertility bull interacted with hamster oocytes at a higher rate than spermatozoa from the higher fertility bull in six tests, comparing six ejaculates of fresh semen from both bulls. Comparing the higher fertility bull with the lower fertility bull, the average of six tests for oocyte penetration rates and mean number of spermatozoa per penetrated oocyte were 60% and 1.6 versus 89% and 3.0, respectively. This suggests that this hamster test cannot be used with fresh semen to predict relative levels of fertility of frozen semen. Also, the subjective rating of sperm motility did not correspond with the in vitro oocyte penetrating ability of the spermatozoa. PMID:16726582

  1. Contribution of semen trait selection, artificial insemination technique, and semen dose to the profitability of pig production systems: A simulation study.

    Science.gov (United States)

    Gonzalez-Pena, Dianelys; Knox, Robert V; Rodriguez-Zas, Sandra L

    2016-01-15

    The economic impact of selection for semen traits on pig production systems and potential interaction with artificial insemination (AI) technique and semen dose remains partially understood. The objectives of this study were to compare the financial indicators (gross return, net profit, cost) in a three-tier pig production system under one of two selection strategies: a traditional strategy including nine paternal and maternal traits (S9) and an advanced strategy that adds four semen traits (S13). Maternal traits included the number of pigs born alive, litter birth weight, adjusted 21-day litter weight, and the number of pigs at 21 days, and paternal traits included days to 113.5 kg, back fat, average daily gain, feed efficiency, and carcass lean percentage. The four semen traits included volume, concentration, progressive motility of spermatozoa, and abnormal spermatozoa. Simultaneously, the impact of two AI techniques and a range of fresh refrigerated semen doses including cervical AI with 3 × 10(9) (CAI3) and 2 × 10(9) (CAI2) sperm cells/dose, and intrauterine AI with 1.5 × 10(9) (IUI1.5), 0.75 × 10(9) (IUI0.75), and 0.5 × 10(9) (IUI0.5) sperm cells/dose were evaluated. These factors were also evaluated using a range of farrowing rates (60%-90%), litter sizes (8-14 live-born pigs), and a selected semen collection frequency. The financial impact of the factors was assessed through simulation of a three-way crossbreeding system (maternal nucleus lines A and B and paternal nucleus line C) using ZPLAN. The highest return on investment (profit/cost) of boars was observed at 2.33 collections/wk (three periods of 24 hours between collections). Under this schedule, a significant (P < 0.0001) interaction between the selection strategy and the AI technique-dose combination was identified for the gross return; meanwhile, significant (P < 0.0001) additive effects of the selection strategy and AI technique-dose combination were observed for the net profit. The highest gross return was obtained under S13 with IUI0.75 and IUI0.5. The net profit of S13 was 34.37% higher than the traditional S9 (P < 0.0001). The net profit favored IUI0.5 with relative differences of 4.13%, 2.41%, 1.72%, and 0.43% compared to CAI3, CAI2, IUI1.5, and IUI0.75, respectively. The advanced selection strategy proposed including four semen traits is recommended on the basis of the higher profitability relative to the traditional strategy. PMID:26435262

  2. Elimination of toxicity and enhanced detection of lumpy skin disease virus on cell culture from experimentally infected bovine semen samples.

    Science.gov (United States)

    Bagla, V P; Osuagwuh, U I; Annandale, C H; Irons, P C; Venter, E H

    2006-12-01

    Lumpy skin disease virus (LSDV), a poxvirus of the genus Capripoxvirus, is shed in the semen of infected bulls. The screening of semen for infectious virus requires a sensitive diagnostic method. The isolation of the virus on cell cultures and/or the polymerase chain reaction (PCR) are sensitive diagnostic tests which may be used to screen semen for LSD viral DNA prior to artificial insemination. Although cell culture detects infectious virus and is a sensitive method, there are major difficulties in using this method due to the toxic effect of semen on the cells. The aim of this study was to find a method that decreases the toxic effect of semen and enhances the isolation of LSDV on cell culture. Semen samples from LSDV sero-negative bulls were collected and infected with a field isolate of LSDV, strain V248/93, with a titre of 6.5 log TCID50. The semen samples were treated with one of four different methods: centrifugation, serial dilution, filtration and chemical treatment with kaolin. The samples subjected to centrifugation, serial dilution and filtration were supplemented with gentamycin. Semen toxicity on cell cultures was eliminated when supernatants of semen samples centrifuged at 2000 rpm for 1, 3 and 5 min and serially diluted were used to inoculate confluent monolayer bovine dermis cells. The toxicity recorded when the pellet fractions of semen samples centrifuged for 5 min at 2000 rpm was comparable to results obtained from serially diluted samples supplemented with gentamycin. Filtration and kaolin treatment of semen samples did not remove the toxic effect. PMID:17283726

  3. Características Bioquímicas del Plasma Seminal Fresco y Congelado/Descongelado de Alpaca (Vicugna pacos) / Biochemical characteristics of fresh and freeze/thawed seminal plasma of alpaca (Vicugna pacos)

    Scientific Electronic Library Online (English)

    Hugo, Díaz V; Juan, Espinoza B; Wilfredo, Huanca L; Bernardo, Lopez-Torres; José, Rodríguez G.

    2015-01-01

    Full Text Available El objetivo del estudio fue determinar y comparar las características bioquímicas del plasma seminal de alpacas en fresco y descongelado. Se recolectó semen, mediante electroeyaculación, de cuatro alpacas adultas, una vez por semana por cuatro semanas. El semen se centrifugó y el plasma seminal fue [...] separado. Una parte se analizó en fresco y la otra parte se almacenó en nitrógeno líquido por un mes. Se le hizo el análisis bioquímico a ambos juegos de muestras. Se determinaron los niveles de glucosa, colesterol total, colesterol-HDL, triglicéridos, proteínas totales, albúmina, calcio, fosfatasa alcalina, ALT y ?-GT. Solo los valores de triglicéridos descendieron significativamente por el proceso de congelación/descongelación (p Abstract in english The aim of this study was to determine and compare the biochemical characteristics of fresh and thawed seminal plasma of alpacas. Semen was collected by electroejaculation from four adult males, once a week per four weeks. Semen was centrifuged and the seminal plasma was separated. One part was anal [...] ysed fresh and other stored for one month on liquid nitrogen and then thawed and analysed. Levels of glucose, total cholesterol, HDL-cholesterol, triglycerides, total protein, albumin, calcium, alkaline phosphatase, ALT and ?-GT were determined. Only the triglycerides significantly decreased due to the process of freeze/thawed, where the values were 44.12 ± 7.38 and 27.31 ± 4.65 mg/dl in fresh and thawed respectively.

  4. Cloned embryos from semen. Part 1: in vitro proliferation of epithelial cells on embryonic fibroblasts after isolation from semen by gradient centrifugation.

    Science.gov (United States)

    Nel-Themaat, Liesl; Gómez, Martha C; Pope, C Earle; Lopez, Monica; Wirtu, Gemechu; Cole, Alex; Dresser, Betsy L; Lyons, Leslie A; Bondioli, Kenneth R; Godke, Robert A

    2008-03-01

    Although epithelial-like somatic cells have been previously isolated from semen, cell proliferation rates were low. Culture of whole semen samples resulted in loss of potentially valuable spermatozoa. The aims of the present study were to: (1) isolate somatic cells from semen, while preserving sperm viability, and (2) optimize in vitro culture conditions for semen-derived epithelial cells. Density gradient centrifugation of washed ejaculates of two rams (Ovis aries) (n = 24) and one eland bull (Taurotragus oryx) (n = 4) was performed using a three-layer discontinuous Percoll column consisting of 90% (P-90), 50% (P-50), and 20% (P-20) Percoll. In vitro culture and Trypan Blue staining indicated that live somatic cells settled in the P-20 layer. Nonmotile spermatozoa were recovered at the P-50 and P-90 interfaces, whereas motile spermatozoa were collected in the pellet from the P-90 layer. Subsequently, somatic cells isolated from the P-20 layer were plated either on inactivated 3T3 mouse embryonic fibroblast feeder layers, collagen-coated plates with 3T3 feeder cell inserts, or on collagen-coated plates. Initial somatic cell plating was similar among treatments, but proliferation significantly increased when cocultured with 3T3 cells (feeder or insert). Furthermore, two different types of epithelial cells were obtained. The exact origin of the cells in the male reproduction system is uncertain and probably variable. The present method of cell isolation and in vitro culture may be of value for preserving endangered species. Specifically, cells isolated and cultured from cryopreserved semen of nonliving males could be used for producing embryos by somatic cell nuclear transfer. PMID:18241128

  5. Efecto de tres dilutores en la conservación del semen de alpacas

    Scientific Electronic Library Online (English)

    Fernando, Raymundo T.; Wilfredo, Huanca L.; Teodosio, Huanca M.; Sandra, Huerta O.; Aída, Cordero R.

    2006-07-01

    Full Text Available El presente trabajo tuvo el propósito de evaluar la eficiencia de tres dilutores: Tris-glucosa, Tris-fructosa y un dilutor comercial de cerdo, en la conservación del semen de alpaca. Se utilizaron 12 machos que fueron entrenados por un mes en la colección de semen con vagina artificial y frazadilla [...] eléctrica. Los animales fueron de la Sub-Estación Experimental Quimsachata del INIA, Puno. El semen tuvo las siguientes características: volumen de 2.7 ± 0.8 ml, viscosidad de 1.04 ± 0.3, motilidad de 54.0 ± 8.0%, pH con tendencia a la alcalinidad, concentración de 248,100 espermatozoides/ml, y el color que predominó fue el blanco lechoso. El tiempo promedio de cópula fue de 26.5 ± 3.8 minutos. Se utilizó un factor de dilución de 1 en 2 para semen y dilutor, respectivamente. Las diluciones fueron evaluadas considerando la motilidad individual como único parámetro para determinar la viabilidad espermática. El dilutor Tris-glucosa mostró una viabilidad promedio de 5.8 ± 1.1 horas, el Tris-fructosa de 6.1 ± 2.5 horas y el dilutor comercial de cerdo de 5.5 ± 1.0 horas, sin haber diferencia estadística significativa entre dilutores. Abstract in english The present work was carried out at the Experimental Research Station Quimsachata-INIA, Puno. The objective was to evaluate the efficiency of three semen extenders in alpaca semen: Tris-glucose, Tris-fructose and a pig´s commercial extender. Twelve animals were selected for semen collection using th [...] e artificial vagina. Males were trained for a month. Mean values for semen parameters were: volume of 2.7 ± 0.8 ml, viscosity of 1. 04 ± 0.3, motility of 54.0 ± 8.0%, pH towards to alkaline, concentration of 248,000 sperms/ml, and the most common color was milky white. The average time for the copula was 26.5 ± 3.8 minutes. Semen was diluted in 1:2 and the dilutions were evaluated on individual motility as the only parameter for sperm viability. The extender Tris-glucose had an average of 5.8 ± 1.1 hours viability, Tris-fructose had 6.1 ± 2.5 hours, and the commercial extender had 5.5 ± 1.0 hours, without statistical differences between extenders.

  6. [Concentration of some trace elements in the semen of men].

    Science.gov (United States)

    Chowaniec, T; Lorenz, K; Guzikowski, W

    1989-04-01

    By means of atomic absorption spectrophotometry, the authors determined the concentration of calcium, potassium, magnesium, zinc, copper and plumbum in the spermatic fluid of 32 men infertile at the time of the examination. Assuming the number of sperms as the main criterion, the material was divided in three groups: I--lack of sperms (5.men), II--more than 40 million sperms in 1 ml of the spermatic fluid (8 men) and group III--less than 40 million sperms in the spermatic fluid (19 men). Different degrees of asthenozoospermia were taken into consideration--in group II--4 cases, in group III--14 cases. The mean values of the levels of the elements defined in mg/dm3, the range of the levels and standard deviations have been presented in the table. Statistical calculations made according to the T-Student test on the IBM/PC computer according to the Epistat programme did not show statistical significance between the particular groups as to the elements examined. It seems that the examination of the level of trace elements in the semen based on the clinical classification, without considering environmental conditions of life and work, way of nutrition and other possible factors does not present greater value. PMID:2806982

  7. Semen cryopreservation in fish: effects on sperm motility and fertility

    International Nuclear Information System (INIS)

    The cryopreservation of semen in fish, as in many species even shows effects that decrease sperm quality and directly engage cell ability to successfully participate in the processes of fertilization and embryonic development. the characteristics such as mobility and fertilizing capacity of fertilization of sperm are considered to be quality criteria that allow to measure the success or failure of the process, since they are considered integrative variables, being indicators that depend not on a single factor, but on the stability and welfare of all structures, enzymes and subcellular functional compounds that give place to these spermatic characteristics. membrane damage (Adenylate cyclase, ion channels, grouping of other proteins, among others) and their implication in the route of signaling pathway leading to spermatic activation, ATP degradation and fragmentation of nuclear and mitochondrial DNA (genome), degradation of kinase enzymes and other cytosolic proteins (proteome) are considered today, as some of the molecular factors that most affect during cryopreservation and markedly decreasing the fertilizing capacity and mobility of sperm in fish. Proposals on the molecular mechanisms, by which these subcellular factors interact and act as consequence of cryopreservation, are some of the topics covered in this review. Understanding the principles and factors that are involved in the origin of such damages, will allow to improved cryopreservation processes, making them less harmful and more efficient.

  8. Sperm head phenotype and male fertility in ram semen.

    Science.gov (United States)

    Maroto-Morales, A; Ramón, M; García-Álvarez, O; Montoro, V; Soler, A J; Fernández-Santos, M R; Roldan, E R S; Pérez-Guzmán, M D; Garde, J J

    2015-12-01

    Although there is ample evidence for the effects of sperm head shape on sperm function, its impact on fertility has not been explored in detail at the intraspecific level in mammals. Here, we assess the relationship between sperm head shape and male fertility in a large-scale study in Manchega sheep (Ovis aries), which have not undergone any selection for fertility. Semen was collected from 83 mature rams, and before insemination, head shapes were measured for five parameters: area, perimeter, length, width, and p2a (perimeter(2)/2×?×area) using a computer-assisted sperm morphometric analysis. In addition, a cluster analysis using sperm head length and p2a factor was performed to determine sperm subpopulations (SPs) structure. Our results show the existence of four sperm SPs, which present different sperm head phenotype: SP1 (large and round), SP2 (short and elongated), SP3 (shortest and round), and SP4 (large and the most elongated). No relationships were found between males' fertility rates and average values of sperm head dimensions. However, differences in fertility rates between rams were strongly associated to the proportion of spermatozoa in an ejaculate SP with short and elongated heads (P < 0.001). These findings show how the heterogeneity in sperm head shape of the ejaculate has an effect on reproductive success, and highlight the important role of modulation of the ejaculate at the intraspecific level. PMID:26318229

  9. Effect of varicocelectomy on testis volume and semen parameters in adolescents: a meta-analysis.

    Science.gov (United States)

    Zhou, Tie; Zhang, Wei; Chen, Qi; Li, Lei; Cao, Huan; Xu, Chuan-Liang; Chen, Guang-Hua; Sun, Ying-Hao

    2015-01-01

    Varicocele repair in adolescent remains controversial. Our aim is to identify and combine clinical trials results published thus far to ascertain the efficacy of varicocelectomy in improving testis volume and semen parameters compared with nontreatment control. A literature search was performed using Medline, Embase and Web of Science, which included results obtained from meta-analysis, randomized and nonrandomized controlled studies. The study population was adolescents with clinically palpable varicocele with or without the testicular asymmetry or abnormal semen parameters. Cases were allocated to treatment and observation groups, and testis volume or semen parameters were adopted as outcome measures. As a result, seven randomized controlled trials (RCTs) and nonrandomized controlled trials studying bilateral testis volume or semen parameters in both treatment and observation groups were identified. Using a random effect model, mean difference of testis volume between the treatment group and the observation group was 2.9 ml (95% confidence interval [CI]: 0.6, 5.2; P3.0, 8.7; P= 0.336) respectively. In conclusion, although varicocelectomy significantly improved bilateral testis volume in adolescents with varicocele compared with observation cases, semen parameters did not have any statistically significant difference between two groups. Well-planned, properly conducted RCTs are needed in order to confirm the above-mentioned conclusion further and to explore whether varicocele repair in adolescents could improve subsequently spontaneous pregnancy rates. PMID:25677136

  10. Microsatellite analysis of cryopreserved stallion semen stored on FTA(R paper : research communication

    Directory of Open Access Journals (Sweden)

    M.L. Schulman

    2002-07-01

    Full Text Available The aim of this study was to establish and validate a method to permit microsatellite analysis of DNA profiles obtained from frozen-thawed stallion sperm cells. This would provide reliable and accurate verification of the identification of a semen donor. Ejaculates from 5 pony stallions were collected, processed and frozen in 0.5 m plastic straws. Aliquots of 100 m of the frozen-thawed semen thus obtained were either placed directly, or diluted (1 : 10 ; 1 : 100 ; and 1 : 1000 and placed on slides of FTA(R paper. Similarly, blood samples obtained from each of the stallions were placed onto slides of FTA(R paper. A punch was removed from each sample after drying. Each sample was mixed with FTA(R purification reagent, Dithiothreitol and Proteinase K before incubation and processing. All samples were processed with a set of 13 microsatellite markers. Further analysis permitted a comparison of the DNA profiles of the frozen-thawed semen and the blood samples. A full profile of markers was obtained from the 1 : 10 and 1 : 100 dilutions of the frozen-thawed semen samples as well as from the blood samples. The DNA profiles from the frozen-thawed semen and blood samples obtained from the stallions matched in all cases.

  11. Diagnostic value of sperm function tests and routine semen analyses in fertile and infertile men.

    Science.gov (United States)

    Wang, C; Chan, S Y; Ng, M; So, W W; Tsoi, W L; Lo, T; Leung, A

    1988-01-01

    The results of routine semen analyses, the zona-free hamster oocyte penetration test, the hypoosmotic swelling test, and semen adenosine triphosphate levels were studied in 66 fertile and 130 infertile men. Multivariate discriminant analysis demonstrated that routine semen parameters including semen volume, sperm count, percent sperm motility, and percent normal spermatozoa in combination could predict the fertility of these patients with 70.4% accuracy. Of the three sperm function tests evaluated, the zona-free hamster oocyte penetration test and the hypoosmotic swelling test were selected by the multivariate discriminant analysis as variables capable of providing significant information on the fertility status of the patients. However, the addition of the results of these two tests to the routine semen analysis did not significantly improve the predictability of fertility. The overall correct prediction rate was 77.6% after incorporation of the results of these two sperm function tests. In this group of subjects, the presently available sperm function tests did not predict the fertility status of a patient with a high degree of accuracy. PMID:3215824

  12. Efecto del dilutor tris y citrato con yema de huevo de cordorniz sobre la viabilidad espermática en semen ovino congelado en pajillas / Effect of tris and citrate - quail eggyolk extenders on viability of ovine frozen semen in straws

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V.; Arturo, Ayulo L.; César, Pantoja A..

    2011-07-01

    Full Text Available Se evaluó el comportamiento de los dilutores Tris-yema y Citrato-yema en el congelamiento de semen de ovino y la integridad de la membrana espermática del semen congelado en pajillas. El estudio se realizó en el Banco Nacional de Semen UNALM con seis carneros de tres razas. El semen se colectó en va [...] gina artificial, se diluyó con Tris - glucosa - yema de huevo de Codorniz (Tris) o Citrato - glucosa - yema de huevo (Citrato), se almacenó en pajillas de 0.5 ml, y se congeló en nitrógeno líquido. El descongelamiento se realizó a 38 °C por 15 segundos. En semen refrigerado, la Motilidad Individual Progresiva (MIP) en semen diluido con Tris fue 82.3% y con Citrato de 79.2%, y los valores de la integridad de membrana (HOST) fueron de 78.0 ± 4.4 con Tris y 73.2 ± 5.8% con Citrato. En semen descongelado, la MIP fue de 62.0 y 56.8%, y HOST de 49.8 ± 3.9 y 41.3 ± 3.8% para los dilutores Tris y Citrato, respectivamente, existiendo diferencias significativas entre dilutores, carneros y momentos de procesamiento (p Abstract in english The study evaluated the performance of Tris-egg yolk and Citrate-egg-yolk as extenders for freezing ram semen in straws and the integrity of sperm membrane of frozen sperm at the National Semen Bank - UNALM, Lima, Peru using six ram semen donors of three breeds. The semen was collected in an artific [...] ial vagina, diluted with Tris - glucose - quail egg yolk (Tris) or with Citrate - glucose - egg yolk (Citrate), stored in 0.5 ml pellets, and frozen in liquid nitrogen. Thawing was done at 38 ºC for 15 seconds. In refrigerated semen, the Progressive Individual Motility (PIM) in diluted semen with Tris was 82.3% and with Citrate was 79.2%, and the integrity of the cytoplasmic membrane (HOST) was 78.0 ± 4.4 with Tris and 73.2 ± 5.8% with Citrate. In thawed semen, PIM was 62.0 and 56.8%, and HOST was 49.8 ± 3.9 and 41.3 ± 3.8% for Tris and Citrate respectively, with significant differences between extenders, rams and processing period (p

  13. Comparação entre os sistemas automatizado e convencional de criopreservação de sêmen bovino / Comparison between the conventional and automated systems of semen bovine cryopreservation

    Scientific Electronic Library Online (English)

    Cátia Oliveira Guimarães, Abud; Lucas Jacomini, Abud; José Carvalho, Oliveira Neto; Margot Alves Nunes, Dode; José Robson Bezerra, Sereno; Carlos Frederico, Martins.

    2014-03-01

    Full Text Available O objetivo deste estudo foi comparar a eficiência do sistema automatizado (curva de resfriamento controlada eletronicamente) de congelação de sêmen bovino versus o sistema convencional (curva não controlada) por meio dos parâmetros de qualidade e viabilidade espermática no período pós-descongelação. [...] O sêmen de quatro touros azebuados adultos foram criopreservados simultaneamente em meio tris, gema e glicerol 7%. A avaliação computadorizada do sêmen descongelado detectou os seguintes parâmetros: MP 56,50±22,25%; VAP 34,77±4,25µm/s; VSL 28,17±4,25 µm/s; VCL 58,45±6,85µm/s; STR 82,00±2,31%; LIN 49,50±3,32%, para o sistema automatizado e MP. 57,00±13,11%; VAP 25,75±1,66µm/s; VSL 23,32±1,99µm/s; VCL 63,32±1,79µm/s; STR 82,25±3,59µm/s; LIN 50,00±4,97µm/s para o sistema convencional. Os valores médios das avaliações de integridade de membrana plasmática e integridade acrossomal foram de 54,72±12,55% e 36,13±22,20% para o sistema automatizado e 53,22±13,22% e 47,26±5,74% para o sistema convencional, respectivamente. Com os parâmetros avaliados foi possível identificar que não houve diferença estatística entre os sistemas de criopreservação. Desta forma, a escolha do método de criopreservação do sêmen bovino para utilização direta na propriedade fica a critério do técnico responsável, que deverá se basear na realidade de cada propriedade. Para tanto, sempre se deve considerar que o sistema convencional pode trazer mais variações que o sistema automatizado que, apesar do custo do equipamento, pode garantir repetibilidade nos resultados e consequente qualidade do sêmen bovino criopreservado. Abstract in english The objective of this study was to compare the efficiency of bovine semen cryopreservation using the controlled-rate freezing machine versus the conventional method (uncontrolled curve) by the parameters of sperm quality and viability in post-thaw period. Semen from four adult crossbreed bulls was c [...] ryopreserved in Tris-yolk-glycerol medium. The computer assisted analysis of thawed semen detected the following results: PM 56.50±22.25%; VAP 34.77±4.25µm/s; VSL 28.17±4.25µm/s; VCL 58.45±6.85µm/s; STR 82.00±2.31%; LIN 49.50±3.32%, to automated system and PM 57.00±13.11%; VAP 25.75±1.66µm/s; VSL 23.32±1.99µm/s; VCL 63.32±1.79µm/s; STR 82.25±3.59µm/s; LIN 50.00±4.97µm/s to conventional cryopreservation system. The results of plasma membrane and acrosome integrity evaluation were 54.7±12.55% and 36.13±22.20% for the automated system and 53.22±13.22% and 47.26±5.74% for the conventional system, respectively. The parameters evaluated demonstrated that there was no statistical difference between the cryopreservation systems. Thus, the choice of the bovine semen cryopreservation method to be used on a farm is a responsibility of the technician, and should be based on the reality of each farm. Therefore, it is always necessary to consider that the conventional system of bovine semen cryopreservation can vary more than the automated system, which, despite the cost of the equipment, can ensure repeatability of the results and consequent quality of cryopreserved bovine semen.

  14. Introducing and validation of SYBR Green Real-Time PCR method to determinate sex ratio in bovine semen.

    Science.gov (United States)

    Maleki, Adham Fani; Moussavi, AliReza Heravi; Nassiri, Mohammad Reza; Tahmoorespur, Mojtaba; Vakili, Seyed Alireza

    2013-07-01

    Flow cytometry is a widely used application for validating the accuracy of sperm sexing. However, this method is relatively expensive and requires considerable technical support. An alternative method employing simpler technology at low cost could be suitable for the evaluation of bovine semen in laboratories with low budgets. We used a SYBR Green Real-Time PCR assay to determinate sex ratio in bovine semen. The PLP and SRY genes were amplified to isolate the specific fragments of X- and Y-chromosome sequences, respectively. Two certified standard curves were obtained using two plasmids containing PLP and SRY amplicons. Our results show no significant difference in semen sex ratio in unsorted semen (54.7±0.52% X and 47.6±0.60% Y). However, significant difference was observed in X/Y-sorted semen (93.3±0.08% X and 91.4±0.06% Y-sperm), as compared to the expected ratio in unsorted semen or the post-sorting reanalysis data. The evolution of X-chromosome bearing sperm content in unsorted samples showed an average of 52.6 for ejaculates and 51.8 for the commercial semen. In order to confirm our results, the accuracy, repeatability and reproducibility of the method were tested resulting in 98.2% accuracy, repeatability of CV=5.59% and reproducibility of CV=5.40%. Thus, this method is demonstrated to be a reliable and inexpensive way to test sexual chromosome content in semen samples. PMID:23773328

  15. Characteristics of urethral and epididymal semen collected from domestic cats-A retrospective study of 214 cases.

    Science.gov (United States)

    Prochowska, Sylwia; Ni?a?ski, Wojciech; Ochota, Ma?gorzata; Partyka, Agnieszka

    2015-12-01

    This study was designed to describe and compare basic semen characteristics and sperm motility parameters obtained via computer-assisted sperm analysis (CASA) in feline semen collected from the urethra and epididymis, on the basis of large, unselected population of domestic cats. The semen collected from 214 males was subjected for routine semen assessment and CASA evaluation. Semen collected by urethral catheterization (CT) and by epididymal slicing (EP) has comparable characteristics according to total sperm count (47.7 ± 42.1 and 52.9 ± 45.0), subjective motility (71.1 ± 17.0 and 69.3 ± 13.9), viability (74.9 ± 13.4 and 76.7 ± 10.6), and morphology (52.6 ± 19.0 and 47.2 ± 17.4). The study of a large feline population confirmed a high incidence of teratospermy in cats, which negatively affects sperm motility parameters assessed by CASA. A lack of a correlation between CT and EP semen for total sperm count and viability, as well as occasional gross differences between the morphology of CT and EP semen of the same cat suggests that many factors may affect sperm cells, and the fertility and/or infertility of patients should not be assessed after examining only one sample. Additionally, technical problems with assessment of EP samples (understated results) suggest that CT semen is more appropriate for an analysis by CASA than EP. PMID:26359850

  16. SEMEN COLLECTION IN EMU (DROMAIUS NOVAEHOLLANDIAE BIRD BY NONTEASER METHOD AND ITS MACROSCOPICAL EVALUATION IN HUMID TROPICAL CLIMATE

    Directory of Open Access Journals (Sweden)

    Sundaresan, A*

    2015-03-01

    Full Text Available A study was conducted for collection and evaluation of emu bird semen by non teaser method. Ten adult male emu birds aged 3 to 4 years were selected and housed individually in a 10’ x 50’ pen constructed in parallel rows at emu unit, University Research Farm, TANUVAS, Chennai, Tamilnadu, India. The male birds were selected based on their readiness in accepting human beings without fear. All the birds were housed properly under standard managemental condition. An Isocaloric and Isonitrogenous standard emu breeder ration was fed to birds and portable drinking water were made available ad libitum. The selected male emus were trained for semen collection by non-teaser method. Out of 10 males, only seven males responded for semen collection. The raw semen collected from individual emu birds was evaluated for macroscopical seminal attributes namely volume, colour, consistency and pH. The overall mean values for volume and pH of individual male were 0.61? 0.02 ml and 7.40 ? 0.03 respectively. The individual males showed varied response and significant difference in seminal attributes. Creamy white thick consistency semen had significant (P?0.01 seminal attributes than yellow and watery semen. The temperament of male emu, sexual behavior and acceptance of the collector and courtship behavior by the male are the key factors for successful training of breeders. This study ensures the possibility of semen collection and facilitate further processing of semen.

  17. 9 CFR 85.10 - Interstate movement of swine semen and swine embryos for insemination of or implantation into swine.

    Science.gov (United States)

    2010-01-01

    ... ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS PSEUDORABIES § 85.10 Interstate movement of swine semen... to pseudorabies, were negative to an official pseudorabies serologic test within 30 days prior to the collection of the semen or embryos or were members of a qualified pseudorabies negative herd, and had...

  18. Centrifugation on PureSperm(®) density-gradient improved quality of spermatozoa from frozen-thawed dog semen.

    Science.gov (United States)

    Dorado, J; Alcaráz, L; Duarte, N; Portero, J M; Acha, D; Demyda, S; Muñoz-Serrano, A; Hidalgo, M

    2011-07-15

    The main objective of this study was to investigate if centrifugation through PureSperm(®) density-gradient can improve the post-thaw semen quality of dog semen. Semen from 5 dogs was collected and cryopreserved following a standard protocol. After thawing, semen samples were selected by centrifugation on PureSperm(®). Assessments of sperm motility (assessed by computerized-assisted semen analysis), morphology (Diff-Quick staining) and viability (triple fluorescent stain of Propidium iodine/isothiocyanate-labeled peanut (Arachis hypogaea) agglutinin/Rhodamine 123), were performed on aliquots of fresh semen, unselected samples and selected preparations. Cryopreservation had a significant (P < 0.001) effect on all studied semen parameters. PureSperm(®) centrifugation yielded sperm suspensions with improved motility and viability (P < 0.001). The washing step significantly reduced (P < 0.001) all of the kinematics parameters evaluated as well as reduced the proportion of viable spermatozoa with intact acrosomes (P < 0.05). We concluded that PureSperm(®) centrifugation is a successful method for improving the quality of frozen-thawed dog spermatozoa. However, washing after density-gradient centrifugation dramatically reduces the post-thaw semen quality, indicating that the inclusion of such a washing step is unnecessary. PMID:21497393

  19. Cryopreservation of canine semen after cold storage in a Neopor box: effect of extender, centrifugation and storage time.

    Science.gov (United States)

    Hidalgo, M; Portero, J M; Demyda-Peyrás, S; Ortiz, I; Dorado, J

    2014-07-01

    The aim of this work was to assess the combined effect of sperm centrifugation, semen extender and storage time before freezing on post-thaw sperm quality and freezability on chilled stored canine semen in a Neopor box. Sperm parameters evaluated were total and progressive sperm motility by Computer-Assisted Sperm Analysis (CASA) and sperm viability and acrosome integrity using a triple fluorescent stain. Sperm quality and freezability indexes were also studied. First, the effect of centrifugation and two commercial extenders from Minitübe (Biladyl A and CaniPRO Freeze A) was evaluated in chilled semen after 24 and 45?hours of cold storage. No significant differences were observed between treatments in almost all the sperm parameters assessed. Secondly, chilled semen was frozen after 24 and 45?hours of cold storage in a Neopor box. The best results were obtained when semen was centrifuged, chilled with CaniPRO Freeze A and then frozen after 24?hours of cold storage, showing no differences in both post-thaw sperm quality and freezability in comparison with semen immediately frozen after collection. In conclusion, dog semen centrifuged after collection and extended with CaniPRO Freeze can be frozen after 24?hours of cold storage in a Neopor box, obtaining similar results to semen immediately frozen after collection. PMID:24799391

  20. Quality assessment of wild Atlantic sturgeon (Acipenser oxyrinchus oxyrinchus) semen under conditions of short-term storage

    Science.gov (United States)

    Short-term storage trials were conducted with Atlantic sturgeon semen collected from a total of nine wild males during the 2008 and 2009 spawning seasons on the Hudson River. Semen samples were kept refrigerated (4 plus or minus 1 degree C) and stored in different gaseous atmospheres and storage ext...

  1. Scanning electron microscopy of human sperms after preparation of semen for in-vitro fertilization.

    Science.gov (United States)

    Grab, D; Thierauf, S; Rosenbusch, B; Sterzik, K

    1993-01-01

    Ultrastructural changes of human sperms after routine preparation for in-vitro fertilization were examined by scanning electron microscopy. Studies were performed with freshly ejaculated semen of 21 normozoospermic patients. Spermatozoa were analysed at 10000-fold (sperm head with acrosome, postacrosomal border and postnuclear cap) and 2500-fold (midpiece and endpiece of sperm tail) magnification. Compared with untreated specimens, slight membrane damage was found after routine washing and centrifugation procedures in swim-up preparations. However, on the basis of a score system for quantification of morphologic data, no statistically significant differences existed between untreated semen and swim-up preparations. We conclude that, with normozoospermic semen, the rate of ultrastructural damage attributable to sperm-washing procedures is too low to be of clinical consequence. PMID:8503704

  2. The effect of breed on the survivability and motility rate of cryopreserved cock semen

    Scientific Electronic Library Online (English)

    M.B., Makhafola; K.C., Lehloenya; M.L., Mphaphathi; A., Dinnyes; T.L., Nedambale.

    Full Text Available This study evaluated the effect of breed on the survivability and motility rate of cryopreserved cock semen. Semen from three cock breeds; White Leghorn (WL), Ovambo (OV) and Potchefstroom Koekoek (PK) was collected by means of the abdominal massage technique. Following semen collection, sperm were [...] analyzed for motility and survivability with the use of contrast light BHTU microscope (20 x magnification). The semen was diluted (1 : 2 v/v) with egg yolk citrate (EYC) (extender A) and thereafter with extender B (EYC + 5% DMSO). The equilibration after each dilution was 2 h at 5 ºC. The diluted samples were evaluated for sperm concentration, motility, survivability and pH. The samples were then loaded into straws and cooled in programmable freezer from 5 ºC to -20 ºC at the rate of 1 ºC/minute. Semen straws were then exposed to liquid nitrogen vapour (-80 ºC) for five minutes, plunged directly into liquid nitrogen (-196 ºC) and stored for a week or more. Frozen straws were thawed at 5 ºC and evaluated at 0, 30, 60 and 90 min post-thaw. From the results there was no significant effect of breed on the survival and motility of fresh-diluted and frozen-thawed semen at 30 and 90 min post-thaw in all breeds. The sperm survivability of the PK breed was significantly higher than that of the WL breed. However, there was no sperm survivability difference between PK and OV breed immediately after thawing. The cryopreservation and thawing processes affected the survivability and motility of sperm of all poultry breeds negatively.

  3. Sperm Chromatin Structure, Semen Quality and Lead in Blood and Seminal Fluid among Infertility Men

    Directory of Open Access Journals (Sweden)

    M Mansour

    2010-12-01

    Full Text Available Background: Exposures to lead above the threshold value of 50–60 ?g/dL have been linked to diminished semen quality parameters. Worldwide, the lead exposure has been diminished during the last years. Therefore, it has become of a great concern to examine the effects of lead exposures on semen quality at low levels of exposure.Objective: To evaluate the effect of low level (<20 µg/dL blood lead on semen quality and sperm chromatin structure.Methods: A cross-sectional study was conducted on 29 men with primary infertility attending the outpatient clinic of infertility in Mansoura University Hospital, Egypt, from March to May 2010. Semen quality parameters and sperm flow-cytometry analysis were compared between two groups of infertile men with blood lead level (BLL above, and below 20 µg/dL, respectively.Results: The mean BLL in the studied subjects was 20.08 µg/dL. 45% of the studied men had BLL ?20 µg/dL. Non-significant reduction in sperm count, impaired sperm motility and altered sperm morphology were observed in those with BLL ?20 µg/dL compared to those with BLL <20 µg/dL. Concerning semen flow-cytometry analysis, percentage of haploid sperms was significantly lower among men with BLL ?20 µg/dL (78% compared to that among those with BLL <20 µg/dL (87%. A positive significant correlation was observed between BLL and percentage of diploid sperms. The chromatin condensation was however, negatively correlated with BLL (p<0.05.Conclusion: Semen quality of men with primary infertility does not have any correlation with BLL at the cutoff value of 20 µg/dL. However, even at this low level, a significant decrease in haploid sperm counts and chromatin condensation was observed.

  4. SEMEN PRODUCTION AND PRODUCTIVE LIFE OF SAHIWAL BULLS: RELATIONSHIP WITH GENETIC WORTH

    Directory of Open Access Journals (Sweden)

    M. S. KHAN, A. A. BHATTI, S. A. BHATTI1 AND M. ASHIQ2

    2007-01-01

    Full Text Available Objective of the present study was to document the semen producing ability, productive life and genetic ability for lactation milk yield of Sahiwal bulls used for artificial insemination (AI in Punjab and to find the impact of AI bulls on the improvement of Sahiwal cattle. Data from Semen Production Unit (SPU, Qadirabad, Sahiwal, Pakistan were used for this purpose. A repeatability animal model was used for estimation of breeding values for lactation milk yield. Productive life of a bull was calculated as a difference between culling age and the age at first ejaculation. Number of bulls brought to SPU varied from 9 to 102 for any year. Average number of doses of semen produced by any bull for a year varied from 724 to 5745. On the average, 238 bulls produced 17143 ± 1164 semen doses during their average stay of 5.4 ± 0.2 years. About 50% of the bulls stayed for less than four years at the SPU; with a maximum range of 14 years. Progeny tested bulls (n=90 produced 5000 and 10000 semen doses (Y in three and four years of stay (X, respectively (Y = 24.8 + 2.3635 X - 0.0112 X2. To produce 20,000 doses, it is predicted that bulls need to stay for six and a half years at the SPU. There was no association between breeding values for lactation milk yield estimated under a repeatability animal model (EBVs and number of semen doses produced (r = 0.17 and EBVs and number of daughters. Lack of genetic superiority of bulls used indicated that AI did not bring desired genetic improvement in Sahiwal cattle in the present situation. Modifications for judicious utilization of bulls are suggested along with improvements in data recording.

  5. Herpesvírus bovino tipo 1 no sêmen Bovine herpesvirus-1 in semen

    Directory of Open Access Journals (Sweden)

    Maurilio Andrade Rocha

    1999-06-01

    Full Text Available O herpesvírus bovino tipo 1 (HVB-1 é o agente causador da rinotraqueíte infecciosa bovina, além de estar associado a doenças do trato genital em bovinos. A transmissão do HVB-1 através da inseminação artificial (IA pode ocasionar problemas reprodutivos nas vacas inseminadas, como endometrite, infertilidade, absorção embrionária e abortos. Animais infectados tornam-se portadores vitalícios do HVB-1 e podem apresentar episódios intermitentes de reexcreção viral. O HVB-1 poder ser encontrado no sêmen de touros, independente do desenvolvimento de anticorpos neutralizantes. Uma vez que os testes sorológicos não são suficientes para se estimar a presença do HVB-1 no sêmen e que as condições de processamento e armazenamento do sêmen são ideais para a preservação do vírus, somente o exame individual das partidas pode assegurar a comercialização de sêmen livre do vírus. Testes laboratoriais para detecção do HVB-1 no sêmen bovino e medidas adicionais para controlar a transmissão do vírus através da IA são apresentados.Bovine herpesvirus 1 (BHV-1 is the causative agent of infectious bovine rhinotracheitis (IBR and is also associated with genital disease in cattle. BHV-1 transmission by artificial insemination (AI may cause reproductive problems in inseminated cows, such as endometritis, infertility, embryonic absorption and abortion. Infected animals are lifelong reservoirs of BHV-1 and may go through intermittent episodes of virus reexcretion. It is important to note that conditions of semen storage are optimal for virus survival. Additionally, BHV-1 can be found in bovine semen despite of the development of neutralizing antibody. Since serological tests are not sufficient to ascertain the presence of the virus in semen, the laboratory testing of all semen batches for BHV-1 is the only way to ensure the BHV-1-free status of the semen for commercialization. Laboratory tests used for BHV-1 detection in bovine semen and additional approaches to prevent the spread of BHV-1 through AI are presented.

  6. Herpesvírus bovino tipo 1 no sêmen / Bovine herpesvirus-1 in semen

    Scientific Electronic Library Online (English)

    Maurilio Andrade, Rocha; Aurora Maria Guimarães, Gouveia; Rômulo Cerqueira, Leite.

    1999-06-01

    Full Text Available O herpesvírus bovino tipo 1 (HVB-1) é o agente causador da rinotraqueíte infecciosa bovina, além de estar associado a doenças do trato genital em bovinos. A transmissão do HVB-1 através da inseminação artificial (IA) pode ocasionar problemas reprodutivos nas vacas inseminadas, como endometrite, infe [...] rtilidade, absorção embrionária e abortos. Animais infectados tornam-se portadores vitalícios do HVB-1 e podem apresentar episódios intermitentes de reexcreção viral. O HVB-1 poder ser encontrado no sêmen de touros, independente do desenvolvimento de anticorpos neutralizantes. Uma vez que os testes sorológicos não são suficientes para se estimar a presença do HVB-1 no sêmen e que as condições de processamento e armazenamento do sêmen são ideais para a preservação do vírus, somente o exame individual das partidas pode assegurar a comercialização de sêmen livre do vírus. Testes laboratoriais para detecção do HVB-1 no sêmen bovino e medidas adicionais para controlar a transmissão do vírus através da IA são apresentados. Abstract in english Bovine herpesvirus 1 (BHV-1) is the causative agent of infectious bovine rhinotracheitis (IBR) and is also associated with genital disease in cattle. BHV-1 transmission by artificial insemination (AI) may cause reproductive problems in inseminated cows, such as endometritis, infertility, embryonic a [...] bsorption and abortion. Infected animals are lifelong reservoirs of BHV-1 and may go through intermittent episodes of virus reexcretion. It is important to note that conditions of semen storage are optimal for virus survival. Additionally, BHV-1 can be found in bovine semen despite of the development of neutralizing antibody. Since serological tests are not sufficient to ascertain the presence of the virus in semen, the laboratory testing of all semen batches for BHV-1 is the only way to ensure the BHV-1-free status of the semen for commercialization. Laboratory tests used for BHV-1 detection in bovine semen and additional approaches to prevent the spread of BHV-1 through AI are presented.

  7. Decline of semen quality and increase of leukocytes with cigarette smoking in infertile men

    Directory of Open Access Journals (Sweden)

    Zhi Hong Zhang

    2013-01-01

    Full Text Available Background: Previous researches about the effect of smoking on semen quality are contradictory, and the mechanism behind the harmful effect of smoking on semen quality still remains unclear until today. Objective: The objectives of this study are evaluation of the relationship between smoking and fertility, investigation of the effects of cigarette smoking on sperm parameters and detection of presence of leukocytes within the semen of idiopathic infertile men from Northeastern China. Materials and Methods: A retrospective study of 1512 infertile patients who visited affiliated hospitals of Jilin University from 2007-2010 were enrolled in this study. Patients were assigned into one non-smoking and one smoking group which was divided into mild, moderate and heavy subgroups. Sperm parameters (including leukocytes and sperm morphology analysis were performed using standard techniques. Results: Compared with non-smokers, smokers had a significant decrease in semen volumes (p=0.006, rapid progressive motility (p=0.002 and sperm viability (p=0.019; moreover, smokers had a significant increase in the levels of immotile sperms (p=0.005 and semen leukocytes (p=0.002; pH and sperm concentration were not statistically significant (p=0.789 and p=0.297 respectively. Sperm motion parameters were all lower in the smokers except for beat-cross frequency (Hz (BCF. Further, the percentage of normal morphology sperm was decreased significantly in smokers (p=0.003, the sperm morphology was worse with increasing degree of smoking. Conclusion: These findings suggest that smoking leads to a significant decline in semen quality and higher levels of leukocytes, thus smoking may affects the fertilization efficiency.

  8. Optimizing human semen cryopreservation by reducing test vial volume and repetitive test vial sampling

    DEFF Research Database (Denmark)

    S. Fuglesang Jensen, Christian; Ohl, Dana A

    2015-01-01

    OBJECTIVE: To investigate optimal test vial (TV) volume, utility and reliability of TVs, intermediate temperature exposure (-88°C to -93°C) before cryostorage, cryostorage in nitrogen vapor (VN2) and liquid nitrogen (LN2), and long-term stability of VN2 cryostorage of human semen. DESIGN: Prospective clinical laboratory study. SETTING: University assisted reproductive technology (ART) laboratory. PATIENT(S): A total of 594 patients undergoing semen analysis and cryopreservation. INTERVENTION(S): Semen analysis, cryopreservation with different intermediate steps and in different volumes (50-1,000 ?L), and long-term storage in LN2 or VN2. MAIN OUTCOME MEASURE(S): Optimal TV volume, prediction of cryosurvival (CS) in ART procedure vials (ARTVs) with pre-freeze semen parameters and TV CS, post-thaw motility after two- or three-step semen cryopreservation and cryostorage in VN2 and LN2. RESULT(S): Test vial volume of 50 ?L yielded lower CS than other volumes tested. Cryosurvival of 100 ?L was similar to thatof larger volumes tested. An intermediate temperature exposure (-88°C to -93°C for 20 minutes) during cryopreservation did not affect post-thaw motility. Cryosurvival of TVs and ARTVs from the same ejaculate were similar. Cryosurvival of the first TV in a series of cryopreserved ejaculates was similar to and correlated with that of TVs from different ejaculates within the same patient. Cryosurvival of the first TV was correlated with subsequent ARTVs. Long-term cryostorage in VN2 did not affect CS. CONCLUSION(S): This study provides experimental evidence for use of a single 100 ?L TV per patient to predict CS when freezing multiple ejaculates over a short period of time (<10 days). Additionally, semen cryostorage in VN2 provides a stable and safe environment over time.

  9. The effect of Curcuma longa extracted (curcumin) on the quality of cryopreserved boar semen.

    Science.gov (United States)

    Chanapiwat, Panida; Kaeoket, Kampon

    2015-09-01

    The aim of this study was to determine the optimal concentration of curcumin needed for cryopreservation of boar semen. Semen samples (n?=?9) were collected from nine Duroc boars which having proven fertility were used for routine artificial insemination. Semen samples were collected and divided into six groups (groups A-F) according to various concentrations of curcumin in freezing extender (i.e. 0, 0.125, 0.25, 0.50, 0.75 and 1.0?mmol/L, respectively). The semen was frozen by traditional liquid nitrogen vapor method and stored at -196°C in the liquid nitrogen tank. After storage, frozen semen samples were thawed at 50°C for 12?s and evaluated for progressive motility, viability and acrosome integrity. The present results indicated that the addition of curcumin at 0.25 (group C) or 0.50?mmol/L curcumin (group D) yielded the higher percentage of progressive motility (33.3 and 36.1%, respectively) (P?semen. PMID:26032188

  10. Effect of Saffron on Semen Parameters of Infertile Men

    Directory of Open Access Journals (Sweden)

    Soudabeh Givrad

    2008-12-01

    Full Text Available

    Introduction: We conducted this study to determine the effects of saffron (Crocus sativus on the results of semen analysis in men with idiopathic infertility.

    Materials and Methods: In this clinical trial, 52 nonsmoker infertile men whose problem could not be solved surgically were enrolled. They were treated by saffron for 3 months. Saffron, 50 mg, was solved in drinking milk and administered 3 times a week during the study course. Semen analysis was done before and after the treatment and the results were compared.

    Results: The mean percentage of sperm with normal morphology was 26.50 ± 6.44% before the treatment which increased to 33.90 ± 10.45%, thereafter (P < .001. The mean percentage of sperm with Class A motility was 5.32 ± 4.57% before and 11.77 ± 6.07% after the treatment (P < .001. Class B and C motilities were initially 10.09 ± 4.20% and 19.79 ± 9.11% which increased to 17.92 ± 6.50% (P < .001 and 25.35 ± 10.22% (P < .001, respectively. No significant increase was detected in sperm count; the mean sperm count was 43.45 ± 31.29 × 106/mL at baseline and 44.92 ± 28.36× 106/mL after the treatment period (P = .30.

    Conclusion: Saffron, as an antioxidant, is positively effective on sperm morphology and motility in infertile men, while it does not increase sperm count. We believe further studies on larger sample sizes are needed to elucidate the potential role and mechanism of action of saffron and its ingredient in the treatment of male infertility.

  11. Evaluation of buffalo semen by Trypan blue/Giemsa staining and related fertility in vitro

    OpenAIRE

    B. Gasparrini; Mariotti, E.; L. Attanasio; De Rosa, A.; R. Di Palo; Boccia, L.

    2010-01-01

    The aim of this work was to verify the feasibility of an easy, quick double staining technique for evaluation of frozen-thawed semen to predict the fertilizing capability in vitro of buffalo bulls. In Experiment 1, frozen-thawed semen from 6 bulls was stained with double Trypan blue/ Giemsa and the incidence of acrosome-intact live (AIL), acrosome-intact dead (AID), acrosome-lost live (ALL) and acrosome-lost dead (ALD) sperm was recorded. In Experiment 2, sperm from the same bulls were used t...

  12. Compact and Light-Weight Automated Semen Analysis Platform Using Lensfree on-Chip Microscopy

    OpenAIRE

    Su, Ting-wei; Erlinger, Anthony; Tseng, Derek; Ozcan, Aydogan

    2010-01-01

    We demonstrate a compact and lightweight platform to conduct automated semen analysis using a lensfree on-chip microscope. This holographic on-chip imaging platform weighs ~46 g, measures ~4.2 × 4.2 × 5.8 cm, and does not require any lenses, lasers or other bulky optical components to achieve phase and amplitude imaging of sperms over ~24 mm2 field-of-view with an effective numerical aperture of ~0.2. Using this wide-field lensfree on-chip microscope, semen samples are imaged for ~10 s, captu...

  13. Semen characteristics of goats with subacute, acute and chronic besnoitiosis : research communication

    Directory of Open Access Journals (Sweden)

    M.J. Njenga

    1999-07-01

    Full Text Available A study on the semen obtained from breeding goats suffering from mild to severe chronic besnoitiosis revealed marked changes in semen volume, colour, density, concentration, mass and individual motility and percentage live. There were also many neutrophils and spermatozoa with primary and secondary defects, including missing tails and deformed heads and tails. The observed changes were considered to be severe enough to account for the infertility observed in the flock. Sections of testes obtained for histopathology were characterised by massive blockage of the pampiniform plexus, degeneration of the germinal epithelium, tubular necrosis with an inflammatory infiltrate and, in some cases, accumulation of haemosiderin-like material in the tunica vaginalis.

  14. The relationship between sperm quality in cool-shipped semen and embryo recovery rate in horses.

    Science.gov (United States)

    Love, C C; Noble, J K; Standridge, S A; Bearden, C T; Blanchard, T L; Varner, D D; Cavinder, C A

    2015-12-01

    The relationship between the quality of cool-shipped stallion semen and fertility has not been adequately described. This study evaluated sperm quality of cool-shipped semen from 459 ejaculates (N = 130 stallions) that were used for insemination of 196 embryo donor mares (n = 496 estrous cycles). Embryo recovery rate (ERR; %) increased, as all sperm measures (e.g., motility, viability, DNA quality, morphology, concentration, and total number) increased. Threshold values are reported for each sperm quality measure (e.g., total sperm motility ? 65%) that separate two ERR groups (e.g., average: ?50% ERR; high: ?65% ERR). PMID:26363735

  15. The effect of cigarette smoking on semen quality of infertile men

    International Nuclear Information System (INIS)

    To evaluate the effects of cigarette smoking on semen quality of infertile men. Two hundred fourteen infertile men who had been smoking cigarette and one hundred thirty infertile non smokers men participated in this study. Seminal volume, sperm concentration, motility, viability, and morphology were examined. The quality of spermatozoa obtained from smokers were much lower than non-smokers (P<0.01). The sperm concentration, viability and forward progression were negatively correlated with cigarette smoking (P<0.01). Smoking does affect the semen quality of infertile men. (author)

  16. Caffeine intake and semen quality in a population of 2,554 young Danish men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Swan, Shanna H; Skakkebaek, Niels E; Rasmussen, Sanne; Jørgensen, Niels

    2010-01-01

    The authors examined the association between semen quality and caffeine intake among 2,554 young Danish men recruited when they were examined to determine their fitness for military service in 2001-2005. The men delivered a semen sample and answered a questionnaire including information about caffeine intake from various sources, from which total caffeine intake was calculated. Moderate caffeine and cola intakes (101-800 mg/day and

  17. Vitamin E and reduced glutathione in Prochilodus lineatus (curimba) semen cryopreservation (Characiformes: Prochilodontidae)

    Scientific Electronic Library Online (English)

    Daniella A. J., Paula; Estefânia S., Andrade; Luis D. S., Murgas; Viviane O., Felizardo; Elissandra U., Winkaler; Walmes, Zeviani; Rilke T. F., Freitas.

    2012-09-01

    Full Text Available Este estudo avaliou a adição de antioxidantes vitamina E e glutationa reduzida no sêmen criopreservado de curimba (Prochilodus lineatus) e comparou solução de bicarbonato de sódio e água destilada como ativadores. O experimento foi conduzido na estação ambiental da CEMIG, em Itutinga-MG, entre Dezem [...] bro/2009 e Janeiro/2010. Sêmen de sete animais, com motilidade espermática acima de 80%, foi diluído em soluções crioprotetoras compostas por metanol 10% e lactose 15% em diferentes concentrações de antioxidantes: 50 (VE50), 100 (VE100) e 250 (VE250) µM de vitamina E, 0,5 (RG5.5), 1,0 (RG1.0) e 1,5 (RG1.5) mM glutationa reduzida e uma solução controle sem antioxidante. O sêmen foi diluído na proporção de 1:4 (100 µL de sêmen: 400 µL de solução crioprotetora). A toxicidade das soluções foi avaliada pela motilidade espermática após de 10 minutos em solução. O restante do sêmen diluído foi armazenado em palhetas de 0,5 mL mantidos em vapor de nitrogênio por 24 horas e estocado em cilindro de nitrogênio líquido por quatro dias. As amostras foram descongeladas em banho-maria a 60°C por 8 segundos e avaliada a taxa (%) e duração (s) pela ativação do sêmen com água destilada e bicarbonato de sódio a 1%. No teste de toxicidade, observamos que os antioxidantes da vitamina E e glutationa, nas diferentes concentrações, não foram tóxicos para o sêmen do curimba (P>0,05). A duração da motilidade foi maior (P0,05). Assim, os antioxidantes vitamina E e glutationa reduzida não melhoram a qualidade do sêmen criopreservado de curimba, mas não causam efeitos tóxicos para o sêmen in natura e criopreservados por não diminuir sua qualidade durante a criopreservação. Abstract in english This study investigated the addition of antioxidants vitamin E and reduced glutathione on curimba (Prochilodus lineatus) semen cryopreservation and compared sodium bicarbonate solution and distilled water as activators. The experiment was conducted at the environmental station of CEMIG, in Itutinga- [...] MG, Brazil, between December/2009 and January/2010. Semen samples (n = 7) with semen motility above 80% were diluted in cryoprotectant solutions composed of 10% methanol, 15% lactose and containing different concentrations of antioxidants: 50 (VE50), 100 (VE100) and 250 (VE250) µM of vitamin E, and 0.5 (RG0.5), 1.0 (RG1.0) and 1.5 (RG1.5) mM of reduced glutathione. A solution without antioxidants was used as a control. The semen was diluted at a ratio of 1:4 (100 ìL semen:400 ?L cryoprotectant solution). The toxicity of the solutions was evaluated by investigating semen motility after 10 min in the solution. The rest of the diluted semen was placed into 0.5 mL straws maintained in nitrogen vapour for 24 hours and packed into a nitrogen liquid cylinder for four days. The samples were thawed in a water bath at 60°C for 8 s and the rate (%) and duration (s) of semen activation with distilled water or sodium bicarbonate was evaluated. In the toxicity test, we found that vitamin E and reduced glutathione were not toxic to curimba semen at any of the tested concentrations (P>0.05). The duration of motility was longer (P0.05). Thus, the antioxidants vitamin E and reduced glutathione did not improve the quality of cryopreserved curimba semen, but they did not cause toxic effects to the semen in natura and they did not decrease its quality during cryopreservation.

  18. Infecciones de Transmisión Sexual en Semen: El Hombre como Vector de Transmisión / Sexual Transmission Infections in Semen: Men as Vector Transmission

    Scientific Electronic Library Online (English)

    Tamara, Viscarra A; Priscilla, Brebi M; Alejandra, Andana V; Raúl, Sánchez G.

    2013-03-01

    Full Text Available En los últimos años el estudio de las infecciones de transmisión sexual ha cobrado gran importancia debido principalmente al incremento de estas en parejas heterosexuales y hombres que tienen sexo con hombres. En mujeres existe mucha información de epidemiología y patogénesis de estas infecciones, s [...] in embargo, en hombres la información es muy escasa debido a que la mayoría no presenta sintomatología. En los últimos años se ha evidenciado un creciente interés en el estudio del semen como vía de transmisión, debido principalmente a la afinidad de algunos patógenos con los espermatozoides. Dentro de los principales microorganismos infectantes en semen se encuentran Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Virus de la Inmunodeficiencia Humana tipos 1 y 2, Virus Herpes Simplex 1 y 2, Virus Papiloma Humano, Virus de la Hepatitis B y C, Citomegalovirus, Virus Epstein-Barr y Trichomonas vaginalis. Abstract in english Sexually transmitted infections study has become an important issue in these days, mainly due to the increment of heterosexual and men have sex with men partners of people. In women, there is a lot information about epidemiology and pathogenesis of these infections. However, the information is very [...] limited in men, because most infected men are asymptomatic. In recent years, there has been an increasing interest in study of semen as a transmission way, due to the affinity of some pathogens to sperm. The most prevalent microorganisms infecting semen are: Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Human Immunodeficiency Virus Types 1 and 2 Herpes Simplex Virus 1 and 2, Human Papillomavirus, Hepatitis B and C virus, Cytomegalovirus, Epstein-Barr and Trichomonas vaginalis.

  19. Infecciones de Transmisión Sexual en Semen: El Hombre como Vector de Transmisión Sexual Transmission Infections in Semen: Men as Vector Transmission

    OpenAIRE

    Tamara Viscarra A; Priscilla Brebi M; Alejandra Andana V; Raúl Sánchez G

    2013-01-01

    En los últimos años el estudio de las infecciones de transmisión sexual ha cobrado gran importancia debido principalmente al incremento de estas en parejas heterosexuales y hombres que tienen sexo con hombres. En mujeres existe mucha información de epidemiología y patogénesis de estas infecciones, sin embargo, en hombres la información es muy escasa debido a que la mayoría no presenta sintomatología. En los últimos años se ha evidenciado un creciente interés en el estudio del semen como vía d...

  20. Obtención de cachorros mediante inseminación artificial con semen canino refrigerado.: Primera descripción en Chile / Puppies obtained using artificial insemination with chilled extended semen.: First report in Chile

    Scientific Electronic Library Online (English)

    A., Sánchez; J., Rubilar.

    Full Text Available Empleando una pareja de perros Siberian Husky, se describe, por primera vez en Chile, una inseminación artificial empleando semen canino refrigerado. El semen fue obtenido por manipulación digital y diluido con leche semidescremada UHT con antibióticos en relación 1:4 y refrigerado a 5ºC. Se practic [...] aron 3 inseminaciones a partir del tercer día del estro, el cual fue determinado mediante exámenes de citología vaginal, considerándose inicio del estro cuando las células superficiales constituían sobre el 80% del total de células vaginales en los frotis. Se inseminó con dosis refrigeradas por 24 y 48 horas y con una concentración promedio de 600 millones de espermatozoides totales. El diagnóstico de gestación, mediante ecógrafo de tiempo real, se realizó 28 días después de la última inseminación y la perra parió 4 cachorros vivos 61 días Abstract in english Using a couple of Husky Siberian, it is described for the first time in Chile a kind of artificial insemination using cooled canine semen. The semen was obtained by digital manipulation and was diluted with UHT semi-skimmed milk and antibiotics in relation 1:4 and cooled at 5ºC. There inseminations [...] were carried out on the third day of the oestrus which was determined through vaginal cytology, considering the beginning of the oestrus when the superficial cells constituted over the 80% of the total vaginal cells in the vaginal smear. Inseminated was carried out using cooled doses for 24 and 48 hours and with an average concentration of 600 x 10(6) spermatozoa. The pregnancy diagnosis, through a real time ultrasonography, was done 28 days after the last insemination and the bitch gave birth to 4 normal puppies 61 days after last insemination

  1. Cloned embryos from semen. Part 2: intergeneric nuclear transfer of semen-derived eland (Taurotragus oryx) epithelial cells into bovine oocytes.

    Science.gov (United States)

    Nel-Themaat, Liesl; Gómez, Martha C; Pope, C Earle; Lopez, Monica; Wirtu, Gemechu; Jenkins, Jill A; Cole, Alex; Dresser, Betsy L; Bondioli, Kenneth R; Godke, Robert A

    2008-03-01

    The production of cloned offspring by nuclear transfer (NT) of semen-derived somatic cells holds considerable potential for the incorporation of novel genes into endangered species populations. Because oocytes from endangered species are scarce, domestic species oocytes are often used as cytoplasts for interspecies NT. In the present study, epithelial cells isolated from eland semen were used for intergeneric transfer (IgNT) into enucleated bovine oocytes and compared with bovine NT embryos. Cleavage rates of bovine NT and eland IgNT embryos were similar (80 vs. 83%, respectively; p > 0.05); however, development to the morula and blastocyst stage was higher for bovine NT embryos (38 and 21%, respectively; p or = 8 cells at 84 hpa, while 32% of the bovine NT embryos had > or = 8 cells at the same interval. However, 100 and 66% of bovine NT and eland IgNT embryos, respectively, that had > or = 8 cells synthesized DNA. From these results we concluded that (1) semen-derived epithelial cell nuclei can interact and be transcriptionally controlled by bovine cytoplast, (2) the first cell-cycle occurred in IgNT embryos, (3) a high frequency of developmental arrest occurs before the eight-cell stage in IgNT embryos, and (4) IgNT embryos that progress through the early cleavage stage arrest can (a) synthesize DNA, (b) progress through subsequent cell cycles, and (c) may have the potential to develop further. PMID:18241126

  2. A comparison of conventional and computer-assisted semen analysis (CRISMAS software) using samples from 166 young Danish men

    DEFF Research Database (Denmark)

    Vested, Anne; Ramlau-Hansen, Cecilia H

    2011-01-01

    The aim of the present study was to compare assessments of sperm concentration and sperm motility analysed by conventional semen analysis with those obtained by computer-assisted semen analysis (CASA) (Copenhagen Rigshospitalet Image House Sperm Motility Analysis System (CRISMAS) 4.6 software) using semen samples from 166 young Danish men. The CRISMAS software identifies sperm concentration and classifies spermatozoa into three motility categories. To enable comparison of the two methods, the four motility stages obtained by conventional semen analysis were, based on their velocity classifications, divided into three stages, comparable to the three CRISMAS motility categories: rapidly progressive (A), slowly progressive (B) and non-progressive (C+D). Differences between the two methods were large for all investigated parameters (P <0.001). CRISMAS overestimated sperm concentration and the proportion of rapidly progressive spermatozoa and, consequently, underestimated the percentages of slowly progressive and non-progressive spermatozoa, compared to the conventional method. To investigate whether results drifted according to time of semen analysis, results were pooled into quarters according to date of semen analysis. CRISMAS motility results appeared more stable over time compared to the conventional analysis; however, neither method showed any trends. Apparently, CRISMAS CASA results and results from the conventional method were not comparable with respect to sperm concentration and motility analysis. This needs to be accounted for in clinics using this software and in studies of determinants of these semen characteristics.

  3. Changes in motility, morphology, plasma membrane and acrosome integrity during stages of cryopreservation of buck sperm

    Scientific Electronic Library Online (English)

    Mushtaq, Ahmad; Rashad, Nasrullah; Hasan, Riaz; Abdul, Sattar; Nasim, Ahmad.

    2014-01-01

    Full Text Available Changes in sperm structure and function occur during the processing of semen. The present study was designed to investigate the effect on buck sperm during different stages of semen preparation including dilution, cooling, equilibration and freeze-thawing. Semen ejaculates from three mature bucks (r [...] eplicates = 5) were diluted with tris-citric acid egg yolk glycerol extender at 37 °C, cooled to 4 °C over 90 min, equilibrated at 4 °C for 2 h, transferred to 0.5 mL straws, placed in nitrogen vapour, frozen and thawed and then analysed. Sperm samples were assessed for percentage motility, acrosomal and plasma membrane integrity, live sperm, and morphology after dilution, cooling, equilibration and thawing. Mean percentage motility after dilution (86.0 ± 1.4%) was reduced significantly (p

  4. Parental infertility and semen quality in male offspring : a follow-up study

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia HØst; Thulstrup, Ane Marie

    2007-01-01

    Jensen et al. (Am J Epidemiol 2007;165:583-90) reported for the first time that men whose mothers had received fertility treatment had poor semen quality. This result could be confounded by the mothers' body mass index. Obesity is a strong predictor of fecundity and could have a programming effect on semen quality through hormonal factors or links to fetal growth. The authors of the current study tried to replicate the finding of Jensen et al. after controlling for maternal body mass index and other covariates using data from a recently conducted, population-based, Danish follow-up study on the association between maternal smoking during pregnancy in 1984-1987 and sons' semen quality, in which the participants were sampled according to levels of maternal smoking during pregnancy. After adjustment, sons of mothers who reported that they had been examined or treated for childlessness (n = 30) had a lower sperm concentration and total sperm count and fewer motile and morphologically normal spermatozoa in comparison with sons of mothers who had not been examined or treated for childlessness (n = 295). None of the differences (except for semen concentration) between the groups reached statistical significance, but the study has limited power. The findings were in the same direction as those reported by Jensen et al. and do not indicate that their results are confounded by maternal body mass index.

  5. Maternal folic acid supplement intake and semen quality in Danish sons: a follow-up study

    DEFF Research Database (Denmark)

    Jacobsen, Kristoffer; Ramlau-Hansen, Cecilia HØst

    2011-01-01

    OBJECTIVE: To examine whether maternal folic acid supplement intake during pregnancy is related to better semen quality in male offspring. DESIGN: A follow-up study. SETTING: Two major Danish municipalities, Aalborg and Odense. PATIENT(S): The study population included 347 singleton sons of mothers enrolled into the Healthy Habits for Two cohort when pregnant in 1984-87. INTERVENTION(S): Information on maternal folic acid supplement intake during pregnancy was provided by self-administered questionnaire in the 36th week of gestation. MAIN OUTCOME MEASURE(S): Semen characteristics and serum concentrations of sex hormones. RESULT(S): The distribution of semen characteristics among sons whose mothers took folic acid supplement during pregnancy (n = 88, 25%) did not differ from the distributions among those without (n = 75, 22%) or with unknown folic acid supplement intake (n = 84, 53%). On the contrary, serum levels of FSH and LH were significantly higher in the folic acid supplement group. CONCLUSION(S): The hypothesis that folic acid supplement intake during pregnancy will improve semen quality in male offspring was not corroborated by a follow-up study in young Danish men.

  6. Apoptotic markers in semen of infertile men: association with cigarette smoking

    Scientific Electronic Library Online (English)

    Nagla T., El-Melegy; Mohamed-Esam M., Ali.

    2011-08-01

    Full Text Available OBJECTIVES: (i) To examine the role of apoptosis in the pathogenesis of DNA damage in semen from infertile men. (ii) To assess the effects of smoking on apoptotic markers and seminal parameters among infertile men. (iii) To assess the correlation of apoptosis with conventional semen parameters. MATE [...] RIALS AND METHODS: The study was carried out on 70 men with idiopathic infertility, divided into two groups: thirty infertile non smokers and forty infertile smokers. In addition to 60 fertile men (30 non smokers and 30 smokers) as control group. Each subject provided semen for analysis of parameters, determination of % of DNA fragmentation, s-Fas, caspase-3 activity levels and cotinine levels. RESULTS: The results revealed that infertile men, particularly smokers have significantly lower semen variables and significantly higher levels of apoptotic variables (% of DNA fragmentation, s-Fas and caspase-3 activity) in addition to cotinine. CONCLUSIONS: The present findings provide additional evidence supporting the importance of the evaluation of apoptotic markers to test male infertility particularly among smokers.

  7. COTININE CONCENTRATIONS IN SEMEN, URINE AND BLOOD OF SMOKERS AND NONSMOKERS

    Science.gov (United States)

    The extent to which ambient exposures to environmental chemicals results in exposures to human genetic material is poorly understood. he purpose of the current study is to document the presence of cotinine, a metabolite of nicotine but not a known mutagen, in the semen of men exp...

  8. A comparative evaluation of semen parameters in pre- and post-Hurricane Katrina human population

    Directory of Open Access Journals (Sweden)

    Caner Baran

    2015-01-01

    Full Text Available A natural disaster leading to accumulation of environmental contaminants may have substantial effects on the male reproductive system. Our aim was to compare and assess semen parameters in a normospermic population residing in the Southern Louisiana, USA area pre- and post-Hurricane Katrina. We retrospectively evaluated semen analyses data (n = 3452 of 1855 patients who attended the Tulane University Andrology/Fertility Clinic between 1999 and 2013. The study inclusion criteria were men whose semen analyses showed ? 1.5 ml volume; ?15 million ml -1 sperm concentration; ?39 million total sperm count; ?40% motility; >30% morphology, with an abstinence interval of 2-7 days. After the inclusion criteria applied to the population, 367 normospermic patients were included in the study. Descriptive statistics and group-based analyses were performed to interpret the differences between the pre-Katrina (Group 1, 1999-2005 and the post-Katrina (Group 2, 2006-2013 populations. There were significant differences in motility, morphology, number of white blood cell, immature germ cell count, pH and presence of sperm agglutination, but surprisingly there were no significant differences in sperm count between the two populations. This long-term comparative analysis further documents that a major natural disaster with its accompanied environmental issues can influence certain semen parameters (e.g., motility and morphology and, by extension, fertility potential of the population of such areas.

  9. Mycoplasma agalactiae in semen and milk of goat from Pernambuco state, Brazil

    Directory of Open Access Journals (Sweden)

    Bruno H.L.S. Alves

    2013-11-01

    Full Text Available In goat and sheep flocks, mycoplasmosis is a disease that may cause severe economical losses associated with polyarthritis, mastitis, agalactia, conjunctivitis, pneumonia and reproductive failure. The latter may involve repeat breeding, granular vulvovaginitis, infertility and abortions. The aim of the present study was to assess the occurrence of Mycoplasma agalactiae (Ma in semen and milk samples from naturally infected goat in the semiarid region from Pernambuco State, Northeast from Brazil. Thirty-nine semen samples and 81 milk samples were submitted to DNA extraction using a commercially available kit and following the manufacturer's instructions. The polymerase chain reaction (PCR was then performed in accordance with protocols described in the literature. The results of the present study revealed the presence of Ma in the DNA of 17.9% (7/39 of the semen samples and 3.7% (3/81 of the milk samples. The results obtained in the present study confirm the elimination of the DNA of Ma in the semen and milk samples. The presence of this agent in goat flocks is considered very risky in terms of reproductive disorders and contagious agalactia outbreaks in the Northeast region of Brazil.

  10. ANEUPLOIDY AND CHROMOSOME BREAKAGE IN SWIM-UP VERSUS UNPROCESSED SEMEN FROM TWENTY HEALTHY MEN

    Science.gov (United States)

    Toxicologic and epidemiologic studies have investigated a number of factors believed to induce cytogenetic damage in human sperm cells in order to estimate heritable risk to future generations. Most of these studies, however, have not enriched research semen specimens for fertil...

  11. Efficacious long-term cooling and freezing of Sapajus apella semen in ACP-118(®).

    Science.gov (United States)

    Leão, D L; Miranda, S A; Brito, A B; Lima, J S; Santos, R R; Domingues, S F S

    2015-08-01

    The objectives of the present study were to test the effect of coconut water solution (CWS), TES-TRIS and ACP-118(®) on the seminal cooling and cryopreservation of semen from capuchin monkeys (Sapajus apella). Semen was collected from six males by electro-ejaculation, diluted in TES-TRIS, CWS or ACP-118(®), and maintained at 4°C for 28h. Semen was subsequently evaluated (Experiment I) or cryopreserved in the presence of different glycerol concentrations (3%, 5% or 7%) (Experiment II). ACP-118(®) was the preferred extender to preserve sperm motility and viability after 28h incubation at 4°C. Cooled sperm were successfully frozen-thawed in a medium containing 3% glycerol. After thawing, sperm retained the capacity to fertilize oocytes and zygotes were obtained. In conclusion, ACP-118(®) can be effectively and efficiently used as extender for the cooling of S. apella semen. Furthermore, cryopreservation using ACP-118(®) by adding 3% glycerol is suitable to maintain sperm morphology and the capacity of these cells to fertilize in vitro. PMID:26071650

  12. A comparative evaluation of semen parameters in pre- and post-Hurricane Katrina human population.

    Science.gov (United States)

    Baran, Caner; Hellstrom, Wayne J; Sikka, Suresh C

    2015-01-01

    A natural disaster leading to accumulation of environmental contaminants may have substantial effects on the male reproductive system. Our aim was to compare and assess semen parameters in a normospermic population residing in the Southern Louisiana, USA area pre- and post-Hurricane Katrina. We retrospectively evaluated semen analyses data (n = 3452) of 1855 patients who attended the Tulane University Andrology/Fertility Clinic between 1999 and 2013. The study inclusion criteria were men whose semen analyses showed ? 1.5 ml volume; ?15 million ml -1 sperm concentration; ?39 million total sperm count; ?40% motility; >30% morphology, with an abstinence interval of 2-7 days. After the inclusion criteria applied to the population, 367 normospermic patients were included in the study. Descriptive statistics and group-based analyses were performed to interpret the differences between the pre-Katrina (Group 1, 1999-2005) and the post-Katrina (Group 2, 2006-2013) populations. There were significant differences in motility, morphology, number of white blood cell, immature germ cell count, pH and presence of sperm agglutination, but surprisingly there were no significant differences in sperm count between the two populations. This long-term comparative analysis further documents that a major natural disaster with its accompanied environmental issues can influence certain semen parameters (e.g., motility and morphology) and, by extension, fertility potential of the population of such areas. PMID:25677132

  13. Investigation of Chlamydiaceae in semen and cauda epididymidis and seroprevalence of Chlamydophila abortus in breeding bulls

    Directory of Open Access Journals (Sweden)

    Persson Ylva

    2010-01-01

    Full Text Available Abstract Background Reproductive disorders associated with chlamydial infection have been reported worldwide in cattle and there are indications of potential venereal transmission. Methods Semen samples from 21 dairy bulls and cauda epididymidis tissue samples from 43 beef bulls were analysed for chlamydial agent by real-time polymerase chain reaction (PCR including an internal amplification control (mimic. Additionally, presence of antibodies against Chlamydophila (Cp. abortus among the bulls was investigated with the commercial Pourquier® ELISA Cp. abortus serum verification kit. Results No chlamydial agent was detected by PCR in either the semen samples or in the tissue samples. Additionally, no antibodies against Cp. abortus were detected. Conclusions The results suggest that Cp. abortus is very rare, or absent in Swedish bulls and thus the risk for venereal transmission of chlamydial infection through their semen is low. However, because Chlamydophila spp. infection rates seem to differ throughout the world, it is essential to clarify the relative importance of transmission of the infection through semen on cattle fertility.

  14. Cryopreservation of semen from functional sex-reversed genotypic females of the rainbow trout, Oncorhynchus mykiss

    Scientific Electronic Library Online (English)

    Alexandre, Ninhaus-Silveira; Fausto, Foresti; Yara Aiko, Tabata; Marcos Guilherme, Rigolino; Rosicleire, Veríssimo-Silveira.

    2006-01-01

    Full Text Available A criopreservação do sêmen de fêmeas masculinizadas de truta arco-íris tem como objetivo a racionalização do processo de produção de estoques 100% femininos. Para tal, foi coletado sêmen de machos normais (M) e de dois tipos de fêmeas genotípicas (R e G), masculinizadas pela administração oral de 17 [...] alfa-metiltestosterona. R foi obtido pela fertilização de ovócitos normais com sêmen de fêmeas masculinizadas enquanto G foi através de reprodução ginogenética. O sêmen foi diluído em uma solução crioprotetora (glicose 5,4 g, gema de ovo de galinha 10 ml, dimetil sulfóxido 10 ml, água destilada 80 ml) na razão de 1:3 (sêmen/diluidor), envasado em palhetas de 0,5 ml e congelado em um "container" tipo "seco" Cryopac CP-65, à temperatura de -180ºC. A descongelação foi feita em água a 70ºC por 3 segundos. As taxas de fertilização obtidas, não revelaram diferença estatística significativa (P Abstract in english Cryopreservation of semen from sex-reversed females of rainbow trout aims at rationalizing the production of stocks composed by 100% females. Semen from normal males (M) and two types of genotypic females (R and G), sex-reversed by the oral administration of 17alpha-methyltestosterone, were used. R [...] was obtained by the fertilization of normal eggs with semen of sex-reversed females while G via gynogenetic reproduction. Semen was diluted in an extender solution (glucose 5,4 g, egg yolk 10 ml, dimetil sulfoxide 10 ml, water 80 ml) at 1:3 ratio (semen/extender), stored in straws of 0.5 ml and freezed in a dry container Cryopac CP-65, at -180ºC. Thawing was performed with water at 70ºC for 3 seconds. There were no significant fertilization rate differences (P>0.05) among thawed semen groups (M = 73.1±11.5%; R = 67.2±23.6%; G = 64±5.8%), confirming that the freezing methodology used was efficient to cryopreserve semen of all three trout groups.

  15. Absence of lumpy skin disease virus in semen of vaccinated bulls following vaccination and subsequent experimental infection.

    Science.gov (United States)

    Osuagwuh, U I; Bagla, V; Venter, E H; Annandale, C H; Irons, P C

    2007-03-01

    Twelve serologically negative bulls were used, six were vaccinated with a modified live LSD vaccine and six unvaccinated. All were then experimentally infected with a virulent field strain of LSDV. No clinical abnormality was detected following vaccination, and mild clinical signs were seen in four vaccinated bulls following challenge. Virus was not found in semen of vaccinated bulls. Two of the unvaccinated bulls developed severe LSD and four showed mild symptoms, all excreted the virus in the semen following challenge. This study confirmed the ability of LSD vaccination to prevent the excretion of LSDV in semen of vaccinated bulls. PMID:17250934

  16. Alergia al plasma seminal humano: ¿mito o realidad?

    Scientific Electronic Library Online (English)

    Jenniffer, Puerta-Suárez; Walter, Cardona-Maya.

    Full Text Available Antecedentes: La hipersensibilidad al plasma seminal humano abarca una amplia variedad de manifestaciones clínicas que comprenden desde prurito local y reacciones dérmicas localizadas, hasta situaciones que ponen en riesgo la vida, como la anafilaxia. Objetivo: Caracterizar este fenómeno, para el es [...] tudio a profundidad del tema y enfatizar en un problema que no está siendo valorado debido al poco conocimiento del evento. Método: Revisión de la literatura empleando los términos "semen allergy" y "human seminal plasma allergy" y sus equivalentes en español en diferentes bases de datos. Resultados: Este desorden inmunológico es más frecuente entre los 23 y los 35 años de edad, en la mayoría de los casos los síntomas se inician dentro de la primera hora después de culminada la relación sexual o inmediatamente después de tener contacto con el semen. El método de prevención más eficaz es el condón, aunque no es una opción adecuada para las parejas que desean concebir. Conclusión: Se requiere estudiar y caracterizar mejor este fenómeno para mejorar tanto su diagnóstico como su tratamiento. Abstract in english Background: Human seminal plasma hypersensitivity includes a wide variety of clinical manifestations comprising itching and localized dermal reactions to situations that threaten life as anaphylaxis. Aims: To characterize this phenomenon, for in-depth study of the subject and emphasize a problem tha [...] t is not being assessed due to poor knowledge of the event. Method: Review of the literature using the terms "semen allergy" and "human seminal plasma allergy" and their spanish equivalents in different databases. Results: This immune disorder is more common between 23 and 35 years of age, in most cases the symptoms begin within the first hour after culminating intercourse or immediately after contact with the semen and most effective prevention method is the condom, although not an adequate solution for couples who want to conceive. Conclusion: Further studies are required to further characterize this phenomenon to improve both diagnosis as treatment.

  17. Use of cryotubes for the cryopreservation of tambaqui fish semen (Colossoma macropomum).

    Science.gov (United States)

    Maria, Alexandre Nizio; Carvalho, Allan Charles Marques; Araújo, Rafael Venâncio; Santos, Jadson Pinheiro; Carneiro, Paulo César Falanghe; Azevedo, Hymerson Costa

    2015-04-01

    Tambaqui (Colossoma macropomum) is a freshwater fish of great importance to aquaculture in several South American countries. Recent studies have developed a protocol for semen cryopreservation in 0.25 and 0.5 mL straws; however, this technique has limitations for fingerling production at a large scale due to the high fecundity of tambaqui. The main objective of this study was to evaluate the feasibility of using cryotubes (1.6 and 4.5 mL) for tambaqui semen cryopreservation. Semen samples were diluted in freezing solution (5% glucose solution, 10% methylglycol, 5% egg yolk), stored in 1.6 and 4.5 mL cryotubes, frozen in liquid nitrogen vapor at -175°C and transferred to a cryogenic container at -196°C. The cryotubes were thawed in a water bath at 60°C for 70 or 90 s and the motility (total motility - TM; progressive motility - PM; curvilinear velocity - VCL; straight line velocity - VSL and average path velocity - VAP) and the viability of sperm were evaluated. There was no significant difference in sperm motility and viability post-thawing between 1.6 and 4.5m L cryotubes, except for TM (47% and 40%, respectively). Thawing for 90 s provided better results, being used in fertilization trials. Although the fertilization rate did not differ between the cryotubes (41-45%), it was significantly lower than that for fresh semen (74%). A strong positive correlation was observed between the sperm motility and fertilization rate (r=0.69-0.89). We conclude that 1.6 and 4.5 mL cryotubes have high potential for tambaqui semen cryopreservation when thawed for a minimum time of 90 s at 60°C. PMID:25725470

  18. Increased conception rates in beef cattle inseminated with nanopurified bull semen.

    Science.gov (United States)

    Odhiambo, John F; DeJarnette, J M; Geary, Thomas W; Kennedy, Chelsey E; Suarez, Susan S; Sutovsky, Miriam; Sutovsky, Peter

    2014-10-01

    Aberrant sperm phenotypes coincide with the expression of unique sperm surface determinants that can be probed by objective, biomarker-based semen analysis and targeted as ligands for semen purification. This study evaluated a nanoparticle-based magnetic purification method that removes defective spermatozoa (?30% of sample) from bull semen and improves sperm sample viability and fertilizing ability in vitro and in vivo. Two types of nanoparticles were developed: a particle coated with antibody against ubiquitin, which is present on the surface of defective spermatozoa, and a particle coated with the lectin peanut agglutinin, which binds to glycans exposed by acrosomal damage. In a 2 yr artificial insemination field trial with 798 cows, a conception rate of 64.5% ± 3.7% was achieved with a 10 × 10(6) sperm dose of peanut agglutinin-nanopurified spermatozoa, comparable to a control nonpurified full dose of 20 × 10(6) spermatozoa per dose (63.3% ± 3.2%) and significantly higher than a 10 × 10(6) sperm dose of nonpurified control semen (53.7% ± 3.2%; P < 0.05). A total of 466 healthy calves were delivered, and no negative side effects were observed in the inseminated animals or offspring. Because the method is inexpensive and can be fully integrated in current protocols for semen cryopreservation, it is feasible for use in the artificial insemination industry to improve fertility with reduced sperm dosage inseminations. Spermatology will benefit from nanopurification methodology by gaining new tools for the identification of candidate biomarkers of sperm quality such as binder of sperm protein 5 (BSP5), described in the present study. PMID:25232015

  19. Use of combinations of in vitro quality assessments to predict fertility of bovine semen.

    Science.gov (United States)

    Sellem, E; Broekhuijse, M L W J; Chevrier, L; Camugli, S; Schmitt, E; Schibler, L; Koenen, E P C

    2015-12-01

    Predicting in vivo fertility of bull ejaculates using in vitro-assessed semen quality criteria remains challenging for the breeding industry. New technologies such as computer-assisted semen analysis (CASA) and flow cytometry may provide accurate and objective methods to improve semen quality control. The aim of this study was to evaluate the relationship between semen quality parameters and field fertility of bull ejaculates. A total of 153 ejaculates from 19 Holstein bulls have been analyzed using CASA (postthawing semen motility and morphology) and several flow cytometric tests, including sperm DNA integrity, viability (estimated by membrane integrity), acrosomal integrity, mitochondria aerobic functionality and oxidation. Samples were analyzed both immediately after thawing and after 4 hours at 37 °C. A fertility value (FV), based on nonreturn rate at 56 days after insemination and adjusted for environment factors, was calculated for each ejaculate. Simple and multiple regressions have been used to correlate FV with CASA and flow cytometric parameters. Significant simple correlations have been observed between some parameters and FV (e.g., straight line velocity [?m/s], r(2) = -0.12; polarized mitochondria sperm (%), r(2) = 0.07), but the relation between simple parameter and FV was too week to predict the fertility. Partial least square procedure identified several mathematical models combining flow cytometer and CASA variables and had better correlations with FV (adjusted r(2) ranging between 0.24 and 0.40 [P work will be required to increase the prediction reliability and promote this technology in routine artificial insemination laboratory practice. PMID:26296523

  20. Effect of split ejaculation and seminal extenders on longevity of donkey semen preserved at 5° C

    Directory of Open Access Journals (Sweden)

    Mello S.L.V.

    2000-01-01

    Full Text Available The aim of this study was to evaluate the longevity of donkey sperm comparing the rich seminal fraction and the whole semen in two extenders, Kenney and modified Baken extenders. Semen of five donkeys were collected through an open-end artificial vagina once a week for five consecutive weeks. The two first jets (rich fraction of semen were collected separately from the rest of the ejaculate. Whole semen samples were obtained mixing proportionally part of the rich with part of the poor seminal fractions. Seminal samples were immediately diluted 1:1 in each extender and maintained at room temperature during sperm concentration analysis. Samples were further diluted to rich 50×10(6 sperm per ml, cooled in a refrigerator at the initial rate of -0.6° C/min and preserved at 5° C. Total motility (TM, progressive motility (PM and sperm vigor (V were examined after final dilution and cooling, and every 24 hours up to the decrease of total motility under 10%. Sperm morphology was evaluated using a phase contrast microscope directly after dilution, on days 3, 6 and 9 post collection. It was used a 2×2 factorial design in a randomised bloc experiment, and means were compared by Student?s t test. Longevity did not vary between the rich seminal fraction and the whole semen for both extenders used. TM, PM, V and sperm morphology were better preserved in the extender with egg yolk (modified Baken extender than in the one with skimmed milk (Kenney in both seminal fractions.

  1. Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad Micoplasma hominis, Ureaplasma urealyticum and aerobic bacteria present in the semen from men attending infertility service

    Directory of Open Access Journals (Sweden)

    Bertha Victoria Rodríguez Pendás

    2013-04-01

    Full Text Available Introducción: las infecciones en el semen humano pueden alterar la calidad espermática, y vincularse con problemas de infertilidad masculina. Objetivo: determinar la frecuencia de infecciones por Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad, e identificar si existe relación entre las infecciones encontradas y las alteraciones en las variables de calidad del semen. Métodos: se realizó un estudio descriptivo transversal, para evaluar muestras de semen de 140 hombres, con edades entre 20 y 45 años, provenientes de las consultas de infertilidad del Instituto Nacional de Endocrinología. Se realizó un espermograma completo, que incluyó leucocitospermia, siguiendo los lineamientos de la OMS, para determinar las variables cualitativas y cuantitativas del semen. Las muestras de semen fueron cultivadas en agar sangre y agar chocolate a 37° C en atmósfera de CO2 para investigar bacterias aeróbicas, y se utilizó un juego de reactivos (Mycoplasma System Plus que permite realizar el cultivo, la identificación, el conteo semicuantitativo y el antibiograma de micoplasmas/ureaplasma urogenitales. Se tuvo en cuenta los aspectos éticos, y los resultados obtenidos se analizaron mediante cálculo de por cientos y la aplicación de la prueba de chi cuadrado. Resultados: de las 140 muestras de semen evaluadas, 58 (41,4 % mostraron la presencia de infecciones, de ellas 37 correspondieron a Ureaplasma urealyticum (25,7 %, 2 a Micoplasma hominis (1,4 % y 19 a bacterias aeróbicas (13,8 %. Al comparar las variables cualitativas y cuantitativas del semen con los sujetos infectados y no infectados, no se observaron diferencias estadísticamente significativas en ninguna de las variables de calidad espermática evaluadas. Conclusiones: la frecuencia total de infecciones, en la muestra estudiada, fue relativamente alta, pero no asociada a alteraciones en las variables seminales.Introduction: human semen infections can alter the sperm quality and be associated to male infertility disorders. Objectives: to determine the frequency of infections from Micoplasma hominis, Ureaplasma urealyticum and other aerobic bacteria in the semen of men who attended the infertility service, and to identify whether there is some relation between the detected infections and the altered semen quality variables or not. Methods: a cross-sectional descriptive study was performed to evaluate semen samples from 140 men aged 20 to 45 years, who attended the infertility service at the National Institute of Endocrinology. According to the WHO guidelines, a complete spermiogram including leukocytospermia was performed in order to determine the qualitative and quantitative variables in the semen. The semen samples were cultured in blood agar and in chocolate agar at 37oC under CO2 environment to find out possible aerobic bacteria. To this end, a set of reagents known as Mycoplasma System Plus was used, allowing the culture, the identification, the semi-quantitative count and the antibiogram of urogenital mycoplasms/ureaplasms. The ethical aspects were allowed for; the results were analyzed through percentage estimations and the chi square test. Results: out of the 140 evaluated semen samples, 58 (41.4 % showed some infection, 37 of them were caused by Ureaplasma urealyticum (25.7 %, 2 by Micoplasma hominis (1.4 % and 19 by the aerobic bacteria (13.8 %. When making a comparison of the qualitative and quantitative variables of the semen from infected and non-infected subjects, there were not any statistically significant differences in the evaluated variables of the sperm quality. Conclusions: the total frequency of infections in the studied sample was relatively high, but was not associated to altered seminal variables.

  2. Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad / Micoplasma hominis, Ureaplasma urealyticum and aerobic bacteria present in the semen from men attending infertility service

    Scientific Electronic Library Online (English)

    Bertha Victoria, Rodríguez Pendás; Cecilia, Ortiz Rodríguez; Felipe, Santana Pérez; Emma, Domínguez Alonso; Blanca, Nurquez Guerra.

    2013-04-01

    Full Text Available Introducción: las infecciones en el semen humano pueden alterar la calidad espermática, y vincularse con problemas de infertilidad masculina. Objetivo: determinar la frecuencia de infecciones por Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan po [...] r infertilidad, e identificar si existe relación entre las infecciones encontradas y las alteraciones en las variables de calidad del semen. Métodos: se realizó un estudio descriptivo transversal, para evaluar muestras de semen de 140 hombres, con edades entre 20 y 45 años, provenientes de las consultas de infertilidad del Instituto Nacional de Endocrinología. Se realizó un espermograma completo, que incluyó leucocitospermia, siguiendo los lineamientos de la OMS, para determinar las variables cualitativas y cuantitativas del semen. Las muestras de semen fueron cultivadas en agar sangre y agar chocolate a 37° C en atmósfera de CO2 para investigar bacterias aeróbicas, y se utilizó un juego de reactivos (Mycoplasma System Plus) que permite realizar el cultivo, la identificación, el conteo semicuantitativo y el antibiograma de micoplasmas/ureaplasma urogenitales. Se tuvo en cuenta los aspectos éticos, y los resultados obtenidos se analizaron mediante cálculo de por cientos y la aplicación de la prueba de chi cuadrado. Resultados: de las 140 muestras de semen evaluadas, 58 (41,4 %) mostraron la presencia de infecciones, de ellas 37 correspondieron a Ureaplasma urealyticum (25,7 %), 2 a Micoplasma hominis (1,4 %) y 19 a bacterias aeróbicas (13,8 %). Al comparar las variables cualitativas y cuantitativas del semen con los sujetos infectados y no infectados, no se observaron diferencias estadísticamente significativas en ninguna de las variables de calidad espermática evaluadas. Conclusiones: la frecuencia total de infecciones, en la muestra estudiada, fue relativamente alta, pero no asociada a alteraciones en las variables seminales. Abstract in english Introduction: human semen infections can alter the sperm quality and be associated to male infertility disorders. Objectives: to determine the frequency of infections from Micoplasma hominis, Ureaplasma urealyticum and other aerobic bacteria in the semen of men who attended the infertility service, [...] and to identify whether there is some relation between the detected infections and the altered semen quality variables or not. Methods: a cross-sectional descriptive study was performed to evaluate semen samples from 140 men aged 20 to 45 years, who attended the infertility service at the National Institute of Endocrinology. According to the WHO guidelines, a complete spermiogram including leukocytospermia was performed in order to determine the qualitative and quantitative variables in the semen. The semen samples were cultured in blood agar and in chocolate agar at 37oC under CO2 environment to find out possible aerobic bacteria. To this end, a set of reagents known as Mycoplasma System Plus was used, allowing the culture, the identification, the semi-quantitative count and the antibiogram of urogenital mycoplasms/ureaplasms. The ethical aspects were allowed for; the results were analyzed through percentage estimations and the chi square test. Results: out of the 140 evaluated semen samples, 58 (41.4 %) showed some infection, 37 of them were caused by Ureaplasma urealyticum (25.7 %), 2 by Micoplasma hominis (1.4 %) and 19 by the aerobic bacteria (13.8 %). When making a comparison of the qualitative and quantitative variables of the semen from infected and non-infected subjects, there were not any statistically significant differences in the evaluated variables of the sperm quality. Conclusions: the total frequency of infections in the studied sample was relatively high, but was not associated to altered seminal variables.

  3. Qualidade espermática de sêmen de cães naturalmente infectados por Leishmania sp: Semen quality of dogs naturally infected by Leishmania sp

    Directory of Open Access Journals (Sweden)

    É. Labat

    2010-06-01

    Full Text Available Avaliaram-se alterações espermáticas associadas à infecção por leishmaniose no sêmen de cães naturalmente infectados, utilizando-se, durante oito semanas consecutivas, ejaculados de seis cães soronegativos e seis cães soropositivos. As amostras foram colhidas uma vez por semana e avaliadas quanto ao volume, concentração, motilidade, vigor, morfologia espermática, integridade da cromatina, avaliação simultânea da integridade da membrana plasmática, acrossoma e potencial mitocondrial. Concomitantemente foram dosadas a proteína total do plasma seminal e sanguíneo. A leishmaniose visceral causou aumento dos defeitos maiores e menores nos espermatozoides dos animais acometidos pelo estágio moderado a severo da doença. Em estágios mais avançados da enfermidade, a integridade das membranas acrossomal e plasmática foi afetada negativamente. Não foi possível estabelecer um critério quanto à avaliação do potencial mitocondrial. A incidência de alterações morfológicas nos animais acometidos não promoveu aumento de injurias à cromatina. Todos os animais com leishmaniose apresentaram hiperproteinemia do sêmen.The spermatic changes associated with the natural infection in dogs by Leishmania sp was evaluated during eight consecutive weeks, using ejaculates of six seronegative and six seropositive dogs. The samples were collected once a week and evaluated for volume, concentration, motility, vigor, sperm morphology, chromatin integrity, simultaneous evaluation of the plasmatic membrane integrity, acrosome, and mitochondrial potential. The total proteins of the seminal plasma and blood were measured. The visceral leishmaniasis caused increase of major and minor defects in spermatozoa of animals attacked by moderate to severe stages of the disease. In more advanced stages of the illness, the acrosomal and plasmatic membranes integrity was adversely affected. It was not possible to establish a pattern refering the evaluation of the mitochondrial potential. The incidence of morphological changes in the seropositive animals did not promote an increase of injuries to the chromatin. All animals with leishmaniasis presented hyperproteinemia of the semen.

  4. Qualidade espermática de sêmen de cães naturalmente infectados por Leishmania sp: / Semen quality of dogs naturally infected by Leishmania sp

    Scientific Electronic Library Online (English)

    É., Labat; J.T., Carreira; B.H., Matsukuma; M.T.A., Martins; V.M.F., Lima; S.R.M., Bomfim; S.H.V., Perri; M.B., Koivisto.

    2010-06-01

    Full Text Available Avaliaram-se alterações espermáticas associadas à infecção por leishmaniose no sêmen de cães naturalmente infectados, utilizando-se, durante oito semanas consecutivas, ejaculados de seis cães soronegativos e seis cães soropositivos. As amostras foram colhidas uma vez por semana e avaliadas quanto ao [...] volume, concentração, motilidade, vigor, morfologia espermática, integridade da cromatina, avaliação simultânea da integridade da membrana plasmática, acrossoma e potencial mitocondrial. Concomitantemente foram dosadas a proteína total do plasma seminal e sanguíneo. A leishmaniose visceral causou aumento dos defeitos maiores e menores nos espermatozoides dos animais acometidos pelo estágio moderado a severo da doença. Em estágios mais avançados da enfermidade, a integridade das membranas acrossomal e plasmática foi afetada negativamente. Não foi possível estabelecer um critério quanto à avaliação do potencial mitocondrial. A incidência de alterações morfológicas nos animais acometidos não promoveu aumento de injurias à cromatina. Todos os animais com leishmaniose apresentaram hiperproteinemia do sêmen. Abstract in english The spermatic changes associated with the natural infection in dogs by Leishmania sp was evaluated during eight consecutive weeks, using ejaculates of six seronegative and six seropositive dogs. The samples were collected once a week and evaluated for volume, concentration, motility, vigor, sperm mo [...] rphology, chromatin integrity, simultaneous evaluation of the plasmatic membrane integrity, acrosome, and mitochondrial potential. The total proteins of the seminal plasma and blood were measured. The visceral leishmaniasis caused increase of major and minor defects in spermatozoa of animals attacked by moderate to severe stages of the disease. In more advanced stages of the illness, the acrosomal and plasmatic membranes integrity was adversely affected. It was not possible to establish a pattern refering the evaluation of the mitochondrial potential. The incidence of morphological changes in the seropositive animals did not promote an increase of injuries to the chromatin. All animals with leishmaniasis presented hyperproteinemia of the semen.

  5. 77 FR 74555 - Importation of Live Swine, Swine Semen, Pork, and Pork Products; Estonia, Hungary, Slovakia, and...

    Science.gov (United States)

    2012-12-17

    ...Swine Semen, Pork, and Pork Products; Estonia, Hungary, Slovakia, and Slovenia AGENCY...We are also announcing the addition of Estonia, Hungary, Slovakia, and Slovenia to...European CSF region, the addition of Estonia, Slovakia, and Slovenia to the...

  6. Physical activity, fatness, educational level and snuff consumption as determinants of semen quality: findings of the ActiART study.

    Science.gov (United States)

    Pärn, Triin; Grau Ruiz, Raúl; Kunovac Kallak, Theodora; Ruiz, Jonatan R; Davey, Eva; Hreinsson, Julius; Wånggren, Kjell; Salumets, Andres; Sjöström, Michael; Stavreus-Evers, Anneli; Ortega, Francisco B; Altmäe, Signe

    2015-07-01

    In this study, the association between physical activity and other potential determinants, objectively measured by accelerometry, was examined. Sixty-two men attending an infertility clinic participated in the study. Obese men (body mass index ? 30) and those with a waist circumference 102?cm or more had lower semen volume than the other men (P snuff, compared with the other participants (P snuff consumption are negatively related to semen quality. PMID:25999214

  7. Sugar-sweetened beverage intake in relation to semen quality and reproductive hormone levels in young men

    DEFF Research Database (Denmark)

    Chiu, Y H; Afeiche, M C; Gaskins, A J; Williams, P L; Mendiola, J; Jørgensen, N; Swan, S H; Chavarro, J E

    2014-01-01

    STUDY QUESTION: Is consumption of sugar-sweetened beverages (SSB) associated with semen quality? SUMMARY ANSWER: Higher consumption of SSB was associated with lower sperm motility among healthy, young men. WHAT IS KNOWN ALREADY: The existing literature on the potential role of SSBs on male reproductive function is scarce and primarily focused on the relation between caffeinated beverages and semen quality. However, a rodent model suggests that SSBs may hamper male fertility. STUDY DESIGN, SIZE, ...

  8. Liquid and Frozen Storage of Agouti (Dasyprocta leporina) Semen Extended with UHT Milk, Unpasteurized Coconut Water, and Pasteurized Coconut Water

    OpenAIRE

    G. W. Garcia; W. M. Mollineau; Adogwa, A. O.

    2010-01-01

    This study evaluated the effects of semen extension and storage on forward progressive motility % (FPM%) in agouti semen. Three extenders were used; sterilized whole cow's milk (UHT Milk), unpasteurized (CW) and pasteurized coconut water (PCW), and diluted to 50, 100, 150, and 200 × 106 spermatozoa/ml. Experiment 1: 200 ejaculates were extended for liquid storage at 5?C and evaluated every day for 5 days to determine FPM% and its rate of deterioration. Experiment 2: 150 ejaculates were extend...

  9. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men: a cross-sectional study

    OpenAIRE

    Mocevic, Emina; Specht, Ina O.; Marott, Jacob L.; Giwercman, Aleksander; Jönsson, Bo AG; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens

    2012-01-01

    Several animal studies indicate that mercury is a male reproductive toxicant, but human studies are few and contradictory. We examined semen characteristics and serum levels of reproductive hormones in relation to environmental exposure to mercury. Blood and semen samples were collected from 529 male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml?1 in G...

  10. Effect of separating bull semen into X and Y chromosome-bearing fractions on the sex ratio of resulting embryos.

    OpenAIRE

    Hagele, W C; Hare, W C; Singh, E L; Grylls, J L; Abt, D A

    1984-01-01

    Seventy-six, day 12 to day 15 bovine embryos, collected from 14 donors which had been inseminated with either X or Y chromosome-bearing spermatozoa fractions of semen separated by a thermal convection counterstreaming sedimentation and forced convection galvanization process, were processed for sexing by chromosomal analysis. Fifty-seven embryos were sexed; 20 from Y chromosome-bearing and 37 from X chromosome-bearing fractions of semen. Statistical analysis of the sexing data indicated that ...

  11. The Effects of Frequent Electroejaculation on the Semen Characteristics of a Captive Siberian Tiger (Panthera tigris altaica)

    OpenAIRE

    FUKUI, Daisuke; NAGANO, Masashi; Nakamura, Ryohei; BANDO, Gen; NAKATA, Shinichi; KOSUGE, Masao; SAKAMOTO, Hideyuki; MATSUI, Motozumi; YANAGAWA, Yojiro; Takahashi, Yoshiyuki

    2013-01-01

    Artificial insemination (AI) can help to avoid inbreeding and genetic degeneration for sustaining genetically healthy populations of endangered species in captivity. Collection of a sufficient quantity of viable sperm is an essential first step in the AI process. In the present study, we examined the effects of frequent electroejaculation on semen characteristics in a Siberian tiger. We collected semen in all 17 trials during 6 breeding seasons (6 years). The mean number of spe...

  12. Sensitive Simultaneous Detection of Seven Sexually Transmitted Agents in Semen by Multiplex-PCR and of HPV by Single PCR

    OpenAIRE

    GIMENES, Fabrícia; Medina, Fabiana Soares; de Abreu, André Luelsdorf Pimenta; Irie, Mary Mayumi Taguti; Esquiçati, Isis Baroni; Malagutti, Natália; Vasconcellos, Vinícius Rodrigo Bulla; Discacciati, Michele Garcia; Bonini, Marcelo Gialluisi; Maria-Engler, Silvya Stuchi; CONSOLARO, Marcia Edilaine Lopes

    2014-01-01

    Sexually transmitted diseases (STDs) may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR) assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV) ?1 an...

  13. Regional differences and temporal trends in male reproductive health disorders : semen quality may be a sensitive marker of environmental exposures

    DEFF Research Database (Denmark)

    Nordkap, Loa; Joensen, Ulla Nordström

    2012-01-01

    The decline in semen quality has been the subject of an animated debate. A recent prospective study now irrefutably shows a decline in semen quality in men from Finland, a country that previously boasted good semen quality. Semen quality has, in some countries, reached a level where a considerable fraction of young men are at risk of fertility problems. Impaired semen quality, testicular cancer, cryptorchidism and hypospadias are risk factors for each other, and the testicular dysgenesis syndrome (TDS) has been put forward to explain the observations. This syndrome implies that the four disease entities share the same patho-physiological etiology caused by disturbed testicular development in early fetal life. It seems likely that the rapid rise in TDS-associated conditions can, at least partly, be explained by environmental factors. Animal studies provide strong evidence that manmade chemicals can disrupt the hormone dependent pathways responsible for fetal gonadal development, subsequently leading to TDS-like symptoms. In humans, fetal exposure to endocrine disrupting substances may play a role, although genetic factors are probably also involved. Recent studies indicate that exposure to endocrine disrupters also in adulthood may affect semen quality and reproductive hormones. Causal relationships are inherently difficult to establish in humans, and a clear connection between the disorders and specific toxicants has not been established. It seems likely that the cumulative effects of various low-dose exposures to endocrine disrupters in our environment are responsible for the adverse effects in the male reproductive system. Semen quality may be the most sensitive marker of adverse environmental exposures, and we suggest that standardized surveillance studies of semen quality are continued or initiated to monitor the combined effects of various preventive actions.

  14. Maternal alcohol consumption during pregnancy and semen quality in the male offspring: two decades of follow-up

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia; Toft, Gunnar; Jensen, Morten Søndergaard; Strandberg-Larsen, Katrine; Hansen, Mette Lausten; Olsen, Jørn

    2010-01-01

    BACKGROUND Concurrent alcohol exposure has been associated with reduced fecundity, but no studies have estimated the effect of prenatal alcohol exposure on male fecundity. The aim of this study was to investigate the association between maternal alcohol consumption during pregnancy, semen quality and levels of reproductive hormones in young, adult men. METHODS From a Danish pregnancy cohort established in 1984-1987, 347 sons were selected for a follow-up study conducted in 2005-2006. Semen and b...

  15. Semen quality according to prenatal coffee and present caffeine exposure: two decades of follow-up of a pregnancy cohort

    DEFF Research Database (Denmark)

    Ramlau-Hansen, C H; Thulstrup, A M; Bonde, J P; Olsen, J; Bech, B H

    2008-01-01

    BACKGROUND: A few studies have investigated the association between male caffeine consumption in adult life and semen quality with conflicting results, but so far no studies have explored the effect of prenatal coffee exposure. We studied the association between prenatal coffee and current caffeine exposure and semen quality and levels of reproductive hormones. METHODS: From a Danish pregnancy cohort established in 1984-1987, 347 sons out of 5109 were selected for a follow-up study conducted 200...

  16. Human semen quality in the new millennium: a prospective cross-sectional population-based study of 4867 men

    DEFF Research Database (Denmark)

    JØrgensen, N; Joensen, Ulla Nordström

    2012-01-01

    Objectives Considerable interest and controversy over a possible decline in semen quality during the 20th century raised concern that semen quality could have reached a critically low level where it might affect human reproduction. The authors therefore initiated a study to assess reproductive health in men from the general population and to monitor changes in semen quality over time. Design Cross-sectional study of men from the general Danish population. Inclusion criteria were place of residence in the Copenhagen area, and both the man and his mother being born and raised in Denmark. Men with severe or chronic diseases were not included. Setting Danish one-centre study. Participants 4867 men, median age 19?years, included from 1996 to 2010. Outcome measures Semen volume, sperm concentration, total sperm count, sperm motility and sperm morphology. Results Only 23% of participants had optimal sperm concentration and sperm morphology. Comparing with historic data of men attending a Copenhagen infertility clinic in the 1940s and men who recently became fathers, these two groups had significantly better semen quality than our study group from the general population. Over the 15?years, median sperm concentration increased from 43 to 48?million/ml (p=0.02) and total sperm count from 132 to 151 million (p=0.001). The median percentage of motile spermatozoa and abnormal spermatozoa were 68% and 93%, and did not change during the study period. Conclusions This large prospective study of semen quality among young men of the general population showed an increasing trend in sperm concentration and total sperm count. However, only one in four men had optimal semen quality. In addition, one in four will most likely face a prolonged waiting time to pregnancy if they in the future want to father a child and another 15% are at risk of the need of fertility treatment. Thus, reduced semen quality seems so frequent that it may impair the fertility rates and further increase the demand for assisted reproduction.

  17. Lifestyles Associated With Human Semen Quality: Results From MARHCS Cohort Study in Chongqing, China.

    Science.gov (United States)

    Yang, Huan; Chen, Qing; Zhou, Niya; Sun, Lei; Bao, Huaqiong; Tan, Lu; Chen, Hongqiang; Zhang, Guowei; Ling, Xi; Huang, Linping; Li, Lianbing; Ma, Mingfu; Yang, Hao; Wang, Xiaogang; Zou, Peng; Peng, Kaige; Liu, Kaijun; Liu, Taixiu; Cui, Zhihong; Liu, Jinyi; Ao, Lin; Zhou, Ziyuan; Cao, Jia

    2015-07-01

    Decline of semen quality in past decades is suggested to be potentially associated with environmental and sociopsychobehavioral factors, but data from population-based cohort studies is limited. The male reproductive health in Chongqing College students (MARHCS) study was established in June 2013 as a perspective cohort study that recruited voluntary male healthy college students from 3 universities in Chongqing. The primary objectives of the MARHCS study are to investigate the associations of male reproductive health in young adults with sociopsychobehavioral factors, as well as changes of environmental exposure due to the relocation from rural campus (in University Town) to metro-campus (in central downtown). A 93-item questionnaire was used to collect sociopsychobehavioral information in manner of interviewer-interviewing, and blood, urine and semen samples were collected at the same time. The study was initiated with 796 healthy young men screened from 872 participants, with a median age of 20. About 81.8% of this population met the WHO 2010 criteria on semen quality given to the 6 routine parameters. Decreases of 12.7%, 19.8%, and 17.0%, and decreases of 7.7%, 17.6%, and 14.7% in total sperm count and sperm concentration, respectively, were found to be associated with the tertiles of accumulated smoking amount. Fried food consumption (1-2 ?times/wk or ?3 ?times/wk vs nonconsumers) was found to be associated with decreased total sperm count (10.2% or 24.5%) and sperm concentration (13.7% or 17.2%), respectively. Coffee consumption was found to be associated with increased progressive and nonprogressive motility of 8.9% or 15.4% for subjects consuming 1-2 ?cups/wk or ?3 ?cups/wk of coffee, respectively. Cola consumption appeared an association with decreased semen volume at 4.1% or 12.5% for 1-2? bottles/wk or ?3 ?bottles/wk. A cohort to investigate the effects of environmental/sociopsychobehavioral factors act on semen quality was successfully set up. We found smoking, coffee/cola/fried foods consumption to be significantly associated with semen quality from the baseline investigation. PMID:26181561

  18. Características seminales del macho cabrío Serrano Transmontano (Semen characteristics of the Serrano Transmontano buck

    Directory of Open Access Journals (Sweden)

    Almendra, L.

    2005-12-01

    Full Text Available Las características de producción espermática constituyen uno de los factores más importantes del desarrollo de programas de inseminación artificial. El objetivo del presente trabajo consistió en el estudio de algunas de las características del semen producido a lo largo del año por machos cabríos de la raza Serrana Ecotipo Transmontano. Fueron estudiados 8 animales (4 adultos datando la primera recogida de semen con más de 18 meses y 4 machos jóvenes con 6-10 meses de edad. Las variables analizadas fueron el volumen (n=378; 0,859 ± 0,337 ml, la concentración (n=227; 4,791 x 106 ± 1,694 espermatozóides/ml, la motilidad masal (n=314; 3,7 ± 0,8 y la motilidad individual (n=308; 69,2 ± 14,1 %. Se observó una influencia muy significativa (P0,05. A pesar de las variaciones observadas, las características seminales (volumen de eyaculado y motilidad espermática, no parecen constituir un factor adverso en la utilización del semen en inseminación artificial, cualquiera que sea la época del año. Sperm production is one of the most important factors for the development of artificial insemination programs. The objective of this study was the evaluation of some characteristics of semen produced throughout the year by bucks of the breed Serrana ecotype Transmontano. Eight male goats were studied (4 adult males, more than 18 months old at the first semen collection and 4 young males 6-10 months old. Variables studied were volume of ejaculate (n=378; 0.859 ± 0.337 ml, sperm number (n=227; 4.791 x 106 ± 1.694 sperm cells/ml, sperm mass motility (n=314; 3.7 ± 0.8 and sperm individual motility (n=308; 69.2 ± 14.1 %. Age of males influenced significantly (P0,05. In spite of the observed variations, the seminal characteristics (volume of the ejaculate and sperm motility don't seem to constitute an adverse factor to the use of the semen in artificial insemination in any season throughout the year

  19. Is prenatal exposure to tobacco smoking a cause of poor semen quality? : A follow-up study

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia HØst; Thulstrup, Ane Marie

    2007-01-01

    A few studies indicate that exposure to maternal smoking during fetal life decreases semen quality in adult life, but the results are inconsistent and retrospectively collected smoking data were used in most studies. From a Danish pregnancy cohort established in 1984-1987, 347 of 5,109 sons were selected according to their exposure to tobacco smoke in fetal life. From February 2005 to January 2006, a semen sample from the 347 men was analyzed for conventional semen characteristics according to standardized criteria by using a mobile laboratory. The authors found an inverse association between maternal smoking during pregnancy and total sperm count (p = 0.002). Men exposed to more than 19 cigarettes daily during pregnancy had approximately 19% lower semen volume (p = 0.04), 38% lower total sperm count (p = 0.11), and 17% lower sperm concentration (p = 0.47) compared with unexposed men. The odds ratio for oligospermia was 2.16 (95% confidence interval: 0.68, 6.87) among exposed men compared with the unexposed. No associations were found for sperm motility or morphology. These results indicate that prenatal exposure to tobacco smoke may have an adverse effect on semen quality and, if these associations are causal, they could explain some of the reported differences between populations and secular changes in semen quality.

  20. Investigation the Effects of Dietary L-Carnitine Supplementation on Characteristics of Rooster Semen During Liquid Storage

    Directory of Open Access Journals (Sweden)

    Y.J. Ahangari

    2011-01-01

    Full Text Available The objective of present study was to investigate the effects of various levels of dietary L carnitine supplementation (0, 125, 250 and 500 mg kg?1 on rooster semen characteristics during liquid storage. Semen were collected from 16 rooster using abdominal massage and suitable samples were mixed together and sperm characteristics including percentage of motile, viable, abnormal, semen pH, volume and concentration were assessed. This experiment was carried out on the basis of completely randomized design. Results showed that during liquid storage, the effect of L carnitine on motility and viability percentage of sperm in beltsville extender were significant (p1 L-carnitine supplementation. Semen characteristics such as volume, pH and abnormal percentage of sperm did not differ significantly (p>0.05. Furthermore, semen concentration of birds fed dietary carnitine significantly differ from controls during experiment (p1 L-carnitine. Therefore, use of L-carnitine supplementation (250 mg kg?1 in broiler breeder male feeding is recommended to improve quality of rooster semen.

  1. What do Male Students at the College of Medicine of the University of Malawi Say About Semen Donation?

    Directory of Open Access Journals (Sweden)

    Fanuel Lampiao

    2013-02-01

    Full Text Available Aim This study was aimed at assessing knowledge and attitude to semen donation among male students at the College of Medicine. Methods A semi-structured questionnaire survey of students doing Pre-Medical Sciences, MBBS, Pharmacy, Physiotherapy, and Medical Laboratory Science degrees at the College of Medicine. There were 180 respondents who took part in this study. Their ages ranged from 15 to 43 years with a mean of 21.21 years. Results A total of 130 (72.2% of the respondents were aware of the practice of sperm donation for research purposes or the treatment of infertility while 50 students had never heard of it. A total of 86 (47.8% students reported their willingness to donate their semen. The main motivation for wanting to donate sperm was to get paid. The leading factors which discouraged the respondents from donating semen were that the practice was either against their religious belief (42.6%, or that they were not comfortable with the practice of semen donation because it was morally wrong (50%. Conclusion Despite having the high level of awareness of semen donation among male students of the College of Medicine, more than half of them were unfavourably disposed to it. Public enlightenment through the mass media and correction of false notions about semen donation will go a long way in addressing this problem. [TAF Prev Med Bull 2013; 12(1.000: 75-78

  2. Cloned embryos from semen. Part 2: Intergeneric nuclear transfer of semen-derived eland (Taurotragus oryx) epithelial cells into bovine oocytes

    Science.gov (United States)

    Nel-Themaat, L.; Gomez, M.C.; Pope, C.E.; Lopez, M.; Wirtu, G.; Jenkins, J.A.; Cole, A.; Dresser, B.L.; Bondioli, K.R.; Godke, R.A.

    2008-01-01

    The production of cloned offspring by nuclear transfer (NT) of semen-derived somatic cells holds considerable potential for the incorporation of novel genes into endangered species populations. Because oocytes from endangered species are scarce, domestic species oocytes are often used as cytoplasts for interspecies NT. In the present study, epithelial cells isolated from eland semen were used for intergeneric transfer (IgNT) into enucleated bovine oocytes and compared with bovine NT embryos. Cleavage rates of bovine NT and eland IgNT embryos were similar (80 vs. 83%, respectively; p > 0.05); however, development to the morula and blastocyst stage was higher for bovine NT embryos (38 and 21%, respectively; p embryos (0.5 and 0%, respectively). DNA synthesis was not observed in either bovine NT or eland IgNT cybrids before activation, but in 75 and 70% of bovine NT and eland igNT embryos, respectively, cell-cycle resumption was observed at 16 h postactivation (hpa). For eland IgNT embryos, 13% had ???8 cells at 84 hpa, while 32% of the bovine NT embryos had ???8 cells at the same interval. However, 100 and 66% of bovine NT and eland IgNT embryos, respectively, that had ???8 cells synthesized DNA. From these results we concluded that (1) semen-derived epithelial cell nuclei can interact and be transcriptionally controlled by bovine cytoplast, (2) the first cell-cycle occurred in IgNT embryos, (3) a high frequency of developmental arrest occurs before the eight-cell stage in IgNT embryos, and (4) IgNT embryos that progress through the early cleavage stage arrest can (a) synthesize DNA, (b) progress through subsequent cell cycles, and (c) may have the potential to develop further. ?? 2008 Mary Ann Liebert, Inc.

  3. Does last week's alcohol intake affect semen quality or reproductive hormones? : A cross-sectional study among healthy young Danish men

    DEFF Research Database (Denmark)

    Hansen, M L; Thulstrup, A M

    2012-01-01

    The association between last 5 days of alcohol intake, semen quality and reproductive hormones was estimated in this cross-sectional study among 347 men. Conventional semen characteristics, DNA fragmentation index and reproductive hormones (testosterone, estradiol, sex hormone-binding globulin (SHBG), follicle-stimulating hormone (FSH), luteinizing hormone (LH) and inhibin B) were determined. There was a tendency towards lower semen characteristics at higher intake of alcohol past 5 days, albeit with no statistically significant dose-response association. The ratio between free estradiol and free testosterone was higher at higher alcohol intake during the 5 days preceding semen sampling. In conclusion, alcohol intake was associated with impairment of most semen characteristics but without a coherent dose-response pattern. The study indicates an association between recent alcohol intake and a hormonal shift towards higher estradiol/testosterone ratio. The hormonal changes observed may over time, lead to adverse effects on semen quality, but longitudinal studies are needed to study this.

  4. Reología del semen humano: compromiso de la lisozima

    OpenAIRE

    Mendeluk, Gabriela R.; Blanco, Ana María; Bregni, Carlos

    1996-01-01

    El objetivo del presente trabajo fue evaluar el coinpromiso de la lisozima en el fenómeno de hiperviscosidad seminal. La enzima fue determinada en 142 muestras de plasma seminal clasificadas de acuerdo a su consistencia (normal o aumentada) y a la presencia o no de leucospermia y macrófagos activos. Los parámetros reológicos determinados con un viscosímetro Wells-Brookfield a 20ºC mostraron diferencia significativa entre los lotes de consistencia normal y aumentada (p < 0,0l). Se empleó e...

  5. PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

    Scientific Electronic Library Online (English)

    Francisca Elda Ferreira, Dias; Cáris Marone, Nunes; Tânia Vasconcelos, Cavalcante; Andréa Azevedo Pires de, Castro; Jorge Luis, Ferreira; José Fernando, Garcia.

    2013-09-01

    Full Text Available Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas [...] à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial. Abstract in english This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by pheno [...] l/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

  6. Cryopreservation of rabbit semen: effectiveness of different permeable and non-permeable cryoprotectants on post-thaw sperm quality and reproductive performances

    OpenAIRE

    Di Iorio, Michele

    2015-01-01

    Rabbit breeding for meat production is based mainly on artificial insemination (AI) programs. In order to obtain many of potential advantages of AI, improvement of the storage of rabbit semen is necessary. Therefore, meat rabbit farming would greatly benefit if semen could be stored after collection and subsequently used for AI without affecting fertility. The rabbit sperm can be stored by refrigeration (in liquid or solid extenders) or freezing. The use of frozen semen would provide more p...

  7. Effect of Estrus-AI interval on timed AI pregnancy rates in beef cows inseminated with fresh extended or frozen thawed semen

    OpenAIRE

    R. K. Kasimanickam and W. D. Whittier

    2011-01-01

    We hypothesize that insemination with fresh extended semen will improve the AI pregnancy rate due to its prolonged longevity in female reproductive tract compared to frozen thawed semen. The objective of this trial was to determine the effect of fresh and frozen semen on fixed-time AI pregnancy rate in beef cows synchronized with progesterone based CO-Synch protocols and inseminated at different estrus-AI intervals. Angus cross beef cows (N=180) were synchronized with CO-Synch-CIDR protocols ...

  8. COMPUTER-ASSISTED SEMEN ANALYSIS OF RAT SPERMATOZOA AFTER AN INTRAPERITONEAL ADMINISTRATION OF INSECTICIDE DIAZINON

    Directory of Open Access Journals (Sweden)

    R. TOMAN

    2013-12-01

    Full Text Available The aim of this study was to reveal the effect of diazinon on the rat spermatozoa motility characteristics using the computer-assisted semen analysis (CASA. Motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, STR, LIN, WOB, ALH, and BCF after the diazinon i.p. administration of 20 mg/kg b.w. were evaluated. 36 hours after the diazinon administration, only slight decrease in VCL, DCL and increase in percentage of progressive motility in the diazinon-treated group. Significant decrease (P<0.01 was only observed in BCF in diazinon-treated group. Computer-assisted semen analysis (CASA of rat sperm motility showed that acute diazinon administration slightly affected the rat sperm motility which can be the first step in the decreased fertilization capacity caused by pesticides. Further investigation of reproductive effects of diazinon is needed.

  9. Effects of alpha-lipoic acids on sperm membrane integrity during liquid storage of boar semen

    Directory of Open Access Journals (Sweden)

    Laura Parlapan

    2015-05-01

    Full Text Available Preliminary studies have shown that sperm membrane from swine shows high sensitivity to cryopreservation process, causing a dramatic reduction in sperm quality. This has been attributed to the production of reactive oxygen species, that cause lipid peroxidation in sperm membranes. The aim of the present study was to minimize the oxidative attack by adding different concentration of alpha-lipoic acid into the sperm liquid storage at 17ºC for 7 days. Freshly ejaculated boar semen was diluted with Beltsville Thawing Solution (BTS and supplemented with 5 levels of alpha-lipoic  acid (0.015, 0.02, 0.05, 0.1, 0.15 mmol/ml. The membrane integrity was evaluated at days 0, 1, 3, 5 and 7 of liquid preservation, using flow cytometer FACSCanto II (BD Biociencias systems. The experiment indicate that supplementation of alpha-lipoic  acid to the semen liquid storage extender improve sperm membrane

  10. Hazard Analysis and Critical Control Points System for a Bull Semen Production Centre.

    Science.gov (United States)

    Goularte, K L; Madeira, E M; Ferreira, Cer; Duval, E H; Vieira, A D; Mondadori, R G; Lucia, T

    2015-12-01

    Bull semen production centres (SPC) generally present satisfactory quality control for sperm processing, but non-standardized hygiene procedures. This study describes a Hazard Analysis and Critical Control Points (HACCP) system developed for bull SPC and subsequently implemented in a commercial SPC. After the identification of hazards at each step of semen processing and the determination of their risk and severity, monitoring and corrective procedures were designed to assess the system's efficiency. The HACCP system identified six microbiological hazards, 10 physical hazards, four chemical hazards and three critical control points. After the establishment of Good Processing Practices, Standard Operating Procedures and Standard Sanitizing Operating Procedures, the system was validated through an audit, to identify eventual failures and to define measures to correct them. PMID:26477334

  11. Age-related changes in quality and fertility of porcine semen

    Scientific Electronic Library Online (English)

    Ioannis A, Tsakmakidis; Tarek AA, Khalifa; Costas M, Boscos.

    Full Text Available The aim of this study was to investigate the effect of boar age on quality traits and fertility of liquid-stored semen. Boars were allocated into 3 age groups: 7-10 months (young), 18-33 months (mature), 51-61 months (old). Ejaculates of > 200x10(6) sperm/ml and 85% total motile sperm were extended [...] to 30x10(6) sperm/ml, stored at 17-18 °C and used within 12-24 h for artificial insemination (AI) of 2062 multiparous sows. After 24 h of storage, aliquots of diluted semen were assessed for sperm progressive motility (SPM), incidence of sperm chromatin instability (SCI), proportion of live morphologically normal sperm (LMNS) and head morphometry of LMNS. The results showed that young boars had higher percentages of SCI and lower proportions of LMNS than those of the mature (p

  12. Physical activity and television watching in relation to semen quality in young men

    DEFF Research Database (Denmark)

    Gaskins, Audrey Jane; Mendiola, Jaime; Afeiche, Myriam; Jørgensen, Niels; Swan, Shanna H; Chavarro, Jorge E

    2015-01-01

    BACKGROUND: Semen quality appears to have declined over the past decades but reasons for this decline are unresolved. The concurrent increase in sedentary behaviour may be a contributing factor. The objective of this study was to evaluate the relationship of physical activity and television (TV) watching with sperm parameters in a population of young, healthy men. METHODS: Men aged 18-22 years (n=189) from the Rochester Young Men's Study (2009-2010) participated in this analysis. Physical activi...

  13. Urinary bisphenol A levels in young men : association with reproductive hormones and semen quality

    DEFF Research Database (Denmark)

    Lassen, Tina Harmer; Frederiksen, Hanne

    2014-01-01

    BACKGROUND: Few human studies have examined bisphenol A (BPA) exposure in relation to semen quality and reproductive hormones in men, and results are divergent. OBJECTIVES: We examined associations between urinary BPA concentration and reproductive hormones, as well as semen quality, in young men from the general population. METHODS: Our study population consisted of 308 young men from the general population. Urinary BPA concentration was measured by isotope dilution TurboFlow-liquid chromatography-tandem mass spectrometry. We used multiple linear regression analysis to estimate associations between BPA concentration and reproductive hormones and semen quality, adjusting for confounding factors. RESULTS: We found that 98% of the men had detectable urinary levels of BPA. Median (5th-95th percentiles) BPA concentration was 3.25 ng/mL (0.59-14.89 ng/mL). Men with BPA concentrations above the lowest quartile had higher concentrations of serum testosterone, luteinizing hormone (LH), estradiol, and free testosterone compared with the lowest quartile (p trend ? 0.02). Men in the highest quartile of BPA excretion had on average 18% higher total testosterone (95% CI: 8, 28%), 22% higher LH (95% CI: 6, 39%), and 13% higher estradiol (95% CI: 4, 24%) compared with lowest quartile. Men in the highest quartile of BPA also had significantly lower percentage progressive motile spermatozoa compared with men in the lowest quartile (-6.7 percentage points, 95% CI: -11.76, -1.63). BPA was not associated with other semen parameters. Adjusting for dietary patterns did not influence the results. CONCLUSIONS: The pattern of associations between BPA and reproductive hormones could indicate an antiandrogenic or antiestrogenic effect, or both, of BPA on the hypothalamic-pituitary-gonadal hormone feedback system, possibly through a competitive inhibition at the receptor level. However, additional research is needed to confirm our findings and to further test the suggested potential mechanisms.

  14. Induction of Heat Shock Protein Expression in Cervical Epithelial Cells by Human Semen

    Directory of Open Access Journals (Sweden)

    S. S. Witkin

    1999-01-01

    Full Text Available Objective: The 70kD heat shock protein (Hsp70, induced when cells are subjected to environmental stress, prevents the denaturation and incorrect folding of polypeptides and may expedite replication and transmission of DNA and RNA viruses. We analyzed whether messenger RNA (mRNA for Hsp70 was expressed following exposure of a cultured human cervical cell line (HeLa cells to human semen or in cervical cells from sexually active women.

  15. Effects of Methanolic Extract of Moringa Oleifera Leaves on Semen and biochemical Parameters in Cryptorchid Rats

    OpenAIRE

    Afolabi, Ayobami Oladele; Aderoju, Hameed Adeola; Alagbonsi, Isiaka Abdullateef

    2013-01-01

    While anti-oxidant effects of Moringa oleifera in much oxidative stress related diseases have been well reported, cryptorchidism on the other hand has been shown to cause oxidative stress. However, study is scanty on the likely role of Moringa oleifera in reducing cryptorchidism-induced oxidative stress in rats has not been studied. The present study looked into the effects of methanolic extract of Moringa oleifera leaves (MEMO) on semen and biochemical parameters in cryptorchid rats. Twenty ...

  16. Semen quality and reproductive hormones before orchiectomy in men with testicular cancer

    DEFF Research Database (Denmark)

    Petersen, P M; Skakkebaek, N E; Vistisen, K; Rørth, M; Giwercman, A

    1999-01-01

    PURPOSE: To obtain information about preorchiectomy gonadal function in patients with testicular germ cell cancer to improve the clinical management of fertility and other andrologic aspects in these men. PATIENTS AND METHODS: In group 1, a group of 83 consecutive patients with testicular germ cell cancer (TGCC) investigated before orchiectomy, semen analysis was carried out in 63 patients and hormonal investigations, including measurement of follicle-stimulating hormone, luteinizing hormone (LH...

  17. Semen quality, reproductive hormones and fertility of men operated for hypospadias

    DEFF Research Database (Denmark)

    Asklund, C; Jensen, Tina Kold; Main, K M; Sobotka, T; Skakkebæk, Niels Erik; Jørgensen, N

    2010-01-01

    The testicular function of men previously operated for hypospadias has been sparsely investigated. Therefore, we investigated semen quality and reproductive hormones of 92 men with isolated hypospadias (IH) and 20 with hypospadias and additional genital disorders (HAGD) and compared with similar results from young men from the general Danish population. All participants lived the Copenhagen area of Denmark. Additionally, fertility information on 1083 men registered as operated for hypospadias wa...

  18. The effect of Rift Valley fever virus Clone 13 vaccine on semen quality in rams.

    Science.gov (United States)

    Brown, Geoff; Venter, Estelle H; Morley, Paul; Annandale, Henry

    2015-01-01

    Rift Valley fever (RVF) is an arthropod-borne viral disease of importance in livestock and humans. Epidemics occur periodically in domestic ruminants. People in contact with infected livestock may develop disease that varies from mild flu-like symptoms to fatal viraemia. Livestock vaccination may assist in disease control. Rift Valley fever virus (RVFV) Clone 13 is a relatively new vaccine against RVF, derived from an avirulent natural mutant strain of RVFV, and has been shown to confer protective immunity against experimental infection with RVFV. The hypothesis tested in the current trial was that rams vaccinated with RVFV Clone 13 vaccine would not experience a reduction in semen quality (measured by evaluating the percentage progressively motile and percentage morphologically normal spermatozoa in successive ejaculates) relative to unvaccinated control animals. Ram lambs were screened for antibodies to RVFV using a serum neutralisation test. Animals without detectable antibodies (n = 23) were randomly allocated to either a test group (n = 12) or a control group (n = 11). Animals in the test group were vaccinated with RVFV Clone 13 vaccine. Daily rectal temperature measurements and weekly semen and blood samples were taken from all animals. Seven animals were eliminated from the statistical analysis because of potential confounding factors. Logistic regression analysis was performed on data gathered from the remaining animals to determine whether an association existed between animal group, rectal temperature and semen quality parameters. No correlation existed between the treatment group and values obtained for the semen quality parameters measured. There was no statistically significant post-vaccination decline in the percentage of live morphologically normal spermatozoa, or the percentage of progressively motile spermatozoa, either when assessed amongst all animals or when assessed within individual groups. A repeat study with a larger sample size and a more comprehensive pre-screening process may be indicated to avoid the inclusion of unsuitable animals. PMID:26244683

  19. Entrenamiento de carneros para recolección de semen mediante vagina artificial, utilizando como estímulo objetos inanimados

    OpenAIRE

    Virginio Aguirre Flores; Reyes V\\u00E1zquez Rosales; Agust\\u00EDn Orihuela Trujillo

    2005-01-01

    Con el fi n de desarrollar una metodología para entrenar carneros en la recolección de semen con vagina artifi cial (VA), montando un objeto inanimado, se utilizaron nueve animales que se sometieron a cuatro etapas de preparación. La primera con el propósito de lograr la manifestación del repertorio sexual natural, y el resto para llevar a cabo un programa de condicionamiento operante: cuando la respuesta correcta (monta) sucedía, en un inicio provocada por un estado de motivac...

  20. Effects of oncological treatments on semen quality in patients with testicular neoplasia or lymphoproliferative disorders

    OpenAIRE

    DI BISCEGLIE, Cataldo; Bertagna, Angela; Composto, Emanuela R; LANFRANCO, Fabio; Baldi, Matteo; Motta, Giovanna; Barberis, Anna M; NAPOLITANO, EMANUELA; Castellano, Elena; MANIERI, Chiara

    2013-01-01

    Pretherapy sperm cryopreservation in young men is currently included in good clinical practice guidelines for cancer patients. The aim of this paper is to outline the effects of different oncological treatments on semen quality in patients with testicular neoplasia or lymphoproliferative disorders, based on an 8-year experience of the Cryopreservation Centre of a large public hospital. Two hundred and sixty-one patients with testicular neoplasia and 219 patients with lymphoproliferative disor...

  1. Cryobiology and a new look at the preservation of stallion semen

    DEFF Research Database (Denmark)

    Grout, Brian William Wilson; Lehn-Jensen, Henrik; Petersen, Morten Rønn; Draper, Delene; Morris, John G.

    2009-01-01

      During freeze-preservation of high-viability ejaculates of horse semen the duration of the equilibration time for nucleated straws (achieved at -7 0C following induced nucleation and during controlled, slow cooling to -60 0C) has little impact on viability, measured using propidium iodide staining to indicate cells that have lost osmotic competence.  Further, relatively high viability is retained if direct plunging into liquid nitrogen (LN) replaces the controlled protocol, and the sample can ...

  2. EFFECTS OF BREED, SPERMATOZOA CONCENTRATION, AND STORAGE ON PROGRESSIVE MOTILITY OF EXTENDED BOAR SEMEN

    OpenAIRE

    Aleksandar Boži?; Roger Harvey; Blagoje Stan?i?; Saša Dragin; Ivan Stan?i?; Robin Anderson

    2011-01-01

    The classic technology of artificial insemination (AI) often requires insemination doses to be kept for more than 24 hours, with a requirement that the degree of progressive motility at the moment of insemination not be below 65%. The aim of this paper was to determine the influence of breed, spermatozoa concentration, and storage time on the fertilization capacity of extended semen from native ejaculates of boars. The research included the following boar breeds: Duroc (n=34), Hampshire (n=30...

  3. Semen analysis parameters: Experiences and insight into male infertility at a tertiary care hospital in Punjab

    International Nuclear Information System (INIS)

    Objective: To determine the prevalence of low sperm count including oligospermia and azoospermia in male infertile population, and to assess the pattern and distribution of abnormal semen parameters in infertile men. Methods: The descriptive cross-sectional survey was carried out at the Department of Gynaecology and Obstetrics, Sharif Medical City Hospital, Lahore, from June 2009 to June 2010. A total of 500 consecutively consenting male partners of women fulfilling the inclusion criteria between 20 and 40 years of age were approached. Semen analysis was performed according to methods and standards defined by the World Health Organisation (WHO). Samples were categorised into normospermia, oligospermia and azoospermia on the basis of sperm count. After exclusion of azoospermic samples, normospermic and oligospermic samples were compared for ejaculated volume, pus cells, motility and morphology. SPSS 10 was used for statistical analysis. Results: Out of the 500 males approached, 104 (20.8%) had to be left out either because of their unwillingness or inability to pass semen. The study sample comprised of 396 (response rate 79.2%); normospermia was observed in 293 (73.99%) males, azoospermia in 59 (14.89%), and oligospermia in 44 (11.11%). The oligospermic samples had low ejaculated volume, but significantly higher percentage of non-motile sperms 62%+-23.9% and abnormal morphology 55%+-15.6% in comparison to normospermic samples (p 0.0001). Asthenospermia was observed in 37 (25.81%), teratospermia in 11 (3.26%) and oligoasthenoteratospermia in 4 (9.09%) of samples. Conclusion: Semen analysis is the cornerstone for the evaluation of infertility in men. Sperm concentration, motility and morphology are related to each other, factors that cause deterioration of one of them usually also have negative impact on the other two as well. (author)

  4. New sialoglycoprotein from rat seminal vesicle and its association with semen coagulum

    Energy Technology Data Exchange (ETDEWEB)

    Limpaseni, T.; Chulavatnatol, M.

    1986-04-29

    By radiolabeling using NaIO4/(/sup 3/H)KBH4, a new sialoglycoprotein with Mr of 19,000 was found in the secretion of rat seminal vesicle. It was shown to interact non-covalently with semen coagulum. It existed in three acidic forms with pI values of 4.1, 3.7 and 2.9 and possessed high contents of sialic acids and acidic amino acids.

  5. Effect of Dietary Selenium and Vitamin E on Ganders’ Response to Semen Collection and Ejaculate Characteristics

    OpenAIRE

    Jerysz, Anna; LUKASZEWICZ, Ewa

    2013-01-01

    Compared to other domestic bird species, geese exhibit the lowest reproductive efficiency (poor semen quality, low egg production, and poor fertility and hatchability rates). From an economic perspective, it is a necessity of improve these reproductive traits. Studies have demonstrated that the essential trace element—selenium—plays key roles in testicular development and the maintenance of spermatogenesis. The aim of the present study was to determine the effect of feed supplementation with ...

  6. The impact of male overweight on semen quality and outcome of assisted reproduction

    OpenAIRE

    Thomsen, Lise; Humaidan, Peter; Bungum, Leif; Bungum, Mona

    2014-01-01

    It is well-documented that male overweight and obesity causes endocrine disorders that might diminish the male reproductive capacity; however, reports have been conflicting regarding the influence of male body mass index (BMI) on semen quality and the outcome of assisted reproductive technology (ART). The aim of this study was to investigate whether increased male BMI affects sperm quality and the outcome of assisted reproduction in couples with an overweight or obese man and a non-obese part...

  7. Sexual behavior and its relationship with semen quality parameters in Sahiwal breeding bulls

    Directory of Open Access Journals (Sweden)

    Shushant Singh

    2015-06-01

    Full Text Available Aim: The study was conducted at Artificial Breeding Research Centre, NDRI, Karnal, to determine the sexual behavior and its relationship with semen quality parameters in Sahiwal breeding bulls. Materials and Methods: A total of 63 ejaculates were collected from six adult Sahiwal bulls (age ~47 mo and bwt ~466 kg, to study the relationship of sexual behavior and semen quality. The degree of association between different variables was estimated by Pearson’s correlation coefficient method. Results: The results depicted that, sexual aggressiveness showed significantly high positive correlation with libido score (LS and sexual behavior score (SBS. Reaction time (RT and total time taken in mounts (TTTM had a significant negative correlation with LS and SBS. Penile erection score and penile protrusion score (PPS both had a significant positive correlation with ejaculatory thrust score, mating ability score, and SBS. Results of correlation among seminal attributes and with sexual behavior depicted that ejaculate volume had positive significant correlation with initial progressive motility (IPM, sperm concentration (SCON, head abnormality, total abnormality, hypo-osmotic swelling test (HOST, acrosomal integrity (AI whereas, mass activity had positive significant correlation with IPM, SCON, non-eosinophilic spermatozoa count (NESC, HOST, AI, RT and TTTM and IPM had positive significant correlation with SCON, NESC, HOST, AI, and TTTM, whereas and HOST had positive significant correlation with AI. Among seminal attributes, SCON had a positive significant correlation with PPS where as head abnormalities had a positive significant correlation with RT and TTTM. Conclusion: It can be concluded that the relationship of sexual behavior and semen quality parameters are reflecting that the sexual behavior of individual bulls is important to harvest good quality and quantity of semen as desired type of sexual preparation can be provided.

  8. KAJIAN EKSPERIMENTAL SELF COMPACTING CONCRETE (SCC) YANG MENGGUNAKN SEMEN PORTLAND POZZOLAN DAN SERAT BESI BERSIKU

    OpenAIRE

    : M.Wihardi Tjaronge; Rita Irmawaty

    2007-01-01

    Self Compacting Concrete (SCC) SCC adalah suatu beton yang memiliki sifat kecairan (Fluidity) yang tinggi sehingga mampu mengalir dan mengisi ruang-ruang di dalam cetakan tanpa proses pemadatan atau hanya sedikit sekali memerlukan getaran untuk memadatkannya. Sifat penelitian ini adalah eksperimental sunguhan (true experimental research). Penelitian ini mempelajari perilaku mekanik SCC yang menggunakan semen Portland Pozzolan sebagai bahan perekat (binding material) dan serat besi dengan siku...

  9. The impact of male overweight on semen quality and outcome of assisted reproduction

    DEFF Research Database (Denmark)

    Thomsen, Lise; Humaidan, Peter; Bungum, Leif; Bungum, Mona

    2014-01-01

    It is well-documented that male overweight and obesity causes endocrine disorders that might diminish the male reproductive capacity; however, reports have been conflicting regarding the influence of male body mass index (BMI) on semen quality and the outcome of assisted reproductive technology (ART). The aim of this study was to investigate whether increased male BMI affects sperm quality and the outcome of assisted reproduction in couples with an overweight or obese man and a non-obese partner...

  10. Assessment of Nili-Ravi buffalo (Bubalus bubalis) semen by MTT reduction assay

    Scientific Electronic Library Online (English)

    M., Iqbal; A., Ijaz; M., Aleem; H., Rehman; M.S., Yousaf.

    Full Text Available MTT (3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay is commonly used to validate the viability of metabolically active cells. The study was conducted to examine and validate the MTT test to assess the sperm viability of Nili-Ravi buffalo bulls and compare the efficiency of the [...] test with the supra-vital staining technique (eosin-nigrosine) and hypo-osmotic swelling test. Fresh semen samples from breeding Nili-Ravi buffalo bulls (n = 20) were collected using an artificial vagina. After assessing the quality of semen for normal parameters, the MTT assay was carried out in phosphate buffer saline. Results revealed a high significant correlation (r = 0.995) between the viability of sperm and the rate of reduction of MTT. The other proportions of some semen samples showed a weak relationship between the eosinnigrosine method (r = -0.32), hypo-osmotic swelling test (r = -0.12) and motility (r = -0.08). However, the MTT assay was found to be superior to other tests as it was able to determine those sperm which were more than 90% viable. In conclusion, the MTT assay is a simple, robust test that can be used to select Nili-Ravi buffalo bulls on the basis of sperm quality.

  11. Associations between occupation exposure to Formaldehyde and semen quality, a primary study.

    Science.gov (United States)

    Wang, Hai-Xu; Li, He-Cheng; Lv, Mo-Qi; Zhou, Dang-Xia; Bai, Li-Zhi; Du, Liang-Zhi; Xue, Xia; Lin, Pu; Qiu, Shu-Dong

    2015-01-01

    Formaldehyde (FA), a ubiquitous environmental pollutant, has long been suspected of having male reproductive toxicity. However, FA male reproductive toxicity was inconclusive due to dearth of human studies. Therefore, we sought to investigate whether occupational exposure to FA affects semen quality. Semen quality including five conventional parameters and seven kinematics parameters were compared between 114 male workers occupationally exposed to FA and 76 referents. FA exposure index (FEI) was measured and calculated. Our results showed that sperm progressive motility, total sperm motility, VCL, VSL and VAP were statistically significant decreased in FA exposure workers compared with the referents. Moreover, FEI was significantly negative associated with sperm progressive motility (??=?-0.19, P?=?0.01) and total sperm motility (??=?-0.23, P?=?0.004). In addition, a significant elevated risk of abnormal sperm progressive motility were observed in both low- (OR?=?2.58; 95%?CI: 1.11-5.97) and high-FA-exposed group (OR?=?3.41; 95%?CI: 1.45-7.92) respectively. Furthermore, a significant increased risk was also estimated for abnormal total sperm motility in both low- (OR?=?3.21; 95%?CI: 1.24-8.28) and high-FA-exposed group (OR?=?4.84; 95%?CI: 1.83-12.81) respectively. In conclusion, our study revealed the adverse effects of FA occupation exposure on semen quality, especially on sperm motion parameters. PMID:26515386

  12. Genital Tract Infection in Asymptomatic Infertile Men and Its Effect on Semen Quality

    Directory of Open Access Journals (Sweden)

    M Golshani

    2006-07-01

    Full Text Available Male urogenital tract infection plays an important role in men infertility. Asymptomatic bacteriospermia has been paid attention as a major cause of male infertility. The aim of this study was to microbiological investigation of semen sample of infertile men attending to infertility clinic and evaluation of the effects of bacteriospermia on semen quality. Eighty eight infertile men were evaluated by standard bacterial culture method. Standard semen analysis was performed according to WHO guidelines. Among total cases, 35.22% (31 cases showed at least one pathogen: 10.22% E.coli, 9.09% Coagulase Negative Staphylococci (Saprophyticcus, 6.81% Group B Streptococci, 5.88% Entrococci, 5.68% Candida sp., 2.27% Gonococci, 2.27% Staphylococcus aureus, 1.13% Klebsiella sp. and 1.13% Providencia sp. There was a significant relation between the bacteriospermia and the rate of no motile and morphologically abnormal sperms (P0.05. It seems that leukocytospermia is a poor marker to predict bacteriospermia.

  13. The impact of male overweight on semen quality and outcome of assisted reproduction

    Directory of Open Access Journals (Sweden)

    Lise Thomsen

    2014-10-01

    Full Text Available It is well-documented that male overweight and obesity causes endocrine disorders that might diminish the male reproductive capacity; however, reports have been conflicting regarding the influence of male body mass index (BMI on semen quality and the outcome of assisted reproductive technology (ART. The aim of this study was to investigate whether increased male BMI affects sperm quality and the outcome of assisted reproduction in couples with an overweight or obese man and a non-obese partner. Data was prospectively collected from 612 infertile couples undergoing ART at a Danish fertility center. Self-reported information on paternal height and weight were recorded and BMI was calculated. The men were divided into four BMI categories: underweight BMI 30 kg m?2 . Conventional semen analysis was performed according to the World Health Organization guideline and sperm DNA integrity was analyzed by the Sperm Chromatin Structure Assay (SCSA. No statistically significant effect of male BMI was seen on conventional semen parameters (sperm concentration, total sperm count, seminal volume and motility or on SCSA-results. Furthermore, the outcome of ART regarding fertilization rate, number of good quality embryos (GQE , implantation and pregnancy outcome was not influenced by the increasing male BMI.

  14. Effect of Selenium and Vitamin E Supplementation on Semen Quality in Dogs with Lowered Fertility

    Directory of Open Access Journals (Sweden)

    Domos?awska Anna

    2015-04-01

    Full Text Available Thirty clinically healthy dogs with poor semen quality were used in the study. Fifteen dogs were supplemented daily with selenium (0.6 mg/kg organic selenium from yeast and vitamin E (5 mg/kg per os for 60 d. The control group (15 dogs was not supplemented. Semen was collected from all dogs by manual manipulation on days 0, 30, 60, and 90. The sperm concentration and motility parameters were evaluated with a Hamilton Thorne sperm analyser, version IVOS 12.3. For the assessment of sperm morphology, Diff-Quik stain was used. The percentage of live and dead spermatozoa was estimated on dried smears stained with eosin-nigrosin. The concentration of spermatozoa, most motility parameters determined (PMOT, VSL, VCL, ALH, BCF, RAPID, MEDIUM, SLOW, and STATIC, and the percentage of spermatozoa morphologically normal and live increased significantly (P < 0.05 after 60 d of supplementation. In the control group, there were no changes in motility parameters while the concentration and total sperm count decreased over the duration of the study. In conclusion, supplementation with selenium and vitamin E for 60 d can improve the quality of semen in dogs with lowered fertility.

  15. Influence of antisperm antibodies in the semen on intracytoplasmic sperm injection outcome

    Scientific Electronic Library Online (English)

    Sandro C., Esteves; Danielle T., Schneider; Sidney, Verza Jr..

    2007-12-01

    Full Text Available OBJECTIVE: The aim of this study was to analyze the influence of autoantibodies against spermatozoa present in the semen on the outcome of in vitro fertilization with intracytoplasmic sperm injection (ICSI). MATERIALS AND METHODS: We performed a retrospective analysis of clinical and laboratorial da [...] ta from a six year-period ICSI cycles. Screening for the presence of ASA in the semen, by using the direct immunobeads test (IBT), was available for 351 cycles. According to the percentage of antibody-bound spermatozoa in the semen, we divided the cycles in four groups: I (n = 194): 0%-10% ASA; II (n = 107): 11%-20%; III (n = 33): 21%-50% and IV (n = 17): 51%-100% ASA. Additionally, a group of 349 ICSI cycles performed with ejaculated spermatozoa from oligo/asthenozoospermic men who had insufficient number of motile sperm available for ASA screening was included for comparison. ICSI outcomes were compared among groups and included fertilization rate (2 PN), cleavage rate, cleavage velocity, embryo quality, clinical pregnancy and miscarriage rates. Data were examined statistically, with an alpha level of 5% considered significant. RESULTS: Fertilization, cleavage rate and velocity, percentage of good quality embryos, as well as clinical pregnancy and miscarriage rates did not differ among different ASA levels groups. ICSI outcomes in men exhibiting different levels of autoimmunity against spermatozoa did not differ from those with severely abnormal seminal parameters. CONCLUSIONS: Our data indicate that intracytoplasmic sperm injection (ICSI) outcomes are not influenced by ASA levels on sperm.

  16. Influence of antisperm antibodies in the semen on intracytoplasmic sperm injection outcome

    Directory of Open Access Journals (Sweden)

    Sandro C. Esteves

    2007-12-01

    Full Text Available OBJECTIVE: The aim of this study was to analyze the influence of autoantibodies against spermatozoa present in the semen on the outcome of in vitro fertilization with intracytoplasmic sperm injection (ICSI. MATERIALS AND METHODS: We performed a retrospective analysis of clinical and laboratorial data from a six year-period ICSI cycles. Screening for the presence of ASA in the semen, by using the direct immunobeads test (IBT, was available for 351 cycles. According to the percentage of antibody-bound spermatozoa in the semen, we divided the cycles in four groups: I (n = 194: 0%-10% ASA; II (n = 107: 11%-20%; III (n = 33: 21%-50% and IV (n = 17: 51%-100% ASA. Additionally, a group of 349 ICSI cycles performed with ejaculated spermatozoa from oligo/asthenozoospermic men who had insufficient number of motile sperm available for ASA screening was included for comparison. ICSI outcomes were compared among groups and included fertilization rate (2 PN, cleavage rate, cleavage velocity, embryo quality, clinical pregnancy and miscarriage rates. Data were examined statistically, with an alpha level of 5% considered significant. RESULTS: Fertilization, cleavage rate and velocity, percentage of good quality embryos, as well as clinical pregnancy and miscarriage rates did not differ among different ASA levels groups. ICSI outcomes in men exhibiting different levels of autoimmunity against spermatozoa did not differ from those with severely abnormal seminal parameters. CONCLUSIONS: Our data indicate that intracytoplasmic sperm injection (ICSI outcomes are not influenced by ASA levels on sperm.

  17. The impact of male overweight on semen quality and outcome of assisted reproduction

    DEFF Research Database (Denmark)

    Thomsen, Lise; Humaidan, Peter

    2014-01-01

    It is well-documented that male overweight and obesity causes endocrine disorders that might diminish the male reproductive capacity; however, reports have been conflicting regarding the influence of male body mass index (BMI) on semen quality and the outcome of assisted reproductive technology (ART). The aim of this study was to investigate whether increased male BMI affects sperm quality and the outcome of assisted reproduction in couples with an overweight or obese man and a non-obese partner. Data was prospectively collected from 612 infertile couples undergoing ART at a Danish fertility center. Self-reported information on paternal height and weight were recorded and BMI was calculated. The men were divided into four BMI categories: underweight BMI 30 kg m-2 . Conventional semen analysis was performed according to the World Health Organization guideline and sperm DNA integrity was analyzed by the Sperm Chromatin Structure Assay (SCSA). No statistically significant effect of male BMI was seen on conventional semen parameters (sperm concentration, total sperm count, seminal volume and motility) or on SCSA-results. Furthermore, the outcome of ART regarding fertilization rate, number of good quality embryos (GQE ), implantation and pregnancy outcome was not influenced by the increasing male BMI.

  18. Effect of Camellia sinensis supplementation and increasing holding time on quality of cryopreserved boar semen.

    Science.gov (United States)

    Gale, I; Gil, L; Malo, C; González, N; Martínez, F

    2015-06-01

    Cryopreservation of boar semen is still considered suboptimal due to the low fertility when compared with fresh semen. This study was performed to evaluate the effects of green tea (Camellia sinensis) supplementation of the freezing extender at different concentration (0, 2.5%, 5%, 10%) and also to determine the influence of increasing holding time from 2 to 24 h at 15 °C. Seventeen ejaculates from nine boars were used to make pools of three of them and then cryopreserved. Sperm motility, viability, acrosome integrity, membrane functionality (HOST) and capacitation status were determined before freezing and at 0, 30, 60, 90 and 120 min after thawing. Lipid peroxidation was evaluated just after thawing. The main findings emerging from this study were the following: (i) no improvement in quality of thawed spermatozoa with addition of tea to the freezing extender, (ii) no improvement in quality of thawed spermatozoa with prolonged holding time, (iii) lower peroxidation rate in presence of tea 5% and (iv) a decrease in the number of uncapacited viable spermatozoa with any tea supplementation. We conclude that amplification of holding time in semen cryopreservation process does not vary results, facilitating freezing protocol. Tea supplementation reduces lipoxidation but did not improve quality parameters. PMID:24909203

  19. Complications and the effect of varicocelectomy on semen analysis, fertility, early ejaculation and spontaneous abortion

    Directory of Open Access Journals (Sweden)

    Shamsa Ali

    2010-01-01

    Full Text Available Varicocele is still an enigma. Its effects on semen analysis, fertility and, more re-cently, early ejaculation and spontaneous abortion in spouses are not yet fully understood. In this retrospective study, we evaluated these four parameters (semen analysis, fertility, early ejacu-lation and spontaneous abortion among spouses in relation to varicocele and varicocelectomy during a 13-year period. A total of 1,711 patients with varicocele underwent varicocelectomy by high inguinal method (251 cases, subinguinal method (1,375 cases, scrotal method (34 cases, and subinguinal method with local anesthesia (38 cases. Our complication rate was acceptable. Sperm count, motility and morphology increased three months post operation in 55, 51, and 46%, respectively (P value 0.000, 0.000, and 0.015, respectively. Paternity was 56% after one year of post varicocelectomy follow-up. Only 7 out of 82 azoospermic men had sperm in their semen after varicocelectomy and only one of them with mild spermatogenic hypoplasia became a father. The spontaneous abortion rate in the spouses of respondents was 59%. Early ejaculation improved in 75% of the respondents. In conclusion, varicocelectomy does not improve sperm parameters in all men, but it improves pregnancy rate, early ejaculation, and scrotal pain.

  20. Effects of Alpha Lipoic Acids on Cattle Sperm Kinetics Using Computer Assisted Semen Analysis

    Directory of Open Access Journals (Sweden)

    Amat Aswadi Abd Karim

    2012-01-01

    Full Text Available This study investigated the protective effect of Alpha Lipoic Acid (ALA on animal sperm quality using Computer Assisted Semen Analysis (CASA. Fresh semen sample collected from adult Limousin bulls. The experiment involved five test groups and a control. Alpha lipoic acid with different concentrations (0.1, 0.05, 0,025, 0.0125 and 0.00625 mmol mL-1 incubated into semen from all test groups. They were cryopreserved and thawed after 1 h. CASA analysis prior to cryopresevation confirmed the baseline condition. While post-thawed investigation determined the changes in sperm quality between the various groups. CASA parameters used were percent motility, Average Path Velocity (VAP, ? sec-1, Curvilinear Velocity (VCL, ? sec-1, Straight Line Velocity (VSL, ? sec-1, Amplitude of Lateral Head displacement (ALH, ?, Beat Cross Frequency (BCF, Hz, Linearity (LIN, ratio of VSL/VCL and Straightness (STR, ratio of VSL/VAP. ALA statistically improved VAP, VCL, VSL, ALH and BCF particularly for ALA concentration > 0.05 mmol L-1. On the other hand, it did not influenced LIN and STR. As a conclusion, ALA influences semicircular sperm motion and increases velocity. It might be useful as an additive in the extender or cryoprotectant agent to improve sperm motility.

  1. The Influence of Microalgal Preparation Administration on the Cryoresistance of the Bull Semen Material

    Directory of Open Access Journals (Sweden)

    Vera Granaci

    2011-05-01

    Full Text Available The biopreparation’s effect of algal origin on cells semen’s cryoresistance and the reproductive system function of the sire bulls was established. BioR was influenced significantly (fig. 1 the cryoresistence of the semen material of sires bulls. To the end of the administration period (10 days, the group cured with 0,1 ml/ 100kg living mass /day showed an increase of the spermatic mobility with 69,14%, comparing to the preexperimental period. The group cured with 0,4 ml/ 100kg living mass /day showed an increase of 3,88%. The next 50 days from the ceasing of the preparation administration, the seminal cells mobility increased for the first group (0,1 ml/100 kg living mass/day with 107,14%, and for the second group (0,4 ml/100 kg living mass/day this indices value maintains on the stage. The DMA concentration in blood for the first group was 3,74 mmol/l, 10 days after the administration we established an decrease of this indices till 3,12 mmol/l (P?0,05and 50 days after this treatment ceasing the value of studded index was 2,95 mmol/l (P?0,05. The group carried with 0,4 ml/ 100 kg bodily weight /day shoved a tendency of decrease only 50 days from the ceasing of the preparation administration.

  2. High-resolution melt analysis of DNA methylation to discriminate semen in biological stains.

    Science.gov (United States)

    Antunes, Joana; Silva, Deborah S B S; Balamurugan, Kuppareddi; Duncan, George; Alho, Clarice S; McCord, Bruce

    2016-02-01

    The goal of this study was to develop a method for the detection of semen in biological stains using high-resolution melt (HRM) analysis and DNA methylation. To perform this task, we used an epigenetic locus that targets a tissue-specific differentially methylated region for semen. This specific locus, ZC3H12D, contains methylated CpG sites that are hypomethylated in semen and hypermethylated in blood and saliva. Using this procedure, DNA from forensic stains can be isolated, processed using bisulfite-modified polymerase chain reaction (PCR), and detected by real-time PCR with HRM capability. The method described in this article is robust; we were able to obtain results from samples with as little as 1 ng of genomic DNA. Samples inhibited by humic acid still produced reliable results. Furthermore, the procedure is specific and will not amplify non-bisulfite-modified DNA. Because this process can be performed using real-time PCR and is quantitative, it fits nicely within the workflow of current forensic DNA laboratories. As a result, it should prove to be a useful technique for processing trace evidence samples for serological analysis. PMID:26470939

  3. The protective effect of antioxidants on liquid and frozen stored ram semen

    Directory of Open Access Journals (Sweden)

    Csilla Budai

    2014-05-01

    Full Text Available This systematic review is focusing on the current literature in order to give an overview of the protective role of antioxidants in ram semen preservation. Throughout the sperm conservation process the unsaturated fatty acids of the spermatozoa membrane binds oxygen and evolves numerous peroxide bonds. The lipid peroxidation leads to unbalanced oxidative stress that causes different impairments of sperm cells, and acrosome loss. ,,Cold shock” also induces caspase cascade involved in apoptosis, DNA fragmentation and in overall it has a detrimental effect on the fertilizing capacity of spermatozoa. Nowadays the cryopreservation of semen is considered as a routine procedure in cattle. Despite the various advantages of the method, the recovery rate of live and intact spermatozoa still remains low in boar, dog and ram samples. Previously several studies highlighted that the addition of antioxidants could improve the survival and motility rates, because antioxidants acted as free radical scavengers and protected spermatozoa against reactive oxygen species (ROS. Enzymatic antioxidants as superoxide dismutase (SOD, catalase, glutathione peroxidase (GPX and non-enzymatic antioxidant molecules like tocopherol, ascorbic acid, pyruvate, resveratrol have a protective effect against membrane damage that occurs during semen preservation process.

  4. Evaluation of buffalo semen by Trypan blue/Giemsa staining and related fertility in vitro

    Directory of Open Access Journals (Sweden)

    B. Gasparrini

    2010-02-01

    Full Text Available The aim of this work was to verify the feasibility of an easy, quick double staining technique for evaluation of frozen-thawed semen to predict the fertilizing capability in vitro of buffalo bulls. In Experiment 1, frozen-thawed semen from 6 bulls was stained with double Trypan blue/ Giemsa and the incidence of acrosome-intact live (AIL, acrosome-intact dead (AID, acrosome-lost live (ALL and acrosome-lost dead (ALD sperm was recorded. In Experiment 2, sperm from the same bulls were used to fertilize in vitro matured oocytes. The data obtained confirm that there is a strong “bull effect” in buffalo species, with differences in the percentage of AIL sperm at thawing, in cleavage and blastocyst rates among bulls. Interestingly, it was found that this staining technique can be used for a preliminary screening to select semen to use for IVF, as shown by the correlation existent between the percentages of acrosome-intact viable sperm cells at thawing and the blastocyst yields for 4/6 bulls.

  5. Coenzyme Q10 and soyphosphatidylcholine in EK extender on preservation of Rhode Island Red poultry semen

    Directory of Open Access Journals (Sweden)

    Amit Kumar Nath

    2015-06-01

    Full Text Available The objective of this study was to evaluate the efficacy of EK extender alone or incorporation with CoenzymeQ10 (CoQ10 and/or soyphosphatidylcholine (SPC in poultry semen and their effects on seminal traits during temporal storage at 4?C for different time intervals (12 h, 24 h, and 36 h. Heterospermic pooled semen samples diluted (1:4 with EK, EK + SPC, EK+ CoQ10 and EK + SPC + CoQ10 extenders separately, preserved and different spermiogram were assessed. Various seminal traits within the same extender differ significantly (p<0.05 among different groups and with different time intervals of storage. CoQ10 and SPC in the EK extender exhibited favorable synergistic effect on sperm quality and were able to protect the male gametes against cold-stress up to 36h at 4?C. In this study, we concluded that incorporation of SPC and CoQ10 together in EK extender possess novel potentiality to maintain seminal quality during liquid storage of poultry semen at 4?C and for their safe transportation and further use for Artificial Reproductive technologies (ARTs.

  6. RNA/DNA co-analysis from human saliva and semen stains--results of a third collaborative EDNAP exercise

    DEFF Research Database (Denmark)

    Haas, Claus; Hanson, E

    2013-01-01

    A third collaborative exercise on RNA/DNA co-analysis for body fluid identification and STR profiling was organized by the European DNA Profiling Group (EDNAP). Twenty saliva and semen stains, four dilution series (10-0.01 µl saliva, 5-0.01 µl semen) and, optionally, bona fide or mock casework samples of human or non-human origin were analyzed by 20 participating laboratories using an RNA extraction or RNA/DNA co-extraction method. Two novel mRNA multiplexes were used: a saliva triplex (HTN3, STATH and MUC7) and a semen pentaplex (PRM1, PRM2, PSA, SEMG1 and TGM4). The laboratories used different chemistries and instrumentation and a majority (16/20) were able to successfully isolate and detect mRNA in dried stains. The simultaneous extraction of RNA and DNA from individual stains not only permitted a confirmation of the presence of saliva/semen (i.e. tissue/fluid source of origin), but allowed an STR profile of the stain donor to be obtained as well. The method proved to be reproducible and sensitive, with aslittle as 0.05 µl saliva or semen, using different analysis strategies. Additionally, we demonstrated the ability to positively identify the presence of saliva and semen, as well as obtain high quality DNA profiles, from old and compromised casework samples. The results of this collaborative exercise involving an RNA/DNA co-extraction strategy support the potential use of an mRNA based system for the identification of saliva and semen in forensic casework that is compatible with current DNA analysis methodologies.

  7. Effect of homeopathic treatment used in commercial boar semen diluent on sperm viability

    Directory of Open Access Journals (Sweden)

    Mayra Assunpção

    2012-09-01

    Full Text Available Background: It has been speculated that the homeopathic treatment of sperm cells in order to improve semen quality could be promising. However, few data is available and its use in spermatozoa requires investigation. It is well established that mitochondrial membrane potential is an important viability parameter of spermatozoa and it is intimately related to reproductive efficiency. In this manner, new technologies in order to improve the activity of sperm cells and, finally, the fecundity of swine herds are of extremely importance. Due to the lack of knowledge of homeopathic treatment effect on spermatozoa, the aim of the present study was to verify the effect of three different homeopathic treatments on viability of boar sperm cells. Methods: semen samples were obtained from two sexually mature boars (18 mo of age. The boars were cross bred, with similar genetics of Pietrain versus Duroc, BP 450 progeny from a supplier company of similar reproductive performance animals. The animals were maintained in individual stalls, study conducted in Sao Paulo - Brazil. Three homeopathic treatments: Pulsatilla 6CH, Avena 6 CH or both, compared to placebo treatment (sucrose, the homeopathic medicaments or the control were administrated as globules manipulated according Brazilian Homeopathic Pharmacology. Each globule weighted 30 mg and contained sucrose as vehicle. One dose of two globules was added per 100 mL of diluted boar semen, which were chilled for 24 or 48 hours. All samples were labeled in codes in order to allow all laboratory analysis and evaluations being performed as a blind test. Data were tested for normality of residues and homogeneity of variances using the Guided Data Analysis software. Variables and interactions were analyzed by the PROC MIXED of the SAS package (SAS Institute Ins. Cary, NC. Adjusted least squares means (LSMEANS of treatments were compared using the Tukey Test. Results: The different treatments contributed to maintain acrossome integrity for prolonged periods of cooling over 48 hours. The use of Pulsatilla was effective in maintaining high sperm mitochondria activity up to 24 hours from harvesting. Conclusion: Homeopathic medications can be used in artificial insemination in order to improve the quality of cooled and stored pig semen [1]. Keywords: homeopathy, swine semen, sperm viability. Reference [1] Soto, F. R. M.; Vuaden, E. R.; Coelho, C. P.; Bonamin, L. V.; Azevedo, S. S. A.; Benites, N. R.; Barros, F. R. O.; Goissis, M. D.; Assumpção, M. E. O. D.; Visintin, J. A.; Marques, M. G. Effects of the utilization of homeopathic elements in commercial diluent on swine sperm viability. In Vitro Cell.Dev.Biol.—Animal. 47:205–209, 2011.

  8. [Effects of occupational exposure to pesticides on semen quality of workers in an agricultural community of Merida state, Venezuela].

    Science.gov (United States)

    Miranda-Contreras, Leticia; Cruz, Ibis; Osuna, Jesús A; Gómez-Pérez, Roald; Berrueta, Lisbeth; Salmen, Siham; Colmenares, Melisa; Barreto, Silvio; Balza, Alirio; Morales, Yasmin; Zavala, Leisalba; Labarca, Emilitza; García, Nelly; Sanchez, Beluardi; Contreras, Carlos A; Andrade, Henry

    2015-06-01

    Numerous studies report adverse effects of pesticides on male reproductive health. The objectives of this study were to investigate whether there is a relationship between occupational exposure to pesticides and semen quality, and to determine whether chronic exposure to pesticides differentially affects semen quality in men of different ages. A comparative study of 64 farmers and 64 control men was performed. The farmers were interviewed to determine their occupational history and particularly, activities that may involve exposure to pesticides. Semen parameters were evaluated and a comparative analysis of semen variables between exposed and control groups, as well as between age groups: 18-29, 30-37 and 38-60 years was done. Significant alterations of some semen parameters in the exposed group were found, such as: decreases in sperm concentration, slow progressive motility and sperm membrane integrity; at the same time, increases in eosin Y positive and sperm DNA fragmentation index. The results obtained by age groups showed significant differences between exposed and control groups for the parameters of membrane integrity, eosin Y positive and sperm DNA fragmentation index, being the exposed group between 18-29 years that showed the highest altered cases of these parameters. Our results prove that occupational pesticide exposure is associated with alterations in sperm quality, creating a risk to farm workers in their reproductive capacity. PMID:26299054

  9. Detecção de Toxoplasma gondii no sêmen de ovinos naturalmente infectados / Toxoplasma gondii detection in the semen of naturally infected sheep

    Scientific Electronic Library Online (English)

    Érica P.B.X, Moraes; Eduardo B, Faria; André M, Batista; Antonio Carlos, Freitas; Jean Carlos R, Silva; Pedro Paulo F, Albuquerque; Rinaldo A, Mota.

    2010-11-01

    Full Text Available O objetivo deste trabalho foi estudar a eliminação de Toxoplasma gondii no sêmen de carneiros naturalmente infectados. Foram utilizados 65 reprodutores submetidos inicialmente à pesquisa de anticorpos anti-T. gondii por meio da técnica de imunofluorescência indireta (IFI). Os carneiros sorologicamen [...] te positivos foram submetidos à colheita de sêmen para detecção do DNA de T. gondii. Na sorologia observaram-se 6/65 (9,2%) carneiros positivos, enquanto no PCR nested de sêmen 4/6 (66,6%) carneiros foram positivos. Conclui-se que a detecção, por meio da técnica da PCR nested, da forma proliferativa de T. gondii no sêmen de carneiros naturalmente infectados, reforça a necessidade de se pesquisar sobre a possibilidade da transmissão horizontal do parasito via sêmen na espécie ovina. Abstract in english The aim of this paper was to study the Toxoplasma gondii shedding in the semen of naturally infected rams. Sixty-five rams were initially submitted to anti-T. gondii antibody detection by indirect immunofluorescence (IIF). Serologically positive rams were then submitted to semen collection for T. go [...] ndii DNA detection. In the serology, 6/65 (9.2%) rams were positive, while in the nested PCR of semen there were 4/6 (66.6%) positive rams. It can be concluded that detection of the proliferative form of T. gondii in semen of naturally infected rams by the nested PCR technique reinforces the need to investigate possible horizontal transmission of this parasite via semen in sheep.

  10. Transfer of cattle embryos produced with sex-sorted semen results in impaired pregnancy rate and increased male calf mortality.

    Science.gov (United States)

    Mikkola, M; Andersson, M; Taponen, J

    2015-10-15

    This study investigated the pregnancy rate and calf mortality after transfer of embryos produced using sex-sorted semen. Data for 12,438 embryo transfers performed on dairy farms were analyzed. Of these, 10,697 embryos were produced using conventional semen (CONV embryos) and 1741 using sex-sorted semen from 97 bulls (SEX embryos), predominantly of Ayrshire and Holstein breeds. Of the CONV embryos, 27.4% were transferred fresh, whereas of the SEX embryos, 55.7% were fresh. Recipient attributes (breed, parity, number of previous breeding attempts, and interval from calving to transfer) were comparable for both embryo types, heifers representing 57.8% of recipients in the CONV group and 54.8% in the SEX group. Recipients that were not artificially inseminated or did not undergo a new embryo transfer after the initial embryo transfer and had registered calving in fewer than 290 days after the transfer were considered pregnant. Pregnancy rate for recipients receiving CONV embryos was 44.1%, and for those receiving SEX embryos, it was 38.8%. The odds ratio for pregnancy in recipients receiving CONV embryos was 1.34 compared with SEX embryos (P embryos produced with sex-sorted semen decreased the pregnancy rate by about 12% compared with embryos produced using conventional semen. Mortality of male calves born from SEX embryos was higher than for those born from CONV embryos. PMID:26174034

  11. CARACTERÍSTICAS DO SÊMEN CAPRINO DESCONGELADO APÓS A ADIÇÃO DE RINGER LACTATO, CITRATO DE SÓDIO E SOLUÇÃO TRIS / CHARACTERISTICS OF THAWED GOAT SEMEN AFTER ADDITION OF RINGER LACTATE, SODIUM CITRATE AND TRIS SOLUTION

    Scientific Electronic Library Online (English)

    Júlio Cesar Oliveira, Dias; Madriano Christilis da Rocha, Santos; Jurandy Mauro, Penitente Filho; Gisele Dias, Oliveira; Vivian Rachel Araujo, Mendes; Antonio Bento, Mancio.

    2015-06-01

    Full Text Available A criopreservação do sêmen é de grande importância para diversas biotecnologias da reprodução, como Inseminação Artificial (IA), Produção de Embriões In Vitro (PIV) e Injeção Intracitoplasmática de Espermatozoides (ICSI). Avaliou-se a estabilidade e persistência da motilidade e vigor dos espermatozo [...] ides, assim como alterações da membrana plasmática, após a adição de Ringer com Lactato, citrato de sódio 2,92% ou solução TRIS ao sêmen caprino descongelado. O sêmen foi coletado de dois bodes da raça Parda Alpina, realizando-se os procedimentos padrões de análise e criopreservação seminal. Após a descongelação do sêmen, foram adicionados os diluentes Ringer Lactato, citrato de sódio 2,92% ou solução TRIS, realizando-se os Testes de Termorresistência (TTR), Supravital e Morfológico. No TTR, somente o grupo a que foi adicionada a Solução TRIS obteve motilidade e vigor por maior período (90 minutos; P 0,05). Concluiu-se que a adição das soluções não permite uma grande persistência da motilidade e vigor dos espermatozoides descongelados, porém a solução TRIS poderia ser utilizada para expansão de doses seminais utilizadas em biotecnologias reprodutivas in vitro. Abstract in english Cryopreservation of semen is of great importance for various reproductive biotechnologies such as artificial insemination (IA), In Vitro Embryo Production (PIV) and Intracytoplasmic Sperm Injection (ICSI). The objective of this work was to evaluate the stability and persistence of motility and stren [...] gth of sperm, as well as changes in the plasma membrane after the addition of Ringer Lactate, sodium citrate 2.92% or TRIS solution in thawed goat semen. Semen was collected from two Alpine Brown goats, and standard procedures for cryopreservation and seminal analysis were performed. After thawing the semen, the extenders Ringer Lactate, sodium citrate 2.92% and TRIS solution were added and Thermoresistance (TTR), Supravital and Morphology Tests were carried out. In TTR, only the group received TRIS solution presented motility and strength for a longer period (90 minutes; P 0.05). We concluded that the addition of the solutions does not allow a large persistence of motility and strength of thawed sperm, but TRIS solution could be used for expansion of seminal doses used in vitro reproductive biotechnology.

  12. Prostatic acid phosphatase in serum and semen of dogs / Fosfatasa ácida prostática en suero y semen de perros

    Scientific Electronic Library Online (English)

    CRF, Gadelha; WRR, Vicente; APC, Ribeiro; M, Apparicio; GJ, Covizzi; ACN, Campos.

    Full Text Available La incidencia de cáncer de próstata ha incrementado el uso de los marcadores celulares para detectar el cáncer en este tejido. Antígenos específicos del tejido o antígenos de diferenciación se encuentran en la superficie de las células normales. Clínicamente, estos antígenos son importantes para el [...] diagnóstico de alteraciones en estos tejidos y para la inmunoterapia. Este estudio trata de evaluar la importancia de la fosfatasa ácida prostática en la próstata canina e investigar su concentración en el suero y en el plasma seminal de perros saludables de diferentes edades. La concentración de fosfatasa ácida prostática en el plasma seminal y en el suero fue evaluada por espectrofotometría, utilizando un kit comercial. Los niveles de la fosfatasa ácida prostática (PAP) no fueron diferentes de acuerdo con la edad y no presentaron correlación con la edad o con las dimensiones de las próstatas verificadas por ecografía. Los valores de concentración de PAP presentaron una gran variación en cada grupo. Sin embargo, son necesarios más estudios para evaluar el papel de la fosfatasa ácida prostática en la próstata canina y su importancia como una prueba de diagnóstico para los trastornos de la próstata. Abstract in english The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The ob [...] jective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.

  13. Evaluación de la calidad del espermatozoide humano: comparación entre la integridad del ADN espermático y variables del semen / Evaluation of the quality of the human spermatozoon: comparison between spermatic DNA integrity and semen variables

    Scientific Electronic Library Online (English)

    Ibis, Cruz; Melisa, Colmenares; Leidith, Berrueta-Carrillo; Roald, Gomez-Perez; Henry, Montes; Lisbeth, Berrueta; Siham, Salmen; Jesús Alfonso, Osuna.

    2010-03-01

    Full Text Available El análisis del semen no tiene valor predictivo absoluto de fertilidad, pero informa sobre el potencial de fertilidad del varón, el cual está relacionado con la calidad de sus espermatozoides y de otras variables del semen. Se ha comprobado que los valores del semen pueden mostrar gran variabilidad [...] en un mismo individuo. Esto explica por que un hombre cuyas variables no son absolutamente normales, puede lograr un embarazo en su pareja. Dentro de los parámetros tradicionalmente utilizados en la evaluación clínica de la fertilidad masculina se encuentran: la concentración, la movilidad y la morfología espermática; además de medir estas variables, nuevos procedimientos han sido incorporados para evaluar la capacidad funcional de los espermatozoides, uno de los que ha alcanzado particular importancia en la última década es la medida de la integridad del ADN nuclear. La fragmentación del ADN consiste en interrupciones en las cadenas simples o dobles del ADN que ocurre frecuentemente en la muestra de pacientes no fértiles. Se ha llevado a cabo un estudio clínico, en muestras de semen provenientes de pacientes que acudieron al laboratorio de Andrología de la Universidad de los Andes, colectadas entre marzo del 2007 y marzo del 2009, a fin de establecer comparaciones entre los parámetros convencionales y la medición de la integridad de la cromatina espermática, mediante citometría de flujo. Los resultados obtenidos mostraron correlaciones evidentes entre los parámetros convencionales y la integridad del ADN espermático y aportan datos de gran utilidad en el estudio clínico integral de la infertilidad masculina. Abstract in english Semen analysis does not have an absolute predictive value on fertility, however it is a reflection of male fertility potential, which is related to its spermatozoa quality and other semen variables. Great variability in human semen parameters has been demonstrated within a single individual, an obse [...] rvation that could explain why a male with low semen quality can successfully fertilize an egg. Although conventional semen analysis, such as sperm concentration, motility and morphology, provide important information about the clinical status of male fertility, new procedures to predict the sperm functional capability have been developed in the last decade, such as analysis of nuclear DNA integrity, which have improved considerably the clinical diagnosis of male infertility, and increased the knowledge about spermatozoa function. DNA fragmentation consist in interruptions, both in single and double DNA strains, that frequently occur in sperm samples from infertile patients. We have conducted a clinical study in semen samples from patients who have attended the Andrology laboratory of the University of Los Andes, between March 2007 and March 2009. The aim of this study was to compare sperm DNA integrity, analyzed by flow cytometry, with traditional semen parameters. Our results show remarkable correlations between conventional human semen variables and sperm chromatin integrity, contributing to asses an integral evaluation of sperm quality allowing the analysis of its fertilizing potential in clinical studies.

  14. Effect of non-sperm cells removal with single-layer colloidal centrifugation on myeloperoxidase concentration in post-thaw equine semen.

    Science.gov (United States)

    Ponthier, Jérôme; Teague, Sheila R; Franck, Thierry Y; de la Rebière, Geoffroy; Serteyn, Didier D; Brinsko, Steven P; Love, Charles C; Blanchard, Terry L; Varner, Dickson D; Deleuze, Stéfan C

    2013-12-01

    Myeloperoxidase (MPO) is a pro-oxidant enzyme contained in and released by neutrophils during degranulation or after lysis. Post-thaw semen contains MPO and its concentration is associated with decreased sperm motility. Recently, MPO concentration in post-thaw semen was shown to be associated with the presence of non-sperm cells (NSC). The objective of this study was to evaluate the effect of a single-layer colloidal centrifugation before cryopreservation on NSC and MPO concentrations in equine semen. The experimental design consisted of freezing semen with or without previous centrifugation through two concentrations of single-layer colloid media. Non-sperm cells and MPO concentrations were assessed in pellet and upper layer at each step of the procedure and MPO was detected in cells by immunocytochemistry. Single-layer colloid centrifugation decreased NSC and MPO concentrations in post-thaw semen. The MPO concentration was correlated with concentration of NSC in the upper layer of the supernatant. In post-thaw semen, with or without previous single-layer colloid centrifugation, MPO concentration was correlated with concentration of NSC. Overall, neutrophils were rarely observed and NSC were mainly epithelial cells or cellular debris, as demonstrated by MPO immunocytochemistry. At all steps of the semen processing and cryopreservation, MPO immunostaining was clearly identified only on NSC. In conclusion, our study shows that NSC present in fresh semen release MPO during freezing. PMID:24054552

  15. Use of sexed semen and its effect on conception rate, calf sex, dystocia, and stillbirth of Holsteins in the United States

    Science.gov (United States)

    Sexed-semen use for breeding Holstein heifers and cows in Dairy Herd Improvement herds was documented by frequency and percentage for parity and service number as well as for herd region, size, and milk yield. Year of breeding accounted for the most variation in the amount of use of sexed semen for ...

  16. Evaluation of the semen characteistics after induced spermiation in the bullfrog Lithobates catesbeianus - doi: 10.4025/actascibiolsci.v35i3.14780

    Directory of Open Access Journals (Sweden)

    Jose Teixeira Seixas Filho

    2013-08-01

    Full Text Available Evaluation of semen characteristics after hormonal induction of the bullfrog could provide valuable information on the gametes of this species, which may be useful for projects related to artificial fertilization, animal improvement, and cryopreservation. Bullfrog males were induced to spermiate with buserelin acetate (GnRHa, and their semen was subsequently analyzed. GnRHa (0.4 ?g was administered to the bullfrog males with secondary sexual characteristics such as weight > 200 g, yellow chin, nuptial callus, and amplexus reflex, being the semen collected after 60 min. The semen volume was 5.76 mL, light-colored. The other characteristics of the semen were: vigor of 4.80, motility of 93%, concentration of 14.24 × 106 mL-1, and content of normal spermatozoa of 70%. The volume, color, vigor, motility, sperm concentration, and content of normal spermatozoa were adequate in these bullfrog semen samples. Evaluation of the bullfrog semen samples based on this set of parameters is essential for decision-making about the quality and destination of the semen.  

  17. Efecto de la criopreservación de semen de conejo Nueva Zelanda (Oryctolagus cuniculus) sobre su viabilidad y estado acrosomal / Effect of cryopreservation on viability and the acrosomal state of new zeland rabbit (Oryctolagus cuniculus) semen

    Scientific Electronic Library Online (English)

    P.J.E, Hernández; R.F, Fernández; S.J.L, Rodríguez; R.M, Negrete; M.Y.G, Soto; R.A.D, García.

    2012-12-01

    Full Text Available El objetivo del estudio fue investigar el efecto de la criopreservación sobre la viabilidad y estado acrosomal de espermatozoides de conejo de la raza Nueva Zelanda (Oryctolagus cuniculus). Se utilizaron 46 eyaculados, obtenidos mediante vagina artificial, evaluándose las siguientes características [...] en semen fresco y post-descongelado: % de viabilidad sin y con reacción acrosomal (VsRA y VcRA, respectivamente), y % de mortalidad sin y con reacción acrosomal (MsRA y McRA, respectivamente), mediante la tinción de Isotiocianato de fluoresceína conjugada con la lectina de Arachis Hypogaea y Ioduro de Propidio (FITC-PNA/IP). Se obtuvieron los siguientes valores en semen fresco: 73.6+4.9%, 5.5+2.4%, 15.2+3.7% y 5.6+2.3%, respectivamente; y para semen post-descongelado: 40.0+4.8%, 10.4+3.1%, 38.1+6.1 y 11.5+3.6, respectivamente. Se determinaron diferencias estadísticamente significativas (p Abstract in english The effect of cryopreservation on the viability and the acrosomal state of spermatozoa of New Zeeland rabbits (Oryctolagus cuniculus) was studied. Forty six ejaculates, obtained with an artificial vagina, were used to determine the percentages of viability and mortality with and without acrosomal re [...] action (VsRA, VcRA, MsRA and McRA, respectively) in fresh and post-thawed semen by staining with fluorescein isothiocianato conjugated with lectine from Arachis Hypogaea and propidium iodide (FITC-PNA/IP). The values obtained in fresh semen were 73.6+4.9%, 5.5+2.4%, 15.2+3.7% and 5.6+2.3%, respectively, and 40.0+4.8%, 10.4+3.1%, 38.1+6.1 y 11.5+3.6, respectively, in post-thawed semen. Statistically significant differences (p

  18. Evolución de la fragmentación del ADN en semen criopreservado de toros de Lidia / Development of DNA fragmentation in semen criopreservation of Fighting bull

    Scientific Electronic Library Online (English)

    R., Posado; M., Hernández; J.J., García; D.J., Bartolomé; C., López-Fernández; J., Gosálvez.

    2011-09-01

    Full Text Available El objetivo de este trabajo fue analizar la curva de fragmentación del ADN espermático en semen criopreservado de 10 sementales de la raza de Lidia y observar su evolución a diferentes intervalos de tiempo preestablecidos. Se descongelaron las dosis a 37ºC y se incubaron durante 10 días a 38,6ºC, si [...] mulando la temperatura corporal de la hembra. Se analizó el porcentaje de fragmentación del ADN espermático de cada muestra a las 4, 24, 48 y 72 horas y a los 4, 5, 6, 7, 8, 9 y 10 días de incubación utilizando el kit Sperm-Halomax®-Bos-FF (ChromaCell SL, Madrid, Spain) para microscopía de fluorescencia. Los resultados obtenidos indican que: (i) Los niveles de fragmentación basal, así como la velocidad de degradación del ADN espermático a diferentes tiempos de incubación, presentan importantes diferencias interindividuales. (ii) A falta del estudio de un mayor número de muestras, se podría considerar que en esta raza, la integridad de la molécula de cromatina se rompe cuando el semen es incubado a una temperatura de 38,6ºC, pero aún así, puede permanecer estable durante un prolongado período de tiempo. Aquellos sementales con altos porcentajes de fragmentación y que acumulan daños en su ADN espermático rápidamente, tendrían escasas posibilidades de conseguir la fertilización. Por tanto, sería interesante conocer la curva de fragmentación del ADN de cada muestra seminal criopreservada, porque proporcionaría información muy valiosa para establecer la mejor estrategia de reproducción asistida y esclarecer problemas de infertilidad o de falta de desarrollo embrionario cuando se aplican estas técnicas. Abstract in english The objective of the present study was to analyze the curve of sperm DNA fragmentation and its development during a pre-established period of time, in cryopreserved semen of 10 bulls from Lidia's breed. Semen samples were thawed at 37ºC and were preserved in incubation up to 10 days at 38.6ºC, to em [...] ulate the corporal temperature in the female. Analysis of DNA fragmentation was assessed after 4, 24, 48, 72 hours and at 4, 5, 6, 7, 8, 9 and 10 days of incubation from each sample. Sperm-Halomax®-Bos-FF kit (ChromaCell SL, Madrid, Spain) was used to determine this parameter, by fluorescence microscopy. The results obtained indicated that: (i) Basal levels of fragmentation, and the velocity of sperm DNA degradation between different times, presented variation among individuals. (ii) We can consider that in these breed, the nuclear chromatin integrity gets degraded when it is incubated at a temperature of 38.6ºC and can remain stable for long periods of time. Those bulls that present high percents of fragmentation index and a high speed of damage accumulation have a low potential to achieve fertilization. Therefore, it would be interesting to determinate the curve of DNA fragmentation in each cryopreserved sample, because it would supply information when establishing the best strategy for use to assisted reproduction techniques and it could clarify infertility or embryonic development problems for artificial insemination protocols.

  19. The effects of frequent electroejaculation on the semen characteristics of a captive Siberian tiger (Panthera tigris altaica).

    Science.gov (United States)

    Fukui, Daisuke; Nagano, Masashi; Nakamura, Ryohei; Bando, Gen; Nakata, Shinichi; Kosuge, Masao; Sakamoto, Hideyuki; Matsui, Motozumi; Yanagawa, Yojiro; Takahashi, Yoshiyuki

    2013-10-01

    Artificial insemination (AI) can help to avoid inbreeding and genetic degeneration for sustaining genetically healthy populations of endangered species in captivity. Collection of a sufficient quantity of viable sperm is an essential first step in the AI process. In the present study, we examined the effects of frequent electroejaculation on semen characteristics in a Siberian tiger. We collected semen in all 17 trials during 6 breeding seasons (6 years). The mean number of sperm and the percentage of motile sperm were 294.3 ± 250.2 × 10?/ejaculate and 82.4 ± 11.4%, respectively. The number of motile sperm tended to increase during frequent electroejaculation in the same breeding season. Semen collection by electroejaculation can be performed effectively up to the fourth sequential ejaculate, which contained the most sperm in the study. In conclusion, frequent collection of sperm by electroejaculation from tigers may be effective for collection of a large number of motile sperm. PMID:23774799

  20. Human semen quality in relation to dietary pesticide exposure and organic diet

    DEFF Research Database (Denmark)

    Juhler, R. K.; Larsen, S. B.

    1999-01-01

    The objective of the study was to corroborate or refute the hypothesis that farmers having a high intake of organic grown commodities have a high semen quality due to their expected lower level of dietary pesticides intake. Food frequency data and semen were collected from 256 farmers (171 traditional farmers and 85 organic farmers, overall participation rate: 32%) who were selected from central registers. Each farmer delivered one semen sample before the spraying season started. The farmers were divided into three groups where the commodities from organic production contributed no (N, 0%), medium (M, 1-49%), or a high (H, 50-100%) proportion of the fruit and vegetables consumed. Farmers having a high relative intake of organically grown fruit and vegetables also had a high relative consumption of organically produced meat, milk, and bread, and differences were observed comparing the actual mean intake of single commodities, such as rice, potato, and pork meat. The current individual dietary intake of 40 pesticides was estimated using food frequencies and generalized serving size data in combination with data on pesticide concentrations in food commodities as obtained from the National Danish Food Monitoring Program. The estimated pesticide intake was significantly lower among farmers of group H, but for all three groups of farmers the average dietary intake of 40 pesticides was at or below 1% of the acceptable daily intake (ADI) except for the dithiocarbamates (max = 0.21 mu g/kg day = 2.2% ADI), methidathion, (max = 0.01 mu g/kg day = 1.4% ADI), and 2-phenylphenol (max = 0.21 mu g/kg day = 1.1% ADI). The median sperm concentration for the three groups of farmers was not significantly different (p = 0.40, median sperm concentration was N = 62, M = 44, and H = 75 million/ml). The group of men without organic food intake had a significant lower proportion of morphologically normal spermatozoa, but in relation to 14 other semen parameters no significant differences were found between the groups. Intake of 40 individual pesticides was correlated with four semen parameters (concentration, percentage dead spermatozoa, percentage normal sperm heads, and motility [VCL]). Five significant correlations (p value 0.01) were found among the 160 comparisons in relation to percentage dead spermatozoa: azin-phos-methyl, carbaryl, chlorfenson, fenitrothion, and tetradifon. For all of them a lower percentage of dead spermatozoa were found in the groups with a high dietary intake of the specific pesticide. In contrast, for all pesticides evaluated only minor differences were found between the groups when considering spermatozoa concentration, morphology, and motility. In conclusion the estimated dietary intake of 40 pesticides did not entail a risk of impaired semen quality, but precautions should be taken when generalizing this negative result to populations with a higher dietary exposure level or an intake of other groups of pesticides.

  1. Effect of Estrus-AI interval on timed AI pregnancy rates in beef cows inseminated with fresh extended or frozen thawed semen

    Directory of Open Access Journals (Sweden)

    R. K. Kasimanickam and W. D. Whittier

    2011-12-01

    Full Text Available We hypothesize that insemination with fresh extended semen will improve the AI pregnancy rate due to its prolonged longevity in female reproductive tract compared to frozen thawed semen. The objective of this trial was to determine the effect of fresh and frozen semen on fixed-time AI pregnancy rate in beef cows synchronized with progesterone based CO-Synch protocols and inseminated at different estrus-AI intervals. Angus cross beef cows (N=180 were synchronized with CO-Synch-CIDR protocols for a fixed-time AI. A subset of cows (N=110 received Heatwatch estrus detection system's pressure sensor at CIDR removal to determine the time of estrus. Cows were divided into two groups, inseminated either at 47h (early or at 67h (late from CIDR removal with fresh extended (3 million sperm or of frozen thawed (20 million sperm semen. Results indicated that cows inseminated at 67 h had numerically higher fixed time AI pregnancy compared to cows inseminated at 47 h [44.4% (40/90 vs. 33.3% (30/90; P=0.13]. Cows inseminated with frozen thawed semen had similar fixed time AI pregnancy compared to fresh extended semen [40.8 (31/76 vs. 37.5% (39/104; P=0.66]. AI-estrus interval was divided into three groups < 0 h (AI occurred before estrus, 0 to 16 h and > 16 h (AI occurred 16 h after estrus. The AI pregnancy rates for fresh semen for the 3 estrus-AI intervals were similar to frozen semen. In conclusion, the fresh semen yielded similar AI pregnancy as frozen semen when inseminated at different estrus-AI interval in a fixed time AI breeding program in beef cows. [Vet. World 2011; 4(6.000: 245-247

  2. Genomic selection strategies in dairy cattle breeding programmes: Sexed semen cannot replace multiple ovulation and embryo transfer as superior reproductive technology

    DEFF Research Database (Denmark)

    Pedersen, Louise Dybdahl; Kargo, Morten

    2012-01-01

    The aim of this study was to test whether the use of X-semen in a dairy cattle population using genomic selection (GS) and multiple ovulation and embryo transfer (MOET) increases the selection intensity on cow dams and thereby the genetic gain in the entire population. Also, the dynamics of using different types of sexed semen (X, Y or conventional) in the nucleus were investigated. The stochastic simulation study partly supported the hypothesis as the genetic gain in the entire population was elevated when X-semen was used in the production population as GS exploited the higher selection intensity among heifers with great accuracy. However, when MOET was applied, the effect was considerably diminished as was the exchange of females between the nucleus and the production population, thus causing modest genetic profit from using X-sorted semen in the production population. In addition, the effect of using sexed semen on the genetic gain was very small compared with the effect of MOET and highly dependent on whether cow dams or bull dams were inseminated with sexed semen and on what type of semen that was used for the bull dams. The rate of inbreeding was seldom affected by the use of sexed semen. However, when all young bull candidates were born following MOET, the results showed that the use of Y-semen in the breeding nucleus tended to decrease the rate of inbreeding as it enabled GS to increase within-family selection. This implies that the benefit from using sexed semen in a modern dairy cattle breeding scheme applying both GS and MOET may be found in its beneficial effect on the rate of inbreeding

  3. Effects of in vitro selenium addition to the semen extender on the spermatozoa characteristics before and after freezing in water buffaloes (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Kamran Dorostkar

    2012-12-01

    Full Text Available The aim of the present study was to investigate the effect of in vitro supplementation of selenium on fresh and frozen spermatozoa quality of buffalo (Bubalus bubalis bulls. Five healthy buffalo bulls (5 ejaculates from each bull were used. Each ejaculate was diluted at 37 ?C with tris-based extender containing 0 (control, 0.5, 1, 2, 4 and 8 ?g mL-1 sodium selenite and the sperm motility and viability were evaluated at 0 (T0 (immediately after dilution, 60 (T1 and 120 (T2 min after diluting semen. In the second step, semen samples were diluted with tris-egg yolk-glycerol extender containing the same amounts of sodium selenite, cooled to 4 ?C, equilibrated and semen parameters (motility, viability, membrane integrity and DNA damage were estimated. Then, the semen was packed in 0.5 mL French straws and frozen in liquid nitrogen. Later, the semen was thawed and analyzed for the same parameters, as well as total antioxidant capacity. Results showed that addition of 1 and 2 ?gmL-1 selenium to the semen extender significantly increased the sperm motility of fresh and equilibrated semen compared to the control without affecting other parameters. However, in frozen-thawed semen, extenders containing 1 and 2 ?g mL-1 selenium significantly improved sperm motility, viability, membrane integrity and semen total antioxidant capacity and also resulted in lower DNA damaged sperms. In this study selenium supplementation of semen extender of 4 and 8 ?g mL-1 had deleterious effects on sperm parameters as early as the samples were prepared for freezing.

  4. Low semen volume in 47 adolescents and adults with 47,XXY Klinefelter or 46,XX male syndrome

    DEFF Research Database (Denmark)

    Aksglaede, L; JØrgensen, N

    2009-01-01

    Klinefelter syndrome is characterized by progressive testicular failure causing androgen deficiency and azoospermia in most patients. The aim of this study was to evaluate semen quality in consecutive patients with an additional X chromosome as compared with healthy males. Forty-seven males with non-mosaic 47,XXY (n = 40) or SRY-positive 46,XX male (n = 7) karyotypes aged 26.1 (range: 15.0-51.7) years participated. Semen quality was compared with 2136 (control group I) men from the general population aged 18.9 (17.9-28.6) years and with 349 fertile men (control group II) aged 30.9 (22.0-43.8) years. Semen volume adjusted for duration of abstinence was significantly smaller in the patients [2.0 (0.2-5.7) mL] when compared with control group I [3.1 (0.3-12.5) mL, p <0.0001] and group II [3.6 (0.6-12.5) mL, p <0.0001]. There was no difference in semen volume between 47,XXY and 46,XX males. All patients had azoospermia except two 47,XXY males aged 29 years who had sperm concentrations of 0.5 and 1.6 million/mL, respectively. We found significantly smaller semen volume in the patients when compared with controls, and the presence of motile spermatozoa in two out of 47 patients. The small semen volume supports the notion of 47,XXY patients being androgen insufficient despite serum testosterone levels within the normal range.

  5. Does weight loss improve semen quality and reproductive hormones? results from a cohort of severely obese men

    Directory of Open Access Journals (Sweden)

    Ernst Emil

    2011-08-01

    Full Text Available Abstract Background A high body mass index (BMI has been associated with reduced semen quality and male subfecundity, but no studies following obese men losing weight have yet been published. We examined semen quality and reproductive hormones among morbidly obese men and studied if weight loss improved the reproductive indicators. Methods In this pilot cohort study, 43 men with BMI > 33 kg/m2 were followed through a 14 week residential weight loss program. The participants provided semen samples and had blood samples drawn, filled in questionnaires, and had clinical examinations before and after the intervention. Conventional semen characteristics as well as sperm DNA integrity, analysed by the sperm chromatin structure assay (SCSA were obtained. Serum levels of testosterone, estradiol, sex hormone-binding globulin (SHBG, luteinizing hormone (LH, follicle-stimulating hormone (FSH, anti-Müllerian hormone (AMH and inhibin B (Inh-B were measured. Results Participants were from 20 to 59 years of age (median = 32 with BMI ranging from 33 to 61 kg/m2. At baseline, after adjustment for potential confounders, BMI was inversely associated with sperm concentration (p = 0.02, total sperm count (p = 0.02, sperm morphology (p = 0.04, and motile sperm (p = 0.005 as well as testosterone (p = 0.04 and Inh-B (p = 0.04 and positively associated to estradiol (p Conclusion This study found obesity to be associated with poor semen quality and altered reproductive hormonal profile. Weight loss may potentially lead to improvement in semen quality. Whether the improvement is a result of the reduction in body weight per se or improved lifestyles remains unknown.

  6. Effect of rosemary (Rosmarinus officinalis) extracts and glutathione antioxidants on bull semen quality after cryopreservation

    Energy Technology Data Exchange (ETDEWEB)

    Daghigh-Kia, H.; Olfati-Karaji, R.; Hoseinkhani, A.; Ashrafi, I.

    2014-06-01

    The present study determined the effects of the addition of rosemary extract (ROM), glutathione (GSH), and their combination (ROM + GSH) to freezing extender on the quality of bull semen after cryopreservation. Before cryoperservation, the samples were diluted in a tris-egg yolk (TEY) extender containing 5 mM GSH (treatment I), 5 or 10 g L{sup -}1 ROM (treatments II and III), and ROM with GSH (5 mM GSH with 5 or 10 g L{sup -}1 of ROM) (treatments IV and V). An extender containing no antioxidants (non-ROM/GSH-treated) served as control group. Kinematic parameters were evaluated by means of a computer-assisted semen analysis (CASA). The viability and membrane integrity of the sperm were assessed using eosin-nigrosin stain and the hypo-osmotic swelling test (HOST) at 0 and 2 h after freezethawing. Lipooxidative parameters, superoxide dismutase, and glutathione peroxidase (GPx) activity were assessed after thawing. Treatment III showed positive effects for total motility (TM) (p < 0.01), average path velocity (VAP) (p < 0.001), viability (p < 0.01) and HOST (p < 0.01); however, lipid peroxidation (LPO) decreased (p < 0.05) and GPx activity increased (p < 0.05) immediately after thawing compared to the control. The TM (p < 0.01), VAP (p < 0.01), viability (p < 0.01), HOST (p < 0.01) decreased in LPO (p < 0.01) and GPx activity (p < 0.05) for treatment V and the viability and GPx activity (p < 0.05) for treatment I were significantly higher than for the control group at 2 h after thawing. It was concluded that the inclusion of ROM and its combination with GSH improves the post-thaw quality of bull semen. (Author)

  7. Shorter anogenital distance predicts poorer semen quality in young men in Rochester, New York

    DEFF Research Database (Denmark)

    Mendiola, Jaime; Stahlhut, Richard W

    2011-01-01

    BACKGROUND: In male rodents, anogenital distance (AGD) provides a sensitive and continuous correlate of androgen exposure in the intrauterine environment and predicts later reproductive success. Some endocrine-disrupting chemicals can alter male reproductive tract development, including shortening AGD, in both rodents and humans. Whether AGD is related to semen quality in human is unknown. OBJECTIVE: We examined associations between AGD and semen parameters in adult males. METHODS: We used multiple regression analyses to model the relationships between sperm parameters and two alternative measures of AGD [from the anus to the posterior base of the scrotum (AGD(AS)) and to the cephalad insertion of the penis (AGD(AP))] in 126 volunteers in Rochester, New York. RESULTS: AGD(AS), but not AGD(AP), was associated with sperm concentration, motility, morphology, total sperm count, and total motile count (p-values, 0.002-0.048). Men with AGD(AS) below (vs. above) the median were 7.3 times more likely (95% confidence interval, 2.5-21.6) to have a low sperm concentration (< 20 × 106/mL). For a typical study participant, sperm concentrations were 34.7 × 106/mL and 51.6 × 106/mL at the 25th and 75th percentiles of (adjusted) AGD(AS). CONCLUSIONS: In our population, AGD(AS) was a strong correlate of all semen parameters and a predictor of low sperm concentration. In animals, male AGD at birth reflects androgen levels during the masculinization programming window and predicts adult AGD and reproductive function. Our results suggest, therefore, that the androgenic environment during early fetal life exerts a fundamental influence on both AGD and adult sperm counts in humans, as demonstrated in rodents.

  8. Wet heat exposure: a potentially reversible cause of low semen quality in infertile men

    Scientific Electronic Library Online (English)

    Shai, Shefi; Phiroz E., Tarapore; Thomas J., Walsh; Mary, Croughan; Paul J., Turek.

    2007-02-01

    Full Text Available OBJECTIVE: To evaluate the recovery of semen quality in a cohort of infertile men after known hyperthermic exposure to hot tubs, hot baths or whirlpool baths. MATERIALS AND METHODS: A consecutive cohort of infertile men had a history remarkable for wet heat exposure in the forms of hot tubs, Jacuzzi [...] or hot baths. Clinical characteristics and exposure parameters were assessed before exposure was discontinued, and semen parameters analyzed before and after discontinuation of hyperthermic exposure. A significant seminal response to withdrawal of hyperthermia was defined as > 200% increase in the total motile sperm count (TMC = volume x concentration x motile fraction) during follow-up after cessation of wet heat exposure. RESULTS: Eleven infertile men (mean age 36.5 years, range 31-44) exposed to hyperthermia were evaluated pre and post-exposure. Five patients (45%) responded favorably to cessation of heat exposure and had a mean increase in total motile sperm counts of 491%. This increase was largely the result of a statistically significant increase in sperm motility from a mean of 12% at baseline to 34% post-intervention (p = 0.02). Among non-responders, a smoking history revealed a mean of 5.6 pack-years, compared to 0.11 pack-years among responders. The prevalence of varicoceles was similar in both cohorts. CONCLUSIONS: The toxic effect of hyperthermia on semen quality may be reversible in some infertile men. We observed that the seminal response to exposure elimination varies biologically among individuals and can be profound in magnitude. Among non-responders, other risk factors that could explain a lack of response to elimination of hyperthermia should be considered.

  9. Electroejaculation, semen characteristics and serum testosterone concentrations of free-ranging african elephants (Loxodonta africana).

    Science.gov (United States)

    Howard, J G; Bush, M; de Vos, V; Wildt, D E

    1984-09-01

    A regimented electroejaculation protocol (120 electrical stimulations; 10-30 V) was used to collect semen and characterize ejaculate quality from 9 adult, free-ranging African elephants under anaesthesia. Eight of the 9 ejaculates contained high concentrations of progressively motile spermatozoa. The overall mean ejaculate volume, sperm concentration/ml ejaculate, sperm motility, sperm status and ejaculate pH were 93.3 ml, 2408.6 X 10(6) spermatozoa/ml, 70%, 3.9 and 7.4, respectively. A high percentage (mean 77.5%) of spermatozoa within each ejaculate was morphologically normal. Of the aberrant spermatozoa, 72% had a cytoplasmic droplet defect. When sperm viability was tested in vitro at 37 degrees C, sperm motility rating declined by at least half of the initial assessment within 3.5 h of semen collection. Generally, spermatozoa maintained motility in vitro for less than 6 h. Serum testosterone ranged from 1.4 to 8.2 ng/ml in 4 males evaluated in the morning (07:30-08:00 h). In 4 of the 5 bulls assessed in the afternoon (15:00-18:00 h), testosterone levels were less than 0.9 ng/ml. The remaining bull, evaluated at 16:00 h, had exceptionally high testosterone concentrations (peak 25.6 ng/ml) and a preputial discharge potentially indicative of 'musth'. The present study demonstrates that high quality semen can be collected consistently from the African elephant and that striking differences exist in serum testosterone amongst free-ranging males which may be due, in part, to a diurnal rhythm. PMID:6471047

  10. The effect of recombinant follicle-stimulating hormone on semen parameters after varicocelectomy in infertile men

    Directory of Open Access Journals (Sweden)

    Atoosa Bagheri Behzad

    2015-12-01

    Full Text Available Background: Infertility is defined as failure to achieve pregnancy after one year of unprotected sexual intercourse. Infertility can be related to male or female factors. Varicocele is the most common cause of infertility in men that is correctable with surgery. The purpose of this study was to determine the effects of recombinant follicle-stimulating hormone (rFSH on semen parameters in infertile men. Methods: This randomized clinical trial was done on 96 infertile men admitted to the Women's General Hospital Mohebe-Yas from September 2014 to September 2015. Inclusion criteria were to include varicocelectomy for unilateral idiopathic varicoceles and consent to participate in the study. Allergy to the drug combination and patient dissatisfaction were exclusion criteria. Patients participating in the study were divided into two groups randomly, one group received recombinant FSH three times a week and the other group received a placebo (normal saline in the same way. After three months, the improvement of semen parameters, including motility, morphology and sperm count as well as the complications were determined in both groups. The data were analyzed with statistical software SPSS version 13 (Chicago, IL, USA. Results: A total of 96 patients were enrolled in two groups of 48 men and women; both groups were matched in terms of underlying factors. The rate of improvement in the morphology and motility of sperm in the treated group was significantly more than the placebo group (P= 0.0001; but the changes in sperm count were not significantly different between the groups (P= 0.495. Conclusion: In summary, based on the results obtained in this study, it can be concluded that recombinant FSH is effective on improving semen parameters in infertile men after varicocelectomy compared with a placebo group and its major impact is on the morphology and motility of sperm.

  11. Effect of detoxified karanja (Pongamia spp.) cake on testicular architecture and semen production in ram lambs.

    Science.gov (United States)

    Dineshkumar, D; Selvaraju, S; Parthipan, S; Thayakumar, Allen; Rajendran, D; Ravindra, J P; Krishnamoorthy, P; Reddy, I J; Rao, S B N

    2013-10-01

    The protein-rich non-conventional detoxified karanja cake (dKC) can be used in place of conventional protein supplements like soybean meal (SBM), groundnut meal, etc. in livestock feed. The present study was conducted to assess the effect of two levels of dKC by replacing SBM on testicular architecture, semen quality and expressions of mRNAs encoding luteinizing hormone receptor (LHR) and insulin-like growth factor (IGF-I) in testes of ram lambs. Eighteen ram lambs were randomly divided into three groups (n = 6) and fed different levels (%) of karanja cake (0% replacement--control; 50% replacement--dKC-50 and 75% replacement--dKC-75) for 140 days. After 120 days of feeding, the semen from the animals was collected and analysed. The testes samples were collected on day 140 of feeding for transcripts expression studies. The dKC-50 group had no change in BW, whereas dKC-75 group showed decreased (P < 0.05) BW as compared with control. The number of animals ejaculated semen in dKC-75 group was lower (P < 0.05) than the control group. A reduction (P < 0.05) in LHR expression in dKC-75 was observed, whereas a reduction in IGF-I expression (P < 0.05) was observed in dKC-50 and dKC-75 as compared with control group. The study reveals that in ram lambs, long-term feeding of dKC at 50% replacement of SBM may not affect BW. However, long-term feeding of dKC as a replacement of SBM may affect testicular function. PMID:23866979

  12. Need of reevaluation of the parameters of semen straws to be used in artificial insemination programs

    Directory of Open Access Journals (Sweden)

    J. Angel

    2010-02-01

    Full Text Available In buffalo industry artificial insemination is being used in breeding programs of our country . It has limitations such us seasonality, difficult estrus detection and low pregnancy rates when compared with cattle. IATF programs using a single insemination show results from 10 to 50% pregnancy rate, little information is available about minimum requirements of spermatozoa for IA. The aim of this paper is to compare the pregnancy rates after using narual mating or frozen semen in a sincronization of ovulation program. This work were conducted in Pueblo Nuevo Cordoba Colombia in August during the breeding season of 2005-6. 99 multiparous crossbred females were used with 50 to 150 postpartum days. Body score condition of 3,5 to 4. All animals were palpated to exclude anatomical alterations. Ovsynch protocol for IATF reported by Baruselli (2000, they were allocated in two groups: Buffalo group, after the last GnRH analog injection 17 females were allocated with 5 bulls, and IATF Group 82 females were inseminated 16 hours later. The semen of 7 different buffalo bulls were used and evaluated and qualified as normal. Inseminations were performed by 3 different technicians. A blood sample was obtained 20 days after IA to determine pregnancy by determinations of P4 levels using chemiluminiscence, ?1ng/ml were used as cut off value to determine pregnancy. Data were compared using Chi square test. 70% (12/17 females of the bull group and 29% (24/82 of IATF group were diagnosed us pregnant using P4, this difference were statistically significant (P?0.001. Buffalo bulls mount all females. No statistical differences were found in pregnancy rates of the bulls used for IATF, from 12% to 37 %, one exceptional bull obtain 71%. As expected bulls have higher pregnancy rates than artificial insemination, the results obtained here allow researchers to evaluated semen quality, specially density to improve results IATF in buffaloes.

  13. First results from insemination with sex-sorted semen in dairy heifers in Macedonia

    Directory of Open Access Journals (Sweden)

    Ljupche Kochoski

    2015-03-01

    Full Text Available Science has been searching for a long time for a reliable method for controlling the sex of mammalian offspring. Recently, the application of specific modern cellular methodologies has led to the development of a flow cytometric system capable of differentiating and separating living X- and Y-chromosome-bearing sperm cells in amounts suitable for AI and therefore, commercialization of this sexing technology. The aim of this work was to present the first results of heifers that introduce bovine AI with sex sorted semen, for the first time in Macedonia. Insemination with sex sorted cryopreserved semen (2x106 spermatozoa per dose imported from the USA was done at two dairy farms in ZK Pelagonija. In total, 74 heifers (Holstein Friesian were inseminated. Inseminations were carried out in a timely manner following a modified OvSynch protocol. During the insemination, the sperm was deposited into the uterine horn ipsi lateral to the ovary where a follicle larger than 1.6 cm was detected by means of transrectal ultrasound examination. Pregnancy was checked by ultrasound on day 30 after the insemination. Overall, the average pregnancy rate in both farms was 43,24% (40,54% and 45,95%, for farm 1 and farm 2, respectively. All pregnant heifers delivered their calves following a normal gestation length (274,3 days in average and of the 32 born calves, 30 (93,75% were female. In conclusion, since the first results from inseminations with sex-sorted semen in dairy heifers in Macedonia are very promising, the introduction of this technique may bring much benefit to the local dairy sector. Average pregnancy rate seems similar with results obtained following ‘regular’ inseminations, notwithstanding the relatively low number of spermatozoa per insemination dose. Due to the latter, we however recommend inseminations only to be carried out by experienced technicians followinga TAI protocol and ultrasound examinations of the ovaries prior to insemination.

  14. Experimental study of ?PERSICAE SEMEN? on the blood injected by Endotoxin in rats

    OpenAIRE

    Chang-Keun; Kyeong-Sun Soh; Chan-Gil Jeong

    2005-01-01

    This study was performed to investigate the effects of ?Persicae Semen?(PS) on the blood injected by Endotoxin in rats. The blood was induced by Endotoxin injection into the caudal vein of rats and PS group taken a measurement of RBC, Hb, Hct, Platelet, WBC, ESR, CRP. The results were obtained as follows: 1. RBC, Hb, Hct, Platelet, WBC were increased with statistical significance at PS group as compared with those of the control group. 2. ESR, CRP were decreased with statistical sign...

  15. Association Between Use of Marijuana and Male Reproductive Hormones and Semen Quality

    DEFF Research Database (Denmark)

    Gundersen, Tina Djernis; Jørgensen, Niels; Andersson, Anna-Maria; Bang, Anne Kirstine; Nordkap, Loa; Skakkebæk, Niels E; Priskorn, Lærke; Juul, Anders; Jensen, Tina Kold

    2015-01-01

    A total of 1,215 young Danish men aged 18-28 years were recruited between 2008 and 2012 when they attended a compulsory medical examination to determine their fitness for military service. The participants delivered a semen sample, had a blood sample drawn, and underwent a physical examination. They responded to questionnaires including information on marijuana and recreational drug use during the past 3 months (no use, use once per week or less, or use more than once per week). A total of 45% h...

  16. Holographic imaging of unlabelled sperm cells for semen analysis: a review

    CERN Document Server

    Di Caprio, Giuseppe; Miccio, Lisa; Merola, Francesco; Memmolo, Pasquale; Ferraro, Pietro; Coppola, Giuseppe

    2014-01-01

    Male reproductive health in both humans and animals is an important research field in biological study. In order to characterize the morphology, the motility and the concentration of the sperm cells, which are the most important parameters to feature them, digital holography demonstrated to be an attractive technique. Indeed, it is a labelfree, non-invasive and high-resolution method that enables the characterization of live specimen. The review is intended both for summarize the state-of-art on the semen analysis and recent achievement obtained by means of digital holography and for exploring new possible applications of digital holography in this field.

  17. Semen Collection from Japanese Quail (Coturnix japonica) Using a Teaser Female

    OpenAIRE

    CHELMONSKA, Bronislawa; JERYSZ, Anna; LUKASZEWICZ, Ewa

    2008-01-01

    The quantity and quality of Japanese quail (Coturnix japonica) semen collected individually after stimulation by a teaser female was assessed. From among 25 mature males, 10 were selected for experimental purposes on the basis of reaction intensity to stimulation, size of the proctodeal foam gland, and ejaculation speed. Males were kept individually in cages (32 x 44 x 24 cm) and 5 females that served for male stimulation were kept in a group cage (60 x 45 x 48 cm). The applied method of seme...

  18. Selenium in pig nutrition and reproduction: boars and semen quality-a review.

    Science.gov (United States)

    Surai, Peter F; Fisinin, Vladimir I

    2015-05-01

    Selenium plays an important role in boar nutrition via participating in selenoprotein synthesis. It seems likely that selenoproteins are central for antioxidant system regulation in the body. Se-dependent enzyme glutathione peroxidase (GSH-Px) is the most studied selenoprotein in swine production. However, roles of other selenoproteins in boar semen production and maintenance of semen quality also need to be studied. Boar semen is characterised by a high proportion of easily oxidized long chain polyunsaturated fatty acids and requires an effective antioxidant defense. The requirement of swine for selenium varies depending on many environmental and other conditions and, in general, is considered to be 0.15 to 0.30 mg/kg feed. It seems likely that reproducing sows and boars are especially sensitive to Se deficiency, and meeting their requirements is an important challenge for pig nutritionists. In fact, in many countries there are legal limits as to how much Se may be included into the diet and this restricts flexibility in terms of addressing the Se needs of the developing and reproducing swine. The analysis of data of various boar trials with different Se sources indicates that in some cases when background Se levels were low, there were advantages of Se dietary supplementation. It is necessary to take into account that only an optimal Se status of animals is associated with the best antioxidant protection and could have positive effects on boar semen production and its quality. However, in many cases, background Se levels were not determined and therefore, it is difficult to judge if the basic diets were deficient in Se. It can also be suggested that, because of higher efficacy of assimilation from the diet, and possibilities of building Se reserves in the body, organic selenium in the form of selenomethionine (SeMet) provided by a range of products, including Se-Yeast and SeMet preparations is an important source of Se to better meet the needs of modern pig genotypes in commercial conditions of intensive pig production. PMID:25924964

  19. Expanding the dairy herd in pasture-based systems: the role for sexed semen use on virgin heifers.

    Science.gov (United States)

    Hutchinson, I A; Shalloo, L; Butler, S T

    2013-02-01

    A model was developed to examine the effects of sexed semen use on replacement heifer numbers and rate of herd expansion in a seasonal dairy production system. Three separate herds were established according to the type of semen used on virgin heifers: conventional frozen-thawed (Conv), sexed fresh (SFre), or sexed frozen-thawed (SFro). In the model, sexed semen was used for the first and second inseminations in heifers only. Pregnancy rates achieved with sexed fresh and sexed frozen-thawed semen were assumed to be 94% and 75% of those achieved with conventional frozen-thawed semen, respectively. Initial herd size was 100 cows, which was maintained for the first 2 yr of the 15-yr simulation, after which all available replacement heifers were retained to facilitate herd expansion. Two different scenarios of land availability (S1 and S2) were examined for each of the 3 herds using different semen types: land available allowed expansion to a maximum herd size of 150 cows (S1) or 300 cows (S2). Once maximum herd size was reached, sexed semen use was discontinued and all excess heifer calves were sold at 1 mo of age. All capital expenditure associated with expansion was financed with a 15-yr loan. Each of the different options was evaluated in terms of annual farm profit, annual cash flow, and total discounted net profit. The analysis was completed at a milk price of € 0.27/L, and sensitivity around milk price was carried out at € 0.22/L and € 0.32/L. The use of SFre generated more replacement heifers and thus faster herd expansion compared with SFro and Conv semen. Maximum herd size was reached in yr 5, 6, and 7 under S1, and in yr 10, 12, and 14 under S2 for SFre, SFro, and Conv herds, respectively. Total discounted net profit under S1 for the SFre herd was € 19,929 greater than that of the SFro herd and € 41,852 greater than that of the Conv herd. Under S2, discounted net profit for the SFre herd was € 138,587 greater than that of the SFro herd and € 239,987 greater than that of the Conv herd. All 3 herds suffered negative cash flows for extended periods under both S1 and S2 at the lower milk price of € 0.22/L, although cash flows were most negative in the SFre herd. The use of sexed semen, in particular fresh sexed semen, in dairy heifers facilitates faster and more profitable expansion compared with the use of conventional frozen-thawed semen. Financial pressures caused by low milk price were greatest when the rate of expansion was highest. PMID:23200471

  20. Analysis and differentiation of seminal plasma via polarized SERS spectroscopy

    Science.gov (United States)

    Chen, Xiwen; Huang, Zufang; Feng, Shangyuan; Chen, Jinhua; Wang, Lan; Lu, Peng; Zeng, Haishan; Chen, Rong

    2012-01-01

    Polarized surface-enhanced Raman scattering (SERS) spectroscopy was applied for obtaining biochemical information about the seminal plasma. The effect of different laser polarizations (nonpolarized, linear-polarized, right-handed circularly polarized, and left-handed circularly polarized) on seminal plasma SERS spectroscopy was explored for the first time. The diagnostic performance in differentiating abnormal seminal plasma (n = 37) from normal seminal plasma (n = 24) was evaluated. A combination of principal component analysis (PCA) and linear discriminant analysis (LDA) was employed to develop diagnostic algorithms. Classification results of different laser polarizations demonstrated different diagnostic sensitivities and specificities, among which, left-handed circularly polarized laser excitation showed the best diagnostic result (95.8% sensitivity and 64.9% specificity). Our exploratory study demonstrated that SERS spectroscopy with left-handed circularly polarized laser excitation has the potential for becoming a new diagnostic method in semen-quality assessment. PMID:23269870

  1. INDUCCIÓN IN VITRO DE LA REACCIÓN ACROSÓMICA CON HEPARINA EN SEMEN CONGELADO DE TOROS BRAHMAN Y GYR / IN VITRO INDUCTION wITH HEPARIN OF ACROSOME REACTION IN FROZEN BRAHMAN AND GYR BULLS SEMEN

    Scientific Electronic Library Online (English)

    José, Montes; María, Torres; Clara, Rugeles; Roberto, Almanza; José, Guimarães.

    2012-12-30

    Full Text Available El objetivo de este trabajo fue evaluar la respuesta del semen congelado-descongelado de toros Brahman y Gyr a la inducción de la reacción acrosómica in vitro con heparina y su uso como prueba complementaria, para predecir la fertilidad del semen congelado-descongelado. Fueron usados siete toros ceb [...] uínos (4 Brahman y 3 Gyr), sexualmente maduros. En la evaluación seminal posdescongelación, se evaluó la Motilidad Progresiva Individual Rápida (MPIR), Anormalidades Primarias (AP), Anormalidades Secundarias (AS), Anormalidades Totales (AT) y porcentaje de inducción de la Reacción Acrosómica (RA). La RA fue determinada sobre extendidos con eosina-nigrosina, mediante microscopía óptica a 100X. No hubo diferencia entre las dosis seminales de ambas razas para la MPIR, morfología espermática y RA (p > 0.05), con excepción de las AP, donde la raza Brahman evidenció menor porcentaje de defectos que la raza Gyr (p Abstract in english The aim of this study was to value the in vitro induction by heparin of acrosome reaction in frozen semen from 0.05). No correlation was observed between semen quality [...] assessment (MPIR, AS, AP, AT and RA) and the non-return rate of the bulls (p

  2. Kajian Aspek Teknis Dan Aspek Ekonomis Proyek Packing Plant PT. Semen Indonesia Di Banjarmasin

    Directory of Open Access Journals (Sweden)

    Diyah Tri Sulistyorini

    2014-09-01

    Full Text Available Pembangunan Packing Plant PT. Semen Indonesia di wilayah Banjarmasinmemunculkan serangkaian pertanyaan penting diantaranya dimana lokasi yang akan dibangun, berapa kapasitas silo semen yang akan dibangun, kapan akan dibangun, sumber pendanaan dari mana yang akan digunakan dan apakah pembangunan Packing Plant akan menguntungkan. Semua pertanyaan itu perlu dikaji terlebih dahulu.Penelitian ini bertujuan untuk mengevaluasi kelayakan dibangunnya Packing Plant Banjarmasin baik dari segi teknik maupun ekonomis. Kajian aspek teknis memaparkan kelayakan proyek dari segi peraturan daerah setempat yaitu persyaratan wilayah darat dan wilayah perairan. Persyaratan wilayah darat meliputi kondisi tanah, bangunan, daerah hijau dan persyaratan lainnya. Persyaratan wilayah perairan meliputi kondisi sedimentasi, pasang surut sungai, alur pelayaran, karakteristik kapal dan persyaratan lainnya. Kajian aspek ekonomis memaparkan kelayakan proyek dari segi efisiensi biaya transportasi dibandingkan dengan biaya investasi proyek. Dari segi teknis, perencanaan pembangunan proyek ini memenuhi syarat zoning yang ditetapkan.Dari segi ekonomis, harapan mendapatkan efisiensi biaya transportasi terpenuhi.Berdasarkan hasil perhitungan efisiensi biaya transportasi antara kondisi existing dan rencana didapatkan efisiensi biaya transportasi sebesar Rp. 17.990.676.595. Namun apabila dibandingkan dengan biaya investasi sebesar Rp. 148.733.861,14 efisiensi biaya transportasi tersebut masih terlalu kecil.

  3. Physical activity and television watching in relation to semen quality in young men

    DEFF Research Database (Denmark)

    Gaskins, Audrey Jane; Mendiola, Jaime

    2015-01-01

    BACKGROUND: Semen quality appears to have declined over the past decades but reasons for this decline are unresolved. The concurrent increase in sedentary behaviour may be a contributing factor. The objective of this study was to evaluate the relationship of physical activity and television (TV) watching with sperm parameters in a population of young, healthy men. METHODS: Men aged 18-22 years (n=189) from the Rochester Young Men's Study (2009-2010) participated in this analysis. Physical activity (h/week of moderate and vigorous exercise) and TV watching (h/week of TV, video or DVD watching) over the past 3 months were assessed via questionnaire. Semen quality was assessed by sperm concentration, motility, morphology and total sperm count. RESULTS: Sperm concentration and total sperm count were directly related to physical activity after multivariable adjustment (p-trend=0.01 and 0.04); men in the highest quartile of moderate-to-vigorous activity (?15 h/week) had 73% (95% CI 15% to 160%) higher sperm concentration than men in the lowest quartile (20 h/week) had 44% (95% CI 15 to 63%) lower sperm concentration than men in the lowest quartile (0 h/week). These measures of physical and leisure time activities were not significantly associated with sperm motility or morphology. CONCLUSIONS: In this population of healthy men, higher moderate-to-vigorous activity and less TV watching were significantly associated with higher total sperm count and sperm concentration.

  4. Kualitas Semen Cair Asal Epididimis Kerbau Belang dalam Bahan Pengencer Andromed yang Mendapat Penambahan Sukrosa

    Directory of Open Access Journals (Sweden)

    M. Rizal

    2009-08-01

    Full Text Available The aim of this research was to observe the quality of spotted buffalo epididymal sperm after storage at 4 °C as liquid semen for 12 and 24 hours in andromed containing sucrose 0.2% and 0.4%. Sperm was collected from epididymal tissues by combination of slicing and pressing methods. The parameters observed were the percentage of progressive motility and live sperm. The results showed that the percentage of progressive motility of the liquid semen after storage for 12 hours in andromed (A, andromed + sucrose 0.2% (P1 and andromed + sucrose 0.4% (P2 were 48.33%; 53.33% and 55% (P>0.05, respectively. In addition, the percentage of motility after 24 hours of storage in those extenders were 45%; 46.67% and 46.67% (P>0.05, respectively. The percentage of live sperm in A, P1 and P2 after 12 hours of storage were 70.33%; 73% and 73.33% while after 24 hours of storage, the percentage of live sperm in those extenders were 66.33%; 68.67% and 69.67%, respectively. In conclusion, the addition of 0.2% and 0.4% sucrose in andromed extender could maintain the quality of the spotted buffalo epididymal sperm after storage for 12 and 24 hours at 4 °C.

  5. Caffeine intake and semen quality in a population of 2,554 young Danish men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Swan, Shanna H

    2010-01-01

    The authors examined the association between semen quality and caffeine intake among 2,554 young Danish men recruited when they were examined to determine their fitness for military service in 2001-2005. The men delivered a semen sample and answered a questionnaire including information about caffeine intake from various sources, from which total caffeine intake was calculated. Moderate caffeine and cola intakes (101-800 mg/day and 14 0.5-L bottles/week) and/or caffeine (>800 mg/day) intake was associated with reduced sperm concentration and total sperm count, although only significant for cola. High-intake cola drinkers had an adjusted sperm concentration and total sperm count of 40 mill/mL (95% confidence interval (CI): 32, 51) and 121 mill (95% CI: 92, 160), respectively, compared with 56 mill/mL (95% CI: 50, 64) and 181 mill (95% CI: 156, 210) in non-cola-drinkers, which could not be attributed to the caffeine they consumed because it was

  6. Study upon the Moment of Ovulation in Sows to Establish the Optimum Moment for Semen Inoculation

    Directory of Open Access Journals (Sweden)

    Mariana Sandu

    2012-05-01

    Full Text Available Efficiency of artificial insemination depends equaly by semen quality and time of inoculation. The optimal time for inoculation was calculated usually from the moment of detection of heat, for double insemination, so that one of the two inoculations to approach the time of ovulation. To increase the efficiency of boars exploitation is necesary to change the method to a single insemination. To ensure normal fertility parameters with only one inoculation it is necessary to chose with great precision the moment of insemination ,in order to ensure the time for sperm capacitation and penetration of viable oocytes. Starting from the fact that major events such as forrowing and death occur, according to the circadian rhythm, in the second half of the night, this study aims to detect from this point of view the moment of ovulation, to find a more reliable calculation for the time of semen inoculation. The experiments were conducted on puberal gilts, which were not treated for induction of ovulation; the control for detecting the follicular dehiscence was done only on physiological oestrus. Females having symptoms at heat control were subject to series of laparatomias, complete with collection and examination of oocytes.

  7. Repro-sexual intersections: sperm donation, HIV prevention and the public interest in semen.

    Science.gov (United States)

    Pralat, Robert

    2015-03-01

    In the scientific literature on fertility and assisted reproduction, and in the corresponding area of clinical practice, increasing attention has been paid to two groups: people living with the human immunodeficiency virus (HIV) and gay men. However, research on fertility in the context of HIV focuses almost exclusively on heterosexual couples, whereas studies on non-heterosexual reproduction rarely mention HIV, despite the fact that, in many western countries, HIV prevalence among men who have sex with men is higher than ever before and men who have sex with men are the only group in which new HIV infections are on the rise. This review identifies links between reproduction, HIV and homosexuality, showing that, historically, they are closely intertwined, which has important implications for current issues facing HIV care and fertility services. Considering sex and parenthood as two different but related kinds of intimacy and kinship, the dual role semen plays in sexually transmitted infection and in assisted reproduction is discussed. The review reflects on the future of sperm donation and HIV prevention, asking whether two challenges that potentially face healthcare and medicine today - the shortage of 'high-quality' sperm and the 'surplus' of infected semen - could be addressed by a greater exchange of knowledge. PMID:25530032

  8. Semen Hoveniae extract protects against acute alcohol-induced liver injury in mice.

    Science.gov (United States)

    Du, Jian; He, Da; Sun, Lian-Na; Han, Ting; Zhang, Hong; Qin, Lu-Ping; Rahman, Khalid

    2010-08-01

    The protective effects of Semen Hoveniae extract (SHE) from Hovenia dulcis Thunb. (Rhamnaceae) on acute alcohol-induced liver injury were investigated in vivo using mice as test models. In the present study, SHE (150, 300, 600 mg/kg/day) was given to mice by intragastric administration for 4 days. Mice were gavaged with 60% ethanol 10 mL/kg after the last dose of extract. Six hours after alcohol administration, liver injury was evaluated by biochemical examination. Lipid peroxidation and the activity of antioxidants were measured by spectrophotometric methods. In mice, administration of SHE significantly decreased the activities of alanine aminotransferase (ALT) and aspartate transaminase (AST) in serum. Administration of SHE also protected against alcohol-induced alcohol dehydrogenase (ADH) elevation in mice. Concurrently, there was an augmentation in the activities of antioxidant enzymes such as superoxide dismutase (SOD), glutathione S-transferase (GST), and glutathione (GSH), and it also facilitated alcohol metabolism. Acute toxicity tests showed that a single dose of oral SHE up to 22 g/kg did not result in any death or toxic side effects in mice during 14 days' observation. These results demonstrate that SHE could protect against acute alcohol-induced liver injury without any toxic side effects. Therefore, Semen Hoveniae has potential for the development of a clinically useful agent which could protect the liver from alcohol-induced injury. PMID:20673184

  9. Anti-gastritis and wound healing effects of Momordicae Semen extract and its active component.

    Science.gov (United States)

    Jung, Kiwon; Chin, Young-Won; Chung, Yoon Hee; Park, Yang Hae; Yoo, Hunseung; Min, Dong Sun; Lee, Bongyong; Kim, Jinwoong

    2013-02-01

    Momordicae Semen, Momordica cochinchinensis Springer (Cucurbitaceae), has long been known to effectively relieve boils, rheumatic pain, and hemorrhoids. In this study, we investigated whether Momordicae Semen extract (MSE) has anti-gastritis effects in various rodent models and also explored possible mechanisms for the gastroprotective effects of MSE. MSE provided remarkable protective effects, comparable to those of rebamipide, in ethanol- and diclofenac-induced acute gastritis. In addition, it has demonstrated protective effect in a Helicobacter pylori-insulted chronic gastritis model. MSE also showed wound healing effect on cutaneous injury of mice and stimulated calcitonin gene-related peptide and somatostatin receptors, which may be related to its anti-gastritis effects. In a single oral dose toxicity study, the approximate lethal dose of MSE was determined at >2000?mg/kg/day. The NOAEL was set to be 2000?mg/kg/day from the repeated oral dose toxicity study. Moreover, momordica saponin I, a major ingredient of MSE, treatment decreased gastric mucosa damage indices in the ethanol- and diclofenac-induced acute gastritis models. The results suggest that MSE could be a promising gastroprotective herbal medicine and momordica saponin I might be used as an active marker compound for MSE. PMID:22889079

  10. EFFECTS OF BREED, SPERMATOZOA CONCENTRATION, AND STORAGE ON PROGRESSIVE MOTILITY OF EXTENDED BOAR SEMEN

    Directory of Open Access Journals (Sweden)

    Aleksandar Boži?

    2011-12-01

    Full Text Available The classic technology of artificial insemination (AI often requires insemination doses to be kept for more than 24 hours, with a requirement that the degree of progressive motility at the moment of insemination not be below 65%. The aim of this paper was to determine the influence of breed, spermatozoa concentration, and storage time on the fertilization capacity of extended semen from native ejaculates of boars. The research included the following boar breeds: Duroc (n=34, Hampshire (n=30, Large White (n=42 and Swedish Landrace (n=32, from large pig farms in Vojvodina (Republic of Serbia. Two ejaculates were collected from each boar once monthly for 12 months (a total of 24 ejaculates per boar. There was statistically significant (p<0.01 influence of breed on the number of spermatozoa samples that maintained ? 65% progressive motility during 48 hours of storage in 1:4 dilution. There was also an influence of spermatozoa concentration on progressive motility. As spermatozoa concentration increased during storage, ? 65% progressive motility declined (P?0.01 within 24 hours. The results show that it is necessary to determine the adequate dilution rate and storage time for each ejaculate, while taking into account spermatozoa concentration in the native semen.

  11. Insulin addition to swine semen diluted and cooled at 15 ºC

    Scientific Electronic Library Online (English)

    Evandro César Pereira, Cunha; Márcio Gilberto, Zangeronimo; Luis David Solis, Murgas; Douglas Evangelista, Braga; Bárbara Azevedo, Pereira; Luiz Gustavo Pessoa, Rocha; Bruno Generoso, Faria; Luciano José, Pereira.

    2012-04-01

    Full Text Available The objective of this study was to evaluate the effect of adding different doses of insulin to swine semen processed and stored at 15 ºC. The experiment used sixteen ejaculates from four commercial breeding pigs, distributed in a randomized block design (ejaculate) with split plot along time (0, 24, [...] 48 and 72 hours of storage) with four treatments (insulin levels - 0.0 4.0 8.0 and 12.0 IU per dose) and 16 repetitions. The experimental unit was made of two insemination doses of 100 mL each, with 3×10(9) spermatozoids. Insulin used was NPH-human, added at the time of processing the doses. The addition of insulin did not affect motility, sperm viability, the percentage of abnormal cells, the osmotic resistance or the degradation rate of motility in 120 minutes. There was a linear decrease in semen quality over storage time, regardless of insulin levels. The addition of insulin at the mentioned concentrations does not influence the quality of insemination dose in pigs.

  12. Insulin addition to swine semen diluted and cooled at 15 ºC

    Directory of Open Access Journals (Sweden)

    Evandro César Pereira Cunha

    2012-04-01

    Full Text Available The objective of this study was to evaluate the effect of adding different doses of insulin to swine semen processed and stored at 15 ºC. The experiment used sixteen ejaculates from four commercial breeding pigs, distributed in a randomized block design (ejaculate with split plot along time (0, 24, 48 and 72 hours of storage with four treatments (insulin levels - 0.0 4.0 8.0 and 12.0 IU per dose and 16 repetitions. The experimental unit was made of two insemination doses of 100 mL each, with 3×10(9 spermatozoids. Insulin used was NPH-human, added at the time of processing the doses. The addition of insulin did not affect motility, sperm viability, the percentage of abnormal cells, the osmotic resistance or the degradation rate of motility in 120 minutes. There was a linear decrease in semen quality over storage time, regardless of insulin levels. The addition of insulin at the mentioned concentrations does not influence the quality of insemination dose in pigs.

  13. Prevalence of mycoplasmas in the semen and vaginal swabs of Danish stallions and mares

    DEFF Research Database (Denmark)

    Baczynska, Agata; Fedder, J

    2007-01-01

    The reproduction rate of horses is one of the lowest within domestic livestock despite advances the veterinary medicine. Infertility in horses may be due mainly to the lack of suitable selection criteria in the breeding of horses. However, acquired infertility due to genital, bacterial infections may occur. Mycoplasmas have been implicated in genital disorders and infertility of many species including humans and horses. However, their role as commensals or pathogens of the genital tract of horses is still not determined. Bacteriological examinations made on the fossa glandis, urethra, penis and semen of stallions, showed the presence of different Mycoplasma species. Therefore our study aimed to find the prevalence of Mycoplasma species and a possible association with fertility problems in Danish riding horses. Eighty semen samples from stallions and 19 vaginal swab samples from mares were tested by PCR for presence of mycoplasmal DNA. The vaginal swab samples were also cultured in the Mycoplasma specific medium. None of the samples were positive for presence of genital mycoplasmas during the screen. The lack of genital mycoplasmas observed in this study may be due to a very extensive use of artificial insemination of modern sport horses.

  14. Evaluación de dimetilacetamida como crioprotector para la crioconservación de semen de bocachico Prochilodus magdalenae / Evaluation of dimethylacetamide as cryoprotectant for cryopreservation of sperm of bocachico Prochilodus magdalenae

    Scientific Electronic Library Online (English)

    VJ, Atencio; EJ, Perez; JA, Espinosa; SC, Pardo.

    Full Text Available Se evaluó dimetilacetamida (DMA) como crioprotector, a tres concentraciones: 8% (0,85 M), 10% (1,07 M) y 12% (1,29 M) combinado con glucosa 6% (0.33 M) y yema de huevo 12% para crioconservar semen de bocachico Prochilodus magdalenae. El semen fue diluido en proporción 1:4 en la solución crioprotecto [...] ra, empacado en pajuelas de 2,5 mL y congelado en vapores de nitrógeno líquido (N2L) durante 30 minutos y luego almacenados en un termo de N2L de 34 L. La concentración, movilidad total, progresividad y velocidad tanto en semen fresco (control) como en semen crioconservado-descongelado se evaluó con ayuda de Sperm Class Analyzer (SCA). Las pajuelas fueron descongeladas en baño serológico a 60°C durante 45 segundos. La fertilidad y eclosión fueron evaluadas inseminando dos gramos de huevos (1540 huevos/g) a razón de 320.000 spz/ovocito. El semen fresco registró mayores valores de movilidad total, progresividad total, velocidad curvilínea y velocidad lineal con respecto al semen crioconservado-descongelado (P 0,05). DMA 12% reportó los menores valores de todas las variables que evaluaron la calidad seminal. Con semen fresco se obtuvo fertilidad de 74,0 ± 5,3% y eclosión de 62,3 ± 3,1%; mientras que con semen crioconservado-descongelado con DMA 8% se obtuvo adecuada fertilidad (60,4 ± 8,4%) y eclosión (50,1 ± 9,8%). Los resultados del estudio sugieren que la solución crioprotectora compuesta por DMA 8%, glucosa 6% y yema de huevo 12% es una alternativa viable para la crioconservación de semen de bocachico. Abstract in english The aim of this study was to e valuate the performance of dimethylacetamide (DMA) as cryoprotectant at three concentrations: 8% (0.85 M), 10% (1.07 M) and 12% (1.29 M), combined with glucose at 6% (0.33 M) and egg yolk at 12%, to cryopreserve semen of bocachico Prochilodus magdalenae. The semen was [...] diluted at 1:4 ratio in the cryoprotective solution, packed in 2.5 mL straws and frozen in liquid nitrogen vapor (LN2) for 30 minutes, then it was stored in a container with LN2 of 34 L. The concentration, total motility, progressive motility and sperm speed in both fresh (control) and cryopreserved-thawed semen were evaluated using Sperm Class Analyzer (SCA). Straws were thawed in serological bath at 60°C for 45 seconds. Fertility and hatching were evaluated inseminating 2 g of eggs (1,540 eggs/g) at a rate of 320,000 spz/egg. Fresh semen recorded the highest values of total motility, total progressive, curvilinear speed and linear speed with regard to cryopreserved-thawed semen (P 0.05). DMA 12% reported the lowest values of all the variables evaluating semen quality. Fresh semen obtained values of 74.0 ± 5.3% and 62.3 ± 3.1% for fertility and hatching, respectively, while cryopreserved-thawed semen with DMA at 8% produced adequate fertility (60.4 ± 8.4%) and hatching (50.1 ± 9.8%) values. The results of this study suggest that the cryoprotectant solution composed of DMA at 8%, glucose at 6% and egg yolk at 12% is a viable alternative for the cryopreservation of semen of bocachico.

  15. Toxoplasma gondii in semen of experimentally infected swine / Toxoplasma gondii no sêmen de suínos experimentalmente infectados

    Scientific Electronic Library Online (English)

    Anderson B., Moura; Alvimar J., Costa; Sérgio, Jordão Filho; Beatriz B., Paim; Fernanda R., Pinto; Daniela C., Di Mauro.

    2007-10-01

    Full Text Available Oito reprodutores suínos foram divididos em três grupos e inoculados com Toxoplasma gondii [GI (n=3) 1.5x10(4) oocistos cepa P; GII (n=3) 1.0x10(6) taquizoítos cepa RH, e GIII (n=2) controle, não inoculados]. Exames clínicos, hematológicos, de parasitemia e sorológicos foram realizados para avaliar [...] a infecção toxoplásmica. Pesquisa do parasito no sêmen, por meio do bioensaio e pela técnica da PCR, e em órgãos do sistema reprodutor (bioensaio e imunohistoquímica) foi realizada. Sangue e sêmen foram colhidos nos dias -2, -1, 1, 3, 5, 7, 9, 11, 14, e semanalmente até o 84º dia pós-infecção (DPI). Nenhuma alteração clínica ou hematimétrica foi observadda nos animais. Parasitemia foi detectada em um animal inoculado com oocistos no 7º DPI e em outro inoculado com taquizoítos (GII) nos 3º e 49º DPI. A sorologia revelou a presença de anticorpos contra T. gondii nos animais inoculados com oocistos ou taquizoítos no 7º DPI com títulos de 1:256 e 1:64, que atingiram picos de 1:4096 nos dias 11 e 9, respectivamente. O bioensaio revelou a presença do parasita em amostras seminais de um animal inoculado com oocistos (GI) nos 3º, 49º e 56º DPI, e de dois animais infectados com taquizoítos (GII), um deles no 5º DPI e os dois ao 49º DPI. Pela PCR, o DNA de T. gondii foi detectado no sêmen dos Suínos 1 e 3 inoculados com taquizoítos e oocistos, respectivamente. A imunohistoquímica revelou T. gondii em órgão do aparelho reprodutor dos Suínos 1 e 2, inoculados com taquizoítos e oocistos, respectivamente. Esses achados sugerem a possibilidade da ocorrência da transmissão venérea do T. gondii em suínos. Abstract in english Eight reproductive boars were divided into three groups and inoculated with Toxoplasma gondii [GI (n=3) 1.5x10(4) oocysts strain P; GII (n=3) 1.0x10(6) tachyzoites strain RH; and GIII (n=2) non-inoculated control]. Clinical, hematological, parasitemia and serological tests and studies of the parasit [...] e in the semen through bioassay and PCR, and in reproductive organs (Bioassay and immunohistochemical analyses) were conducted to evaluate the toxoplasmic infection. Blood and semen were collected on day -2, -1, 1, 3, 5, 7, 9, 11, 14 and weekly up to 84 days post-inoculation (DPI). No clinical or hematimetric alteration was observed in the boars. Parasitemia was detected in one boar inoculated with oocysts at the 7th DPI and in another boar infected with tachyzoites (GII) at the 3rd and 49th DPI. Serological tests revealed antibodies against T. gondii in animals inoculated with oocysts or tachyzoites at the 7th DPI with dilutions of 1:256 and 1:64, which reached peaks of 1:4096 at day 11 and 9, respectively. The bioassays revealed the presence of the parasite in semen samples of a boar inoculated with oocysts (GI) at 3, 49 and 56 DPI and from two boars infected with tachyzoites (GII), one animal at 5 and two animals at 49 days DPI. Mice inoculated with semen from the control group (GIII) remained serologically negative. PCR analysis showed T. gondii DNA in the semen of Boar 1 and Boar 3 inoculated with tachyzoites and oocysts, respectively. The immuno-histochemical tests showed T. gondii in the reproductive organs of Boar 1 and Boar 2, inoculated with tachyzoites and oocysts, respectively. These findings suggest the possible occurrence of venereal transmission of T. gondii in swine.

  16. Consideraciones prácticas acerca de la calidad del semen de conejos aplicado en estudios de toxicología de la fertilidad (Practice considerations about the semen quality of rabbits for applied in fertility toxicology study.

    Directory of Open Access Journals (Sweden)

    Arencibia Arrebola Daniel Francisco

    2009-08-01

    Full Text Available ResumenEl conejo doméstico es un descendiente del conejo salvaje que habitaba en el oeste de Europa y en el noroeste de África. En los estudios de toxicología experimental se destaca su uso en la determinación de toxicidad por irritación dérmica, ocular, toxicología de vacunas, además de ser básico como modelo animal para determinar compuestos teratogénicos, los cuales influyen tanto en la fertilidad de la hembra como en la del macho. Los métodos para la valoración de la calidad del semen, tanto para la inseminación artificial como en la investigación, están sufriendo un constante desarrollo para intentar estimar con mayor precisión la fertilidadde los machos. Desafortunadamente, las valoraciones de laboratorio nopredicen con exactitud la fertilidad y tampoco se obtiene una repetitividad de unos análisis a otros, debido a la subjetividad de muchas de dichas valoraciones. El objetivo de este trabajo es la confección de una guía teórico-práctica que permita realizar estudios del semen en conejos de la raza Nueva Zelanda Blanca, aplicado a la temática de toxicología de la fertilidad. Trataremos los temas de inducción del celo en las hembras, condiciones y método para la extracción del semen, pruebas macroscópicas y microscópicas del semen, valoración del peso de órganos y examen anatomopatológico. Todas las pruebas descritas aportan datos que nosindicarán una disminución de la calidad del semen, pero debemos realizar valoraciones que nos aporten sencillez, rapidez y que sean económicamente viables; para ello cada investigador debe utilizar aquellas que mejor se adapten a sus condiciones de trabajo.SummaryThe domestic rabbit is descendend from the wilds rabbits was to inhabited of western Europe and Northwestern Africa. The rabbits is very usefull in the experimental Toxicology study, in dermal irritation, ocular irritation and the vaccines Toxicology, beside is a basic animal models in teratogenicity evaluation of the pharmaceutics products, that its influence in the female and male fertility. The methods of semen quality valuation in artificialinsemination and research were suffering a constant development toestimate with more precision the males fertility. Unfortunately, thelaboratory valuations don't predict with accuracy the fertility and not obtained the repetitive of some analyses to other, because of thesubjectivity of many valuations. The objective of this work is the making of a theoretical-practice guide that allows to carry out studies of the semen in rabbits, (New Zealand White breed, applied to the fertility toxicology thematic. We will treat the topics of the zeal induction in the females, conditions and method for the semen extraction, macroscopic and microscopic semen tests, organs weight valuation and anatomopatologic exam. All the described tests contribute data that will indicate a decrease of the semen quality, but we should carry out valuations that contribute simplicity, speed and they are economically viable; the researcher should be use the best option for his work conditions.

  17. Toxoplasma gondii in experimentally infected Bos taurus and Bos indicus semen and tissues / Toxoplasma gondii em semen e tecidos de Bos taurus and Bos indicus experimentalmente infectados

    Scientific Electronic Library Online (English)

    Leslie, Scarpelli; Welber Daniel Zanetti, Lopes; Matheus, Migani; Katia Denise Saraiva, Bresciani; Alvimar José da, Costa.

    2009-01-01

    Full Text Available Dezoito bovinos foram inoculados com Toxoplasma gondii e distribuídos aleatoriamente em três grupos de seis bovinos cada: GI (2,5x10(5) oocistos da cepa "P"), GII (5,0x10(6) taquizoítos da cepa "RH") e GIII (controle). Exames clínicos, sorológicos e parasitêmicos foram realizados. Pesquisas do paras [...] ito, por meio da bioprova e pela técnica de Reação em Cadeia pela Polimerase (PCR), foram realizadas no sêmen e em fragmentos de musculatura esquelética, linfonodos, cérebro, retina, baço, fígado, pulmão, testículo, epidídimo e vesícula seminal. Amostras de sangue e sêmen foram colhidas nos dias -2, -1, 1, 3, 5, 7, 14 e, semanalmente, até o 84º dia pós-infecção (DPI). Os bovinos inoculados (GI e GII) apresentaram hipertermia do 3º ao 16º DPI. Anticorpos contra T. gondii foram detectados (IFI) no 5º DPI (1:16), em ambos grupos inoculados (oocistos e taquizoítos), atingindo picos de 1:4096 no 7º DPI. Surtos parasitêmicos ocorreram em todos os bovinos infectados, principalmente do 7º ao 28º DPI, independente da cepa e inóculo utilizados. O bioensaio revelou a presença do parasito em amostras seminais dos bovinos infectados com oocistos (GI) e taquizoítos (GII), em diversas datas experimentais, entre o 7º e 84º DPI. Parasitismo tissular por T. gondii foi diagnosticado por meio da bioprova e pela técnica da PCR, em vários fragmentos de tecidos e/ou órgãos. Os achados sugerem a possibilidade da ocorrência da transmissão sexual do T. gondii na espécie bovina. Abstract in english Eighteen young steers were inoculated with Toxoplasma gondii and randomly distributed into three groups of six animals each: GI, 2.5x10(5) "P" strain oocysts, GII, 5.0x10(6) "RH" strain tachyzoites, and GIII (Control). Clinical, serological and parasitemia exams were realized. Parasite investigation [...] by bioassay and PCR was realized on semen and fragments of skeletal musculature, lymph nodes, brain, retina, spleen, liver, lung, testicle, epididymis and seminal vesicle. Blood and semen samples were collected on days -2, -1, 1, 3, 5, 7, 14 and weekly thereafter, up to postinfection day (PID) 84. The inoculated steers (GI and GII) presented hyperthermia from PID 3 to 16. Antibodies against T. gondii were detected through the indirect fluorescence antibody test (IFAT) on PID 5 (1:16) in both inoculated groups (oocysts and tachyzoites), reaching peaks of 1:4096 on PID 7. Parasitemia outbursts occurred in all infected bovines, principally from PID 7 to 28, independent of the strain and inoculate used. Bioassays revealed the presence of parasites in semen samples of animals infected with oocysts (GI) and tachyzoites (GII) on several experimental days between PID 7 and 84. Tissue parasitism by T. gondii was diagnosed by bioassay and the PCR technique in several organ and tissue fragments. These findings suggest the possibility of sexual transmission of T. gondii in the bovine species.

  18. Digital image analysis of testicular and prostatic ultrasonographic echogencity and heterogeneity in dogs and the relation to semen quality.

    Science.gov (United States)

    Moxon, Rachel; Bright, Lucy; Pritchard, Beth; Bowen, I Mark; de Souza, Mírley Barbosa; da Silva, Lúcia Daniel Machado; England, Gary C W

    2015-09-01

    A semi-automated ultrasonographic method was developed to measure echogenicity and heterogeneity of the testes and prostate gland and relationships of these measures with semen quality were assessed in 43 fertile dogs. The relationship between animal age and body weight upon the volume of the testes, epididymal tail volume and prostate volume were also established. Mean testicular echogenicity was negatively correlated with the percentage of morphologically normal live spermatozoa (more echogenic testes were associated with fewer normal sperm) but not with any other semen quality measure. Mean testicular heterogeneity was positively correlated with the total spermatozoal output (more heterogenous testes, being those with anechoic parenchyma and prominent echogenic stippling, were associated with greater sperm output) but not with any other semen quality measure. There was no relationship between either mean prostatic echogenicity or mean prostatic heterogeneity and any semen quality measure. There was no relationship between age and any testicular or prostatic parameter; however bodyweight was significantly correlated with total testicular volume, total epididymal tail volume and total prostatic volume. Testicular and prostatic ultrasonographic echogenicity and heterogeneity can be objectively assessed using digital image analysis and testicular echogenicity and heterogeneity may be useful adjunct measurements in a breeding soundness examination. PMID:26282522

  19. Sperm DNA fragmentation and morphological degeneration in chilled elephant (Elephas maximus and Loxodonta Africana) semen collected by transrectal massage.

    Science.gov (United States)

    O'Brien, J K; Steinman, K J; Montano, G A; Love, C C; Robeck, T R

    2013-05-01

    Ejaculates from nine Asian and two African elephants were analysed to gain a further understanding of mechanisms underlying variable semen quality after transrectal massage. Semen analysis was performed after collection (0 h; subjective motility parameters only) and after 24 h of chilled storage at 10 °C (24 h; all ejaculate and sperm characteristics). Ejaculates with ?50% total motility (TM) at 24 h, which represented >90% of collection attempts, contained a sperm population with a high degree of DNA damage (64.2 ± 19.2% fragmented DNA) and an elevated incidence of detached heads (43.3 ± 22.5%). In contrast, good quality ejaculates designated as those with >50% TM at 24 h displayed higher (p African bull) based on in vitro characteristics after chilled storage for up to 48 h post-collection. Urine contamination of semen, as assessed quantitatively by creatinine concentration, was confirmed as a significant factor in reduced elephant ejaculate quality. However, the identification of considerable DNA damage and morphological degeneration in the majority of ejaculates after only 24 h of chilled storage indicates that sperm ageing could be a primary contributor to inconsistent semen quality in the elephant. PMID:23536498

  20. Effect of argan oil on liquid storage of ram semen in Tris or skim milk based extenders.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Contell, Jesus; Louanjli, Noureddine; Moula, Anass Ben; Badi, Abdelmoughit; Essamadi, Abdelkhalid; Nasser, Boubker; El Amiri, Bouchra

    2015-09-01

    Due to its high antioxidant content, the argan oil could play a beneficial role in liquid storage of ram semen. The aim of this study was to investigate effects of different concentration of argan oil (ARO) on spermatologic parameters, lipid peroxidation and DNA fragmentation during liquid storage of ram semen until 48h. Also effects of extenders and temperature on same parameters were assessed. For these aims, semen samples were collected from Boujaâd rams, extended with Tris egg yolk or skim milk extenders without (control) or supplemented with different concentrations of ARO (1%, 2%, 5% and 10% v/v) at a final concentration of 0.8×10(9) sperm/mL and stored until 48h at 5°C or 15°C. The sperm quality assessments were performed at different intervals during storage (0, 8, 24 and 48h). Sperm progressive motility started to decrease after 8h of storage in all temperatures - extenders combinations and dropped steadily during the 8-48h interval. However, sperm viability, progressive motility and membrane integrity were markedly higher in ARO groups (especially in 1% in Tris and 5% in skim milk) until 24h and 48h storage at both temperatures compared to controls. The argan oil also decreased the level of spontaneous and induced malondialdehyde (MDA) and the sperm DNA fragmentation until 48h storage. In conclusion, it was determined that addition of argan oil to conventional extenders may improve the quality of ram semen during liquid storage in different temperatures. PMID:26235670

  1. Maternal alcohol consumption during pregnancy and semen quality in the male offspring: two decades of follow-up

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia; Toft, G; Jensen, M S; Strandberg-Larsen, Katrine; Hansen, M L; Olsen, J

    2010-01-01

    Concurrent alcohol exposure has been associated with reduced fecundity, but no studies have estimated the effect of prenatal alcohol exposure on male fecundity. The aim of this study was to investigate the association between maternal alcohol consumption during pregnancy, semen quality and levels of reproductive hormones in young, adult men.

  2. Effects of manganese on routine semen quality parameters: results from a population-based study in China

    Directory of Open Access Journals (Sweden)

    Li Yuyan

    2012-10-01

    Full Text Available Abstract Background Manganese (Mn is an essential element in humans but its effect on semen quality is unclear. This study therefore aimed to assess the effects of Mn on semen quality in healthy men with no occupational exposure to Mn. Methods Semen samples were obtained from healthy Chinese men 20–59 years old who were recruited from six provinces in China. Individuals with urogenital tract diseases, tuberculosis, or occupational exposure to heavy metals were excluded. A questionnaire survey was conducted, and the external genitalia, semen quality, and serum Mn levels were examined. Results A total of 1,179 volunteers were enrolled in this study. The median serum Mn concentration was 8.2 ?g/L (25th percentile (P25=3.7 ?g/L, P75=16.2?g/L. After adjusted area (six provinces, abstinence interval, season, registered residence, age of subjects, education level, income, smoking, and drinking, the risk of teratospermia was increased at serum Mn concentrations >19.40 ?g/L (P80 group, with an adjusted odds ratio of 2.27 (95% confidence interval: 1.18–4.37. Conclusion High serum Mn levels appeared to have harmful effects on sperm morphology and motility among healthy men with no occupational exposure to Mn.

  3. EPISODIC AIR POLLUTION IS ASSOCIATED WITH INCREASED DNA FRAGMENTATION IN HUMAN SPERM WITHOUT OTHER CHANGES IN SEMEN QUALITY

    Science.gov (United States)

    This study was motivated by a previous report of associations between episodes of high air pollution and alterations in semen quality in young men living in an industrial district of the Czech Republic. Using a repeated measures study design, a cohort of men from this district we...

  4. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  5. RECOVERY OF CAMPYLOBACTER JEJUNI IN FECES, CECA, AND SEMEN OF BROILER BREEDER ROOSTERS FOLLOWING THREE ROUTES OF INOCULATION

    Science.gov (United States)

    We reported the recovery of Campylobacter (naturally colonized) from the ductus deferens of 5 / 101 caged roosters (5%) at 65 wk-of-age, and four of those five positive roosters had previously produced Campylobacter positive semen samples. Those results prompted further evaluation to determine if i...

  6. Association of sleep disturbances with reduced semen quality : a cross-sectional study among 953 healthy young Danish men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Andersson, Anna-Maria

    2013-01-01

    Several studies have found an association between sleep duration and morbidity and mortality, but no previous studies have examined the association between sleep disturbances and semen quality. We conducted a cross-sectional study among 953 young Danish men from the general population who were recruited in Copenhagen at the time of determination of fitness for military service between January 2008 and June 2011. All of the men delivered a semen sample, had a blood sample drawn, underwent a physical examination, and answered a questionnaire including information about sleep disturbances. Sleep disturbances were assessed on the basis of a modified 4-item version of the Karolinska Sleep Questionnaire, which includes questions on sleep patterns during the past 4 weeks. Sleep disturbances showed an inverse U-shaped association with sperm concentration, total sperm count, percent motile and percent morphologically normal spermatozoa, and testis size. Men with a high level of sleep disturbance (score >50) had a 29% (95% confidence interval: 2, 48) lower adjusted sperm concentration and 1.6 (95% confidence interval: 0.3, 3.0) percentage points' fewer morphologically normal spermatozoa than men with a sleep score of 11-20. This appears to be the first study to find associations between sleep disturbances and semen quality. In future studies, investigators should attempt to elucidate mechanistic explanations and prospectively assess whether semen quality improves after interventions restoring a normal sleeping pattern.

  7. Analysis of volatile components in herbal pair Semen Persicae-Flos Carthami by GC-MS and chemometric resolution.

    Science.gov (United States)

    Fu, Jiangang; Li, Xiaoru; Lu, Hongmei; Liang, Yizeng

    2012-11-01

    Analysis of volatile components in herbal pair (HP) Semen Persicae-Flos Carthami (SP-FC) was performed by GC-MS coupled with chemometric resolution method (CRM). Furthermore, temperature-programmed retention indices were used together with mass spectra for identification of the volatile components. With the help of CRM, the two-dimensional data obtained from GC-MS instruments were resolved into a pure chromatogram and a mass spectrum of each chemical compound. By use of these methods upon two-dimensional data, 26, 49, and 59 volatile chemical components in essential oils of single herb Semen Persicae, Flos Carthami, and HP SP-FC were determined qualitatively and quantitatively, accounting for 78.42, 81.08, and 82.48% total contents of essential oil of single herb Semen Persicae, Flos Carthami, and HP SP-FC, respectively. It is shown that the accuracy of qualitative and quantitative analysis can be enhanced greatly by means of CRM. It is further demonstrated that the numbers of volatile chemical components of HP SP-FC are almost the addition of those of two single herbs, but the main volatile chemical components of the former are completely different from those of single herb Semen Persicae or Flos Carthami because of chemical reactions and physical changes occurring in the process of decocting two single herbs. This means that chemical components especially pharmacologically active compounds in the recipe might be different from those of single herbs. PMID:23023790

  8. Aplicación de visualización de una ontología para el dominio del análisis del semen humano Application to visualize an ontology for the human semen analysis domain

    Directory of Open Access Journals (Sweden)

    Roberto Casañas

    2007-06-01

    Full Text Available En este trabajo se presenta el diseño e implementación de una ontología para el dominio del análisis del semen humano, cuyo objetivo es representar, organizar, formalizar y estandarizar el conocimiento del dominio, para que éste pueda ser compartido y reutilizado por distintos grupos de personas y aplicaciones de software. Para visualizar la ontología se desarrolló una aplicación basada en una arquitectura cliente/servidor para ambientes Web, la cual está constituida por un módulo de Administración y otro de Acceso Público. A través del primero se mantiene el sitio Web de la ontología, mientras que el segundo permite a los usuarios acceder al conocimiento almacenado y a un conjunto de recursos tales como imágenes, videos, artículos relativos al dominio, manuales y protocolos de laboratorio. La arquitectura propuesta facilita la observación y recuperación de las complejas estructuras de conocimiento, así como la navegación y administración de la información representada en la ontología. El enfoque utilizado en el diseño de los mecanismos de recuperación de información está dirigido tanto a usuarios poco familiarizados con el vocabulario del dominio, como a aquellos que ya lo conocen. Esta funcionalidad es de especial interés dado lo heterogénea que resulta la audiencia a la que está dirigida la ontología, como son profesionales y estudiantes de las ciencias de la salud, entre otros. La metodología Methontology fue seleccionada para desarrollar la ontología y se utilizó el editor Protégé para su implementación.The following work presents the design and implementation of an ontology for human semen analysis whose objective is to present, organize, formalize and standardize the domain knowledge, in order to be shared and reused by different groups of people and software applications. To visualize this ontology, a Web application based on a client/server architecture was developed, which is constituted by an administration and a public access module. The ontology web site is maintained throughout the administration module whereas the public access module allows users to access the stored knowledge and a group of resources such as images, videos, domain related articles, tutorials and laboratory protocols. The proposed architecture facilitates the observation and recovering of complex knowledge structures as well as the navigation and administration of the information presented in the ontology. The approach used for the design of the information retrieval mechanisms is oriented to both expert and inexpert users. This functionality is of special interest given the heterogeneous of the audience towards this ontology is oriented which includes, among others, health sciences students and professionals. Methontology methodology was selected in order to develop this ontology, using Protégé editor for its implementation.

  9. Sugar-sweetened beverage intake in relation to semen quality and reproductive hormone levels in young men

    DEFF Research Database (Denmark)

    Chiu, Y H; Afeiche, M C

    2014-01-01

    STUDY QUESTION: Is consumption of sugar-sweetened beverages (SSB) associated with semen quality? SUMMARY ANSWER: Higher consumption of SSB was associated with lower sperm motility among healthy, young men. WHAT IS KNOWN ALREADY: The existing literature on the potential role of SSBs on male reproductive function is scarce and primarily focused on the relation between caffeinated beverages and semen quality. However, a rodent model suggests that SSBs may hamper male fertility. STUDY DESIGN, SIZE, DURATION: The Rochester Young Men's Study; a cross-sectional study of 189 healthy young men carried out at the University of Rochester during 2009-2010. PARTICIPANTS/MATERIALS, SETTING, METHODS: Men aged 18-22 years provided semen and blood samples, underwent a physical examination and completed a previously validated food frequency questionnaire (FFQ). Linear regression was used to analyze the association of SSBs with sperm parameters and reproductive hormone levels while adjusting for potential confounders. MAINRESULTS AND THE ROLE OF CHANCE: SSB intake was inversely related to progressive sperm motility. Men in the highest quartile of SSB intake (?1.3 serving/day) had 9.8 (95% CI: 1.9,17.8) percentage units lower progressive sperm motility than men in the lowest quartile of intake (<0.2 serving/day) (P, trend = 0.03). This association was stronger among lean men (P, trend = 0.005) but absent among overweight or obese men (P, trend = 0.98). SSB intake was unrelated to other semen quality parameters or reproductive hormones levels. LIMITATIONS, REASONS FOR CAUTION: As in all cross-sectional studies, causal inference is limited. An additional problem is that only single semen sample was obtained from each subject. WIDER IMPLICATIONS OF THE FINDINGS: To our knowledge, this is the first report on the relation between SSB intake and low semen quality beyond the contribution of caffeinated beverages. While our findings are in agreement with recent experimental data in rodents, more studies are required to draw conclusions on the relation of SSB with semen quality or male infertility. STUDY FUNDING/COMPETING INTEREST(S): Supported by the European Union Seventh Framework Program (Environment), 'Developmental Effects of Environment on Reproductive Health' (DEER) grant 212844. Grant P30 DK046200 and Ruth L. Kirschstein National Research Service Award T32 DK007703-16 and T32HD060454 from the National Institutes of Health. None of the authors has any conflicts of interest to declare.

  10. Hypoosmotic test to predict viability of equine chilled semen in different extenders Teste hiposmótico para avaliação da viabilidade do sêmen eqüino resfriado com diferentes diluidores

    OpenAIRE

    M.I.V. Melo; Henry, M; A.R.C.L. Beker

    2005-01-01

    The hypoosmotic test (HO) was used to evaluate plasmatic membrane integrity of equine chilled semen and to estimate the correlation between the results of the HO test and those from applied routine exams of semen. The semen of seven stallions was preserved at 5ºC in three different extenders. Each ejaculate was diluted in three extenders, Kenney (K), Baken with 3% of egg yolk (B3) and Baken with 10% of egg yolk (B10), and chilled at 5ºC. The total motility (MT), progressive motility (MP), spe...

  11. Semen quality and reproductive hormones according to birthweight and body mass index in childhood and adult life: two decades of follow-up

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia Høst; Hansen, Maj; Jensen, Cecilie Rutkjaer; Olsen, Jørn; Bonde, Jens Peter; Thulstrup, Ane Marie

    2010-01-01

    OBJECTIVE: To investigate the association between childhood body mass index (BMI), birth weight, and adulthood BMI, and adult semen quality and level of reproductive hormones. DESIGN: Follow-up study. SETTING: From a pregnancy cohort established in 1984-1987. PATIENT(S): 347 out of 5,109 sons were selected for a study conducted 2005 to 2006. INTERVENTION(S): Semen and blood samples were related to information on BMI in boys (5-8 years), birth weight, and adult BMI. MAIN OUTCOME MEASURE(S): Semen...

  12. Comparison of dot blot hybridization, polymerase chain reaction, and virus isolation for detection of bovine herpesvirus-1 (BHV-1) in artificially infected bovine semen.

    OpenAIRE

    Xia, J. Q.; Yason, C V; Kibenge, F S

    1995-01-01

    Bovine semen samples spiked with bovine herpesvirus 1 (BHV-1) were used to compare dot blot hybridization, polymerase chain reaction (PCR), and virus isolation for detection of BHV-1 in bovine semen. The PCR amplification used primers targeting the BHV-1 thymidine kinase gene and a nucleic acid releasing cocktail (GeneReleaser); the PCR product was used as the DNA probe in dot blot hybridization; virus isolation was done in primary bovine fetal testis (BFT) cell cultures. Semen diluted 1:20 i...

  13. A potential tool for diagnosis of male infertility: Plasma metabolomics based on GC-MS.

    Science.gov (United States)

    Zhou, Xinyi; Wang, Yang; Yun, Yonghuan; Xia, Zian; Lu, Hongmei; Luo, Jiekun; Liang, Yizeng

    2016-01-15

    Male infertility has become an important public health problem worldwide. Nowadays the diagnosis of male infertility frequently depends on the results of semen quality or requires more invasive surgical intervention. Therefore, it is necessary to develop a novel approach for early diagnosis of male infertility. According to the presence or absence of normal sexual function, the male infertility is classified into two phenotypes, erectile dysfunction (ED) and semen abnormalities (SA). The aim of this study was to investigate the GC-MS plasma profiles of infertile male having erectile dysfunction (ED) and having semen abnormalities (SA) and discover the potential biomarkers. The plasma samples from healthy controls (HC) (n=61) and infertility patients with ED (n=26) or with SA (n=44) were analyzed by gas chromatography-mass spectrometry (GC-MS) for discrimination and screening potential biomarkers. The partial least squares-discriminant analysis (PLS-DA) was performed on GC-MS dataset. The results showed that HC could be discriminated from infertile cases having SA (AUC=86.96%, sensitivity=78.69%, specificity=84.09%, accuracy=80.95%) and infertile cases having ED (AUC=94.33%, sensitivity=80.33%, specificity=100%, accuracy=87.36%). Some potential biomarkers were successfully discovered by two commonly used variable selection methods, variable importance on projection (VIP) and original coefficients of PLS-DA (?). 1,5-Anhydro-sorbitol and ?-hydroxyisovaleric acid were identified as the potential biomarkers for distinguishing HC from the male infertility patients. Meanwhile, lactate, glutamate and cholesterol were the found to be the important variables to distinguish between patients with erectile dysfunction from those with semen abnormalities. The plasma metabolomics may be developed as a novel approach for fast, noninvasive, and acceptable diagnosis and characterization of male infertility. PMID:26592580

  14. Hope for restoration of dead valuable bulls through cloning using donor somatic cells isolated from cryopreserved semen.

    Science.gov (United States)

    Selokar, Naresh L; Saini, Monika; Palta, Prabhat; Chauhan, Manmohan S; Manik, Radheysham; Singla, Suresh K

    2014-01-01

    Somatic cells were isolated from cryopreserved semen of 4 buffalo bulls, 3 of which had died over 10 years earlier, and were established in culture. The cells expressed cytokeratin-18, keratin and vimentin indicating that they were of epithelial origin. The cells were used as nuclear donors for hand-made cloning for producing buffalo embryos. The blastocyst rate and quality, as indicated by apoptotic index, were comparable among embryos produced using cells obtained from fresh or frozen-thawed semen or those obtained from conventional cell sources such as skin. Examination of the epigenetic status revealed that the global level of H3K27me3 but not that of H3K9/14ac and H4K5ac differed significantly (Pcloned embryos from different bulls. The relative mRNA abundance of HDAC1, DNMT1, P53 and CASPASE 3 but not that of DNMT3a differed in cells and in cloned embryos. Following transfer of 24 cloned embryos produced from fresh semen-derived cells to 12 recipients, one calf weighing 55 kg, which is now 6 months of age and is normal, was born through normal parturition. Following transfer of 20 embryos produced from frozen-thawed semen-derived cells to 10 recipients, 2 became pregnant, one of which aborted in the first trimester; the calf born was severely underweight (17 kg), and died 12 h after birth. The ability of cells derived from fresh and frozen-thawed semen to produce live offspring confirms the ability of these cells to be reprogrammed. Our findings pave the way for restoration of highly precious progeny-tested bulls, which has immense economic importance, and can also be used for restoration of endangered species. PMID:24614586

  15. Antibiotics supplemented culture media can eliminate non-specific bacteria from human semen during sperm preparation for intra uterine insemination

    Directory of Open Access Journals (Sweden)

    D. M. A. B. Dissanayake

    2014-01-01

    Full Text Available Rationale: Bacterial flora can be isolated from many semen samples of subfertile males. Bacteriospermia can compromise the outcome of intra uterine insemination (IUI by contaminating the post-processed sperm sample. Objectives: The objective of the present study is to determine the efficacy of penicillin and streptomycin in eliminating the bacteria from semen samples in the sperm processing procedure, and to assess the effects of antibiotics on sperm motility, survivability, and pregnancy rates. Design and Settings: A prospectively controlled study was carried out using couples undergoing IUI with their informed consent. Intervention: Sperm processing using the swim-up technique in penicillin and streptomycin supplemented culture medium. Subjects And Methods: Couples were consecutively allocated in two groups for sperm processing (a Group AB+ (antibiotics supplemented culture medium, n = 33 and (b Group AB? (antibiotic free culture medium, n = 33. Semen culture was performed before and after sperm processing. Sperm motility was assessed immediately after processing and after 24 h of incubation. Results: Bacterial isolates were found in 20 (60.6% and 22 (66.1% of samples before processing in Groups AB+ and AB? respectively. Addition of antibiotics resulted in completely eliminating non-specific bacteria from semen samples without affecting sperm motility. In vitro survival rate of sperm enhanced in AB+ group compared with AB? group (motile sperm after 24 h, 62.21% (standard deviation [SD]: 37.27 versus 41.36% (SD: 30.78, P = 0.012. Pregnancy rate, was comparable between two groups (9% in Group AB+ vs. 6% in Group AB?, P = 0.45. Conclusion: Penicillin streptomycin combination could completely eliminate non-specific bacteria from semen samples during sperm processing in this population. The types of antibiotics and dosage used did not seem to have any harmful effects on human sperm.

  16. Semen quality among Danish and Finnish men attempting to conceive. The Danish First Pregnancy Planner Study Team

    DEFF Research Database (Denmark)

    Jensen, T K; Vierula, M

    2000-01-01

    OBJECTIVE: To assess differences in semen quality between similar populations from Denmark and Finland. DESIGN: Comparison of semen quality between 221 Finnish men (of whom 115 had no proven fertility) and 411 Danish men with no proven fertility in two follow-up studies among normal couples trying to conceive. METHODS: In Finland male partners of couples without experienced infertility attempting to conceive were recruited through advertisements in local newspapers from 1984 to 1986. From 1992 to 1995 Danish men who lived with a partner and who had not attempted to achieve a pregnancy previously were recruited through their union when they discontinued birth control. All semen analyses were performed in accordance with the World Health Organization guidelines. RESULTS: Median sperm concentration, total sperm count and the percentage of morphologically normal spermatozoa were significantly higher among the Finnish men without proven fertility (104.0 million/ml, 304.0 million and 58% respectively) compared with the Danish men (53.0 million/ml, 140.8 million, and 41% respectively). Sperm concentration was 105.7% (95% confidence interval (CI) 58.1%-167.6%) and total sperm count was 127.4% (95% CI 71.4%-201.6%) higher among Finnish men without proven fertility than among Danish men after control for confounders. CONCLUSIONS: Some, but hardly all, of the observed difference in semen quality may be explained by differences in recruitment procedures, selection of the men and by methodological differences in semen analysis between the two countries. Also a birth cohort effect may explain some of the differences between countries as the Finnish men were recruited 11 years before the Danish men. Therefore, follow-up studies with identical recruitment and selection of men from the two countries are needed.

  17. ESTRES OXIDATIVO Y SU EFECTO SOBRE CALIDAD SEMINAL The oxidative stress effect on semen quality

    Directory of Open Access Journals (Sweden)

    Beatriz Reina Bouvet

    2007-12-01

    Full Text Available La membrana espermática tiene ácidos grasos insaturados que la tornan vulnerable al ataque de sustancias oxígeno reactivas. Los espermatozoides poseen sistemas protectores, pero un desbalance entre pro y antioxidantes produce “estrés oxidativo". Objetivo: estudiar en semen de hombres infértiles, el efecto del estrés oxidativo sobre la membrana y núcleo espermático. Se analizaron muestras seminales de 142 hombres infértiles. Se efectuó espermograma, se seleccionaron 83 muestras sin aglutinación ni hiperviscosidad y con concentración espermática mayor a 5 x 10 6 /ml. Se estudió la membrana espermática con Test Hipoosmótico, la condensación cromatínica con Azul de Anilina y el ADN con Naranja de Acridina. Para estrés oxidativo se aplicó el Test MOST (movilidad traslativa final/movilidad traslativa inicial que evalúa la pérdida de movilidad de los espermatozoides luego de ser incubados por 4 hs. en baño de agua a 40 °C. Se agruparon las muestras en G1: MOST mayor o igual a 0.40 (normal y G2: MOST menor a 0.40 (anormal. El análisis estadístico demostró diferencia significativa (pThe spermatozoids have in its plasmatic membrane high concentrations of unsaturated fatty acids, vulnerable to the attack of the reactive oxygen substances. The male gamete has protective systems, the distortion between pro and antioxidizers produces “oxidative stress". Objective: to study samples of semen from infertile men, the effect of oxidative stress on the sperm membrane and the nucleus. 142 semen samples were analyzed from infertile men. The sperm study was evaluated according to OMS and 83 samples without agglutination and hiperviscosity with concentration of spermatozoids more of 5 x 10 6 /ml were chosen. The sperm membrane was studied with the Hipoosmotic Test, the maturity of chromatina with blue aniline and the nuclear AND with acridine orange. The EO was evaluated with the MOST test (motility end/motility initial measuring the loss of motility of the spermatozoids incubated at 40ºC in a water bath for 4 hours, separating the samples in : G1 : MOST major or equal to 0.40 (normal G2 : MOST under to 0.40 ( abnormal. The statistic analysis of the three tests showed significant difference (p<0.003. The oxidative stress affects essential structures.

  18. The concentration of nitrite in seminal plasma does not correlate with sperm concentration, sperm motility, leukocytospermia and sperm culture.

    OpenAIRE

    GHIGO, Dario Antonio; Massobrio, Marco; BOSIA, Amalia; BERGANDI, Loredana; REVELLI, Alberto

    2001-01-01

    OBJECTIVE: To correlate the concentration of nitrite (the stable metabolite of nitric oxide) in seminal plasma with sperm number and motility, leukocytospermia, and sperm culture. DESIGN: Prospective study. SETTING: Academic research institution. PATIENT(S): Seventy normozoospermic or dyspermic men enrolled in an artificial insemination/in vitro fertilization program. INTERVENTION(S): Semen samples (n = 70) were checked for sperm concentration, total sperm count, sperm motility, seminal leuko...

  19. Experimental study of ?PERSICAE SEMEN? on the blood injected by Endotoxin in rats

    Directory of Open Access Journals (Sweden)

    Chang-Keun

    2005-06-01

    Full Text Available This study was performed to investigate the effects of ?Persicae Semen?(PS on the blood injected by Endotoxin in rats. The blood was induced by Endotoxin injection into the caudal vein of rats and PS group taken a measurement of RBC, Hb, Hct, Platelet, WBC, ESR, CRP. The results were obtained as follows: 1. RBC, Hb, Hct, Platelet, WBC were increased with statistical significance at PS group as compared with those of the control group. 2. ESR, CRP were decreased with statistical significance at PS group as compared with those of the control group. It is concluded that PS group has significant effects on the blood injected by Endotoxin in rats. Therefore, PS group seems to be applicable to the diseases related to Endotoxin in clinics.

  20. Ovulation induction and artificial insemination of a captive polar bear (Ursus maritimus) using fresh semen.

    Science.gov (United States)

    Curry, Erin; Wyatt, Jeff; Sorel, Lawrence J; MacKinnon, Katherine M; Roth, Terri L

    2014-09-01

    In 2008, polar bears were listed as a species threatened with extinction by the U.S. Endangered Species Act. Unfortunately, reproductive success has been poor despite breeding recommendations for almost every reproductively viable bear by the Species Survival Plan. Assisted reproductive technologies could complement breeding efforts by overcoming the challenges of behavioral incompatibilities and deficiencies, facilitating genetic management and increasing cub production. The goal of this study was to artificially inseminate a female polar bear after inducing ovarian activity and ovulation with exogenous hormones (equine chorionic gonadotropin and porcine luteinizing hormone). Fresh semen collected from an adult male via electroejaculation/urethral catheterization was used for the insemination. Fecal steroid monitoring indicated that the female ovulated following the exogenous hormone treatment. Progestin concentrations increased in late summer, at the time implantation was expected to occur; however, no cubs were produced. To the authors' knowledge, this is the first report of ovulation induction and artificial insemination in a polar bear. PMID:25314835

  1. Holographic imaging of unlabelled sperm cells for semen analysis: a review.

    Science.gov (United States)

    Di Caprio, Giuseppe; Ferrara, Maria Antonietta; Miccio, Lisa; Merola, Francesco; Memmolo, Pasquale; Ferraro, Pietro; Coppola, Giuseppe

    2015-10-01

    Male reproductive health in both humans and animals is an important research field in biological study. In order to characterize the morphology, the motility and the concentration of the sperm cells, which are the most important parameters to feature them, digital holography demonstrated to be an attractive technique. Indeed, it is a label-free, non-invasive and high-resolution method that enables the characterization of live specimen. The review is intended both for summarizing the state-of-art on the semen analysis and recent achievement obtained by means of digital holography and for exploring new possible applications of digital holography in this field. Quantitative phase maps of living swimming spermatozoa. PMID:25491593

  2. A NEW MODEL OF BOAR SEMEN EVALUATION AND THE IMPACT OF CRYOGENIC FACTOR ON SPERMATIC CELLS

    Directory of Open Access Journals (Sweden)

    M. Z?HAN

    2009-05-01

    Full Text Available Nowadays, sperm evaluation is mostly used to predict fertility and freezability. Theaim of this study is to evaluate the possibility of investigating the effects of thecryogenic agent on boar spermatozoa, by identifying a set of laboratory tests for arapid and efficient evaluation of semen quality. Usual sperm analysis such as spermconcentration, motility and spermatozoa morphology are not able to show subtleabnormalities, which are having a basic role in the fertilizing ability. Moreover, itseems that other sperm characteristics, involved in the fertilizing ability, can interferewith the freezing-thawing processes, being not evaluated or maybe not known.Morphological (microscopic analysis of stained spermatozoa, functional (motilityanalysis and hypo-osmotic swelling test and chromatin integrity (Acridine OrangeTest and Comet Assay analysis were performed aiming to show the differences inspermatozoon integrity and functionality, caused by the cryogenic factor

  3. Does the duration of infertility affect semen parameters and pregnancy rate after varicocelectomy?: a retrospective study

    Scientific Electronic Library Online (English)

    Mohammed A., Al-Ghazo; Ibrahim Fathi, Ghalayini; Rami S, Al-Azab; Ibrahim, Bani-Hani; Mohammad S., Daradkeh.

    2011-12-01

    Full Text Available OBJECTIVES: The most common indication for treatment of varicocele is still male subfertility. The aim of this study was to explore the effect of infertility duration on semen parameters and spontaneous pregnancy rate after varicocelectomy. MATERIALS AND METHODS: The medical records of 183 infertile [...] patients with clinical varicocele were retrospectively reviewed. The patients were divided into three groups according to the duration of infertility (group I, 1-3 years, group II, 3-6 years and group III, > 6 years). Total sperm motility counts (TMCs) before and after varicocelectomy and spontaneous pregnancy rate among these groups were statistically compared. RESULTS: The greatest changes, regarding preoperative and postoperative TMCs and spontaneous pregnancy rate were noticed between group I and III. Preoperative TMCs in group I and III was 15.2 ± 1.2, 7.8 ± 1.4, respectively (p

  4. Semen and reproductive parameters during some abstinence periods after cigarette smoke exposure in male rats

    Scientific Electronic Library Online (English)

    Michele Kimie, Sankako; Patricia Carvalho, Garcia; Renata Carolina, Piffer; Oduvaldo Câmara Marques, Pereira.

    2013-02-01

    Full Text Available Cigarette smoking is very widespread globally and can also be implicated in male and female infertility. This study aimed to evaluate the testicular function throughout a complete spermatic cycle during abstinence from cigarette smoke exposure in order to identify a possible residual damage and whet [...] her the parameters could recover spontaneously. Male Wistar rats were randomly divided into control and cigarette smoke-exposed (20 cigarettes/day/2 months) groups. After finishing the treatment, according to the number of days after the last cigarette exposure (0, 15, 30, or 60 days), the rats were euthanized and analyzed for compromised sperm count and quality. Results showed residual damage on sperm concentration, motility and morphology; the recovery of these parameters occurred only at 60th days of abstinence. The study showed that cigarette smoke exposure damaged the semen and reproductive parameters and that the spontaneous recovery of some parameters occurred only after a complete spermatic cycle subsequent to stopping smoke exposure.

  5. Environmental protection management by monitoring the surface water quality in Semenic area

    Directory of Open Access Journals (Sweden)

    Dana SÂMBOTIN

    2011-08-01

    Full Text Available Environment seems to have been the war against all. In fact recently most people polluted the environment and those few are cared for his cleaning. Today, the relationship evolvedas societies have changed in favour of ensuring environmental protection. With modern technology, performance, monitoring the environment becomes part of human activity ever more necessary, more possible and more efficient. The quality of the environment, its components: air, water, soil, plants, vegetable and animal products, is a condition "sine qua non" for the life of the modern man. The consequences of environmental pollution areso dangerous that modern man cannot afford considering them. Through this paper I will study the environmental quality by monitoring the surfaces waters from the Semenic- G?râna area.

  6. Effect of semen collection by transrectal massage of accessory sexual glands or artificial vagina on the outcome of breeding soundness examinations of Italian yearling beef bulls.

    Science.gov (United States)

    Sylla, Lakamy; Palombi, Claudio; Stradaioli, Giuseppe; Vagniluca, Antonio; Monaci, Maurizio

    2015-03-15

    Although semen quality is one of the major traits that influence breeding soundness examination outcomes in bulls, field conditions occasionally do not allow for the collection of semen samples by means of an artificial vagina. The aims of the present study were to report the results of a large number of semen collections that were performed via the transrectal massage (TRM) of the accessory sexual glands of Italian yearling beef bulls and compare this semen collection method to the artificial vagina (AV) method in term of breeding soundness examination outcomes; furthermore, we determined whether the breed affected the semen characteristics. In the TRM group (n = 475), the semen samples were collected via TRM of the accessory sexual glands, and in the AV group (n = 502), the AV method was used. In the TRM group, semen samples were obtained from 81.3% of the bulls and penile protrusion was observed in 87.6% of the animals during semen collection. The sperm concentrations (920.5 ± 439.0 vs. 281.0 ± 259.8 × 10(6)/mL) and the percentages of total abnormal spermatozoa (22.8 ± 15.0 vs. 18.8 ± 12.9) were significantly higher in the AV group than those in the TRM group. The percentage of bulls that did not meet the minimum requirement for normal cells (?70%) was 6.2% higher in the AV group than that in the TRM group (P < 0.05). Moreover, the samples collected from Chianina bulls by TRM exhibited a lower percentage of motile sperm and a higher percentage of abnormal spermatozoa when compared with the other two breeds. The major drawbacks of the TRM technique were the inability to conduct complete evaluation of the libido and mating ability of the yearling bulls, a significant reduction of the number of spermatozoa collected, and an increase in the variability of the semen characteristics due to breed. In conclusion, despite the drawbacks, TRM guarantees that semen evaluation can be conducted in cases in which the semen samples cannot be collected with the AV method. PMID:25488791

  7. High frequency of sub-optimal semen quality in an unselected population of young men

    DEFF Research Database (Denmark)

    Andersen, A G; Jensen, T K

    2000-01-01

    Male reproductive function seems to have deteriorated considerably during the past 4-5 decades. However, studies of the reproductive function in unselected populations have not previously been reported. As the large majority of young men in Denmark are subjected to a compulsory medical examination for military service, this provided a unique opportunity to study the reproductive function in an unbiased population. Altogether 891 young men delivered a blood sample in which reproductive hormones were measured. From 708 of these men data were also obtained on semen quality and testis size. The median sperm concentration was 41 x 10(6)/ml (mean 57.4 x 10(6)/ml). Men with ejaculation abstinence above 48 h had slightly higher sperm concentrations (median 45 x10(6)/ml, mean 63.2 x 10(6)/ml), but even in this subgroup, 21 and 43% respectively had sperm counts below 20 x 10(6)/ml and 40 x 10(6)/ml. Among men with no history of reproductive diseases and a period of abstinence above 48 h, as many as 18 and 40% respectively had concentrations below 20 and 40 x 10(6)/ml. Sperm counts were positively correlated with testis size, percentage normal spermatozoa and inhibin B, and negatively correlated with percentage immotile spermatozoa and follicle stimulating hormone. Possible causes for this high frequency of young men with suboptimal semen quality are obscure and need to be explored. Whether these findings apply for young male populations of comparable countries remains to be seen.

  8. Exploration of the Association between Obesity and Semen Quality in a 7630 Male Population

    Science.gov (United States)

    Tsao, Chih-Wei; Liu, Chin-Yu; Chou, Yu-Ching; Cha, Tai-Lung; Chen, Shih-Chang; Hsu, Chien-Yeh

    2015-01-01

    This study aimed to explore the association between body mass index (BMI), other anthropometric indexes and semen quality in a general male population in Taiwan. In this cross-sectional cohort study, the study cohort consisted of 7941 healthy male individuals aged 18 years or older who participated in a standard medical screening program run by a private firm from January 2008 to May 2013. Semen parameters including sperm concentration (SC), total sperm motility (TSM), progressive motility (PRM), and normal sperm morphology (NSM) were recorded. Anthropometric indexes including BMI, waist circumference (WC), hip circumference (HC), waist-to-hip ratio (WHR), waist-to-height ratio (WHtR) and body fat percentage were measured. A total of 7630 men were enrolled for the final analysis, of whom 68.5% had a normal weight distribution and 31.4% were overweight or obese. Total sperm motility, progressive motility, normal sperm morphology and sperm concentration showed a statistically linear decline with increasing age (p significantly negatively linear association with BMI (p = 0.005), and normal sperm morphology showed an inverse association with BMI and waist-to-height ratio (p < 0.001 and p = 0.004). The prevalence of abnormal total sperm motility, progressive motility, normal sperm morphology and sperm concentration increased with increasing age (p = 0.011, p < 0.001, p < 0.001 and p = 0.002). Lower normal sperm morphology and sperm concentration were associated with increasing body adiposity (p<0.05). No relationship between obesity and sperm motility was identified. PMID:25822490

  9. Validation of the FACSCount AF system for determination of sperm concentration in boar semen

    DEFF Research Database (Denmark)

    Hansen, C.; Christensen, P.

    2002-01-01

    A flow cytometric method has been developed for rapid determination of sperm concentration in semen from various mammalian species.* All cells containing DNA are stained with SYBR-14 or propidium iodide (PI) and sperm concentration is determined in relation to an internal standard of fluorescent microspheres ( beads). Satisfactory staining can be achieved within 2-3 min and the following flow cytometric analysis on the FACSCount AF System rapidly provides the user with a precise and accurate assessment of the sperm concentration. In this study, the FACSCount AF System and Sperm Counting Reagent ( BD Biosciences) was compared with microscopic counting using a Burker-Turk haemocytometer. In addition, sperm concentration was determined using the Corning 254 spectrophotometer which is used routinely by Danish artificial insemination stations for boars. The results show that the agreement between flow cytometry and microscopic counting is very high. The slope for the regression line was 1.12 (SE = 0.03) with an estimated intercept with the Y-axis of 22 x 10(6) sperm/ml (SE = 10 x 10(6) sperm/ml) and an estimated error of the model of 10 x 10(6) sperm/ml. For the spectrophotometer, the slope of the regression line was 1.09 (SE = 0.07) with an estimated intercept of 137 x 10(6) sperm/ml (SE = 25 x 10(6) sperm/ml). The average error made by the spectrophotometer was 55 x 10(6) sperm/ml. In addition, the results obtained using flow cytometry was highly repeatable ( CV = 2.7%) in comparison with the spectrophotometric method ( CV = 6.3%). These results indicate that the FACSCount AF System is a valuable tool for precise and accurate assessment of sperm concentration in boar semen and that use of this system may lead to production of more uniform insemination doses containing a specific number of sperm per dose.

  10. Assessment of the range of the HIV-1 infectivity enhancing effect of individual human semen specimen and the range of inhibition by EGCG

    OpenAIRE

    Hartjen Philip; Frerk Sebastian; Hauber Ilona; Matzat Verena; Thomssen Adriana; Holstermann Barbara; Hohenberg Heinrich; Schulze Wolfgang; Schulze zur Wiesch Julian; Lunzen Jan

    2012-01-01

    Abstract Recently, it has been shown that human ejaculate enhances human immunodeficiency virus 1 (HIV-1) infectivity. Enhancement of infectivity is conceived to be mediated by amyloid filaments from peptides that are proteolytically released from prostatic acid phosphatase (PAP), termed Semen-derived Enhancer of Virus Infection (SEVI). The aim of this study was to test the range of HIV-1 infectivity enhancing properties of a large number of individual semen samples (n = 47) in a TZM-bl repor...

  11. Prenatal and adult exposures to smoking are associated with adverse effects on reproductive hormones, semen quality, final height and body mass index

    DEFF Research Database (Denmark)

    Ravnborg, Trine L; Jensen, Tina K; Andersson, Anna-Maria; Toppari, Jorma; Skakkebæk, Niels E; Jørgensen, Niels

    2011-01-01

    BACKGROUND Exposure to tobacco smoking prenatally is a risk factor for reduced semen quality, but whether the exposure has adverse effects on reproductive hormones, pubertal development or adult BMI remain largely unexplored. The aim of this study was to investigate the associations between these factors while controlling for the effects of current smoking in young adulthood. METHODS This cross-sectional study (1996-2006) included 3486 Danish men (median age: 19 years), participating in a semen-...

  12. Study on the effect of prostaglandin F2? treatment on semen characteristics and enzymatic activates of Awassi rams in breeding and non breeding seasons

    OpenAIRE

    Osama Ibrahim Azawi; Abdul Nasir Thanoon Mahmood Al-Khasab; Nabil Najeeb Al-Kadoo

    2011-01-01

    The purpose of this research work was to determine the effects of PGF2?, given immediately before semen collection, on semen characteristics and libido in Awassi rams during breeding and non breeding season. The experiment was conducted in late summer to early autumn when major breeding activities commence and winter during the non breeding season at Mosul region in northern Iraq at the Animal Research and Practice Farm of the College of The Veterinary Medicine, University of Mosul. Twelve ma...

  13. SEMEN CHARACTERISTICS OF CROSSBRED (FRIESIAN X SAHIW AL) BULLS AT LIVESTOCK RESEARCH ST A T.lON, NA TIONAL AGRICUL TURAL RESEARCH CENTRE, ISLAMABAD

    OpenAIRE

    S. M. H. Andrabi, S. Naheed, L. A. Khan and N. Ullah

    2002-01-01

    The aim of the present study was to investigate the. semen characteristics (volume, motility concentration and morphology) of crossbred (Friesian x Sahiwal; F x S) bulls maintained at Livestock Research Station of National Agricultural Research Centre, Islamabad. Moreover, sperm head, mid-piece and tail dimensions in crossbred (F x S) and pure-bred (Friesian and Sahiwal) bulls were also studied. Semen was routinely collected twice a week during the. months