
Sample records for semen plasma glycerylphosphorylcholine

  1. Efecto del plasma seminal sobre el estado redox del semen equino criopreservado / Effect of seminal plasma on the redox state of cryopreserved stallion semen

    Scientific Electronic Library Online (English)

    Edison, Pizarro L; Giovanni, Restrepo B; José, Echeverry Z; Benjamín, Rojano.


    Full Text Available Objetivo. Determinar el efecto del plasma seminal sobre la generación de especies reactivas de oxígeno (ERO) y la peroxidación lipídica de semen equino criopreservado y su asociación con parámetros de calidad seminal. Materiales y métodos. El semen de cinco caballos de la raza criollo colombiano (do [...] s eyaculados cada uno), fue criopreservado mediante un protocolo de congelación rápida, empleando un diluyente leche-yema de huevo, suplementado con 0%, 10% y 20% de plasma seminal equino. En muestras de semen fresco y criopreservado se evaluó la generación de ERO y la peroxidación lipídica por espectrofluorimetría, y los parámetros de calidad seminal de movilidad progresiva, vitalidad e integridad de membrana, mediante microscopia de contraste de fase. Para el análisis estadístico se ajustaron modelos mixtos y se realizaron análisis de regresión y correlación. Resultados. Se hallaron promedios post-descongelación de movilidad progresiva, vitalidad e integridad de membrana de 37.8%±20.2, 50.6% ± 14.6 y 37.8% ± 15.5, respectivamente. Para el semen fresco y criopreservado suplementado con 0%, 10% y 20% de plasma seminal, los promedios de producción de ERO (URF) fueron de 13.34±10.7, 16.15 ± 13.5, 17.32 ± 16 y 22.98 ± 19.4, respectivamente; mostrando un incremento estadísticamente significativo (p?0.05) en la producción de ERO por efecto de la criopreservación y la suplementación con plasma seminal. Los promedios de peroxidación lipídica (nmolMDA/ml) para estos mismos tratamientos, fueron de 0.41 ± 0.25, 0.72±0.37, 0.51 ± 0.29 y 0.47±0.26, respectivamente; mostrando una reducción significativa (p?0.05) de la peroxidación lipídica del semen suplementado con 10% y 20% de plasma seminal, respecto al semen no suplementado (0%). Conclusiones. El plasma seminal reduce la peroxidación lipídica del semen equino criopreservado. Abstract in english Objective. Determine the effect of seminal plasma on the generation of reactive oxygen species (ROS) and lipid peroxidation of cryopreserved stallion semen, and its association with semen quality parameters. Materials and methods. The semen of five stallions of Colombian creole breed (two ejaculates [...] each) was cryopreserved by a rapid freezing protocol, using a milk-egg yolk extender supplemented with 0%, 10% and 20% of equine seminal plasma. The samples of fresh and cryopreserved semen were evaluated for ROS generation and lipid peroxidation by spectrofluorimetry, and semen quality parameters of progressive motility, vitality and membrane integrity using phase contrast microscopy. Mixed models were adjusted for statistical, regression, and correlation analysis. Results. Post-thaw averages of progressive motility, vitality and integrity of membrane of 37.8% ± 20.2, 50.6% ± 14.6 and 37.8 ± 15.5%, respectively were found. For fresh and cryopreserved semen supplemented with 0%, 10% and 20% of seminal plasma, the averages of ROS production (RFU) were 13.34 ± 10.7, 16.15 ± 13.5, 17.32 ± 16 and 22.98 ± 19.4, respectively; showing a statistically significant increase (p?0.05) of ROS production by effect of cryopreservation and seminal plasma supplementation. The averages of lipid peroxidation (nmolMDA / ml) for these same treatments were 0.41 ± 0.25, 0.72 ± 0.37, 0.51 ± 0.29 and 0.47 ± 0.26, respectively; showing a significant decrease (p?0.05) of lipid peroxidation of semen supplemented with 10% and 20% of seminal plasma compared to unsupplemented semen (0%). Conclusions. Seminal plasma reduces lipid peroxidation of stallion cryopreserved semen.

  2. Influence of boar breeds or hybrid genetic composition on semen quality and seminal plasma biochemical variables. (United States)

    Žaja, Ivona Žura; Samardžija, Marko; Vince, Silvijo; Maji?-Bali?, Ivanka; Vili?, Marinko; ?uri?i?, Dražen; Milinkovi?-Tur, Suzana


    The enzyme concentrations of seminal plasma are important for spermatozoa metabolism and function in boars. The need has arisen for introducing a biochemical evaluation of semen, along with the usual standard semen analyses. There are no data on the influence of boar breeds on the seminal plasma biochemical variables investigated in this study. Therefore, the objective was to determine the influence of breed and hybrid genetic composition of boars on semen quality and seminal plasma biochemical variables. Semen samples of 27 boars (Swedish Landrace, German Landrace, Large White, Pietrain and Pig Improvement Company hybrid-PIC-hybrid), aged between 1.5 and 3 years, were collected. After evaluation of semen quality, the seminal plasma was separated from the spermatozoa by centrifugation of semen. The seminal plasma was subjected to spectrophotometric analysis to determine alkaline phosphatase (ALP), acid phosphatase (ACP), ?-glutamyltransferase (GGT), creatine kinase (CK) and lactate dehydrogenase (LDH) and to atomic absorption spectrophotometric analysis to measure the concentration of calcium and magnesium. Conventional semen quality variables differed depending on breed and PIC-hybrid genetic composition, though these differences were typically insignificant. In the seminal plasma, significant differences were determined in enzyme activity (ALP, GGT, CK and LDH) and in calcium concentration among boars of differnt breeds. There are, therefore, differences in semen quality and significant differences in the seminal plasma biochemical variables among boars of different breeds and PIC-hybrid genetic composition. The data and differences in semen variables detected in the present study provide knowledge for enhancing evaluation and monitoring of boar reproductive potential, semen quality and explain the potential causes of boar infertility. PMID:26692346

  3. Efecto de la adición de plasma seminal en el semen equino descongelado Effect of seminal plasma addition on frozen-thawed equine semen

    Directory of Open Access Journals (Sweden)

    D. Lozano Benito


    Full Text Available Antecedentes y objetivos: El semen criopreservado ofrece beneficios adicionales no presentes en el semen refrigerado. Sin embargo, varios factores afectan al éxito en la inseminación artificial con semen congelado de caballos. El objetivo del trabajo es evaluar si la adición de plasma seminal a diferentes concentraciones, sobre espermatozoides equinos descongelados, afecta a la motilidad espermática, viabilidad y a nivel de membrana. Material y métodos: Se utilizaron diferentes razas, cuatro sementales de silla, y dos sementales de tiro. En un primer experimento el semen descongelado se centrifugó, mientras en el segundo no se centrifugó. A continuación, se adicionó el plasma seminal al 10, 20, 30% suspendido en solución tampón fosfato y plasma seminal puro (100%. Resultados: En los caballos de silla el plasma seminal no afectó a los parámetros estudiados (p>0,05, pero se apreció un posible efecto tóxico del plasma seminal puro sobre las características espermáticas. En las muestras con plasma seminal de los caballos de tiro, se observaron unos índices mejores en espermatozoides vivos con acrosoma intacto que en las muestras control. Asimismo se obtuvo un porcentaje menor en espermatozoides reaccionados que en las muestras control, encontrando en esta categoría una diferencia significativa (pBackground and objectives: Stallion sperm cryopreservation offers benefits not available in cooled semen. However various factors affect the success of artificial insemination with frozen-thawed equine semen. This study aims to evaluate if adding different concentrations of seminal plasma on frozen-thawed equine spermatozoa affects sperm motility, viability and membrane status. Material and Methods: Different breeds were used; four saddle stallions and two draft stallions. In the first experiment thawed semen was centrifuged and in the second one it was not. Subsequent to that, the spermatozoa resuspended with 10, 20, 30% seminal plasma in phosphate buffered saline and pure seminal plasma (100%. Results: semen parameters of saddle stallions were not affected (p>0,05, but a possible toxic effect of pure seminal plasma was observed on sperm characteristics. Seminal plasma samples in draft breed got better rates in viable sperm with intact acrosome. A lower percentage was also found on spermatozoa with acrosome reaction than in control samples. This category showed signif icant differences (p<0,05. Conclusions: Post-thawing spermatozoa incubation with seminal plasma can stop acrosome reaction, due to the low percentage of spermatozoa suffering true acrosome reaction.

  4. Efecto de la adición de plasma seminal en el semen equino descongelado / Effect of seminal plasma addition on frozen-thawed equine semen

    Scientific Electronic Library Online (English)

    D., Lozano Benito; L., Gil Huerta; C., Álvarez San Martín.


    Full Text Available Antecedentes y objetivos: El semen criopreservado ofrece beneficios adicionales no presentes en el semen refrigerado. Sin embargo, varios factores afectan al éxito en la inseminación artificial con semen congelado de caballos. El objetivo del trabajo es evaluar si la adición de plasma seminal a dife [...] rentes concentraciones, sobre espermatozoides equinos descongelados, afecta a la motilidad espermática, viabilidad y a nivel de membrana. Material y métodos: Se utilizaron diferentes razas, cuatro sementales de silla, y dos sementales de tiro. En un primer experimento el semen descongelado se centrifugó, mientras en el segundo no se centrifugó. A continuación, se adicionó el plasma seminal al 10, 20, 30% suspendido en solución tampón fosfato y plasma seminal puro (100%). Resultados: En los caballos de silla el plasma seminal no afectó a los parámetros estudiados (p>0,05), pero se apreció un posible efecto tóxico del plasma seminal puro sobre las características espermáticas. En las muestras con plasma seminal de los caballos de tiro, se observaron unos índices mejores en espermatozoides vivos con acrosoma intacto que en las muestras control. Asimismo se obtuvo un porcentaje menor en espermatozoides reaccionados que en las muestras control, encontrando en esta categoría una diferencia significativa (p Abstract in english Background and objectives: Stallion sperm cryopreservation offers benefits not available in cooled semen. However various factors affect the success of artificial insemination with frozen-thawed equine semen. This study aims to evaluate if adding different concentrations of seminal plasma on frozen- [...] thawed equine spermatozoa affects sperm motility, viability and membrane status. Material and Methods: Different breeds were used; four saddle stallions and two draft stallions. In the first experiment thawed semen was centrifuged and in the second one it was not. Subsequent to that, the spermatozoa resuspended with 10, 20, 30% seminal plasma in phosphate buffered saline and pure seminal plasma (100%). Results: semen parameters of saddle stallions were not affected (p>0,05), but a possible toxic effect of pure seminal plasma was observed on sperm characteristics. Seminal plasma samples in draft breed got better rates in viable sperm with intact acrosome. A lower percentage was also found on spermatozoa with acrosome reaction than in control samples. This category showed signif icant differences (p

  5. Study on the relationship between the trace protein contents in semen plasma and male fertility

    International Nuclear Information System (INIS)

    Objective: To explore the relationship between the trace protein contents in semen plasma and male fertility. Methods: The semen plasma concentrations of albumin (Alb), ?2-microglobulin (?2-m), ?2-microglobulin (?2-m), TH glycoprotein (THP), immunoglobulin G (IgG), secreting-type immunoglobulin A (SIgA), and ferritin (Fer) were determined with RIA in 22 fertile and 125 sterile males. Results: With the exception of ferritin, the semen plasma contents of all these trace proteins in the sterile individuals were lower than those in the fertile ones and there were significant differences (p2-m, Alb and Fer were positively correlated to the sperm counts. Contents of SIgA and IgG could reflect the local immune status of the genital tract. Determination of the contents of these trace proteins in semen plasma would be helpful in the evaluation and management of male infertility

  6. Semen quality and concentration of soluble proteins in the seminal plasma of Alpine bucks Semen quality and concentration of soluble proteins in the seminal plasma of Alpine bucks

    Directory of Open Access Journals (Sweden)

    Simone Eliza Facione Guimarães


    Full Text Available It was aimed to study the in vitro seminal quality analyzed by complementary tests and to compare them with physical, morphological and biochemical aspects of male goat semen of the Alpine breed. This experiment took place at the Federal University of Viçosa, situated at 20º45’ S latitude and 42º51’ W longitude, Southwest of Brazil. It was done during the summer months of January and February, and three adult male goats of the Alpine breed were used in intensive conditions. The semen was collected by artificial vagina method. In all semen samples (45 ejaculates, after the physical and morphological analysis, the hiposmotic test was done. In 24 ejaculates, it were done thermo-resistance test, and in 21 ejaculates it were determined the concentration of total soluble proteins in seminal plasma. The male goats presented difference in the semen physical and morphological aspects, in the hiposmotic test and thermo-resistance test, but they did not presented difference in total soluble proteins concentration in seminal plasma. Results of the slow thermo-resistance test and hiposmotic test were positively correlated (r = 0.60. It was concluded, according to our results, that the concentration of total soluble proteins in seminal plasma can not be used as a parameter to predict the seminal quality of Alpine bucks.It was aimed to study the in vitro seminal quality analyzed by complementary tests and to compare them with physical, morphological and biochemical aspects of male goat semen of the Alpine breed. This experiment took place at the Federal University of Viçosa, situated at 20º45’ S latitude and 42º51’ W longitude, Southwest of Brazil. It was done during the summer months of January and February, and three adult male goats of the Alpine breed were used in intensive conditions. The semen was collected by artificial vagina method. In all semen samples (45 ejaculates, after the physical and morphological analysis, the hiposmotic test was done. In 24 ejaculates, it were done thermo-resistance test, and in 21 ejaculates it were determined the concentration of total soluble proteins in seminal plasma. The male goats presented difference in the semen physical and morphological aspects, in the hiposmotic test and thermo-resistance test, but they did not presented difference in total soluble proteins concentration in seminal plasma. Results of the slow thermo-resistance test and hiposmotic test were positively correlated (r = 0.60. It was concluded, according to our results, that the concentration of total soluble proteins in seminal plasma can not be used as a parameter to predict the seminal quality of Alpine bucks.

  7. Characteristics of seminal plasma and cryopreservation of anoa (Bubalus sp. semen obtained by electroejaculation

    Directory of Open Access Journals (Sweden)



    Full Text Available The population of anoa, which is an endemic fauna to Indonesia, was getting decrease caused by the illegal hunting and deforestation. Anoa is included in endangered species by IUCN, and Appendix I by CITES. The experiment aimed to characterize the seminal plasma contents and to cryopreserve the anoa semen for artificial insemination application in captivity. The experiment was carried out in Taman Safari Indonesia (Bogor. Semen was collected from 2 anesthetized males (4-10 years by electroejaculation. Seminal plasma gained by centrifugation of ejaculate (3000 rpm, 20 minutes, and then was evaluated the biochemical contents. Other ejaculates were evaluated macroscopically and microscopically, and then extended in Tris and Na-citrate media to a total concentration of 100 billion cells mL-1. Extended semen was stored at 4oC, and evaluated the motility and viability every 12 h. Frozen semen was made in Tris medium added with 5% of glycerol. The seminal plasma of anoa contained total lipid, Na, Ca and Mg higher than the buffalo, but its total protein, K and Cl were lower. Electrophoresis of seminal plasma using by SDS-PAGE method showed 10 bands of proteins (17-148 kDa. The motility and viability of chilled-extended semen in Tris and Na-citrate media were not significantly different (P > 0.05 during 72 h of evaluation. Extended semen in both of media may applicable for AI program for 24-48 h. Post thawing motility of frozen semen was still low, 26.00 ± 9.62%. Therefore, it is necessary to improve each stages of semen processing, so the motility will increased and resulted high pregnancy in AI program.

  8. Efecto del plasma seminal sobre el estado redox del semen equino criopreservado

    Directory of Open Access Journals (Sweden)

    Edison Pizarro L.


    Full Text Available Objetivo. Determinar el efecto del plasma seminal sobre la generación de especies reactivas de oxígeno (ERO y la peroxidación lipídica de semen equino criopreservado y su asociación con parámetros de calidad seminal. Materiales y métodos. El semen de cinco caballos de la raza criollo colombiano (dos eyaculados cada uno, fue criopreservado mediante un protocolo de congelación rápida, empleando un diluyente leche-yema de huevo, suplementado con 0%, 10% y 20% de plasma seminal equino. En muestras de semen fresco y criopreservado se evaluó la generación de ERO y la peroxidación lipídica por espectrofluorimetría, y los parámetros de calidad seminal de movilidad progresiva, vitalidad e integridad de membrana, mediante microscopia de contraste de fase. Para el análisis estadístico se ajustaron modelos mixtos y se realizaron análisis de regresión y correlación. Resultados. Se hallaron promedios post-descongelación de movilidad progresiva, vitalidad e integridad de membrana de 37.8%±20.2, 50.6% ± 14.6 y 37.8% ± 15.5, respectivamente. Para el semen fresco y criopreservado suplementado con 0%, 10% y 20% de plasma seminal, los promedios de producción de ERO (URF fueron de 13.34±10.7, 16.15 ± 13.5, 17.32 ± 16 y 22.98 ± 19.4, respectivamente; mostrando un incremento estadísticamente significativo (p?0.05 en la producción de ERO por efecto de la criopreservación y la suplementación con plasma seminal. Los promedios de peroxidación lipídica (nmolMDA/ml para estos mismos tratamientos, fueron de 0.41 ± 0.25, 0.72±0.37, 0.51 ± 0.29 y 0.47±0.26, respectivamente; mostrando una reducción significativa (p?0.05 de la peroxidación lipídica del semen suplementado con 10% y 20% de plasma seminal, respecto al semen no suplementado (0%. Conclusiones. El plasma seminal reduce la peroxidación lipídica del semen equino criopreservado.

  9. Laktosa Mempertahankan Daya Hidup Spermatozoa Kambing Peranakan Etawah yang Dipreservasi dengan Plasma Semen Domba Priangan


    Demianus Ferdinand Souhoka; Michel Johan Matatula; Wilmientje Marlene Mesang-Nalley; Muhammad Rizal


    The purpose of this research was to examine the effect of lactose in Tris extender on theviability of Etawah crossbreed goat spermatozoa which is preserved in the plasma using Prianganram seminal plasma at 3–5oC. Semen was collected using artificial vagina once a week. Freshsemen was divided into four tubes, and centrifuged at 3,000 RPM for 30 min. Supernatant wasremoved and replaced which an equal volume with Priangan ram seminal plasma. Semen in firsttube was diluted with Tris extender-20% ...

  10. Relationship of zinc concentrations in blood and seminal plasma with various semen parameters in infertile subjects

    International Nuclear Information System (INIS)

    To find out relationship of zinc concentrations in blood and seminal plasma with various semen parameters between fertile and infertile men. (JPMC), Karachi and Department of Biochemistry. Basic Medical Sciences Institute, JPMC, Karachi. Fifty eight primary infertile male subjects, without any treatment, who had regular unprotected intercourse for at least 12 months without conception with their partners, aged 20-40 years, were selected from Infertility Clinic Jinnah Postgraduate Medical Center, Karachi. After semen analyses they were grouped as, oligospermic (30), and azoospermic (28). Twenty five known fertile male selected from general population and after semen analysis were taken as normospermic control group. Semen analyzed according to WHO criteria. Serum and seminal plasma zinc were estimated by 5Br. PAPS Colorimetric method. This study showed significant difference in serum and seminal zinc levels in normospermic, oligospermic (p<0.05) and azoospermic (p<0.005). Seminal plasma zinc showed a positive correlation with sperm count and negative with sperm motility in normospermic and oligospermic and negative correlation with volume, pH, WBC concentration in all three groups. There was no correlation found with sperm morphology. On the basis of the findings of this study and those of other reports, zinc may contribute to fertility through its significant effects on various semen parameters. It seems that the estimation of seminal plasma zinc may help in investigation and treatment of infertile males. (author)

  11. Effect of Addition of Concentrated Proteins and Seminal Plasma Low Molecular Weight Proteins in Freezing and Thawing of Equine Semen

    Directory of Open Access Journals (Sweden)

    Bruno Fagundes


    Full Text Available Difficulties in obtaining equine frozen semen with potential fertility are recognized. This study was designed to investigate the effect of seminal plasma on frozen/thawing of eight stallion semen from different breed using the following treatments: Seminal plasma with ten-fold concentrated proteins with molecular weight above 10 kDa on frozen extender; Part of seminal plasma with proteins under 10 kDa on frozen extender; Conventional freezing, using whole seminal plasma on frozen extender. Using the parameter of 30% of seminal motility post-thawing as index of good freezability, it was verified an increased percentage of stallions that presented good freezability when semen was frozen with seminal plasma containing ten-fold concentrated proteins with molecular weight above 10 kDa on frozen extender. These results, suggested the use of seminal plasma concentrated proteins from own stallion to freezing/thawing semen.

  12. Laktosa Mempertahankan Daya Hidup Spermatozoa Kambing Peranakan Etawah yang Dipreservasi dengan Plasma Semen Domba Priangan

    Directory of Open Access Journals (Sweden)

    Demianus Ferdinand Souhoka


    Full Text Available The purpose of this research was to examine the effect of lactose in Tris extender on theviability of Etawah crossbreed goat spermatozoa which is preserved in the plasma using Prianganram seminal plasma at 3–5oC. Semen was collected using artificial vagina once a week. Freshsemen was divided into four tubes, and centrifuged at 3,000 RPM for 30 min. Supernatant wasremoved and replaced which an equal volume with Priangan ram seminal plasma. Semen in firsttube was diluted with Tris extender-20% egg yolk without lactose (control. Semen in second,third, and fourth tubes were diluted with Tris extender-20% egg yolk and 0.3% (0.3 g per 100 mlextender (L0.3, 0.6% (L0.6, and 1.2% (L1.2 lactose, respectively. Diluted-semen were stored inrefrigerator at 3–5oC. Quality of diluted-semen including percentages of motile spermatozoa (MS,live spermatozoa (LS, and intact plasma membrane (IPM were evaluated daily during storage at3–5oC for four days. The data were analyzed by usi analysis of variance (ANOVA. Means werecompared significant difference test at 0.05 significant level. Results of this study showed thatmean volume, colour, consistency, pH, mass activity, spermatozoa concentration, MS, LS,spermatozoa abnormal, and IPM of Etawah crossbreed goat fresh semen were 0.68 ml, cream,thick, 7, ++/+++, 4,148.57 million cell/ml, 70%, 83.89%, 7.12%, and 84%, respectively. Addition oflactose in Tris extender could maintain the quality of semen during preservation. At day-5 ofstorage, the percentages of MS, LS, and IPM for treatment L0.6 (40, 55.6, and 53.8% weresignificantly (P<0.05 higher than treatment L1.2 (36, 50.2, and 51.8%, treatment L0.3 (34, 51.2,and 48.4%, and control (29, 41.4, and 41.8%. In conclusion, addition of 0.6% lactose in Trisextender is the best dose in maintaining the quality of Etawah crossbreed goat spermatozoa, andcould be maintaining percentage of motile spermatozoa 40% for four days after preserved at 3–5oC.

  13. Primary study on the clinical significance of measurement of epidermal growth factor (EGF) and NPY concentrations in human semen plasma

    International Nuclear Information System (INIS)

    Objective: To investigate the difference between the semen plasma contents of EGF and NPY in fertile and non-fertile males with the relevant sperm count and motility. Methods: Semen plasma contents of EGF and NPY were determined with RIA in 110 non-fertile males. Simultaneous semen analysis revealed (1) Group A, n=45, with normal sperm count, (2) Group B, n=34 low sperm count (0-20) x 106/ml and (3) Group C n=31, with aspermia. White blood cell/HPF was examined in all the semen specimens and sperm motile rate and motility were examined in Group A specimens. Results: The semen plasma contents of EGF and NPY in non-fertile males were significantly higher than those in fertile males (P 1 x 106/ml) were significantly lower than those in specimens with more white blood cells (P<0.05). Conclusion: Higher semen plasma contents of EGF and NPY might exert toxic effect on the sperms, contributing to the development of infertility. (authors)

  14. Effect of seminal plasma and egg yolk concentration on freezability of goat semen

    Directory of Open Access Journals (Sweden)

    Valéria da Silva Ferreira


    Full Text Available The objective of this study was to evaluate the effects of egg yolk and seminal plasma on the viability of cryopreserved goat semen. To this end, four fertile Saanen bucks, aged between 10 months and 1 year, and weighing 18 to 25 kg, were used. Semen was collected from each buck by the artificial vagina method at the end of breeding season (June-July. The extender used was the yolk citrate, which was split into two equal aliquots: 5% egg yolk (2.5 mL egg yolk: 47.5 mL citrate solution were added to one of the samples and 10% egg yolk (5.0 mL egg yolk: 45.0 mL citrate solution were added to another. The sperm motility and vigor after thawing and post thermal resistance test (TRT were evaluated and the data were subjected to analysis of variance and means were compared by the F test at 5.0% probability. The observed values for motility and vigor after thawing and post thermal resistance test (TRT, fast and slow, according to the presence of seminal plasma and egg yolk percentage were: 5% egg yolk with plasma (25.0% and 3.3; 1.60% and 0.7; 12.36% and 1.6, respectively; 5% egg yolk without plasma (23.61% and 3.1; 1.25% and 0.2; 9.93% and 1.3, respectively; 10% egg yolk with plasma (30.8% and 3.3; 4.4% and 1.9; 19.5% and 2.7, respectively; and 10% egg yolk without plasma (13.4% and 2.5; 4.1% and 0.5; 17.0% and 1.0, respectively. There were significant differences between the analyzed data in relation to semen with or without plasma at different percentages of egg yolk, and the group that presented the best results was 10% egg yolk citrate in extender with plasma. The presence of seminal plasma and higher concentration of egg yolk in extender provide a higher viability of cryopreserved goat semen.

  15. Effect of seminal plasma and egg yolk concentration on freezability of goat semen

    Scientific Electronic Library Online (English)

    Valéria da Silva, Ferreira; Marco Roberto Bourg de, Mello; Carlos Elysio Moreira da, Fonseca; Állan César Ferreira, Dias; Jéssica Machado, Cardoso; Rebecca Barbosa, Silva; Wagner Pereira, Martins Júnior.


    Full Text Available The objective of this study was to evaluate the effects of egg yolk and seminal plasma on the viability of cryopreserved goat semen. To this end, four fertile Saanen bucks, aged between 10 months and 1 year, and weighing 18 to 25 kg, were used. Semen was collected from each buck by the artificial va [...] gina method at the end of breeding season (June-July). The extender used was the yolk citrate, which was split into two equal aliquots: 5% egg yolk (2.5 mL egg yolk: 47.5 mL citrate solution) were added to one of the samples and 10% egg yolk (5.0 mL egg yolk: 45.0 mL citrate solution) were added to another. The sperm motility and vigor after thawing and post thermal resistance test (TRT) were evaluated and the data were subjected to analysis of variance and means were compared by the F test at 5.0% probability. The observed values for motility and vigor after thawing and post thermal resistance test (TRT), fast and slow, according to the presence of seminal plasma and egg yolk percentage were: 5% egg yolk with plasma (25.0% and 3.3; 1.60% and 0.7; 12.36% and 1.6, respectively); 5% egg yolk without plasma (23.61% and 3.1; 1.25% and 0.2; 9.93% and 1.3, respectively); 10% egg yolk with plasma (30.8% and 3.3; 4.4% and 1.9; 19.5% and 2.7, respectively); and 10% egg yolk without plasma (13.4% and 2.5; 4.1% and 0.5; 17.0% and 1.0, respectively). There were significant differences between the analyzed data in relation to semen with or without plasma at different percentages of egg yolk, and the group that presented the best results was 10% egg yolk citrate in extender with plasma. The presence of seminal plasma and higher concentration of egg yolk in extender provide a higher viability of cryopreserved goat semen.


    Directory of Open Access Journals (Sweden)

    Jelena Api?


    Full Text Available Recently, it was frequently demonstrated that fertility of sows after artificially inseminated is lower than after mating. This is associated with a reduced fertilization capacity of overdiluted insemination doses. The aim of this study was to investigate the sperm motility in the semen samples, forming from the ejaculates with high or low protein content, stored in vitro on 17oC for 3 days. Progressive motility was significantly higher (p<0.01 in the ejaculates with high, compared to the ejaculates with low protein content (82% vs. 76%. After 3 days of storage, in the1:4 dilution proportion, the average progressive motility was significantly (p<0.01 decreased in relation to this value in native semen from the boars with high (82% to64%, as well from the boars with low protein content in seminal plasma (76% to48%. However, the average diluted semen progressive motility was significantly greater (p<0.01 in the boars with high (64%, compared to the boars with low protein content in seminal plasma (48%. The number of good diluted semen samples (?65% progressive motility, was also significantly (p<0.01 greater in the boars with high (41%, compared to the boars with low protein content in seminal plasma (12%. These results show that seminal plasma proteins play an important role in maintaining the sperm progressive motility of diluted semen in vitro stored for 3 days.

  17. Clinical significance of determination of semen plasma IL-2, IL-6, IL-8 and TNF-? contents in infertile males

    International Nuclear Information System (INIS)

    Objective: To explore the influence of high semen plasma contents of the cytokines (IL-2, IL-6, IL-8, TNF-?) on male fertility. Methods: Semen plasma levels of IL-2, IL-6, IL-8, and TNF-? were determined with RIA in 126 infertile and 20 fertile males. Results: Semen plasma contents of the 4 cytokines in infertile subjects were significantly higher than those in fertile ones (p4/HP, n=15) had significantly higher contents of cytokines than those without leucocytospermia (WBC<4/HP, n=111). Besides, TNF-? contents in subjects with lower sperm activity and less motility rate as well as IL-8 contents in subjects with less sperm motility rate were both significantly higher than those in subjects with more normal sperms (p<0.01, p<0.05). Conclusion: High semen plasma cytokines contents represent existing local infection and enhanced auto-immune status, both damaging to sperms. Infertility would be the inevitable consequence. Monitoring of changes of the cytokine contents should be a part of fertility studies

  18. Detection of haptoglobin in seminal plasma of Awassi rams and the relation with its level in serum and some semen parameters


    Dhafer M. Aziz; Ahmad K. Ahmad


    The study was conducted to detect haptoglobin in seminal plasma (SP-Hp) of Awassi rams and the effect of the breeding season on its concentration, along with determining the correlation with its concentration in serum (S-Hp) and main semen variables. Pre-warmed artificial vagina was used to collect semen samples biweekly from five Awassi rams. Semen samples were evaluated for volume, concentration and sperm motility. Blood samples were collected 10–30 min after semen collection. The concentra...

  19. Effect of seminal plasma vesicular structures in canine frozen-thawed semen. (United States)

    Goericke-Pesch, S; Hauck, S; Failing, K; Wehrend, A


    Membrane vesicles (MVs) in the ejaculate have been identified in various species and are considered to affect membrane fluidity due to their characteristic molecular composition. Addition of MV to human frozen semen has been shown to improve post-thaw motility. Similarly, a beneficial effect has been suggested for frozen equine semen. As post-thaw canine semen quality varies widely between dogs, the aim of our study was to test for the effect of addition of canine MV on post-thaw semen quality in dogs. Semen samples from 10 male dogs were purified from MV and prepared for freezing. In experiment 1, three groups were compared: sperm frozen (1) with MV (S1); (2) without MV, but MV added immediately after thawing (S2); and (3) without MV (C). Semen analysis included computer-assisted sperm analysis of motility parameters immediately after thawing (t0), after 10 (t10) and 30 minutes (t30), % living sperm, % membrane intact, % morphologically normal sperm (all t0 and t30). Computer-assisted sperm analysis motility distance and velocity parameters (all P Computer-assisted sperm motility analysis was performed at t0, t10, and t30. No differences between MV concentrations were identified, only a significant interaction between effect of treatment and time for progressive motility (P < 0.01). Our study identified a short-term beneficial effect of canine MV on post-thaw distance and velocity parameters, whereas at t30 progressive motility, motility parameters and % living sperm were reduced in samples with MV compared to C. The results point to species-specific differences regarding the MV effect on frozen semen and indicate the need for further studies using different semen and MV purification protocols and more frequent analyses. At the moment, addition of MV is not an option to improve post-thaw semen quality in dogs. PMID:26296522

  20. Selenium in blood, semen, seminal plasma and spermatozoa of stallions and its relationship to sperm quality. (United States)

    Bertelsmann, H; Keppler, S; Höltershinken, M; Bollwein, H; Behne, D; Alber, D; Bukalis, G; Kyriakopoulos, A; Sieme, H


    The essential trace element selenium is indispensable for male fertility in mammals. Until now, little data existed regarding the relationship between selenium and sperm quality in the stallion. Selenium, or selenium-dependent glutathione peroxidase activity, was determined in red blood cells, semen, seminal plasma and spermatozoa, and the percentages of spermatozoa with progressive motility (PMS), intact membranes (PMI), altered (positive) acrosomal status (PAS) and detectable DNA damage, determined by the sperm chromatin structure assay, were evaluated in 41 healthy stallions (three samples each). The pregnancy rate per oestrus cycle (PRC) served as an estimation of fertility. An adverse effect on stallion fertility caused by low dietary selenium intake was excluded, as all stallions had sufficient selenium levels in their blood. Interestingly, no significant correlations (P > 0.05) between the selenium level in blood and the selenium level in seminal plasma or spermatozoa were found, suggesting that the selenium level in blood is no indicator of an adequate selenium supply for spermatogenesis. The selenium level in spermatozoa (nmol billion(-1)) was correlated with PMI, PMS and PAS (r = 0.40, r = 0.31 and r = -0.42, respectively; P

  1. Quantification of leptin in seminal plasma of buffalo bulls and its correlation with antioxidant status, conventional and computer-assisted sperm analysis (CASA) semen variables. (United States)

    Kumar, Pradeep; Saini, Monika; Kumar, Dharmendra; Jan, M H; Swami, Dheer Singh; Sharma, R K


    The present study is the first to quantify leptin in seminal plasma of buffalo and investigate its relationship with seminal attributes. Ten ejaculates each from 10 Murrah buffalo bulls were collected. Semen quality variables such as semen volume, sperm concentration, sperm abnormalities, membrane integrity, antioxidant enzyme activities (superoxide dismutase, catalase and total antioxidant capacity), malondialdehyde (MDA) concentration, as well as sperm kinetics and motility variables were evaluated. The leptin concentration in serum and seminal plasma were estimated by the ELISA method. Bulls were classified in two groups on the basis of sperm concentration with Group I having >800 million sperm/mL and Group II kinetic and motility variables, sperm membrane integrity and seminal plasma antioxidant enzyme activity. Thus, the data suggest that seminal leptin has a role in spermatogenesis and can be used as a marker for spermatogenesis to predict the capacity of buffalo bulls for semen production. PMID:26796919

  2. Selección Espermática en Semen Congelado/Descongelado de Equino: Evaluación de las Membranas Plasmática, Acrosomal y Potencial de Membrana Mitocondrial / Sperm Selection in Frozen/Thawed Semen of Equine: Evaluation of Plasma, Acrosome Membranes and Mitochondrial Membrane Potential

    Scientific Electronic Library Online (English)

    Paulina, Cabrera; Raúl, Sánchez; Jennie, Risopatrón.


    Full Text Available Los procedimientos de criopreservación inducen cambios morfofuncionales en los espermatozoides. Es importante post descongelación espermática utilizar procedimientos de selección que permitan recuperar espermatozoides altamente funcionales. El objetivo del presente estudio fue comparar la eficiencia [...] del Swim-up y Equipure® en la selección de espermatozoides funcionales en semen descongelado de equino. Semen de 4 potros reproductores Criollos Chilenos (A, B, C y D), fueron descongelados separadamente y procesados (n=15) por: I.- Swim-up (SU) y II.- Equipure® (EQ). Post descongelación se determinó por citometría de flujo la viabilidad e integridad de membrana plasmática (SYBR-14/PI), potencial de membrana mitocondrial (YDm; JC-1), integridad de la membrana acrosomal (FITC-PSA/PI). La motilidad progresiva (%) en dos animales fue más alta (P Abstract in english Freeze-thaw procedures induce structural and functional changes in sperm. It is important to use post thaw sperm selection procedures that can retrieve highly functional sperm. The aim of this study was to compare the efficiency of the Swim-up and Equipure® in the selection of functional sperm of th [...] awed equine semen. Semen of four Chilean Criollo reproductive stallions (A, B , C and D) were frozen and thawed using a standard protocol and processed separately (n = 15) : I. Swim-up (SU) and II. Equipure® (EQ). Post sperm selection,was determined by flow cytometry. Viability and plasma membrane integrity (SYRB-14/PI), mitochondrial membrane potential (YDm, JC -1), acrosome membrane integrity (FITC-PSA/PI). Progressive motility (%) was higher (P

  3. Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

    Directory of Open Access Journals (Sweden)

    Tathiana Ferguson Motheo


    Full Text Available This study aimed to determine the effects of different concentrations of botulinum toxin type A (BT-A on semen parameters, and seminal plasma biochemical and protein profiles of dogs with benign prostatic hyperplasia (BPH. Eighteen sexually intact male dogs with BPH were randomly divided in three groups, and received an intraprostatic injection of saline solution (control group - CG, 250UI (GI or 500UI (GII of BT-A under transabdominal ultrasound guidance. Semen was collected at baseline, 2, 4 and 8 weeks after treatment. Semen parameters were determined and seminal plasma pH, total protein (TP, total chlorides (TC, calcium (Ca, potassium (K, and sodium (Na concentrations were assessed. One-dimensional sodium dodecyl sulfatepolyacrilamide gel eletrophoresis (SDS- PAGE was performed to determine seminal plasma protein profile. Sperm parameters and seminal plasma pH, TP, TC, Ca and K mean values did not change significantly at any time point and among treated groups (P>0.05. The SDS-PAGE analysis of the pooled fractions identified 31 protein bands with molecular weights ranging from 3.9 to 106.2kDA in all treatment groups during the entire evaluation period. Regardless the used dose, intraprostatic BT-A injection do not alter semen parameters and seminal plasma biochemical and protein profiles of dogs with BPH.

  4. Proteínas do plasma seminal de caprinos relacionadas com o índice pluviométrico e a qualidade do sêmen Proteins of goat seminal plasma related with precipitation index and semen quality

    Directory of Open Access Journals (Sweden)

    Andreia Fernandes de Souza


    Full Text Available O objetivo deste estudo foi identificar as proteínas do plasma seminal de caprinos da raça Alpina Americana criados na região Nordeste do Brasil que estão relacionadas ao índice pluviométrico e à qualidade do sêmen. O sêmen foi obtido pelo método de vagina artificial a partir de três reprodutores e foi avaliado quanto aos parâmetros macroscópicos e microscópicos. O perfil de proteínas do plasma seminal foi realizado por eletroforese bidimensional. Os parâmetros volume do sêmen, integridade do acrossoma e proteínas totais evidenciaram diferença significativa (PThe aim of this study was to identify proteins in seminal plasma of goats raised in the Northeast of Brazil related with precipitation index and semen quality. Semen was obtained from three bucks and evaluated to the microscopic and macroscopic parameters. The profile of seminal plasma proteins was performed by analysis of two-dimensional electrophoresis. Volume, acrosome integrity and total proteins had significant difference (P<0.05 between the periods of high (1.7mL, 90.3% and 372g mL-1, respectively and low (1.2mL, 80.3% and 494µg mL-1, respectively precipitation index. It was detected during high and low precipitation index, 47 and 49 spots of proteins with molecular weight of 4 to 106kDa and 15 to 97kDa, and isoelectric point of 3.00 to 8.96, and 4.48 to 9.83, respectively. Only in the period of high precipitation index were observed groups of proteins with 13kDa and 45kDa. It can be concluded that semen of Alpine American goats raised in the Northeast of Brazil has best quality when obtained in the period of high precipitation index, which can be attributed to the presence of protein with 13kDa and 45kDa.

  5. [Semen allergy]. (United States)

    Allam, J-P; Haidl, G; Novak, N


    A semen allergy is a type I reaction. Reliable figures about incidence/prevalence are not available. Symptoms can be characterized as local and systemic. After exposure to ejaculate, the patient may experience itching and swelling at points of contact, while systemically it may also lead to generalized urticaria with angioedema or higher grade anaphylaxis. As triggering allergens, substances in seminal plasma (SP) have been identified, which can be SP typical or SP atypical. Reactions against spermatozoa have not yet been clearly proven. With regard to SP-typical allergens, prostate-specific antigen (PSA) has been identified, while for SP-atypical allergens, medications or food allergens have been reported, which apparently accumulate in the SP and can then trigger symptoms in women with existing sensitization. The main criteria for the diagnosis of sperm allergy is freedom from symptoms when condoms are used during intercourse. In addition, skin prick tests and determination of allergen-specific IgE are used. In patients with a desire for children, washed, SP-free spermatozoa can be used for insemination. In addition, desensitization may be considered. PMID:26490774

  6. Identifying useable semen. (United States)

    Foxcroft, G R; Dyck, M K; Ruiz-Sanchez, A; Novak, S; Dixon, W T


    The "predictors of useable semen" used in most commercial AI centers provide a very conservative estimate of the relative fertility of individual boars. Furthermore, the relatively high sperm numbers used in commercial AI practice (usually >3 x10(9) total sperm per dose of extended semen) usually compensate for reduced fertility, as can be demonstrated in some boars when lower numbers of sperm are used for AI. Differences in relative boar fertility are also masked by the widespread use of pooled semen for commercial AI in many countries. However, the need to continually improve the efficiency of pork production, suggests that commercial AI practice should involve increased use of boars with the highest genetic merit for important production traits. Necessarily, this must be linked to the use of fewer sperm per AI dose, fewer inseminations per sow bred, and hence more sows bred by these superior sires. In turn, this requires improved techniques for evaluating semen characteristics directly related to the fertilization process, such as IVM-IVF assays, analysis of seminal plasma protein markers, more discriminatory tests of sperm motility and morphology, with the goal of identifying high-index boars whose fertility is sustained when low numbers of sperm are used for AI. This paper reviews the current status of laboratory-based boar semen evaluation techniques that meet these criteria. PMID:18775561

  7. Alergia al semen / Semen allergy

    Scientific Electronic Library Online (English)

    Laura, Franco Cuadros; Jenniffer, Puerta Suárez; Ángela, Cadavid Jaramillo; Walter, Cardona Maya.


    Full Text Available La alergia al semen comprende una variedad de síntomas tanto locales como sistémicos causados por reacciones de hipersensibilidad inmediata y caracterizados por títulos elevados de IgE. El objetivo de este estudio es describir el caso de una paciente con alergia al semen: mujer de 21 años de edad qu [...] e presenta ardor y sensación de quemazón en el área genital luego de tener contacto con el semen de su pareja. El análisis seminal del compañero sexual no presenta ningún tipo de alteración. Los síntomas desaparecen con el uso de condón o con la práctica del coito interrumpido. La alergia al semen es una alteración, que si bien es poco frecuente, puede afectar los deseos de concepción de las mujeres que la presentan, es un fenómeno poco estudiado por lo que se requieren más reportes para su caracterización. Abstract in english Semen allergy includes several local and systemic symptoms caused by immediate hypersensitivity reactions and it is characterized by high levels of IgE. The objective of this study was to describe the case of a patient with semen allergy. A 21 year-old woman experienced itching and burning sensation [...] in the genital area after contact with the semen of her sexual partner. Semen analysis was normal. Symptoms disappear with the use of condom or the practice of coitus interruptus. Semen allergy is a condition, although rare, can affect the desire of conceiving in women who suffers it. It is a briefly studied phenomenon which requires more reports for proper characterization.

  8. Crioprotetor para sêmen de carneiro a base de plasma de gema mantém membrana acrossomal intacta após a descongelação / Ram semen cryoprotector based on egg yolk plasma maintain the viability of acrosomal membrane

    Scientific Electronic Library Online (English)

    Ivo Walter dos, Santos; Jandui Escarião da, Nóbrega Junior; Matheus Pedrotti de, Cesaro; Gustavo Freitas, Ilha; Monique Tomazele, Rovani; Paulo Bayard Dias, Gonçalves.


    Full Text Available O presente estudo teve como objetivo avaliar a capacidade crioprotetora das lipoproteínas de baixa densidade (LDL) presentes no plasma de gema de ovo, adicionado ao trihidroxiaminometano (TRIS) para congelar sêmen ovino. Trinta e seis ejaculados foram coletados para formar 12 "pool". Cada alíquota d [...] e sêmen foi diluída em TRIS-gema de ovo (TRISG) ou TRIS- plasma de gema de ovo (TRISP) antes de congelar o sêmen. Para a obtenção do plasma da gema de ovo, foi utilizado o método de ultracentrifugação. Após o descongelamento, não houve diferença entre os dois extensores em relação aos parâmetros seminais (motilidade, viabilidade, membrana acrossômica e plasma). No entanto, no Teste de Termo Resistência Lenta (TTRL - 4h/38°C), o sêmen congelado com TRISP resultou no aumento do número de espermatozoides com acrossoma intacto (P Abstract in english The present study aimed to evaluate the cryoprotectant low-density lipoprotein (LDL) present in the plasma of egg yolk added to the extender trihidroxiaminometano (TRIS) for freezing ram semen. Thirty-six ejaculates were collected to form 12 pool. Each aliquot of semen was diluted in TRIS-egg yolk ( [...] TRISG) or TRIS-egg yolk plasma (TRISP) before freezing the semen. The plasma of egg yolk was obtained by ultracentrifugation. After thawing, no difference was detected between the two extenders in relation to seminal parameters (motility, viability, plasma membrane and acrosome). However, in the thermal resistance slow test (4h in a water bath at 38°C), the semen frozen with TRISP resulted in higher number of sperm with intact acrosome than those with TRISG (P

  9. Calcium, Magnesium and Total Antioxidant Capacity (TAC in Seminal Plasma of Water Buffalo (Bubalus Bubalis Bulls and their Relationships with Semen Characteristics

    Directory of Open Access Journals (Sweden)

    Mohammad-Hassan Khadem Ansari


    Full Text Available In order to determine calcium (Ca, magnesium (Mg content and total antioxidant capacity (TAC of seminal plasma in buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls; semen quality was evaluated, seminal plasma was then harvested by centrifugation and its Ca and Mg content were estimated and its TAC determined. The Ca and Mg content of the seminal plasma (Mean ± SEM were recorded as 22.36 ± 0.52 mg dl-1 and 11.94 ± 0.36 mg dl-1 respectively, while, its mean TAC value was 1.50 ± 0.02 mmol L-1. The mean Ca value was highly associated with sperm progressive motility, gross motility, viability (P = 0.000 for all, negatively with semen volume (P = 0.01, and with Mg and TAC values (P = 0.000 for both. The mean Mg values was highly associated with sperm progressive motility, gross motility and viability and seminal plasma Ca and TAC (P = 0.000 for all and negatively associated with semen volume (P = 0.014. The mean TAC values was highly associated with sperm progressive motility, gross motility and viability and seminal plasma Ca and Mg (P = 0.000 for all. For further clarification of these associations, the data was categorized in three groups of excellent (Ex, >90% motile, n = 33, good (Go, 80-89% motile, n = 15 and moderate (Mo, <79% motile, n = 6 according to their percentage of sperm motility. The mean progressive motility in Ex group was 92.24 ± 0.51%, in Go group it was 81.66 ± 0.62 %, and in Mo group it was 71.66 ± 1.05 %. The mean Ca, Mg and TAC values were respectively recorded as 25.12 ± 0.29 mg dl-1, 13.78 ± 0.20 mg dl-1, and 1.57 ± 0.009 mmol L-1 in Ex, 18.74 ± 0.63 mg dl-1, 9.14 ± 0.33mg dl-1, and 1.42 ± 0.044 mmol L-1 in Go, and 17.34 ± 0.18 mg dl-1, 8.06 ± 0.25 mg dl-1, and 1.23± 0.05 mmol L-1 in Mo groups. The associations in groups are discussed. These results show that seminal plasma Ca and Mg content and TAC are associated with semen characteristics, and synergistically have an effect on motility and viability of the spermatozoa after ejaculation, which are important factors in semen fertility.

  10. Effect of heterologous seminal plasma and semen extenders on motility of frozen-thawed ram spermatozoa

    Directory of Open Access Journals (Sweden)

    G.A. Mataveia


    Full Text Available Ram seminal plasma increases the fertility of frozen-thawed ram spermatozoa deposited into the cervix. The aim of the current study was to compare the effect of ram seminal plasma to that of bull seminal plasma, dog prostatic fluid, protein-free TALP, TrilEq (Triladyl with 0.5 m? of Equex STM paste added to each 100 m? and heat-treated skim milk on longevity and percentages of progressively motile and aberrantly motile frozen-thawed ram spermatozoa. Three ejaculates from each of 6 rams were extended in TrilEq, pooled and frozen in straws as a single batch per ram. One hundred and eight straws (3 straws from each ram for each fluid were thawed in random order. Once thawed, a straw was emptied into a tube with 0.85m? of the appropriate fluid at 37 °C and kept at that temperature for 6 h. Motility was assessed at x200 magnification immediately (time zero and 2, 4 and 6 h after thawing. Progressive motility decreased from each time to the next (P < 0.05 and was 39.0% (0 h, 26.0% (2 h, 19.6% (4 h and 12.6% (6 h; SEM 1.24, n=108 for each group. Ram seminal plasma resulted in higher progressive motility than bull seminal plasma, lower than milk, and similar to the other fluids. Ram seminal plasma resulted in lower aberrant motility than protein-free TALP and similar aberrant motility to other fluids. The effect of ram seminal plasma and dog prostatic fluid was very similar. The effect of ram seminal plasma on the fertility of frozen-thawed ram spermatozoa deposited into the cervix is not due an exceptionally beneficial effect on the motility of spermatozoa.

  11. Phospholipase A1-catalyzed hydrolysis of soy phosphatidylcholine to prepare l-?-glycerylphosphorylcholine in organic-aqueous media. (United States)

    Bang, Hyo-Jeong; Kim, In-Hwan; Kim, Byung Hee


    This study aimed to optimize the preparation of L-?-glycerylphosphorylcholine (l-?-GPC) via phospholipase A1 (Lecitase Ultra)-catalyzed hydrolysis of soy phosphatidylcholine (PC). The reaction was performed in n-hexane-water biphasic media in a stirred batch reactor, and modeling and optimization were conducted using response surface methodology. Optimal conditions to completely hydrolyze PC to L-?-GPC were: temperature, 50 °C; reaction time, 30 h; water content, 69 g/100 g of PC weight; and enzyme loading, 13 g/100 g of PC weight. The optimal n-hexane-to-water ratio in the medium was 5.8:1 (v/v), and 21.3g of PC was treated as the substrate in 100 mL of the medium. L-?-GPC with purity 99.3 g/100 g was obtained from the reaction products after diethyl ether extraction and silica column chromatography. These findings suggest that the use of n-hexane-water media increases the productivity of l-?-GPC compared to the aqueous media used in enzymatic reaction systems in other published studies. PMID:26212962

  12. Localization and characterization of glutathione peroxidase (GPx) in boar accessory sex glands, seminal plasma, and spermatozoa and activity of GPx in boar semen. (United States)

    Jelezarsky, L; Vaisberg, Ch; Chaushev, T; Sapundjiev, E


    Boar ejaculate owes its characteristic large volume mainly to accessory sex gland (ASG) secretions. These are main contributors to the protective functions of seminal plasma, especially against oxidative damage. Numerous antioxidants have been detected in ASG secretions, and, respectively, in seminal plasma. However, as regards one key antioxidant protector -- the Se-dependent enzyme glutathione peroxidase (GPx) -- there is no agreement yet among researchers as to its presence in boar seminal plasma. Nevertheless, the beneficial effect of dietary Se supplementation on male fertility has been widely recognized. The aim of the present study was to investigate the localization and characterization of GPx in boar ASGs, seminal plasma, and spermatozoa, as well as to evaluate GPx activity in boar semen. Immunohistochemical assays demonstrated GPx presence in the epithelial cells, vacuole membranes, and vascular endothelium of boar seminal vesicle, prostate and bulbourethral glands. Western blot analysis demonstrated the presence of a monomer form of GPx with MW 20 kDa in lysates from seminal vesicle, prostate, bulbourethral glands, and spermatozoa, but not in seminal plasma. Surprisingly, peroxidase activity detected in seminal plasma from normal ejaculates was nearly three times as high as in spermatozoa. Our findings confirmed the presence of immunoreactive GPx in the boar reproductive tract, while further investigation is still warranted to uncover the exact protein forms involved and their function. PMID:17964641

  13. Efeito de proteínas do plasma seminal eqüino com massa superior a 10 kDa concentradas 10 vezes sobre a congelabilidade do sêmen Effect of high concentration of protein of the equine seminal plasma on semen cryopreservation

    Directory of Open Access Journals (Sweden)

    Marcus Antonio Pessanha Barreto


    Full Text Available Objetivou-se avaliar os efeitos da adição de concentrados de proteínas do plasma seminal (PPS no diluente de congelamento sobre a congelabilidade do sêmen eqüino. Foram avaliados três tratamentos: um controle, no qual o sêmen foi congelado no diluente Botu-Crio®; e outros dois, com adição de 10% ou 20% (v/v de proteínas do plasma seminal ao diluente. As maiores médias de motilidades total e progressiva foram observadas no tratamento controle, que foram superiores às obtidas com adição de 20% de proteínas, mas não diferiram das obtidas com adição de 10% de PPS. Os resultados do teste hiposmótico e do número de espermatozóides vivos obtidos com o congelamento do sêmen no diluente (controle foram superiores aos encontrados com a adição de 10% de PPS, que, por sua vez, foram melhores que os observados com a adição de 20% de PPS ao diluente. A adição do concentrado de proteínas do plasma seminal não melhora os parâmetros espermáticos do sêmen eqüino.The aim of this study was to evaluate the effect of increasing the concentration of protein of the seminal plasma in the extender used for frozing equine semen. Three treatments were compared: The conventional one, defined by using only the Botu-Crio® extender for frozing semen; and other two defined by adding 10% (v/v or 20% (v/v of seminal plasma proteins to Botu-Crio® extender. Averages of total and progressive motility were statistically higher in the conventional treatment than in that defined by adding 20% (v/v of seminal plasma proteins but they did not differ from those obtained by adding 10% (v/v of seminal plasma proteins to Botu-Crio® extender. The best results for the hypoosmotic test and the number of live spermatozoa were obtained in the conventional treatment, and results for adding 10% (v/v of seminal plasma proteins were better than those obtained by adding 20% (v/v of seminal plasma proteins to Botu-Crio® extender. These results indicate that the addition of concentrated protein of the seminal plasma to the extender did not improve the cryopreservation of equine semen.

  14. Efeito de proteínas do plasma seminal eqüino com massa superior a 10 kDa concentradas 10 vezes sobre a congelabilidade do sêmen / Effect of high concentration of protein of the equine seminal plasma on semen cryopreservation

    Scientific Electronic Library Online (English)

    Marcus Antonio Pessanha, Barreto; José Frederico Straggiotti, Silva; Bruno, Fagundes; José Renato Costa, Caiado; Guilherme Valente de, Souza; Aldo, Shimoya.


    Full Text Available Objetivou-se avaliar os efeitos da adição de concentrados de proteínas do plasma seminal (PPS) no diluente de congelamento sobre a congelabilidade do sêmen eqüino. Foram avaliados três tratamentos: um controle, no qual o sêmen foi congelado no diluente Botu-Crio®; e outros dois, com adição de 10% ou [...] 20% (v/v) de proteínas do plasma seminal ao diluente. As maiores médias de motilidades total e progressiva foram observadas no tratamento controle, que foram superiores às obtidas com adição de 20% de proteínas, mas não diferiram das obtidas com adição de 10% de PPS. Os resultados do teste hiposmótico e do número de espermatozóides vivos obtidos com o congelamento do sêmen no diluente (controle) foram superiores aos encontrados com a adição de 10% de PPS, que, por sua vez, foram melhores que os observados com a adição de 20% de PPS ao diluente. A adição do concentrado de proteínas do plasma seminal não melhora os parâmetros espermáticos do sêmen eqüino. Abstract in english The aim of this study was to evaluate the effect of increasing the concentration of protein of the seminal plasma in the extender used for frozing equine semen. Three treatments were compared: The conventional one, defined by using only the Botu-Crio® extender for frozing semen; and other two define [...] d by adding 10% (v/v) or 20% (v/v) of seminal plasma proteins to Botu-Crio® extender. Averages of total and progressive motility were statistically higher in the conventional treatment than in that defined by adding 20% (v/v) of seminal plasma proteins but they did not differ from those obtained by adding 10% (v/v) of seminal plasma proteins to Botu-Crio® extender. The best results for the hypoosmotic test and the number of live spermatozoa were obtained in the conventional treatment, and results for adding 10% (v/v) of seminal plasma proteins were better than those obtained by adding 20% (v/v) of seminal plasma proteins to Botu-Crio® extender. These results indicate that the addition of concentrated protein of the seminal plasma to the extender did not improve the cryopreservation of equine semen.

  15. INAA determination of selenium via sup(77m)Se in plasma, semen and hair samples from beef and dairy bulls

    International Nuclear Information System (INIS)

    Interest in the element selenium with respect to its biological significance has been steadily increasing for the last ten years. Neutron activation analysis has long been used for the accurate determination of selenium in biological samples usually via 75Se. More recently activation analysts having access to high flux reactors with rapid delivery pneumatic tube facilities; have successfully employed sup(77m)Se. This approach, which is much faster, is particularly well suited to the Missouri University Research Reactor (MURR). The specific interest concerning bulls has to do with the involvement of selenium in the reproductive system. Selenium analysis methodology and data on plasma, semen and 22 tissues from both beef and dairy bulls are presented. (author)

  16. Adição de plasma seminal ao sêmen descongelado e taxa de prenhez de ovelhas inseminadas em tempo fixo / Addition of seminal plasma to frozen-thawed semen and pregnancy rate of fixed time inseminated ewes

    Scientific Electronic Library Online (English)

    O.R., Prado; G.M., Bastos; A.L.G., Monteiro; B.B., Saab; S., Gilaverte; C.C., Pierobom; F., Hentz; L.H.S., Martins; C.J.A., Silva; G.S., Dranca; T.S.S., Stivari; G., Cerqueira.


    Full Text Available Avaliou-se o efeito da adição de plasma seminal ovino ao sêmen descongelado sobre a taxa de prenhez de ovelhas em rebanho comercial. Cento e setenta e quatro ovelhas cruza Texel foram distribuídas em quatro tratamentos: T1) inseminação artificial cervical (IAC) com sêmen descongelado (SD) diluído em [...] solução tampão fosfato salino (PBS); T2) IAC com SD e adição de plasma seminal ovino; T3) grupo-controle I: IAC com sêmen fresco diluído em PBS; T4) grupo-controle II: inseminação artificial por laparoscopia com SD diluído em PBS. Para indução de cio, utilizaram-se esponjas impregnadas com acetato de medroxiprogesterona (MAP) por 12 dias, com aplicação intramuscular de 400 UI de eCG (Novormon®) e de 37,5µg de cloprostenol sódico (Sincrocio®), no dia da retirada das esponjas. O aparecimento de cio foi monitorado com rufiões vasectomizados a partir da retirada das esponjas até a inseminação artificial em tempo fixo - 54 a 60 horas. A taxa de prenhez do tratamento com adição de plasma seminal ao sêmen descongelado (7,0%) não diferiu (P>0,05) do tratamento sem adição de plasma (4,3%), entretanto foi menor (P Abstract in english The effect of seminal plasma addition to thawed-frozen ram semen on the pregnancy rate of commercial herd ewes was evaluated. One hundred and seventy-four crossbred Texel sheep were allocated to four treatments: T1) cervical artificial insemination (CAI) using frozen-thawed semen (FTS) diluted in ph [...] osphate buffered saline solution (PBS); T2) CAI using FTS diluted in ovine seminal plasma; T3) control group I: CAI using fresh semen diluted in PBS; T4) control group II: laparoscopic insemination using FTS diluted in PBS. Estrus induction was performed with medroxiprogesterone acetate (MAP) impregnated sponges for 12 days, followed by intramuscular injection of 400 IU of eCG (Novormon®) and 37.5µg of sodium cloprostenol (Sincrocio®) on the day of sponge removal. Estrus was monitorated with vasectomized rams, beginning at the time of the sponge removal until the fixed time artificial insemination - 54 to 60 hours. The pregnancy rate of FTS diluted in seminal plasma treatment (7.0%) did not differ (P>0.05) for the treatment without addition of seminal plasma (4.3%), however it was lower (P

  17. Caracterização de proteínas do plasma seminal e sua relação com parâmetros de qualidade do sêmen criopreservado em ovinos Characterization of seminal plasma proteins and its relationship with quality parameters of frozen semen in ram

    Directory of Open Access Journals (Sweden)

    Priscilla Pereira Moura


    Full Text Available Os objetivos deste trabalho foram analisar o perfil proteico do plasma seminal ovino e identificar proteínas relacionadas com a congelabilidade do sêmen que possam ser utilizadas como marcadores para essa característica. Foram utilizados os ejaculados de cinco reprodutores, nos quais foram realizadas avaliações espermáticas e dos quais os plasmas seminais obtidos por centrifugação foram submetidos à eletroforese bidimensional em gel de poliacrilamida. Foram identificados 92 spots, considerando todos os animais analisados. A avaliação dos dados obtidos evidenciou variações significativas nos resultados das análises do sêmen dos animais e uma variabilidade no perfil proteico no plasma seminal dos carneiros. As proteínas 03 (7,9kDa; pI 6,35, 23 (13,6kDa; pI 5,01 e 31 (21,4kDa; pI 4,75 se destacaram, por apresentarem maior expressão e relações com as características espermáticas. Sugere-se que mais estudos sejam realizados para verificar se as proteínas 03, 23 e 31 podem ser utilizadas como marcadores da capacidade criopreservadora do sêmen.The objective of this study was to analyze the protein profile of ram seminal plasma and to identify proteins associated with semen freezability, which could be used as marker for predicting this feature. Semen from five rams was used. The sperm analysis was held and the seminal plasma obtained by centrifugation was submitted to two-dimensional electrophoresis using acrylamide gel. Ninety two spots were identified considering the analyzed animals. The results showed a significant variation among sperm analysis of the animals and variability in the protein profile of the seminal plasma of the rams. The proteins 03 (7.9kDa; pI 6.35, 23 (13.6kDa; pI 5.01 e 31 (21.4kDa; pI 4.75 stood out because they showed higher expression and because of its relationship with the sperm characteristics. It is suggested more studies to verify if proteins 03, 23 and 31 could be used as markers of semen freezability.

  18. Caracterização de proteínas do plasma seminal e sua relação com parâmetros de qualidade do sêmen criopreservado em ovinos / Characterization of seminal plasma proteins and its relationship with quality parameters of frozen semen in ram

    Scientific Electronic Library Online (English)

    Priscilla Pereira, Moura; Maurício Machaim, Franco; Thiago Antônio de Souza Nascimento, Silva; Thales Lima, Rocha; Diogo Ramos, Leal; Pedro Ivo Braga, Passos; Jairo Pereira, Neves.


    Full Text Available Os objetivos deste trabalho foram analisar o perfil proteico do plasma seminal ovino e identificar proteínas relacionadas com a congelabilidade do sêmen que possam ser utilizadas como marcadores para essa característica. Foram utilizados os ejaculados de cinco reprodutores, nos quais foram realizada [...] s avaliações espermáticas e dos quais os plasmas seminais obtidos por centrifugação foram submetidos à eletroforese bidimensional em gel de poliacrilamida. Foram identificados 92 spots, considerando todos os animais analisados. A avaliação dos dados obtidos evidenciou variações significativas nos resultados das análises do sêmen dos animais e uma variabilidade no perfil proteico no plasma seminal dos carneiros. As proteínas 03 (7,9kDa; pI 6,35), 23 (13,6kDa; pI 5,01) e 31 (21,4kDa; pI 4,75) se destacaram, por apresentarem maior expressão e relações com as características espermáticas. Sugere-se que mais estudos sejam realizados para verificar se as proteínas 03, 23 e 31 podem ser utilizadas como marcadores da capacidade criopreservadora do sêmen. Abstract in english The objective of this study was to analyze the protein profile of ram seminal plasma and to identify proteins associated with semen freezability, which could be used as marker for predicting this feature. Semen from five rams was used. The sperm analysis was held and the seminal plasma obtained by c [...] entrifugation was submitted to two-dimensional electrophoresis using acrylamide gel. Ninety two spots were identified considering the analyzed animals. The results showed a significant variation among sperm analysis of the animals and variability in the protein profile of the seminal plasma of the rams. The proteins 03 (7.9kDa; pI 6.35), 23 (13.6kDa; pI 5.01) e 31 (21.4kDa; pI 4.75) stood out because they showed higher expression and because of its relationship with the sperm characteristics. It is suggested more studies to verify if proteins 03, 23 and 31 could be used as markers of semen freezability.


    Directory of Open Access Journals (Sweden)



    Full Text Available The investigation was performed to evaluate the dog semen freezability and itsquality after thawing allowing its use for artificial insemination (AI. On the basis ofsperm motility, concentration and alkaline phosphatase (AP activity in semenplasma it was possible to establish that AP activity corresponds with the basic factorof semen examination. Significant statistical differences occurred between thequality of ejaculates which were qualified or disqualified to deep freezing and AI.These results show that AP activity in raw dog semen plasma can be used as amarker for the dog semen qualification for deep freezing and AI with 95%probability of the prognosis of the results.

  20. Role of amino acids as additives on sperm motility, plasma membrane integrity and lipid peroxidation levels at pre-freeze and post-thawed ram semen. (United States)

    Sangeeta, Sharon; Arangasamy, A; Kulkarni, S; Selvaraju, S


    The possibility of including amino acids for cryopreservation of ram semen to improve the quality of frozen semen was explored in this study in sheep model. 24 samples were collected in triplicate from 8 rams of 2-3 year old Bannur cross bred rams maintained at the Institute Experimental Livestock Unit. Semen was diluted in tris-egg yolk glycerol diluent and made into 7 aliquots as follows: aliquot 1 served as control, "l-alanine" was added at 100 and 135mM in the aliquots 2 and 3, "l-glutamine" was added at 20 and 25mM in the aliquots 4 and 5 and "l-proline" was added at 25 and 50mM in the aliquots 6 and 7, respectively. Diluted semen was filled in 0.25ml French straws and frozen in LN2. Inclusion of "l-proline" and "l-glutamine" in the diluent increased the percent live sperm (Pram semen as they prevented cryoinjuries to sperm and improved the pre-freeze and post-thaw semen characteristics. PMID:26362050

  1. Reproduction in nondomestic birds: Physiology, semen collection, artificial insemination and cryopreservation (United States)

    Gee, G.F.; Bertschinger, H.; Donoghue, A.M.; Blanco, J.; Soley, J.


    Pioneering work by Quinn and Burrows in the late 1930s led to successful artificial insemination (AI) programs in the domestic poultry industry. A variety of species specific modifications to the Quinn and Burrows massage technique made AI possible in nondomestic birds. Massage semen collection and insemination techniques span the entire range of species from sparrows to ostriches. Also, cooperative semen collection and electroejaculation have found limited use in some nondomestic species. Artificial insemination produces good fertility, often exceeding fertility levels in naturally copulating populations. However, aviculturists should explore other ways to improve fertility before resorting to AI. Artificial insemination is labor intensive and may pose risks to nondomestic birds as well as handlers associated with capture and insemination. Semen collection and AI makes semen cryopreservation and germ plasma preservation possible. Yet, semen cryopreservation techniques need improvement before fertility with frozen-thawed semen will equal fertility from AI with fresh semen.

  2. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen

    Directory of Open Access Journals (Sweden)

    G.V. Aguiar


    Full Text Available The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile (fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity were analyzed. It was observed a reduction (P<0.05 in normal sperm morphology, fructose, citric acid, P, Mg and total protein concentration during the dry season, which did not affect the motility, vigor, volume and sperm concentration. Phospholipase A2 activity was increased during the dry season (P<0.05. The analysis of the semen cooled at 4ºC during 48 hours showed reduction in total motility and vigor sperm during the dry season (P<0.05. Based on these results, we conclude that the best period of year for caprine semen cooling is the rainy season.


    Scientific Electronic Library Online (English)

    Francisco Javier, Henao Uribe; Julián Alonso, Valencia Giraldo; Orlando, Díaz Franco; Marcos Yesid, Rangel Sierra.


    Full Text Available Las gotas citoplásmicas (GCs) son remanentes del citoplasma que quedan adheridos al espermatozoide después de la espermatogénesis, constituyen la anormalidad espermática más frecuente en porcinos, y se relacionan claramente con baja fertilidad. Hay serios indicios de que la fructosa y el AMPc del pl [...] asma seminal intervienen en la maduración espermática, en el desprendimiento de las GCs, y en la reacción acrosómica. El objetivo del presente estudio fue evaluar el efecto de la adición de plasma seminal, en el desprendimiento de las GCs en machos con diagnóstico de persistencia de las mismas. En el estudio se emplearon tres verracos (dos con persistencia de GCs y uno normal) de tres a cinco años de edad, alojados en la granja Montelindo de la Universidad de Caldas; a los cuales se les realizaron análisis seminales semanales, completos, durante cuatro meses. Se llevó a cabo un arreglo factorial 3x3x2 (adición a la FR de los machos con persistencia de GCs de 0%, 20% de PSMS y 20% de PSMGCs; 0, 60 y 120 minutos de incubación, y 16 y 37ºC de temperaturas de incubación) en un diseño de bloques completos al azar, analizado mediante análisis de varianza y prueba de Tukey. La incubación del semen de machos con persistencia de GCs con PSMGCs redujo más del 4% las GCs respecto a la incubación sin PS y con PSMS; igualmente se registró reducción de aproximadamente el 5% en las GCs, al aumentar el tiempo de incubación de 0 a 120 minutos, y alrededor de 2% al llevar la temperatura de incubación de 16 a 37ºC. Abstract in english The cytoplasmic droplets (CDs) are remnants of the cytoplasm that are attached to the sperm after spermatogenesis. CDs constitute the most frequent sperm abnormality in pigs and are clearly related to low fertility. There are serious indications that fructose and the seminal plasma AMPc are involved [...] in sperm maturation in the CDs detachment and in the acrosome reaction. The objective of this study was to evaluate the effect of the addition of seminal plasma in the CDs detachment in males with diagnosis of persistence of such detachment. Three boars (two with persistence of CDs and one normal) from three to five years of age, housed in the Montelindo farm at Universidad de Caldas were used in the study. These boars were performed complete seminal analysis weekly during four months. A factorial arrangement 3x3x2 (addition to the males FR with CDs persistence of 0%, 20% of SPHM and 20% of SPMCDs; 0, 60 and 120 minutes incubation, and 16, and 37ºC incubation temperature) was carried out in a randomized complete blocks design, analyzed through variance analysis and Tukey's test. Incubation of males semen with persistence of CDs with SPMCDs decreased more than 4% the CDS with regards to incubation without SP and SPHM; similarly, there was reduction of approximately 5% in CDs when increasing incubation time from 0 to 120 minutes, and about 2% when increasing incubation temperature from 16 to 37ºC.

  4. Impact of cryopreservation on bull () semen proteome. (United States)

    Westfalewicz, B; Dietrich, M A; Ciereszko, A


    Cryopreservation of bull spermatozoa is a well-established technique, allowing artificial insemination of cattle on a commercial scale. However, the extent of proteome changes in seminal plasma and spermatozoa during cryopreservation are not yet fully known. The objective of this study was to compare the proteomes of fresh, equilibrated, and cryopreserved bull semen (spermatozoa and seminal plasma) to establish the changes in semen proteins during the cryopreservation process. Semen was collected from 6 mature Holstein Friesian bulls. After sample processing, comparative analysis and identification of proteins was performed using 2-dimensional difference in-gel electrophoresis coupled with matrix-assisted laser desorption/ionization mass spectrometry. Analysis of spermatozoa extracts revealed that 25 identified protein spots, representing 16 proteins, underwent significant ( < 0.05) changes in abundance due to equilibration and cryopreservation. Eighteen protein spots decreased in abundance, 5 protein spots increased in abundance, and 2 protein spots showed different, specific patterns of abundance changes. Analysis of seminal fluid containing seminal plasma showed that 6 identified protein spots, representing 4 proteins, underwent significant ( < 0.05) changes in abundance due to equilibration and cryopreservation. Two protein spots increased in abundance and 4 decreased in abundance. Semen extending and equilibration seems to be responsible for a significant portion of the proteome changes related to cryopreservation technology. Most sperm proteins affected by equilibration and cryopreservation are membrane bound, and loss of those proteins may reduce natural spermatozoa coating. Further research is needed to unravel the mechanisms of the particular protein changes described in this study and establish the relationship between those changes and sperm quality. PMID:26641044

  5. Pengaruh Berbagai Konsentrasi Dimethylsulfoxide terhadap Kualitas Semen Beku Ayam Hutan Hijau Post Thawing

    Directory of Open Access Journals (Sweden)

    Wayan Bebas


    Full Text Available The process of freezing and thawing on semen can lead to physical stress, often called cold shock, and couses the structural and biochemical damage that affecting cell function and ultimately lead to the death of the cell The aim of this study was to know the effect of the addition of various concentrations of dimethylsulfoxide (DMSO as the intracellular cryoprotectant in phosphate yolk diluent on the post thowing quality of the green jungle fowl semen. The study used eight green jungle fowl semens which were collected with massage techniques. Semen was evaluated macroscopically and microscopically. Good quality semen was diluted with phosphate yolk which was added four different concentration of DMSO, namely 4%, 6%, 8%, and 10%. Semen was then filled and sealed in a mini straw (0.25 mL with the concentration of 150.106 cells, and equilibrated at 4oC for 4 hours. The semen freezing was processed using conventional method. Evaluation was performed on post thawing semen. The evaluation of semen quality included the progressive motility and plasma membrane intact. Data were analyzed by analysis of variance. If there were any significant differences, the data were futher analyzed by Duncan test. The results showed that addition of DMSO concentration of 6% has resulted the progressive motility and intact plasma membrane higher significantly (P <0.05 than those of the addition of DMSO concentration 4%, 8%, and 10%.

  6. Semen donors and STD screening.


    Craig, J. M.; Barratt, C L; Kinghorn, G. R.


    AIM: The British Andrology Society recommends screening semen donors for sexually transmitted infections to minimise the risk of pathogen transmission to the mother and fetus. The aim was to review recent findings of semen donor screening and, if appropriate, recommend changes to the screening protocol. SUBJECTS: 175 consecutive men attending for STD screening between January 1992 and December 1995 who had been preselected by the Department of Obstetrics and Gynaecology as suitable semen dono...

  7. Between male variation in semen characteristics and preliminary results on the dilution of semen in the ostrich

    Scientific Electronic Library Online (English)

    M., Bonato; P.K., Rybnik; I.A., Malecki; C.K., Cornwallis; S.W.P., Cloete.

    Full Text Available This study is part of an ongoing project on artificial insemination in ostriches. The physical output of neat semen from four ostrich males was investigated and the effect of reconstituting semen with: 1) seminal plasma of the same male (SPS); 2) seminal plasma of another male (SPD), and 3) Dulbecco [...] 's Modified Eagles Medium (DMEM). Semen was collected daily from one or two pairs of males using the dummy female method, each pair being replicated twice. Spermatozoa viability in neat semen, SPS, SPD and DMEM was assessed using nigrosin-eosin staining and the proportions of live normal, live abnormal and dead sperm were determined. Semen volume (mean ± SE) was 1.27 ± 0.13 mL, the concentration of spermatozoa 3.68 ± 0.17 x 10(9) /mL and the number of spermatozoa 4.92 ± 0.64 x 10(9) /ejaculate. Furthermore, the live normal, live abnormal and dead spermatozoa in the neat semen were 61.2 ± 4.5%, 21.2 ± 2.7% and 17.7 ± 4.3% respectively. The ejaculate volume and the number of dead spermatozoa were not affected by collection time. However, the number of live abnormal spermatozoa increased through the day causing a reduction in live normal spermatozoa. Furthermore, re-suspending spermatozoa in DMEM reduced the number of live normal (31.4 ± 4.6%) and live abnormal spermatozoa (11.0 ± 2.7%) and increased the number of dead spermatozoa (57.6 ± 4.4%). In contrast, numbers of live spermatozoa were higher when suspended in seminal plasma and similar in SPS (53.9 ± 4.6%) and SPD (50.7 ± 4.6%). These are the first crucial steps to determining the optimum semen collection time and to improving the viability of diluted spermatozoa.

  8. Semen quality assessments and their significance in reproductive technology. (United States)

    Kordan, W; Fraser, L; Wysocki, P; Strzezek, R; Lecewicz, M; Mogielnicka-Brzozowska, M; Dzieko?ska, A; Soliwoda, D; Koziorowska-Gilun, M


    Semen quality assessment methods are very important in predicting the fertilizing ability of persevered spermatozoa and to improve animal reproductive technology. This review discusses some of the current laboratory methods used for semen quality assessments, with references to their relevance in the evaluation of male fertility and semen preservation technologies. Semen quality assessment methods include sperm motility evaluations, analyzed with the computer-assisted semen analysis (CASA) system, and plasma membrane integrity evaluations using fluorescent stains, such as Hoechst 33258 (H33258), SYBR-14, propidium iodide (PI), ethidium homodimer (EthD) and 6-carboxyfluorescein diacetate (CFDA), and biochemical tests, such as the measurement of malondialdehyde (MDA) level. This review addresses the significance of specific fluorochromes and ATP measurements for the evaluation of the sperm mitochondrial status. Laboratory methods used for the evaluation of chromatin status, DNA integrity, and apoptotic changes in spermatozoa have been discussed. Special emphasis has been focused on the application of proteomic techniques, such as two-dimensional (2-D) gel electrophoresis and liquid chromatography mass spectrometry (LC-MS/MS), for the identification of the properties and functions of seminal plasma proteins in order to define their role in the fertilization-related processes. PMID:24597323

  9. Relationship of semen hyperviscosity with IL-6, TNF-?, IL-10 and ROS production in seminal plasma of infertile patients with prostatitis and prostato-vesiculitis. (United States)

    Castiglione, R; Salemi, M; Vicari, L O; Vicari, E


    Changes in levels of oxidative damage products in semen and their relationship to seminal fluid viscosity (SFV) have recently received increasing research interest. We analysed whether SFV was associated with ROS generation, levels of cytokines TNF-alpha (TNF-?), IL-6 and IL-10 and seminal leucocyte concentration, and whether ROS production was related to the extent of infections/inflammations at one (prostatitis) or two (prostato-vesiculitis) male accessory glands. We studied 169 infertile patients, with chronic bacterial prostatitis (PR, n = 74) and/or bilateral prostato-vesiculitis (PV, n = 95), as diagnosed by the ultrasound (US) criteria. Healthy fertile men (n = 42) served as controls. In the PV patient group, SFV, semen characteristics and ROS production had median values that were significantly higher than those found in PR patients and controls, although other sperm variables had values significantly lower than those found in PR patients or controls. In PV infertile patients, ROS generation and pro-inflammatory cytokines levels were higher than those found in PR infertile patients and controls, although seminal IL-10 levels in PV and PR patients were lower than those found in the controls. In PR patients, the levels of SFV were positively related to TNF-? (r = 0.67; P < 0.01), fMLP-stimulated ROS production in the 45% Percoll fraction (r = 0.687, P < 0.01) and the 90% Percoll fraction in basal condition (r = 0.695, P < 0.01), and after fMLP-stimulation (r = 0.688, P < 0.01). Thus, our data indicated that seminal hyperviscosity is associated with increased oxidative stress in infertile men and increased pro-inflammatory interleukins in patients with male accessory gland infection, more when the infection was extended to the seminal vesicles. PMID:24329571

  10. Zinc, magnesium and calcium in human seminal fluid : relations to other semen parameters and fertility

    DEFF Research Database (Denmark)

    SØrensen, M B; Bergdahl, I A


    The effects of zinc, magnesium and calcium in seminal plasma on time-to-pregnancy (TTP) in healthy couples, on conventional semen parameters and computer-assisted semen analysis (CASA) parameters were evaluated. The localization of chelatable zinc ions in seminal plasma and spermatozoa were assessed by autometallography (AMG). Differences in chelatable zinc localization in samples with high and low total zinc were evaluated. Semen samples from 25 couples with short TTP and 25 couples with long TTP were subjected to conventional semen analysis, CASA, zinc and magnesium measurements by inductively coupled plasma mass spectrometry, and calcium by flame atomic absorption spectrometry. The cations were strongly inter-correlated, but no correlation with TTP or conventional semen parameters was found. Semen samples with high zinc concentrations exhibited statistically significant poorer motility assessed by the CASA parameters straight line velocity and linearity than samples with low zinc content. Calcium concentration also showed statistically significant differences for the same parameters, but the effect was removed by entering zinc concentration into a multiple regression model. Semen samples with high total zinc exhibited stronger staining of the seminal plasma at AMG. It is suggested that high seminal zinc concentrations have a suppressing effect on progressive motility of the spermatozoa ('quality of movement'), but not on percentage of motile spermatozoa ('quantity of movement').

  11. Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection / Parâmetros seminais e perfis bioquímicos e proteicos do plasma seminal de cães com hyperplasia prostática benigna após a administração intra-prostática de toxina botulínica tipo A

    Scientific Electronic Library Online (English)

    Tathiana Ferguson, Motheo; Aracélle Elisane, Alves; Giuliano Queiroz, Mostachio; Maricy, Apparício; Alexandre Pinto, Ribeiro; Fabiana Ferreira de, Souza; Maria Denise, Lopes; Wilter Ricardo Russiano, Vicente.


    Full Text Available O objetivo do presente estudo foi determinar a ação de diferentes concentrações de toxina botulínica tipo A (TB-A) sobre os parâmetros seminais, perfis bioquímicos e proteicos do plasma seminal de cães com hiperplasia prostática benigna (HPB). Dezoito cães hígidos, não orquiectomizados com HPB foram [...] divididos em três grupos, os quais foram submetidos à injeção intra-prostática de solução salina (grupo controle - GC), 250UI (GI) ou 500UI (GII) de TB-A. Amostras seminais foram coletadas previamente aos tratamentos e após 2, 4 e 8 semanas. Os parâmetros seminais assim como os valores de pH e concentrações de proteínas totais (TP), cloretos totais (CT), cálcio (Ca), potássio (K), sódio (Na) do plasma seminal foram mensurados após as coletas. O perfil proteico do fluido prostático foi estabelecido por meio de eletroforese SDS-PAGE. Não foram constatadas diferenças significativas quanto aos parâmetros espermáticos e perfil bioquímico do plasma seminal intragrupos e intergrupos (P>0,05). À SDS-PAGE foram identificadas 31 bandas proteicas com pesos moleculares de 3,9 a 106,2kDA, em todos os tratamentos e durante todo o período de avaliação. Dessa forma, concluiu-se que, independentemente da dose utilizada, a injeção intra-prostática de TB-A não altera os parâmetros seminais, assim como os perfis bioquímico e proteico do plasma seminal de cães com HPB. Abstract in english This study aimed to determine the effects of different concentrations of botulinum toxin type A (BT-A) on semen parameters, and seminal plasma biochemical and protein profiles of dogs with benign prostatic hyperplasia (BPH). Eighteen sexually intact male dogs with BPH were randomly divided in three [...] groups, and received an intraprostatic injection of saline solution (control group - CG), 250UI (GI) or 500UI (GII) of BT-A under transabdominal ultrasound guidance. Semen was collected at baseline, 2, 4 and 8 weeks after treatment. Semen parameters were determined and seminal plasma pH, total protein (TP), total chlorides (TC), calcium (Ca), potassium (K), and sodium (Na) concentrations were assessed. One-dimensional sodium dodecyl sulfatepolyacrilamide gel eletrophoresis (SDS- PAGE) was performed to determine seminal plasma protein profile. Sperm parameters and seminal plasma pH, TP, TC, Ca and K mean values did not change significantly at any time point and among treated groups (P>0.05). The SDS-PAGE analysis of the pooled fractions identified 31 protein bands with molecular weights ranging from 3.9 to 106.2kDA in all treatment groups during the entire evaluation period. Regardless the used dose, intraprostatic BT-A injection do not alter semen parameters and seminal plasma biochemical and protein profiles of dogs with BPH.

  12. Avian artificial insemination and semen preservation (United States)

    Gee, G.F.


    Summary: Artificial insemination is a practical propagation tool that has been successful with a variety of birds. Cooperative, massage, and electroejaculation and modifications of these three basic methods of semen collection are described for a variety of birds. Semen color and consistency and sperm number, moti!ity, and morphology, as discussed, are useful indicators of semen quality, but the most reliable test of semen quality is the production of fertile eggs. Successful cryogenic preservation of avian semen with DMSO or glycerol as the cryoprotectant has been possible. Although the methods for preservation require special equipment, use of frozen semen requires only simple insemination supplies

  13. Concentration, activity and biochemical characterization of myeloperoxidase in fresh and post-thaw equine semen and their implication on freezability. (United States)

    Ponthier, J; Franck, T; Parrilla-Hernandez, S; Niesten, A; de la Rebiere, G; Serteyn, D; Deleuze, S


    Myeloperoxidase (MPO) is a pro-oxidant enzyme associated with decreased motility in thawed equine semen. This study aimed to describe MPO concentration, activity and subunits in raw and thawed semen and to correlate these data with motilities in raw and thawed semen. Semen samples from five stallions were collected four times. Motilities were assessed in raw and thawed semen. MPO assays were performed in raw seminal plasma, raw sperm-rich pellet and thawed semen. Total and active MPO concentrations were, respectively, assayed by enzyme-linked immunosorbent assay and specific immunological extraction followed by enzymatic detection. MPO subunits present in semen were characterized by Western blot. Purified active MPO was added in saline solution and freezing extender to control its activity during freezing procedure. Differences between medians were determined using Kruskal-Wallis test, and correlations were determined using Spearman's test for nonparametric data. Active MPO concentration was low in seminal plasma and thawed semen, but high in pellet (p = 0.0058), as the opposite relation was observed for total MPO concentration (p < 0.0001). In seminal plasma and post-thaw semen, inactive 86-kDa MPO precursor was mainly observed. Purified MPO activity was decreased in the extender (p = 0.0286). MPO activity in pellet was highly correlated with thawed progressive motility (r = -0.5576, p = 0.0086). Inactive MPO precursor and unknown low molecular weight inactive MPO precursor subunits explain low MPO activity in semen. Major MPO activity was observed in pellet, and post-thaw loss of activity is partially explained by MPO inactivation in extender. Thawed semen motility was negatively correlated with MPO activity in pellet, becoming a potential freezability predictor. PMID:24479950

  14. Kualitas Semen Beku Kuda dalam Pengencer Susu Skim dan Dimitropoulos dengan Dimetilformamida Sebagai Krioprotektan

    Directory of Open Access Journals (Sweden)

    I. Arifiantini


    Full Text Available Equine semen are far less tolerant in the freezing and thawing process than bull semen. The stallion spermatozoa are known susceptible to cold-shock relating with the content of their fatty acid on the plasma membrane. The extender is one of determining factors in the success of stallion semen cryopreservation, as an energy source and protector the cell from harmfull effect of cold shock. The common cryoprotective agent (CPA for mammalian spermatozoa was glycerol, but for stallion semen cryopreservation, dimethyl formamide (DMF was more suitable. This research was conducted to compare the success of the stallion semen cryopreservation in skim milk and dimitropoulos (DV extender with DMF as cryoprotectant. Semen from three sexualy mature stallions was collected twice a week using an artificial vagina. Semen was evaluated macro- and microscopically and then divided into two tubes, diluted each of them with skim milk dan DV extender (1:1, centrifuged at 3 000 rpm for 15 minutes. The supernatant was removed and the pellet (spermatozoa was re-diluted in skim DMF (SDMF and DVDMF extender with the concentration of spermatozoa was 200x106 ml-1. The semen then packed in 0.3ml minitub straw equilibrated for two hours at 4-5oC and frezee in liquid N2 vapor for 10 minutes. The assessment of sperm quality was conducted based on the percentage of sperm motility and viability. In this research, post-thawed semen in DVDMF showed the percentages of the motility (36.2% and the viability (59.3% higher (P<0.05 than SDMF (28.5 and 48.0 %. In conclusion, the DVDMF extender provided better post-thawed semen quality than SDMF.

  15. Palmitoleate enhances quality of rooster semen during chilled storage. (United States)

    Rad, Hamed Mirzaei; Eslami, Mohsen; Ghanie, Abolfazl


    The practice of artificial insemination is widely utilized in poultry; and this requires a broad use of semen storage techniques to prevent the reduction of fertilizing ability of stored semen. The antioxidant activity of palmitoleic acid with in vitro experiments has been shown. The present study was designed to evaluate the effect of palmitoleic acid on the quality of rooster semen stored at 4C. Semen was collected from ten roosters twice a week. Ejaculates with greater than 80% forward spermatozoa motility were pooled and after dilution semen was enriched with 0 (control), 0.125 (P 0.125), 0.25 (P 0.25), 0.5 (P 0.5) and 1 (P 1) millimolar palmitoleate. Forward spermatozoa progressive motility and viability, as well as amounts of malondialdehyde (MDA) and total antioxidant activity (AOA) were evaluated in seminal plasma and spermatozoa at 0, 24 and 48h of storage. Motility was 78.5±2.21, 77.5±1.04, and 69.5±2.32% at 24h and 58.66±1.35, 49.33±1.36 and 43.00±2.08% at 48h in P 0.125, P 0.25 and control, respectively (P<0.02). There were no significant differences in amount of MDA in the seminal plasma among groups, while the amounts of MDA in spermatozoa were less in the P 0.125, P 0.25 and P 0.5 groups compared to the control group at 24 and 48h of storage (P<0.002). Total amounts of AOA in seminal plasma were greater in palmitoleate treatment groups than the control at 24 and 48h (P<0.01). Moreover, palmitoleate treatment groups had greater values of total AOA in spermatozoa compared to the control group at 24 and 48h of storage (P<0.05). In conclusion, enrichment of rooster semen with small doses of palmitoleate has beneficial effects on the semen quality during cold storage. PMID:26723480

  16. Semen quality and sedentary work position

    DEFF Research Database (Denmark)

    Støy, Julie; Hjøllund, Niels Henrik Ingvar; Mortensen, Jens Tølbøll; Burr, Hermann; Bonde, Jens Peter


    Increased scrotal temperature can, in experimental settings, markedly disturb the production of semen. Sedentary work position may increase the temperature of the scrotum, but previous studies have failed to determine whether changes in scrotal temperature caused by sedentary work actually do affect semen quality. This study was carried out to elucidate the possible harmful effects of sedentary work on sperm count and other semen characteristics. In 1981-1983 a semen sample was obtained from 311...

  17. Banking North American buffalo semen. (United States)

    Lessard, C; Danielson, J; Rajapaksha, K; Adams, G P; McCorkell, R


    The purpose of this study was to develop a procedure to collect and preserve semen from wood bison (Bison bison athabascae) and plains bison (Bison bison bison). Semen samples from three wood and three plains bison bulls were collected by electroejaculation from June through October. In addition, sperm was collected from the cauda epididymis of seven plains bison. Semen was cryopreserved using two commercially available cryopreservation media, an egg yolk-based medium (Triladyl), and a medium free of products of animal origin (Andromed). Sperm morphology and motility were recorded on fresh and post-thawed semen samples. Total sperm motility was not different between plains and wood bison for the months of June (50%), July (69%) and October (54%). However, total sperm motility for wood bison was higher (Pbison for the months of August and September (August: 80% vs 55%; September: 73% vs 40%). Plains and wood bison did not differ in mean total and mean progressive motility (35 and 15%, respectively) of frozen-thawed sperm samples. The post-thaw motility of Triladyl-treated sperm was higher (Pbison semen, and cryopreserved it for future needs. PMID:19181375

  18. Total Antioxidant Capacity and Lipid Peroxidation in Semen of Patient with Hyperviscosity

    Directory of Open Access Journals (Sweden)

    Issa Layali


    Full Text Available Semen hyperviscosity (SHV is one of the factors involved in deficiency in sperm function. This research aimed to evaluate seminal plasma total antioxidant capacity (TAC and malondialdehyde (MDA levels in infertile patients with hyperviscous and non-hyperviscous semen samples to understand whether hyperviscous semen is associated with oxidative damage in infertile subjects. In this cross sectional study, 59 semen samples were provided by fertile (n=12 individuals as control, infertile patients with normal viscosity (n=25 and infertile patients with hyperviscosity (n=22. After semen parameters examination, semen viscosity was studied by glass pipettes. Seminal plasma TAC and MDA levels were measured by ferric reducing of antioxidant power (FRAP and thiobarbituric acid reaction (TBAR methods, respectively. A probability less than 0.05 was considered statistically significant throughout the article. The mean of sperm parameters including: counts, motility and normal morphology in patients with hyperviscosity were significantly lower than those in non-hyperviscosity patients (p<0.05, p<0.01 and p<0.001, respectively. The mean of seminal plasma TAC value in seminal plasma of non-hyperviscosity patients (1710.31 ± 458.67 ?mol/l was significantly (p<0.01 higher than that of hyperviscosity group (1230.25 ± 352 ?mol/l. A trend toward a higher mean of seminal plasma MDA value was estimated for hyperviscous group compared with non-hyperviscous (1.01 ± 0.41 nmol/ml vs. 0.94 ± 0.28 nmol/l; however, it was nonsignificant. Hyperviscous semen impairs seminal plasma TAC which is eventually associated with sperm membrane lipid peroxidation.

  19. Growth, testis size, spermatogenesis, semen parameters and seminal plasma and sperm membrane protein profile during the reproductive development of male goats supplemented with de-oiled castor cake. (United States)

    Oliveira, C H A; Silva, A M; Silva, L M; van Tilburg, M F; Fernandes, C C L; Velho, A L M C; Moura, A A; Moreno, F B M B; Monteiro-Moreira, A C O; Moreira, R A; Lima, I M T; Rondina, D


    The present study was conducted to evaluate the effect of de-oiled castor cake on reproductive traits of crossbreed goats. Fourteen males were grouped into two lots (n = 7/group), as described: group without de-oiled castor cake (WCC) and group fed with de-oiled castor cake (CC). Goats received two diets containing a mixture of Bermudagrass hay and concentrates with the same energy (73% total digestive nutrients) and protein content (15% crude protein) during 150 days, corresponding to ages from 40 (puberty) to 60 weeks. Blood plasma concentrations of urea, albumin, lactate dehydrogenase, creatinine, alanine aminotransferase and testosterone were determined. We also evaluated scrotal circumference, sperm parameters, quantitative aspects of spermatogenesis and daily sperm production (DSP), as well as the proteome of seminal plasma and sperm membrane. Seminal fluid and sperm proteins were analyzed by 2D SDS-PAGE and mass spectrometry. After 150 days of castor cake feeding, animals had no changes in the biochemical composition of blood plasma, suggesting the absence of intoxication by ingestion of ricin. There were no alterations in dry mater intake, weight gain, testis size, peripheral concentrations of testosterone, sperm concentration, motility and morphology. Sertoli and germ cell populations in the testis and DSP were not affected either. However, there were significant variations in the expression of five seminal plasma proteins and four sperm membrane proteins. In conclusion, the replacement of soybean meal by castor cake (with ricin concentrations of 50mg/kg) did not interfere with the growth and core reproductive development of male goats. However, the diet with ricin altered the expression of certain seminal plasma and sperm membrane proteins, which play roles in sperm function and fertilization. Lower expression of these proteins may impair the ricin-fed animals to perform as high-fertility sires. PMID:25883025

  20. Environmental factors and semen quality

    DEFF Research Database (Denmark)

    Jurewicz, Joanna; Hanke, Wojciech; Radwan, Michal; Bonde, Jens Peter


    OBJECTIVES: An increasing number of reports suggest that chemical and physical agents in the environment, introduced and spread by human activity, may affect male fertility in humans. This article aims at evaluating the impact of environmental exposures (pesticides, phthalates, PCBs, air pollution......, trihalomethanes (THMs), mobile phones) on semen quality, by reviewing most recent published literature. MATERIALS AND METHODS: Epidemiological studies focusing on exposure to environmental factors and semen quality for the last ten years were identified by a search of the Pubmed, Medline, Ebsco, Agricola and...... motility but also the sperm counts, viability and morphology. In spite of their consistent results, most of the studies are rather small. Association between exposure to THMs and poor semen quality was not observed. CONCLUSIONS: Epidemiological studies suggest awareness of environmental factors which may...

  1. Microbes in tree swallow semen. (United States)

    Lombardo, M P; Thorpe, P A


    A frequently hypothesized but poorly studied cost of multiple mating in birds is that exposure to pathogenic sexually transmitted microbes (STM's) can lower reproductive success. Conversely, female birds may benefit from high frequencies of copulation and multiple copulation partners if they receive cloacal inoculations of beneficial STM's that can either protect them against future encounters with pathogens and/or serve as therapy against present infection. We examined the semen of 30 male tree swallows (Tachycineta bicolor) in 1998 to determine the presence and prevalence of potential pathogenic and beneficial STM's. Semen was collected directly from males after applying gentle pressure to the cloaca and we used standard microbiological techniques to identify microbes. We found that 19 of 30 samples contained one or more types of microbes. In these 19 positive samples, we isolated both pathogenic and beneficial microbes from 11, only pathogenic microbes from seven, and only beneficial microbes from one. This variation among males suggests that females would benefit from considering a particular male's potential as a donor of either pathogenic or beneficial STM's as a criterion for mate choice. There were few significant differences between males with pathogen-infected semen and those without pathogens in their semen in measures of size, morphology, and ectoparasite score and feather damage. Likewise, there were few significant differences between males with beneficial Lactobacilli spp. in their semen and those without Lactobacilli spp. in their semen in measures of size, morphology, and ectoparasite score and feather damage. We were unable to determine if there was a relationship between microbe presence and prevalence on reproductive performance. PMID:10941730

  2. Morphological Defects in Turkey Semen


    ALKAN, Serhat; BARAN, Alper; ÖZDA?, Ö. Banu; EVECEN, Mithat


    The goal of this study was to evaluate the abnormal spermatozoa rates and types of American Bronze turkeys under Turkish conditions. Semen was collected from toms by abdominal massage and pooled once a week for 10 weeks. After pooling, the semen samples were examined morphologically and mean abnormal rates and types were evaluated. A total abnormal spermatozoa rate of 17 ± 0.06% was determined. Acrosome and mid-piece defects were the leading defects at 66 ± 0.36%. Tail defects of 22 ± 0.18% a...

  3. Use of immobilized cryopreserved bovine semen in a blind artificial insemination trial. (United States)

    Standerholen, Fride Berg; Waterhouse, Karin Elisabeth; Larsgard, Anne Guro; Garmo, Randi Therese; Myromslien, Frøydis Deinboll; Sunde, Jan; Ropstad, Erik; Klinkenberg, Geir; Kommisrud, Elisabeth


    To make timing of artificial insemination (AI) relative to ovulation less critical, methods for prolonging shelf life of spermatozoa in vivo after AI have been attempted to be developed. Encapsulation of sperm cells is a documented technology, and recently, a technology in which sperm cells are embedded in alginate gel has been introduced and commercialized. In this study, standard processed semen with the Biladyl extender (control) was compared with semen processed by sperm immobilization technology developed by SpermVital AS in a blind field trial. Moreover, in vitro acrosome and plasma membrane integrity was assessed and compared with AI fertility data for possible correlation. Semen from 16 Norwegian Red young bulls with unknown fertility was collected and processed after splitting the semen in two aliquots. These aliquots were processed with the standard Biladyl extender or the SpermVital extender to a final number of 12 × 10(6) and 25 × 10(6) spermatozoa/dose, respectively. In total, 2000 semen doses were produced from each bull, divided equally by treatment. Artificial insemination doses were set up to design a blinded AI regime; 5 + 5 straws from each extender within ejaculates in ten-straw goblets were distributed to AI technicians and veterinarians all over Norway. Outcomes of the inseminations were measured as 56-day nonreturn rate (NRR). Postthaw sperm quality was assessed by flow cytometry using propidium iodide and Alexa 488-conjugated peanut agglutinin to assess the proportion of plasma membrane and acrosome-intact sperm cells, respectively. In total, data from 14,125 first inseminations performed over a 12-month period, 7081 with Biladyl and 7044 with SpermVital semen, were used in the statistical analyses. There was no significant difference in 56-day NRR for the two semen categories, overall NRR being 72.5% and 72.7% for Biladyl and SpermVital, respectively. The flow cytometric results revealed a significant higher level of acrosome-intact live spermatozoa in Biladyl-processed semen compared to SpermVital semen. The results indicate that the level of acrosome-intact live spermatozoa in the AI dose did not affect the 56-day NRR for the two semen processing methods. In conclusion, this study has showed that immobilized spermatozoa provide equal fertility results as standard processed semen when AI is performed in a blinded field trial, although the immobilization procedure caused increased sperm damage evaluated in vitro compared to standard semen processing procedure. PMID:25922170

  4. 9 CFR 98.36 - Animal semen from Canada. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Animal semen from Canada. 98.36... CERTAIN ANIMAL EMBRYOS AND ANIMAL SEMEN Certain Animal Semen § 98.36 Animal semen from Canada. (a) General importation requirements for animal semen from Canada. If the product is . . . Then . . . (1) Equine...

  5. Semen Allergy Manifesting As Chronic Pruritus Vulva

    Directory of Open Access Journals (Sweden)

    Pavithran K


    Full Text Available A young woman of 24 with personal and family history of atopy development pruritus vulva each time after sexual intercourse with her husband. History of urticaria of sites of contact with semen on her thighs gave suspicion of contact urticaria. Positive wheal and flare response to pin prick test with semen, excellent therapeutic response to topical steroid and oral Cetirizine and non- recurrence of the problem after using condom by her husband confirmed the diagnosis of semen allergy.

  6. The measurement of reactive oxygen species in human neat semen and in suspended spermatozoa: a comparison

    Directory of Open Access Journals (Sweden)

    Brezinova Jana


    Full Text Available Abstract Background It is generally accepted that oxidative stress is an important factor in male infertility because it may impair the physiological function of spermatozoa at the molecular level. Nevertheless, although several approaches have been reported, the imbalance between production of reactive oxygen species (ROS and activity of the antioxidant defense system in semen is difficult to investigate and remains poorly understood. Methods This study compares measurement of ROS production in neat semen and in washed spermatozoa obtained from the same ejaculate, and suspended in phosphate buffered saline using exactly the same luminol-mediated chemiluminescence method. Ninety one samples were obtained from males of infertile couples and 34 from volunteers with proven fertility. Results As expected, ROS levels were markedly lower in neat semen than in washed spermatozoa suspensions where seminal plasma with its potent antioxidant capacity was removed. In the cases of both neat semen and washed spermatozoa, ROS production was lowest in samples from normozoospermic males and highest in samples containing more than half million peroxidase-positive leukocytes per milliliter. For all samples, there was a significant positive correlation between ROS production by neat semen and that by washed spermatozoa suspension. Conclusion Measurement of ROS production in neat semen better reflects actual oxidative status because it detects only the overproduction of ROS which are not effectively scavenged by antioxidant capacity of seminal fluid. The results of our study show a good commutability of both measurements for identification of semen samples with high ROS production. The measurement in neat semen is even less time consuming and therefore easier to implement into laboratory routine.

  7. Assessment of semen quality in Swamp Buffalo AI Bulls in Thailand

    Directory of Open Access Journals (Sweden)

    S. Koonjaenak


    Full Text Available Characteristic of Thai swamp buffalo bulls semen used for artificial insemination (AI in Thailand, aspects relevance in freezing and thawing of semen are review. Semen and sperm characteristics were evaluated included sperm count, motility (assessed subjectively and by CASA, morphology (using phase-contrast light microscopy and SEM, plasma membrane integrity (PMI (using a hypo-osmotic swelling test [HOST] and SYBR- 14/propidium iodide [PI], plasma membrane stability (PMS (using Annexin-V/PI and deoxyribonucleic acid (DNA integrity (using SCSA and flow cytometry [FCM]. The average ejaculate volume was about 3.0–4.0 mL, with good viability (PMI measured by the HOST and motility (>65% and >70%, respectively. Sperm concentration ranged from 1.1 to 1.2 billion/mL, being also affected by bull age. Whereas semen quality (including sperm output, pH and initial sperm motility did not differ between the seasons. Few spermatozoa (<15%/ ejaculate had abnormal morphology with abnormalities resembling those in other bovidae. In FT semen, PMI (using SYBR-14/PI and PMS were highest in winter. Across seasons, ~50% of post-thaw spermatozoa depicted linear motility, a proportion that decreased to ~35% during incubation (38oC for 60 minutes, without marking any seasonal difference. The sperm DNA was hardly damaged (with <3% fragmentation, expressed as DNA fragmentation index [DFI], among seasons.

  8. Ebola Virus Persistence in Semen Ex Vivo


    Fischer, Robert J.; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent; Munster, Vincent J.


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions.

  9. Relation between semen quality and fertility

    DEFF Research Database (Denmark)

    Bonde, Jens Peter; Ernst, Erik; Jensen, Tina Kold; Hjollund, N H; Kolstad, Henrik A.; Henriksen, T B; Scheike, Thomas Harder; Giwercman, Aleksander; Olsen, J; Skakkebaek, N E


    Semen analysis is part of the routine assessment of infertile couples. WHO defines a sperm concentration above 20x10(6) per mL seminal fluid as normal. We studied the association between semen quality and the probability of conception in a single menstrual cycle in Danish couples with no previous reproductive experience.

  10. Ebola Virus Persistence in Semen Ex Vivo (United States)

    Fischer, Robert J.; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions. PMID:26811984

  11. Ebola Virus Persistence in Semen Ex Vivo. (United States)

    Fischer, Robert J; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent; Munster, Vincent J


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions. PMID:26811984

  12. Leakage of Phosphatases and Fertility of Buck Semen Cryopreserved under Different Freezing Modes

    Directory of Open Access Journals (Sweden)

    Sunanda Sharma


    Full Text Available Present study was conducted on 160 ejaculates collected at weekly interval by artificial vagina method from 13 adult Sirohi bucks. Pooled ejaculates were diluted with Tris-egg yolk-citric acid-fructose-glycerol extender (1:4, filled and sealed in straws. Few straws of diluted semen were thawed (40° C/15 seconds and assessed for acid and alkaline phosphatases (ACP and AKP in seminal plasma of diluted semen (Control Group. Remaining semen straws were randomly grouped to constitute freezing mode groups (M1, M2, M2, and M4 and processed further for cryo-preservation of semen. Accordingly diluted semen straws were cooled @-4° C/minute from 25° C up to 5° C thereafter equilibrated for 2 hours and frozen up to -160° C @ 15, 20, 25 and 300 C/minute for M1, M2, M3 and M4 groups respectively. These frozen straws were hold at this temperature for 2 minutes then stored separately in LN2. After 7 days of storage, straws from each freezing mode group were thawed and assessed for ACP and AKP in seminal plasma. In vivo fertility trials were also conducted with straws of control (fresh diluted semen as well as freezing mode groups (frozen at different freezing rates. Least square analysis of variance for the data obtained revealed highly significant (P ≤ 0.01 rise in the seminal plasma ACP and AKP enzyme levels in frozen thawed semen as compared to that in fresh diluted semen. The Values of ACP and AKP also differed significantly (P ≤ 0.05 among all the freezing mode groups wherein lowest values of ACP were observed in M3 group followed by M4, M2 and M1 groups in increasing order whereas, lowest values of AKP were observed in M3 followed by M2, M4 and M1 groups in increasing order. Highest fertility rates were observed with semen from M3 followed by M2, M4 and M1 groups. On the basis of enzyme leakage and in-vivo fertility trials, the optimum freezing rate for cryopreservation protocol was arrived at 25° C/minute.

  13. Confidentiality and American semen donors. (United States)

    Karow, A M


    Most American donor insemination programs include a policy of complete confidentiality concerning the donor of the semen. This is the result of a long legal tradition of American constitutional law. However, some slight abridgement of this body of legal decisions might be very much in the best interests of children arising from donor insemination, and even--in most cases, in fact--the donors themselves. With regard to the children, the factors involved are both those of genetic counseling, should the need arise, and psychological development. Of course, as at present, the donor must be relieved of all responsibility, both legal and financial. PMID:8348162

  14. Effects of pH during liquid storage of goat semen on sperm viability and fertilizing potential. (United States)

    Liu, Chang-He; Dong, Hai-Bo; Ma, Dong-Li; Li, You-Wei; Han, Dong; Luo, Ming-Jiu; Chang, Zhong-Le; Tan, Jing-He


    A specific problem in goat semen preservation is the detrimental effect of seminal plasma on sperm viability in extenders containing yolk or milk. Thus, the use of chemically defined extenders will have obvious advantages. Although previous studies indicate that the initial pH of an extender is crucial to sustain high sperm motility, changes in extender pH during long-term semen storage have not been observed. Monitoring extender pH at different times of semen storage and modeling its variation according to nonlinear models is thus important for protocol optimization for long-term liquid semen preservation. The present results showed that during long-term liquid storage of goat semen, both sperm motility and semen pH decreased gradually, and a strong correlation was observed between the two. Whereas increasing the initial extender pH from 6.04 to 6.25 or storage with stabilized pH improved, storage with artificially lowered pH impaired sperm motility. Extender renewal improved sperm motility by maintaining a stable pH. Sperm coating with chicken (Gallus gallus) egg yolk improved motility by increasing tolerance to pH decline. A new extender (n-mZAP) with a higher buffering capacity was formulated, and n-mZAP maintained higher sperm motility, membrane integrity and acrosome intactness than the currently used mZAP extender did. Goat semen liquid-stored for 12 d in n-mZAP produced pregnancy and kidding rates similar to those obtained with freshly collected semen following artificial insemination. In conclusion, maintenance of a stable pH during liquid semen storage dramatically improved sperm viability and fertilizing potential. PMID:26612188

  15. Alternatives to Antibiotics in Semen Extenders: A Review


    Morrell, Jane M; Wallgren, Margareta


    Antibiotics are added to semen extenders to be used for artificial insemination (AI) in livestock breeding to control bacterial contamination in semen arising during collection and processing. The antibiotics to be added and their concentrations for semen for international trade are specified by government directives. Since the animal production industry uses large quantities of semen for artificial insemination, large amounts of antibiotics are currently used in semen extenders. Possible alt...

  16. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen


    G.V. Aguiar; M F Van Tilburg; A.G.V. Catunda; C.K.S. Celes; I.C.S. Lima; A.C.N. Campos; A.A.A. Moura; A.A. Araújo


    The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile (fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity) were analyzed. It was observed a reduction (P

  17. Semen analysis under photochemotherapy (PUVA-therapy)

    International Nuclear Information System (INIS)

    In 9 male patients with psoriasis vulgaris a semen analysis before and during photochemotherapy with 8-methoxypsoralen and UVA (PUVA) was performed to rule out drug-induced toxic damage of spermatogenesis or impairment of fertility due to scrotal hyperthermia. Two hours after oral application of 40-60 mg 8-methoxypsoralen the patients had been irradiated in UVA high intensity treatment units. PUVA-treatments were performed four times weekly until total body clearing was achieved. For complete remission 13-26 (mean 20.5) PUVA-treatments were necessary. Corresponding total UVA-doses were 35.3 - 191.0 (mean 83.2) Joule/cm2. The investigated parameters total motility, progressive motility, spermatozoa density, total spermatozoa count, spermatozoa morphology, and seminal plasma fructose remained unchanged. Only the volume of the ejaculate showed a small decrease during 3 months of therapy. From this pilot study there is no evidence, that PUVA-therapy leads to an impairment of fertility in male patients within their reproductive age. (orig.)

  18. Stainless steel welding and semen quality

    DEFF Research Database (Denmark)

    Jelnes, J E; Knudsen, Lisbeth E.

    Questionnaire studies of patients from fertility clinics suggest that welders may have an increased risk of reduced semen quality. In this study, welders and nonwelders from the same plants were asked to provide blood, urine, and semen samples. Urine was analyzed for chromium and nickel, and for ...... and nonwelders. Because the metal dust exposure of nonwelders in the plant may be higher than that in the general population, welders were also compared to referents not working in the metal industry. Again, no decrease in semen quality associated with welding was demonstrated....

  19. Estrés oxidativo en el semen equino criopreservado

    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo Betancur


    Full Text Available La escasa fertilidad del semen equino criopreservado ha limitado de manera sustancial su uso en procedimientos de biotecnología reproductiva. El estrés oxidativo es uno de los factores más relacionados con este fenómeno, debido al incremento en los niveles de especies reactivas de oxígeno (ERO en el semen como resultado del choque térmico, de la toxicidad de los crioprotectores, y de la alteración en la disponibilidad y la funcionalidad de los antioxidantes endógenos durante los procesos de criopreservación. Esta revisión analiza el efecto del estrés oxidativo sobre la fertilidad del semen equino criopreservado.

  20. Effect of platelet activating factor (PAF) supplementation in semen extender on viability and ATP content of cryopreserved canine spermatozoa. (United States)

    Kordan, W; Lecewicz, M; Strzezek, R; Dzieko?ska, A; Fraser, L


    The aim of this study was to investigate the effect of platelet activating factor (PAF) on the quality characteristics of cryopreserved canine spermatozoa. Cryopreserved semen of 5 mixed-breed dogs was treated with different concentrations of exogenous PAF (1 x 10(-3) M, 1 x 10(-4) M, 1 x 10(-5) M and 1 x 10(-6) M) and examined at different time intervals (0, 30, 60 and 120 min). Cryopreserved semen treated without PAF was used as the control. Sperm quality was evaluated for motility (computer-assisted semen analysis, CASA), mitochondrial function (JC-1/PI assay) and plasma membrane integrity (SYBR-14/PI assay and Hoechst 33258). Also, ATP content of spermatozoa was determined using a bioluminescence assay. Treatment of cryopreserved semen with 1 x 10(-3) M PAF at 120 min of incubation resulted in significantly higher total sperm motility compared with the control. It was observed that PAF-improved total sperm motility was concurrent with enhanced sperm motility patterns after treatment of cryopreserved semen. Treatment of cryopreserved semen with PAF did not improve either sperm mitochondrial function or plasma membrane integrity, as monitored by different fluorescent membrane markers. Furthermore, ATP content of cryopreserved spermatozoa was significantly higher when PAF was used at a concentration of 1 x 10(-3) M compared with the control and other PAF treatments, regardless of the incubation time. The findings of this study indicated that treatment with 1 x 10(-3) M PAF at 120 min of incubation rendered better quality of cryopreserved canine semen, which was associated with improved sperm motility parameters and ATP content. It can be suggested that exogenous PAF addition is beneficial as a supplement for canine semen extender used for cryopreservation. PMID:21370733

  1. Effects of dietary supplementation with polyunsaturated fatty acids and antioxidants on biochemical characteristics of boar semen. (United States)

    Strzezek, Jerzy; Fraser, Leyland; Kukli?ska, Magda; Dzieko?ska, Anna; Lecewicz, Marek


    The aim of this study was to investigate the effect of providing a supplement containing polyunsaturated fatty acids and antioxidants (PROSPERM) on the biochemical characteristics of boar semen. Two sexually mature boars were fed a standard diet with PROSPERM (250 g daily) for a 24-week period. Ejaculates collected prior to supplementation were used as the control. Semen quality and biochemical parameters were analyzed. The dietary supplementation enhanced sperm characteristics, including the percentage of spermatozoa with intact plasma membrane and osmotic resistance of the acrosomal membrane. Higher production of malondialdehyde was concurrent with increased activity of superoxide dismutase in the seminal plasma and spermatozoa after 8 weeks of supplementation. These changes were accompanied by a high content of total protein and low-molecular antioxidants of the seminal plasma. It was observed that PROSPERM supplementation enhanced the survivability of boar spermatozoa during storage in a standard semen extender supplemented with lipoprotein fractions, isolated from hen egg yolk or ostrich egg yolk, at 5 degrees C and 16 degrees C. These results indicate that PROSPERM supplementation of boars had a beneficial effect on the biological characteristics of the spermatozoa, which could be useful for semen preservation at different temperatures. PMID:15592586

  2. A validation study of the Nucleix DSI-Semen kit--a methylation-based assay for semen identification. (United States)

    LaRue, Bobby L; King, Jonathan L; Budowle, Bruce


    The detection of semen can assist in reconstructing the events of a sexual assault and impact the outcome of legal dispositions. Many methods currently are used for detecting the presence of semen, but they all have limitations with regards to specificity, sample degradation/consumption, stability of biomolecule assayed, and/or incompatibility with downstream individual identification assays. DNA is routinely collected at sexual assault crime scenes and is widely used for individual identification. The DNA also carries methylation patterns that are tissue specific. To date, however, assays designed to exploit methylation patterns suffer from complex chemistries and unwieldy analyses. DSI-Semen™ kit uses a novel approach involving CpG methylation-sensitive restriction endonuclease digestion coupled to a multiplexed polymerase chain reaction (PCR) to generate an amplicon profile that makes it possible to determine whether the tissue source of a DNA sample was semen or non-semen. The assay returned an appropriate positive result for semen with neat semen, semen stains, and semen/non-semen tissue mixtures. The assay is robust and reliable, with a positive result for semen given as little as 31 pg of template DNA input. Low levels of semen were detected in mixtures of semen and other body fluids. UV-exposed samples and those in the presence of limited concentrations of known PCR inhibitors were typeable. The DSI-Semen™ kit provides a reliable tool for the determination of DNA being derived from semen. PMID:22895803

  3. Reduction of concentrate for bovine sires: Influence on metabolic status and semen quality under production conditions

    International Nuclear Information System (INIS)

    The effects of reduced concentrate fed in rations of Holstein Friesian bulls for artificial insemination was evaluated with respect to metabolic status, sexual behaviour, semen production and semen quality during one year. In the first of two studies, twenty bulls were fed diets based on hay, green forage and concentrate according to the standard nutrient requirements for dairy cattle in artificial insemination centres. Bulls were divided into two groups: Group 1 (n = 10, control, 5 kg concentrate) and Group 2 (n = 10, experimental, 1 kg concentrate). Feed, blood semen samples were taken for bromatological analysis, metabolic profile and semen evaluation, respectively. Group 2 had lower plasma concentrations of urea (P<0.001), calcium (P<0.05) and phosphorous (P<0.01). Urea were below the reference range. Season of the year affected lipid metabolite concentrations (P<0.001) and osteotrophic minerals (P<0.05 to P<0.001). Group 2 had better production and quality of semen than did Group 1. In the second study, five bulls were fed as the experimental group in the first study. Time of sampling, season of the year and sire affected the hormonal secretion pattern (P<0.001). There were no differences in testoterone and LH plasma concentrations before and after mounting; however, cortisol concentrations showed a significant raise during the period of maximum excitation. Individual secretion patterns varied between bulls and were related to pathological morphology of reproductive and endocrine organs. The effect of sire was significant on all the indicators of the sperm production, except to percentage of live sperm. Season of the year significantly affected sperm concentration and number of doses of extended sperm produced. It is concluded that a reduction of concentrate in the diet did not affect the metabolic status, sexual behaviour, semen production or sperm quality of sires. 29 refs, 2 figs, 4 tabs

  4. Influence of trace elements and their correlation with semen quality in fertile and infertile subjects


    SUNDARAM, Vickram; SRINIVAS, Muthugadhalli; GURUNATHAN, Jayaraman


    There has been increasing curiosity about the appraisal of essential trace elements present in human body fluids and their correlation to human health. Human seminal plasma contains several trace elements that have an imperative role in the normal functioning of the semen. As a result, it is very important to evaluate Zn and other trace elements present in the seminal plasma for the assessment of male infertility. The main objective of this research is to evaluate Zn concentrations and their ...

  5. Effect of initial seminal plasma fructose concentration on goat semen storage at 5ºC / Efeito da concentração inicial de frutose sobre a conservação a 5 ºC do sêmen caprino

    Scientific Electronic Library Online (English)

    B.G., Matos-Brito; I.C.S., Lima; J.F., Pereira; F.M., Barboza; M.A.B., Linard; G.V., Aguiar; A.G.V., Catunda; A.A.A., Moura; J.F., Nunes; A.C.N., Campos.


    Full Text Available Foram coletadas 24 amostras de sêmen caprino. Cada ejaculado foi dividido em 4 alíquotas, e foram diluídas em citrato-gema de ovo (CG), TRIS-gema de ovo (TG) e água de coco industrializada-gema de ovo (ACI-G), a quarta, foi centrifugada para determinação da concentração de frutose e atividade da FLA [...] 2 no PS. O sêmen foi conservado a 5 ºC e avaliado a fresco, 2, 24 e 48 h, em cada tempo foi avaliado o vigor, motilidade e alterações morfológicas. Os reprodutores foram divididos em dois grupos: grupo I-concentração de frutose >710 mg/dL e o grupo II-concentração de frutose Abstract in english Twenty-four goat semen samples were collected and divided into four aliquots, diluted with the citrate-egg yolk (CY), TRIS-egg yolk (TY) or industrialized coconut water with egg yolk (ICW-Y) extenders. The fourth aliquot was centrifuged to analyze fructose concentration and PLA2 activity on SP. The [...] semen was stored at 5ºC and evaluated at times fresh, 2, 24 and 48 h, in each time was evaluated the vigor, sperm motility and total morphological alterations. The animals were divided into two groups: group Ifructose concentration >710 mg/dL and group IIfructose concentration


    This project, also called the Healthy Men Study will examine potential associations between human exposure to drinking water disinfection byproducts, particularly haloacetic acids (HAAs) and trihalomethanes (THMs), and male reproductive health as indicated by semen quality. Sinc...

  7. Artificial insemination of cranes with frozen semen (United States)

    Gee, G.F.; Sexton, T.J.


    For the first time (1978) artificial insemination (AI) with frozen greater sandhill crane (Grus canadensis tabida) semen resulted in fertile eggs and chicks. During the 2 year (1977-78) study, 6 of 27 eggs produced were fertile. Three chicks hatched. Semen samples used for insemination were frozen and stored in liquid nitrogen for two months or less. Recent improvements in the laboratory indicated that a more effective sample can be prepared and greater fertility rates should be expected.

  8. Update on sexed semen technology in cattle. (United States)

    Seidel, G E


    The technology in current use for sexing sperm represents remarkable feats of engineering. These flow cytometer/cell sorters can make over 30 000 consecutive evaluations of individual sperm each second for each nozzle and sort the sperm into three containers: X-sperm, Y-sperm and unsexable plus dead sperm. Even at these speeds it is not economical to package sperm at standard numbers per inseminate. However, with excellent management, pregnancy rates in cattle with 2 million sexed sperm per insemination dose are about 80% of those with conventional semen at normal sperm doses. This lowered fertility, in part due to damage to sperm during sorting, plus the extra cost of sexed semen limits the applications that are economically feasible. Even so, on the order of 2 million doses of bovine semen are sexed annually in the United States. The main application is for dairy heifers to have heifer calves, either for herd expansion or for sale as replacements, often for eventual export. Breeders of purebred cattle often use sexed semen for specific matings; thawing and then sexing frozen semen and immediately using the few resulting sexed sperm for in vitro fertilization is done with increasing frequency. Beef cattle producers are starting to use sexed semen to produce crossbred female replacements. Proprietary improvements in sperm sexing procedures, implemented in 2013, are claimed to improve fertility between 4 and 6 percentage points, or about 10%. PMID:24680061

  9. 9 CFR 98.34 - Import permits for poultry semen and animal semen. (United States)


    ...address of the importer; the species, breed, quantity of animal semen to...are lesions of TB in the test positive pigs, the whole group will be ineligible lesions are found, the rest of the pigs will be eligible as semen donors with...

  10. 9 CFR 98.34 - Import permits for poultry semen and animal semen. (United States)


    ... dosage as a precautionary treatment for leptospirosis. Feed and bedding used during the isolation... hygienic requirements established by the OVO of the PRC concerning freedom of the feed and bedding from... section have been met. (d) Sheep and goat semen from regions where scrapie exists. Importation of semen...

  11. Study of enzyme activities and protein content of beluga (Huso huso) semen before and after cryopreservation. (United States)

    Aramli, M S


    Knowledge gained regarding the biochemical processes that occur during sperm collection, processing and freezing-thawing might improve current sperm cryopreservation techniques. In our present study, we determined the effect of cryopreservation on the total protein concentration (TP) and the activities of certain enzymes in semen samples from the beluga (Huso huso). The TP content of the seminal plasma of fresh semen was 0.47 ± 0.026 g/l, and the TP after cryopreservation was 1.86 ± 0.6 g/l. The activities of acid phosphatase (0.82 ± 0.042 U/l), lactate dehydrogenase (234.4 ± 19.4 U/l), arylsulfatase (143.1 ± 32.5 U/l) and ?-N-acetylglucosaminidase (58.39 ± 4.14 U/l) in the seminal plasma of fresh semen were significantly lower than those in the supernatant of frozen-thawed semen samples (7.43 ± 0.64, 3224.6 ± 167.2, 422.6 ± 21.3 and 90.2 ± 5.37 U/l respectively). These parameters may be useful as biomarkers for estimating damage to the cell membrane of spermatozoa caused by freezing-thawing. PMID:24780122

  12. Semen abnormalities with SSRI antidepressants. (United States)


    Despite decades of widespread use, the adverse effect profile of "selective" serotonin reuptake inhibitor (SSRI) antidepressants has still not been fully elucidated. Studies in male animals have shown delayed sexual development and reduced fertility. Three prospective cohort studies conducted in over one hundred patients exposed to an SSRI for periods ranging from 5 weeks to 24 months found altered semen param-eters after as little as 3 months of exposure: reduced sperm concentration, reduced sperm motility, a higher percentage of abnormal spermatozoa, and increased levels of sperm DNA fragmentation. One clinical trial showed growth retardation in children considered depressed who were exposed to SSRls. SSRls may have endocrine disrupting properties. Dapoxetine is a short-acting serotonin reuptake inhibitor that is chemically related to fluoxetine and marketed in the European Union for men complaining of premature ejaculation. But the corresponding European summary of product characteristics does not mention any effects on fertility. In practice, based on the data available as of mid-2014, the effects of SSRI exposure on male fertility are unclear. However, it is a risk that should be taken into account and pointed out to male patients who would like to father a child or who are experiencing fertility problems. PMID:25729824

  13. Effect of Genotype and Frequency of Semen Collection on Semen Characteristics of Local Chicken Cocks

    Directory of Open Access Journals (Sweden)

    S.N. Ibe


    Full Text Available This study reports the effect of genotype and frequency of semen collection on seminal traits of local chicken cocks. Semen was collected, using the back-lumbar massage method from Normal Feather (NOF, Naked Neck (NN, Frizzle (FR and Naked Neck x Frizzle (NNxFR cocks at two ejaculation frequencies, namely once and twice per week for nine weeks. Ejaculates were subjected to both physical and laboratory evaluations for quality. Results showed that there were significant (p<0.05 differences between the genotypes for semen volume with the NOF (0.150.009 mL and NN x FR (0.130.013 mL cocks having higher semen volumes than that of the NN (0.110.013 mL and FR (0.080.013 mL counterparts. Total spermatozoa was the only seminal trait significantly affected by the two frequencies of collection with once a week giving higher values than twice a week collection. Interaction effect was significant for sperm concentration and total spermatozoa. This effect was stronger when semen was harvested twice a week with the NN x FR and NOF cocks producing higher values. It was therefore concluded that NN x FR and NOF genotype were superior to their NN and FR counterparts in both semen output and frequency of semen collections and may be considered as potential candidates for use in natural mating and/or artificial insemination programmes aimed at improving the lot of the local chicken.

  14. Characterization and usage of sexed semen from US field data (United States)

    The objectives were to characterize sexed semen available and its usage from US field data. This included investigating active Holstein proven bulls with sexed semen available, as well as percentages and frequencies of sexed semen matings for heifers and cows. Herds were also characterized for the...


    Directory of Open Access Journals (Sweden)

    Cristiane A Alvarez e Gentil Vanini de Moraes


    Full Text Available Spermatozoa are susceptible to peroxidative damages due to the high concentration of polyunsaturated fatty acids in its cytoplasmic membranes. Studies have shown that the spermatozoa and seminal leukocytes are capable to generate high levels of reactive oxygen species (ROSs that may reduce the viability and fertility of spermatozoa. However, small quantities of ROSs are necessary to initiation of the function of spermatozoa, as well as, capacitation and induction of the acrosomic reaction. Thus an equilibrium between the production of ROSs and antioxidative protection is necessary to assure the spermatic function. The antioxidative protection of the semen is supplied by enzymes such as superoxide dismutase, glutathione peroxidase (GPx, catalase, vitamin C, vitamin E and other substances (albumine, glutathione, taurine, hypotaurine found inside of spermatic cells or in seminal plasma. Thus, the objective of this revision is characterize how reactive oxygen species cause irreparable damages to spermatozoa membranes and the importance of the antioxidative protection of the semen that can be promoted by the addition of simple minerals like selenium and vitamins (e.g. ascorbic acid.

  16. Effects of ground semen collection on weight bearing on hindquarters, libido, and semen parameters in stallions. (United States)

    Burger, D; Meroni, G; Thomas, S; Sieme, H


    Collection of semen on the ground from the standing stallion represents an alternative method to dummy mount semen collection and is of increasing popularity for sport stallions, males suffering from health problems, or in studs without a dummy or suitable mare at disposal. Our aim was to collect and compare spermatological and physiological data associated with traditional and ground semen collection. Twelve of 23 Franches-Montagnes stallions were selected to carry out semen collection on a dummy and while standing in a crossed experimental protocol. Semen quantity and quality parameters, weight bearing on hindquarters, and behavioral and libido data were recorded. Ground versus dummy mount semen collection was accompanied by lower seminal volume (15.9 ± 14.6 vs. 22.0 ± 13.3 mL; P < 0.01) and lower total sperm count (4.913 ± 2.721 × 10(9) vs. 6.544 ± 2.856 × 10(9) sperm; P < 0.001). No significant differences were found concerning sperm motility and viability. Time to ejaculation was longer, and the number of attempts to ejaculation was higher (P = 0.053) in the standing position compared with the mount on the dummy. A higher (P < 0.01) amount of tail flagging was manifested by the stallions during ejaculation on the dummy compared to when standing. There was no difference in weight bearing on hindquarters when comparing dummy collection (51.2 ± 2.5%) and standing collection (48.9 ± 5.5%). Ground semen collection can be considered as a viable option for stallions that cannot mount a dummy or a mare. However, it requires training and may be not easily accepted by all stallions. Owners should be advised that ground semen collection is associated with significantly lower sperm numbers than with dummy mount semen collection. PMID:26050613

  17. Semen quality in Peruvian pesticide applicators: association between urinary organophosphate metabolites and semen parameters

    Directory of Open Access Journals (Sweden)

    Gasco Manuel


    Full Text Available Abstract Background Organophosphates are broad class of chemicals widely used as pesticides throughout the world. We performed a cross-sectional study of associations between dialkylphosphate metabolites of organophosphates and semen quality among pesticide applicators in Majes (Arequipa, Peru. Methods Thirty-one men exposed to organophosphate (OP pesticides and 31 non-exposed were recruited (age, 20–60 years. In exposed subjects, semen and a blood sample were obtained one day after the last pesticide application. Subjects were grouped according to levels of OP metabolites in urine. Semen samples were analyzed for sperm concentration, percentage of sperm motility, percentage of normal morphology, semen leucocytes and concentrations of fructose and zinc. Exposure to OP was assessed by measuring six urinary OP metabolites (dimethyl and diethyl phosphates and thiophosphates by gas chromatography using a single flame photometric detector. Results Diethyldithiophosphate (p = 0.04 and diethylthiophosphate (p = 0.02 better reflected occupational pesticide exposure than other OP metabolites. Semen analysis revealed a significant reduction of semen volume and an increase in semen pH in men with OP metabolites. Multiple regression analysis showed that both occupational exposure to pesticides and the time of exposure to pesticides were more closely related to alterations in semen quality parameters than the single measurement of OP metabolites in urine. Conclusion The study demonstrated that occupational exposure to OP pesticides was more closely related to alterations in semen quality than a single measurement of urine OP metabolites. Current measurement of OP metabolites in urine may not reflect the full risk.

  18. Inseminación artificial a tiempo fijo con semen ovino refrigerado / Timed artificial insemination with ram chilled semen

    Scientific Electronic Library Online (English)

    P., Naim; M., Cueto; A., Gibbons.


    Full Text Available Se evaluó la preñez resultante de la inseminación artificial sistemática cervical (IASC) con semen ovino refrigerado a 5ºC durante 12 o 24 h y dosis de 150 o 300 millones de espermatozoides. Doscientas ovejas adultas Merino se dividieron al azar en grupos de 40 animales, según arreglo factorial de l [...] os tratamientos (2x2) más un grupo control. En la estación reproductiva, los estros fueron sincronizados mediante 14 días con esponjas intravaginales con 60 mg acetato de medroxiprogesterona y 200 UI de eCG al retirar las esponjas. A las 12 y 24 h previas a la IASC se colectaron, diluyeron y refrigeraron los eyaculados. La dilución del semen se realizó con OviPro (Minitüb®, Alemania) en una relación 1:2 (semen/ diluyente). El grupo control fue inseminado con semen fresco sin diluir y dosis de 100 millones de espermatozoides. La IASC se realizó en el orificio uterino externo a las 54-56 h después del tratamiento progestacional. La preservación seminal durante 12 h alcanzó el 25% (10/40) y 38% (15/ 39) de preñez con dosis de 150 y 300 millones de espermatozoides. El semen preservado durante 24 h determinó el 3% (1/37) y 19% (7/37) de preñez con dosis inseminantes de 150 y 300 millones de espermatozoides, respectivamente. El porcentaje de preñez del grupo control (59%) evidenció que las condiciones de la majada no estuvieron afectadas por el estado nutricional o de manejo. La IASC con semen refrigerado ovino durante 12 h y una dosis de inseminación de 300 millones de espermatozoides, permitió obtener una preñez aceptable (38%) considerando el beneficio de poder transportar semen a largas distancias y su bajo costo operativo. Abstract in english We evaluated pregnancy by timed artificial insemination (TAI) with ram semen chilled at 5ºC during 12 or 24 h and insemination doses of 150 or 300 millions spermatozoa. Two hundred adult Merino sheep were randomly divided in 4 groups of 40 animals each, according to a factorial arrangement (2x2) plu [...] s a control group. During the breeding season, estrus were synchronized with intravaginal sponges impregnated with 60 mg of medroxyprogesterone acetate inserted for 14 days and administration of 200 UI PMSG at sponge removal. Twelve and 24 h before insemination, semen from adult Merino rams was collected, and after the ejaculates were diluted and chilled. Semen was diluted with the Ovipro extender (Minitüb®, Alemania) using a dilution rate of 1:2 (semen/extender). Control group was inseminated with fresh semen without diluent and an insemination dose of 100 millions spermatozoa. For every group, cervical TAI was performed 54-56 hours after progestational treatment. Preserved semen during 12 hours obtained 25% and 38% pregnancy with an insemination dose of 150 and 300 millions spermatozoa. Semen preserved for 24 hours caused 3% and 19% pregnancy with an insemination dose of 150 and 300 millions spermatozoa respectively. Control group showed a pregnancy of 59%, which evidenced that flock fertility was not affected by nutritional status or management. TAI with ram chilled semen during 12 h, with an insemination dose of 300 millions spermatozoa, was found to provide an acceptable fertility (38%), considering the benefit of carryng semen for long distances and the low operative cost for its implementation.

  19. Semen characteristics in HIV-1 positive men and the effect of semen washing. (United States)

    Lasheeb, A S; King, J; Ball, J K; Curran, R; Barratt, C L; Afnan, M; Pillay, D


    We have undertaken an analysis of semen from HIV infected men with regard to sperm counts and motility, non-spermatozoal cells, and viral nucleic acid. Regression analysis showed that sperm concentration and motility were positively associated with blood CD4 cell count. By contrast, non-spermatozoal cell concentration (round cells) was inversely related to CD4 count. Extracellular HIV RNA was detected in the majority of semen samples and proviral DNA in a minority. Percoll gradient washing of 12 semen samples yielded six samples containing adequate sperm concentration for analysis. This washing procedure reduced prewash extracellular RNA to below detectable limits in all cases; proviral DNA present in two of the six prewash samples was also reduced to below detectable limits after washing. We conclude that semen washing before artificial insemination may reduce the risk of HIV transmission from an infected man to an uninfected woman. However, further evidence from prospective analyses of such an approach is required. PMID:9389956

  20. Semen quality in Peruvian pesticide applicators: association between urinary organophosphate metabolites and semen parameters


    Gasco Manuel; Yucra Sandra; Rubio Julio; Gonzales Gustavo F


    Abstract Background Organophosphates are broad class of chemicals widely used as pesticides throughout the world. We performed a cross-sectional study of associations between dialkylphosphate metabolites of organophosphates and semen quality among pesticide applicators in Majes (Arequipa), Peru. Methods Thirty-one men exposed to organophosphate (OP) pesticides and 31 non-exposed were recruited (age, 20–60 years). In exposed subjects, semen and a blood sample were obtained one day after the la...

  1. Demonstration of organ-characteristic glycoproteins in human semen. (United States)

    Uhlenbruck, G; Herrmann, W P; Steinhausen, G


    Tridacnin M, a galactosyl-specific reagent prepared from the bivalve clam Tridacna maxima (Röding) was used for the demonstration of 2 different glycosubstances with terminal galactosido units in human semen. The results obtained by immunodiffusion tests indicate that the seminal plasma contains a water-soluble glycoprotein with two carbohydrate chains, one of them having a terminal beta-galatosyl group whereas the other one seems to have a terminal N-acetyl-neuraminic acid group and a subterminal beta-galactosyl group. This glycoprotein is a secretion product of the seminal vesicles and, therefore, of diagnostic significance: it is absent in cases of bilateral occlusion of the ampullae. Another glycosubstance with terminal galactosido-residues could be demonstrated on the surface of sperm cells by agglutination reactions. This glycosubstance is an integral part of the spermatozoan membrane because it cannot be removed by repeated washings. PMID:407814

  2. Correlation of phthalate exposures with semen quality

    International Nuclear Information System (INIS)

    Phthalates are widely used man-made chemical released in the environment and human exposure is mainly through diet. As the phthalate plasticizers are not covalently bound to PVC, they can leach, migrate or evaporate into the environment and as a result have become ubiquitously contaminants. The present study investigates the correlation, if any, between the phthalate esters (DEP, DEHP, DBP, DMP, DOP) and sperm mitochondrial status, ROS, LPO, SCSA, and sperm quality. The study was conducted in the urban/rural population of Lucknow visiting Obstetrics and Gynecology Department, CSMMU, Lucknow. Semen analysis was performed according to the WHO guidelines while phthalate analysis by HPLC and LPO by spectrophotometer and the sperm mitochondrial status, ROS, SCSA using flow cytometry. The questionnaire data showed no significant difference in the demographic characteristics among the groups. In general, urban population was found to have statistically significant higher levels of phthalate esters than the rural. Further, infertile men showed statistically significant (p < 0.05) higher levels of pollutants in the semen than fertile men. A negative correlation between semen phthalate level viz DEHP and sperm quality and positive association with depolarized mitochondria, elevation in ROS production and LPO, DNA fragmentation was established. The findings are suggestive that phthalates might be one among the contributing factors associated with the deterioration in semen quality and these adverse effects might be ROS, LPO and mitochondrial dysfunction mediated

  3. Do perfluoroalkyl compounds impair human semen quality?

    DEFF Research Database (Denmark)

    Joensen, Ulla Nordström; Bossi, Rossana; Leffers, Henrik; Jensen, Allan Astrup; Skakkebaek, Niels E; Jørgensen, Niels


    BACKGROUND: Perfluoroalkyl acids (PFAAs) are found globally in wildlife and humans and are suspected to act as endocrine disruptors. There are no previous reports of PFAA levels in adult men from Denmark or of a possible association between semen quality and PFAA exposure. OBJECTIVES: We investig...

  4. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen / Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen

    Scientific Electronic Library Online (English)

    G.V., Aguiar; M.F., van Tilburg; A.G.V., Catunda; C.K.S., Celes; I.C.S., Lima; A.C.N., Campos; A.A.A., Moura; A.A., Araújo.


    Full Text Available Verificou-se as características seminais de caprinos durante a época seca e a chuvosa no Nordeste brasileiro e a influência da época no resfriamento do sêmen. Foram mensurados volume, concentração espermática, porcentagem de espermatozoides móveis, vigor, morfologia espermática e características bio [...] químicas (frutose, ácido cítrico, fósforo, magnésio, proteínas totais e atividade da fosfolipase A2). Observou-se redução (P Abstract in english The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile ( [...] fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity) were analyzed. It was observed a reduction (P

  5. Role of various sugars in improving frozen semen quality of Garut ram

    Directory of Open Access Journals (Sweden)

    Muhammad Rizal


    Full Text Available Ram spermatozoa are sensitive to extreme changes in temperature during the freeze-thawed process. The present study was conducted to examine the effects of addition of various sugars in Tris extender on sperm cryosurvival of Garut ram. Semen was collected using an artificial vagina from three mature rams once a week. Immediately after initial evaluation, semen was divided into five parts and diluted with Tris extender (control, Tris extender + 0.4% dextrose, Tris extender + 0.4% raffinose, Tris extender + 0.4% trehalose, and Tris extender + 0.4% sucrose, respectively. Semen was loaded in to 0.25 ml mini straw with the concentration of 200 million or 800 million motile spermatozoa per ml. Semen was equilibrated at 5oC for three hours, then frozen and stored in liquid nitrogen for seven days. Quality of processed-semen including percentages of motile spermatozoa (MS, live spermatozoa (LS, intact acrosome cap (IAC, and intact plasma membrane (IPM were evaluated after dilution, equilibration, and thawing, respectively. Data were analyzed using completely randomized design with five treatments and six replicates. Means were compared significant difference test at 0.05 significant level. Results of this research showed that there was no significantly difference (P>0.05 between treatments for all sperm quality parameters after dilution and equilibration. Mean percentages of post thawing MS, LS, IAC, and IPM for dextrose (54.00; 68.00; 66.60, and 57.83%, raffinose (50.00; 64.33; 61.80, and 61.75%, trehalose (50.83; 65.67; 61.40 and 57.75%, and sucrose (49.00; 66.80; 58.50 and 58.50% were significantly (P<0.05 higher than control (40.83; 52.67; 54.60, and 49.40% respectively. In conclusion, addition of 0.4% dextrose, raffinose, trehalose or sucrose in Tris extender are effective in improving frozen semen quality of Garut ram. Key Words: Sugars, Tris extender, Frozen Semen Quality, Garut Ram

  6. Microbiology of semen specimens from males attending a fertility clinic

    DEFF Research Database (Denmark)

    Kjærgaard, Niels; Kristensen, B; Hansen, Estrid Stæhr; Farholt, S; Schønheyder, H C; Madsen, Hans; Uldbjerg, N


    The relationship between semen quality, pyospermia and bacteriology was studied in 201 semen specimens from male patients attending a fertility clinic. Semen quality parameters were within normal limits in 115 (57%) patients, slightly reduced in 60 (30%), and 26 (13%) had findings indicating reduced fertility. Twelve patients (6%) had pyospermia. In 182 patients, 552 microorganisms were detected, including Enterobacteriaceae (2.8%), Gardnerella vaginalis (9.6%), Chlamydia trachomatis (1.6%), Myc...

  7. Métodos de colección de semen en camélidos sudamericanos

    Directory of Open Access Journals (Sweden)

    Pacheco Curie, Joel Iván


    Full Text Available La colección de semen depende de una buena y constante producciónespermática para que la calidad del semen sea buena. Las técnicas decolección de semen están bastante desarrolladas en otros animales,especialmente en rumiantes domésticos en los cuales ya es unprocedimiento de rutina, pero en camélidos, dadas las especialescaracterísticas reproductivas, anatómicas y fisiológicas de estas especies, esta colección es bastante dificultosa y no existe un protocolo recomendado y una técnica optima, así como su manejo posterior.

  8. Communication requested: Boar semen transport through the uterus and possible consequences for insemination. (United States)

    Rath, D; Knorr, C; Taylor, U


    Recent insemination techniques bypass the interactions between sperm and the uterine wall because the semen is deposited deep into the tip of uterine horn or directly into the oviduct. Such techniques allow high dilution of the ejaculates. After normal mating, semen entering the uterus communicates with the uterine milieu. Intact sperm of high mitochondrial membrane potential bind to uterine epithelial cells, whereas most of the unbound sperm in the uterine lumen have damaged membranes. Lectins are the most likely factors to mediate these sperm-uterine interactions. The lectin wheat germ agglutinin is known to induce the strongest binding of sperm, whereas binding is impaired when sialic acid receptors are blocked by wheat germ agglutinin. This suggests that sialic acid is involved in porcine sperm-endometrium interactions, and it is hypothesized that the use of a semen extender supplemented with sialidase would allow insemination with reduced sperm numbers. A lack of contact of sperm and seminal plasma with the uterine wall, as a result of deep insemination, may adversely affect (1) events during ovulation, (2) induction of immunologic tolerance against paternal antigens, (3) preparation of the endometrium for implantation and placentation, and (4) immunologic support required for the fetus during pregnancy. Seminal plasma is known to signal post-insemination changes in the uterine endometrium involving the redistribution of leukocytes. This may involve migration of leukocytes from the uterine wall to the ovary, as seminal plasma particularly increases the appearance of the major histocompatibility complex class II-positive cells. Uterine epithelial cells respond to sperm binding by the production of pro- or anti-inflammatory cytokines. These cytokines may include synchronizing substances, transferred through a counter-current pathway to the ipsilateral ovary, thereby accelerating the final maturation of preovulatory follicles and advancing time of ovulation. In several species, an ovulation-inducing factor exists in seminal plasma, first identified as ß-nerve growth factor in camelid semen, indicating another pathway that influences the hypothalamic-pituitary-gonadal axis. In summary, low-dose inseminations may not necessarily require semen deposition deep into the uterine horn, as binding inhibitors can circumvent the binding of sperm to the uterine wall. However, subsequent immune-relevant events that control ovulation and prepare the uterine milieu for the developing embryo should be taken into account. PMID:26462662

  9. Improving outcome of in vitro sperm activation using non–liquefied versus liquefied semen of oligoasthenozoospermic patients

    Directory of Open Access Journals (Sweden)

    Muhammad Fakhrildin


    Full Text Available Objective: To evaluate the efficacy of in vitro sperm activation (ISA using non-liquefied versus liquefied asthenozoospermic semen samples for improvement of sperm parameters. Materials and Methods: Fifty six oligoasthenozoospermic (OA patients (age range: 22-44 years; mean: 32.089 years were enrolled in this study. OA patients were classified according to type of infertility. Also, duration of infertility was recorded. Fifty six semen samples were collected, and seminal fluid analyses were done involving macroscopic and microscopic examinations were performed according to WHO methodology. Direct swim–up technique was used to separate the motile spermatozoa from seminal plasma. Minimum Essential Medium Eagle (MEME enriched with 5% Human serum albumin (HSA was used. One mL of either non–liquefied or liquefied semen was layered beneath 1 mL of MEME enriched with 5% HSA, and placed for incubation in an air incubator at 37 oC for 30 minutes. Then, one drop (10 ?L from upper layer of culture medium was taken using automatic pipette to be examined under high power field (40 X for assessment of sperm parameters.Results: According to type of infertility, infertile patients were classified into patients with either primary infertility (no. 46; 82.15 % or secondary infertility (no. 10; 17.85 %. In contrast to other parameters, significant (P<0.05 reductions were noticed in the percentages of sperm motility and progressive sperm motility for OA patients with primary infertility as compared to OA patients with secondary infertility. All sperm parameters were significantly (P<0.001 enhanced after in vitro activation of liquefied and non-liquefied semen samples when compared to pre-activation. In the present study, best results were achieved for non-liquefied semen samples as compared to liquefied semen samples.Conclusion: It was concluded that the outcome of ISA was enhanced in regard to sperm parameters when using non-liquefied semen of OA patients. Furthermore, some components of seminal plasma of OA patients may be have harmful effects on certain sperm functions when in vitro incubated for longer periods. Further study is recommended to investigate the effect of in vitro sperm activation from non-liquefied semen on successful rate of artificial insemination husband.

  10. Semen quality of Italian local pig breeds

    Directory of Open Access Journals (Sweden)

    G. Gandini


    Full Text Available From 1996 to 1999 a conservation programme was carried out within the framework of EC contract “European gene banking project for the pig genetic resources” (Ollivier et al., 2001 in the Italian local pig breeds. The aims of the program included the primary characterization of the breeds, i.e. information on the organization in charge of the breed, breeding population numbers, breed description and qualifications, and field trials on productive and reproductive performances. In this context the “Semen Bank of Italian local pig breeds” was built. A total of 30,835 straws of four Italian local pig breeds (Cinta Senese, Casertana, Mora Romagnola and Nero Siciliano, collected from 42 sires, have been stored. In this work semen quality traits, lipid composition and freezability of the four Italian local pig breeds are reported.

  11. Methods of cryopreservation of Tambaqui semen, Colossoma macropomum. (United States)

    Varela Junior, A S; Goularte, K L; Alves, J P; Pereira, F A; Silva, E F; Cardoso, T F; Jardim, R D; Streit, D P; Corcini, C D


    This study compared three different techniques for sperm cryopreservation of Tambaqui (Colossoma macropomum). Semen was diluted in Beltsville Thawing Solution with the addition of dimethyl sulfoxide (DMSO) at various concentrations (5%, 10%, 15% and 20%). Cryopreservation was performed using three methods: Box Conditioner Method with straws at a 5 cm distance from liquid nitrogen vapor (N2L); Dry Shipper Method placing the straws inside the machine; Vitrification Method placing the straws directly into N2L, amounting to 12 treatments (four DMSO concentrations×three freezing methods). The samples were evaluated for analysis of sperm quality in vivo and in vitro. Use of the Vitrification Method at different concentrations of DMSO provided the least values in the different evaluations. Fertilization, hatching rates and plasma membrane integrity using the Box Conditioner Method with 5% and 10% DMSO did not differ (P>0.05) but use of the concentration of 5% DMSO resulted in greater values than the other treatments (P<0.05) as well as for sperm motility and latency time (P<0.05), although sperm viability was superior using the Dry Shipper Method with 20% of the cryoprotectant. Mitochondrial functionality was impaired by use of the Vitrification Method with all DMSO concentration tested showing the most desirable values when the Box Conditioner Method was used with 5%, 10%, 15% DMSO and the Dry Shipper Method was used with 10% and 15% DMSO. Considering the variables evaluated, the use of the Box Conditioner Method is associated with enhanced Tambaqui semen quality with freeze concentrations of 5% and 10% DMSO. PMID:25906678

  12. Penambahan Osteopontin dalam Pengencer Semen Beku Sapi Perah Friesian Holstein Meningkatkan Ekspresi B-Cell Cll/Lymphoma-2 Spermatozoa Postthawing (ADDITIONAL OSTEOPONTIN INTO FROZEN FRIESIAN-HOLSTEIN SEMEN DILUTER INCREASES THE EXPRESSION OF B-CELL CLL/L

    Directory of Open Access Journals (Sweden)

    Abdul Samik


    Full Text Available Post thawed frozen semen viability is one of the most important keys in artificial inseminationdepended on two major cell death mechanism, apoptosis and necrosis. It has been known that good fertilitydiary bull’s seminal plasma contains high concentration of osteopontin (OPN. Osteopontin also known ascell survival protein via inhibition to apoptotic cell death, and B-cell CLL/Lymphoma-2 (Bcl-2expressionmostly related to the ability of cell survival. The aim of this study was to investigate the influence ofadditional OPN into frozen semen diluter on post thawed sperm Bcl-2 expression. Fresh semen collectedfrom ±4 year Friesian Holstein bull. Treatment group divided into four groups i.e.: control group (P0:without OPN supplementation, (P1: fresh semen with OPN supplementation 5 ?g/5.107 spermatozoa, (P2:fresh semen with OPN supplementation 10 ?g/5.107 spermatozoa, (P3: fresh semen with OPNsupplementation 20 ?g/5.107spermatozoa. Bcl-2 sperm expression was determined usingimunocytochemistry. The result of this study showed that there was no significant difference betweengroup P0 and P1 (p>0,05, but both group P2 and group P3 showed a significant difference with P0 (p<0,05.Nevertheless, there was no significant difference between group P2to group P3 on post thawed FriesianHolstein sperm Bcl-2 expression (p>0,05. The conclusion of this study is osteopontin supplement in frozensemen diluter is capable to increase post thawed Friesian Holstein sperm Bcl-2 expression.

  13. Influence of addition of different antibiotics in semen diluent on viable bacterial count and spermatozoal viability of Awassi ram semen


    O. I. Azawi; M A Ismaeel


    The objectives of the present study were to determine the effects of six different antibiotics in controlling the growth of semen contaminating bacteria and if these antibiotics have any adverse effect on Awassi ram spermatozoa. Semen samples from six mature Awassi rams were used in this study. A total number of 120 ejaculates were collected from the rams using an artificial vagina once a week. Semen ejaculates were evaluated for volume, sperm concentration, mass motility, individual motility...

  14. Métodos de coleccion de semen en camélidos sudamericanos - Methods of semen collection in south american camelids

    Directory of Open Access Journals (Sweden)

    Pacheco Curie, Joel Iván;


    Full Text Available ResumenLa colección de semen depende de una buena y constante producciónespermática para que la calidad del semen sea buena. Las técnicas decolección de semen están bastante desarrolladas en otros animales,especialmente en rumiantes domésticos en los cuales ya es unprocedimiento de rutina, pero en camélidos, dadas las especialescaracterísticas reproductivas, anatómicas y fisiológicas de estasespecies, esta colección es bastante dificultosa y no existe un protocolo recomendado y una técnica optima, así como su manejo posterior. Las características seminales son también muy variables y dependen de la forma de colección y existen varios factores que afectan su calidad, así como frecuencia de colección, edad, época, etc., por lo que también se evaluaron y desarrollaron diferentes técnicas de degelificar, diluir, conservar y congelar estas células espermáticas, de acuerdo a la técnica de colección y la especie, así como la utilización de dilutores y crioprotectores utilizados para otras especies, pudiéndose posteriormente utilizar en la evaluación reproductiva de los machos.SummaryThe collection of semen depends on a good and constant spermaticproduction so that the quality of the semen is good. The techniques ofcollection of semen enough developed in other animals are, especially in ruminant domestic in which is already a routine procedure, but incamélids, given the special ones characteristic reproductive, anatomical and physiologic of these species, this collection is quite difficult and it doesn't exist a recommended protocol and a good technique, as well as its later handling. The seminal characteristics are also very variable and they depend in the collection way and several factors that affect their quality, exist as well as collection frequency, age, time, etc, for what too were also evaluated and they developed different techniques of degelification, to dilute, to conserve and to freeze these spermatic cells,according to the collection technique and the species, as well as theextenders use and crioprotectors used for other species, being able tolater on to use in the reproductive evaluation of the males.

  15. Environmental exposure to arsenic may reduce human semen quality: associations derived from a Chinese cross-sectional study

    Directory of Open Access Journals (Sweden)

    Xu Weipan


    Full Text Available Abstract Background Recent observations in in vitro and in vivo models suggest that arsenic (As is an endocrine disruptor at environmentally-relevant levels. When exposed to As, male rats and mice show steroidogenic dysfunction that can lead to infertility. However, the possible effects of As on human male semen quality remain obscure. Methods We monitored the profile of As species in the urine of a reproductive-age human cohort and assessed its association with semen quality. Men (n?=?96 were recruited in an infertility clinic from July 2009 to August 2010 in the Affiliated Hospital of Chongqing Institute for Population and Family Planning. Five urinary As species were analyzed by high-performance liquid chromatography coupled with inductively coupled plasma mass spectrometry (HPLC-ICP-MS. Clinical information on the semen volume, sperm concentration and motility was employed to catalogue and evaluate semen quality according to WHO guidelines. As species concentrations in addition to other continuous variables were dichotomized by the medians and modelled as categorical variables in order to explore using the binary logistic regression possible associations between As exposure and semen quality. Results Urinary concentrations (geometric mean ± SD, ?g g-1 creatinine of different As species were 7.49 (±24.8 for AsB, 20.9 (±13.7 for DMA, 2.77 (±3.33 for MMA, and 4.03 (±3.67 for Asi (AsiIII and AsiV. DMA concentrations above the median were significantly associated with below-reference sperm concentrations (P =0.02 after adjusting for age, body mass index (BMI, abstinence, smoking and drinking habits. In addition, smoking was positively associated with MMA. Conclusion Reduced parameters in human semen quality are positively associated with As exposure in a reproductive-age Chinese cohort.

  16. Semen collection methods affect the bacterial composition of post-thawed semen of silver barb (Barbodes gonionotus). (United States)

    Boonthai, Traimat; Khaopong, Weerasith; Sangsong, Jumlong; Sooksawat, Treerat; Nimrat, Subuntith; Vuthiphandchai, Verapong


    Biosafety issue associated with the risk of pathogenic contamination of cryopreserved semen is a common concern because of associated declines in sperm quality, storage period and disease transmission. This study was conducted to evaluate the effects of methods of semen collection on sperm quality and bacterial composition of post-thawed semen of silver barb (Barbodes gonionotus). Semen collection methods consisted of four treatments: (1) hand-stripping of abdomen without rinsing of urogenital area with water, (2) hand-stripping of abdomen after rinsing of urogenital area with water, (3) catheterization without rinsing of urogenital area with water and (4) catheterization after rinsing of urogenital area with water. Semen diluted with calcium-free Hank's balanced salt solution containing 10% dimethylsulfoxide (DMSO) was frozen at a freezing rate of -8°Cmin(-1) before plunging in liquid nitrogen. Post-thawed semen collected by catheterization after rinsing urogenital area had the lowest bacterial number, about 2-log reduction of total heterotrophic, Gram negative and pseudomonad bacteria, compared with the other three collection treatments. However, percentages of motile and viable sperm were not significantly (P>0.05) different among treatments. This method eliminated Flavobacterium aquatile, Bacillus megaterium, Kocuria varians, Staphylococcus haemolyticus and Aeromonas media in cryopreserved semen. This is the first report demonstrating the effects of semen collection methods on bacteriological quality of frozen-thawed fish semen. PMID:26778122

  17. Porcine semen as a vector for transmission of viral pathogens. (United States)

    Maes, Dominiek; Van Soom, Ann; Appeltant, Ruth; Arsenakis, Ioannis; Nauwynck, Hans


    Different viruses have been detected in porcine semen. Some of them are on the list of the World Organization for Animal Health (OIE), and consequently, these pathogens are of socioeconomic and/or public health importance and are of major importance in the international trade of animals and animal products. Artificial insemination (AI) is one of the most commonly used assisted reproductive technologies in pig production worldwide. This extensive use has enabled pig producers to benefit from superior genetics at a lower cost compared to natural breeding. However, the broad distribution of processed semen doses for field AI has increased the risk of widespread transmission of swine viral pathogens. Contamination of semen can be due to infections of the boar or can occur during semen collection, processing, and storage. It can result in reduced semen quality, embryonic mortality, endometritis, and systemic infection and/or disease in the recipient female. The presence of viral pathogens in semen can be assessed by demonstration of viable virus, nucleic acid of virus, or indirectly by measuring serum antibodies in the boar. The best way to prevent disease transmission via the semen is to assure that the boars in AI centers are free from the disease, to enforce very strict biosecurity protocols, and to perform routine health monitoring of boars. Prevention of viral semen contamination should be the primary focus because it is easier to prevent contamination than to eliminate viruses once present in semen. Nevertheless, research and development of novel semen processing treatments such as single-layer centrifugation is ongoing and may allow in the future to decontaminate semen. PMID:26506911

  18. Criopreservação de sêmen suíno: avanços tecnológicos e perspectivas / Cryopreservation of boar semen: progress and perspectives / Criopreservación de semen de verraco: avances y perspectivas tecnológicas

    Scientific Electronic Library Online (English)

    Tainã, Figueiredo Cardoso; Estela, Fernandes e Silva; Carine, Dahl Corcini.


    Full Text Available Resumo A criopreservação de sêmen suíno é uma técnica ainda não consolidada devido à alta sensibilidade do espermatozoide da espécie ao processo de congelamento e descongelamento. Ainda assim, a utilização do sêmen criopreservado é altamente desejável para o intercâmbio genético e manutenção da bios [...] segurança. Esta revisão tem como objetivo ressaltar alguns fatores limitantes do processo e apontar os consideráveis avanços desenvolvidos nos últimos anos, principalmente devido ao aperfeiçoamento das técnicas já existentes, como caracterização das proteínas do ejaculado, ajustes na remoção do plasma seminal e uso de adjuvantes na confecção dos diluentes. Todas estas técnicas tornarão a criopreservação do sêmen suíno mais aplicável nos próximos anos para que possa ser finalmente uma técnica de uso comercial. Abstract in spanish Resumen La criopreservación del semen de porcino es una técnica aún no consolidada debido a la alta sensibilidad del espermatozoide de esta especie al proceso de congelación y descongelación, aun así, el uso de semen criopreservado es altamente deseable para el intercambio genético y el mantenimient [...] o de la bioseguridad. Esta revisión tiene por objeto poner de relieve algunos factores limitantes del proceso y señalar las importantes avances desarrollados en los últimos años, debido principalmente al mejoramiento de las técnicas existentes, entre ellas, la caracterización de las proteínas de la eyaculación, los ajustes de extracción del plasma seminal y el uso de adyuvantes en la producción de los diluyentes. Todas estas técnicas harán que la criopreservación del semen de porcino sea más aplicable en los próximos años, para ser finalmente una técnica de uso comercial. Abstract in english Abstract Biotechnology of boar semen cryopreservation has not succeeded due to the high sensitivity of swine sperm to the freezing and thawing process. However, its use is highly desirable for genetic improvement and maintenance of biosecurity. This review aims to highlight some limitations of the p [...] rocess and point out important advances obtained in recent years, including the improvement of existing techniques, such as protein characterization of the ejaculate, adjustments in the removal of seminal plasma, and use of adjuvants in the manufacture of diluents; all of which will make cryopreservation commercially available in the near future.

  19. Sperm parameters and biochemical components of goat seminal plasma in the rainy and dry seasons in the Brazilian Northeast: the season's influence on the cooling of semen Caracrterísticas espermáticas e bioquímicas do plasma seminal de caprinos nas estações chuvosa e seca do Nordeste brasileiro: influência da estação no resfriamento do sêmen

    Directory of Open Access Journals (Sweden)

    G.V. Aguiar


    Full Text Available The present study aimed to verify the caprine semen characteristics during dry and rainy seasons in the Brazilian Northeast, and the influence of these seasons on cooled semen. Seminal volume, concentration, percentage of motile cells, vigor and spermatic morphology, as well as biochemical profile (fructose, citric acid, P, Ca2+, Mg, total proteins and phospholipase A2 activity were analyzed. It was observed a reduction (PVerificou-se as características seminais de caprinos durante a época seca e a chuvosa no Nordeste brasileiro e a influência da época no resfriamento do sêmen. Foram mensurados volume, concentração espermática, porcentagem de espermatozoides móveis, vigor, morfologia espermática e características bioquímicas (frutose, ácido cítrico, fósforo, magnésio, proteínas totais e atividade da fosfolipase A2. Observou-se redução (P<0,05 no número de espermatozóides morfologicamente normais, frutose, ácido cítrico, fósforo, magnésio e proteínas totais durante a época seca que não influenciaram na motilidade, vigor, volume e concentração do sêmen. Entretanto, a atividade da fosfolipase A2 foi maior na época seca. Quando o sêmen foi submetido ao resfriamento a 4ºC durante 48 horas, houve redução (P<0,05 na motilidade total e no vigor espermático durante a época seca. Com base nesses resultados, conclui-se que o período chuvoso é melhor para resfriar sêmen de caprinos no Nordeste brasileiro.

  20. Model Perencanaan Pengangkutan dan Distribusi Semen di Wilayah Indonesia Timur

    Directory of Open Access Journals (Sweden)

    Windra Iswidodo


    Full Text Available Pertumbuhan ekonomi dan pembangunan di wilayah Indonesia timur dalam 5 tahun terakhir mengalami peningkatan yang cukup signifikan. Perkembangan infrastruktur di wilayah Indonesia timur merukapak salah satu faktor yang menyebabkan meningkatnya permintaan semen. Akan tetapi peningkatan permintaan semen ini tidak didukung oleh pola distribusi yang baik. Oleh karena itu, diperlukannya suatu solusi untuk memenuhi permintaan semen di wilayah Indonesia timur, salah satunya adalah dengan merencanakan pengangkutan dan distribusi semen dengan jaringan transportasi yang sesuai dengan karekteristik di wilayah Indonesia timur. Tugas akhir ini bertujuan untuk merencanakan rute distribusi semen di wilayah Indonesia timur untuk menghasilkan biaya transportasi yang minimum. Perbandingan antara konsep direct port dengan konsep multiport diharpakan dapat menentukan pola jaringan distribusi semen menuju wilayah Indonesia timur dengan biaya transportasi yang minimum diantara kedua konsep tersebut. Dari hasil pengembangan skenario terdapat titik tujuan yang belum terpenuhi, sehingga rute antisipasi untuk memenuhi permintaan semen pada titik tujuan dengan pola operasi kapal charter. Hasil perhitungan menunjukkan bahwa seluruh titik tujuan distribusi dapat terpenuhi oleh kapal perintis cargo passanger dan kapal charter . Konsep multiport lebih murah dibandingkan direct port, dengan selisih biaya transportasi sebesar  33% untuk contoh rute Ambon-Amahai-Geser-Banda. Sehingga konsep multiport lebih baik diterapakan untuk distribusi semen di wilayah Indonesia timur.

  1. Opportunities to improve liquid and frozen storage of boar semen (United States)

    Artificial insemination has facilitated the utilization of superior genetics, and has reduced boar biosecurity problems and housing costs. The use of frozen semen permits the flexibility to inseminate animals at unscheduled times and to use semen of deceased boars. While good long-term storage exten...

  2. Effects of Exogenous Glutathione Supplementation in Biocell® Extender on Quality of Cryopreserved Buffalo (Bubalus bubalis Semen

    Directory of Open Access Journals (Sweden)

    Tohid Rezaei Topraggaleah


    Full Text Available The study was designed to investigate the effect of exogenous glutathione supplementation in soybean based extender Bioxcell® extender on post thaw semen quality of buffalo (Bubalus bubalis. Split pooled ejaculates (n = 6, possessing >70% visual sperm motility were extended at 37°C with different levels of glutathione (0.0, 0.5, 1 and 2 mM in Bioxcell® extender. Semen was cooled to 4°C in 2 h, equilibrated at 4°C for 4 h, filled in 0.5 mL straws and frozen in a programmable cell freezer before plunging into liquid nitrogen. Thawing of frozen semen was performed after 72 h at 37°C for 30 sec. Sperm motion characteristics, viability, plasma membrane integrity, acrosome morphology of each semen sample immediately after thawing and incubation for 2 h were assessed by using Computer assisted semen analyzer (SCA, eosin-nigrosin staining, Hypo Osmotic Swelling (HOS assay and phase contrast microscope, respectively. Results revealed that the addition 0.5 and 1.0 Mm of glutathione in Bioxcell® extender did not present any significant effect on overall and progressive motility as well as sperm motility characteristics (VAP, VSL, VCL, LIN and ALH, compared to the control groups (p>0.05. Immediately after thawing the proportion of post thaw sperm viability, plasma membrane integrity and normal apical ridge remained similar in all groups. However, glutathione supplementation of the extender with 2.0 mM concentration decreased sperm motility, viability at 0 and 2 h after thawing in a dose dependent manner compared to the control (p0.05. These results revealed that supplementation of the new commercial in soybean based extender Bioxcell® with glutathione did not improve sperm post thaw motility or acrosomal integrity.

  3. Indian story on semen loss and related Dhat syndrome (United States)

    Prakash, Om; Kar, Sujit Kumar; Sathyanarayana Rao, T. S.


    India is a country of many religions and ancient cultures. Indian culture is largely directed by the Vedic culture since time immemorial. Later Indian culture is influenced by Buddhism, Islam, and Christianity. Indian belief system carries the footprints of these cultures. Every culture describes human behaviors and an interpretation of each human behavior is largely influenced by the core cultural belief system. Sexuality is an important domain which is colored by different cultural colors. Like other cultures, Indian culture believes “semen” as the precious body fluid which needs to be preserved. Most Indian beliefs consider loss of semen as a threat to the individual. Ancient Indian literature present semen loss as a negative health related event. Dhat syndrome (related to semen loss) is a culture-bound syndrome seen in the natives of Indian subcontinent. This article gathers the Indian concepts related to semen loss. It also outlines belief systems behind problems of Dhat syndrome. PMID:25568479

  4. AZF Microdeletions in Human Semen Infected with Bacteria

    Directory of Open Access Journals (Sweden)

    Hayfa H Hassani


    Full Text Available Bacterial infections are associated with infertility in men. This study was aimed to investigate microdeletions on Yq chromosome in semen infected with bacteria by using bacteriological, biochemical, and serological assays. The investigation showed that 107 of 300 (84.80% semen samples collected from infertile men with primary or secondary infertility were infected with different species of bacteria. Chlamydia trachomatis and Neisseria gonorrheae were the most frequently diagnosed bacteria in the infected semen samples. The percentages of infections of semen samples with C. trachomatis and N. gonorrhea were 42.31% and 35.28% respectively. Genomic DNA from each semen sample infected with predominant bacteria was analyzed for AZF deletions by using multiplex PCR. Different patterns of AZF microdeletions were obtained. It can be concluded that sexually transmitted bacteria may contribute in microdeletions of Yq chromosome by indirectly producing reactive oxygen species and causing gene defect in AZF regions.

  5. Progressive motility - a potential predictive parameter for semen fertilization capacity in bovines. (United States)

    Li, Y; Kalo, D; Zeron, Y; Roth, Z


    We examined the association between progressive motility of spermatozoa and in vitro fertilization (IVF) competence of bovine ejaculates. Fresh semen was evaluated using a computerized sperm quality analyzer for bulls using progressive motility as the primary parameter. Ejaculates with high progressive motility (HPM; >81%) were compared with those with low progressive motility (LPM; 0.05). Examination of sperm morphology revealed a higher proportion of spermatozoa with abnormal morphology (P < 0.01) in LPM versus HPM ejaculates, the predominant abnormal feature being a bent tail (P < 0.05). Sperm viability, acrosome integrity and DNA fragmentation did not differ between HPM and LPM samples. Mitochondrial membrane potential was higher (P < 0.01) in HPM versus LPM semen. Zinc concentrations in the seminal plasma correlated with progressive motility (R2 = 0.463, P = 0.03). In addition, representative ejaculates from HPM and LPM groups were cryopreserved in straws and used for IVF. The proportions of embryos cleaved to 2- and 4-cell stages (88.1 ± 1.1 versus 80.5 ± 1.7, P = 0.001) and developed to blastocysts (33.5 ± 1.6 versus 23.5 ± 2.2, P = 0.026) were higher for HPM than LPM semen. The total cell number of embryos and blastocyst apoptotic index did not differ between groups. Although sperm progressive motility is associated with IVF competence, further examination is required to determine whether progressive motility can serve as a predictor of semen fertilization capacity in vivo. PMID:25532584

  6. Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities. (United States)

    Liu, Te; Cheng, Weiwei; Gao, Yongtao; Wang, Hui; Liu, Zhixue


    MicroRNAs (miRNAs) play a crucial role in tissue development and the pathology of many diseases, however, the effects and roles of miRNAs in the development of semen abnormalities in infertile males have not yet been investigated. In this study, we analyzed and compared the miRNA expression profiles of abnormal semen from 86 infertile males with normal semen from 86 healthy males using an miRNA microarray. In total, 52 miRNAs were differentially expressed between the abnormal semen of infertile males and the normal semen of healthy males. The differential expression of selected miRNAs was validated by real time qRT-PCR and northern blotting: miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b were upregulated (fold change>1.5, p<0.001) and miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a were downregulated (fold change<0.667, p<0.001) in the semen of infertile males with semen abnormalities. In conclusion, this study provides new insights into specific miRNAs that are associated with semen abnormalities in infertile males. PMID:22735917

  7. Clinical relevance of routine semen analysis and controversies surrounding the 2010 World Health Organization criteria for semen examination

    Scientific Electronic Library Online (English)

    Sandro C., Esteves.


    Full Text Available Semen analysis is the corner stone of infertility evaluation as it provides information on the functional status of the seminiferous tubules, epididymis and accessory sex glands. The methods on how the human semen should be evaluated are provided by the World Health Organization, which periodically [...] releases manuals that include specific protocols and reference standards. In 2010, the WHO published new criteria for human semen characteristics that were markedly lower than those previously reported. In this review initially it is discussed the limitations of semen analysis as a surrogate measure of a man’s ability to father a pregnancy. Secondly, it is analyzed methodology issues that could explain why the newly released reference values were different from those earlier reported. Thirdly, it is speculated on the likely effects of the 2010 WHO criteria in the management of male infertility. Due to the several inherent limitations of semen analysis as a surrogate marker of male infertility, physicians should exercise caution when interpreting results. A template for semen analysis reports that incorporates the distribution of the semen characteristics of recent fathers in centiles rather than solely the minimum thresholds could aid clinicians to better understand how a given patient results compare with the reference population. Importantly, a male infertility evaluation must go far beyond a simple semen analysis, as it has to be complemented with a proper physical examination, a comprehensive history taking, and relevant endocrine, genetic, and other investigations.

  8. Comparative study of heparin-binding proteins profile of Murrah buffalo (Bubalus bubalis semen

    Directory of Open Access Journals (Sweden)

    S. S. Ramteke


    Full Text Available Aim: The experiment was conducted to study the total seminal plasma protein (TSPP and heparin-binding proteins (HBPs in relation to initial semen quality of buffalo bull. Materials and Methods: Semen from two Murrah buffalo bulls (bull no. 605 and 790 with mass motility of ?3+ were used for the study and categorized into three groups (Group I- Mass motility 3+, Group II- Mass motility 4+ and Group III- Mass motility 5+. Seminal plasma from semen was separated by centrifugation. HBPs was isolated and purified from heparin-agarose affinity column by modified elution buffer. TSPP and isolated HBPs concentration was estimated by Lowry’s method. The purified HBPs were resolved on Sodium dodecyl sulfate polyacrylamide gel electrophoresis to check the protein profile of two bulls. Results: The mean values of TSPP concentrations in bull no. 605 and 790 in Group I, II and III were 30.64±0.12, 31.66±0.09, 32.53±0.19 and 28.51±0.09, 29.49±0.15, 30.45±0.17 mg/mL, respectively. The mean values of HBPs concentrations in bull no. 605 and 790 in Group I, II and III were 3.11±0.07, 3.32±0.06, 3.46±0.08 and 2.51±0.08, 2.91±0.05, 3.10±0.03 mg/mL, respectively. Both the values of TSPP and HBPs were significantly higher (p<0.01 in bull no. 605 when compared to 790 in all the three groups. 31 kDa HBP was more intensely present in bull no. 605, thus may indicate its superiority over bull no. 790 in relation to fertility potential. Conclusion: TSPP and HBPs shows variation in concentration with respect to initial semen quality. Furthermore, presence of fertility related 31 kDa HBPs in one of the bull may be an indication of high fertility of a bull. In future, in-vivo and in-vitro correlative study on larger basis is needed for the establishment of fertility-related HBPs in semen which might establish criteria for selection of buffalo bull with high fertility potential.

  9. Semen A Altshuler: scientist, mentor, teacher (United States)

    Kochelaev, Boris I.


    International Conference `Resonances in Condensed Matter' is devoted to 100 years of the birthday of the Corresponding member of Academy of Sciences of the USSR, Professor of the Kazan University Semen Alexandrovich Altshuler (1911-1983). He is well known by pioneer works on EPR, the prediction and grounds for an existence of the neutron magnetic moment, the prediction and the theory of the acoustic paramagnetic resonance, and as a founder of the Kazan scientific school `Magnetic radiospectroscopy of condensed matter' (with E K Zavoiskii and B M Kozyrev)

  10. Semen A Altshuler: scientist, mentor, teacher

    International Nuclear Information System (INIS)

    International Conference 'Resonances in Condensed Matter' is devoted to 100 years of the birthday of the Corresponding member of Academy of Sciences of the USSR, Professor of the Kazan University Semen Alexandrovich Altshuler (1911–1983). He is well known by pioneer works on EPR, the prediction and grounds for an existence of the neutron magnetic moment, the prediction and the theory of the acoustic paramagnetic resonance, and as a founder of the Kazan scientific school 'Magnetic radiospectroscopy of condensed matter' (with E K Zavoiskii and B M Kozyrev)

  11. The effect of semen collection method and level of egg yolk on capability of dilution and storage of buck semen

    Directory of Open Access Journals (Sweden)

    N.N. Dhaher


    Full Text Available The study was conducted to evaluate the effect of semen collection method for reduction of the deleterious interaction between the enzymes of bulbourethral gland and egg yolk during the dilution and storage of buck semen by three different level of egg yolk. Ten bucks were used in this study; the bucks were divided into two groups (five bucks in each group. Semen samples were collected once a week for four weeks from the bucks in first group using an artificial vagina, and from the animals in second group using an electroejaculator. The collected semen samples were diluted with sodium citrate extender with three different level of egg yolk (5, 10 and 20%. Extend semen samples were stored at 5 °C for three days. Computer assisted sperm analysis and Sperm Class Analyzer® were used for evaluation of the buck semen samples. Sperm motility parameters were evaluated which includes; percentage of motile sperm, percentage of progressive motile sperm, the value of the linear velocity (VSL, the value of the average velocity (VAP, the value of the curvilinear velocity (VCL, and the amplitude of lateral movement of the head (ALH. Results showed that all sperm motility parameters under the different level of egg yolk in semen samples that collected by artificial vagina were significantly higher than those which collected by electroejaculator. The percentage of motile sperm and progressive motile sperm of samples that collected by artificial vagina were higher at 10% of egg yolk, while these motility parameters were higher at 5% of egg yolk for semen samples that collected by electroejaculator. The differences between the two methods of semen collection in VCL and ALH were clear and the values were higher in samples that collected using the artificial vagina. The values of VSL, VAP and VCL of semen samples that collected by artificial vagina were higher at the second day than first day of semen storage under 10% of egg yolk. In conclusion, there are effects of the semen collection method on ability of dilution and storage of buck semen, and using of artificial vagina and 10% of egg yolk is recommended for buck semen dilution and storage.

  12. Effect of psychological stress on the L-arginine-nitric oxide pathway and semen quality

    Directory of Open Access Journals (Sweden)

    S. Eskiocak


    Full Text Available It has been reported that mental stress causes abnormality of spermiogram parameters. We investigated the effect of psychological stress on the L-arginine-nitric oxide (NO pathway. Semen samples were collected from 29 healthy fourth semester medical students just before (stress and 3 months after (non-stress the final examinations. Psychological stress was measured by the State Anxiety Inventory questionnaire. After standard semen analysis, arginase activity and NO concentration were measured spectrophotometrically in the seminal plasma. Measurements were made in duplicate. During the stress period, sperm concentration (41.28 ± 3.70 vs 77.62 ± 7.13 x 10(6/mL, rapid progressive motility of spermatozoa (8.79 ± 1.66 vs 20.86 ± 1.63% and seminal plasma arginase activity (0.12 ± 0.01 vs 0.22 ± 0.01 U/mL were significantly lower than in the non-stress situation, whereas seminal plasma NO (17.28 ± 0.56 vs 10.02 ± 0.49 µmol/L was higher compared to the non-stress period (P < 0.001 for all. During stress there was a negative correlation between NO concentration and sperm concentration, the percentage of rapid progressive motility and arginase activity (r = -0.622, P < 0.01; r = -0.425, P < 0.05 and r = -0.445, P < 0.05, respectively. These results indicate that psychological stress causes an increase of NO level and a decrease of arginase activity in the L-arginine-NO pathway. Furthermore, poor sperm quality may be due to excessive production of NO under psychological stress. In the light of these results, we suggest that the arginine-NO pathway, together with arginase and NO synthase, are involved in semen quality under stress conditions.


    Directory of Open Access Journals (Sweden)



    Full Text Available Semen from three Egyptian buffalo bulls was collected once weekly and ejaculates with more 75% progressive motility and more 85 % normal sperm morphology prior to cryopreservation were pooled in order to have sufficient semen for a replicate and to eliminate the bulls effect. Seven extenders were used: Tris 20 % egg yolk extender with 7 ml glycerol as a control (T1, and substitution of whole egg yolk with 4, 6, 8, 10, 12 and 15 % low density lipoprotein (LDL, T2 – T6, respectively. Semen was diluted to 80 x106 sperm/ml, packaged into 0.25 ml straws, cooled, held at 5.C for 4 h, and then frozen in liquid nitrogen (LN and stored at -196.C for at least one month. Sperm progressive motility, intact acrosome and plasma membrane integrity were assesd at post dilution, equilibration, post-thawing (at 37.C for 30 sec. and after 30 days storage in LN. This study reveled that LDL extenders were more effective in preservation of progressive motility, intact acrosome and integrity of the plasma membrane of buffalo spermatozoa than whole egg yolk extender. Sperm progressive, intact acrosome and plasma membrane integrity were much higher (P < 0.05 in the 12% LDL extender (63.3, 77.17 and 71.3% respectively vs. 35, 40.8 and 34.7% in the control 20% EY extender at post-thawing process, respectively. Fertility rates were higher in extender containing 12% LDLs compared with the control (72.7% vs. 50%, respectively. It was concluded that LDL (12% in extender improved the freezability and fertility of buffalo bull spermatozoa.

  14. Influences of a diet supplemented with linseed oil and antioxidants on quality of equine semen after cooling and cryopreservation during winter. (United States)

    Schmid-Lausigk, Yvonne; Aurich, Christine


    Seasonal changes in the reproductive physiology of stallions contribute to a decrease in the quality of frozen-thawed semen during late winter. Changes in the lipid composition of the sperm plasma membrane may contribute to this phenomenon. In the present study, we have, therefore, investigated the effects of adding linseed oil (LO) in combination with antioxidants to the diet of breeding stallions on the motility and membrane integrity of cooled-stored and cryopreserved semen. Starting in November, the diet of LO stallions (n = 6) but not control (C) stallions (n = 5) was supplemented with LO (100 mL once daily) plus an antioxidant (Myostem Protect; Audevard, Clichy, France) for a total of 84 days. Before (November) and at the end of this period (February), ejaculates were processed for cryopreservation (n = 3 ejaculates per stallion) and cooled shipping at 5 °C. Frozen-thawed and cooled-shipped semen was sent to the laboratory for computer-assisted semen analysis of total motility, progressive motility, and velocity parameters (average path velocity [VAP], curved line velocity [VCL], and straight-line velocity [VSL]) and evaluation of membrane integrity. The quality of frozen-thawed semen decreased (P 0.05). A decrease in the velocity parameters VAP, VCL, and VSL was more pronounced in LO stallions than in C stallions (e.g., VSL: November LO 67 ± 1 ?m/s, C 64 ± 2 ?m/s; February LO 59 ± 2 ?m/s, C 63 ± 2 ?m/s; interaction month by treatment, P cooled-stored semen, total motility, progressive motility, and membrane integrity were lower in February than in November (P cooled storage = 24 hours after semen collection: total motility in November LO 88 ± 1% and C 87 ± 3%; in February LO 83 ± 2% and C 73 ± 11%; interaction month by treatment: P cooled-stored stallion semen during winter. This may improve the fertility of cooled-shipped semen. In contrast, the treatment did not counteract the decrease in quality of frozen-thawed semen that occurs in late winter. PMID:24576708

  15. Cytokines in the blood and semen of infertile patients (United States)

    Havrylyuk, Anna; Chopyak, Valentyna; Boyko, Yaryna; Kril, Iryna


    Cytokines have been important mediators of the immunity and can be involved in numerous processes in the male genital tract including acting as immunomodulatory elements within the male gonad. The aims of this study were: 1) to detect pro- and anti-inflammatory cytokine levels in the control group and subgroups of infertile men; and 2) to set up the practical recommendations concerning determination of cytokine levels for the male infertility diagnosis. Observations were performed in a group of 82 men: healthy controls (n = 27) and infertile patients (n = 55). The male infertility group was further subdivided into patients with: varicocele (n = 22), idiopathic infertility (n = 13) and partners of couples with recurrent spontaneous abortion (RSA; n = 20). Semen analysis was determined following WHO criteria. The cytokine interleukin 1? (IL-1?), IL-6, IL-10, IL-18; tumor necrosis factor ? (TNF-?), interferon g (IFN-g) and transforming growth factor ?1 (TGF-?1) contents in serum and seminal plasma were determined by quantitative ELISA. An interesting marker of male infertility appears to be TGF-?1 (blood) significantly elevated in idiopathically infertile males and in the RSA group. Besides elevated TGF-?1 in a group of idiopathic infertility significantly elevated IL-10, IL-18, IFN-g (blood) and statistically decreased IL-1? while increased IFN-g were revealed in seminal plasma compared to healthy controls. We may postulate novel cytokine micropatterns for patients with different background of infertility. Therefore, circulating cytokines: IL-1?, IL-10, IL-18, TGF-?1, IFN-g and IL-1?, IFN-g and TGF-?1 in seminal plasma should be extended in evaluation of specific types of male infertility. PMID:26648778

  16. Semen cryopreservation protocols of Mangalarga Marchador stallions

    Directory of Open Access Journals (Sweden)

    Marcela Leite Candeias


    Full Text Available The effect of the utilization of three semen protocols (Inra 82®, Merck Gema and Botu-crio® and two filling techniques (0.25 and 0.50 mL straws in Mangalarga Marchador stallions were studied in this experiment. Sperm parameters were assessed during processing and post-freezing. No interactions between the protocols and type of filling were observed, so they were assessed separately. Sperm parameters were not altered when the extender was added to the centrifugation; however, there was reduction of motility and strength when freezing extenders were added. The Botu-crio® protocol preserved the parameters of total and progressive sperm motility, smoothed path velocity (µm/s, straight line velocity (µm/s, track velocity (µm/s and the average and fast spermatozoa percentage better than the others. No difference between the extenders for the percentage of sperm integrity was observed. There was no difference in the responses studied on the filling techniques. The stallions presented better freezing with the use of the Botu-crio® protocol. The best post-freezing viability results were found for semen frozen using the Botu-crio® protocol and there were no differences concerning the sperm quality comparing 0.25 and 0.50 mL straws.

  17. Semen cryopreservation protocols of Mangalarga Marchador stallions

    Scientific Electronic Library Online (English)

    Marcela Leite, Candeias; Marco Antonio, Alvarenga; Márcio Teoro do, Carmo; Heder Nunes, Ferreira; Mônica Russo Souto, Maior; Rodolpho de Almeida, Torres Filho; André Luís Rios, Rodrigues; Felipe Zandonadi, Brandão.


    Full Text Available The effect of the utilization of three semen protocols (Inra 82®, Merck Gema and Botu-crio®) and two filling techniques (0.25 and 0.50 mL straws) in Mangalarga Marchador stallions were studied in this experiment. Sperm parameters were assessed during processing and post-freezing. No interactions bet [...] ween the protocols and type of filling were observed, so they were assessed separately. Sperm parameters were not altered when the extender was added to the centrifugation; however, there was reduction of motility and strength when freezing extenders were added. The Botu-crio® protocol preserved the parameters of total and progressive sperm motility, smoothed path velocity (µm/s), straight line velocity (µm/s), track velocity (µm/s) and the average and fast spermatozoa percentage better than the others. No difference between the extenders for the percentage of sperm integrity was observed. There was no difference in the responses studied on the filling techniques. The stallions presented better freezing with the use of the Botu-crio® protocol. The best post-freezing viability results were found for semen frozen using the Botu-crio® protocol and there were no differences concerning the sperm quality comparing 0.25 and 0.50 mL straws.

  18. Use of factor scores for determining the relationship between body measurements and semen traits of cocks


    Udeh Ifeanyichukwu


    Semen evaluation is required to predict fertility. In most rural African communities, facilities for microscopic evaluation of semen are not available. Therefore, an indirect method of predicting semen traits of cocks is required by poultry farmers. The objective of this study was to use factor scores derived from factor analysis of body measurements to predict some semen traits of cocks. Correlation matrix was obtained by calculating the correlations between body measurements and semen trait...

  19. Comparison of four diluents for the retriever dogs semen preservation

    Directory of Open Access Journals (Sweden)

    A. Wicaksono


    Full Text Available The quality of chilled semen depends on the composition of diluent. The choice of the buffer, anti-cold shock and nutrition sources can be the first decision in order to choose appropriate diluents. Nowadays a lot of diluent are used for canine semen preservation such as Tris buffer and Citrate buffer. This study was aimed to observe the differences of diluent for preserving Retriever dog spermatozoa. The semen sample collected from four Retriever dogs with three times repetition. The semen was evaluated macro-and microscopically. The semen with >70% sperm motility was divided into four tubes and diluted with diluter 1 (P1, diluter: P2, P3 and P4 (modified P3. The diluted semen was divided into two tubes and each sample was stored at room and 50C temperature. The viability of chilled semen was observed every 3 hours at room temperature and 12 hours at 50C. The result showed that P2 keep the sperm viability better than the other diluents. On 50C at 24 hours storage P2 showed the highest motile and live sperm percentage (46.25 ± 0.22%; 57.11 ± 0.25%. In room temperature at 6 hours P2 showed the highest motile and live sperm percentage (40.94 ± 0.20%; 52.65 ± 0.23%. It is concluded that P2 can keep the sperm viability by 84 hours of 50C and 21 hours at room temperature.

  20. Relationships between rabbit semen characteristics and fertilising ability after insemination. (United States)

    Theau-Clément, M; Ailloud, E; Sanchez, A; Saleil, G; Brun, J M


    This study aimed to analyse the relationship between rabbit semen characteristics and semen fertilising ability after insemination, which is generally found to be weak. Our hypothesis was that using high semen dilutions (1 : 19), non-oestrus-stimulated does, and homospermic inseminations would make it easier to predict semen fertilising ability. Semen characteristics were evaluated on 275 ejaculates of 128 INRA1001 bucks, distributed into five successive batches. A total of 1970 inseminations were performed. The continuous semen variables were subdivided into three classes of similar size to account for any non-linear relationship between semen characteristics and fertilising ability. Mass motility was divided into two classes according to the presence or absence of waves under microscope observation. Libido, the presence or absence of gel, volume, percentage of progressive sperms, curvilinear velocity, beat frequency of the flagellum, and straightness and linearity of sperm movement did not affect fertility, prolificacy or productivity. It was confirmed that mass motility, estimated by visual observation under the microscope, significantly influenced fertility as well as the percentage of motile and of rapid sperms, and the amplitude of lateral head displacement, estimated by a computer-assisted semen analysis system. To a lesser extent, the percentage of motile cells and of rapid cells significantly influenced prolificacy. Consequently, mass motility and the percentage of motile cells significantly influenced rabbit doe productivity (+1 live births/AI when the semen showed at least a beginning of wave movement, or when the percentage of motile cells was >84%). Interestingly, a gain of 1.5 rabbits was observed when the percentage of rapid cells changed from 64% to 79%, whereas productivity significantly dropped beyond 83% of rapid cells, reflecting a non-linear relationship. PMID:26549861

  1. Kualitas Semen Cair Kambing Peranakan Etawah dalam Modifikasi Pengencer Tris dengan Trehalosa dan Rafinosa (THE QUALITY OF ETAWAH CROSSBREED BUCK LIQUID SEMEN IN MODIFIED TRIS DILUENTS WITH TREHALOSE AND RAFFINOSE

    Directory of Open Access Journals (Sweden)

    Oriza Savitri Ariantie


    Full Text Available The aim of this study was to compare the efficacy of trehalose and raffinose supplementation in Trisegg yolk (TEY and Tris soya (TS diluents in optimizing the quality of Etawah Crossbreed liquid semen.Semen were collected from three sexually mature bucks using artificial vagina. Semen were then evaluatedand divided into six aliquot tubes. Each of them was diluted in TEY and TS supplemented with 50 mMtrehalose or raffinose, respectively. The liquid semen were then stored in refrigerator (5°C. The motility,viability and plasma membrane integrity (PMI of the spermatozoa were evaluated every 12 hours untilsperm motility remained up to 50%. The results showed that sperm motility in TEY supplemented withtrehalose or raffinose remained up to 50% for 72-84 hours, compared to in TS which was for 48-60 hours(P<0,05. The best diluent was demonstrated by TEY supplemented with trehalose where the spermmotility was 52,82±3,21% up to 84 h compared to raffinose supplementation (52,78±4,41% and control(51,78±4,86% which was up to 72 hours, respectively. Meanwhile, the spermatozoa motility in TS diluentsupplemented with raffinose was 52,78±4,41% for up to 60 hours compared to supplemented with trehalose(53,33±3,54% and control (51,11±4,86% which was up to 48 hours. In all diluents, the viability ofspermatozoa was 6-9% higher than the percentage of sperm motility, whilst the percentage of PMI wassimilar to the percentage of sperm motility. In conclusion, TEY supplemented with trehalose was the bestdiluents for preservation of Etawah Crossbreed buck liquid semen, and when using TS diluent it isrecommended to add raffinose  rather than trehalose.

  2. Evaluation of sperm chromatin structure in boar semen

    Directory of Open Access Journals (Sweden)

    Banaszewska Dorota


    Full Text Available This study was an attempt to evaluate sperm chromatin structure in the semen of insemination boars. Preparations of semen were stained with acridine orange, aniline blue, and chromomycin A3. Abnormal protamination occurred more frequently in young individuals whose sexual development was not yet complete, but may also be an individual trait. This possibility is important to factor into the decision regarding further exploitation of insemination boars. Thus a precise assessment of abnormalities in the protamination process would seem to be expedient as a tool supplementing morphological and molecular evaluation of semen. Disruptions in nucleoprotein structure can be treated as indicators of the biological value of sperm cells.

  3. Should single layer centrifugation of dog semen be done before or after the semen is cooled? (United States)

    Gálvez, M J; Ortiz, I; Hidalgo, M; Morrell, J M; Dorado, J


    The aim of this study was to assess the effectiveness of sperm selection by single layer centrifugation (SLC) on canine sperm quality when SLC was performed before or after the cooling process, or when double SLC (before and after cooling) was performed. Twenty ejaculates from four dogs were divided into four aliquots as follows: unselected: no SLC was performed; SLC prior to cooling (SLC-PC): sperm selection was carried out before cooling; SLC after cooling (SLC-AC): sperm selection was performed after cooling; and double SLC: sperm selection was carried out before and after cooling. Sperm motility (by computer-assisted semen analysis), morphology (Diff-Quick staining), sperm membrane integrity (Vital-Test kit) and acrosome integrity (double fluorescent stain) were assessed in re-warmed semen samples. Four sperm subpopulations (sP) were detected using a pattern analysis technique (sP1: highly active, non-progressive; sP2: low velocity, highly progressive; sP3: less vigorous, poorly progressive; sP4: highly progressive motility). A higher proportion of sperm were classified as sP4 in SLC-AC samples. Most of the sperm parameters assessed showed higher values in the SLC-AC group. We conclude that SLC-AC is the best protocol to improve sperm quality in chilled canine semen in comparison to the other procedures tested. PMID:25653394

  4. Variations of protein profiles and calcium and phospholipase A2 concentrations in thawed bovine semen and their relation to acrosome reaction


    V. Alonso Marques; L.R. Goulart; A.E.D. Feliciano Silva


    Just as calcium plays an integral role in acrosome capacitation and reaction, several spermatozoon proteins have been reported as binding to the ovum at fertilization. We examined the relationship between thawed bovine semen protein profiles, seminal plasma calcium ion concentration, spermatozoon phospholipase A2 (PLA2) activity and acrosome reaction. Electrophoretic profile analysis of spermatozoa and bovine seminal plasma proteins (total and membrane) revealed qualitative and quantitative d...

  5. Environmental exposure to lead induces oxidative stress and modulates the function of the antioxidant defense system and the immune system in the semen of males with normal semen profile

    International Nuclear Information System (INIS)

    We investigated the associations between environmental exposure to lead and a repertoire of cytokines in seminal plasma of males with normal semen profile according to the WHO criteria. Based on the median lead concentration in seminal plasma, 65 samples were divided into two groups: low (LE) and high exposure to lead (HE). Differences in semen volume and the pH, count, motility and morphology of sperm cells were not observed between the examined groups. The total oxidant status value and the level of protein sulfhydryl groups as well as the activities of manganese superoxide dismutase and catalase were significantly higher in the HE group, whereas the total antioxidant capacity value and the activities of glutathione reductase and glutathione-S-transferase were depressed. IL-7, IL-10, IL-12, and TNF-α levels were significantly higher in the HE group compared with the LE group. Environmental exposure to lead is sufficient to induce oxidative stress in seminal plasma and to modulate antioxidant defense system. - Highlights: • Lead induces oxidative stress in seminal plasma in human. • Lead modulates antioxidant defense system in seminal plasma in human. • Lead does not change a Th1/Th2 imbalance in seminal plasma in human


    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo Betancur


    Full Text Available Abstract. Semen cryopreservation is a fundamental process for the development of biotechnologies for assisted reproduction in horses. The use of cryopreservation techniques with changes in concentrations and the nature of the cryoprotectant, as well as, the different types of vials for storage of semen, have become an alternative to improve the protocols used. The objective of this work was to evaluate the effect of two protocols of cryopreservation (freezing and vitrification on the fertilizing capacity of stallion semen. The study was conducted with horses of the Criollo Colombiano breed. For freezing was used a extender supplemented with egg yolk (4% and dimethyl formamide (5%, and 0.5 mL straws as vials, whereas for vitrification, the extender was supplemented with egg yolk (8% and dimethyl formamide (8%, and cryovials were used as carriers. As post thaw parameters were evaluated: progressive motility, vitality, normal morphology and integrity of the plasma membrane through the hypoosmotic swelling test (HOS. For statistical evaluation was fitted a generalized linear model (GLM and means were compared by the Tukey test. Were found average percentages of progressive motility, vitality, normal morphology and HOS of 41.6 ± 11.8 and 37 ± 8.5, 54.3 ± 10.2 and 52.3 ± 7.8, 83.1 ± 5.4 and 83.6 ± 5.8, 41.7 ± 9.8 and 38.9 ± 3.6, for cryopreserved semen by freezing and vitrification, respectively. There were no statistically significant differences (P ? 0.05 between treatments for any of the parameters evaluated. The fertilizing capacity of equine semen cryopreserved by vitrification is comparable to that obtained by conventional freezing.Resumen. La criopreservación de semen es un proceso fundamental en el desarrollo de biotecnologías para la reproducción asistida en equinos. El uso de diferentes técnicas de criopreservación con cambios en las concentraciones y la naturaleza de los crioprotectores, así como en los diferentes tipos de soportes para el almacenamiento del semen, se ha constituido en una alternativa para mejorar los protocolos empleados. El objetivo de este trabajo fue evaluar el efecto de dos protocolos de criopreservación (congelación y vitrificación, sobre la capacidad fecundante del semen equino. El estudio se realizó con equinos de la raza Criollo Colombiano. Para la congelación se empleó un diluyente suplementado con de yema de huevo (4% y dimetilformamida (5%, y pajillas de 0,5 mL como soportes; mientras que para la vitrificación, el diluyente fue suplementado con yema de huevo (8% y dimetilformamida (8% y se usaron crioviales como soportes. Post-descongelación, se evaluaron los parámetros: movilidad progresiva, vitalidad, morfología normal e integridad de la membrana plasmática (HOS. Para la evaluación estadística se ajustó un modelo lineal generalizado (GLM y las medias se compararon por la prueba de Tukey. Se encontraron porcentajes promedio de movilidad progresiva, vitalidad, morfología normal y HOS de 41,6±11,8 y 37,0±8,5, 54,3±10,2 y 52,3±7,8, 83,1±5,4 y 83,6±5,8, 41,7±9,8 y 38,9±3,6, para el semen criopreservado por congelación y vitrificación, respectivamente. No se encontraron diferencias estadísticamente significativas (P ? 0,05 entre los tratamientos para ninguno de los parámetros evaluados. La capacidad fecundante del semen equino criopreservado por vitrificación es equiparable a la obtenida por congelación convencional.

  7. Parental age at delivery and a man's semen quality

    DEFF Research Database (Denmark)

    Priskorn, Lærke; Jensen, Tina K; Lindahl-Jacobsen, Rune; Skakkebæk, Niels E; Bostofte, Erik; Eisenberg, Michael L


    STUDY QUESTION: Is parental age at delivery associated with a man's semen quality? SUMMARY ANSWER: In this large register-based study both mother's and father's age are found to have minimal effects on semen quality in men. WHAT IS KNOWN ALREADY: Both maternal and paternal age have been associated...... with a range of adverse health effects in the offspring. Given the varied health effects of parental age upon offspring, and the sensitivity of genital development to external factors, it is plausible that the age of a man's mother and father at conception may impact his reproductive health. To our...... knowledge this is the first examination of the effects of parental age on semen quality. STUDY DESIGN, SIZE, DURATION: A retrospective cohort study of 10 965 men with semen data and parental data. PARTICIPANTS/MATERIALS, SETTING, METHODS: The study was based on Danish men referred to the Copenhagen Sperm...

  8. Ebola Persists for Extended Period in Survivors' Semen (United States)

    ... Ebola Persists for Extended Period in Survivors' Semen: Study ... 2015 WEDNESDAY, Oct. 14, 2015 (HealthDay News) -- The Ebola virus is capable of hiding out in the ...

  9. Relación entre calidad del semen y la edad / Relationship between quality of semen and age

    Scientific Electronic Library Online (English)

    John, Chávez; José, Yarlequé; Elmer, Avalos; Ruth, Barrientos-Marka; MarcoAntonio, García.


    Full Text Available Objetivo: Determinar la relación entre la calidad del semen humano y la edad. Material y Métodos: El espermatograma se realizó siguiendo el Manual de Laboratorio de la OMS para el examen del Semen Humano y de la Interacción Moco Cervical y Semen (1999), de los exámenes realizados entre julio 2003 a [...] diciembre 2008. Se estudiaron 2 441 casos de varones que cumplen con los criterios de inclusión. Resultados: La motilidad A+B fue de 51,55% para varones de 20 a 29 años; los espermatozoides normales fue de 77,73% para varones mayores de 50 años; el recuento espermático (mill/ml) fue de 61,09 para varones mayores de 50 años.La evaluación de la motilidad espermática tuvo como coeficiente de correlación lineal múltiple de 0,222 y coeficiente de determinación de 0,049; en la morfología espermática, coeficiente de correlación lineal de 0,0622 y coeficiente de determinación de 0,0039; en el recuento espermático, coeficiente de correlación lineal múltiple de 0,465 y coeficiente de determinación de 0,216. Conclusiones: existe una tendencia inversa entre la motilidad y la edad, una tendencia directa entre el recuento espermático y la edad, y una tendencia constante entre morfología espermática y edad. Abstract in english Objectives: To determine the relationship between the quality of human semen and age. Methods: A spermatogram was performed following the WHO´s laboratory manual to evaluate human sperm and the interaction between cervical mucus and semen (1999) from July 2003 and December 2008. We studied 2441 male [...] cases that fulfilled the inclusion criteria. Results: A+B motility was 51.55% for 20-29 years of age male participants; normal spermatozoids were found in 77.73% of males above 50 years of age; the spermatic count (mill/ml) was 61.09 for males above 50 years of age. Spermatic motility had a multiple lineal correlation coefficient of 0.222 and a determination coefficient of 0.049; respective values for the spermatic count were 0.465 and 0.216. Conclusions: There is an inverse trend between motility and age, a direct trend between spermatic count and age, and a constant trend between spermatic morphology and age.


    Directory of Open Access Journals (Sweden)

    P. URDEA


    Full Text Available Spontaneous Potential Investigations in Semenic Mountains. The use of geophysical methods such as that of Spontaneous Potential (SP to investigate areas where the geomorphological processes occur, has the role to identify less visible processes as for example subcutaneous erosion or piping, subsoil water drainage and finding specific spatial differences of these processes. Comparative study of these sites allows correlation between geomorphological factors, soil and climate, but also to observe the evolution of subsurface erosion or underground water infiltration over time. During this investigation a series of mesh grids have been made in areas with different characteristics (lithology, pedology, slope, exposition, etc. at different time periods in order to spot and analyse the change in data in the chosen sites, various conditions given. Values expressed in millivolts (mV obtained by the Spontaneous Potential method have been put into an algorithm for interpolation looking to yield a pattern of values of what is happening in the soil during that period of time. Thus, in the autumn, the investigation site at the nivation niche Baia Vulturilor, returned values of between -22.6 mV and 65.6 mV, while in spring in the same site, values were within the range of -14.4 mV / 30.1 mV. On the other hand, on the site of the cryopediment under the Semenic peak, in the spring, return values ranged from -40.4 mV and -1.1 mV. A particular case is that of the glacis near Piatra Goznei peak; in this area anthropogenic electricity influences on soil can be found. Based on some models a trend of water movement in the soil could be established, this depending heavily on the amount of precipitation infiltration, local lithology, depth of soil and their structure, and evapotranspiration process. Water movement in the soil may be a correlation with sediment movement in soil horizons and instability manifested on the slopes.

  11. Bull Semen Collection and Analysis for Artificial Insemination


    Karolina Barszcz; Dariusz Wiesetek; Michal Wasowicz; Marta Kupczynska


    Insemination is acknowledged as a breeding method that contributes to improvement of farm animal populations, particularly of cattle. Artificial insemination allows for maximum use of the most valuable breeders and, at the same time, for significant increase of breeding advance. Moreover, using semen of proved quality reduces the spread of sexually transmitted diseases. The purpose of this study was to present the process of collection and analysis of bulls’ semen in the Mazovian Centre of An...

  12. Wasting semen: context and condom use among the Maasai


    Coast, Ernestina


    Motivations for condom use are intricate and the behaviour of individuals and couples takes place in complex sociocultural settings. This study examines in detail the sociocultural context of condom use among the Maasai, an east African agropastoralist population. A review of the ethno-demographic literature demonstrates the sociocultural significance of semen in a range of settings. A detailed description of Maasai values relating to semen is followed by an analysis presenting results from a...

  13. Artificial insemination and cryopreservation of semen from nondomestic birds (United States)

    Gee, G.F.


    Studies of Al and cryopreservation of semen from nondomestic birds began because of the increased emphasis on conservation of avian species threatened with extinction. Over the years, aviculturists have developed techniques for Al and cryopreservation of semen obtained from a variety of birds ranging from passerines to Andean condors. Generally, for each new species, we develop a practical semen collection technique and then evaluate the semen. A commercial semen extender (Beltsville Poultry Semen Extender) is modified and used to dilute the semen and provide support for the sperm during the freezing process (the pH and osmolality of the extender is adjusted to reflect the pH and osmolality of the semen being frozen). We find that the freezing schedule developed by Sexton (1977), which utilizes dimethylsulfoxide (DMS0) as cryoprotectant, works well for many species. We cool the sample sequentially in an ethanol bath, in liquid nitrogen vapor, and lastly in liquid nitrogen. Although we have experimented with a variety of freezing protocols, we prefer a 15-min equilibration period in DMSO at 5 C. We begin the freezing process by cooling at -1 C/min from 5 to -20 C in the ethanol bath. The samples are transferred into a vapor tank at a location just above liquid nitrogen and frozen at -50 C/min to -80 C. To complete the freezing process, the samples are plunged into the liquid nitrogen in the bottom of the vapor tank. The samples remain in liquid nitrogen until they are thawed just before insemination. If necessary, the freezing equipment can be transported in a van to remote locations.

  14. Genetic parameters of rabbit semen traits and male fertilising ability. (United States)

    Brun, J M; Sanchez, A; Ailloud, E; Saleil, G; Theau-Clément, M


    This study aimed to estimate genetic parameters for rabbit semen production, semen characteristics and fertilising ability following artificial insemination. It involved five successive batches of 30-36 bucks each, 22 weeks of semen collection, and 11 weeks of semen recording per batch. Semen analyses were based on 2312 ejaculates. A total of 2019 inseminations were performed on 674 females with semen from 236 ejaculates from 128 bucks. Heritability estimates of semen traits ranged from 0.05 to 0.18. At approximately 0.05-0.06 for pH, volume and mass motility, they were higher for concentration (0.10) and the total number of sperms per ejaculate (0.12), and even higher for motility traits based on computer-assisted semen analysis. The percentage of motile sperms had the highest heritability (0.18) and appeared to be a good candidate criterion to select for both sperm number and motility. The heritability estimates were close to zero for all three criteria of fertilising ability: fertility (F), prolificacy (live births, LB) and their product (LB per insemination). A permanent environmental effect of the male seemed to be higher for LB (0.04) than for F (0.01). The rabbit does accounted for approximately 10% of the variance of the three criteria. With respect to the female, the male contribution was negligible for fertility and in a ratio of 4-10 for the number of live births. In our experimental conditions, prolificacy would thus be more highly influenced by the buck than fertility. PMID:26795101

  15. Hormonal induction and semen characteristics of tambaqui Colossoma macropomum. (United States)

    Maria, Alexandre Nizio; Azevedo, Hymerson Costa; Santos, Jadson Pinheiro; Carneiro, Paulo César Falanghe


    In the hatchery-bred tambaqui Colossoma macropomum, spontaneous semen release does not occur, and hand-stripping produces reduced semen volume. The goal of this work is to evaluate the effects of hormonal induction with carp pituitary extract (CPE) on both qualitative (visual aspect, pH, motility, viability and morphological abnormalities) and quantitative (volume, concentration and number of spermatozoa per ejaculate) traits of tambaqui semen. Eleven males were treated with CPE (induced), and 11 were left untreated as a control (non-induced). All analysed parameters except motility and percentage of viable spermatozoa presented significant differences (p < 0.05) between the induced and non-induced treatments. CPE induction resulted in a 25-fold increase in semen volume and a 10-fold increase in the number of spermatozoa collected. However, both sperm concentration and the frequency of sperm with morphological abnormalities (commonly detached heads or bent tails) were significantly lower in CPE-induced fish. The hormonal induction of tambaqui males with CPE is efficient and positively influences some qualitative and quantitative properties of semen. Additionally, semen collection via gentle abdominal massage occurs more readily in CPE-induced fish. PMID:21208496

  16. New Approaches to Boar Semen Evaluation, Processing and Improvement. (United States)

    Sutovsky, P


    The improvement of boar reproductive performance may be the next frontier in reproductive management of swine herd in Unites States, facilitated by better understanding of boar sperm function and by the introduction of new advanced instrumentation in the andrology field. Objective single ejaculate evaluation and individual boar fertility prediction may be possible by introducing automated flow cytometric semen analysis with vital stains (e.g. acrosomal integrity and mito-potential), DNA fragmentation analysis and biomarkers (ubiquitin, PAWP, ALOX15, aggresome) associated with normal or defective sperm phenotypes. Measurement of sperm-produced reactive oxygen species (ROS) is a helpful indicator of normal semen sample. Semen ROS levels could be managed by the addition of ROS-scavenging antioxidants. Alternative energy regeneration substrates and sperm stimulants such as inorganic pyrophosphate and caffeine could increase sperm lifespan in extended semen and within the female reproductive system. Such technology could be combined with timed sperm release in the female reproductive system after artificial insemination. Sperm phenotype analysis by the image-based flow cytometry will go hand in hand with the advancement of swine genomics, linking aberrant sperm phenotype to the fertility influencing gene polymorphisms. Finally, poor-quality ejaculates could be rescued and acceptable ejaculates improved by semen purification methods such as the nanoparticle-based semen purification and magnetic-activated sperm sorting. Altogether, these scientific and technological advances could benefit swine industry, provided that the challenges of new technology adoption, dissemination and cost reduction are met. PMID:26174914

  17. Effect of Conjugated Linoleic Acid on Boar Semen Quality After Long-term Refrigeration at 17°C. (United States)

    Teixeira, Smp; Chaveiro, A; Moreira da Silva, F


    In this study, the effect of conjugated linoleic acid (10 trans, 12 cis) (CLA) on refrigerated boar sperm quality parameters up to 14 days at 17°C was assessed. Semen was extended in Androhep and divided into four treatments supplemented with CLA (25, 50, 100 and 200 ?m) and control group, then kept for 2 h at 22°C. Afterwards an aliquot of each treatment was removed, and mitochondrial activity, viability, lipid membrane peroxidation (LPO) and stability of the sperm plasma membrane were assessed by flow cytometry. The remaining extended semen was maintained at 17°C until 336 h, repeating the same analysis every 48 h. Regarding percentage of live spermatozoa, no statistical differences were observed among treatments up to 96 h. After this time, viability decreased significantly (p refrigerated boar spermatozoa. PMID:25976112

  18. Identifying factors affecting age at first semen freezing and age at first semen use in Sahiwal bulls


    B. C. Naha; A. K. Chakravarty; M.A. Mir; V. Jamuna; A. P. Singh; Maher, D.


    Aim: The objective of the study was to evaluate the effects of non-genetic factors on reproduction traits viz. age at first semen freezing and age at first semen use of breeding bulls in Sahiwal bulls by fitting least-squares analysis. Materials and Methods: The information on reproduction traits of 43 Sahiwal breeding bulls belonging to 8 sets of Sahiwal breeding program at Indian Council of Agricultural Research-National Dairy Research Institute (ICAR-NDRI), Karnal (Haryana), India durin...

  19. Identifying factors affecting age at first semen freezing and age at first semen use in Sahiwal bulls

    Directory of Open Access Journals (Sweden)

    B. C. Naha


    Full Text Available Aim: The objective of the study was to evaluate the effects of non-genetic factors on reproduction traits viz. age at first semen freezing and age at first semen use of breeding bulls in Sahiwal bulls by fitting least-squares analysis. Materials and Methods: The information on reproduction traits of 43 Sahiwal breeding bulls belonging to 8 sets of Sahiwal breeding program at Indian Council of Agricultural Research-National Dairy Research Institute (ICAR-NDRI, Karnal (Haryana, India during 27 years (1987-2013 were analyzed using fixed linear model. The information was collected from AI records, reproduction sheets, and bull AI register maintained at different sections of Institute viz. record room of Dairy Cattle Breeding Division (DCB, Cattle Yard, Artificial Breeding Research Centre, ICAR-NDRI, Karnal. Results: The average age at first semen freezing and age at first semen use of Sahiwal breeding bulls was estimated as 3.17±0.01 years and 5.35±0.01 years, with the coefficient of variation 18.93% and 20%, respectively. The overall least squares mean for age at first semen freezing and age at first semen use was estimated as 3.14±0.09 years and 5.25±0.02 years, respectively, in Sahiwal breeding bulls. Period of freezing/use had significant effects on reproductive traits (p<0.01. Season had no significant effect on any of the traits considered in this study. Conclusion: It can be concluded that management inputs such as nutrition, breeding, and optimum environment should be taken care of to optimize age at first semen freezing and age at first semen use for better utilization of superior germplasm.

  20. Functional characterisation of semen in honeybee queen (A.m.ligustica S.) spermatheca and efficiency of the diluted semen technique in instrumental insemination


    Andrea Galli; Donatella Balduzzi; Marco Lodesani


    Differences over time in the quality of semen present in the honey bee (Apis mellifera ligustica) queen spermatheca werestudied. An increase in the non-vital spermatozoa was shown to be evident (P>0.05) between the 12th and 24th month.The study of semen viability demonstrated that the passage of the semen to the spermatheca is due to sperm motility.In the queen inseminated with non-viable spermatozoa, no semen was detected in the spermatheca. Queens inseminatedtwice with a Hyes solution/semen...

  1. Human semen assays for workplace monitoring. [Monitoring of hazardous materials by determining effects on semen of personnel

    Energy Technology Data Exchange (ETDEWEB)

    Wyrobek, A.J.; Gledhill, B.L.


    Decades of human semen studies have yielded compelling evidence that sperm can be used to access reproductive potential and diagnose pathology. With these studies as background, the small number of detailed semen studies of men exposed to physical and chemical agents point with optimism to the application of human semen assays as efficient, effective means to monitor for reproductive hazards in the workplace. Sperm are the most accessible of human gonadal tissue and provide a means of monitoring exposure induced changes in the human testes, changes which may result in infertility and increased frequencies of genetically abnormal gametes. The focus on semen has precipitated the development of new sperm bioassays which use older conventional andrological methods (i.e., sperm counts, motility, and morphology) as well as recently developed high speed flow and scanning methods for automated cytological analyses. The status of these sperm assays for workplace surveillance is reviewed, procedures are suggested with examples of use, and their effectiveness is evaluated. The available mouse models of induced semen changes are briefly described and the importance of these models for evaluating the genetic implications of findings in human semen is discussed.


    Directory of Open Access Journals (Sweden)

    Martyna B?aszczyk


    Full Text Available Rabbits have been extensively used as a model for large animals and humans. All the reproduction techniques employed with farm animals can be performed with the low-cost rabbit model, and certain placental membrane characteristics make them especially relevant for studies of human teratology. The purpose of this study was to assess semen quality of New Zealand White rabbits. The material represents semen samples collected from adult rabbits (n=30. The semen was obtained by means of artificial vagina. All samples were analyzed using CASA Sperm VisionTM system. To assessed spermatozoa morphology (the length and the width of head and tail; presence of abnormal spermatozoa we used QuickPhoto Micro system. Received data were statistically analyzed. Our research showed decrease of semen parameters value after one hour storage in 37°C. Correlation analysis showed negative correlation between presence of spermatozoa with separated flagellum and CASA parameters value e.g. motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, ALH and BCF. From among 3000 analyzed spermatozoa 14.2% posed abnormal forms. We observed negative influence of semen storage on its quality. Also negative correlations between all types of tail defect and motility of spermatozoa were detectedRabbits have been extensively used as a model for large animals and humans. All the reproduction techniques employed with farm animals can be performed with the low-cost rabbit model, and certain placental membrane characteristics make them especially relevant for studies of human teratology. The purpose of this study was to assess semen quality of New Zealand White rabbits. The material represents semen samples collected from adult rabbits (n=30. The semen was obtained by means of artificial vagina. All samples were analyzed using CASA Sperm VisionTM system. To assessed spermatozoa morphology (the length and the width of head and tail; presence of abnormal spermatozoa we used QuickPhoto Micro system. Received data were statistically analyzed. Our research showed decrease of semen parameters value after one hour storage in 37°C. Correlation analysis showed negative correlation between presence of spermatozoa with separated flagellum and CASA parameters value e.g. motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, ALH and BCF. From among 3000 analyzed spermatozoa 14.2% posed abnormal forms. We observed negative influence of semen storage on its quality. Also negative correlations between all types of tail defect and motility of spermatozoa were detected.

  3. Lifestyle and semen quality: role of modifiable risk factors. (United States)

    Jurewicz, Joanna; Radwan, Michał; Sobala, Wojciech; Ligocka, Danuta; Radwan, Paweł; Bochenek, Michał; Hanke, Wojciech


    The relationship between exposure to lifestyle factors and adverse effects on human reproductive health is debated in the scientific literature and these controversies have increased public and regulatory attention. The aim of the study was to examine the association between modifiable lifestyle factors and main semen parameters, sperm morphology, and sperm chromatin structure. The study population consisted of 344 men who were attending an infertility clinic for diagnostic purposes with normal semen concentration of 20-300 M/ml or with slight oligozoospermia (semen total concentration of 15-20 M/ml) [WHO 1999]. Participants were interviewed and provided semen samples. The interview included questions about demographics, socio-economic status, medical history, lifestyle factors (consumption of alcohol, tobacco, coffee intake, cell phone and sauna usage), and physical activity. The results of the study suggest that lifestyle factors may affect semen quality. A negative association was found between increased body mass index (BMI) and semen volume (p = 0.03). Leisure time activity was positively associated with sperm concentration (p = 0.04) and coffee drinking with the percentage of motile sperm cells, and the percentage of sperm head and neck abnormalities (p = 0.01, p = 0.05, and p = 0.03, respectively). Drinking red wine 1-3 times per week was negatively related to sperm neck abnormalities (p = 0.01). Additionally, using a cell phone more than 10 years decreased the percentage of motile sperm cells (p = 0.02). Men who wore boxer shorts had a lower percentage of sperm neck abnormalities (p = 0.002) and percentage of sperm with DNA damage (p = 0.02). These findings may have important implications for semen quality and lifestyle. PMID:24074254

  4. Quantification of damage at different stages of cryopreservation of endangered North American bison (Bison bison) semen and the effects of extender and freeze rate on post-thaw sperm quality. (United States)

    Hussain, S A; Lessard, C; Anzar, M


    Semen cryopreservation is an important technique for the banking of animal germplasm from endangered species and exploitation of genetically superior sires through artificial insemination. Being a member of bovidae family, bison semen has poor freezing ability as compared to dairy and beef bulls' semen. This study was designed to quantify the damage to bison sperm at different stages of cryopreservation, and to determine the effects of extender (commercial Triladyl(®) vs. custom made tris-citric acid [TCA]) and freeze rate (-10, -25 and -40°C/min) on post-thaw quality of bison semen. Semen was collected from five bison bulls (three woods and two plains) via electroejaculation. In Experiment 1, semen was diluted in Triladyl® extender and frozen with freeze rate -10°C/min. Sperm motility characteristics were recorded in fresh, diluted, cooled (4°C) and freeze-thawed semen using computer-assisted sperm analyzer (CASA). In Experiment 2, semen was diluted in Triladyl® or TCA extender, and frozen with three different freeze rates, i.e. -10, -25 or -40°C/min. Thawing was performed at 37°C for 60s. Post-thaw sperm motility characteristics were assessed using CASA, and sperm structural characteristics (plasma membrane, mitochondrial membrane potential and acrosomes) were evaluated using flow cytometer, at 0 and 3h while incubating semen at 37°C. In Experiment 1, total and progressive motilities did not differ among pre-freeze stages of cryopreservation (P>0.05). However, sperm total and progressive motilities declined (Pbison semen was frozen at -40°C/min. Likewise, the percent change in post-thaw sperm total and progressive motilities, during 3h incubation at 37°C, was less (Pbison semen frozen at -40°C/min. All post-thaw bison sperm characteristics decreased (Pbison sperm occurred during freeze-thaw processes. Post-thaw total and progressive motilities of bison sperm were greater in Triladyl® at 0h whereas sperm survival was greater in TCA extender during 3h post-thaw incubation. Bison sperm had greater survival (P<0.05) when frozen at -40°C/min freeze rate. PMID:22240453


    Scientific Electronic Library Online (English)

    Giovanni, Restrepo Betancur; Juan Esteban, Duque Cortés; Juan David, Montoya Páez.


    Full Text Available Resumen. La criopreservación de semen es un proceso fundamental en el desarrollo de biotecnologías para la reproducción asistida en equinos. El uso de diferentes técnicas de criopreservación con cambios en las concentraciones y la naturaleza de los crioprotectores, así como en los diferentes tipos d [...] e soportes para el almacenamiento del semen, se ha constituido en una alternativa para mejorar los protocolos empleados. El objetivo de este trabajo fue evaluar el efecto de dos protocolos de criopreservación (congelación y vitrificación), sobre la capacidad fecundante del semen equino. El estudio se realizó con equinos de la raza Criollo Colombiano. Para la congelación se empleó un diluyente suplementado con de yema de huevo (4%) y dimetilformamida (5%), y pajillas de 0,5 mL como soportes; mientras que para la vitrificación, el diluyente fue suplementado con yema de huevo (8%) y dimetilformamida (8%) y se usaron crioviales como soportes. Post-descongelación, se evaluaron los parámetros: movilidad progresiva, vitalidad, morfología normal e integridad de la membrana plasmática (HOS). Para la evaluación estadística se ajustó un modelo lineal generalizado (GLM) y las medias se compararon por la prueba de Tukey. Se encontraron porcentajes promedio de movilidad progresiva, vitalidad, morfología normal y HOS de 41,6±11,8 y 37,0±8,5, 54,3±10,2 y 52,3±7,8, 83,1±5,4 y 83,6±5,8, 41,7±9,8 y 38,9±3,6, para el semen criopreservado por congelación y vitrificación, respectivamente. No se encontraron diferencias estadísticamente significativas (P ? 0,05) entre los tratamientos para ninguno de los parámetros evaluados. La capacidad fecundante del semen equino criopreservado por vitrificación es equiparable a la obtenida por congelación convencional. Abstract in english Abstract. Semen cryopreservation is a fundamental process for the development of biotechnologies for assisted reproduction in horses. The use of cryopreservation techniques with changes in concentrations and the nature of the cryoprotectant, as well as, the different types of vials for storage of se [...] men, have become an alternative to improve the protocols used. The objective of this work was to evaluate the effect of two protocols of cryopreservation (freezing and vitrification) on the fertilizing capacity of stallion semen. The study was conducted with horses of the Criollo Colombiano breed. For freezing was used a extender supplemented with egg yolk (4%) and dimethyl formamide (5%), and 0.5 mL straws as vials, whereas for vitrification, the extender was supplemented with egg yolk (8%) and dimethyl formamide (8%), and cryovials were used as carriers. As post thaw parameters were evaluated: progressive motility, vitality, normal morphology and integrity of the plasma membrane through the hypoosmotic swelling test (HOS). For statistical evaluation was fitted a generalized linear model (GLM) and means were compared by the Tukey test. Were found average percentages of progressive motility, vitality, normal morphology and HOS of 41.6 ± 11.8 and 37 ± 8.5, 54.3 ± 10.2 and 52.3 ± 7.8, 83.1 ± 5.4 and 83.6 ± 5.8, 41.7 ± 9.8 and 38.9 ± 3.6, for cryopreserved semen by freezing and vitrification, respectively. There were no statistically significant differences (P ? 0.05) between treatments for any of the parameters evaluated. The fertilizing capacity of equine semen cryopreserved by vitrification is comparable to that obtained by conventional freezing.

  6. Distinct Cytokine Patterns in Semen Influence Local HIV Shedding and HIV Target Cell Activation


    Olivier, Abraham J.; Masson, Lindi; Ronacher, Katharina; Walzl, Gerhard; Coetzee, David; Lewis, David A.; Williamson, Anna-Lise; PASSMORE, Jo-Ann S.; BURGERS, Wendy A.


    Background.?Semen is the main vector for human immunodeficiency virus (HIV) transmission from men to women. We investigated the influence of cytokines in semen on local HIV burden and activated T cells.

  7. Maternal folic acid supplement intake and semen quality in Danish sons: a follow-up study

    DEFF Research Database (Denmark)

    Jacobsen, Kristoffer; Ramlau-Hansen, Cecilia Høst; Thulstrup, Ane Marie; Olsen, Jørn; Bonde, Jens Peter


    To examine whether maternal folic acid supplement intake during pregnancy is related to better semen quality in male offspring.......To examine whether maternal folic acid supplement intake during pregnancy is related to better semen quality in male offspring....

  8. Effects of Diluents, Cryoprotectants, Equilibration Time and Thawing Temperature on Cryopreservation of Duck Semen


    Han, X. F.; Z.Y. Niu; F.Z. Liu; Yang, C.S.


    A series of sequential experiments were carried out to determine optimum diluents, cryoprotectants, equilibration time, and thawing temperature for frozen duck semen in order to set up the commercial semen cryopreservating techniques which could be applied to the conservation of genetic resources, breeding, and commercial production in domestic ducks. In experiment 1, the seven semen extenders were studied to determine efficacy of the diluent on cryopreservation of duck Semen. The result show...

  9. Recent adverse trends in semen quality and testis cancer incidence among Finnish men

    DEFF Research Database (Denmark)

    Jørgensen, N; Vierula, M; Jacobsen, R; Pukkala, E; Perheentupa, A; Virtanen, H E; Skakkebaek, N E; Toppari, J


    Impaired semen quality and testicular cancer may be linked through a testicular dysgenesis syndrome of foetal origin. The incidence of testis cancer has been shown to increase among Finnish men, whereas there is no recent publication describing temporal trends in semen quality. Therefore, we carried out a prospective semen quality study and a registry study of testis cancer incidence among Finnish men to explore recent trends. A total of 858 men were investigated in the semen quality study durin...

  10. Successful artificial insemination in the Asian elephant (Elephas maximus) using chilled and frozen-thawed semen


    Wongkalasin Warut; Boonprasert Khajornpat; Rungsri Ronnachit; Jansittiwate Saran; Angkawanish Taweepoke; Pinyopummin Anuchai; Kornkaewrat Kornchai; Pongsopavijitr Pornsawan; Thitaram Chatchote; Mahasawangkul Sittidet; Thongtip Nikorn; Homkong Pongpon; Dejchaisri Suthathip; Wajjwalku Worawit; Saikhun Kulnasan


    Abstract Background Artificial insemination (AI) using frozen-thawed semen is well established and routinely used for breeding in various mammalian species. However, there is no report of the birth of elephant calves following AI with frozen-thawed semen. The objective of the present study was to investigate the fertilizing ability of chilled and frozen-thawed semen in the Asian elephant following artificial insemination (AI). Methods Semen samples were collected by from 8 bulls (age range, 1...

  11. Parental age at delivery and a man's semen quality

    DEFF Research Database (Denmark)

    Priskorn, Lærke; Jensen, Tina K


    STUDY QUESTION: Is parental age at delivery associated with a man's semen quality? In this large register-based study both mother's and father's age are found to have minimal effects on semen quality in men. BACKGROUND: Both maternal and paternal age have been associated with a range of adverse health effects in the offspring. Given the varied health effects of parental age upon offspring, and the sensitivity of genital development to external factors, it is plausible that the age of a man's mother and father at conception may impact his reproductive health. To our knowledge this is the first examination of the effects of parental age on semen quality. METHODS: The study was based on Danish men referred to the Copenhagen Sperm Analysis Laboratory due to infertility in their partnership. Men born from 1960 and delivering a semen sample until year 2000 were included. The men were linked to the Danish Civil Registration System to obtain information on parent's age at delivery. Logistic regression analyses were used to calculate odds ratios and 95% confidence intervals for impaired semen quality. Linear regression analyses were used to examine a relationship between semen parameters and paternal age. RESULTS: There were no convincing effect of either mother's or father's age on a man's semen quality. As no trends were noted, the few statistically significant results are likely attributable to chance. LIMITATIONS, REASONS FOR CAUTION: Information regarding individual subject characteristics which may impact sperm production (i.e. smoking, BMI) were not available. While our sample size was large, we cannot exclude the possibility that a trend may have been identified with a still larger sample. In addition, the Danish Civil Registration System is merely administrative and hence does not discriminate between biological and adopted children. However, the low rate of adoption (?2%) suggests that misclassification would have a minimal impact. The men were all referred to the laboratory for infertility problems in their partnership and, therefore, do not represent the general population. We, however, compared semen quality among men within the cohort, and it is therefore less important whether they, in fact, represent the general population. WIDER IMPLICATIONS OF THE FINDINGS: The current study found no link between parental age and a son's semen quality, suggesting other factors may explain recent impairments in men's reproductive health. STUDY FUNDING: This work was supported by the Hans and Nora Buchard's Fund and the Kirsten and Freddy Johansen's Fund.

  12. Association between environmental exposure to cadmium and human semen quality. (United States)

    Li, Yuyan; Wu, Junqing; Zhou, Weijin; Gao, Ersheng


    Cadmium (Cd) is a heavy metal with toxicant to reproductive functions. The aim of this study was to explore the effects of environmental exposure to Cd on human semen quality. A total of 587 men from the general population, aged from 20 to 59 years old, and without occupational exposure to Cd were recruited from three provinces in China to participate in the study. The median of serum Cd was 1.9 ?g/L (P25-P75:1.1-2.9). In case Cd was less than or equal to 6.3 ?g/L (P95) and the semen parameters were logarithmically transformed, the inverse associations between Cd and semen volume (- 0.03 ± 0.007), progressive motility (- 0.01 ± 0.004), and sperm morphology (- 0.04 ± 0.004) were found across the whole group, after adjusting for age group, occupation, season of semen sample collection, abstinence intervals, smoking, alcohol drinking, and body mass index. Our findings indicate that higher Cd may reduce the semen volume, progressive motility, and morphology among men without occupational exposure to Cd. PMID:26249156

  13. Royal jelly supplementation in semen extender enhances post-thaw quality and fertility of Nili-Ravi buffalo bull sperm. (United States)

    Shahzad, Qaisar; Mehmood, Muhammad Usman; Khan, Hamayun; Husna, Asma Ul; Qadeer, Saima; Azam, Asima; Naseer, Zahid; Ahmad, Ejaz; Safdar, Muhammad; Ahmad, Mushtaq


    Two experiments were conducted to evaluate the effect of royal jelly (RJ) on post-thaw sperm quality, in vitro and in vivo fertility rate of cryopreserved buffalo bull sperm. The semen was collected from three mature regular donor buffalo bulls, ejaculates were pooled and semen evaluated initially. In Experiment 1, the ejaculates were extended in tris-citric acid diluter supplemented with different RJ concentrations (0, 0.05, 0.1, 0.2, 0.3 or 0.4%). The diluted semen was cooled to 4°C, packaged into 0.5mL straws and frozen using standard procedure. The straws were thawed and assessed for sperm progressive motility, viability, plasma membrane, acrosome, and chromatin integrity. The results indicated that sperm progressive motility was significantly greater (Pplasma membrane and acrosome integrity were significantly improved (P0.05) between 0.1% RJ supplemented and control groups. It is concluded that supplementation of RJ in freezing extender can improve the cryosurvival rate and in vitro fertilizing capacity of buffalo bull sperm. PMID:26896924

  14. Effect of short-term semen storage in salmon (Oncorhynchus mykiss) on sperm functional parameters evaluated by flow cytometry. (United States)

    Trigo, P; Merino, O; Figueroa, E; Valdebenito, I; Sánchez, R; Risopatrón, J


    The short-term storage of salmonid semen is a viable method for in vitro fertilisation. Previous studies have found that short-term storage affects sperm motility, compromising quality and fertilising capacity. However, the functional characteristics of the spermatozoa of O. mykiss during storage time and its relation to the spawning period are little known. This study was designed to evaluate the effects of in vitro short-term storage on sperm functional parameters in O. mykiss, determined by flow cytometry. Semen samples of the first spawning - undiluted (SSD) and diluted (SD) (Storfish(®) 1 : 2v/v; IMV AI solutions, France) - were stored at 4 °C for 14 days. Motility, viability (PMI: plasma membrane integrity) and mitochondrial membrane potential (??M) were assessed. On the fifth day of storage, spermatozoa showed a motility >70% (SSD: 78.3% versus SD 85.0%), PMI (81.5% SSD/87.2% SD) and ??M (72.5% SSD/SD 80.0%) (P < 0.05). However, a significant decline in the percentage of all functional parameters (P < 0.05) was observed after 5 days of storage for all samples of both undiluted (SSD) and diluted semen. In conclusion, the results here provide new data on O. mykiss sperm quality with respect to in vitro short-term storage evaluated by flow cytometry. PMID:24717099

  15. Metil-formamida na criopreservação de sêmen ovino / Methyl-formamide in ram semen cryopreservation

    Scientific Electronic Library Online (English)

    Carlos Pereira das, Graças; Alexandre In Piao Gomes, Lim; Andrei Antonioni Guedes, Fidelis; Júlio Roquete, Cardoso; Hélio, Blume; Rafael Gianella, Mondadori.


    Full Text Available Objetivou-se avaliar a eficácia da metil-formamida na criopreservação do sêmen ovino. O pool de sêmen utilizado no experimento foi obtido a partir da coleta, com vagina artificial, do sêmen de quatro carneiros mestiços Santa Inês, com idade aproximada de quatro anos. As coletas foram realizadas uma [...] vez por semana, por seis semanas consecutivas, correspondendo, cada semana, a uma repetição do experimento. As frações do pool foram diluídas em cinco diferentes meios de congelação: (1) tris-gema com 5,3% de glicerol (TG5,3G); (2) tris-gema com 3% de metil-formamida (TG3MF); (3) tris-gema com 5% de metilformamida (TG5MF); (4) tris-gema com 7% de metil-formamida (TG7MF); (5) tris-gema com 9% de metil-formamida (TG9MF). Foram avaliadas a motilidade progressiva e o vigor das células espermáticas e realizado o teste de termorresistência pós-descongelação. O tratamento que obteve maior motilidade foi o TG5,3G (50%), seguido do TG3MF (38%) e os tratamentos que apresentaram menor motilidade progressiva foram TG5MF (29%), TG7MF (1,0%), TG9MF (6,0%). Os meios contendo metil-formamida apresentaram resultados inferiores ao meio controle para preservar a integridade morfológica dos espermatozoides, sendo que nos meios TG7MF e TG9MF menos de 60% de espermatozóides apresentaram-se morfologicamente normais. Os espermatozoides do meio TG5,3G apresentaram motilidade (15%) e vigor (2,8) similares aos do meio TG3MF (15% e 2,6, respectivamente) no teste de termorresistência, mas o meio TG5,3G preservou melhor a integridade funcional da membrana plasmática. O glicerol foi mais eficiente como crioprotetor do que a metil-formamida na criopreservação de sêmen ovino. Abstract in english The aim of this study was to evaluate the efficacy of methyl-formamide in ram semen cryopreservation. The semen pool used in this experiment was obtained by artificial vagina collection from four mixed breed Santa Inês rams, around four years of age. Semen collection was performed once a week, durin [...] g six weeks. Each week corresponded to one experiment replication. The semen pool was divided in five fractions in order to be diluted in one of the following freezing media: (1) tris-egg yolk with 5.3% of glycerol (TG5.3G); (2) tris-egg yolk with 3% of methyl-formamide (TG3MF); tris-egg yolk with 5% of methyl-formamide (TG5MF); tris-egg yolk with 7% of methyl-formamide (TG7MF); tris-egg yolk with 9% of methyl-formamide (TG9MF). Semen progressive motility, vigor and thermoresistance were evaluated. The treatments TG5.3G (50%) and TG3MF (38%) showed higher progressive motility after thawing, while TG5MF (29%), TG7MF (1%) and TG9MF (6%) showerd lower motility. Freezing media containing methyl-formamide were less effective in preserving spermatozoa membrane integrity and morphology than control media. In TG7MF and TG9MF extenders, less than 60% spermatozoa showed normal morphology. After thermoresistance test, semen cryopreserved in TG3MF showed vigor (2.6) and motility (15%) statistically similar to TG5.3G media (15% and 2.8, respectively); however, the extender TG5.3G was more effective in preserving plasma membrane functional integrity. In conclusion, in the experimental conditions used, glycerol showed more cryoprotectant potential than methyl-formamide.

  16. La administración de selenio disminuye la lipoperoxidación en semen de toros Brahman

    Scientific Electronic Library Online (English)

    C., Flores; Y, Márquez; L., Vilanova; N., Matheus; A., López Ortega.


    Full Text Available La lipoperoxidación es uno de los efectos del estrés oxidativo, el cual cursa con alteraciones de motilidad y viabilidad espermática debido a cambios bioquímicos y estructurales de la membrana plasmática. El trastorno conduce a la infertilidad, por lo cual es menester estudiar las alternativas terap [...] éuticas para mejorar las condiciones reproductivas de los toros. En este estudio se determinó la acción antioxidante del selenio y sus efectos sobre la calidad seminal. Se emplearon toros Brahman sanos, de 15-18 meses de edad, divididos en dos grupos mantenidos a pastoreo. El grupo experimental recibió una dosis intramuscular de 0,22 mg/20 kg PV/ día durante 5 días. Las muestras fueron tomadas con electroeyaculador a los días cero, 15 y 30 post-tratamiento. Se evaluó la calidad seminal (espermatozoides móviles, porcentaje de motilidad progresiva, morfología, vitalidad y presencia de acrosomas) e indicadores de la peroxidación lipídica: dienos conjugados (DC, extraídos con isopropanol) y malondialdehído (MDA, por TBARS). Los datos fueron interpretados a través del análisis de la variancia (p=0,05). La calidad del semen no reveló diferencias significativas entre grupos. Los animales tratados no mostraron diferencias significativas en los DC a los 15 y 30 días con respecto al grupo control. Por su parte, el MDA presentó diferencias significativas a los 30 días de tratamiento, cuando el grupo experimental mostró valores más bajos (1,09 ±0,1 nmoles/mg de proteínas) con respecto al grupo control (1,58 ±0,2 nmoles/mg de proteínas). Se concluye que el selenio resulta eficaz para reducir la lipoperoxidación seminal y preservar la calidad del semen. Abstract in english Lipid peroxidation, one of the effects of oxidative stress, is associated with impaired sperm motility and viability because of biochemical and structural alterations of the plasma membrane which causes infertility. Of interest is the study of therapeutic alternatives for enhancing the reproductive [...] condition of the bulls. In this study the antioxidant action of selenium and its effect on semen quality was determined. Healthy grazing Brahman bulls with 15-18 months of age, divided into two groups, were used for the trial. The experimental group received an intramuscular dose of 0.22 mg/20 kg liveweight /day, during 5 days. The sample was taken with electroejaculator at day zero, 15 and 30 post-treatment. Diene conjugates (DC, extracted with isopropanol) and malondialdehyde (MDA TBARS) were measured. Semen quality (motile sperm, percentage of progressive motility, morphology, sperm vitality and presence of acrosomes) and indicators of lipid peroxidation were evaluated. Data were analyzed by ANOVA (p=0.05). In the study of semen, quality groups did not differ significantly. Compared to the control group, selenium-treated animals showed no significant differences in DC at 15 and 30 days. On the other hand, MDA revealed significant differences at 30 days post treatment, showing lower values (1.09 ±0.1 nmol/mg protein) compared to control group (1.58 ±0.2 nmoles/mg protein). In conclusion, seminal selenium decreases lipid peroxidation and preserves semen quality.

  17. Effect of glycerol and dimethylformamide cryoprotectants on buck Etawah Crossbreed frozen semen using modified tris diluents.

    Directory of Open Access Journals (Sweden)

    Ariantie OS


    Full Text Available A cryoprotectan is component that must be present in a cryopreservation medium to minimize the physical and chemical stresses resulting from the cooling, freezing and thawing of sperm cells. This study was carried out to determine the effect of glycerol (G and dimethylformamide (DMF as cryprotective agent in tris-egg yolk (TEY trehalose (T and tris-soya (TS raffinose (R diluents. Semen were collected from three sexually mature bucks using artificial vagina, evaluated and divided into four aliquot. Each of them was diluted with TEY suplemented with 50 mM trehalose and TS supplemented with 50 mM raffinose, added with glycerol or DMF 4% (v/v. Diluted semen was packed in minitube straw (100 x 106 sperm/0.25 mL and equilibrated for 4 hours at 5°C, then freeze in N2 vapor for 10 minutes in styrofoam box and stored in liquid N2 container (-196 until futher evaluation. Progressive motility, viability and plasma membrane intact were evaluated after thawed at 37°C for 30 seconds factorial experimental design (2 x 2 was used in this study. The sperm motility in TEYTG was significantly higher (65.07±5.38% compared to TEYTDMF (61.67±5.55%. In contrast sperm diluted with TSRDMF indicated better motility (42.22±8.13% than TSRG (39.07±5.38%. It was concluded that cryoprotectant had different effect on different diluents.

  18. Data for chicken semen proteome and label free quantitative analyses displaying sperm quality biomarkers. (United States)

    Labas, Valérie; Grasseau, Isabelle; Cahier, Karine; Gargaros, Audrey; Harichaux, Grégoire; Teixeira-Gomes, Ana-Paula; Alves, Sabine; Bourin, Marie; Gérard, Nadine; Blesbois, Elisabeth


    Understanding of biology of the avian male gamete is essential to improve the conservation of genetic resources and performances in farming. In this study, the semen proteome of the main domestic avian species (Gallus gallus) and evaluation of the molecular phenotype related to sperm quality were investigated using GeLC-MS/MS approach and label-free quantitative proteomic based on Spectral Counting (SC) and extracted ion chromatograms (XIC) methods. Here we describe in details the peptide/protein inventory of chicken ejaculated spermatozoa (SPZ) and seminal plasma (SP). We also show differential analyses of chicken semen (SPZ and corresponding SP) from 11 males demonstrating different levels of fertilizing capacity and sperm motility. The interpretation and description of these data can be found in a research article published by Labas and colleagues in the Journal of Proteomics in 2014 [1]. This is a new resource for exploring the molecular mechanisms involved in fertilizing capacity and to reveal new sets of fertility biomarkers. PMID:26217683

  19. Data for chicken semen proteome and label free quantitative analyses displaying sperm quality biomarkers

    Directory of Open Access Journals (Sweden)

    Valérie Labas


    Full Text Available Understanding of biology of the avian male gamete is essential to improve the conservation of genetic resources and performances in farming. In this study, the semen proteome of the main domestic avian species (Gallus gallus and evaluation of the molecular phenotype related to sperm quality were investigated using GeLC–MS/MS approach and label-free quantitative proteomic based on Spectral Counting (SC and extracted ion chromatograms (XIC methods. Here we describe in details the peptide/protein inventory of chicken ejaculated spermatozoa (SPZ and seminal plasma (SP. We also show differential analyses of chicken semen (SPZ and corresponding SP from 11 males demonstrating different levels of fertilizing capacity and sperm motility. The interpretation and description of these data can be found in a research article published by Labas and colleagues in the Journal of Proteomics in 2014 [1]. This is a new resource for exploring the molecular mechanisms involved in fertilizing capacity and to reveal new sets of fertility biomarkers.

  20. Occupational exposure to pesticides and consequences on male semen and fertility: a review. (United States)

    Mehrpour, Omid; Karrari, Parissa; Zamani, Nasim; Tsatsakis, Aristides M; Abdollahi, Mohammad


    Exposure to pesticides affects many body organs including reproductive system. Disorder of the reproductive system leads to infertility and therefore has been in the center of attention within the recent decades. Pesticides are one of the compounds that might reduce the semen quality in the exposed workers according to current knowledge. Although many underlying mechanisms have been proposed, the mechanisms of action are not clarified yet. The object of the present review was to criticize all the results of studies which evaluated the pesticide effects on male reproductive system. Results indicate that semen changes are multifactorial in the workers exposed to pesticides as there are numerous factors affecting sperm quality in occupational exposures. Majority of pesticides including organophosphoruses affect the male reproductive system by mechanisms such as reduction of sperm density and motility, inhibition of spermatogenesis, reduction of testis weights, reduction of sperm counts, motility, viability and density, and inducing sperm DNA damage, and increasing abnormal sperm morphology. Reduced weight of testes, epididymis, seminal vesicle, and ventral prostate, seminiferous tubule degeneration, change in plasma levels of testosterone, follicle-stimulating hormone (FSH), and luteinizing hormone (LH), decreased level and activity of the antioxidant enzymes in testes, and inhibited testicular steroidogenesis are other possible mechanisms. Moreover, DDT and its metabolites have estrogenic effects on males. Although effect of pesticides on sperm quality is undeniable, well-designed long-term studies are needed to elucidate all the possible affecting variables such as socioeconomic, cultural, nutritional, occupational, physical, and clinical characteristics alongside pesticides. PMID:24487096

  1. Effect of Ergosan on semen quality of male rainbow trout (Oncorhynchus mykiss) broodstock. (United States)

    Sheikhzadeh, Najmeh; Reza, Asadpour; Allah, Jafari Jozani Razi; Hossein, Tayefi-Nasrabadi


    Present study was conducted to investigate the effect of Ergosan on seminal plasma compositions and spermatological parameters in rainbow trout. Male rainbow trout broodstocks (2300 ± 200 g) were fed diets containing Ergosan at 2 different concentrations (6 mg kg(-1) and 20 mg kg(-1)) and control diet without Ergosan for 20 days and on day 22 fish semen were sampled. Results suggest that Ergosan in dietary intake, significantly increased the spermatocrit and sperm count in 20 mg kg(-1) group and Ca(2+) in both treatment groups compared to control group (P<0.05). The values of aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) had significant decrease in both treatment groups compared to the control group (P<0.05). Significant correlations were determined between sperm count versus K(+) value (r=-0.838, P<0.05) and glucose level (r=+0.835, P<0.05) in fish administrated with 20 mg kg(-1) of Ergosan. In group treated with 6 mg kg(-1), significant correlation between Na(+) and duration of sperm motility (r=+0.999, P<0.05) was shown. Meanwhile, glucose level versus percent of sperm motility (r=+0.866, P<0.05) showed significant correlation in this group. Sperm count versus total protein level (r=+0.817, P<0.05) showed significant correlation in control group. Results indicated that Ergosan had a potential efficacy on semen quality in rainbow trout broodstock. PMID:20810224

  2. Semen characteristics and refrigeration in free-ranging giant anteaters (Myrmecophaga tridactyla). (United States)

    Luba, Camila do Nascimento; Boakari, Yatta Linhares; Costa Lopes, Alexandre Martins; da Silva Gomes, Marcelo; Miranda, Flávia Regina; Papa, Frederico Ozanan; Ferreira, João Carlos Pinheiro


    The giant anteater (Myrmecophaga tridactyla) is considered vulnerable to extinction. Scientific data on the reproductive parameters of this species are scarce. Semen from eight free-ranging giant anteaters was collected to establish its characteristics and the effects of cooling and storage at 5 °C after dilution with the BotuCrio extender without cryoprotectant. The ejaculate presented two distinct sequential fractions, including a whitish fraction, which was milky and rich in sperm cells, and a gel fraction, which was colorless, viscous, and azoospermic. The mean ± standard error of the mean values of the seminal characteristics were as follows: volume of the first fraction, 0.75 ± 0.1 mL; motility, 75 ± 2.9%; vigor, 3.2 ± 0.3; sperm motility index, 68.8 ± 4.3; concentration, 108.5 ± 13.4 × 10(6)/mL; plasma membrane integrity index, 71 ± 4.0%; spermatic defects detected using modified Karras staining, 35.5 ± 3.3%; and spermatic alterations identified by differential interference contrast microscopy, 48.3 ± 6.8%. During refrigeration, the semen presented decreasing motility from 0 to 18 hours, sperm motility index decreased from 0 to 24 hours, and vigor did not change in the first 6 hours and then decreased to 18 hours. PMID:26376226

  3. Relationships among frozen-thawed semen fertility, physical parameters, certain routine sperm characteristics and testosterone in breeding Murrah buffalo (Bubalus bubalis bulls

    Directory of Open Access Journals (Sweden)

    A. K. Singh


    Full Text Available Aim: The present study was carried out to examine the relationships among frozen-thawed semen fertility, physical parameters, seminal quality, and testosterone concentration in Murrah buffalo bulls. Materials and Methods: A total of 30 breeding Murrah buffalo bulls (either progeny tested or under progeny testing program were randomly selected from two government bull farms in Punjab. None of the bulls selected for this study had any preceding physical abnormality. A field fertility trial was conducted to determine the first service conception rate (FSCR. The number of females inseminated per bull semen was 10. All the bulls were inspected for structural soundness, measurement of scrotal circumference, testicular biometry, and internal pelvic area (IPA. Frozen-thawed semen was evaluated for total motility, progressive motility, viability, concentration, abnormality, and hypo-osmotic swelling test (HOST. Testosterone was estimated in blood plasma, seminal plasma as well as frozen-thawed semen extracts for establishing relationship. Results: The FSCR was 48% in the bulls having a scrotal circumference of ≥44 cm, although, there was no significant correlation between FSCR and scrotal circumference. Similarly, no consistent relationship existed between sperm concentration and scrotal circumference. A positive correlation was observed between IPA and FSCR (r=0.294. Of the six post-thaw seminal components (total motility, progressive motility, viability, HOST (%, total abnormality and concentration only total motility had a high significant (p<0.01 correlation with FSCR (r=0.694. Varied correlations existed between other seminal parameters and fertility. Using a simple regression analysis, the post-thaw motility, IPA, prepuce length and testosterone (independent variables combined to explain approximately 62% of the variation in the FSCR (dependent variable. Conclusion: The present study indicated that despite low to high correlations between seminal characteristics, physical parameters, fertility, and testosterone; the observations support the importance of these components and their function in maintaining semen quality and subsequent fertility.

  4. Evaluation of semen parameters in semen donors in a ten-year period in the city of São Paulo

    Directory of Open Access Journals (Sweden)

    Sidney Glina


    Full Text Available Objective: To evaluate sperm concentration, morphology and motility of Brazilian semen donors from 1992 to 2003, in the city of São Paulo. Methods: Retrospective study analyzing 182 donor semen samples from 1992 to 2003. The first and the second donated sample were analyzed for each donor. Donor average age was 30.8 years. Means with standard errors, medians with minimum and maximum values, and interquartile ranges were calculated for age, sperm concentration, semen volume, oval morphology and motility. The relation between each characteristic of the semen samples and the year of donation, as well as donor age and season of the year were studied by linear and multiple regression analysis. Results: Linear regression analysis showed that the sperm concentration (R2 = 19.1%, R2 = 20.2%, p < 0.0001 respectively and the oval morphology (R2 = 13%; R2 = 13.5%; p < 0.0001, respectively decreased significantly, even when the first or the second sperm collection is considered. The ejaculated volume showed slight increase during the period for both samples (R2 = 2.2%, p = 0.048; R-sq = 2.4%. p = 0.038, respectively. All characteristics did not depend on the donors’ age or season of the year when the samples were obtained. Conclusions: There was a decrease in spermatic concentration and percentage of oval sperm of semen donors samples from 1992 to 2003, in the city of São Paulo.

  5. Karakteristik Semen Segar dan Kualitas Semen Cair Kuda dalam Pengencer Dimitropoulos yang Disuplementasi dengan Fruktosa, Trehalosa dan Rafinosa

    Directory of Open Access Journals (Sweden)



    Full Text Available The objective of the experiment was to study the characteristics of stallion fresh semen and the quality of sperm preserved in Dimitropoulos extender (DV supplemented with different concentration of fructose, trehalose and raffinose. Semen were collected using artificial vagina from three stallions. Semen characteristics and quality were evaluated macro- and microscopically. Prior to extension, semen were centrifugated at 3000 rpm for 20 minutes. The condensed sperm were re-suspended in DV supplemented with different types of carbohydrate to meet the concentration of 200 million spz/ml. All samples were stored at room and chilled temperature, and were evaluated for motility and viability every 3 h and 12 h. The results of the experiments indicated that fresh semen characteristics were fair good; the volume, consistency, motility, live-dead ratio, concentration (106/ml, total spermatozoa (109/ejaculate and abnormality were 29.25±9.33 ml, watery, 7.00±0.12, 67.08±9.08%, 77.89±6.46%, 211.88±21.15, 6.28±2.45 and 27.26±4.64%, respectively. The supplementation of different type and concentration of carbohydrates did not significantly affect the motility and viability. However, the supplementation of 50 mM fructose significantly increased the motility and viability of the sperm compared to the control. In conclusion, carbohydrate supplementation in DV may not maintain the sperm quality, particularly in the medium with the osmolarity higher than 400 mOsm/kg.

  6. Does exposure to di(2-ethylhexyl) phthalate in pre-pubertal boars affect semen quality post-puberty? (United States)

    Spjuth, Linda; Ljungvall, Karl; Saravia, Fernando; Lundeheim, Nils; Magnusson, Ulf; Hultén, Fredrik; Rodríguez-Martínez, Heriberto


    Di(2-ethylhexyl) phthalate (DEHP), a plastic softener used in polyvinyl chloride (PVC) products, has been ascribed to have toxic effects on animal reproduction. The present study aimed at determining potential late effects of pre-pubertal oral exposure to DEHP on semen quality in young pigs. Ten pairs of cross-bred male siblings were used. One brother in each pair became, at random, the test animal while the other acted as control. Test males were exposed to 300 mg/kg body weight (bw) of DEHP administered orally three times a week from 3 to 7 weeks of age. The control group was given placebo (water). Semen analyses started when the boars reached 6 months of age, with semen collected twice weekly, until animals were 9 months of age. Semen was evaluated for ejaculate volume, sperm concentration, total sperm count, sperm motility, sperm morphology (including presence of cells other than spermatozoa) and sperm plasma membrane integrity. Total sperm motility tended to be lower while local motility was higher in the DEHP-exposed group compared with controls (p = 0.07) when assessed by computer-assisted sperm analysis. The DEHP-exposed group had a significantly (p < 0.05) lower percentage of spermatozoa with tailless, defective heads (at 7-8 months of age) and double-folded tails (at 6-7, 7-8 and 6-9 months of age), compared with controls (albeit always under 5%). In summary, there were no obvious adverse effects of early oral exposure to 300 mg/kg bw of DEHP on sperm output and sperm quality in post-pubertal young boars. PMID:16637905

  7. Effects of Seasonal Changes and Shearing on Thermoregulation, Blood Constituents and Semen Characteristics of Desert Rams (Ovis aries

    Directory of Open Access Journals (Sweden)

    M. Abdelatif Abdalla


    Full Text Available This experiment was designed to study the effects of shearing in different seasons (winter vs. summer on thermoregulation, blood parameters and semen characteristics of desert rams. Eight intact healthy rams were randomly assigned into two groups (n = 4. The control group was kept unshorn (UN with intact pelage, the mean length of hair left was approximately 1.5 cm and the treated group was shorn (SH. Rectal temperature (Tr and Respiration Rate (RR measurements were carried out twice daily throughout the experimental period. Blood samples were collected once weekly for the evaluation of Packed Cell Volume (PCV, Total (TLC and Differential (DLC leukocyte count, Serum Total Protein (STP, Serum Albumin (SA, Serum Urea (SU and Plasma Glucose (PG concentration. Semen samples were collected once weekly for the determination of Ejaculate Volume (EV, Sperm Mass (SM and individual (SIM motility, Sperm Cell Concentration (SCC, live (LSP and abnormal (ABS sperm percent and semen pH. Scrotal Circumference (SC measurements were performed weekly. Shearing of desert rams significantly lowered the morning Tr in both seasons and the afternoon Tr during summer ,while RR was significantly lower in both seasons in the afternoon. The PCV was significantly lower in shorn rams during summer compared to winter and PG was significantly higher during winter compared to summer. In both seasons shearing significantly lowered SIM. It is concluded that shearing significantly affected thermoregulation, blood composition and semen characteristics during winter and summer. It is concluded that shearing in different season significantly affected thermoregulation, blood parameters and seminal traits of Desert Hamari rams.

  8. Sperm penetration assay and its correlation with semen analysis parameters

    Directory of Open Access Journals (Sweden)

    Laxmi Kant Pandey


    Full Text Available Background: Aim of current study was to determine whether the Sperm Penetration Assay (SPA can be used as a test to discriminate the infertile male from fertile one. We have also correlated the SPA with semen analysis. Methods: Sperm characteristics namely Semen analysis and the sperm penetration assay were tested in 44 infertile and 10 fertile men. Sperm penetration assay was determined by using zona free hamster eggs. Results: With decreasing spermatozoa concentration in the semen there was significant decrease in percentage penetration of zona free Hamster eggs (p0.05. Conclusions: The Sperm penetration assay could discriminate the infertile group from fertile group significantly (p<0.001. The test appeared to be highly reproducible and probably identifies a truly infertile male. [Int J Res Med Sci 2015; 3(11.000: 3197-3201

  9. Decreased levels of genuine large free hCG alpha in men presenting with abnormal semen analysis

    Directory of Open Access Journals (Sweden)

    Plas Eugen


    Full Text Available Abstract Background The pregnancy hormone human chorionic gonadotropin (hCG and its free subunits (hCG alpha, hCG beta are produced in the male reproductive tract and found in high concentrations in seminal fluid, in particular hCG alpha. This study aimed to elucidate changes in peptide hormone profiles in patients showing abnormal semen analyses and to determine the genuineness of the highly abundant hCG alpha. Methods Seminal plasma was obtained from 45 male patients undergoing semen analysis during infertility workups. Comprehensive peptide hormone profiles were established by a panel of immunofluorometric assays for hCG, hCG alpha, hCG beta and its metabolite hCG beta core fragment, placental lactogen, growth hormone and prolactin in seminal plasma of patients with abnormal semen analysis results (n = 29 versus normozoospermic men (n = 16. The molecular identity of large hyperglycosylated hCG alpha was analyzed by mass-spectrometry and selective deglycosylation. Results hCG alpha levels were found to be significantly lower in men with impaired semen quality (1346 +/- 191 vs. 2753 +/- 533 ng/ml, P = 0.022. Moreover, patients with reduced sperm count had reduced intact hCG levels compared with normozoospermic men (0.097 +/- 0.022 vs. 0.203 +/- 0.040 ng/ml, P = 0.028. Using mass-spectrometry, the biochemical identity of hCG alpha purified from seminal plasma was verified. Under non-reducing conditions in SDS-PAGE, hCG alpha isolated from seminal plasma migrated in a manner comparable with large free hCG alpha with an apparent molecular mass (Mr, app of 24 kDa, while hCG alpha dissociated from pregnancy-derived holo-hCG migrated at approximately 22 kDa. After deglycosylation with PNGase F under denaturing conditions, all hCG alpha variants showed an Mr, app of 15 kDa, indicating identical amino acid backbones. Conclusions The findings indicate a pathophysiological relevance of hCG, particularly its free alpha subunit, in spermatogenesis. The alternative glycosylation pattern on the free large hCG alpha in seminal plasma might reflect a modified function of this subunit in the male reproductive tract.

  10. Impact of pig insemination technique and semen preparation on profitability. (United States)

    Gonzalez-Peña, D; Knox, R V; Pettigrew, J; Rodriguez-Zas, S L


    Artificial insemination technique and semen preparation impact boar utilization efficiency, genetic dissemination, and biosecurity. Intrauterine (IUI) and deep intrauterine (DUI) AI techniques require lower number of spermatozoa per dose compared to conventional (CON) AI. Frozen semen (FRO) has been associated with lower reproductive performance compared to fresh semen (FRE) preparation. The combined effects of 3 AI techniques (CON, IUI, and DUI) and 2 semen preparations (FRE and FRO) on the financial indicators of a pig crossbreeding system were studied. A 3-tier system was simulated in ZPLAN and the genetic improvement in a representative scenario was characterized. The cross of nucleus lines B and A generated 200,000 BA sows at the multiplier level. The BA sows were inseminated (CON, IUI, or DUI) with FRE or FRO from line C boars at the commercial level. Semen preparation and AI technique were represented by distinct sow:boar ratios in the C × BA cross. A range of farrowing rates (60 to 90%) and litter sizes (8 to 14 liveborn pigs) were tested. Genetic improvement per year for number born alive, adjusted 21-d litter weight, days to 113.5 kg, backfat, and ADG were 0.01 pigs per litter, 0.06 kg, -0.09 d, -0.29 mm, and 0.88 g, respectively. On average, the net profit for FRE (FRO) increased (P-value profit between techniques were driven by differences in costs. Differences in fixed costs between IUI and DUI relative to CON were -2.4 (-5.2%) and -3.4% (-7.4%), respectively. The differences in total costs between FRE and FRO were lower than -5%. The difference in variable costs between FRE and FRO ranged from -5.3 (CON) to -24.7% (DUI). Overall, insemination technique and semen preparation had a nonlinear effect on profit. The average relative difference in profit between FRE and FRO was less than 3% for the scenarios studied. PMID:24352964

  11. A long-day light program accelerates seasonal coat changes but is without effect on semen and metabolic parameters in Shetland pony stallions. (United States)

    Schrammel, Nadine; Deichsel, Katharina; Aurich, Jörg; Aurich, Christine


    Horses are seasonal breeders, and robust breeds may exhibit a winter hypometabolism when kept under semiferal conditions. In this study, we analyzed the effects of artificial long days on rectal temperature, heart rate, heart rate variability, hematology, coat changes, semen parameters, and plasma testosterone concentrations in Shetland stallions stabled overnight and assigned to a control group (CON, n = 9) kept under natural photoperiod, and a treatment group exposed to a long-day light program from 15 December to 20 March (AL, n = 9). During the 8-month study, rectal temperature, heart rate, and heart rate variability at no time differed between groups. Plasma total protein (P coat and total sperm count but only changes in hair coat but not semen parameters were advanced by a long-day light program. PMID:26673622

  12. The extent of increase in first calving age as a result of implementing various sexed semen breeding strategies

    Energy Technology Data Exchange (ETDEWEB)

    Joezy-Shekalgorabi, S.; Shadparvar, A. A.; Vries, A. de; Gay, K. D.


    A deterministic simulation was conducted to assess the effects of sexed semen utilization strategies on age at first calving (AFC). Four different strategies were implemented on dairy heifers: continuous use of conventional semen only (CC), continuous use of sexed semen only (SS), utilization of sexed semen for both the first and second services with conventional semen afterwards (S2), and utilization of sexed semen for the first service with conventional semen afterwards (S1). Results indicated that continuous utilization of sexed semen led to the greatest AFC; however at high conception rates, strategies displayed negligible differences on AFC. Increases in estrus detection rate had the greatest effects on decreasing AFC of the SS scenarios. Negative effect of sexed semen on AFC increased when the effect of low estrus detection rate was combined with low conception rate of sexed semen. Results indicated that in the case of access to sexed semen conception rate, prediction of AFC is possible by quadratic polynomial or exponential equations, depending to the applied breeding strategy. Simultaneous utilization of sexed and conventional semen in a herd did not make a substantial change in AFC when a low percentage of sexed semen was employed. Increasing the contribution of different sexed semen strategies led to higher AFC variation, especially for the SS strategy. AFC of strategies that utilize sexed semen is highly dependent on the conception rate, estrus detection rate and the contribution of sex sorted semen in the total number of inseminations of the heifer herd. (Author)

  13. The Relationship between Occupation and Semen Quality

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Vaziri


    Full Text Available Background: Infertility can be a major concern for couples trying to conceive, and occupationalhazards may constitute a main cause of infertility in men. Studies conducted throughout the worldindicate that physical and chemical hazards in the workplace can have a negative impact on malefertility. The main objective of this study was to determine the frequency of occupational categoriesof men who attended an infertility clinic, and to evaluate the differences in the semen qualityparameters among occupational categories.Materials and Methods: This cross-sectional study was conducted on 1164 males who werereferred to the Infertility Research Center in Tehran for treatment of infertility in order to evaluatethe effects of certain occupations on infertility. The participants were divided into several categoriesaccording to their occupations and evaluated by means of a questionnaire for duration of infertility,BMI, sperm count, percentage of normal sperm morphology and percentages of sperm with class Aand class B motilities. Descriptive statistics, analysis of variance, and correlations were conductedusing SPSS 16.0 for Windows.Results: There were no statistically significant differences in the mean sperm count or spermmorphology between occupational categories. Assessment of the differences in the frequency ofsperm motility classes between occupational categories revealed a significant difference only inthe frequency of sperm with class B motility. The lowest mean percentages of sperm with class Bmotility were seen in those involved in the transportation industry, a finding in agreement with anumber of other researches.Conclusion: Our findings revealed an association between occupation and sperm motility. Sinceour study population was relatively small and in many cases exposures to work hazards were brief,a larger study group must be evaluated in order to support the preliminary results of this study.

  14. Parental infertility and semen quality in male offspring

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia Høst; Thulstrup, Ane Marie; Bonde, Jens Peter; Olsen, Jørn


    Jensen et al. (Am J Epidemiol 2007;165:583-90) reported for the first time that men whose mothers had received fertility treatment had poor semen quality. This result could be confounded by the mothers' body mass index. Obesity is a strong predictor of fecundity and could have a programming effect on semen quality through hormonal factors or links to fetal growth. The authors of the current study tried to replicate the finding of Jensen et al. after controlling for maternal body mass index and o...

  15. Semen quality in Schistosoma haematobium infected men in Madagascar

    DEFF Research Database (Denmark)

    Leutscher, Peter; Høst, Erik; Reimert, Claus M


    The seminal vesicles and the prostate are frequently affected by egg-induced inflammation in Schistosoma haematobium infected men. The objective of this study was to assess the semen quality in men with male genital schistosomiasis (MGS). The examination of the semen samples was performed in men...... aged 15 to 49 years living an S. haematobium endemic area in Madagascar prior to anti-schistosoma treatment with praziquantel and five months later. Men from the high endemic Sirama sugarcane plantation with positive egg excretion in the urine and circulating anodic antigen (CAA) present in serum (n=85...

  16. Evaluación de dos formas de colección de semen en Alpacas

    Scientific Electronic Library Online (English)

    Rosa, Dávalos R; Juan, Olazábal L.


    Full Text Available [...] Abstract in english Semen was collected from 10 alpaca males aged 3-6 years, 3 times weekly for 3 weeks, followed by a week of rest, over a 3 month period. A heated artificial vagina was used together with a dummy model and a female in heat. Semen was collected from all 10 animals utilizing both procedures. Average cop [...] ulation time was 15.9 ± 0.6 and 16.8 ± 0.7 minutes using the dummy and the receptive female (p0.05). Sperm volume averaged 1.03 ± 0.04 and 1.73 ± 0.09 ml, (p

  17. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja DØvling; Bungum, Mona Berger Håkonsen


    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses.

  18. Effects of Vitamin E Addition to Chicken Semen on Sperm Quality During in Vitro Storage of Semen

    Directory of Open Access Journals (Sweden)

    Saleh Tabatabaei


    Full Text Available The purpose of this study was to evaluate the probable effects of the vitamin E addition in different levels to the extender of chicken semen on spermatozoa quality during storage of semen at 4°C for 0, 3, 6, 10 and 24 hours. Eight young Ross broiler breeder strain 308 roosters were used in this experiment. The collected semen from all roosters was mixed together and diluted with modified a Ringer’s solution. The diluted pooled semen was divided into 5 treatments (T. T1 was a control group without any vitamin E addition. For T2 to T5 groups 0.5 %, 1 %, 2 % and 3 % vitamin E (w/v, were added respectively. Treatments were evaluated for sperm motility, sperm viability and probable morphological defects after 0, 3, 6, 10 and 24 hours of incubation at 4°C. The evaluations of spermatozoa immediately after semen collection, were revealed no significant differences among values of treatment groups, whereas after incubating the treatments for different spans of time, the sperm progressive motility and viability rates for groups supplemented with vitamin E were significantly (P < 0.05 higher than that of the control group. In addition, morphological defect rates of chicken spermatozoa in the groups supplemented with different levels of vitamin E were significantly (P < 0.05 lower than that in control group. According to the results of this study we conclude that, the most excellent level of vitamin E for supplementation to the extended semen of chicken in order to improve the sperm motility and viability plus to reduce the morphological defect rates of the spermatozoa up to 24 hours storage time at 4°C is 2 % (w/v.

  19. Blood and Semen Selenium Concentrations and Semen Quality in Boars Fed Diets Supplemented with Organic or Inorganic Selenium

    Directory of Open Access Journals (Sweden)

    Theera Rukkwamsuk


    Full Text Available Effect of dietary supplementation of organic or inorganic selenium on blood and semen selenium concentrations and semen quality was determined in 10 boars. During the 4 weeks of pre-experimental period, all boars were fed a basal diet containing 0.15 mg kg-1 of inorganic selenium. Thereafter, all cows were randomly allocated into 2 groups of five boars which were fed a basal diet supplemented with either 0.3 mg kg-1 of inorganic selenium or 0.3 mg kg-1 of organic selenium for 84 days. Blood samples were collected from all boars to determine selenium concentrations at the end of pre-experimental period and at days 49 and 84 after supplementation. Semen samples were collected at the end of pre-experimental period and at days 35, 49, 63 and 84 to determine selenium concentrations and semen evaluation. For both inorganic and organic selenium groups, blood selenium concentrations at days 49 and 84 were higher than the concentration at day 0 and the concentrations did not differ between the two groups at all sampling periods. Semen selenium concentrations at days 35, 49, 63 and 84 were higher than the concentration at day 0 for both inorganic and organic selenium groups and the concentrations did not differ between the 2 groups at days 35, 49, 63 and 84. Sperm motility parameters including motility (%, progressive motility (%, Average Path velocity (VAP, ?m sec-1, Straight-line velocity (VSL, ?m sec-1 and Curvilinear velocity (VCL, ?m sec-1 did not differ between the 2 groups and among sampling periods. Results revealed that 0.3 mg kg-1 supplementation of either inorganic or organic selenium form in the basal diet containing 0.15 mg of selenium per kg could increase blood and semen selenium levels in the boars. With normally-fertile boars, both inorganic and organic form of selenium supplemented in the diet had similar effect on sperm motility characteristics in the boars.

  20. Técnicas complementarias para la evaluación de semen porcino / Boar semen: complementary techniques for its evaluation

    Scientific Electronic Library Online (English)

    L.O., González; M.L., Fischman; M, Boquet; M.C., Acerbo; M.S., Miguez; H.O., Cisale; M.R, Ferrari.


    Full Text Available Los parámetros del núcleo espermático (morfología, maduración y grado de condensación), la capacidad funcional de los espermatozoides (respuesta de la membrana al medio hipoosmótico y la resistencia térmica) y la calidad del semen se evaluaron en dieciséis cerdos sanos, sexualmente maduros y fértile [...] s. Los núcleos espermáticos se colorearon con la reacción de Feulgen para observar su morfología, con Azul de Anilina para determinar la maduración de la cromatina y con Azul de Toluidina para determinar su condensación. El porcentaje y error estándar de los núcleos normales en las tres pruebas fue: 96.6±0.8, 98.1±1.1. 99.6±0.2 respectivamente. El porcentaje de espermatozoides con movilidad total antes de la prueba de resistencia térmica fue 62.3±3.9. mientras que la movilidad progresiva 35.0±4.6 y las células positivas a la prueba Hipoosmótica (células HOS +) 53.3±2.5. Luego de la incubación térmica el porcentaje de espermatozoides con movilidad total era 37.3±3.5, el de espermatozoides con movilidad progresiva 13.4±3.6 y el de las células HOS+ 37.7±3.5. Los parámetros nucleares no se correlacionaron entre sí ni con los demás parámetros estudiados. La movilidad total presentó correlación con: la movilidad progresiva, la viabilidad espermática, la prueba hipoosmótica y luego de la prueba de resistencia térmica con la movilidad total y la prueba hipoosmótica. Por consiguiente, la combinación de técnicas complementarias podría mejorar la estimación de la calidad del semen porcino. Abstract in english Nuclear parameters of the spermatozoa (morphology, maturation and condensation degree), sperm functional capacity (membrane response to hypoosmotic medium and sperm resistance to heat incubation) and semen quality were evaluated in sixteen healthy, sexually mature and fertile boars. Sperm nuclei wer [...] e stained with the Feulgen reaction to observe morphology, with Aniline Blue to determine chromatin maturation, and with Toluidine Blue to determine chromatin condensation. The mean percentage and standard error of normal nuclei in each of the three tests was: 96.6±0.8, 98.1±1.1 and 99.6±0.2 respectively. The percentage of sperm with total motility before heat incubation was 62.3±3.9, whereas that of sperm with progressive motility was 35.0±4.6 and that of Hypoosmotic Swelling Test+ (HOS+) cells 53.3±2.5. After heat incubation (Thermoresistance Test), the percentage of sperm with total motility was 37.3±3.5, that of sperm with progressive motility 13.4±3.6, and that of HOS+ cells 37.7±3.5. Nuclear parameters did not correlate significantly between each other or with the other sperm parameters studied. Total motility had correlation with: progressive motility, sperm viability, HOS test and total motility and HOS test after Thermoresistance Test. Consequently, combining different complementary tests would improve estimations of semen boar quality.

  1. New methods and media for the centrifugation of honey bee (Hymenoptera: Apidae) drone semen. (United States)

    Wegener, Jakob; May, Tanja; Kamp, Günter; Bienefeld, Kaspar


    Centrifugation of Apis mellifera L. drone semen is a necessary step in the homogenization of semen pools for the enlargement of the effective breeding population, as well as in the collection of semen by the so-called washing technique. It is also of interest for the removal of cryoprotectants after cryopreservation. The adoption of methods involving semen centrifugation has been hampered by their damaging effect to sperm. Here, we tested four new diluents as well as three additives (catalase, hen egg yolk, and a protease inhibitor), using sperm motility and dual fluorescent staining as indicators of semen quality. Three of the new diluents significantly reduced motility losses after centrifugation, as compared with the literature standard. Values of motility and propidium iodide negativity obtained with two of these diluents were not different from those measured with untreated semen. The least damaging diluent, a citrate-HEPES buffer containing trehalose, was then tested in an insemination experiment with centrifuged semen. Most queens receiving this semen produced normal brood, and the number of sperm reaching the storage organ of the queen was not significantly different from that in queens receiving untreated semen. These results could improve the acceptance of techniques involving the centrifugation of drone semen. The diluent used in the insemination experiment could also serve as semen extender for applications not involving centrifugation. PMID:24665683

  2. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen. (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E


    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  3. Seasonal variation in semen quality of Dorper rams using different collection techniques

    Scientific Electronic Library Online (English)

    C.M., Malejane; J.P.C., Greyling; M.B., Raito.


    Full Text Available The aim of the study was to evaluate the seasonal variation in semen quality of Dorper rams using different semen collection techniques. The study was carried out from January 2012 to January 2013. A general management programme for health control was followed, with water being provided ad libitum t [...] hroughout the trial, and all rams being fed a 2.5 kg maintenance diet per day. Eleven mature Dorper rams, recording a mean body weight of 69.6 ± 9.2 kg and mean age of 18 ± 4.7 months, were used in the trial. A group of six rams were trained for semen collection with the aid of the artificial vagina (AV), while in the remaining five rams, semen was collected using the electro ejaculator (EE). Immediately after collection, ejaculates were evaluated macroscopically and microscopically for semen volume, semen colour, semen pH, semen wave motion, sperm motility, sperm cell concentration, sperm viability and morphology. The results of the trial generally showed that semen in Dorper rams may be collected using the AV or EE methods throughout the year. However, an overall significant better semen quality collected by the AV versus the EE collection method was recorded. Generally, semen of significantly higher quality was recorded in summer, autumn and spring (both collection techniques). The tendency in the current trial was that the EE technique of semen collection was the less reliable method. Consequently the AV is recommended as the more acceptable method of semen collection in the Dorper. Winter is not generally recommended for semen collection, especially when using the EE.

  4. Selected qualitative and biochemical parameters of cryopreserved semen of Holstein-Friesian (HF) AI bulls. (United States)

    Lecewicz, M; Hering, D M; Kami?ski, S; Majewska, A; Kordan, W


    Selected qualitative and biochemical parameters were determined in cryopreserved semen used for artificial insemination, sampled from 120 bulls reared at the Animal Breeding and Insemination Center in Bydgoszcz. The total average motility of the analyzed sperm samples was determined at 62.51%. The percentage of motile spermatozoa displaying progressive forward motility was 21.65%. Analyzed samples were characterized by a high percentage of sperm cells with a intact plasma membrane (71.21%) and active mitochondria (71.32%). High efficiency of the enzymatic antioxidant system of the evaluated sperm cells was demonstrated by high activity of CAT, GPx and SOD (494.37, 2847.83 and 5.31U/1x10(9) spermatozoa, respectively) values and low values of the DNA Fragmentation Index (9.32). The results of the study, obtained with the involvement of advanced analytical methods, indicate a high fertilizing capability of the analyzed sperm samples. PMID:25928933

  5. Influence of addition of different antibiotics in semen diluent on viable bacterial count and spermatozoal viability of Awassi ram semen

    Directory of Open Access Journals (Sweden)

    O I Azawi


    Full Text Available The objectives of the present study were to determine the effects of six different antibiotics in controlling the growth of semen contaminating bacteria and if these antibiotics have any adverse effect on Awassi ram spermatozoa. Semen samples from six mature Awassi rams were used in this study. A total number of 120 ejaculates were collected from the rams using an artificial vagina once a week. Semen ejaculates were evaluated for volume, sperm concentration, mass motility, individual motility, percentage live sperm, sperm abnormalities, and viable bacterial count. Semen samples were diluted by sodium citrate-fructose-egg yolk. The diluted semen sample was divided into 7 parts. Six types of antibiotics were added to the semen diluent parts including; penicillin G 1000 IU ml-1 with streptomycin 1 mg ml-1, gentamicin sulphate 250 mg ml-1, tetracycline 0.5 mg ml-1, lincomycin 1 mg ml-1, cefoperazone sodium 1mg ml-1, cefdinir 1 mg ml-1 and the seventh part considered as a control group without antibiotic addition. The diluted semen samples were cooled and preserved at 5 Co for 5 days. Cooled diluted semen samples were examined for individual motility, percent of live sperm, sperm abnormalities, acrosomal defects and bacterial count every 24 h until 5 days. Comparing with the control, all the antibiotics examined were effective in controlling bacterial growth (P<0.05 from 24 h to 96 h of preservation at 5 Co. Cefdinir and cefoperazone sodium proved to be significantly (P<0.05 effective than other antibiotics in controlling bacterial growth at 96 h of preservation as the bacterial count were 23.3 ± 3.7 x 103 / ml and 25.4 ± 6.2 x 103 / ml, respectively. Lincomycin, gentamicin sulphate and tetracycline proved ineffective in controlling bacterial growth at 96 h of preservation as the bacterial count were 57.1 ± 20.1 x 103 / ml, 52.5 ± 29.4 x 103 / ml and 46.5 ± 8.8 x 103 / ml, respectively. The addition of tetracycline to diluted ram semen significantly reduced (P<0.05 sperm individual motility and percent live sperm and a significant increase (P<0.05 acrosomal defects was observed at 96 h of preservation in comparison to control and other antibiotics. Sperm viability was highly correlated with bacterial count in the control part of diluted semen (r = 0.794; P < 0.01. It could be concluded from the results of the present study that additions of cephalosporins (cefdinir or Cefoperazone sodium at the dose of 1 mg ml-1 were most effective amongst the antibiotics used in checking the bacterial growth and improving semen quality of Awassi ram. [Vet. World 2012; 5(2.000: 75-79

  6. Seasonal variation in protein profiles and HSP70 of Holstein crossbred bull semen

    International Nuclear Information System (INIS)

    Since HSP70 is the stress response protein, the impact of heat stress on semen quality may be displayed through the expression of protein profile and HSP70. This study investigated the seasonal effects on the protein profiles and HSP70 in spermatozoa and seminal plasma of 10 Holstein crossbred bulls from an AI centre located in Lopburi, Thailand. Bull semen was collected weekly for 8 consecutive weeks during rainy (average THI 79.34), cool (average THI 75.27), and summer (average THI 80.10) seasons. Protein was extracted from both spermatozoa and seminal plasma using Laemmli's sample buffer. The protein profiles of spermatozoa and seminal plasma were subjected to one-dimensional SDSPAGE with 12% (w/v) acrylamide gel and 4.0% (w/v) acrylamide stacking gel for 120 min. at 8 mA. To visualize the protein profiles, gels were fixed in acetic acid: ethanol: H2O (7: 40: 53), stained with 0.125% (w/v) Coomassie blue R-250 in acetic acid: ethanol: H2O (7: 40: 53) for 60 min., and distained with acetic acid: ethanol: H2O (11: 26: 63) until the background was clear. Western blotting, as described by Kamaruddin et al. was conducted to determine HSP70 using anti-HSP70 monoclonal antibody. Proteins in the polyacrylamide gel were electrophoretically transferred, for 90 min. at 156 mA, to a PVDF membrane. The membrane was rinsed in PBS and blocked overnight in a blocking solution (advanced ECL blocking; Amersham Life Science Inc., Oakville, ON, Canada). The membrane was then incubated for 1 h at room temperature with monoclonal anti-HSP70 (H5147 Sigma Chemical Supplies CO., LTD), incubated with anti-mouse IgG horse radish peroxidase conjugated for 1 h at room temperature, and then detection for immunoreactive bands using ECL detection reagents (Amersham Life Science Inc.) on scientific imaging film. It was found that the profiles of protein were not different among seasons in both sperm and seminal plasma. The profiles of spermatozoa protein range from 10 to 220 kDa while most of proteins found in seminal plasma were low molecular weight (14-30 kDa). The HSP70 was found in both sperm and seminal plasma. However, the amount of HSP70 in winter appears to be greater compare to those found in summer and rainy seasons

  7. Twin pregnancy possibly associated with high semen quality

    DEFF Research Database (Denmark)

    Asklund, Camilla; Jensen, Tina Kold; Jørgensen, Niels; Tabor, Ann; Sperling, Lene; Skakkebæk, Niels Erik


    BACKGROUND: Recent studies found an association between a long waiting time to pregnancy (TTP) and reduced probability of twinning and a reduced dizygotic (DZ) twinning rate in subfertile men. However, it remains unsolved whether semen quality is associated with twin offspring. We therefore studied...

  8. Excretion of lumpy skin disease virus in bull semen. (United States)

    Irons, P C; Tuppurainen, E S M; Venter, E H


    This work was done to establish the incidence and duration of excretion of lumpy skin disease virus (LSDV) in semen of experimentally infected susceptible bulls. Six serologically negative bulls 11-20 months of age were experimentally infected with a virulent field isolate (strain V248/93) of LSDV. Animals were observed for the development of clinical signs, blood was collected until day 90 after infection, and semen was collected every second day until day 18, then twice a week till day 63 and twice a month until three consecutive samples were negative when tested for LSDV by polymerase chain reaction (PCR). An aliquot of each sample which tested positive using PCR was inoculated onto cell monolayers for the recovery of virus. Two bulls developed severe lumpy skin disease (LSD), two bulls showed mild signs and two bulls showed a transient fever only. Multiple samples were positive on PCR from both of the severely affected bulls and one of the mildly affected bulls; between days 10 and 159, days 8 and 132, and days 10 and 21 respectively. Only one sample from each of the other three bulls was positive on PCR. Virus was only isolated from two samples from one of the severely affected bulls and from five semen samples from the other. This study confirmed the excretion of LSDV in bovine semen for prolonged periods, even when obvious clinical signs of the disease were no longer apparent. PMID:15725437

  9. [Comparison of phospholipid in crude and fried semen Dolichos Lablab]. (United States)

    Xu, Y; Wang, Y; Tao, C


    A study of the chemical changes of phospholipid in crude and fried semen Dolichos Lablab was carried out by molybdenum blue colorimetry and TLC scanning. The result shows that both the total phospholipid contents and the molar fraction of phosphatidylcholine in the fried samples are decreased as compared with the crude ones. PMID:1804199


    Turkeys are the only commercial livestock species completely dependent upon artificial insemination (AI) for fertile egg production. Given that every breeder hen must be inseminated weekly during egg production, AI is both time and labor-intensive. Methods for the timing, frequency, semen dosage a...

  11. The influence of boar breed and season on semen parameters

    Scientific Electronic Library Online (English)

    D., Knecht; S., & #346; rodo& #324; ; K., Duzi& #324; ski.


    Full Text Available The aim of the present study was to demonstrate the influence of boar breed and season on semen parameters. The research material consisted of 31 boars: Polish Large White (PLW), Polish Landrace (PL), and Duroc x Pietrain (D x P), aged 8 to 24 months. The analysed material consisted of 1390 ejaculat [...] es, collected during the period January 2010 to October 2012. Semen samples were assessed in terms of semen volume (mL), sperm concentration (x 10(6) m/mL), total number of sperm (x 10(9)), total number of live sperm (x 10(9)) and number of insemination doses obtained from one ejaculate (n). In winter, an increase in sperm concentration was observed for the PLW breed. Moreover, an increase in the volume of semen produced for this breed was noted in summer and autumn. Differences between breeds for the total number of sperm and total number of live sperm were observed for the winter and spring periods. The largest semen volume was noted for the PLW breed (276.4 ± 9.66 mL). However, in the analysis of other sperm parameters, boars of this breed demonstrated the poorest results. The highest insemination dose was obtained from breed D x P in winter (26.0 ± 0.51). Correlation analyses indicated that PLW and D x P boars are the least resistant to higher ambient temperatures, and in summer and autumn this resulted in a reduction in sperm concentration (-0.26 and -0.20, respectively).

  12. New extender for cryopreservation of Siberian sturgeon (Acipenser baerii) semen. (United States)

    Judycka, S; Szczepkowski, M; Ciereszko, A; Dietrich, G J


    The goal of this study was to develop a simple glucose-methanol extender for cryopreservation of Siberian sturgeon (Acipenser baerii) semen. Semen quality was assessed by determining post-thaw sperm motility and fertilizing ability at hatching stage. We tested the effect of glucose concentration (0, 0.10, 0.15, 0.20 and 0.30 M) in a methanol extender on post-thaw sperm motility. Sperm motility parameters and fertilizing ability of semen cryopreserved in 0.1 M glucose in 15% methanol (GM) were compared to previously described Tris-sucrose-KCl in 10% - methanol extender (TSKM). Additionally, sperm motility and fertilizing ability in relation to 30 min equilibration in GM extender before cryopreservation and 30 min of post-thaw storage were determined. The beneficial effect of the glucose for semen cryopreservation was related to its concentration with a quite narrow optimum of 0.1 to -0.15 M. The fertilization rates of frozen/thawed sperm were similar for both (TSKM and GM) tested extenders. The sperm motility and fertilization rate were not affected either by 30 min equilibration in GM extender or by 30 min of post-thaw storage. Our work indicates that the use a simple extender consisting of 0.1M glucose in 15% methanol can be an alternative cryopreservation method to those previously described for sturgeons. The use of an equilibration period and the possibility of post-thaw semen storage can improve organization of hatchery work and help with logistics of large-scale hatchery operations. PMID:25725469

  13. Inseminación artificial de alpacas con semen colectado por aspiración vaginal y vagina artificial / Artificial insemination of alpacas with semen collected by vaginal aspiration and by artificial vagina

    Scientific Electronic Library Online (English)

    Virgilio, Alarcón B; Wilber, García V; P. Walter, Bravo.

    Full Text Available Semen de alpaca fue colectado por dos métodos: por aspiración de la vagina de la hembra después de la monta natural y con vagina artificial. El semen colectado fue evaluado y diluido con Tris tamponado, y luego usado en inseminacion artificial. Se trabajó con 160 alpacas hembras adultas de capacidad [...] reproductiva comprobada y 5 alpacas machos. Se colectó semen post cópula de los cinco machos en 10 hembras, y se hicieron 50 colecciones de semen con vagina artificial de estos machos, dos veces por semana. Se determinó volumen, motilidad, concentración espermática, porcentaje de espermatozoides vivos, viscosidad y color. Los resultados para semen colectado por aspiración de la vagina y con vaginal artificial fueron: volumen (3.6 y 1.5 mL), motilidad (73.4 y 69.0%), concentración espermática (75.2 y 80.3 millones/mL), espermatozoides vivos (75.3 y 70.8%), respectivamente, con diferencia entre métodos (p Abstract in english Semen from alpacas was collected by two methods: by aspiration from the female’s vagina following mating and with an artificial vagina. Semen was collected, evaluated and extended with Tris buffer, and then used in artificial insemination. Altogether 160 female alpacas with proven reproductive histo [...] ry and five males were used. Semen was collected by vaginal aspiration from 10 females using five males as semen donors; likewise, semen from the same males was collected with an artificial vagina twice a week 50 times. Volume, motility, spermatic concentration, live spermatozoa, viscosity and color was evaluated. Seminal characteristics of semen collected by aspiration and with an artificial vagina were: volume (3.6 and 1.5 mL), motility (73.4 and 69.0%), sperm concentration (75.2 and 80.3 million/mL), live spermatozoa (75.3 and 70.8%) respectively, with statistical difference between methods (p


    Abdussamad, A M; Gauly, M; Holtz, W


    Two experiments were conducted. The purpose of Experiment 1 was to investigate whether viability of bovine semen stored in liquid nitrogen (-196°C) will be adversely affected by temporary exposure to dry ice (-79°C). It was convincingly shown that post thaw-motility was not affected, regardless whether semen was thawed immediately or after being returned to liquid nitrogen. Shipping or temporary storage on dry ice, thus, is a viable option. In Experiment 2, refreezing of frozen-thawed semen was attempted. The proportion of motile spermatozoa was reduced by a factor of ten to between 6.0 % and 7.4 %, regardless whether thawing occurred directly after removal from liquid nitrogen or after an interim period on dry ice. When semen was refrozen on dry ice before being returned to liquid nitrogen, motility rates were significantly improved (13.0 % to 17.0 %, P<0.05). In both experiments sperm cells that remained motile displayed vigorous forward movement and normal morphological appearance. PMID:26576003

  15. Study on the effect of prostaglandin F2α treatment on semen characteristics and enzymatic activates of Awassi rams in breeding and non breeding seasons

    Directory of Open Access Journals (Sweden)

    Osama Ibrahim Azawi,


    Full Text Available The purpose of this research work was to determine the effects of PGF2α, given immediately before semen collection, on semen characteristics and libido in Awassi rams during breeding and non breeding season. The experiment was conducted in late summer to early autumn when major breeding activities commence and winter during the non breeding season at Mosul region in northern Iraq at the Animal Research and Practice Farm of the College of The Veterinary Medicine, University of Mosul. Twelve mature Awassi rams were used in this study. Animals were randomly allocated into two equal groups, the first group was administered 7.5 mg IM of PGF2αweekly and the second group as a control group received 1 ml of N-saline solution. Semen samples were collected from the Awassi rams 24 h after IM administration. Scrotal circumference (SC and testicular volume were measured weekly during the study period. Semen ejaculates were evaluated for semen volume, sperm concentration, sperm concentration/ejaculate, mass motility, individual motility, percentage live sperm, sperm abnormalities, and sperm acrosomal defects. Samples of seminal plasma were analyzed for the estimation of alanine amino transferase (ALT, aspartate amino transferase (AST, acid phosphatase (ACP, alkaline phosphatase (ALP and lactic dehydrogenase (LDH. Results of the present showed that PGF2α treatment to Awassi rams did not improve most semen characteristics in both breeding and non breeding seasons compared with the group. The only improvement of Awassi semen quality observed was in sperm concentration in the breeding season. The testicular volume showed a significant increase (P<0.05 in Awassi rams treated with PGF2α in breeding season compared to the control group and PGF2α treated group in the non breeding season. The mean activity of LDH enzyme estimated in the PGF2αtreated group and control group showed a significant difference (P<0.05 between the two groups in the breeding season and non breeding season (52.34 ± 8.96 and 57.43 ± 19.9 vs. 117.02 ± 5.26 and 131.88 ± 5.01, respectively. Other enzymatic activities including ALT, AST, ACP and ALP showed no significant differences between Awassi rams treated with PGF2α and control groups in both breeding and non breeding seasons. In conclusion, PGF2αtreatment of Awassi rams improved sperm concentration and testicular volume

  16. Uso de dilutores hipertónicos en la criopreservación de semen ovino / Hypertonic extenders in the cryopreservation of ovine semen

    Scientific Electronic Library Online (English)

    Hernán, Guerrero V.; Wilfredo, Huanca L.; Fernando, Raymundo T.; Sandra, Huerta O.; Daphne, Ramos D..

    Full Text Available Se evaluó el efecto crioprotector de dos dilutores hipertónicos (Trealosa y Lactosa) sobre las características postdescongelamiento del semen ovino (n=4). La composición de los dilutores base incluyó Tris 27.1 g/l, ácido cítrico 14.0 g/l, fructosa 10.0 g/l, glicina 10.0 g/l, yema de huevo 10.0 % (v/ [...] v) y glicerol 6.5 % (v/v). El semen colectado con vagina artificial tuvo las siguientes características: volumen: 1.1 ± 0.1ml, concentración espermática: 3.5 ± 0.1 x 109/ml, motilidad individual: 87.0 ± 2.4%, motilidad masal (escala 0- 5): 4.4 ± 0.2, espermatozoides vivos: 90.2 ± 3.8% y anormales 1.8 ± 0.7%. El semen fue congelado en pajillas de 0.5 ml y conservado en nitrógeno líquido. Las pajillas fueron descongeladas luego de 3 meses para su evaluación. Se obtuvo una motilidad individual de 40.3 ± 5.9 y 30.0 ± 5.0% y un número de espermatozoides vivos de 34.4 ± 6.6 y 24.4 ± 5.0 para los dilutores Trealosa y Lactosa, respectivamente. El mejor resultado se obtuvo al utilizar el dilutor hipertónico Trealosa por tener mejores características de motilidad individual y espermatozoides vivos postdescongelamiento. Abstract in english The cryoprotectant effect of two hypertonic extenders (trehalose and lactose) on the post-thawing characteristics of ram semen (n=4) was evaluated. The extender composition included Tris 27.1 g/l, Citric acid 14.0 g/l, Fructose 10.0 g/l, Glycine 10.0 g/l, egg yolk 10.0% (v/v) and Glycerol 6.5% (v/v) [...] . Semen was collected in an artificial vagina. Seminal characteristics were: volume: 1.1 ± 0.1 ml, sperm concentration: 3.50 ± 0.1 x 109/ml, individual motility: 87.0 ± 2.4%, wave motility (scale 0-5): 4.4 ± 0.2, live sperms: 90.2 ± 3.8%, and abnormal sperms: 1.8 ± 0.7%. Semen was frozen in 0.5 ml straws and stored in liquid nitrogen. Straws were thawed after 3 months. Results of post-thawing evaluation were: individual motility: 40.3 ± 5.9 and 30.0 ± 5.0%, and live sperms: 34.4 ± 6.6 and 24.3 ± 5.0% for the Trehalose and Lactose extenders respectively. Results showed a better ram semen cryopreservation when the Trehalose extender was used.

  17. Critical sources of bacterial contamination and adoption of standard sanitary protocol during semen collection and processing in Semen Station

    Directory of Open Access Journals (Sweden)

    Chandrahas Sannat


    Full Text Available Aim: The present investigation was conducted to locate the critical sources of bacterial contamination and to evaluate the standard sanitation protocol so as to improve the hygienic conditions during collection, evaluation, and processing of bull semen in the Semen Station. Materials and Methods: The study compared two different hygienic procedures during the collection, evaluation and processing of semen in Central Semen Station, Anjora, Durg. Routinely used materials including artificial vagina (AV inner liner, cone, semen collection tube, buffer, extender/diluter, straws; and the laboratory environment like processing lab, pass box and laminar air flow (LAF cabinet of extender preparation lab, processing lab, sealing filling machine, and bacteriological lab were subjected to bacteriological examination in two phases of study using two different sanitary protocols. Bacterial load in above items/environment was measured using standard plate count method and expressed as colony forming unit (CFU. Results: Bacterial load in a laboratory environment and AV equipments during two different sanitary protocol in present investigation differed highly significantly (p<0.001. Potential sources of bacterial contamination during semen collection and processing included laboratory environment like processing lab, pass box, and LAF cabinets; AV equipments, including AV Liner and cone. Bacterial load was reduced highly significantly (p<0.001 in AV liner (from 2.33±0.67 to 0.50±0.52, cone (from 4.16±1.20 to 1.91±0.55, and extender (from 1.33±0.38 to 0 after application of improved practices of packaging, handling, and sterilization in Phase II of study. Glasswares, buffers, and straws showed nil bacterial contamination in both the phases of study. With slight modification in fumigation protocol (formalin @600 ml/1000 ft3, bacterial load was significantly decreased (p<0.001 up to 0-6 CFU in processing lab (from 6.43±1.34 to 2.86±0.59, pass box (from 12.13±2.53 to 3.78±0.79, and nil bacterial load was reported in LAFs. Conclusion: Appropriate and careful management considering critical points step by step starting right from collection of semen to their processing can significantly minimize bacterial contamination.

  18. Air pollution and decreased semen quality: A comparative study of Chongqing urban and rural areas

    International Nuclear Information System (INIS)

    To investigate the association and effects of air pollution level on male semen quality in urban and rural areas, this study examines the outdoor concentrations of particulate matter (PM10), sulfur dioxide (SO2), nitrous dioxide (NO2) and semen quality outcomes for 1346 volunteers in both urban and rural areas in Chongqing, China. We found the urban area has a higher pollution level than the rural area, contrasted with better semen quality in the rural residents, especially for sperm morphology and computer assistant semen analysis (CASA) motility parameters. A multivariate linear regression analysis demonstrates that concentrations of PM10, SO2, and NO2 significantly and negatively are associated with normal sperm morphology percentage (P 10, SO2, and NO2 in urban ambient air may account for worse semen quality in urban males. - Highlights: • We investigate the distributions of PM10, SO2 and NO2 in urban and rural areas in Chongqing, China. • We explore the associations of air pollution and male semen quality. • The concentrations of PM10, SO2, and NO2 are significantly higher in urban areas. • Median values of some semen quality parameters in rural male were higher than urban male. • PM10, SO2, and NO2 were negatively associated with semen quality parameters. - Air pollution is higher in the urban area while there is better semen quality in rural males. Polluted air may thus account for worse semen quality in urban males

  19. Evaluación del sistema antioxidante en el semen normal / Evaluation of antioxidant system in normal semen

    Scientific Electronic Library Online (English)

    Juan M., Gallardo.


    Full Text Available Antecedentes. Las especies reactivas del oxígeno (ERO), tienen la capacidad de alterar reversible o irreversiblemente la función celular. Se ha propuesto que las ERO modifican la bioquímica y la fisiología del espermatozoide. Por otro lado, los mecanismos antioxidativos pudieran proteger a los esper [...] matozoides del daño producido por las ERO. Objetivo. Determinar los valores normales para el superóxido dismutasa (SOD), glutatión peroxidasa (GPx), malondialdehído (MDA) y óxido nítrico (NOx) en el líquido seminal y espermatozoides de humanos sanos. Procedimientos. Se estudiaron 45 muestras de semen de sujetos aparentemente sanos. Las muestras se obtuvieron por masturbación y se colectaron en tubos estériles. Una vez centrifugadas, se fraccionaron en alícuotas para medir la concentración de SOD, GPx, MDA y NOx. El análisis de las muestras se realizó conforme a métodos bioquímicos ampliamente aceptados. Resultados. Las concentraciones de SOD y MDA en el líquido seminal como en los espermatozoides fueron similares (SOD 0.43 ± 0.09 en semen y 0.45 ± .07 U/mg prot. en espermatozoides, y MDA 0.33 ± .07 y 0.37 ± 0.10 nmoles/mg prot. en líquido seminal y espermatozoides, respectivamente. Con respecto a la GPx, está aumentada casi 13 veces más en los espermatozoides (2547.77 ± 48.59 U/mg prot.) que en el líquido seminal (197.54 ± 25.21 U/mg prot.), el NOx también se incrementa ligeramente en los espermatozoides (4.45 ± 0.43 µmol) cuando se compara con el líquido seminal (3.91 ± 0.16 µmol). Conclusiones. La medición de los antioxidantes y oxidantes pudieran servir para evaluar la infertilidad humana en aquellos casos donde los resultados de la espermatobioscopia aparezcan como normales. Abstract in english Background. Reactive oxygen species (ROS) formation have the ability to alter reversibly or irreversibly the cellular function in humans. It has been proposed that the ROS alters the biochemistry and the physiology of the sperm. On the other hand, the antioxidative mechanisms could protect the sperm [...] s from the damage produced by free radicals. Aim. To determine the normal values for superoxide dismutase (SOD), glutathione peroxidase (GPx), malondialdehyde (MDA) and nitric oxide (NOx) in the seminal liquid of healthy humans. Procedures. Semen samples from 45 healthy men (22 to 47 years of age) were studied. The samples were obtained by masturbation and were collected in conical sterile tubes. Once centrifuged at 4 °C they were divided in aliquots to measure the concentration of SOD, GPx, MDA, and NOx. The analysis of the samples was realized in conformity with biochemical widely accepted methods. Results. The concentrations of SOD and MDA both in the seminal liquid and in the spermatozoids were similar, SOD 0.43 ± 0.09 U/mg prot. in the seminal liquid and 0.45 ± 0.07 U/ mg prot. in spermatozoids, and MDA 0.33 ± 0.07 nmoles/mg prot. and 0.37 ± 0.10 nmoles/mg prot. in the seminal liquid and spermatozoids respectively. With regard to GPx it increased almost 13 times more in the spermatozoids (2547.77 ± 48.59 U/mg prot.) than in the seminal liquid (197.54 ± 25.21 U/mg prot.). The NOx also increased lightly in the spermatozoids (4.45 ± 0.43 \\imol) when compared with the seminal liquid (3.91 ± 0.16 \\imol). Conclusions. The measurement of the antioxidative and oxidative agents could serve to evaluate human infertility in those cases where the result of the spematobioscopy appears normal.

  20. Functional characterisation of semen in honeybee queen (A.m.ligustica S. spermatheca and efficiency of the diluted semen technique in instrumental insemination

    Directory of Open Access Journals (Sweden)

    Andrea Galli


    Full Text Available Differences over time in the quality of semen present in the honey bee (Apis mellifera ligustica queen spermatheca werestudied. An increase in the non-vital spermatozoa was shown to be evident (P>0.05 between the 12th and 24th month.The study of semen viability demonstrated that the passage of the semen to the spermatheca is due to sperm motility.In the queen inseminated with non-viable spermatozoa, no semen was detected in the spermatheca. Queens inseminatedtwice with a Hyes solution/semen mixture (1:1 stored as many spermatozoa in their spermatheca as those inseminatedonce with the classic technique. Queen replacement, oviposition and other functional characteristics were similarto those observed in the classic insemination procedure.

  1. Clinical and biochemical correlates of successful semen collection for cryopreservation from 12-18-year-old patients: a single-center study of 86 adolescents

    DEFF Research Database (Denmark)

    Hagenäs, Isabella; JØrgensen, Niels


    Cryopreservation of semen should be offered to adults before gonadotoxic treatment. However, the experience with semen collection in adolescents is still limited. The objective of this study was to evaluate potential correlates of successful semen sampling in adolescents.

  2. Semen Characteristics of Three Strains of Local Cocks in the Humid Tropical Environment of Nigeria

    Directory of Open Access Journals (Sweden)

    F.O. Ajayi


    Full Text Available The study was conducted to determine the semen characteristics of three genotypes of Nigerian indigenous cocks. Thirty Six (36 local breeding cocks comprising of 12 frizzle, 12 normal and 12 naked neck selected randomly from the poultry breeding unit of the University of Port Harcourt Teaching and Research farm was used for this study. Semen were collected from them by abdominal massage and analyzed for semen characteristics. Semen concentration were significantly higher in naked- neck 4.86×109 ±0.03/mL (p0.05 of strains on semen pH, abnormal sperm and non-motile sperm. Morphological defects of the head, middle and tail was not significantly affected (p>0.05 by the genotypes. Variations on semen characteristics abound in the three Nigerian indigenous cocks sampled.

  3. Efecto de dos dilutores sobre la motilidad e integridad de la membrana espermática en semen congelado de ovinos / Effects of two semen extenders on motility and integrity of sperm membrane in ovine frozen semen

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V; Javier, Orellana Ch; César, Pantoja A.


    Full Text Available El presente estudio tuvo como objetivo evaluar el efecto de dos dilutores, Tris- Fructosa-Yema de huevo (Tris) y Citrato-Glucosa-Yema de huevo (citrato), sobre la motilidad espermática e integridad de la membrana espermática (HOST) en semen congelado de ovinos bajo la forma de pellets. La investigac [...] ión se llevó a cabo en el Banco de Semen de la Universidad Nacional Agraria La Molina, Lima, empleándose 4 carneros (2 Blackbelly y 2 Assaf) de 3.5 a 4 años de edad. Se empleó el análisis de covariancia para analizar Motilidad Individual Progresiva (MIP), y bloques completamente randomizados para medir el efecto de los dilutores sobre la integridad de la membrana espermática. Para el congelamiento del semen se utilizó hielo seco y el descongelamiento se realizó a 38 ºC en tubos de ensayo. En ovinos Assaf, la MIP del semen descongelado fue de 63.77 y 61.11% utilizando Tris y citrato, respectivamente, encontrándose diferencias significativas (p Abstract in english The objective of the study was to evaluate the effects of two semen extenders: Tris- Fructose-egg yolk (Tris) and Citrate-Glucose-egg yolk (citrate) on motility and sperm membrane integrity (HOST) in ovine frozen semen in pellets. The study was carried out at the Semen Bank of the Agrarian Universit [...] y La Molina, in Lima, Peru, using 4 rams (2 Assaf and 2 Blackbelly) of 3.5 to 4 years old. A covariance analysis was used to evaluate the effect of the treatment and breed on Individual Progressive Motility (IPM), and randomized block design to evaluate the effect of extenders on sperm membrane integrity. Semen was frozen of dry ice and thawing was done in test tubes at 38 °C. In the Assaf breed, IPM of thawed semen was 63.77 and 61.11% when using Tris and citrate respectively, showing statistical difference (p

  4. A Review of the Phytochemistry and Pharmacological Activities of Raphani Semen


    Daniel Kam-Wah Mok; Shun-Wan Chan; Chi-On Chan; Yam-Fung Ng; Tung-Ting Sham; Ailsa Chui-Ying Yuen


    The dried ripe seed of Raphanus sativus L., commonly known as radish seed (or Raphani Semen), is used as traditional Chinese medicine (TCM) to treat constipation, chronic tracheitis, and hypertension. The major active compounds in Raphani Semen are alkaloids, glucosinolates, brassinosteroids, and flavonoids. Fatty acids are its main nutritional contents. Raphani Semen has been demonstrated to have beneficial effects on hypertension, obesity, diabetes mellitus, constipation, and cough. So far,...

  5. Semen quality and reproductive hormone levels in men from Southern Spain

    DEFF Research Database (Denmark)

    Fernandez, M F; Duran, I; Olea, N; Avivar, C; Vierula, M; Toppari, J; Skakkebaek, N E; Jørgensen, N


    In North European countries, a significant difference in semen quality among young men has been shown. Men from the western countries, Denmark, Germany and Norway, have lower semen quality than men from the eastern countries Finland, Estonia and Lithuania. Similarly, men in the western countries have a higher risk of testicular cancer. According to the testicular dysgenesis syndrome (TDS) concept that suggests a link between risk of impaired semen quality and increased risk of testicular cancer,...

  6. Influence of PGF2a on semen quality and libido in Holstein bulls


    MASOUMI, Reza; Towhidi, Armin; JAVAREMI, Ardsher N.; NABIZADEH, Habib; ZHANDI, Mehdi


    The aim of this study was to determine the effects of Cloprostenol (PGF2a analogue) on semen quality and libido in Holstein bulls. Ten low libido Iranian Holstein bulls were randomly allocated to 2 groups and received Cloprostenol (n = 5) or saline (n = 5) 30 min prior to the semen collection 2 days per week for 2 months. Reaction time was significantly decreased in the treatment group. Duration of ejaculation was significantly increased in the treatment group. Semen volume and sperm conc...

  7. Is prenatal exposure to tobacco smoking a cause of poor semen quality?

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia Høst; Thulstrup, Ane Marie; Storgaard, Lone; Toft, Gunnar; Olsen, Jørn; Bonde, Jens Peter


    A few studies indicate that exposure to maternal smoking during fetal life decreases semen quality in adult life, but the results are inconsistent and retrospectively collected smoking data were used in most studies. From a Danish pregnancy cohort established in 1984-1987, 347 of 5,109 sons were selected according to their exposure to tobacco smoke in fetal life. From February 2005 to January 2006, a semen sample from the 347 men was analyzed for conventional semen characteristics according to s...

  8. The in vitro effect of leptin on semen quality of water b uffalo ( Bubalus bubalis ) bulls


    Amir Khaki; Rooz Ali Batavani; Gholamreza Najafi


    The purpose of this study was to evaluate the probable effects of leptin addition indifferentlevels to the semen extender on sperm quality (motility and motility parameters,viability,sperm membrane integrity, and DNA damage). Semen specimens were evaluatedimmediately after leptin addition, equilibration time and after thawing the frozen semen.Fivehealthy buffalo bulls (5 ejaculates from each bull) were used.Each ejaculate was diluted at 37 ?Cwith tris-based extender containing 0 (control), 10...

  9. Selenium in Pig Nutrition and Reproduction: Boars and Semen Quality—A Review


    Surai, Peter F; Fisinin, Vladimir I.


    Selenium plays an important role in boar nutrition via participating in selenoprotein synthesis. It seems likely that selenoproteins are central for antioxidant system regulation in the body. Se-dependent enzyme glutathione peroxidase (GSH-Px) is the most studied selenoprotein in swine production. However, roles of other selenoproteins in boar semen production and maintenance of semen quality also need to be studied. Boar semen is characterised by a high proportion of easily oxidized long cha...

  10. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki): A preliminary study


    Khairiah, M.S.; I. Zawawi; H. Wahid; Hajarian, H.; Fahrul, F.J.; Hafiz, M.D.; Hafiz, M.M.; Z.F. Ann; M.I. Iswadi; O. A. Mazni


    The Malayan gaur (Bos gaurus hubbacki) or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN). The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM) and electroejaculation (EEJ) technique was applied in semen collection of the Malayan gaur. The semen w...

  11. A novel method for semen collection and artificial insemination in large parrots (Psittaciformes)


    Michael Lierz; Matthias Reinschmidt; Heiner Müller; Michael Wink; Daniel Neumann


    The paper described a novel technique for semen collection in large psittacines (patent pending), a procedure which was not routinely possible before. For the first time, a large set of semen samples is now available for analysis as well as for artificial insemination. Semen samples of more than 100 psittacine taxa were collected and analysed; data demonstrate large differences in the spermatological parameters between families, indicating an ecological relationship with breeding behaviour (p...

  12. Influence of Deficiency or Supplementary Selenium and a- Tochopherol (Vitamin E) In The Diet of Pubertal Male Zaraibi Goats on Fertility, Semen Quality and Testicular Traits

    International Nuclear Information System (INIS)

    Twenty pubertal male Zaraibi goats (bucks) were randomly divided into four equal groups; fed deficient Se or vit. E, adequate Se, adequate vit. E and adequate Se + vit. E diets for 3 months to study the influence of deficient or adequate selenium (Se) and vitamin E (vit. E) in the diet of pubertal male Zaraibi goats on fertility, semen quantity and quality and some testicular traits. The results showed that the best values of semen quantity (the ejaculate volume, sperm concentration and total sperm output per ejaculate) and semen quality (percentage of progressive motility, percentage of live sperm, number of motile sperm per ejaculate, percentage of dead, abnormal spermatozoa and acrosomal abnormality) were observed in bucks fed diet supplemented with adequate Se combined with adequate vit. E. The lowest values of semen quantity and semen quality were observed in bucks suffering from deficiency of Se and/or vit. E in their diets. Testosterone level in seminal plasma was significantly higher in bucks fed adequate Se and/or vit. E than those fed diet deficient in Se and vit. E. Testosterone level was significantly higher in bucks fed diet adequate in Se + vit. E than those fed diet adequate with Se or vit. E alone. Se and vit. E deficiency in the diets was accompanied by a significant decrease in testosterone, T4 and T3 levels in seminal plasma. Selenium or vit. E each one alone supplementation led to increases of these hormones. T4 and T3 levels were significantly higher in bucks fed adequate Se or adequate Se + vit. E than in bucks fed diet with adequate vitamin E alone. Adequate Se alone and adequate Se + vit. E diets were accompanied by significant increases in Se in seminal plasma. Adequate vit. E and adequate Se + vit. E diets were accompanied by significant increase in vit. E level in the seminal plasma. It is clear that there was synergism between Se and vit. E in the biological role of Se, since the level of Se in bucks fed diet containing adequate Se + vit. E was higher than the level of Se in group fed Se alone. The highest values of scrotal circumference and scrotum length were observed in bucks fed adequate Se + vit. E and the lowest testicular traits and fertility were observed in bucks fed diet deficient with Se and vit. E.

  13. Efecto de la adición de cafeína y lactato sobre la motilidad del semen equino diluido en leche descremada-glucosa / Effect of caffeine and lactate addition on the motility of equine semen diluted in skim-glucose milk

    Scientific Electronic Library Online (English)

    Oscar, R. Wilde; Adolfo C, de la Vega; Maria L., Cruz.


    Full Text Available En equinos la inseminación artificial se practica mayormente con semen refrigerado por las dificultades que plantea la criopreservación. Para mejorar las condiciones de conservación a 5ºC se debe considerar el deterioro espermático post-recolección, puesto que componentes del plasma seminal complica [...] n la supervivencia de los espermatozoides con procesos oxidativos. Algunos compuestos tienen propiedades antioxidantes y mejoran notablemente la motilidad y la supervivencia espermática. En esta experiencia se utilizó lactato de sodio (2mM) y cafeína (10 mM) incorporados al momento de la dilución del semen y a las 48 h de almacenaje a 5ºC, en un extender de base leche descremada-glucosa, con el propósito de estudiar los efectos de estos compuestos sobre los espermatozoides. Incorporados al momento de la dilución, el lactato y la cafeína indujeron movimientos más vigorosos que las muestras sin aditivos desde el inicio. Cuando se agregaron a las 48 h de almacenaje a 5ºC, ambos aditivos produjeron una notable recuperación en la motilidad (49% vs. 31%). Cuando estas mismas muestras fueron cultivadas a 37ºC, a los 30 minutos de incubación aquellas sin aditivos tuvieron escasas formas móviles (5%), frente a las adicionadas con lactato (29%) y cafeína (40%). A los 60 minutos las muestras sin aditivos casi no registraron movimiento, en tanto que las restantes mantuvieron porcentajes elevados. En los tres casos se encontraron diferencias estadísticas (P Abstract in english In equines, artificial insemination is practiced mostly with the use of refrigerated semen due to the difficulties that comes with the preservation of frozen semen. To improve the conservation conditions at 5ºC (refrigerated semen) it is necessary to consider the spermatic deterioration after the ga [...] thering, because components of the seminal plasma complicate the survival of the sperm with oxidative processes. Some components have antioxidant properties and improve notably the spermatic motility and survival. In this experience sodium lactate (2 mM) and caffeine (10 mM) were incorporated at the moment of the dilution of the semen, and at 48 h of conservation at 5ºC in a skim milk - glucose bases extender, with the purpose of studying their effects on the sperm. Incorporated at the moment of the dilution, the lactate and the caffeine induced more vigorous movements than the samples without additives. When they were added at 48 h of preservation at 5ºC, both additives produced a remarkable recovery in the motility (49% vs. 31%). When these same samples were cultivated at 37ºC, at 30 minutes of incubation those without additives had scarce mobile forms (5%), and different from those added with lactate (29%) and caffeine (40%). At 60 minutes, the samples without additives hardly registered movement while the rest maintained the former percentages. In the three cases, there were found statistical differences (P

  14. Semen collection and evaluation of captive coatis (Nasua nasua

    Directory of Open Access Journals (Sweden)

    R.C.R. Paz


    Full Text Available Semen samples (n=105 were collected through eletroejaculation from six adult male coatis (Nasua nasua between January 2007 and December 2008 at Universidade Federal de Mato Grosso Zoo, Cuiabá, Brazil. Mean values were: volume (mL; concentration (sperm/mL; total motility (%; progressive sperm motility (scale, 0-5; live spermatozoa (%; acrossome integrity (%; primary defects (%; and secondary defects (%. There was high correlation between total motility and live sperm; total motility and progressive sperm motility; total motility and acrossome integrity; live sperm and progressive motility; live sperm and acrossome integrity and volume and concentration. The method for semen collection was considered safe and efficient. It can be used for the evaluation of breeding potential of coati in captivity and for the establishment of new assisted reproductive technology (ART for threatened neotropical carnivores species.

  15. Induced lipid peroxidation in ram sperm: semen profile, DNA fragmentation and antioxidant status. (United States)

    Hamilton, Thais Rose Dos Santos; Castro, Letícia Signori de; Delgado, Juliana de Carvalho; de Assis, Patrícia Monken; Siqueira, Adriano Felipe Perez; Mendes, Camilla Mota; Goissis, Marcelo Demarchi; Muiño-Blanco, Teresa; Cebrián-Pérez, José Álvaro; Nichi, Marcílio; Visintin, José Antonio; D'Ávila Assumpção, Mayra Elena Ortiz


    Action of reactive oxygen species, protamination failures and apoptosis are considered the most important etiologies of sperm DNA fragmentation. This study evaluated the effects of induced lipid peroxidation susceptibility on native semen profile and identified the mechanisms involved in sperm DNA fragmentation and testicular antioxidant defense on Santa Ines ram sperm samples. Semen was collected from 12 adult rams (Ovis aries) performed weekly over a 9-week period. Sperm analysis (motility, mass motility, abnormalities, membrane and acrosome status, mitochondrial potential, DNA fragmentation, lipid peroxidation and intracellular free radicals production); protamine deficiency; PRM1, TNP1 and TNP2 gene expression; and determination of glutathione peroxidase (GPx), glutathione reductase, catalase (CAT) and superoxide dismutase activity and immunodetection in seminal plasma were performed. Samples were distributed into four groups according to the sperm susceptibility to lipid peroxidation after induction with ascorbate and ferrous sulfate (low, medium, high and very high). The results were analyzed by GLM test and post hoc least significant difference. We observed an increase in native GPx activity and CAT immunodetection in groups with high susceptibility to induced lipid peroxidation. We also found an increase in total sperm defects, acrosome and membrane damages in the group with the highest susceptibility to induced lipid peroxidation. Additionally, the low mitochondrial membrane potential, susceptible to chromatin fragmentation and the PRM1 mRNA were increased in the group showing higher susceptibility to lipid peroxidation. Ram sperm susceptibility to lipid peroxidation may compromise sperm quality and interfere with the oxidative homeostasis by oxidative stress, which may be the main cause of chromatin damage in ram sperm. PMID:26811546

  16. Effects of age, season and genetics on semen and sperm production in Apis mellifera drones


    Rhodes, John; Harden, Steven; Spooner-Hart, Robert; Anderson, Denis; Wheen, Gretchen


    Adult drone honey bees from 4 Australian breeding lines were reared under similar conditions and examined for semen and sperm production when 14, 21 and 35 days old, during spring, summer and autumn. Almost half (40.5%) of all drones examined did not release any semen when manually everted. For those that released semen, the average volume released per drone was 1.09 ?L (range 0.72 (±0.04)?1.12 (±0.04) ?L) and the average number of sperms in the semen per drone was 3.63 × 106 (range 1.88 (±0....

  17. Role of Semen on Vaginal HIV-1 Transmission and Maraviroc Protection. (United States)

    Council, Olivia D; Swanson, Michael D; Spagnuolo, Rae Ann; Wahl, Angela; Garcia, J Victor


    We used bone marrow/liver/thymus (BLT) humanized mice to establish the effect of semen on vaginal HIV infection and on the efficacy of topically applied maraviroc. Our results demonstrate that vaginal transmission of cell-free HIV occurs efficiently in the presence of semen and that topically applied maraviroc efficiently prevents HIV transmission in the presence of semen. We also show that semen has no significant effect on the transmission of transmitted/founder viruses or cell-associated viruses. PMID:26392489

  18. Effect of L-carnitine supplementation on drake semen quality

    Scientific Electronic Library Online (English)

    H.J., Al-Daraji; A.O., Tahir.


    Full Text Available This study was conducted to determine the effect on semen quality traits of supplementing the diets of Iraqi drakes with L-carnitine. Forty eight male Iraqi ducks, 30 weeks old, were randomly allocated to four treatments with 12 drakes per treatment group, replicated three times, with four drakes pe [...] r replicate. The treatment groups consisted of birds fed a diet free of L-carnitine (T1, control group); birds fed a diet containing 50 mg L-carnitine/kg diet (T2); birds fed a diet containing 100 mg L-carnitine/kg diet (T3); and birds fed a diet containing 150 mg L-carnitine/kg diet. The drakes were fed the experimental diets only during the experimental period, which lasted three months. The semen quality traits that were investigated were ejaculate volume, mass and individual motility of spermatozoa, spermatocrit, spermatozoa concentration, percentages of dead and abnormal spermatozoa and acrosomal abnormalities. Supplementing the diet of drakes with L-carnitine at the levels of 50 - 150 mg/kg diet significantly increased ejaculate volume, spermatocrit, mass and individual motility of spermatozoa, and concentration of spermatozoa, while percentages of dead and abnormal spermatozoa and acrosomal abnormalities were decreased. However, T4 (150 mg L-carnitine/kg diet) recorded the best results in relation to all semen quality traits included in this study. Dietary supplementation with L-carnitine improved the semen quality of local drakes; therefore L-carnitine can be used as an efficient feed additive to improve the reproductive performance of male ducks.

  19. Semen quality and sex hormones with reference to metal welding

    DEFF Research Database (Denmark)

    HjØllund, Niels Henrik Ingvar; Bonde, J P


    Welding may involve hazards to the male reproductive system, but previous studies of semen quality have produced inconsistent results. We studied the effects of welding on markers of semen quality in a Danish nationwide sample of 430 first-time pregnancy planners without earlier reproductive experience. Couples were recruited among members of the union of metal workers and three other trade unions and were followed from termination of birth control until pregnancy for a maximum of six menstrual cycles. The males provided semen samples in each cycle. Median sperm density for welders was 56 x 10(6)/mL (52.5 x 10(6)/mL and 50.0 x 10(6)/mL in two reference groups). No statistically significant differences attributable to welding were found in proportions of morphologically normal sperm, sperm motility assessed by computer-aided sperm analysis, or sex hormones (testosterone, follicle-stimulating hormone, and luteinizing hormone). These negative findings may not apply to populations with high-level exposure to welding fume or to welders exposed to other putative hazards, e.g., heat.

  20. Glyph-Based Video Visualization for Semen Analysis. (United States)

    Duffy, Brian; Thiyagalingam, Jeyarajan; Walton, Simon; Smith, David J; Trefethen, Anne; Kirkman-Brown, Jackson C; Gaffney, Eamonn A; Min Chen


    The existing efforts in computer assisted semen analysis have been focused on high speed imaging and automated image analysis of sperm motility. This results in a large amount of data, and it is extremely challenging for both clinical scientists and researchers to interpret, compare and correlate the multidimensional and time-varying measurements captured from video data. In this work, we use glyphs to encode a collection of numerical measurements taken at a regular interval and to summarize spatio-temporal motion characteristics using static visual representations. The design of the glyphs addresses the needs for (a) encoding some 20 variables using separable visual channels, (b) supporting scientific observation of the interrelationships between different measurements and comparison between different sperm cells and their flagella, and (c) facilitating the learning of the encoding scheme by making use of appropriate visual abstractions and metaphors. As a case study, we focus this work on video visualization for computer-aided semen analysis, which has a broad impact on both biological sciences and medical healthcare. We demonstrate that glyph-based visualization can serve as a means of external memorization of video data as well as an overview of a large set of spatiotemporal measurements. It enables domain scientists to make scientific observation in a cost-effective manner by reducing the burden of viewing videos repeatedly, while providing them with a new visual representation for conveying semen statistics. PMID:26357260

  1. Glyph-Based Video Visualization for Semen Analysis

    KAUST Repository

    Duffy, Brian


    © 2013 IEEE. The existing efforts in computer assisted semen analysis have been focused on high speed imaging and automated image analysis of sperm motility. This results in a large amount of data, and it is extremely challenging for both clinical scientists and researchers to interpret, compare and correlate the multidimensional and time-varying measurements captured from video data. In this work, we use glyphs to encode a collection of numerical measurements taken at a regular interval and to summarize spatio-temporal motion characteristics using static visual representations. The design of the glyphs addresses the needs for (a) encoding some 20 variables using separable visual channels, (b) supporting scientific observation of the interrelationships between different measurements and comparison between different sperm cells and their flagella, and (c) facilitating the learning of the encoding scheme by making use of appropriate visual abstractions and metaphors. As a case study, we focus this work on video visualization for computer-aided semen analysis, which has a broad impact on both biological sciences and medical healthcare. We demonstrate that glyph-based visualization can serve as a means of external memorization of video data as well as an overview of a large set of spatiotemporal measurements. It enables domain scientists to make scientific observation in a cost-effective manner by reducing the burden of viewing videos repeatedly, while providing them with a new visual representation for conveying semen statistics.

  2. Biochemical properties of microbial load in frozen semen of cattle

    Directory of Open Access Journals (Sweden)

    Hemaxi V Patel


    Full Text Available A total 20 French mini straws (0.25ml of frozen semen were randomly collected from one of frozen semen bank for evaluation of microbial load using the standard plate count (SPC method using nutrient agar plate. These plates were incubated at 37oC for 24 and 48 hrs and examined for growth. The average colony count was calculated and bacteria were also identified as Gram positive and Gram negative. A total of 10 biochemical tests were performed to characterize the isolates. Antibiotic sensitivity test was also performed to test the sensitivity against Ampicillin, Erythromycin, Gentamycin, Spectinomycin and Tetracycline. The results indicate that 5 samples out of 20 were found positive for various bacterial isolates and fungi. Both the Gram positive and Gram negative bacteria were found in these samples. One isolate from sample No. CB-594 (white colony was found positive for all 9 biochemical tests. All the bacterial isolates exhibited variable pattern against 5 antibiotics used in the study. The article describes detailed investigation of microbial load in frozen semen of cattle bulls.

  3. Prospective surveillance of semen quality in the workplace

    Energy Technology Data Exchange (ETDEWEB)

    Schenker, M.B.; Samuels, S.J.; Perkins, C.; Lewis, E.L.; Katz, D.F.; Overstreet, J.W.


    We performed a prospective surveillance of semen quality among workers in the plant where 1,2-dibromo-3-chloropropane was first recognized as an occupational cause of impaired semen quality and of infertility. All male employees of the Agricultural Chemical Division were required to participate. Ninety-seven workers (92% participation) provided 258 semen samples over the 4 years of the program. Most samples were analyzed at the plant with a mini-laboratory designed for the study. Motility and shape measures were made objectively. Sixty-six subjects (68%) were non-azoospermic. Generalized multiple regression showed no significant predictors for any response, with the exception of the motility measures, which were reduced with longer times between ejaculation and assay. Between- and within-person standard deviations and correlations were calculated. Comparison of this population with fertile artificial insemination donors (16 men, 498 ejaculates) revealed generally higher ejaculate-to-ejaculate standard deviations in the worker samples. This is probably due to less well controlled conditions of sperm collection in the workplace setting. For cross-sectional studies, one ejaculate per worker is recommended as sufficient; for estimating an individual worker's mean, even three ejaculates may not provide enough precision.

  4. Decreases in Human Semen Quality with Age Among Healthy Men

    Energy Technology Data Exchange (ETDEWEB)

    Eskenazi, B.; Wyrobek, A.J.; Kidd, S.A.; Moore, L.; Young, S.S.; Moore, D.


    The objective of this report is to characterize the associations between age and semen quality among healthy active men after controlling for identified covariates. Ninety-seven healthy, nonsmoking men between 22 and 80 years without known fertility problems who worked for or retired from a large research laboratory. There was a gradual decrease in all semen parameters from 22-80 years of age. After adjusting for covariates, volume decreased 0.03 ml per year (p = 0.001); sperm concentration decreased 2.5% per year (p = 0.005); total count decreased 3.6% per year of age (p < 0.001); motility decreased 0.7% per year (P < 0.001); progressive motility decreased 3.1% per year (p < 0.001); and total progressively motile sperm decreased 4.8% per year (p < 0.001). In a group of healthy active men, semen volume, sperm concentration, total sperm count, and sperm motility decrease continuously between 22-80 years of age, with no evidence of a threshold.


    Directory of Open Access Journals (Sweden)

    S. Hasan, S. M. H. Andrabi, R. Muneer, M. Anzar and N. Ahmad


    Full Text Available In this study the effects of a new antibiotic combination, i.e., gentamycin, tylosin and linco-spectin (STLS on post-thaw motion characteristics, plasma membrane integrity, sperm morphology and the total aerobic bacterial counts (TABC in buffalo and Sahiwal bull semen were investigated. Ten ejaculates, five each from a buffalo and a Sahiwal bull, possessing more than 60% sperm motility were used. These ejaculates were diluted in Tris-citric acid (TCA extender (at 37 °C; 50 X 106 spermatozoa/mi, containing either GTLS (gentamycin 500 ?g/ml, tylosin 100 ?g/ml and linco-spectin 300/600 ?g/ml, streptomycin 1000 ?g/ml and penicillin 1000 IU/ml (SP, or negative control with no antibiotics (NCON. Samples were cooled to 4°C in 2 hours, equilibrated at 4°C for 4 hours, filled in 0.5 ml straws, frozen in a controlled rate cell freezer and plunged into liquid nitrogen. Frozen semen was thawed at 37°C for 15 seconds. Post-thaw sperm motion characteristics, plasma membrane integrity and sperm morphology were determined. Total aerobic bacterial counts and the frequency of appearance of bacterial genera were determined in neat semen, after dilution, and after freezing and thawing. Mean motilities (visual; computer-assisted, linear and circular, velocities (straight-line, average path and curvilinear and lateral head displacement (LHD in post- thaw semen samples did not differ due to antibiotics or species. Same was true for sperm plasma membrane integrity. Morphologically abnormal spermatozoa were lower (P<0.05 in GTLS and SP than in NCON. Sperm cells possessing normal acrosomes were higher (P<0.01 in GTLS and SP than in NCON. Total aerobic bacterial counts in post-thaw samples were lower (P<0.05 in GTLS than in SP or NCON. Staphylococcus and micrococcus were lower in samples treated with GTLS than that of SP or NCON. Pseudomonas and E.coli were more frequent in buffaloes than Sahiwal bull samples. Proteus and corynebacteria were scarcely present. In conclusion, GTLS was not determintal to post thaw motion characteristics, sperm morphology and membrane integrity of buffalo and Sahiwal bull spermatozoa. Furthermore, it efficiently reduced the number of aerobic micro-organisms in buffalo and Sahiwal bull semen.

  6. Persistence of DNA from laundered semen stains: Implications for child sex trafficking cases. (United States)

    Brayley-Morris, Helen; Sorrell, Amber; Revoir, Andrew P; Meakin, Georgina E; Court, Denise Syndercombe; Morgan, Ruth M


    In sexual assault cases, particularly those involving internal child sex trafficking (ICST), victims often hide their semen-stained clothing. This can result in a lag time of several months before the items are laundered and subsequently seized during a criminal investigation. Although it has been demonstrated previously that DNA can be recovered from clothing washed immediately after semen deposition, laundered items of clothing are not routinely examined in ICST cases, due to the assumption that the time delay and washing would result in no detectable DNA. The aim of this study was to examine whether viable DNA profiles could be recovered from laundered semen stains where there has been a significant lag time between semen deposition from one or more individuals and one or more washes of the stained clothing. Items of UK school uniform (T-shirts, trousers, tights) were stained with fresh semen (either from a single donor or a 1:1 mixture from two donors) and stored in a wardrobe for eight months. Stained and unstained items (socks) were then washed at 30 °C or 60 °C and with non-biological or biological detergent. DNA samples extracted from the semen-stained sites and from the unstained socks were quantified and profiled. High quantities of DNA, (6-18 ?g) matching the DNA profiles of the semen donors, were recovered from all semen-stained clothing that had been laundered once, irrespective of wash conditions. This quantity,and profile quality,did not decline significantly with multiple washes. The two donor semen samples yielded ? 10-fold more DNA from the T-shirts than from the trousers. This disparity resulted in the T-shirts yielding a ? 1:1 mixture of DNA from the two donors, whereas the trousers yielded a major DNA profile matching only that of the second donor. The quantities of DNA recovered from the unstained socks were an order of magnitude lower, with most of the DNA being attributable to the donor of the semen on the stained clothing within the same wash, demonstrating the transfer of semen-derived DNA among items of clothing in the washing machine. This study demonstrates that complete DNA profiles can be obtained from laundered semen stains on school uniform-type clothing, with an eight-month lag time between semen deposition and laundering, despite multiple washes and stains from two semen donors. These data emphasise the need to recover and examine the clothing of victims for semen and DNA evidence, even if the clothing has been stored for several months or washed multiple times since the sexual offence took place. PMID:26232275

  7. Semen Quality of Holstein and Buffalo Bulls after Filtration using Sephadex Column

    International Nuclear Information System (INIS)

    To evaluate the effect of sephadex column filtration technique on semen quality of five Holstein bulls and five Egyptian buffalo bulls. Semen was collected biweekly from each eight weeks. Immediately after collection, semen was extended (37degree C) and filtered using sephadex column-filtration technique. Semen was evaluated for physical semen characteristics including, percentages of sperm motility, live sperm and sperm abnormality as well as sperm cell concentration pre-and post-filtration. Results show that among all physical semen characteristics, only ejaculate semen volume was significantly (P<0.001) higher in Holstein than buffalo bulls, but motility, livability, abnormality, sperm concentration and sperm with intact acrosome did not differ between both species. As a result of filtration, sperm motility and livability increased (P<0.05) by 16.4 and 11.8% in Holstein and by 16.9 and 10.1% in buffalo semen, respectively. Sperm abnormality and concentration reduced (P<0.05) by 2.6 and 3.3% in Holstein and by 2.4 and 3.5% in buffalo semen, respectively. Improvements of live sperm and the reduction in sperm concentration (proportional to the pre-filtration value) were better (P<0.05) in Holstein than buffalo semen (15.5% and %52.4 vs. 13.2 and -49.3%, respectively). Improvement of motility and abnormality did not differ in Holstein (25.4 and %57.8) and buffalo semen (26.6 and ,(%54.5respectively. The present results indicate that using sephadex column filter technique has beneficial effects on improving quality of spermatozoa in both species. (author)

  8. Effect of species, breed, and age on bacterial load in bovine and bubaline semen

    Directory of Open Access Journals (Sweden)

    Chandrahas Sannat


    Full Text Available Aim: The present study was conducted to investigate the effect of species, breed and age on bacterial load in fresh and frozen semen of Cattle and Buffalo bull. Materials and Methods: Present study covered 56 cow and 10 buffalo bulls stationed at Central Semen Station Anjora, Durg (Chhattisgarh. Impact of breeds on bacterial load in semen was assessed using six breeds of cattle viz. Sahiwal, Gir, Red Sindhi, Tharparkar, Jersey and Holstein Friesian (HF cross. Cow bulls were categorized into four different groups based on their age ( 6 years to study variation among age groups. Bacterial load was measured in fresh and frozen semen samples from these bulls using the standard plate count (SPC method and count was expressed as colony forming unit (CFU per ml of semen. Results: Higher bacterial load was reported in fresh (2.36 × 104 ± 1943 CFU/ml and frozen (1.00 × 10 ± 90 CFU/ml semen of cow bulls as compared to buffalo bulls (1.95 × 104 ± 2882 and 7.75 × 102 ± 160 CFU/ml in fresh and frozen semen, respectively. Jersey bull showed significantly higher bacterial count (p < 0.05 both in fresh (4.07 × 104 ± 13927 CFU/ ml and frozen (1.92 × 103 ± 178 CFU/ml semen followed by HF cross, Sahiwal, Gir, Red Sindhi and Tharparkar bull. Bulls aged < 4 years and more than 6 years yielded increased bacterial load in their semen. Although a minor variation was reported between species and among age groups, no significant differences were measured. Conclusion: Bacterial load in semen did not differ significantly between species and age groups; however significant variation was reported among different breeds. Bulls of Jersey breed showed significantly higher bacterial load in semen as compared to the crossbred and indigenous bull.

  9. Flora bacteriana del semen de toro antes y después de la congelación (Bacterial flora of bull semen before and after freezing process

    Directory of Open Access Journals (Sweden)

    Enrique A. Silveira Prado


    Full Text Available Se investigó por bacteriología general el semen fresco y después de la congelación de 50 toros de inseminación artificial y se efectuó el conteo total de unidades formadoras de colonias (UFC. A l5 de los toros se les realizó el examen bacteriológico de sus lavados prepuciales. En todas las muestras de semen fresco se obtuvo crecimiento bacteriano y los gérmenes más frecuentemente aislados fueron: Escherichia coli (50,0%, Staphylococcus aureus (36,0% y Staphylococcus coagulasa negativa (28,0%. En el semen congelado solamente se obtuvo crecimiento en el 20,0%. El 74,0% del semen fresco alcanzó conteos ? 1 x 104 UFC/mL antes de ser procesado; después de la congelación el 80,0% fue estéril. En el total de lavados prepuciales se obtuvo crecimiento y se detectó en mayor proporción el Staphylococcus coagulasa negativa (60,0%, microorganismo también aislado en el semen fresco de estos toros. Se concluyó que la adición de antibióticos al menstruo y posterior congelación en pastillas, disminuye notablemente la carga microbiana presente en el semen. It was investigated through general bacteriology both fresh semen and after the freezing process, carried out in 50 bulls of artificial insemination, total counting of colony forming units (CFU was made. A bacteriological analysis of the prepucial washing was made on 15 of these bulls. In all samples of fresh semen there was bacterial growing. The most frequently germs were: Escherichia coli (50,0%, Staphylococcus aureus (36,0% and coagulase negative Staphylococcus (28,0%. In samples of frozen semen growth was only obtained in the 20,0%. The 74,0% of samples of fresh semen reached counts ? 1 x 104 CFU/mL before being processed; after freezing 80,0% of the samples were sterile. In all prepucial washings it was obtained growth and mostly detected coagulase negative Staphylococcus (60.0%, was also isolated in the fresh semen of these bulls. We concluded that the addition of antibiotics to the menses and later freezing in pills, diminishes the load microbial present notably in the semen

  10. Survey of carnitine content of human semen using a semiquantitative auxanographic method: decreased semen total carnitine concentration in patients with azoospermia or severe oligozoospermia. (United States)

    Soffer, Y; Shalev, D P; Weissenberg, R; Orenstein, H; Nebel, L; Lewin, L M


    A microbiological method, using the carnitine-requiring yeast, Torulopsis bovina ATCC 26014, was developed to identify samples of human semen which contained low levels (less than 250 micron M) of total carnitine. Of 399 semen samples from a male infertility clinic which were tested, 30 (7.5%) were low in carnitine. Of these, 14 were azoospermic and 16 were severely oligozoospermic. Some azoospermic samples (19 = 58%) and severely oligozoospermic samples (51 = 79%) did not give evidence of low carnitine concentrations. These results indicate that decreased total carnitine concentration in semen occurs in certain classes of azoospermic and severely oligozoospermic patients. PMID:7198393

  11. Comparison of Holstein service-sire fertility for heifer and cow breedings with conventional and sexed semen. (United States)

    Sire conception rate (SCR), a service-sire fertility evaluation implemented in August 2008, is based on up to 7 conventional-semen breedings for parities 1 through 5 (Ccow). The same procedure was used to derive SCR for other types of breedings: sexed semen for cows (Scow) and conventional semen and...

  12. Effect of sexed-semen use on Holstein conception rate, calf sex, dystocia, and stillbirth in the United States (United States)

    Most artificial-insemination organizations in the United States now market sex-sorted semen. For 10.8 million US Holstein breedings with conventional semen since January 2006 and 122,705 sexed-semen breedings, data were available from all breedings for conception rate, 12 and 9% of breedings for cal...

  13. Detection of human papillomavirus DNA in semen from patients with intrameatal penile warts.


    Green, J.; Monteiro, E; GIBSON, P


    Fifteen semen specimens from 10 men with intrameatal penile warts attending a genitourinary clinic were tested by Southern blot hybridisation for the presence of human papillomavirus (HPV) DNA. Five specimens were positive for HPV types 6/11. This observation may have implications for screening of semen used for artificial insemination by donor.

  14. 19 Beef cattle pregnancy rates following insemination with aged frozen angus semen (United States)

    Artificial insemination has proven to be a valuable asset to the cattle industry. It is assumed that once good quality semen is frozen in liquid nitrogen it should remain viable indefinitely; however, semen viability has not been systematically evaluated after being stored for several decades. In th...

  15. Effect of sexed semen on conception rate for Holsteins in the United States (United States)

    Effect of sexed-semen breedings on conception rate was investigated using US Holstein field data from January 2006 through October 2008. Sexed-semen breeding status was determined by a National Association of Animal Breeders’ 500-series marketing code or by individual breeding information in a cow o...

  16. Tiempo de latencia para semen colectado de Colossoma macropomum “Gamitana” en solución sacarosa

    Directory of Open Access Journals (Sweden)

    Ehrlich Llasaca-Calizaya


    Full Text Available El objetivo fue estimar el tiempo de latencia (almacenamiento, para el semen de Colossoma macropomum, “gamitana” en solución de 400 mM de Sacarosa. Se consideró aceptable los niveles de motilidad superiores al 40%, lo cual garantiza eficientes tasas de fertilización. Para el desarrollo del experimento se colectó 2 lotes de semen inmótiles de gamitana (inducidos con Conceptal®, los cuales posteriormente fueron activados con agua destilada. El primer lote estuvo constituido por semen en sacarosa 400 mM, puro, a temperatura ambiente y refrigerado (4°C. La motilidad fue evaluada, cada hora, hasta la 7ma hora post colecta. El segundo lote con un semen en sacarosa 400mM a temperatura refrigerada y evaluada cada 12 horas. Los resultados del primer lote de semen demuestran que a partir de la 7ma hora hacia delante los índices de motilidad caen significativamente por debajo del 40%. Los resultados del segundo lote demuestran la viabilidad de utilizar solución de sacarosa, como medio de conservación, para mantener semen refrigerado por 2 días y activarlos con agua destilada. El proceso de extraer y colocar repetidas veces la misma muestra en refrigeración, limita el tiempo de viabilidad de semen con sacarosa en 8 horas aproximadamente. La utilización de sacarosa como medio para almacenar semen inmotil viable de gamitana, ayuda a conservar los espermatozoides por tiempos relativamente cortos.

  17. Research on contents of anthraquinones in Cassiae Semen by principal component analysis. (United States)

    Cao, Li-juan; Miao, Jing; Liu, Jie-xiu; Gao, Wen-yuan; Li, Xia


    Cassiae Semen is a common traditional Chinese medicine, and contents of anthraquinones of Cassiae Semen different significantly from area to area. According to Chinese Pharmacopoeia (2010 edition), only contents of aurantio obtusin and chrysophanol were used to evaluate the quality of Cassiae Semen, another data could be added later. Ten batches of Cassiae Semen from different areas were determined, and total anthraquinones, total free anthraquinones and total combined anthraquinones contents were assessed by ultraviolet visible spectrophotometer, contents of aurantio obtusin, rhein, aloe emodin, emodin, chrysophanol and physcion were determined by HPLC. After that, principal components analysis was used to evaluate these data determined previous by dimension reduction analysis. At last, the result suggests that three main components were found out, it shows that content of aloe emodin could be used to evaluate the quality of Cassiae Semen as well as contents of aurantio obtusin and chrysophanol. And Cassiae Semen from Hebei province posseses higher quality than Cassiae Semen from other different areas. All these results can provide a good reference for quality evaluating of Cassiae Semen medicinal materials at a certain extent. PMID:26697683


    Short-term, liquid-phase storage trials were conducted in 2009 on Atlantic sturgeon semen obtained from captive males, held at the U.S. Fish and Wildlife Service, Northeast Fish Technology Center and wild males, collected ripe on the spawning grounds from the Hudson River. Semen samples collected, c...

  19. Application of a quantitative 1H-NMR method for the determination of amygdalin in Persicae semen, Armeniacae semen, and Mume fructus. (United States)

    Tanaka, Rie; Nitta, Akane; Nagatsu, Akito


    A quantitative (1)H-NMR method (qHNMR) was used to measure the amygdalin content of Persicae semen, Armeniacae semen, and Mume fructus, in each of which amygdalin constitutes a major component. The purity of amygdalin was calculated from the ratio of the intensity of the amygdalin H-2 signal at ? 6.50 ppm in pyridine-d 5 to that of the hexamethyldisilane (HMD) signal at 0 ppm. The HMD concentration was corrected by the International System of Units (SI) traceability with certified reference material (CRM)-grade bisphenol A. qHNMR revealed the amygdalin contents to be 2.72 and 3.13% in 2 lots of Persicae semen, 3.62 and 5.19% in 2 lots of Armeniacae semen, and 0.23% in Mume fructus. Thus, we demonstrated the utility of this method for the quantitative analysis of crude drugs. PMID:23744252

  20. Obtención de cachorros mediante inseminación artificial con semen canino refrigerado.: Primera descripción en Chile Puppies obtained using artificial insemination with chilled extended semen.: First report in Chile




    Empleando una pareja de perros Siberian Husky, se describe, por primera vez en Chile, una inseminación artificial empleando semen canino refrigerado. El semen fue obtenido por manipulación digital y diluido con leche semidescremada UHT con antibióticos en relación 1:4 y refrigerado a 5ºC. Se practicaron 3 inseminaciones a partir del tercer día del estro, el cual fue determinado mediante exámenes de citología vaginal, considerándose inicio del estro cuando las células superficiales consti...

  1. Freezing African Elephant Semen as a New Population Management Tool (United States)

    Hermes, Robert; Saragusty, Joseph; Göritz, Frank; Bartels, Paul; Potier, Romain; Baker, Barbara; Streich, W. Jürgen; Hildebrandt, Thomas B.


    Background The captive elephant population is not self-sustaining and with a limited number of breeding bulls, its genetic diversity is in decline. One way to overcome this is to import young and healthy animals from the wild. We introduce here a more sustainable alternative method - importation of semen from wild bulls without removing them from their natural habitat. Due to the logistics involved, the only practical option would be to transport cryopreserved sperm. Despite some early reports on African elephant semen cryopreservation, the utility of this new population management tool has not been evaluated. Methodology/Principal Findings Semen was collected by electroejaculation from 14 wild African savanna elephant (Loxodonta africana) bulls and cryopreserved using the directional freezing technique. Sperm treatments evaluated included the need for centrifugation, the use of hen or quail yolk, the concentration of glycerol (3%, 5% or 7%) in the extender, and maintenance of motility over time after thawing. Our results suggest that dilution in an extender containing hen yolk and 7% glycerol after centrifugation best preserved post-thaw sperm motility when compared to all other treatments (P?0.012 for all). Using this approach we were able to achieve after thawing (mean ± SD) 54.6±3.9% motility, 85.3±2.4% acrosome integrity, and 86.8±4.6% normal morphology with no decrease in motility over 1 h incubation at 37°C. Sperm cryopreserved during this study has already lead to a pregnancy of a captive female elephant following artificial insemination. Conclusions/Significance With working techniques for artificial insemination and sperm cryopreservation of both African and Asian elephants in hand, population managers can now enrich captive or isolated wild elephant populations without removing valuable individuals from their natural habitat. PMID:23483917


    Scientific Electronic Library Online (English)

    Próspero, Cabrera V; César, Pantoja A.

    Full Text Available Se evaluó el deterioro de la membrana espermática e integridad del acrosoma como método para predecir la fertilidad en toros. Se trabajó con cuatro toros (2 Hosltein y 2 Brown Swiss) del Banco Nacional de Semen, Lima-Perú. Se evaluó integridad acrosomal, integridad de membrana espermática, motilidad [...] , espermatozoides vivos, volumen y concentración durante los procesos de refrigeración, congelación y descongelación de 10 eyaculados por animal. En semen fresco sin diluir se encontró un volumen de 4.33 ml, concentración espermática de 922.5 x 106/ml, y 78.5% de espermatozoides vivos. La motilidad individual progresiva en semen diluido fue de 82.7 a 86.0% con diferencia significativa entre toros (p Abstract in english The deterioration of the sperm membrane and acrosome integrity as a method for predicting fertility in bulls was evaluated. Four bulls (2 Holstein and 2 Brown Swiss) from the National Bank of Semen, Lima-Peru were used. Acrosome integrity, sperm membrane integrity, motility, live sperm cells, volume [...] , and sperm concentration during cooling, freezing and thawing was evaluated in 10 ejaculates per sire. In fresh semen, volume was 4.33 ml; sperm concentration was 922.5 x 106/ml and 78.5% of live cells. The individual progressive motility in diluted semen was 82.7 to 86.0% with significant difference between bulls (p

  3. Análisis de diluyentes comerciales de semen porcino refrigerado durante 4 días: resultados preliminares / Analysis of commercial extenders for porcine semen refrigerated for 4 days: preliminary results

    Scientific Electronic Library Online (English)

    P., Torres; M.L., Fischman; M., Acerbo; C., García; M., Míguez; J., Domínguez; H., Cisale.


    Full Text Available La utilización de semen enfriado en inseminación artificial (IA) porcina sigue siendo una limitante, ya que la respuesta frente a temperaturas menores a 16 ºC es aleatoria entre cerdos, y aún entre eyaculados del mismo cerdo. El objetivo del presente trabajo fue jerarquizar la capacidad para la cons [...] ervación de dosis refrigeradas durante 4 días de tres diluyentes comerciales (de larga o media duración) de semen porcino (Androstar Plus®, MRA® y MIII®), analizando: viabilidad, funcionalidad de membrana, integridad acrosomal y movilidad en 11 eyaculados procedentes de 3 verracos. No existieron diferencias (p>0,05) entre diluyentes por lo que sería similar su capacidad de conservación durante un período de 4 días. Abstract in english The use of cold preserved semen is still a limiting factor in artificial insemination, because of the random response of boar semen to temperatures below 16 ºC, even between ejaculates from the same male. The aim of this work was to analyze and rank three commercial (long and medium term) boar semen [...] extenders (Androstar Plus®, MRA® y MIII®), based on their capability to preserve refrigerated semen for four days analyzing: viability, membrane functionality acrosome integrity and motility. Eleven ejaculates were assessed. There were not differences (p>0.05) between extenders for any of the parameters studied, evidencing a similar preservation capability in a four-day period.

  4. A Study of a Method to Assess the Purity of Sorted Bovine Semen Using Rapid Single-Sperm Sexing PCR

    Directory of Open Access Journals (Sweden)

    Weihua Du


    Full Text Available Sort reanalysis using flow cytometry is the most common method for determining the purity of X or Y enriched semen. The high cost of this technique (including the required expensive, proprietary machine limits efforts to improve the technique and to promote develop applications for the sorted semen. In this study, the sperm sex (the presence of the X or Y chromosome was identified by both rapid PCR and flow cytometry reanalysis. The rapid PCR results showed that the percentages of X and Y sperm were 48 and 52% in unsorted semen, 92 and 8% in X-enriched semen and 17 and 83% in Y-enriched semen, respectively. Reanalysis of the DNA content of the sorted samples revealed that the X and Y sperm frequencies were 92 and 8% in X-enriched semen and 15 and 85% in Y-enriched semen, respectively. The sex ratio of unsorted semen analyzed by PCR did not significantly deviate from the expected ratio of 1:1 and there was no significant difference between the sex ratios of sorted semen samples determined by PCR and flow cytometry reanalysis. These results indicate that we have established an effective, reliable and rapid PCR method to verify the purity of sorted semen. This method should contribute greatly to the improvement of sperm sorting techniques and the development of applications for sorted semen.

  5. Effects of distilled Phaseoli Semen rubra Herbal-Acupuncture on lipid composition, liver function, antioxidant capacity and molecular biological aspects in obese rats induced high fat diet


    Ji, Jun Hwan; Lee Jun Mu


    Effects of Phaseoli Semen rubra Herbal-acupuncture at zusanli(ST-36), Quchi(LI-11) and Sanyinjiao(Sp-6) on lipid composition, liver function, oxidative capacity and molecular biological aspects were investigate in high fat diet induced obese rats. Forty male Sprague-Dawley rats weighing about 400g were divided into 4 groups according to body weight and raised four weeks with control, zusanli(ST-36), Quchi(LI-11) and Sanyinjiao(Sp-6) Herbal-acupuncture groups. 1. Plasma total cholesterol an...

  6. Laser researches on livestock semen and oocytes: A brief review

    Directory of Open Access Journals (Sweden)

    Z. Abdel-Salam


    Full Text Available This article presents a brief review of the past and present literature pertinent to laser effects on sperm motility parameters, improvement of oocyte maturation and characterization of semen in livestock. The aim was, on one hand, to make the readers aware of such knowledge and on the other hand to trigger the interest of the animal reproduction scientific community in attempting some laser techniques that have not yet been fully exploited in the field of artificial insemination. With respect to the conventional methods, laser is a more sensitive and less costly technology that can be used for improving artificial insemination and embryo production system. Since 1980s, laser treatment came on the biological samples scene; its applications have continuously been developed thereafter. Exploitation of laser light by various researchers for improving the reproductive efficiency of sperm cells and the maturation rate in different livestock is demonstrated herein. Laser irradiation, in principal, can increase the production of adenosine triphosphate (ATP and consequently increases the energy provided to the cell. Since sperm motility and oocyte maturation depend on the energy consumption, an increase in the energy supply to the cells will be of great importance. In addition, the authors also discuss the use of laser spectrochemical analytical techniques, such as laser induced breakdown spectroscopy (LIBS and laser induced fluorescence (LIF, in characterization of semen samples.

  7. Impact of chronic viral diseases on semen parameters. (United States)

    Lorusso, F; Palmisano, M; Chironna, M; Vacca, M; Masciandaro, P; Bassi, E; Selvaggi Luigi, L; Depalo, R


    The aim of this study was to assess the effect of human immunodeficiency virus (HIV), hepatitis C (HCV) and B (HBV) virus infection on semen parameters. Semen samples were obtained from 27 HCV, 34 HIV, 30 HBV and 41 HCV-HIV-seropositive patients and compared with those of a control population of healthy seronegative subjects. Tests for detection of HIV, HCV and HBV were performed on seminal samples. The sperm concentration was significantly decreased in HCV- and HBV-seropositive males compared to that of controls (P sperm motility (a + b) was significantly decreased in HCV- and HBV-seropositive (P sperm viability was significantly lower in HCV- and HBV-seropositive men than in controls (P sperm concentration after sperm wash was significantly higher in controls than in HCV-, HIV-, HBV- and HIV-HCV-seropositive men (P sperm quality compared with that of controls. The reason for the better sperm quality in our series of HIV- and HCV-HIV-infected men is still under debate. Further investigations in a larger case series are warranted. PMID:20384803

  8. Differential protein profile in sexed bovine semen: shotgun proteomics investigation. (United States)

    De Canio, Michele; Soggiu, Alessio; Piras, Cristian; Bonizzi, Luigi; Galli, Andrea; Urbani, Andrea; Roncada, Paola


    The preparation of sexed semen is based on the differential DNA content between the X and Y chromosome bearing sperm cells determined by fluorescence-activated cell sorting. In spite of its intrinsic limitations this represents the only effective method. However, the employment of sexed sperm for breeding food producing animals on a large scale requires additional knowledge in the protein repertoire for the development of improved methods to differentiate X and Y sperm cells maintaining high vitality. In order to address this issue, we performed a comparative shotgun proteomic investigation by nUPLC-MS/MS to characterize sexed bovine semen. The protein profiles of these two types of sperm cells have shown differential expression of proteins that may be directly associated with the main components of cytoskeletal structures of flagellum, as the axoneme, outer dense fibers and fibrous sheath, as well as glycolytic enzymes and calmodulin, involved in the energetic metabolism regulation. Overall these results may provide a base to a better comprehension of the biological features of sperm cells and may be useful to the development of alternative methods of separation. PMID:24226273

  9. Semen quality and heavy metal and pesticides toxicity

    Directory of Open Access Journals (Sweden)

    Lidia Mínguez-Alarcón


    Full Text Available Male reproductive function has deteriorated significantly in the past 50 years and this change could be related to an exposure to occupational and environmental pollutants and toxicants. The purpose of this paper is to summarize the negative impact of human exposure to heavy metals and pesticides on the male reproductive function. Most pesticides and heavy metals are considered reproductive toxicants and may adversely harm the male reproductive system due to their disrupting effect on the hypothalamus- pituitary gland-gonads axis or by directly affecting spermatogenesis, resulting in impaired semen quality. The negative effects of these compounds have been linked to the main sperm parameters (concentration, normal morphology and motility, semen volume and total sperm count and DNA sperm damage, as well as to changes in serum reproductive hormone levels. Some of these substances have already been banned, whereas others are still on the market. Stricter laws are needed to completely prevent exposure to these toxicants given their proven deleterious effect on male reproductive health.

  10. Evaluation of Semen Fertility of Bulls by Non-return Rate at 60 Days of Cows under Artificial Insemination Programme in Bangladesh

    Directory of Open Access Journals (Sweden)

    M.J.U. Sarder


    Full Text Available The present study were to evaluate the effect of individual bull, semen types, quality of bull semen, sources of semen on Non-return Rate (NRR at 60 days of cows under field condition. A total 75550 cows were inseminated with 71 bull semens from Central Cattle Breeding Station and Dairy Farm (CCBSDF, Savar, Dhaka, Rajshahi Dairy and Cattle Improvement Farm (RDCIF, Rajabarihat and District Artificial Insemination Centre (DAIC, Rajshahi under 40 Artificial Insemination (AI sub-centres/points of District AI centre, Rajshahi. The overall NRR was obtained 78.54% with chilled and frozen semen produced from three AI centres/stations. Analysis of variance showed that individual bull semen had significant (p<0.05 effect on NRR at 60 days after first insemination. Semen types, quality of bull semen and sources of semen had significant (p<0.001 effect on NRR at 60 days of cows. The significant (p<0.001 highest NRR (82.32% was with chilled semen and lowest was with frozen semen (76.39%. The significant (p<0.001 maximum NRR (83.12% was for the best quality bull semen and minimum (70.13% for the poor quality bull semen. Significant (p<0.001 higher NRR (82.32% was in semen from DAIC, Rajshahi and lower (73.01% in semen from RDCIF, Rajabarihat. Results suggested that the NRR of cows at 60 days after first insemination under field condition may be a good practice to discard poor fertility semen among the individual bull semen, semen types (chilled and frozen, quality of bull semen (poor, good and best and sources of semen (CCBSDF, Savar, RDCIF, Rajabarihat and DAIC, Rajshahi for artificial insemination programme in Bangladesh.

  11. Effect of contaminated preprocessed semen on fertilization rate and embryo quality in assisted reproductive techniques. (United States)

    Krissi, H; Orvieto, R; Ashkenazi, J; Gilboa, Y; Shalev, J; Moscovitch, I; Bar-Hava, I


    We aimed to identify the sources and prevalence of semen contamination from mastrubation and determine the effect of bacterospermia on fertilization rate and embryo quality in standard in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI). This was a prospective controlled study, in an IVF unit of a university teaching hospital, of 93 consecutive couples undergoing IVF-embryo transfer cycles. We evaluated handwashing; semen collection and processing; and assisted reproductive technology using semen provided by masturbation. The main outcome measures were presence and type of micro-organisms in the semen samples and embryo culture medium; the effect of hand washing on rate of contamination; and the effect of semen contamination on fertilization rate and embryo quality. The first consecutive 52 men of the 93 couples were not instructed to wash their hands before masturbation, and the remainder were so instructed. Forty-nine semen cultures (94.2%) in the first group were contaminated compared to only 16 (39%) in the second (p < 0.016); 27 of the 65 positive cultures (41.5%) were contaminated by more than one organism. The most common contaminators were bacteria usually found on the skin. All but four embryo medium cultures were negative. There was no significant difference in fertilization rate and embryo quality by culture findings in either the IVF or the ICSI procedures. We found that a high percentage of manually obtained semen for standard IVF or ICSI procedures was contaminated, but this had no effect on fertilization rate and embryo quality. PMID:15195496

  12. Comparative evaluation of Nabi and Beltsville extenders for cryopreservation of rooster semen. (United States)

    Nabi, Mohammad Mahdi; Kohram, Hamid; Zhandi, Mahdi; Mehrabani-Yeganeh, Hassan; Sharideh, Hossein; Zare-Shahaneh, Ahmad; Esmaili, Vahid


    Two experiments were conducted to evaluate the new rooster semen freezing extender which is containing a low level of glycerol and soybean lecithin as an alternative protective agent in the extender. The aim of the first experiment was to evaluate a new extender for freeze-thawing rooster semen known as "Nabi" extender compared to Beltsville. Second experiment was also performed to determine whether the Nabi extender has negative reactions on fertilization after artificial insemination (AI) or no. In the first experiment, post-thaw motion parameters, mitochondrial function and sperm apoptosis were analyzed using Sperm Class Analyzer (SCA), rhodamine-123 and Annexin-V, respectively for frozen-thawed semen in Nabi and Beltsville extender. Results showed that total motility, progressive motility, velocity parameters (VCL, VSL, VAP, LIN and STR) and live spermatozoa with active mitochondria were significantly higher in Nabi compare to Beltsville extender (P inseminated with thawed semen using the new freezing diluents or fresh semen for determination of fertility rate. Fertility rate with thawed semen (with Nabi extender) was lower compared to fresh semen (by approximately 8% points). It can be concluded that Nabi extender would improve post-thawed rooster sperm in vitro quality compared to Beltsville extender. The fertility rates of insemination in hens with freeze-thaw sperm were comparable with fresh sperm. PMID:26632488

  13. Detection of boar sperm plasma membrane protein using Rhodamine 640; implications for cryobiology and physiology (United States)

    Rhodamine 640 (R640) was used to detect changes in boar sperm plasma membrane protein (PMP) during cryopreservation; a poorly understood phenomenon. The protocol was adapted for boar sperm so that semen samples (n = 17) could be analyzed for PMP (R640 positive) and plasma membrane integrity (PMI; Y...

  14. An Outbreak of Porcine Reproductive and Respiratory Syndrome Virus in Switzerland Following Import of Boar Semen. (United States)

    Nathues, C; Perler, L; Bruhn, S; Suter, D; Eichhorn, L; Hofmann, M; Nathues, H; Baechlein, C; Ritzmann, M; Palzer, A; Grossmann, K; Schüpbach-Regula, G; Thür, B


    An outbreak of porcine reproductive and respiratory syndrome virus (PRRSV) occurred in November 2012 in Switzerland (CH), traditionally PRRSV-free. It was detected after a German boar stud informed a semen importer about the detection of PRRSV during routine monitoring. Tracing of semen deliveries revealed 26 Swiss sow herds that had used semen from this stud after its last negative routine monitoring and 62 further contact herds. All herds were put under movement restrictions and examined serologically and virologically. As a first measure, 59 sows from five herds that had previously been inseminated with suspicious semen were slaughtered and tested immediately. Investigations in the stud resulted in 8 positive boars with recent semen deliveries to CH (Seven with antibodies and virus, one with antibodies only). In one boar out of six tested, virus was detected in semen. Of the 59 slaughtered sows, five from three herds were virus-positive. In one herd, the virus had spread, and all pigs were slaughtered or non-marketable animals euthanized. In the remaining herds, no further infections were detected. After confirmatory testings in all herds 3 weeks after the first examination gave negative results, restrictions were lifted in January 2013, and Switzerland regained its PRRSV-free status. The events demonstrate that import of semen from non-PRRS-free countries - even from negative studs - poses a risk, because monitoring protocols in boar studs are often insufficient to timely detect an infection, and infections of sows/herds occur even with low numbers of semen doses. The outbreak was eradicated successfully mainly due to the high disease awareness of the importer and because immediate actions were taken before clinical or laboratory diagnosis of a single case in the country was made. To minimize the risk of an introduction of PRRSV in the future, stricter import guidelines for boar semen have been implemented. PMID:25209832

  15. The reference values for semen parameters of 1213 fertile men in Guangdong Province in China

    Directory of Open Access Journals (Sweden)

    Yun-Ge Tang


    Full Text Available Semen samples were collected from 1213 fertile men whose partners had a time-to-pregnancy (TTP ?12 months in Guangdong Province in Southern China, and semen parameters including semen volume, sperm concentration, total counts, motility, and morphology were evaluated according to the World Health Organization (WHO 2010 guideline. All semen parameters analyzed were normal in ~62.2% of the total samples, whereas ~37.8% showed at least one of the semen parameters below normal threshold values. The fifth centiles (with 95% confidence intervals were 1.3 (1.2-1.5 ml for semen volume, 20 × 10 6 (18×10 6 -20×10 6 ml?1 for sperm concentration, 40 × 10 6 (38×10 6 -44×10 6 per ejaculate for total sperm counts, 48% (47%-53% for vitality, 39% (36%-43% for total motility, 25% (23%-27% for sperm progressive motility, 5.0% (4%-5% for normal morphology. The pH values ranged from 7.2 to 8.0 with the mean ± standard deviation at 7.32 ± 0.17. No effects of age and body mass index were found on semen parameters. Occupation, smoking and alcohol abuse, varicocele appeared to decrease semen quality. Sperm concentration, but not sperm morphology, is positively correlated with TTP, whereas vitality is negatively correlated with TTP. Our study provides the latest reference values for the semen parameters of Chinese fertile men in Guangdong Province, which are close to those described in the new WHO guidelines (5 th Edition.

  16. Evaluación de dimetilacetamida como crioprotector para la crioconservación de semen de bocachico Prochilodus magdalenae

    Directory of Open Access Journals (Sweden)

    VJ Atencio


    Full Text Available Se evaluó dimetilacetamida (DMA como crioprotector, a tres concentraciones: 8% (0,85 M, 10% (1,07 M y 12% (1,29 M combinado con glucosa 6% (0.33 M y yema de huevo 12% para crioconservar semen de bocachico Prochilodus magdalenae. El semen fue diluido en proporción 1:4 en la solución crioprotectora, empacado en pajuelas de 2,5 mL y congelado en vapores de nitrógeno líquido (N2L durante 30 minutos y luego almacenados en un termo de N2L de 34 L. La concentración, movilidad total, progresividad y velocidad tanto en semen fresco (control como en semen crioconservado-descongelado se evaluó con ayuda de Sperm Class Analyzer (SCA. Las pajuelas fueron descongeladas en baño serológico a 60°C durante 45 segundos. La fertilidad y eclosión fueron evaluadas inseminando dos gramos de huevos (1540 huevos/g a razón de 320.000 spz/ovocito. El semen fresco registró mayores valores de movilidad total, progresividad total, velocidad curvilínea y velocidad lineal con respecto al semen crioconservado-descongelado (P 0,05. DMA 12% reportó los menores valores de todas las variables que evaluaron la calidad seminal. Con semen fresco se obtuvo fertilidad de 74,0 ± 5,3% y eclosión de 62,3 ± 3,1%; mientras que con semen crioconservado-descongelado con DMA 8% se obtuvo adecuada fertilidad (60,4 ± 8,4% y eclosión (50,1 ± 9,8%. Los resultados del estudio sugieren que la solución crioprotectora compuesta por DMA 8%, glucosa 6% y yema de huevo 12% es una alternativa viable para la crioconservación de semen de bocachico.

  17. The reference values for semen parameters of 1213 fertile men in Guangdong Province in China. (United States)

    Tang, Yun-Ge; Tang, Li-Xin; Wang, Qi-Ling; Song, Ge; Jiang, Yan-Jia; Deng, Shun-Mei; Jiang, Fang; Qin, Wei-Bing


    Semen samples were collected from 1213 fertile men whose partners had a time-to-pregnancy (TTP) ?12 months in Guangdong Province in Southern China, and semen parameters including semen volume, sperm concentration, total counts, motility, and morphology were evaluated according to the World Health Organization (WHO) 2010 guideline. All semen parameters analyzed were normal in ~62.2% of the total samples, whereas ~37.8% showed at least one of the semen parameters below normal threshold values. The fifth centiles (with 95% confidence intervals) were 1.3 (1.2-1.5) ml for semen volume, 20 × 10 6 (18×10 6 -20×10 6 ) ml-1 for sperm concentration, 40 × 10 6 (38×10 6 -44×10 6 ) per ejaculate for total sperm counts, 48% (47%-53%) for vitality, 39% (36%-43%) for total motility, 25% (23%-27%) for sperm progressive motility, 5.0% (4%-5%) for normal morphology. The pH values ranged from 7.2 to 8.0 with the mean ± standard deviation at 7.32 ± 0.17. No effects of age and body mass index were found on semen parameters. Occupation, smoking and alcohol abuse, varicocele appeared to decrease semen quality. Sperm concentration, but not sperm morphology, is positively correlated with TTP, whereas vitality is negatively correlated with TTP. Our study provides the latest reference values for the semen parameters of Chinese fertile men in Guangdong Province, which are close to those described in the new WHO guidelines (5 th Edition). PMID:25432502

  18. Effect of the Type of Straw on the Spermatic Quality in the Freezing of Boar Semen

    Directory of Open Access Journals (Sweden)

    C.A. C?rdova-Jim?nez


    Full Text Available With the freezing boar semen, could have better options for the optimization of the reproductive handling in the swinish species as well as an alternative for the development of this cattle activity; using technologies like the implementation of banks of frozen of races with characteristic zootechnic of economic importance that guarantee the readiness of germinal material in the moment that is required, to have germinal material of males proven genetically, still when the animal no longer exists, to overcome certain intentional restrictions of transport of alive animals, for the problem of transmission of illnesses and, to overcome the restrictive of time of viability of the diluted fresh semen. In this work was examined the effect of the freezing boar semen in straws plastic of 0.5 and 5 mL on the Motility and the Acrosome Integrity (NAR. For it, 9 were used ejaculated of different animals, the experiment was carried out comparing fresh semen with thawing semen coming from straws of 0.5 and 5 mL. The results of percentages of motility and NAR for fresh and thawing semen, were of 86.19, 47.14 and 47.14, for straws of 0.5 mL and 75.62, 48.19 and 46.81, for straws of 5 mL. When carrying out the analysis of the variance and the test of multiple comparisons it was found that the freezing of the semen in both straws types, the percentages of motility and NAR reduce, with regard to the fresh semen; however, the macrotubes or straws of 5 mL, represent a good option in the artificial insemination using boar semen frozen-thawing.

  19. Effect of preputial washing on bacterial load and preservability of semen in Murrah buffalo bulls

    Directory of Open Access Journals (Sweden)

    G. S. Meena


    Full Text Available Aim: To study the effect of preputial washing on bacterial load, preservability and semen quality in Murrah buffalo bulls Materials and Methods: A total of 36 collections of three Murrah buffalo bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal, were collected at weekly intervals from each bull without preputial washing and latter ejaculates from same bull with preputial washing by infusing normal saline (0.85%, KMnO4 (0.02% and savlon (2.0% to first, second and third bull, respectively. The microbial load and semen quality were evaluated during different hours of storage at refrigerated temperature (0, 24 and 48 h and after thrawing of cryopreserved (at ?196°C semen. Results: The results of preservation of semen at refrigerated temperature showed that bacterial load was markedly lower in ejaculates of bulls subjected to preputial washing. Semen preserved at refrigerator temperature and cryopreserved, the effect of washing solution was significant for individual motility (IM, non-eosiniphilic count, hypo-osmotic swelling reactivity (HOST, total plate count (TPC and acrosome integrity. KMnO4 was found to be the best in lowering bacterial load, sperm abnormalities and in improving semen quality such as motility, non-eosinophilic count, HOST and acrosome integrity even up to 48 h of preservation and cryopreserved semen. Effect of duration of preservation and stage of cryopreservation was also significant for IM, non-eosiniphilic count, HOST, sperm abnormalities and acrosome integrity. Conclusion: Overall the results suggested that preputial washing with KMnO4 solution improved the semen quality and reduced microbial load of Murrah buffalo bull’s semen preserved at refrigerated temperature and cryopreservation.

  20. Improvement of the Shami goat semen quality by adding bovine serum albumin

    Directory of Open Access Journals (Sweden)

    O.I. Azawi


    Full Text Available The present study was aimed to improve the quality of Shami goat semen diluted with Tris diluent by adding bovine serum albumin. In the current study, six male goats were used. Semen was collected using artificial vagina of one ejaculate per week of every male included in this study. This study was performed during the breeding season from 1 \\ 10 \\ 2012 to 1 \\ 12 \\ 2012. In this study, two semen diluents were use first; Tris- fructose- egg yolk 2.5% and second Tris - fructose - 2.5% egg yolk with 1% of bovine serum albumin. Diluted semen samples were cooled gradually and stored at 5 ° C. Cooled diluted semen samples were examined every 24 h of storage to 144 h. These tests includes the proportion of live sperm and the percentage of secondary abnormalities of the sperm, the percentage of sperm acrosomal defects and percentage of progressive motility using a computer-aided sperm analysis. These results showed that the addition of bovine serum albumin with egg yolk to semen of male goats led to improved qualities of semen significantly (P<0.05 including the proportion of live sperm and the percentage of secondary abnormalities of the sperm, the percentage of sperm acrosomal defects and percentage of progressive motility. It could be concluded from the results of the current study, the possibility of storing goat semen for more than six days with alive sperm of more than 50% and the percentage of the progressive motility of more than 40% when adding bovine albumin serum to dilute goat semen at 1% level and this result has not reached by any previous study.

  1. Genetic gain in dairy cattle populations is increased using sexed semen in commercial herds

    DEFF Research Database (Denmark)

    SØrensen, Morten Kargo; Andersen, Jakob Voergaard


    Using stochastic simulation, the effect of using sexed semen to cow dams (CD) in a dairy cattle breeding scheme, with or without use of multiple ovulation and embryo transfer (MOET) to bull dams (BD), on annual genetic gain at the population level was examined. Three levels of sexed semen were combined with three levels of MOET: no sexed semen, sexed semen to the best CD and sexed semen to all heifers, combined with no MOET, MOET on all BD and MOET randomly on 20% of the BD. In total, nine scenarios were compared. The simulated population was monitored for 30 years and included 450 herds with 100 cows each. Each year 50 young bulls (YB), 10 active sires and 215 BD were selected on best linear unbiased prediction estimated breeding values by truncation selection across the simulated population, and the YB were tested within the population. Use of sexed semen alone gave a positive increase in the annual genetic gain of 2.1% when used on the best CD and 2.7% when used on all heifers, but only the latter was statistically significant. The increased annual genetic gain was caused by a larger contribution from the CD to the BD. Use of sexed semen together with MOET on BD increased the annual genetic gain by 1.8–2.5% compared with schemes without sexed semen and MOET on all BD. Performing MOET on all BD enables selection of offspring with high Mendelian deviations, which increase the annual genetic gain. Use of sexed semen decreased the genetic lag between the sires and the CD by 12–14% when used on the best CD and by 6% when used to all heifers. The decrease in the genetic lag is caused by the increased selection intensity of the cow dams

  2. Dose-dependent effects of tamsulosin on the ejaculation and semen quality in bucks




    The objective of this study was to investigate the effect of tamsulosin (TAM) dosages on ejaculation and semen quality. Two sets of Latin square experiment design were applied to 6 bucks receiving normal saline (CON), TAM 134.8 nM/kg (LTAM), or 269.7 (HTAM) nM/kg at 1-week intervals. Semen collection, libido, and ejaculatory scoring were undertaken at 3, 6, 9, 12, and 24 h after injection. Heart rate and body temperature were measured before administration and at 30 min, and before semen coll...

  3. Effect of extenders, postdilution intervals, and seasons on semen quality in dairy goats


    QURESHI, Muhammad Subhan; Khan, Daulat; MUSHTAQ, Anila; AFRIDI, Shoaib Sultan


    The breeding of female dairy goats with good quality sires has been a problem in rural areas and artificial insemination (AI) provides an answer to this issue. To develop an AI model, a total of 9 bucks were purchased from a local market. Semen was collected in an artificial vagina, the libido was noted, and the semen was evaluated for its physical characteristics. The libido, semen volume, mass motility, individual motility, and sperm concentration were 2.94 ± 0.25 (scale of 1-3), 0.79 ± 0.5...

  4. Motilidad y fertilidad del semen de carnero descongelado a dos diferentes ritmos de temperatura


    Rosa Bertha Angulo Mejorada; Antonio Ortiz Hern\\u00E1ndez; Jos\\u00E9 Manuel Berruecos Villalobos; Deborah Feldman Steel; Javier Valencia M\\u00E9ndez


    El objetivo del presente trabajo fue comparar el efecto de dos temperaturas y tiempos de descongelación sobre la motilidad y fertilidad del semen del ovino. Se utilizó un total de 208 ovejas y 13 carneros de diferentes razas. El semen se obtuvo por medio de una vagina artificial. Se evaluó, se diluyó con Tris -ácido cítrico-fructosa-glicerol-yema de huevo y se centrifugó a 200 g/15 min; el paquete celular se resuspendió con el mismo diluyente. El semen diluido se congeló en pajill...



    El-Seify; I. M.; Abd El-Razek; M.A.R.; Ibrahim ,; I S; El-Shamaa; M. E.; El-Sharawy; E.M.


    Semen from three Egyptian buffalo bulls was collected once weekly and ejaculates with more 75% progressive motility and more 85 % normal sperm morphology prior to cryopreservation were pooled in order to have sufficient semen for a replicate and to eliminate the bulls effect. Seven extenders were used: Tris 20 % egg yolk extender with 7 ml glycerol as a control (T1), and substitution of whole egg yolk with 4, 6, 8, 10, 12 and 15 % low density lipoprotein (LDL), T2 – T6, respectively. Semen wa...

  6. Caffeine intake and semen quality in a population of 2,554 young Danish men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Swan, Shanna H; Skakkebaek, Niels E; Rasmussen, Sanne; Jørgensen, Niels


    The authors examined the association between semen quality and caffeine intake among 2,554 young Danish men recruited when they were examined to determine their fitness for military service in 2001-2005. The men delivered a semen sample and answered a questionnaire including information about...... caffeine intake from various sources, from which total caffeine intake was calculated. Moderate caffeine and cola intakes (101-800 mg/day and semen quality. High cola (>14 0.5-L bottles...

  7. Semen quality in men with chronic kidney disease and its correlation with chronic kidney disease stages. (United States)

    Lehtihet, M; Hylander, B


    The aim of this study was to assess whether chronic kidney disease (CKD) has any impact on semen quality parameters in men with CKD stage 1-5. Results were collected from 66 men with different CKD stages (age 18-50 years). Age and BMI (body mass index) were recorded for each male. Higher CKD stage had a significant negative linear trend on semen volume (P BMI per se had no significant effect on semen volume, sperm number, sperm concentration, morphology, ?-glucosidase activity, fructose concentration or zinc level. A significant negative correlation between BMI and sexual-hormone-binding globulin (SHBG) (P BMI. PMID:25487067

  8. Karakterisasi Ball Mill Import pada Industri Semen di Indonesia

    Directory of Open Access Journals (Sweden)

    Ratna Kartikasari


    Full Text Available The purpose of this research is to investigate the characteristics of import Ball Mill which is used at cement mills in Indonesia. There were two kind of import Ball Mill from PT. Semen Gresik, Tbk that used in this research which are A type (Ø 30 mm and B type (Ø 40 mm. Visual investigation, chemistry composition, distribution of hardness, and microstructure photograph was conducted characterize these ball mill. Visually, the import Ball Mill has rough surface, white coloring when cut off, and small cracks at all specimens. Type A ball mill contains of 2,934% C, 11,231% Cr, and 0,177% Mo, where type B Ball Mill contains of 2,693% C, 12,31% Cr, and 1,103% Mo. Both are martensitic white cast iron ASTM A532 Class II type A. The surface are harder then the its core. The highest hardness on the surface are 720,82 kg/mm2 (type A and 746,5 kg/mm2 (type B, where as lowest hardness on the core are 631,1 kg/mm2 (type A and 544,0 kg/mm2 (type B. Microstructure investigation shows Perlit, Cementit, and Martensit. Abstract in Bahasa Indonesia : Penelitian ini bertujuan untuk mengetahui karakteristik Ball Mill import yang digunakan oleh pabrik semen di Indonesia. Bahan yang digunakan adalah ball mill import di PT. Semen Gresik, Tbk dari 2 merk berbeda, yaitu merk A (f 30 mm dan merk B (f 40 mm. Karakterisasi Ball Mill import dilakukan dengan pengamatan visual, uji komposisi kimia, uji distribusi kekerasan dan foto struktur mikro. Secara visual terlihat bahwa Ball Mill import memiliki permukaan kasar, hasil potongan berwarna keputihan dan terdapat retakan-retakan kecil pada semua specimen. Hasil uji komposisi kimia menunjukkan bahwa Ball Mill import f 30 mm mengandung 2,934% C, 11,231% Cr, dan 0,117% Mo sedangkan f 40 mm mengandung 2,693% C, 12,313% Cr dan 1,103 Mo, termasuk dalam kelompok Martensitic white cast iron ASTM A532 Class II Type A. Hasil uji distribusi kekerasan menunjukkan bagian permukaan lebih keras dibandingkan bagian pusat dengan nilai kekerasan tertinggi 720,82 kg/mm2 (f 30 mm dan 746,5 kg/mm2 (f 40 mm sedangkan nilai kekerasan terendah 631,1 kg/mm2 (f 30 mm dan 544,0 kg/mm2 (f 40 mm. Hasil pengamatan foto struktur mikro menunjukkan bahwa struktur terdiri dari Perlit, Cementit dan Martensit. Kata kunci: ASTM A532, bola penggiling, besi tuang putih martensitik.

  9. Evaluation of Physical Semen Characteristics of Male Rabbits Exposed to Different Climatic Conditions and Lighting Regimes Using Nuclear Techniques

    International Nuclear Information System (INIS)

    The number of 20 mature males New Zealand White (NZW) rabbits, in the first production year was used in the present research. The study included two periods; each was of 2 months. The first period was under mild conditions (18.0 degree C) while the second one was during hot conditions (35.0 degree C). In each period, 10 males with the same age and average live body weight were used. Animals within each period were divided randomly into two equal groups, with nearly equal body weights. One of the two groups exposed to natural day light (NDL) which was 10:50 L: 13:10 D in winter and 13:40 L: 10:20 D in summer and was considered as photo period control and the other group was exposed to photo period treatment (Artificial photo period, AP). The treatment group was exposed to artificial long photo period (13:40 L: 10:20 D) during winter and artificial short photo period (10:50 L: 13:10 D) during hot conditions. In seminal plasma, T4, T3 and testosterone hormonal levels were significantly lower in heat stressed rabbits than those reared under mild conditions. In contrast, the hot condition was accompanied by significant increases in cortisol level. T3 and cortisol affected significantly while T4 and testosterone levels were not affected significantly due to change in period of lighting. Concerning physical semen characteristics i.e. ejaculate volume, sperm motility, sperm cell concentration, total sperm output and number of motile sperms per ejaculate were significantly lower under heat stress than under mild conditions. In contrast, hot conditions were accompanied by a significant increase in each of reaction time, dead sperm %, sperm abnormalities % and acrosomal abnormalities %. Exposure of male rabbits during winter to long lighting as compared to NDL caused significant increase in T3 (1.4 vs. 1.3 ng/ml), testosterone (3.2 vs. 2.8 ng/ml) and cortisol (1.8 vs. 1.5 ng/ml) levels as well as significant decline in semen quality, i.e., ejaculate volume (70 vs. 60 x 10-2 ml), sperm motility (76.8 vs. 70.8%), total number sperm-cell output per ejaculate (287.00 vs. 240.00 x106 ) and number of motility sperm output per ejaculate (220.42 vs. 169.92 x106 ). Exposure of male rabbits during summer to short lighting as compared to NDL caused significant increase in T3 (1.10 vs.0.90 ng/ml) and cortisol (2.8 vs. 2.3 ng/ml) in seminal plasma as well as significant decrease in sperm motility (64.8 vs. 60.8%) and significant increase in reaction time (11.6 vs. 12.8 seconds), ejaculate volume (50 vs. 58 x 10-2 ml) and total number sperm-cell output per ejaculate (190.00 vs. 208.80 x 106 ). Finally, correlations between physical semen characteristics and seminal plasma hormonal levels were carried out to evaluate the rabbit bucks semen using nuclear technique

  10. Liquid storage of boar semen: Current and future perspectives on the use of cationic antimicrobial peptides to replace antibiotics in semen extenders. (United States)

    Schulze, M; Dathe, M; Waberski, D; Müller, K


    Antibiotics are of great importance in boar semen extenders to ensure long shelf life of spermatozoa and to reduce transmission of pathogens into the female tract. However, the use of antibiotics carries a risk of developing resistant bacterial strains in artificial insemination laboratories and their spread via artificial insemination. Development of multiresistant bacteria is a major concern if mixtures of antibiotics are used in semen extenders. Minimal contamination prevention techniques and surveillance of critical hygiene control points proved to be efficient in reducing bacterial load and preventing development of antibiotic resistance. Nevertheless, novel antimicrobial concepts are necessary for efficient bacterial control in extended boar semen with a minimum risk of evoking antibiotic resistance. Enhanced efforts have been made in recent years in the design and use of antimicrobial peptides (AMPs) as alternatives to conventional antibiotics. The male genital tract harbors a series of endogenic substances with antimicrobial activity and additional functions relevant to the fertilization process. However, exogenic AMPs often exert dose- and time-dependent toxic effects on mammalian spermatozoa. Therefore, it is important that potential newly designed AMPs have only minor impacts on eukaryotic cells. Recently, synthetic magainin derivatives and cyclic hexapeptides were tested for their application in boar semen preservation. Bacterial selectivity, proteolytic stability, thermodynamic resistance, and potential synergistic interaction with conventional antibiotics propel predominantly cyclic hexapeptides into highly promising, leading candidates for further development in semen preservation. The time scale for the development of resistant pathogens cannot be predicted at this moment. PMID:26264695

  11. A novel method for semen collection and artificial insemination in large parrots (Psittaciformes). (United States)

    Lierz, Michael; Reinschmidt, Matthias; Müller, Heiner; Wink, Michael; Neumann, Daniel


    The paper described a novel technique for semen collection in large psittacines (patent pending), a procedure which was not routinely possible before. For the first time, a large set of semen samples is now available for analysis as well as for artificial insemination. Semen samples of more than 100 psittacine taxa were collected and analysed; data demonstrate large differences in the spermatological parameters between families, indicating an ecological relationship with breeding behaviour (polygamous versus monogamous birds). Using semen samples for artificial insemination resulted in the production of offspring in various families, such as Macaws and Cockatoos, for the first time ever. The present technique represents a breakthrough in species conservation programs and will enable future research into the ecology and environmental factors influencing endangered species. PMID:23797622

  12. Cryopreservation of tambaqui (Colossoma macropomum) semen: extenders, cryoprotectants, dilution ratios and freezing methods. (United States)

    Carneiro, P C F; Azevedo, H C; Santos, J P; Maria, A N


    The tambaqui is an Amazonian fish of great economic and environmental importance to Brazil and other South American countries. Several semen cryopreservation methodologies have been tested for different Brazilian fish species; however, there is little information on the use of this technique on tambaqui semen. The aim of the present study was to investigate the effect of osmolarity and activation solutions on sperm kinetics and, glucose solutions, cryoprotectants, dilution ratios, egg yolk and freezing methods on tambaqui semen freezing. The osmolarity of 230 mOsm was suitable for simultaneously yielding higher sperm motility (85%) and motility time (54 sec.) and osmolarities above 360 mOsm maintain immobile tambaqui sperm. The tambaqui semen can be successfully cryopreserved when diluted 1:9 in freezing medium composed of 5 percent glucose solution (290 mOsm) with 10 percent methylglycol and 5 percent egg yolk, and frozen directly in a dry shipper container. PMID:23224371

  13. The Effect of Phyto-Lecithin on Preservation and Cryopreservation of Semen: A Review

    Directory of Open Access Journals (Sweden)

    AS Aku


    Full Text Available Artificial insemination represents one of technologies in livestock reproduction that can be applied to cattle, sheep, goats and other livestock. Application of livestock reproduction technology includes artificial insemination to increase reproductive efficiency. Semen processing is one critical phase in an artificial insemination program. The use of animal origin ingredient for semen extenders, such as egg yolk and milk, presents a risk of microbial contamination, which lead to the search for alternatives. To increase standard of quality, researchers exploits phyto-lesitin for semen extender and the results showed no significant differences in motility, viability, and acrosomal status of spermatozoa with phyto-lesitin extender when compared to tris-egg yolk-containing extenders. (Animal Production 9(1: 49-52 (2007 Key Words : Phyto-Lechitin, preservation, cryopreservation, semen

  14. Critical appraisal of conventional semen analysis in the context of varicocele. (United States)

    Kruger, Thinus


    Varicocele is present in approximately 15% of men, and, although it is the most commonly diagnosed cause of male infertility, nearly two-thirds of men with varicoceles remain fertile. It was decided to make use of the current evidence obtained from the previous meta-analyses between 2004 and 2015 as well as available articles covering this field, preferably randomized controlled articles dealing with the topic of semen analysis before and after repair. Two important meta-analyses were discussed as well as other articles dealing with the topic of semen analysis before and after varicocelectomy. The evidence suggests that all semen parameters improve after varicocele repair. Based on the available evidence, it is clear that there is a benefit in treating men with a palpable varicocele. One can expect that all semen parameters will improve within 3 months after repair. PMID:26620460

  15. Semen banking: consideration on viral contamination in the era of new emerging viral infection

    Directory of Open Access Journals (Sweden)

    Viroj Wiwanitkit


    Full Text Available To construct a semen bank, the collection of donated semen has to be done and an important concern is the safety of collected semen. The contamination is a big problem. Basically, the infectious pathogens can exist within donated semen, hence, a good donor screening is very important. Although viruses have an indirect role in sperm quality, but the evidence in banked semen is presently lack. This does not mean that there is no viral contamination but it might imply the inadequate concern on this issue. Contaminated semen usually means poor quality and hazardous to the recipient. The contamination of the virus in banked semen is a common problem in animal semen banking (1. The safety and transmission of each problematic virus is widely studied and well clarified in animal semen banking (2. However, this issue is not widely concerned in human semen banking. For sure, this case is an actual direct contamination and this cannot be detected if there is no specific screening in the banking process. The scenario of important new emerging viral infections will be specifically detailed in this report. West Nile virus is an emerging problematic viral infection that can cause a deadly clinical disorder. Basically, West Nile virus is classified as an arbovirus that is mainly transmitted by mosquito. However, the uncommon modes of transmissions such as transfusion related transmission are reported (3. The contamination of West Nile virus in semen is an important question in andrology. There is no evidence indicating for the presence of West Nile virus in the semen of the patients. However, American Society for Reproductive Medicine/Society for Assisted Reproductive Technology recommended that practitioners defer gamete donors who have confirmed or suspected West Nile virus infections (4. SARS is another deadly emerging viral infection. The new coronavirus infection is transmitted via respiratory route. The serious symptom due to this infection leads to death in almost all cases and brings a great concern to medical scientists around the world. The contamination of SARS in semen is an interesting topic. The possible transmission of SARS virus via germ line is an important question to be investigated in reproductive medicine (5. Luckily, till present, there is no evidence of SARS contamination in semen. Generally, influenza virus is a respiratory virus that causes respiratory tract infection. In the recent few years, an atypical influenza, avian flu, emerged. This infection brought a concern to the medical society. In early of this year, 2009, the newest emerging viral infection caused by a novel influenza virus, swine flu occurred and became pandemic. The topic on the new influenza virus becomes the present hot issue. Focusing on the contamination of classical influenza virus in semen, there are many evidences confirming the existence of virus in semen derived from the infected cases. It is also

  16. HPV Prophylactic Vaccination in Males Improves the Clearance of Semen Infection

    Directory of Open Access Journals (Sweden)

    Carlo Foresta


    Discussion: Humoral immunity has a major role in healing from HPV infection. Elder ART patients with HPV semen infection may benefit by the union of both specific counselling and available prophylactic vaccination.

  17. The importance of semen analysis in the context of azoospermia

    Scientific Electronic Library Online (English)

    Nabil, Aziz.

    Full Text Available Azoospermia is a descriptive term referring to ejaculates that lack spermatozoa without implying a specific underlying cause. The traditional definition of azoospermia is ambiguous, which has ramifications on the diagnostic criteria. This issue is further compounded by the apparent overlap between t [...] he definitions of oligospermia and azoospermia. The reliable diagnosis of the absence of spermatozoa in a semen sample is an important criterion not only for diagnosing male infertility but also for ascertaining the success of a vasectomy and for determining the efficacy of hormonal contraception. There appears to be different levels of rigor in diagnosing azoospermia in different clinical situations, which highlights the conflict between scientific research and clinical practice in defining azoospermia.


    Directory of Open Access Journals (Sweden)

    I.A. Zahid, L.A. Lodhi1, N. Ahmad1, Z.I. Qureshi1, N.U. Rehman1 and M.S. Akhtar2


    Full Text Available In the present study, the effects of gossypol on semen characteristics in Teddy male goats were studied. Nine Teddy male goats were randomly divided into three equal groups named A, B and C. Animals in all groups were fed concentrated ration without cottonseed cakes (CSC at the rate of 3% of their liveweight for a period of 30 days and it was named as pre-treatment period. Just after the completion of this period, animals in group A were fed control ration (without gossypol, those in group B were fed ration which contained unboiled CSC as a source of free and bound gossypol, while animals in group C were given ration containing CSC boiled at 100?C for 1 hour as a source of bound gossypol These experimental rations were fed to animals of respective groups at the rate of 3% of their liveweight for a period of 90 days and it was named as treatment period. Feeding of ration containing gossypol to Teddy male goats did not affect the colour, volume, mass activity, sperm concentration, percentage of dead spermatozoa, liveability and absolute index of liveability of spermatozoa at 37°C. However, it affected significantly (P<0.05 the pH, per cent motility of spermatozoa and percentage of morphologically abnormal spermatozoa. The Teddy male goats fed rations containing a combination of free and bound gossypol showed a significant (P<0.05 increase in the pH and a decrease in motility of spermatozoa which was statistically lower than those fed control diet or diet containing bound gossypol. It was concluded that rations containing a combination of free and bound gossypol (unboiled CSC or bound gossypol only (boiled CSC adversely affected the semen quality of Teddy male goats in terms of sperm motility and morphologically abnormal spermatozoa in ejaculates.

  19. Estandarización del manejo y la criopreservación de semen de hembras masculinizadas de trucha arco iris (Oncorhynchus mykiss) / Standardization of handling and freezing sperm from masculinized females of rainbow trout (Oncorhynchus mykiss) / Padronizar a gestão ea criopreservação de sêmen de fêmeas de truta arco-íris (Oncorhynchus mykiss) sob masculinização

    Scientific Electronic Library Online (English)

    James J, Betancur L; Andrés F, Montoya; Tatiana, Mira; Francy A, Rojas; Martha, Olivera Ángel.


    Full Text Available A procura de linhas monosexo fêmeas na produção de trutas tem aumentado significativamente nos últimos anos, de modo tecnologias foram desenvolvidas com a finalidade de padronizar este processo como o uso do esperma de genética feminina submetido a reversão sexual. O objectivo do presente inquérito [...] foi para uniformizar a maturação in vitro e criopreservação de sêmen masculinização de fêmeas (neomachos XX) trutas arco-íris (Oncorhynchus mykiss) como uma estratégia para produzir descendentes de 100% do sexo feminino dos jogadores colombianos. Para a obtenção do esperma neomachos foram mortas e sêmen foi recuperado submetida a maturação processo normal de plasma seminal plasma seminal masculina ou artificiais. Para a criopreservação de sêmen foi testado crioprotectores dimethylsulphoxide 10% e 10% de metanol. O experimento foi evaluron mobilidade pós maturação e pós descongelamento e fertilidade do sêmen. O processo de maturação teve um efeito significativo sobre a porcentagem de mobilidade (p Abstract in spanish La demanda de líneas monosexo hembras en la producción de trucha ha incrementado significativamente en los últimos años, por lo que se han desarrollado tecnologías para estandarizar este proceso como el uso de semen de hembras genéticas sometidas a reversión sexual. El objetivo de la presente invest [...] igación fue estandarizar la maduración in vitro y la criopreservación de semen de hembras masculinizadas (neomachos XX) de trucha arco iris (Oncorhynchus mykiss) como estrategia para producir descendencias 100% hembras de reproductores colombianos. Para la obtención del semen los neomachos fueron sacrificados y el semen recuperado fue sometido a proceso de maduración con plasma seminal de machos normales o plasma seminal artificial. Para la criopreservación del semen se probaron los crioprotectores dimetilsulfóxido 10% y metanol 10%. En el experimento se evaluron la movilidad post maduración y post descongelación y la fertilidad del semen. El proceso de maduración tuvo un efecto significativo sobre el porcentaje de movilidad (p Abstract in english The demand of monosex female stocks in production of trout has significantly increased during the past years, which has led to develop new technologies to standardize this process. The usage of semen of genetic females submitted to sexual reversion is a good choice. The objective of this research wa [...] s to develop a methodology to mature in vitro and cryopreserved semen of sex-reversed rainbow trout (Oncorhynchus mykiss) females as strategy to produce lineage 100% Colombian trout female. The semen was directly obtained from the gonads after its surgical extraction of the slaughtered individuals, later it was submitted to maturation process implementing seminal plasma of normal males and artificial plasma. The semen was cryopreserved in two extender dimetyhyl sulfoxide 10% and methanol 10%. Postmaturation, postcriopreservation movility and sperm fertility were evaluated. Maturation process had a significative effect on movility, the highest movility was obtained with artificial seminal plasma (55 ± 10.4 %). Highest post criopreservation movility (29.9 ± 13.3%) and highest fertility rates (26.33 ± 7.53 %) were obtained with dimetyhyl sulfoxide 10%.

  20. Estudio preliminar de colección de semen en oso de anteojos (Tremarctos ornatus)

    Scientific Electronic Library Online (English)

    Marco, Enciso H; Lizette, Bermúdez L.; Shirley, Evangelista V; Gianmarco, Rojas M.; Wilfredo, Huanca L..


    Full Text Available [...] Abstract in english Semen was collected in a Spectacled Bear (Tremarctos ornatus) reared in captivity using the electroejaculation technique. Four series of 6 volt discharges by 15 seconds each plus manual stimulation were carried out. An effective penis erection and small volume of ejaculate was obtained in the last s [...] eries of electrical stimulus. Seminal motility was 50%. Further studies are required to optimize the use of the electroejaculator in order to obtain higher volumes and better semen quality.

  1. Detection of human papillomavirus DNA by PCR in semen from patients with and without penile warts.


    Green, J.; Monteiro, E; Bolton, V N; Sanders, P.; Gibson, P. E.


    OBJECTIVES--To determine the prevalence of urethral HPV infection, as indicated by the presence of HPV DNA in semen, in males with and without penile warts. DESIGN--Prevalence study of HPV types 6/11 and 16 DNA using PCR and Southern blot hybridisation analysis of semen. SETTING--Department of Genitourinary Medicine, Blundell Street Clinic, Leeds General Infirmary and the Assisted Conception Unit (ACU) Kings' College, London. SUBJECTS--Patients attending the Genitourinary Clinic for treatment...

  2. Optimizing human semen cryopreservation by reducing test vial volume and repetitive test vial sampling

    DEFF Research Database (Denmark)

    S. Fuglesang Jensen, Christian; Ohl, Dana A; Parker, Walter R; da Rocha, Andre M; Keller, Laura M; Schuster, Timothy G; Sonksen, Jens; Smith, Gary D


    OBJECTIVE: To investigate optimal test vial (TV) volume, utility and reliability of TVs, intermediate temperature exposure (-88°C to -93°C) before cryostorage, cryostorage in nitrogen vapor (VN2) and liquid nitrogen (LN2), and long-term stability of VN2 cryostorage of human semen. DESIGN: Prospective clinical laboratory study. SETTING: University assisted reproductive technology (ART) laboratory. PATIENT(S): A total of 594 patients undergoing semen analysis and cryopreservation. INTERVENTION(S):...

  3. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men

    DEFF Research Database (Denmark)

    Mocevic, Emina; Specht, Ina; Marott, Jacob L; Giwercman, Aleksander; Jönsson, Bo Ag; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens


    Several animal studies indicate that mercury is a male reproductive toxicant, but human studies are few and contradictory. We examined semen characteristics and serum levels of reproductive hormones in relation to environmental exposure to mercury. Blood and semen samples were collected from 529 male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml(-1) in Gr...

  4. Cadmium, Chromium, and Copper Concentration plus Semen-Quality in Environmental Pollution Site, China.


    Yan Li; Qiaoyan Gao; Mingcai Li; Mengyang Li; Xueming Gao


    The environmental pollution is one of the factors contributing to the decrease of sperm quality for human beings. The aim of this study was to assess cadmium (Cd), chromium (Cr), and copper (Cu) concentration of man in environmental pollution site, and explore relationships between men exposure to Cd, Cr, and Cu and semen-quality parameters in environmental pollution site.Ninety five men were recruited through pollution area and controls in 2011. We measured semen quality using Computer-aided...

  5. Effects of Stripping Frequency on Semen Quality of Endangered Caspian Brown Trout, Salmo trutta caspius

    Directory of Open Access Journals (Sweden)

    Saeed Hajirezaee


    Full Text Available Problem statement: Because of dramatic declines in stocks of endangered Caspian brown trout males, Salmo trutta caspius in Caspian Sea, each male brooder is stripped indispensably more than once during the spawning season in other to artificial insemination in hatchery. The aim of the present study was to assay the changes of indicators of semen quality (sperm motility, sperm production, semen volume and chemical composition of seminal fluid during these sequential strippings. Approach: The 11 tagged males were stripped four times every 12-14 days with beginning of spermiation period (2 December 2008 towards its end (10 January 2008. One-way Analysis Of Variance (ANOVA was employed to analyze differences between means of semen parameters. Also, the relationships between semen parameters were tested using the bivariate correlation coefficients of Pearson. Results: The semen volume, sperm density, osmolality and the concentrations of Na+, Cl-, K+, Ca2+, Mg2+ and total protein gradually decreased whereas the values of glucose and triglyceride had no significant changes during sequential strippings. Also, the values of semen pH, the percentage (5s post-activation and duration of motility were statistically stable until third stripping but a decrease was recorded for these parameters in the fourth stripping. As well as, significant positive correlations were found for sperm density vs. K+, Cl-, Na+, Ca2+, Mg2+, total protein, spermatocrit; the percentage of motile spermatozoa Vs Ca2+, Mg2+, K+, Cl-, Na+, total protein and also the duration of motility Vs K+, Cl-, total protein and pH. Conclusion: The semen quality of Caspian brown trout males decrease in successive strippings during spawning season. Also, the knowledge on values and correlations between the sperm motility characteristics and the composition of seminal fluid could be useful to formulation of a species-specific extender solution for cryopreservation of semen of Caspian brown trout.

  6. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men

    DEFF Research Database (Denmark)

    Mocevic, Emina; Specht, Ina O; Marott, Jacob Louis; Giwercman, Aleksander; Jönsson, Bo Ag; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens


    Several animal studies indicate that mercury is a male reproductive toxicant, but human studies are few and contradictory. We examined semen characteristics and serum levels of reproductive hormones in relation to environmental exposure to mercury. Blood and semen samples were collected from 529 male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml(-1) in Gr...

  7. The Effect of Phyto-Lecithin on Preservation and Cryopreservation of Semen: A Review


    AS Aku; N Sandiah; PD Sadsoeitoeboen; Amin, R.; Herdis .


    Artificial insemination represents one of technologies in livestock reproduction that can be applied to cattle, sheep, goats and other livestock. Application of livestock reproduction technology includes artificial insemination to increase reproductive efficiency. Semen processing is one critical phase in an artificial insemination program. The use of animal origin ingredient for semen extenders, such as egg yolk and milk, presents a risk of microbial contamination, which lead to the search f...

  8. Efecto del estrés oxidativo sobre la calidad del semen de pacientes infértiles con leucocitospermia

    Directory of Open Access Journals (Sweden)

    William Quintero Pérez


    Full Text Available La leucocitospermia se ha asociado con alteraciones de la calidad del semen. No obstante no se han precisado con exactitud los mecanismos implicados en este daño. El propósito de este trabajo fue conocer si la leucocitospermia así como su contribución al estrés oxidativo generado en el aparato reproductor pueden afectar la calidad del semen. Para esto se estudió una muestra de 52 pacientes, hombres miembros de parejas infértiles que acudieron a la consulta de infertilidad del Instituto Nacional de Endocrinología, en los años 1998 y 1999. Se les realizó el análisis seminal según los procedimientos habituales y además la determinación de malonildialdehído, catalasa y superóxido dismutasa. La actividad superóxido dismutasa se correlacionó negativamente con el número de leucocitos, y positivamente con la movilidad b y la movilidad a + b. El trabajo realizado permitió concluir que los leucocitos en semen pueden afectar el balance entre los factores que favorecen y los que previenen el estrés oxidativo. La protección contra el estrés oxidativo es beneficiosa para la calidad del semenLeucocytospermia has been associated with alterations of the quality of semen. However, the mechanisms involved in this damage have not been exactly determined yet. This paper was aimed at knowing whether leucocytospermia and its contribution to the oxidative stress generated in the reproductive system may affect the quality of semen. To this end, a sample of 52 male patients members of infertile couples that were attended in the department of infertility of the National Institute of Endocrinology, in 1998 and 1999, was studied. The semen was analyzed according to the habitual procedures. Malondialdehyde, catalase and superoxide dismutase were also determined. The superoxide dismutase activity was negatively correlated to the number of leucocytes and positively to the mobility b and the mobility a+ b. It was concluded that leucocytes may affect the balance between the factors that favor and prevent the oxidative stress. The protection against the oxidative stress is beneficial for the quality of semen

  9. Semen quality and fertility after artificial insemination in dairy cattle and pigs


    Alm-Packalén, Karoliina


    The economic importance of a high breeding efficiency in sows and dairy cows emphasizes the benefit of accurate prediction of fertility of boar and bull semen. The artificial insemination (AI) studs need an objective and rapid, but inexpensive, method to evaluate ejaculates. We developed a new quick and easy fluorescence method for frozen-thawed bull semen that uses an automatized fluorometer and the fluorophore stain propidium iodide that stains only cells with damaged membranes. The fluores...

  10. Effects of Thawing on Frozen Semen Quality of Limousin and Brahman Bulls


    wc Pratiwi; L Affandhy; D Ratnawati


    The success of Artificial Insemination (AI )influenced by many factor, there are nutrition, body condition and post thawing motility (PTM). The PTM influenced by liquid N2 storage, equilibration temperature and handling straw. The purpose of this research to compare the effect of thawing duration to frozen semen quality of Limousin and Brahman. This research was done in BIBD, Agriculture Official of Blora, Central Java and Laboratory of Beef Cattle Station Research, Grati. As semen source is ...

  11. Duration of Ebola virus RNA persistence in semen of survivors: population-level estimates and projections. (United States)

    Eggo, Rosalind M; Watson, Conall H; Camacho, Anton; Kucharski, Adam J; Funk, Sebastian; Edmunds, W John


    Ebola virus can persist in semen after recovery, potentially for months, which may impact the duration of enhanced surveillance required after interruption of transmission. We combined recent data on viral RNA persistence with weekly disease incidence to estimate the current number of semen-positive men in affected West African countries. We find the number is low, and since few reported sexual transmission events have occurred, the future risk is also likely low, although sexual health promotion remains critical. PMID:26676163

  12. Semen quality and reproductive hormone levels in men from Southern Spain

    DEFF Research Database (Denmark)

    Fernandez, M F; Duran, I; Olea, N; Avivar, C; Vierula, M; Toppari, J; Skakkebaek, N E; Jørgensen, N


    testis cancer risk. We therefore investigated 273 men from the Almeria region in the Southern Spain to test this hypothesis. The men delivered semen samples, underwent physical examinations, had a blood sample drawn and provided information on lifestyle and reproductive health parameters. The...... men the Southern Spain, the results show that these have normal semen quality and reproductive hormone levels as expected in a population with a low incidence of testicular cancer....

  13. Criopreservação do sêmen ovino em meio diluente à base de água de coco em pó (ACP-102c) / Cryopreservation of ram semen in powdered coconut water (ACP-102c) based extender

    Scientific Electronic Library Online (English)

    José Maurício Maciel, Cavalcante; Oscar Oliveira, Brasil; Cristiane Clemente de Mello, Salgueiro; Carminda Sandra Brito, Salmito-Vanderley; José Ferreira, Nunes.


    Full Text Available O objetivo deste trabalho foi avaliar o diluente ACP-102c na criopreservação do sêmen ovino em comparação com o diluidor tris-glicose-gema (TRIS) e o sêmen fresco. Foram coletados 48 ejaculados de quatro ovinos, sendo tomadas duas alíquotas por ejaculado para diluição e criopreservação em ACP-102c o [...] u TRIS e uma terceira alíquota utilizada para análise do sêmen fresco. O sêmen fresco e o criopreservado em ambos os diluidores foram avaliados para viabilidade, integridade de membrana plasmática e acrossomal, teste hiposmótico, fragmentação do DNA e de motilidade espermática. Após descongelamento, ambos os diluidores não diferiram para viabilidade espermática, integridade de membrana plasmática e acrossomal, fragmentação de DNA e nas variáveis quantitativas e qualitativas de velocidade espermática, mas diferiram no teste hiposmótico, motilidade total e progressiva e amplitude lateral da cabeça, bem como em todas as variáveis de motilidade avaliadas, exceto linearidade e progressividade, após duas horas de incubação à 37 ºC. Houve variabilidade entre reprodutores na motilidade total e progressiva do sêmen criopreservado em ACP-102c após descongelamento. O diluidor ACP-102c conferiu menor proteção aos espermatozoides ovinos contra danos do congelamento quando comparado ao TRIS, mas o aprimoramento de sua formulação e protocolos mais adequados de congelação poderão torná-lo uma alternativa na congelação do sêmen ovino. Abstract in english The aim of this study was to evaluate the ACP-102c extender in the cryopreservation of ram semen compared to tris-glucose-egg yolk (TRIS) extender and fresh semen. Forty-eight ejaculates were collected from four rams and two aliquots per ejaculate were taken for dilution and cryopreservation in ACP- [...] 102c or TRIS and a third aliquot used for the fresh semen analysis. Either the fresh semen and cryopreserved in both extenders were evaluated for viability, integrity of plasma and acrosomal membrane, hypoosmotic swelling test, DNA fragmentation and sperm motility. The extenders did not differ for sperm viability, acrosome and plasma membrane integrity, DNA fragmentation and quantitative and qualitative parameters of sperm velocity after thawing, but differed in hypoosmotic swelling test, total and progressive motility and lateral extent of the head as well as in all motility parameters evaluated (except linearity and straightness) after two hours of incubation at 37 ºC. There was variability among rams in total and progressive motility of semen cryopreserved in ACP-102c after thawing. The ACP-102c extender showed less protection in the cryopreservation of ram sperm when compared to TRIS, but the improvement in its formulation and freezing protocols may make it an alternative to freezing ram semen.

  14. Preservasi Semen Kambing Peranakan Etawa dalam Pengencer Tris dan Sitrat Kuning Telur dengan Penambahan Sodium Dodecyl Sulphate (THE PRESERVATION OF ETTAWA GRADE BUCK SEMEN IN TRIS AND CITRATE EGG YOLK DILUENTS SUPPLEMENTED WITH SODIUM DODECYL SULPHATE)


    Nur Hidayati; Raden Iis Arifiantini; Dondin Sajuthi3)


    This study was conducted to determineSDS concentration also to compare Tris egg yolk and citrateegg yolk on the quality of ettawa grade chilled semen. The study consist of two experiments. The firstexperiment was to determine the best SDS concentration in Tris egg yolk diluents and the second experimentwas to compare the SDS suplementation in tris and citrate egg yolk in the quality of ettawa grade chilledsemen. The semen were collected from three bucks, immediately after collection the semen...

  15. Semen parameters can be predicted from environmental factors and lifestyle using artificial intelligence methods. (United States)

    Girela, Jose L; Gil, David; Johnsson, Magnus; Gomez-Torres, María José; De Juan, Joaquín


    Fertility rates have dramatically decreased in the last two decades, especially in men. It has been described that environmental factors as well as life habits may affect semen quality. In this paper we use artificial intelligence techniques in order to predict semen characteristics resulting from environmental factors, life habits, and health status, with these techniques constituting a possible decision support system that can help in the study of male fertility potential. A total of 123 young, healthy volunteers provided a semen sample that was analyzed according to the World Health Organization 2010 criteria. They also were asked to complete a validated questionnaire about life habits and health status. Sperm concentration and percentage of motile sperm were related to sociodemographic data, environmental factors, health status, and life habits in order to determine the predictive accuracy of a multilayer perceptron network, a type of artificial neural network. In conclusion, we have developed an artificial neural network that can predict the results of the semen analysis based on the data collected by the questionnaire. The semen parameter that is best predicted using this methodology is the sperm concentration. Although the accuracy for motility is slightly lower than that for concentration, it is possible to predict it with a significant degree of accuracy. This methodology can be a useful tool in early diagnosis of patients with seminal disorders or in the selection of candidates to become semen donors. PMID:23446456

  16. Escitalopram treatment for premature ejaculation has a negative effect on semen parameters. (United States)

    Koyuncu, H; Serefoglu, E C; Yencilek, E; Atalay, H; Akbas, N B; Sar?ca, K


    The aim of this study was to determine the impact of long-term escitalopram treatment on semen parameters of patients with lifelong premature ejaculation (PE). Between November 2008 and January 2010, patients admitted to urology outpatient clinic with a self-reported complaint of PE were evaluated. Medical and sexual history of patients were recorded and patients with lifelong PE (a total of 25 patients) who met the International Society of Sexual Medicine definition were asked to record their intravaginal ejaculatory latency time (IELT) for 1 month, complete Premature Ejaculation Diagnostic Tool (PEDT) questionnaire and give semen samples. Afterwards, patients received 10 mg escitalopram daily for 12 weeks and were invited for control visits at first and third month of treatment. During control visits, PEDT was administered again whereas IELTs were recorded and semen samples were re-examined. PEDT scores, arithmetic means of IELTs and results of semen analyses, which were recorded at baseline, first and third month were compared. At the third month of treatment, a significant increase in mean IELTs and a significant decrease in PEDT scores were detected. However there was a significant decrease in sperm concentration, motility and morphology when compared with the baseline semen measures. Daily escitalopram treatment effects the semen parameters of patients with lifelong PE. Further investigations with larger series are needed to see whether other serotonin reuptake inhibitors have similar side effects and to expose the exact mechanism underlying it. Different treatment modalities should be suggested to patients who desire fertility. PMID:21776003

  17. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki): A preliminary study (United States)

    Iswadi, M.I.; Ann, Z.F.; Hafiz, M.M.; Hafiz, M.D.; Fahrul, F.J.; Hajarian, H.; Wahid, H.; Zawawi, I.; Khairiah, M.S.; Mazni, O.A.


    The Malayan gaur (Bos gaurus hubbacki) or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN). The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM) and electroejaculation (EEJ) technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur.

  18. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki: A preliminary study

    Directory of Open Access Journals (Sweden)

    M.S. Khairiah


    Full Text Available The Malayan gaur (Bos gaurus hubbacki or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN. The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM and electroejaculation (EEJ technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur.

  19. Collection, analysis and cryopreservation of semen from Malayan gaur (Bos gaurus hubbacki): A preliminary study. (United States)

    Iswadi, M I; Ann, Z F; Hafiz, M M; Hafiz, M D; Fahrul, F J; Hajarian, H; Wahid, H; Zawawi, I; Khairiah, M S; Mazni, O A


    The Malayan gaur (Bos gaurus hubbacki) or Seladang is classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN). The Malayan gaur is mainly distributed in the tropical woodlands of Peninsular Malaysia and Southern Thailand. The aim of this study was to collect, analyze and cryopreserve the semen of wild Malayan gaur. Transrectal massage (TM) and electroejaculation (EEJ) technique was applied in semen collection of the Malayan gaur. The semen was then cryopreserved in liquid nitrogen using slow freezing technique. Makler counting chamber was used to evaluate sperm concentration and motility, while the sperm viability and morphology of fresh and post-thaw sperm was determined using eosin-nigrosin staining protocol. As a result, we have successfully collected the Malayan gaur semen using EEJ technique. Sperm motility, viability and morphological changes of the post-thaw semen of Malayan gaur were found undesirable due to the complication of the cryopreservation process. On the basis of current study it can be concluded that Malayan gaur bulls semen can be obtain by EEJ with no evidence of rectal trauma. Optimization of the process of cryopreservation for Malayan gaur sperm is needed to maintain the cryoviability of the good sperm quality. The data generated in this study would be useful in conservation of genetic diversity program for Malayan gaur. PMID:26623302

  20. Presence of aerobic micro-organisms and their influence on basic semen parameters in infertile men. (United States)

    Filipiak, E; Marchlewska, K; Oszukowska, E; Walczak-Jedrzejowska, R; Swierczynska-Cieplucha, A; Kula, K; Slowikowska-Hilczer, J


    Urogenital tract infections in males are one of the significant etiological factors in infertility. In this prospective study, 72 patients with abnormal semen parameters or any other symptoms of urogenital tract infection were examined. Semen analysis according to the WHO 2010 manual was performed together with microbial assessment: aerobic bacteria culture, Chlamydia antigen test, Candida culture, Ureaplasma and Mycoplasma-specific culture. In total, 69.4% of semen samples were positive for at least one micro-organism. Ureaplasma sp. was the most common micro-organism found in 33% of semen samples of infertile patients with suspected male genital tract infection. The 2nd most common micro-organisms were Enterococcus faecalis (12.5%) and Escherichia coli (12.5%), followed by Staphylococcus aureus (7%), Chlamydia trachomatis (7%) and Candida sp. (5.6%). Generally, bacteria were sensitive to at least one of the antibiotics tested. No statistically significant relationship was observed between the presence of aerobic micro-organisms in semen and basic semen parameters: volume, pH, concentration, total count, motility, vitality and morphology. PMID:25209133

  1. Reproductive toxicity of chromium in adult bonnet monkeys (Macaca radiata Geoffrey). Reversible oxidative stress in the semen

    International Nuclear Information System (INIS)

    The present study was designed to test the hypothesis that oxidative stress mediates chromium-induced reproductive toxicity. Monthly semen samples were collected from adult monkeys (Macaca radiata), which were exposed to varying doses (50, 100, 200 and 400 ppm) of chromium (as potassium dichromate) for 6 months through drinking water. Chromium treatment decreased sperm count, sperm forward motility and the specific activities of antioxidant enzymes, superoxide dismutase and catalase, and the concentration of reduced glutathione in both seminal plasma and sperm in a dose- and duration-dependent manner. On the other hand, the quantum of hydrogen peroxide in the seminal plasma/sperm from monkeys exposed to chromium increased with increasing dose and duration of chromium exposure. All these changes were reversed after 6 months of chromium-free exposure period. Simultaneous supplementation of vitamin C (0.5 g/L; 1.0 g/L; 2.0 g/L) prevented the development of chromium-induced oxidative stress. Data support the hypothesis and show that chronic chromium exposure induces a reversible oxidative stress in the seminal plasma and sperm by creating an imbalance between reactive oxygen species and antioxidant system, leading to sperm death and reduced motility of live sperm

  2. Trehalose improves semen antioxidant enzymes activity, post-thaw quality, and fertility in Nili Ravi buffaloes (Bubalus bubalis). (United States)

    Iqbal, Sajid; Andrabi, Syed Murtaza Hassan; Riaz, Amjad; Durrani, Aneela Zameer; Ahmad, Nasim


    Our objectives were to study the effect of trehalose in extender on (1) antioxidant enzymes profile during cryopreservation (after dilution, before freezing, and after thawing), (2) in vitro quality (after thawing), and (3) in vivo fertility of Nili Ravi buffalo (Bubalus bubalis) bull spermatozoa. Semen samples (n = 20) from four buffalo bulls were diluted in Tris-citric acid-based extender having different concentrations of trehalose (0.0, 15, 30, 45, and 60 mM) and frozen in French straws. At post dilution, profile of sperm catalase (U/mL) was higher (P < 0.05) in extenders containing 15, 30, and 45 mM of trehalose as compared to control. Although profiles of superoxide dismutase (U/mL) and total glutathione (?M) were higher (P < 0.05) in extenders containing 15 and 30 mM of trehalose as compared to control. At prefreezing, sperm catalase, superoxide dismutase, and total glutathione profiles were higher (P < 0.05) in all the treatment groups as compared to control. At post thawing, the profiles of catalase and total glutathione were higher (P < 0.05) in extender containing 30-mM trehalose as compared to other treatment groups and control. Whereas, profile of superoxide dismutase was higher (P < 0.05) in extenders containing 30, 45, and 60 mM of trehalose as compared to control and 15mM group. Post thaw total sperm motility (%) was higher (P < 0.05) in extender containing 30-mM trehalose as compared to control and 15 and 60-mM groups. Although sperm progressive motility (%), rapid velocity (%), average path velocity (?m/s), straight line velocity (?m/s), curvilinear velocity (?m/s), plasma membrane (structural and functional, %), acrosome (%), and DNA (%) integrity were higher (P < 0.05) in extender containing 30 mM trehalose as compared to other treatment groups and control. The fertility rates (61% vs. 43%) were higher (P < 0.05) in buffaloes inseminated with semen doses cryopreserved in extender containing 30 mM of trehalose than the control. It is concluded that addition of 30-mM trehalose in extender improves the semen antioxidant enzymes activity, post thaw quality, and fertility in Nili Ravi buffaloes. PMID:26653954

  3. Human semen quality in the new millennium: a prospective cross-sectional population-based study of 4867 men

    DEFF Research Database (Denmark)

    Jørgensen, N; Joensen, Ulla Nordström; Jensen, TK; Jensen, MB; Almstrup, Kristian; Olesen, IA; Juul, A; Andersson, A; Carlsen, E; Petersen, Jørgen Holm; Toppari, J; Skakkebæk, Niels Erik


    Objectives Considerable interest and controversy over a possible decline in semen quality during the 20th century raised concern that semen quality could have reached a critically low level where it might affect human reproduction. The authors therefore initiated a study to assess reproductive health in men from the general population and to monitor changes in semen quality over time. Design Cross-sectional study of men from the general Danish population. Inclusion criteria were place of residen...

  4. Impact of porcine circovirus type 2 (PCV2) vaccination on boar semen quality and quantity using two different vaccines


    Caspari, K; Henning, H.; Schreiber, F; Maass, P.; Gössl, R; Schaller, C.; Waberski, D


    Porcine circovirus type-2 (PCV2) is widespread in domestic pig populations. It can be shed with boar semen, but the role boars have in epidemiology is still unclear. Vaccinating boars against PCV2 can reduce disease and virus load in semen, but may have unwanted side effects, that is, impairment of spermatogenesis. Therefore, the aim of this study was to investigate the effect and impact of two different PCV2 vaccines on boar semen quality and quantity. Healthy normospermic Large White boars ...

  5. A comparison of conventional and computer-assisted semen analysis (CRISMAS software) using samples from 166 young Danish men

    DEFF Research Database (Denmark)

    Vested, Anne; Ramlau-Hansen, Cecilia H; Bonde, Jens P; Thulstrup, Ane M; Kristensen, Susanne L; Toft, Gunnar


    ) using semen samples from 166 young Danish men. The CRISMAS software identifies sperm concentration and classifies spermatozoa into three motility categories. To enable comparison of the two methods, the four motility stages obtained by conventional semen analysis were, based on their velocity...... proportion of rapidly progressive spermatozoa and, consequently, underestimated the percentages of slowly progressive and non-progressive spermatozoa, compared to the conventional method. To investigate whether results drifted according to time of semen analysis, results were pooled into quarters according...

  6. Viability and fertility of cooled equine semen diluted with skimmed milk or glycine egg yolk-based extenders

    Directory of Open Access Journals (Sweden)

    Guilherme Pugliesi


    Full Text Available Two semen extenders were compared for their ability to maintain viability of horse semen during 24 hours of cold preservation, and for the pregnancy rate after artificial insemination. In the experiment 1, five ejaculates from three stallions were split-diluted in either a skimmed milk-based extender (Kenney extender or a glycine egg yolk-based extender (Foote extender and cooled at 6-8 ºC for 24 hours. Semen samples stored in Kenney extender for 24 hours had higher motility and spermatic vigor compared with those stored in Foote extender. However, samples stored in Foote extender had higher number of reactive sperm by hypoosmotic test and greater viability by epifluorescence test compared with those in Kenney extender. In the experiment 2, 17 and 23 ejaculates from two stallions were split-diluted with Kenney extender and Foote extender. The sperm concentration in each extender was adjusted to 500 million viable sperms per insemination dose. Semen was cooled to 6-8 ºC and stored for 24 hours. Seventy-four cycles of crossbred mares were inseminated with either semen diluted in Kenney extender or semen diluted in Foote extender. The pregnancy rate was higher from semen diluted in Kenney extender than that from semen in Foote extender (0.553 vs. 0.306. The Kenney extender is effective in preserving the motility, vigor and fertility of stallion semen after 24 hours of cold storage, whereas the Foote extender is not acceptable.

  7. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen.


    van Engelenburg, F A; Maes, R. K.; van Oirschot, J T; Rijsewijk, F A


    We developed a polymerase chain reaction (PCR) assay to detect bovine herpesvirus type 1 (BHV-1) in bovine semen. Since bovine semen contains components that inhibit PCR amplification, a protocol was developed to purify BHV-1 DNA from bovine semen. To identify failures of PCR amplification, we used an internal control template that was coamplified by the same PCR primers. When separated fractions of BHV-1-contaminated semen were analyzed by the PCR, we found that more than 90% of the BHV-1 DN...

  8. Rapid detection of bovine herpesvirus 1 in the semen of infected bulls by a nested polymerase chain reaction assay.


    Masri, S A; Olson, W; Nguyen, P. T.; Prins, S.; Deregt, D


    A nested polymerase chain reaction (PCR) assay was developed for the detection of bovine herpesvirus 1 (BHV-1) in bovine semen and compared with the virus isolation method. When extended semen, commonly used in the bovine artificial insemination industry, was inoculated with BHV-1, the PCR assay detected BHV-1 DNA in semen inoculated at 0.25-2.5 TCID50 per 0.5 mL. In contrast, the lower limit of detection for virus isolation was 250 TCID50 of BHV-1 inoculated in 0.5 mL of extended semen. Thes...

  9. Viability and fertility of cooled equine semen diluted with skimmed milk or glycine egg yolk-based extenders

    Scientific Electronic Library Online (English)

    Guilherme, Pugliesi; Giovanni Ribeiro de, Carvalho; Daniel Macêdo, Rates; Pedro Gama, Ker; Manuela Pereira da, Matta; Renan Reis de, Oliveira; José Monteiro da, Silva Filho.


    Full Text Available Two semen extenders were compared for their ability to maintain viability of horse semen during 24 hours of cold preservation, and for the pregnancy rate after artificial insemination. In the experiment 1, five ejaculates from three stallions were split-diluted in either a skimmed milk-based extende [...] r (Kenney extender) or a glycine egg yolk-based extender (Foote extender) and cooled at 6-8 ºC for 24 hours. Semen samples stored in Kenney extender for 24 hours had higher motility and spermatic vigor compared with those stored in Foote extender. However, samples stored in Foote extender had higher number of reactive sperm by hypoosmotic test and greater viability by epifluorescence test compared with those in Kenney extender. In the experiment 2, 17 and 23 ejaculates from two stallions were split-diluted with Kenney extender and Foote extender. The sperm concentration in each extender was adjusted to 500 million viable sperms per insemination dose. Semen was cooled to 6-8 ºC and stored for 24 hours. Seventy-four cycles of crossbred mares were inseminated with either semen diluted in Kenney extender or semen diluted in Foote extender. The pregnancy rate was higher from semen diluted in Kenney extender than that from semen in Foote extender (0.553 vs. 0.306). The Kenney extender is effective in preserving the motility, vigor and fertility of stallion semen after 24 hours of cold storage, whereas the Foote extender is not acceptable.

  10. Association between a biomarker of exposure to polycyclic aromatic hydrocarbons and semen quality

    Directory of Open Access Journals (Sweden)

    Joanna Jurewicz


    Full Text Available Objectives: Growing evidence supports the reproductive and developmental toxicity of polycyclic aromatic hydrocarbons (PAHs from prenatal and postnatal exposure, but the results of epidemiological studies regarding harmful effects of PAHs exposure on male reproductive system still remain limited and inconclusive. The aim of the present study was to investigate the relationship between 1-hydroxypyrene, a biomarker of polycyclic aromatic hydrocarbons exposure and semen quality. Materials and Methods: The study population consisted of 277 men attending an infertility clinic for diagnostic purposes and having normal semen concentration of 20-300 mln/ml or slight oligozoospermia (semen concentration: 15-20 mln/ml (WHO 1999. All the men were healthy and under 45 years of age. All participants were interviewed and provided a semen sample. The interview included questions concerning demographics, socio-economic status, medical history related to past diseases which may have an impact on semen quality, lifestyle factors and occupational information. Concentrations of 1-hydroxypyrene (1-OHP in the urine samples were analyzed using high performance liquid chromatography (HPLC. Results: A positive association was found between the level of 1-OHP in urine and sperm neck abnormalities as well as the percentage of static sperm cells (p = 0.001, p = 0.018, respectively. Additionally, exposure to PAHs measured by 1-OHP in urine decreased semen volume and the percentage of motile sperm cells (p = 0.014, p = 0.0001, respectively. Conclusions: Presented findings indicate that the environmental level of PAHs exposure adversely affects male semen quality. The future large-scale studies should incorporate different biomarkers to generate a more accurate and full assessment of the effects of PAHs exposure on male fertility.

  11. Liquid semen storage in elephants (Elephas maximus and Loxodonta africana): species differences and storage optimization. (United States)

    Kiso, Wendy K; Brown, Janine L; Siewerdt, Frank; Schmitt, Dennis L; Olson, Deborah; Crichton, Elizabeth G; Pukazhenthi, Budhan S


    Artificial insemination plays a key role in the genetic management of elephants in zoos. Because freshly extended semen is typically used for artificial insemination in elephants, it has become imperative to optimize conditions for liquid storage and semen transport. The objectives of this study were to examine the interactions between different extenders and storage temperatures on sperm total motility, progressive motility, and acrosomal integrity in Asian (Elephas maximus) and African (Loxodonta africana) elephants. Ejaculates were collected by rectal massage, diluted using a split-sample technique in 5 semen extenders: TL-Hepes (HEP), Modena (MOD), Biladyl (BIL), TEST refrigeration medium (TES), and INRA96 (INR), maintained at 35°C, 22°C, or 4°C. At 0, 4, 6, 12, and 24 hours, aliquots were removed and assessed for sperm total motility, progressive motility, and acrosomal integrity. After 24 hours of storage, African elephant spermatozoa exhibited greater longevity and higher values in sperm quality parameters compared with those of Asian elephants. In both species, semen storage at 35°C resulted in a sharp decline in all sperm quality parameters after 4 hours of storage, whereas storage at 22°C and 4°C facilitated sperm survival. In Asian elephants, MOD and HEP were most detrimental, whereas BIL, TES, and INR maintained motility up to 12 hours when spermatozoa were cooled to 22°Cor4°C. In African elephants, there were no differences among extenders. All media maintained good sperm quality parameters at 22°C or 4°C. However, although MOD, BIL, and INR were most effective at lower temperatures, HEP and TES maintained sperm motility at all storage temperatures. This study demonstrated sperm sensitivity to components of various semen extenders and storage temperatures and offers recommendations for semen extender choices for liquid semen storage for both Asian and African elephants. PMID:21127305

  12. Effect of L-(+-Ergothioneine (EGT on Freezability of Ram Semen

    Directory of Open Access Journals (Sweden)

    U.C. Ari


    Full Text Available The aim of this study was to investigate freezability of ram semen extended with different L-(+-Ergothioneine (EGT doses. For this aim, semen from four ram were collected with artificial vagina (44°C and then pooled. Pooled semen was divided five aliquots and extended with skim milk based extender containing 0 mmol/L (EGT0: Control, 1 mmol/L (EGT1, 2 mmol/L (EGT2, 5 mmol/L (EGT5 and 10 mmol/L (EGT10 EGT, respectively. After equilibration (+5°C/2 h, the extended aliquots of semen in straws were cryopreserved in Liquid Nitrogen (LN2 vapour (-120°C/15 min and stored in LN2 (-196°C until examination date. Totally two straws from 17 replications (trials in each experimental group were thawed in water bath (37°C/1 min and percentages of progressive motility, sperm viability, abnormality, acrosome and membrane integrity were determined and statistically assessed with SPSS. In the result, it was determined that different doses of EGT did not affect freezability of ram semen when seventeen replications considered (p>0.05. However, when separated trials according to good (?20% for motility in control groups; 8 in 17 replications or poor (<20% for motility in control groups; 9 in 17 replications freezability were statistically analyzed, beneficial effects of 10 mmol/L concentration of EGT on progressive motility and membrane integrity were determined in poor freezability trials, compared with control (p<0.05. In conclusion, addition of EGT in semen extenders may be considered to improve freezability of ram semen, if there is a situation of poor-freezability.

  13. Boar semen bacterial contamination in Italy and antibiotic efficacy in a modified extender

    Directory of Open Access Journals (Sweden)

    Carla Bresciani


    Full Text Available The aims of the study were to identify microbial flora in boar semen under field conditions in northern Italy, to investigate antibiotic resistance and sensitivity of isolated bacteria, and to evaluate elimination of bacteria after storage in two types of extenders added with different antibiotics (amikacin vs gentamicin. A total of 60 boars were collected in 13 pig farms. Bacteriological and mycological investigations were performed immediately on raw semen samples, then at 48 and 120 h of storage on semen diluted randomly in a new short-term modified extender (ME-S or in a commercial one (CRONOSTM. Bacterial contamination was found in 63% of raw semen samples and different bacterial species were isolated: E.coli, Serratia marcescens, Staphylococcus epidermidis and aureus, Proteus spp., Streptococcus spp. and Pseudomonas aeruginosa. E. coli was the most isolated contaminant (53%; Pseudomonas aeruginosa was found only in one semen sample. The analysis of variance of factors affecting contamination levels was significant for the farm of origin (P<0.05 and not significant for the breed. Antibiotic resistance of these bacteria was assessed using different antibiotics. Significant differences (P<0.05 between observed and expected frequencies of bacterial isolates resistant or not to the antibiotics contained in the extenders were found. At 48 h of storage a reduction of aerobic contamination was found after ME-S dilution by 85.3% and after CRONOSTM by 63.8%. This paper proved the presence of pathogenic bacteria in semen. We thus believe it is highly advisable to perform periodic microbiological screening of boar semen in the swine industry to avoid the use of low sperm quality.

  14. Prediction of fertility of bovine semen: Preliminary studies with the hamster egg penetration test. (United States)

    Eaglesome, M D; Miller, S A


    The ability of liposome-treated fresh and frozen spermatozoa from two bulls to interact with zona-free hamster oocytes was examined to show whether the in vitro test results would correspond with in vivo fertility as indicated by the 60 to 90 d nonreturn to service rates which, using frozen semen, were 77 and 59%, respectively. The motility of spermatozoa in washed suspensions was also rated. Hamster test results were obtained using three ejaculates from each bull both as fresh and frozen semen. The results with frozen semen corresponded with fertility. The averages of three hamster tests for oocyte penetration rates and mean number of spermatozoa per penetrated oocyte comparing spermatozoa from the bull with the higher fertility with spermatozoa from the bull with the lower fertility were 91% and 2.7 versus 56% and 1.4, respectively. Spermatozoa washed from frozen semen from the bull with the higher fertility interacted with hamster oocytes at the higher rate even when sperm motility was rated the same for both bulls. By contrast, fresh spermatozoa from the lower fertility bull interacted with hamster oocytes at a higher rate than spermatozoa from the higher fertility bull in six tests, comparing six ejaculates of fresh semen from both bulls. Comparing the higher fertility bull with the lower fertility bull, the average of six tests for oocyte penetration rates and mean number of spermatozoa per penetrated oocyte were 60% and 1.6 versus 89% and 3.0, respectively. This suggests that this hamster test cannot be used with fresh semen to predict relative levels of fertility of frozen semen. Also, the subjective rating of sperm motility did not correspond with the in vitro oocyte penetrating ability of the spermatozoa. PMID:16726582

  15. Use of computer-assisted semen analysis for evaluation of Rosy-faced lovebird (Agapornis roseicollis) semen collected in different periods of the year. (United States)

    Dogliero, Andrea


    The seminal characteristics of the Rosy-faced lovebird (Agapornis roseicollis) were analyzed, both in and out of season, using a computer-aided sperm analyzer. Avian semen collection and artificial insemination techniques have great potential for captive breeding programs, and computer-aided sperm analyzer allows an objective and quantitative assessment of sperm motility and kinetics. Although Agapornis roseicollis is a largely diffuse species, its seminal parameters have never been fully investigated. Using the massage technique, 38 ejaculates were collected in the breeding season, and 6 ejaculates were collected outside of the breeding season. Semen color, volume, degree of contamination, spermatozoa concentration, total and progressive motility, and kinetics parameters were recorded. Seasonal significant differences were found in the ejaculate volume (1.6 ± 0.6 and 1.1 ± 0.2 mL in and out season, respectively, P < 0.01) and spermatozoa concentration (7194.0 ± 6735.1 x 10(6) and 327.5 ± 314.0 x 10(6) spermatozoa/mL, P < 0.01); among the motility parameters, only beat cross frequency, indicating the frequency of flagellar beats, was significantly higher out of the reproductive season (29.8 ± 2.6 vs. 24.5 ± 3.8 Hz, P < 0.01). There was very large individual variation in semen characteristics that could qualify a male as a potentially good or bad semen donor for future assisted reproduction in captivity. PMID:25441497

  16. Contribution of semen trait selection, artificial insemination technique, and semen dose to the profitability of pig production systems: A simulation study. (United States)

    Gonzalez-Pena, Dianelys; Knox, Robert V; Rodriguez-Zas, Sandra L


    The economic impact of selection for semen traits on pig production systems and potential interaction with artificial insemination (AI) technique and semen dose remains partially understood. The objectives of this study were to compare the financial indicators (gross return, net profit, cost) in a three-tier pig production system under one of two selection strategies: a traditional strategy including nine paternal and maternal traits (S9) and an advanced strategy that adds four semen traits (S13). Maternal traits included the number of pigs born alive, litter birth weight, adjusted 21-day litter weight, and the number of pigs at 21 days, and paternal traits included days to 113.5 kg, back fat, average daily gain, feed efficiency, and carcass lean percentage. The four semen traits included volume, concentration, progressive motility of spermatozoa, and abnormal spermatozoa. Simultaneously, the impact of two AI techniques and a range of fresh refrigerated semen doses including cervical AI with 3 × 10(9) (CAI3) and 2 × 10(9) (CAI2) sperm cells/dose, and intrauterine AI with 1.5 × 10(9) (IUI1.5), 0.75 × 10(9) (IUI0.75), and 0.5 × 10(9) (IUI0.5) sperm cells/dose were evaluated. These factors were also evaluated using a range of farrowing rates (60%-90%), litter sizes (8-14 live-born pigs), and a selected semen collection frequency. The financial impact of the factors was assessed through simulation of a three-way crossbreeding system (maternal nucleus lines A and B and paternal nucleus line C) using ZPLAN. The highest return on investment (profit/cost) of boars was observed at 2.33 collections/wk (three periods of 24 hours between collections). Under this schedule, a significant (P < 0.0001) interaction between the selection strategy and the AI technique-dose combination was identified for the gross return; meanwhile, significant (P < 0.0001) additive effects of the selection strategy and AI technique-dose combination were observed for the net profit. The highest gross return was obtained under S13 with IUI0.75 and IUI0.5. The net profit of S13 was 34.37% higher than the traditional S9 (P < 0.0001). The net profit favored IUI0.5 with relative differences of 4.13%, 2.41%, 1.72%, and 0.43% compared to CAI3, CAI2, IUI1.5, and IUI0.75, respectively. The advanced selection strategy proposed including four semen traits is recommended on the basis of the higher profitability relative to the traditional strategy. PMID:26435262

  17. Elimination of toxicity and enhanced detection of lumpy skin disease virus on cell culture from experimentally infected bovine semen samples. (United States)

    Bagla, V P; Osuagwuh, U I; Annandale, C H; Irons, P C; Venter, E H


    Lumpy skin disease virus (LSDV), a poxvirus of the genus Capripoxvirus, is shed in the semen of infected bulls. The screening of semen for infectious virus requires a sensitive diagnostic method. The isolation of the virus on cell cultures and/or the polymerase chain reaction (PCR) are sensitive diagnostic tests which may be used to screen semen for LSD viral DNA prior to artificial insemination. Although cell culture detects infectious virus and is a sensitive method, there are major difficulties in using this method due to the toxic effect of semen on the cells. The aim of this study was to find a method that decreases the toxic effect of semen and enhances the isolation of LSDV on cell culture. Semen samples from LSDV sero-negative bulls were collected and infected with a field isolate of LSDV, strain V248/93, with a titre of 6.5 log TCID50. The semen samples were treated with one of four different methods: centrifugation, serial dilution, filtration and chemical treatment with kaolin. The samples subjected to centrifugation, serial dilution and filtration were supplemented with gentamycin. Semen toxicity on cell cultures was eliminated when supernatants of semen samples centrifuged at 2000 rpm for 1, 3 and 5 min and serially diluted were used to inoculate confluent monolayer bovine dermis cells. The toxicity recorded when the pellet fractions of semen samples centrifuged for 5 min at 2000 rpm was comparable to results obtained from serially diluted samples supplemented with gentamycin. Filtration and kaolin treatment of semen samples did not remove the toxic effect. PMID:17283726

  18. Cloned embryos from semen. Part 1: in vitro proliferation of epithelial cells on embryonic fibroblasts after isolation from semen by gradient centrifugation. (United States)

    Nel-Themaat, Liesl; Gómez, Martha C; Pope, C Earle; Lopez, Monica; Wirtu, Gemechu; Cole, Alex; Dresser, Betsy L; Lyons, Leslie A; Bondioli, Kenneth R; Godke, Robert A


    Although epithelial-like somatic cells have been previously isolated from semen, cell proliferation rates were low. Culture of whole semen samples resulted in loss of potentially valuable spermatozoa. The aims of the present study were to: (1) isolate somatic cells from semen, while preserving sperm viability, and (2) optimize in vitro culture conditions for semen-derived epithelial cells. Density gradient centrifugation of washed ejaculates of two rams (Ovis aries) (n = 24) and one eland bull (Taurotragus oryx) (n = 4) was performed using a three-layer discontinuous Percoll column consisting of 90% (P-90), 50% (P-50), and 20% (P-20) Percoll. In vitro culture and Trypan Blue staining indicated that live somatic cells settled in the P-20 layer. Nonmotile spermatozoa were recovered at the P-50 and P-90 interfaces, whereas motile spermatozoa were collected in the pellet from the P-90 layer. Subsequently, somatic cells isolated from the P-20 layer were plated either on inactivated 3T3 mouse embryonic fibroblast feeder layers, collagen-coated plates with 3T3 feeder cell inserts, or on collagen-coated plates. Initial somatic cell plating was similar among treatments, but proliferation significantly increased when cocultured with 3T3 cells (feeder or insert). Furthermore, two different types of epithelial cells were obtained. The exact origin of the cells in the male reproduction system is uncertain and probably variable. The present method of cell isolation and in vitro culture may be of value for preserving endangered species. Specifically, cells isolated and cultured from cryopreserved semen of nonliving males could be used for producing embryos by somatic cell nuclear transfer. PMID:18241128

  19. Study of correlation between reaction time and refractory period (as indices of libido) with semen characteristics in Arkharmerino×Moghani and Baluchi×Moghani rams


    Rahimi, Ali A. R.; Gholamali Moghaddam; Mohamad M. Pourseif


    This study was conducted on 10 crossbred rams consisted of 5 ArkharMerino×Moghani (AM×MG) and 5 Baluchi×Moghani (BL×MG), to analyze correlation between semen characteristics and libido activity. The semen samples were evaluated for semen volume, total sperm per ejaculate (TSE), spermatozoa concentration (SC), color, wave motion, spermatozoa progressive motility, percentage of live and abnormal spermatozoa, pH, rate of metabolic activity of spermatozoa and semen index. The libido of rams was m...

  20. Evaluation of Semen Fertility of Bulls by Non-return Rate at 60 Days of Cows under Artificial Insemination Programme in Bangladesh


    M.J.U. Sarder


    The present study were to evaluate the effect of individual bull, semen types, quality of bull semen, sources of semen on Non-return Rate (NRR) at 60 days of cows under field condition. A total 75550 cows were inseminated with 71 bull semens from Central Cattle Breeding Station and Dairy Farm (CCBSDF), Savar, Dhaka, Rajshahi Dairy and Cattle Improvement Farm (RDCIF), Rajabarihat and District Artificial Insemination Centre (DAIC), Rajshahi under 40 Artificial Insemination (AI) sub-centres/poin...

  1. Efecto de tres dilutores en la conservación del semen de alpacas

    Scientific Electronic Library Online (English)

    Fernando, Raymundo T.; Wilfredo, Huanca L.; Teodosio, Huanca M.; Sandra, Huerta O.; Aída, Cordero R.


    Full Text Available El presente trabajo tuvo el propósito de evaluar la eficiencia de tres dilutores: Tris-glucosa, Tris-fructosa y un dilutor comercial de cerdo, en la conservación del semen de alpaca. Se utilizaron 12 machos que fueron entrenados por un mes en la colección de semen con vagina artificial y frazadilla [...] eléctrica. Los animales fueron de la Sub-Estación Experimental Quimsachata del INIA, Puno. El semen tuvo las siguientes características: volumen de 2.7 ± 0.8 ml, viscosidad de 1.04 ± 0.3, motilidad de 54.0 ± 8.0%, pH con tendencia a la alcalinidad, concentración de 248,100 espermatozoides/ml, y el color que predominó fue el blanco lechoso. El tiempo promedio de cópula fue de 26.5 ± 3.8 minutos. Se utilizó un factor de dilución de 1 en 2 para semen y dilutor, respectivamente. Las diluciones fueron evaluadas considerando la motilidad individual como único parámetro para determinar la viabilidad espermática. El dilutor Tris-glucosa mostró una viabilidad promedio de 5.8 ± 1.1 horas, el Tris-fructosa de 6.1 ± 2.5 horas y el dilutor comercial de cerdo de 5.5 ± 1.0 horas, sin haber diferencia estadística significativa entre dilutores. Abstract in english The present work was carried out at the Experimental Research Station Quimsachata-INIA, Puno. The objective was to evaluate the efficiency of three semen extenders in alpaca semen: Tris-glucose, Tris-fructose and a pig´s commercial extender. Twelve animals were selected for semen collection using th [...] e artificial vagina. Males were trained for a month. Mean values for semen parameters were: volume of 2.7 ± 0.8 ml, viscosity of 1. 04 ± 0.3, motility of 54.0 ± 8.0%, pH towards to alkaline, concentration of 248,000 sperms/ml, and the most common color was milky white. The average time for the copula was 26.5 ± 3.8 minutes. Semen was diluted in 1:2 and the dilutions were evaluated on individual motility as the only parameter for sperm viability. The extender Tris-glucose had an average of 5.8 ± 1.1 hours viability, Tris-fructose had 6.1 ± 2.5 hours, and the commercial extender had 5.5 ± 1.0 hours, without statistical differences between extenders.

  2. [Concentration of some trace elements in the semen of men]. (United States)

    Chowaniec, T; Lorenz, K; Guzikowski, W


    By means of atomic absorption spectrophotometry, the authors determined the concentration of calcium, potassium, magnesium, zinc, copper and plumbum in the spermatic fluid of 32 men infertile at the time of the examination. Assuming the number of sperms as the main criterion, the material was divided in three groups: I--lack of sperms (, II--more than 40 million sperms in 1 ml of the spermatic fluid (8 men) and group III--less than 40 million sperms in the spermatic fluid (19 men). Different degrees of asthenozoospermia were taken into consideration--in group II--4 cases, in group III--14 cases. The mean values of the levels of the elements defined in mg/dm3, the range of the levels and standard deviations have been presented in the table. Statistical calculations made according to the T-Student test on the IBM/PC computer according to the Epistat programme did not show statistical significance between the particular groups as to the elements examined. It seems that the examination of the level of trace elements in the semen based on the clinical classification, without considering environmental conditions of life and work, way of nutrition and other possible factors does not present greater value. PMID:2806982

  3. Sperm head phenotype and male fertility in ram semen. (United States)

    Maroto-Morales, A; Ramón, M; García-Álvarez, O; Montoro, V; Soler, A J; Fernández-Santos, M R; Roldan, E R S; Pérez-Guzmán, M D; Garde, J J


    Although there is ample evidence for the effects of sperm head shape on sperm function, its impact on fertility has not been explored in detail at the intraspecific level in mammals. Here, we assess the relationship between sperm head shape and male fertility in a large-scale study in Manchega sheep (Ovis aries), which have not undergone any selection for fertility. Semen was collected from 83 mature rams, and before insemination, head shapes were measured for five parameters: area, perimeter, length, width, and p2a (perimeter(2)/2×?×area) using a computer-assisted sperm morphometric analysis. In addition, a cluster analysis using sperm head length and p2a factor was performed to determine sperm subpopulations (SPs) structure. Our results show the existence of four sperm SPs, which present different sperm head phenotype: SP1 (large and round), SP2 (short and elongated), SP3 (shortest and round), and SP4 (large and the most elongated). No relationships were found between males' fertility rates and average values of sperm head dimensions. However, differences in fertility rates between rams were strongly associated to the proportion of spermatozoa in an ejaculate SP with short and elongated heads (P < 0.001). These findings show how the heterogeneity in sperm head shape of the ejaculate has an effect on reproductive success, and highlight the important role of modulation of the ejaculate at the intraspecific level. PMID:26318229

  4. Semen cryopreservation in fish: effects on sperm motility and fertility

    International Nuclear Information System (INIS)

    The cryopreservation of semen in fish, as in many species even shows effects that decrease sperm quality and directly engage cell ability to successfully participate in the processes of fertilization and embryonic development. the characteristics such as mobility and fertilizing capacity of fertilization of sperm are considered to be quality criteria that allow to measure the success or failure of the process, since they are considered integrative variables, being indicators that depend not on a single factor, but on the stability and welfare of all structures, enzymes and subcellular functional compounds that give place to these spermatic characteristics. membrane damage (Adenylate cyclase, ion channels, grouping of other proteins, among others) and their implication in the route of signaling pathway leading to spermatic activation, ATP degradation and fragmentation of nuclear and mitochondrial DNA (genome), degradation of kinase enzymes and other cytosolic proteins (proteome) are considered today, as some of the molecular factors that most affect during cryopreservation and markedly decreasing the fertilizing capacity and mobility of sperm in fish. Proposals on the molecular mechanisms, by which these subcellular factors interact and act as consequence of cryopreservation, are some of the topics covered in this review. Understanding the principles and factors that are involved in the origin of such damages, will allow to improved cryopreservation processes, making them less harmful and more efficient.

  5. Características Bioquímicas del Plasma Seminal Fresco y Congelado/Descongelado de Alpaca (Vicugna pacos) / Biochemical characteristics of fresh and freeze/thawed seminal plasma of alpaca (Vicugna pacos)

    Scientific Electronic Library Online (English)

    Hugo, Díaz V; Juan, Espinoza B; Wilfredo, Huanca L; Bernardo, Lopez-Torres; José, Rodríguez G.


    Full Text Available El objetivo del estudio fue determinar y comparar las características bioquímicas del plasma seminal de alpacas en fresco y descongelado. Se recolectó semen, mediante electroeyaculación, de cuatro alpacas adultas, una vez por semana por cuatro semanas. El semen se centrifugó y el plasma seminal fue [...] separado. Una parte se analizó en fresco y la otra parte se almacenó en nitrógeno líquido por un mes. Se le hizo el análisis bioquímico a ambos juegos de muestras. Se determinaron los niveles de glucosa, colesterol total, colesterol-HDL, triglicéridos, proteínas totales, albúmina, calcio, fosfatasa alcalina, ALT y ?-GT. Solo los valores de triglicéridos descendieron significativamente por el proceso de congelación/descongelación (p Abstract in english The aim of this study was to determine and compare the biochemical characteristics of fresh and thawed seminal plasma of alpacas. Semen was collected by electroejaculation from four adult males, once a week per four weeks. Semen was centrifuged and the seminal plasma was separated. One part was anal [...] ysed fresh and other stored for one month on liquid nitrogen and then thawed and analysed. Levels of glucose, total cholesterol, HDL-cholesterol, triglycerides, total protein, albumin, calcium, alkaline phosphatase, ALT and ?-GT were determined. Only the triglycerides significantly decreased due to the process of freeze/thawed, where the values were 44.12 ± 7.38 and 27.31 ± 4.65 mg/dl in fresh and thawed respectively.

  6. Motilidad y fertilidad del semen de carnero descongelado a dos diferentes ritmos de temperatura

    Directory of Open Access Journals (Sweden)

    Rosa Bertha Angulo Mejorada


    Full Text Available El objetivo del presente trabajo fue comparar el efecto de dos temperaturas y tiempos de descongelación sobre la motilidad y fertilidad del semen del ovino. Se utilizó un total de 208 ovejas y 13 carneros de diferentes razas. El semen se obtuvo por medio de una vagina artificial. Se evaluó, se diluyó con Tris -ácido cítrico-fructosa-glicerol-yema de huevo y se centrifugó a 200 g/15 min; el paquete celular se resuspendió con el mismo diluyente. El semen diluido se congeló en pajillas francesas de 0.25 ml con 300 millones de espermatozoides mótiles. Se determinó la motilidad al descongelamiento en 212 pajillas descongeladas en baño María a 36ºC/8 seg (grupo 1 o a 70ºC/4 seg (grupo 2 y otras 208 dosis se utilizaron en la inseminación artificial de las ovejas por vía intracervical. Se determinó el porcentaje de ovejas paridas/ovejas inseminadas con semen descongelado a diferentes ritmos. La motilidad al descongelar fue de 51.28% y 47.98% en el semen descongelado de los grupos 1 y 2, respectivamente, y la fertilidad de 30.7% y 29.2%, para los mismos grupos, respectivamente, sin que existiera diferencia significativa entre grupos (C2; P>0.05. Se concluye que la descongelación de las pajillas a 36ºC durante 8 segundos es un método más práctico e inocuo.

  7. Effect of goserelin and leuprolide added to the semen on reproductive performance in rabbits - Short communication. (United States)

    Gogol, Piotr


    The aim of this study was to evaluate the ability of two synthetic GnRH analogues, goserelin and leuprolide, to induce ovulation in rabbit does using intravaginal administration. A total of 252 primiparous lactating does were randomly divided into five groups that, at the time of insemination, received the following treatments for ovulation induction: 1 µg of buserelin administered intramuscularly (control group), 5 µg of goserelin added to the semen dose (Group G5), 10 µg of goserelin added to the semen dose (Group G10), 5 µg of leuprolide added to the semen dose (Group L5), and 10 µg of leuprolide added to the semen dose (Group L10). The kindling rate was 80.5% in Group G10 and 75.0% in Group L10; these values are comparable to the kindling rate obtained in the control group (85.9%). The kindling rates in Groups G5 and L5 were significantly lower than in the control group (60.0%, 54.2% and 85.9%, respectively). The number of live-born rabbits was not significantly affected by the ovulation induction treatment. As regards the total number of rabbits born the only significant difference was observed between Groups G5 and L5. This study shows the possibility of inducing ovulation in rabbits by adding goserelin and leuprolide directly to the semen dose. PMID:26919148

  8. Evaluación de una solución inmovilizadora para criopreservación del semen de Colossoma macropomum, “Gamitana”

    Directory of Open Access Journals (Sweden)

    Ehrlich Llasaca-Calizaya


    Full Text Available El objetivo del trabajo fue la criopreservacion de semen, que permitirá constituir un banco genético, para lo cual se buscó obtener una solución  inactivadora de colecta para el semen de Colossoma macropomum  “gamitana”, que permita obtener espermatozoides, con buena motilidad de activación después de la descongelación, en nitrógeno líquido. Se utilizó semen de reproductores mantenidos, del Instituto de Investigaciones de la Amazonía Peruana (IIAP inducidos con Conceptal® y sin inducir mantenidos en el Centro de Acuicultura Nuevo Horizonte del Fondo Nacional de Desarrollo Pesquero (CANH - FONDEPES. El semen fue colectado en soluciones inactivadoras de 9% y 10% de NaCl, añadiendo 2 g/L, 4 g/L y 8 g/L de NaHCO3,  soluciones de sacarosa (300 mM, 400 mM y 500 mM sola o con 1,5 g/L, 1 g/L y 0,5 g/Lde NaCl. Se concluye que el tratamiento de 400 mM de sacarosa dio el mejor resultado, con una motilidad del 80% y 40 segundos de duración. También se evaluó la motilidad, después de una hora de almacenamiento a temperatura ambiente, con 60% de motilidad después de la activación y 20 segundos de duración. Este trabajo permitirá desarrollar  un protocolo de criopreservación para lotes de semen inmovilizados, con tiempo suficiente para preparar las pajuelas, congelarlas en nitrógeno líquido y optimizar el manejo de reproductores.

  9. Microsatellite analysis of cryopreserved stallion semen stored on FTA(R paper : research communication

    Directory of Open Access Journals (Sweden)

    M.L. Schulman


    Full Text Available The aim of this study was to establish and validate a method to permit microsatellite analysis of DNA profiles obtained from frozen-thawed stallion sperm cells. This would provide reliable and accurate verification of the identification of a semen donor. Ejaculates from 5 pony stallions were collected, processed and frozen in 0.5 m plastic straws. Aliquots of 100 m of the frozen-thawed semen thus obtained were either placed directly, or diluted (1 : 10 ; 1 : 100 ; and 1 : 1000 and placed on slides of FTA(R paper. Similarly, blood samples obtained from each of the stallions were placed onto slides of FTA(R paper. A punch was removed from each sample after drying. Each sample was mixed with FTA(R purification reagent, Dithiothreitol and Proteinase K before incubation and processing. All samples were processed with a set of 13 microsatellite markers. Further analysis permitted a comparison of the DNA profiles of the frozen-thawed semen and the blood samples. A full profile of markers was obtained from the 1 : 10 and 1 : 100 dilutions of the frozen-thawed semen samples as well as from the blood samples. The DNA profiles from the frozen-thawed semen and blood samples obtained from the stallions matched in all cases.

  10. Relationship of spermatozoal DNA fragmentation with semen quality in varicocele-positive men. (United States)

    Moazzam, A; Sharma, R; Agarwal, A


    The aim of the study was to assess the semen quality and levels of spermatozoal nuclear DNA fragmentation in subfertile subjects clinically diagnosed with varicocele, subfertile subjects without varicocele and healthy fertile controls. Semen samples were obtained from 302 subjects. Of them, 115 were healthy fertile controls having normal semen characteristics, 121 subfertile men diagnosed with varicocele, both, clinically and on ultrasonography, while 66 subjects were subfertile with no varicocele. Spermatozoal concentration, percentage motility, morphology and DNA fragmentation were measured. In the study population, deterioration in semen quality-decreased spermatozoal concentration, percentage motility and normal morphology was seen in subfertile subjects, especially with varicocele. Highest spermatozoal DNA fragmentation was observed in varicocele-positive subjects as compared with varicocele-negative subjects and healthy fertile controls. Significant negative correlation was seen between spermatozoal DNA fragmentation and concentration (r = -0.310), motility (r = -0.328) normal morphology, WHO method (r = -0.221) and Tygerberg strict criteria (r = -0.180) in the varicocele-positive subfertile subjects. In conclusion, this study suggests existence of a negative relationship between spermatozoal DNA fragmentation and semen quality in varicocele-positive subfertile subjects. PMID:25346327

  11. Effect of varicocelectomy on testis volume and semen parameters in adolescents: a meta-analysis. (United States)

    Zhou, Tie; Zhang, Wei; Chen, Qi; Li, Lei; Cao, Huan; Xu, Chuan-Liang; Chen, Guang-Hua; Sun, Ying-Hao


    Varicocele repair in adolescent remains controversial. Our aim is to identify and combine clinical trials results published thus far to ascertain the efficacy of varicocelectomy in improving testis volume and semen parameters compared with nontreatment control. A literature search was performed using Medline, Embase and Web of Science, which included results obtained from meta-analysis, randomized and nonrandomized controlled studies. The study population was adolescents with clinically palpable varicocele with or without the testicular asymmetry or abnormal semen parameters. Cases were allocated to treatment and observation groups, and testis volume or semen parameters were adopted as outcome measures. As a result, seven randomized controlled trials (RCTs) and nonrandomized controlled trials studying bilateral testis volume or semen parameters in both treatment and observation groups were identified. Using a random effect model, mean difference of testis volume between the treatment group and the observation group was 2.9 ml (95% confidence interval [CI]: 0.6, 5.2; Pvaricocele side and 1.5 ml (95% CI: 0.3, 2.7; Pvaricocele compared with observation cases, semen parameters did not have any statistically significant difference between two groups. Well-planned, properly conducted RCTs are needed in order to confirm the above-mentioned conclusion further and to explore whether varicocele repair in adolescents could improve subsequently spontaneous pregnancy rates. PMID:25677136

  12. Diagnostic value of sperm function tests and routine semen analyses in fertile and infertile men. (United States)

    Wang, C; Chan, S Y; Ng, M; So, W W; Tsoi, W L; Lo, T; Leung, A


    The results of routine semen analyses, the zona-free hamster oocyte penetration test, the hypoosmotic swelling test, and semen adenosine triphosphate levels were studied in 66 fertile and 130 infertile men. Multivariate discriminant analysis demonstrated that routine semen parameters including semen volume, sperm count, percent sperm motility, and percent normal spermatozoa in combination could predict the fertility of these patients with 70.4% accuracy. Of the three sperm function tests evaluated, the zona-free hamster oocyte penetration test and the hypoosmotic swelling test were selected by the multivariate discriminant analysis as variables capable of providing significant information on the fertility status of the patients. However, the addition of the results of these two tests to the routine semen analysis did not significantly improve the predictability of fertility. The overall correct prediction rate was 77.6% after incorporation of the results of these two sperm function tests. In this group of subjects, the presently available sperm function tests did not predict the fertility status of a patient with a high degree of accuracy. PMID:3215824

  13. The combined use of embryos and semen for cryogenic conservation of mammalian livestock genetic resources. (United States)

    Boettcher, Paul J; Stella, Alessandra; Pizzi, Flavia; Gandini, Gustavo


    The objective of this empirical simulation study was to evaluate the use of a combination of semen and embryos in the creation of gene banks for reconstruction of an extinct breed. Such an approach was compared for banks with varying proportions of embryos on the basis of the amount of the material to be stored, time for reconstruction, maintenance of genetic variability, and probability of failure during reconstruction. Four types of populations were simulated, based on reproductive rate: single offspring, twinning, enhanced reproduction, and litter bearing. Reconstruction was simulated for banks consisting of different combinations of semen and reduced numbers of embryos (expressed as a percentage of the material needed for a bank containing exclusively embryos and ranging from 10 to 90%). The use of a combination of semen and embryos increased the number of insemination cycles needed for reconstruction and the level of genetic relatedness in the reconstructed population. The risk for extinction was unacceptably high when a very low proportion of embryos (<20%) was used. However, combining semen with embryos could decrease costs, allowing for the conservation of more breeds, and specific strategies for semen use could decrease the level of relationships in the reconstructed breed. PMID:16277973

  14. Efecto del dilutor tris y citrato con yema de huevo de cordorniz sobre la viabilidad espermática en semen ovino congelado en pajillas / Effect of tris and citrate - quail eggyolk extenders on viability of ovine frozen semen in straws

    Scientific Electronic Library Online (English)

    Próspero, Cabrera V.; Arturo, Ayulo L.; César, Pantoja A..


    Full Text Available Se evaluó el comportamiento de los dilutores Tris-yema y Citrato-yema en el congelamiento de semen de ovino y la integridad de la membrana espermática del semen congelado en pajillas. El estudio se realizó en el Banco Nacional de Semen UNALM con seis carneros de tres razas. El semen se colectó en va [...] gina artificial, se diluyó con Tris - glucosa - yema de huevo de Codorniz (Tris) o Citrato - glucosa - yema de huevo (Citrato), se almacenó en pajillas de 0.5 ml, y se congeló en nitrógeno líquido. El descongelamiento se realizó a 38 °C por 15 segundos. En semen refrigerado, la Motilidad Individual Progresiva (MIP) en semen diluido con Tris fue 82.3% y con Citrato de 79.2%, y los valores de la integridad de membrana (HOST) fueron de 78.0 ± 4.4 con Tris y 73.2 ± 5.8% con Citrato. En semen descongelado, la MIP fue de 62.0 y 56.8%, y HOST de 49.8 ± 3.9 y 41.3 ± 3.8% para los dilutores Tris y Citrato, respectivamente, existiendo diferencias significativas entre dilutores, carneros y momentos de procesamiento (p Abstract in english The study evaluated the performance of Tris-egg yolk and Citrate-egg-yolk as extenders for freezing ram semen in straws and the integrity of sperm membrane of frozen sperm at the National Semen Bank - UNALM, Lima, Peru using six ram semen donors of three breeds. The semen was collected in an artific [...] ial vagina, diluted with Tris - glucose - quail egg yolk (Tris) or with Citrate - glucose - egg yolk (Citrate), stored in 0.5 ml pellets, and frozen in liquid nitrogen. Thawing was done at 38 ºC for 15 seconds. In refrigerated semen, the Progressive Individual Motility (PIM) in diluted semen with Tris was 82.3% and with Citrate was 79.2%, and the integrity of the cytoplasmic membrane (HOST) was 78.0 ± 4.4 with Tris and 73.2 ± 5.8% with Citrate. In thawed semen, PIM was 62.0 and 56.8%, and HOST was 49.8 ± 3.9 and 41.3 ± 3.8% for Tris and Citrate respectively, with significant differences between extenders, rams and processing period (p

  15. Relation between semen quality and fertility: a population-based study of 430 first-pregnancy planners

    DEFF Research Database (Denmark)

    Bonde, J.P.E.; Ernst, E.; Jensen, Tina Kold; Hjøllund, N.H.I.; Kolstad, H.; Henriksen, T.B.; Scheike, Thomas H.; Giwercman, A.J.; Olsen, J.; Skakkebæk, Niels Erik


    Semen analysis is part of the routine assessment of infertile couples. WHO defines a sperm concentration above 20x10(6) per mL seminal fluid as normal. We studied the association between semen quality and the probability of conception in a single menstrual cycle in Danish couples with no previous...

  16. Characteristics of urethral and epididymal semen collected from domestic cats-A retrospective study of 214 cases. (United States)

    Prochowska, Sylwia; Ni?a?ski, Wojciech; Ochota, Ma?gorzata; Partyka, Agnieszka


    This study was designed to describe and compare basic semen characteristics and sperm motility parameters obtained via computer-assisted sperm analysis (CASA) in feline semen collected from the urethra and epididymis, on the basis of large, unselected population of domestic cats. The semen collected from 214 males was subjected for routine semen assessment and CASA evaluation. Semen collected by urethral catheterization (CT) and by epididymal slicing (EP) has comparable characteristics according to total sperm count (47.7 ± 42.1 and 52.9 ± 45.0), subjective motility (71.1 ± 17.0 and 69.3 ± 13.9), viability (74.9 ± 13.4 and 76.7 ± 10.6), and morphology (52.6 ± 19.0 and 47.2 ± 17.4). The study of a large feline population confirmed a high incidence of teratospermy in cats, which negatively affects sperm motility parameters assessed by CASA. A lack of a correlation between CT and EP semen for total sperm count and viability, as well as occasional gross differences between the morphology of CT and EP semen of the same cat suggests that many factors may affect sperm cells, and the fertility and/or infertility of patients should not be assessed after examining only one sample. Additionally, technical problems with assessment of EP samples (understated results) suggest that CT semen is more appropriate for an analysis by CASA than EP. PMID:26359850


    Directory of Open Access Journals (Sweden)

    Sundaresan, A*


    Full Text Available A study was conducted for collection and evaluation of emu bird semen by non teaser method. Ten adult male emu birds aged 3 to 4 years were selected and housed individually in a 10’ x 50’ pen constructed in parallel rows at emu unit, University Research Farm, TANUVAS, Chennai, Tamilnadu, India. The male birds were selected based on their readiness in accepting human beings without fear. All the birds were housed properly under standard managemental condition. An Isocaloric and Isonitrogenous standard emu breeder ration was fed to birds and portable drinking water were made available ad libitum. The selected male emus were trained for semen collection by non-teaser method. Out of 10 males, only seven males responded for semen collection. The raw semen collected from individual emu birds was evaluated for macroscopical seminal attributes namely volume, colour, consistency and pH. The overall mean values for volume and pH of individual male were 0.61? 0.02 ml and 7.40 ? 0.03 respectively. The individual males showed varied response and significant difference in seminal attributes. Creamy white thick consistency semen had significant (P?0.01 seminal attributes than yellow and watery semen. The temperament of male emu, sexual behavior and acceptance of the collector and courtship behavior by the male are the key factors for successful training of breeders. This study ensures the possibility of semen collection and facilitate further processing of semen.

  18. Centrifugation on PureSperm(®) density-gradient improved quality of spermatozoa from frozen-thawed dog semen. (United States)

    Dorado, J; Alcaráz, L; Duarte, N; Portero, J M; Acha, D; Demyda, S; Muñoz-Serrano, A; Hidalgo, M


    The main objective of this study was to investigate if centrifugation through PureSperm(®) density-gradient can improve the post-thaw semen quality of dog semen. Semen from 5 dogs was collected and cryopreserved following a standard protocol. After thawing, semen samples were selected by centrifugation on PureSperm(®). Assessments of sperm motility (assessed by computerized-assisted semen analysis), morphology (Diff-Quick staining) and viability (triple fluorescent stain of Propidium iodine/isothiocyanate-labeled peanut (Arachis hypogaea) agglutinin/Rhodamine 123), were performed on aliquots of fresh semen, unselected samples and selected preparations. Cryopreservation had a significant (P < 0.001) effect on all studied semen parameters. PureSperm(®) centrifugation yielded sperm suspensions with improved motility and viability (P < 0.001). The washing step significantly reduced (P < 0.001) all of the kinematics parameters evaluated as well as reduced the proportion of viable spermatozoa with intact acrosomes (P < 0.05). We concluded that PureSperm(®) centrifugation is a successful method for improving the quality of frozen-thawed dog spermatozoa. However, washing after density-gradient centrifugation dramatically reduces the post-thaw semen quality, indicating that the inclusion of such a washing step is unnecessary. PMID:21497393

  19. Cryopreservation of canine semen after cold storage in a Neopor box: effect of extender, centrifugation and storage time. (United States)

    Hidalgo, M; Portero, J M; Demyda-Peyrás, S; Ortiz, I; Dorado, J


    The aim of this work was to assess the combined effect of sperm centrifugation, semen extender and storage time before freezing on post-thaw sperm quality and freezability on chilled stored canine semen in a Neopor box. Sperm parameters evaluated were total and progressive sperm motility by Computer-Assisted Sperm Analysis (CASA) and sperm viability and acrosome integrity using a triple fluorescent stain. Sperm quality and freezability indexes were also studied. First, the effect of centrifugation and two commercial extenders from Minitübe (Biladyl A and CaniPRO Freeze A) was evaluated in chilled semen after 24 and 45?hours of cold storage. No significant differences were observed between treatments in almost all the sperm parameters assessed. Secondly, chilled semen was frozen after 24 and 45?hours of cold storage in a Neopor box. The best results were obtained when semen was centrifuged, chilled with CaniPRO Freeze A and then frozen after 24?hours of cold storage, showing no differences in both post-thaw sperm quality and freezability in comparison with semen immediately frozen after collection. In conclusion, dog semen centrifuged after collection and extended with CaniPRO Freeze can be frozen after 24?hours of cold storage in a Neopor box, obtaining similar results to semen immediately frozen after collection. PMID:24799391

  20. Does weight loss improve semen quality and reproductive hormones? results from a cohort of severely obese men

    DEFF Research Database (Denmark)

    Håkonsen, Linn Berger; Thulstrup, Ane Marie; Aggerholm, Anette Skærbech; Olsen, Jørn; Bonde, Jens Peter; Andersen, Claus Yding; Bungum, Mona; Ernst, EH; Hansen, Mette Lausten; Ernst, Erik Hagen; Ramlau-Hansen, Cecilia Høst


    A high body mass index (BMI) has been associated with reduced semen quality and male subfecundity, but no studies following obese men losing weight have yet been published. We examined semen quality and reproductive hormones among morbidly obese men and studied if weight loss improved the reprodu...

  1. Quality assessment of wild Atlantic sturgeon (Acipenser oxyrinchus oxyrinchus) semen under conditions of short-term storage (United States)

    Short-term storage trials were conducted with Atlantic sturgeon semen collected from a total of nine wild males during the 2008 and 2009 spawning seasons on the Hudson River. Semen samples were kept refrigerated (4 plus or minus 1 degree C) and stored in different gaseous atmospheres and storage ext...

  2. Comparação entre os sistemas automatizado e convencional de criopreservação de sêmen bovino / Comparison between the conventional and automated systems of semen bovine cryopreservation

    Scientific Electronic Library Online (English)

    Cátia Oliveira Guimarães, Abud; Lucas Jacomini, Abud; José Carvalho, Oliveira Neto; Margot Alves Nunes, Dode; José Robson Bezerra, Sereno; Carlos Frederico, Martins.


    Full Text Available O objetivo deste estudo foi comparar a eficiência do sistema automatizado (curva de resfriamento controlada eletronicamente) de congelação de sêmen bovino versus o sistema convencional (curva não controlada) por meio dos parâmetros de qualidade e viabilidade espermática no período pós-descongelação. [...] O sêmen de quatro touros azebuados adultos foram criopreservados simultaneamente em meio tris, gema e glicerol 7%. A avaliação computadorizada do sêmen descongelado detectou os seguintes parâmetros: MP 56,50±22,25%; VAP 34,77±4,25µm/s; VSL 28,17±4,25 µm/s; VCL 58,45±6,85µm/s; STR 82,00±2,31%; LIN 49,50±3,32%, para o sistema automatizado e MP. 57,00±13,11%; VAP 25,75±1,66µm/s; VSL 23,32±1,99µm/s; VCL 63,32±1,79µm/s; STR 82,25±3,59µm/s; LIN 50,00±4,97µm/s para o sistema convencional. Os valores médios das avaliações de integridade de membrana plasmática e integridade acrossomal foram de 54,72±12,55% e 36,13±22,20% para o sistema automatizado e 53,22±13,22% e 47,26±5,74% para o sistema convencional, respectivamente. Com os parâmetros avaliados foi possível identificar que não houve diferença estatística entre os sistemas de criopreservação. Desta forma, a escolha do método de criopreservação do sêmen bovino para utilização direta na propriedade fica a critério do técnico responsável, que deverá se basear na realidade de cada propriedade. Para tanto, sempre se deve considerar que o sistema convencional pode trazer mais variações que o sistema automatizado que, apesar do custo do equipamento, pode garantir repetibilidade nos resultados e consequente qualidade do sêmen bovino criopreservado. Abstract in english The objective of this study was to compare the efficiency of bovine semen cryopreservation using the controlled-rate freezing machine versus the conventional method (uncontrolled curve) by the parameters of sperm quality and viability in post-thaw period. Semen from four adult crossbreed bulls was c [...] ryopreserved in Tris-yolk-glycerol medium. The computer assisted analysis of thawed semen detected the following results: PM 56.50±22.25%; VAP 34.77±4.25µm/s; VSL 28.17±4.25µm/s; VCL 58.45±6.85µm/s; STR 82.00±2.31%; LIN 49.50±3.32%, to automated system and PM 57.00±13.11%; VAP 25.75±1.66µm/s; VSL 23.32±1.99µm/s; VCL 63.32±1.79µm/s; STR 82.25±3.59µm/s; LIN 50.00±4.97µm/s to conventional cryopreservation system. The results of plasma membrane and acrosome integrity evaluation were 54.7±12.55% and 36.13±22.20% for the automated system and 53.22±13.22% and 47.26±5.74% for the conventional system, respectively. The parameters evaluated demonstrated that there was no statistical difference between the cryopreservation systems. Thus, the choice of the bovine semen cryopreservation method to be used on a farm is a responsibility of the technician, and should be based on the reality of each farm. Therefore, it is always necessary to consider that the conventional system of bovine semen cryopreservation can vary more than the automated system, which, despite the cost of the equipment, can ensure repeatability of the results and consequent quality of cryopreserved bovine semen.


    Directory of Open Access Journals (Sweden)

    Jussara Maria Tebet


    Full Text Available The objective of this study was to verify the efficiency of two different extenders: TRIS/Fructose/Citric Acid/Glycerol (8 % - (TRIS 8 % (Morton, 1988 modified and commercial extender - MP50 (PAPA et al., 2002 – for freezing dog semen. Ten ejaculates from different adult dogs were collected by digital manipulation. The samples semen were evaluated for sperm motility and vigor, hypo-osmotic swelling test, sperm membrane integrity, sperm morphology, ultra structural analysis in three different moments, fresh (T1, cooled (T2 and thawed (T3. The samples were packaged in 0.5 mL French straws with 40 x 106 spermatozoa/ straw, and kept at 5 0C for 60 minutes (T2; then frozen in static vapor of nitrogen for the following 20 minutes and immersed in liquid nitrogen until being thawed in 70 0C water for 8 seconds (T3. By analysis of variance, it would be possible to verify the animal effect on almost all variables observed in this study, except for sperm motility and membrane integrity. For cooled semen (T2, MP50 were significantly better for hypo-osmotic swelling test, sperm membrane integrity (p<0.05 and for thawed semen (T3, there was no significant difference between extenders. By ultra structural analysis, it was possible to verify swelling plasma and acrosomal sperm membranes in the different stages of freezing process. In conclusion, the extenders showed the same results as to morphofunctional characteristics the semen canine thawed. KEY WORDS: Semen, dog, freezing and extender. O objetivo deste estudo foi avaliar, por meio de análise funcional e morfológica, dois meios diluentes – TRIS/ frutose/ácido cítrico/glicerol (8 % (TRIS 8 % (Morton, 1988 modificado e um meio comercial (MP50 (PAPA et al., 2002 – para criopreservação de sêmen canino. Colheramse dez ejaculados de cães adultos, por manipulação digital do pênis. Avaliaram-se as amostras pela motilidade espermática, velocidade espermática, teste hiposmótico, integridade de membrana espermática, morfologia espermática, e análise ultra-estrutural no sêmen fresco (T1, refrigerado (T2 e descongelado (T3. Envasaram-se as amostras diluídas em palhetas francesas de 0,5 mL, com 40 x 106 espermatozóides/palheta e se as mantiveram por sessenta minutos a 5 ºC (T2; em seguida, transferiram-nas para vapor de nitrogênio líquido durante vinte minutos e posteriormente estocadas. O sêmen foi descongelado a 70 ºC por 8 segundos. A análise de variância mostrou influência do animal nas diferentes variáveis, com exceção da motilidade espermática e integridade de membrana espermática. Na refrigeração (T2, o meio MP50 apresentou melhores resultados no teste hiposmótico e na integridade de membrana (p<0,05 e no sêmen descongelado (T3 não foi observada diferença significativa entre os meios (p>0,05. A análise ultra-estrutural do sêmen mostrou edema e ondulação da membrana plasmática e acrossomal nas diferentes etapas do processo de criopreservação. Conclui-se que os meios diluentes utilizados mostraram ser semelhantes quanto às características morfofuncionais após a descongelação. PALAVRAS-CHAVE: Cão, congelação, meio diluente, sêmen.

  4. Scanning electron microscopy of human sperms after preparation of semen for in-vitro fertilization. (United States)

    Grab, D; Thierauf, S; Rosenbusch, B; Sterzik, K


    Ultrastructural changes of human sperms after routine preparation for in-vitro fertilization were examined by scanning electron microscopy. Studies were performed with freshly ejaculated semen of 21 normozoospermic patients. Spermatozoa were analysed at 10000-fold (sperm head with acrosome, postacrosomal border and postnuclear cap) and 2500-fold (midpiece and endpiece of sperm tail) magnification. Compared with untreated specimens, slight membrane damage was found after routine washing and centrifugation procedures in swim-up preparations. However, on the basis of a score system for quantification of morphologic data, no statistically significant differences existed between untreated semen and swim-up preparations. We conclude that, with normozoospermic semen, the rate of ultrastructural damage attributable to sperm-washing procedures is too low to be of clinical consequence. PMID:8503704

  5. Studies on the collection and storage of semen from the African Elephant, loxodonta african

    Directory of Open Access Journals (Sweden)

    R.C. Jones


    Full Text Available Methods of semen collection following electrical stimulation are described. Semen was also collected from the male reproductive tract of slaughtered animals for several studies. Spermatozoa flushed from the male reproductive tract were immotile, but, dilution with buffered saline was sufficient to induce motility. It was found that the spermatozoa were sensitive to hypotpnic solutions and rapid cooling to 5C. Spermatozoa were frozen in egg yolk-citrate diluents. Dimethyl sulphoxide (DMSO was a better protective agent than glycerol. Eight per cent v/v was the best concentration of DMSO when used alone, but better results were obtained using a combination of 7% v/v DMSO and 1% v/v glycerol. A semen bank was established using these concentrations of protective agents and thawed samples from the bank showed good viability in the laboratory.


    Directory of Open Access Journals (Sweden)



    Full Text Available Objective of the present study was to document the semen producing ability, productive life and genetic ability for lactation milk yield of Sahiwal bulls used for artificial insemination (AI in Punjab and to find the impact of AI bulls on the improvement of Sahiwal cattle. Data from Semen Production Unit (SPU, Qadirabad, Sahiwal, Pakistan were used for this purpose. A repeatability animal model was used for estimation of breeding values for lactation milk yield. Productive life of a bull was calculated as a difference between culling age and the age at first ejaculation. Number of bulls brought to SPU varied from 9 to 102 for any year. Average number of doses of semen produced by any bull for a year varied from 724 to 5745. On the average, 238 bulls produced 17143 ± 1164 semen doses during their average stay of 5.4 ± 0.2 years. About 50% of the bulls stayed for less than four years at the SPU; with a maximum range of 14 years. Progeny tested bulls (n=90 produced 5000 and 10000 semen doses (Y in three and four years of stay (X, respectively (Y = 24.8 + 2.3635 X - 0.0112 X2. To produce 20,000 doses, it is predicted that bulls need to stay for six and a half years at the SPU. There was no association between breeding values for lactation milk yield estimated under a repeatability animal model (EBVs and number of semen doses produced (r = 0.17 and EBVs and number of daughters. Lack of genetic superiority of bulls used indicated that AI did not bring desired genetic improvement in Sahiwal cattle in the present situation. Modifications for judicious utilization of bulls are suggested along with improvements in data recording.

  7. Use of combinations of in vitro quality assessments to predict fertility of bovine semen. (United States)

    Sellem, E; Broekhuijse, M L W J; Chevrier, L; Camugli, S; Schmitt, E; Schibler, L; Koenen, E P C


    Predicting in vivo fertility of bull ejaculates using in vitro-assessed semen quality criteria remains challenging for the breeding industry. New technologies such as computer-assisted semen analysis (CASA) and flow cytometry may provide accurate and objective methods to improve semen quality control. The aim of this study was to evaluate the relationship between semen quality parameters and field fertility of bull ejaculates. A total of 153 ejaculates from 19 Holstein bulls have been analyzed using CASA (postthawing semen motility and morphology) and several flow cytometric tests, including sperm DNA integrity, viability (estimated by membrane integrity), acrosomal integrity, mitochondria aerobic functionality and oxidation. Samples were analyzed both immediately after thawing and after 4 hours at 37 °C. A fertility value (FV), based on nonreturn rate at 56 days after insemination and adjusted for environment factors, was calculated for each ejaculate. Simple and multiple regressions have been used to correlate FV with CASA and flow cytometric parameters. Significant simple correlations have been observed between some parameters and FV (e.g., straight line velocity [?m/s], r(2) = -0.12; polarized mitochondria sperm (%), r(2) = 0.07), but the relation between simple parameter and FV was too week to predict the fertility. Partial least square procedure identified several mathematical models combining flow cytometer and CASA variables and had better correlations with FV (adjusted r(2) ranging between 0.24 and 0.40 [P < 0.0001], depending on the number of included variables). In conclusion, this study suggests that quality assessment of thawed bull sperm using CASA and flow cytometry may provide a reasonable prediction of bovine semen fertility. Additional work will be required to increase the prediction reliability and promote this technology in routine artificial insemination laboratory practice. PMID:26296523

  8. The effect of breed on the survivability and motility rate of cryopreserved cock semen

    Scientific Electronic Library Online (English)

    M.B., Makhafola; K.C., Lehloenya; M.L., Mphaphathi; A., Dinnyes; T.L., Nedambale.

    Full Text Available This study evaluated the effect of breed on the survivability and motility rate of cryopreserved cock semen. Semen from three cock breeds; White Leghorn (WL), Ovambo (OV) and Potchefstroom Koekoek (PK) was collected by means of the abdominal massage technique. Following semen collection, sperm were [...] analyzed for motility and survivability with the use of contrast light BHTU microscope (20 x magnification). The semen was diluted (1 : 2 v/v) with egg yolk citrate (EYC) (extender A) and thereafter with extender B (EYC + 5% DMSO). The equilibration after each dilution was 2 h at 5 ºC. The diluted samples were evaluated for sperm concentration, motility, survivability and pH. The samples were then loaded into straws and cooled in programmable freezer from 5 ºC to -20 ºC at the rate of 1 ºC/minute. Semen straws were then exposed to liquid nitrogen vapour (-80 ºC) for five minutes, plunged directly into liquid nitrogen (-196 ºC) and stored for a week or more. Frozen straws were thawed at 5 ºC and evaluated at 0, 30, 60 and 90 min post-thaw. From the results there was no significant effect of breed on the survival and motility of fresh-diluted and frozen-thawed semen at 30 and 90 min post-thaw in all breeds. The sperm survivability of the PK breed was significantly higher than that of the WL breed. However, there was no sperm survivability difference between PK and OV breed immediately after thawing. The cryopreservation and thawing processes affected the survivability and motility of sperm of all poultry breeds negatively.

  9. Genome-wide association study for semen production traits in Holstein-Friesian bulls. (United States)

    Suchocki, T; Szyda, J


    Identifying genomic regions, particularly individual genes associated with semen quality traits, may be very important for improving sire fertility via selective breeding. The aim of the study was to estimate (co)variance components and effects of single nucleotide polymorphisms (SNP) from the Illumina BovineSNP50 BeadChip (Illumina, San Diego, CA) on semen production traits and to find candidate genes for these traits. The analyzed data set originates from the Polish Holstein-Friesian dairy cattle population and consists of 1,212 bulls kept at 4 artificial insemination stations. For each bull, 5 semen production traits were collected: sperm concentration, semen volume, number of spermatozoa, motility, and motility score. A multitrait mixed model was used to estimate genetic parameters. The parameters obtained were used to estimate SNP effects for each trait separately by the mixed model, which is used in the Polish direct genomic value project. Additionally, genes located in the vicinity of significant SNP were selected as candidate genes. For motility, 20 genome-wide significant SNP, located on 12 autosomes, were identified. For sperm concentration, we found 7 significant SNP: 3 on chromosome X, and 1 on chromosomes 1, 6, 23, and 24. For semen volume and motility score, 3 and 1 significant SNP were detected, respectively. All these SNP were located on chromosome X. For the number of spermatozoa, 12 significant SNP were observed. Six SNP were located on chromosome X, 3 on chromosome 8, and 1 on chromosomes 2, 7, and 16. This study clearly indicated a key role of the X chromosome in the determination of semen quality and emphasized that including such traits into genetic evaluation should be strongly considered. PMID:26051317

  10. The effect of Curcuma longa extracted (curcumin) on the quality of cryopreserved boar semen. (United States)

    Chanapiwat, Panida; Kaeoket, Kampon


    The aim of this study was to determine the optimal concentration of curcumin needed for cryopreservation of boar semen. Semen samples (n?=?9) were collected from nine Duroc boars which having proven fertility were used for routine artificial insemination. Semen samples were collected and divided into six groups (groups A-F) according to various concentrations of curcumin in freezing extender (i.e. 0, 0.125, 0.25, 0.50, 0.75 and 1.0?mmol/L, respectively). The semen was frozen by traditional liquid nitrogen vapor method and stored at -196°C in the liquid nitrogen tank. After storage, frozen semen samples were thawed at 50°C for 12?s and evaluated for progressive motility, viability and acrosome integrity. The present results indicated that the addition of curcumin at 0.25 (group C) or 0.50?mmol/L curcumin (group D) yielded the higher percentage of progressive motility (33.3 and 36.1%, respectively) (P?semen. PMID:26032188

  11. Decline of semen quality and increase of leukocytes with cigarette smoking in infertile men

    Directory of Open Access Journals (Sweden)

    Zhi Hong Zhang


    Full Text Available Background: Previous researches about the effect of smoking on semen quality are contradictory, and the mechanism behind the harmful effect of smoking on semen quality still remains unclear until today. Objective: The objectives of this study are evaluation of the relationship between smoking and fertility, investigation of the effects of cigarette smoking on sperm parameters and detection of presence of leukocytes within the semen of idiopathic infertile men from Northeastern China. Materials and Methods: A retrospective study of 1512 infertile patients who visited affiliated hospitals of Jilin University from 2007-2010 were enrolled in this study. Patients were assigned into one non-smoking and one smoking group which was divided into mild, moderate and heavy subgroups. Sperm parameters (including leukocytes and sperm morphology analysis were performed using standard techniques. Results: Compared with non-smokers, smokers had a significant decrease in semen volumes (p=0.006, rapid progressive motility (p=0.002 and sperm viability (p=0.019; moreover, smokers had a significant increase in the levels of immotile sperms (p=0.005 and semen leukocytes (p=0.002; pH and sperm concentration were not statistically significant (p=0.789 and p=0.297 respectively. Sperm motion parameters were all lower in the smokers except for beat-cross frequency (Hz (BCF. Further, the percentage of normal morphology sperm was decreased significantly in smokers (p=0.003, the sperm morphology was worse with increasing degree of smoking. Conclusion: These findings suggest that smoking leads to a significant decline in semen quality and higher levels of leukocytes, thus smoking may affects the fertilization efficiency.

  12. Computer aided boar semen motility analysis for cereulide detection in different food matrices. (United States)

    Rajkovic, Andreja; Uyttendaele, Mieke; Debevere, Johan


    Computer Aided Semen Analysis (CASA) study of the boar semen motility has been demonstrated to be an appropriate assay for detection of cereulide (Bacillus cereus emetic toxin). Application of the boar semen bio-assay to detect cereulide directly in foods requires investigation of potential interference of food components, preservatives and other microbial and chemical food contaminants with the bio-assay. Current study provides evidence that none of included Staphylococcus aureus enterotoxins A, B, C and D nor B. cereus Hemolysin BL (HBL) and non-hemolytic enterotoxin (NHE) and three mycotoxins (Sterigmatocystin, Fumonisin B1 and Patulin) exhibited a toxic impact on semen progressive motility. Aflatoxin M1, M3 and zearalenone impaired semen motility only at concentrations (0.004 mg ml(-1), 0.1 mg ml(-1) and 10 mg ml(-1), respectively) much higher than those found in foods and those permitted by legislation, in comparison to cereulide which induces motility cease at concentrations lower than 20 ng ml(-1). Ten commonly used preservatives, namely potassium sorbate, sodium benzoate, (DL) malic acid, citric acid, (L+) tartaric acid, acetic acid, (DL) lactic acid, (L+) ascorbic acid, sodium chloride and sucrose induced no cease in spermatozoa motility even at preservative concentrations higher than permitted by legislation. Dioxins, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and acrylamide had no acute effect on spermatozoa motility at concentrations of 500 and 10,000 mg ml(-1), respectively. Robustness of computer aided boar semen motility analysis, tested with 14 different foods inoculated with cereulide producing B. cereus, showed distinct cereulide production in seven samples (although B. cereus growth to counts higher than 8 log CFU g(-1) was noted in 11 samples), in amounts close to those reported in foodborne outbreaks. Test evaluation in 33 samples suspected to hold cereulide showed actual cereulide presence in ten samples and no interference of food matrix with the assay. PMID:17174428

  13. Herpesvírus bovino tipo 1 no sêmen / Bovine herpesvirus-1 in semen

    Scientific Electronic Library Online (English)

    Maurilio Andrade, Rocha; Aurora Maria Guimarães, Gouveia; Rômulo Cerqueira, Leite.


    Full Text Available O herpesvírus bovino tipo 1 (HVB-1) é o agente causador da rinotraqueíte infecciosa bovina, além de estar associado a doenças do trato genital em bovinos. A transmissão do HVB-1 através da inseminação artificial (IA) pode ocasionar problemas reprodutivos nas vacas inseminadas, como endometrite, infe [...] rtilidade, absorção embrionária e abortos. Animais infectados tornam-se portadores vitalícios do HVB-1 e podem apresentar episódios intermitentes de reexcreção viral. O HVB-1 poder ser encontrado no sêmen de touros, independente do desenvolvimento de anticorpos neutralizantes. Uma vez que os testes sorológicos não são suficientes para se estimar a presença do HVB-1 no sêmen e que as condições de processamento e armazenamento do sêmen são ideais para a preservação do vírus, somente o exame individual das partidas pode assegurar a comercialização de sêmen livre do vírus. Testes laboratoriais para detecção do HVB-1 no sêmen bovino e medidas adicionais para controlar a transmissão do vírus através da IA são apresentados. Abstract in english Bovine herpesvirus 1 (BHV-1) is the causative agent of infectious bovine rhinotracheitis (IBR) and is also associated with genital disease in cattle. BHV-1 transmission by artificial insemination (AI) may cause reproductive problems in inseminated cows, such as endometritis, infertility, embryonic a [...] bsorption and abortion. Infected animals are lifelong reservoirs of BHV-1 and may go through intermittent episodes of virus reexcretion. It is important to note that conditions of semen storage are optimal for virus survival. Additionally, BHV-1 can be found in bovine semen despite of the development of neutralizing antibody. Since serological tests are not sufficient to ascertain the presence of the virus in semen, the laboratory testing of all semen batches for BHV-1 is the only way to ensure the BHV-1-free status of the semen for commercialization. Laboratory tests used for BHV-1 detection in bovine semen and additional approaches to prevent the spread of BHV-1 through AI are presented.

  14. Optimizing human semen cryopreservation by reducing test vial volume and repetitive test vial sampling

    DEFF Research Database (Denmark)

    S. Fuglesang Jensen, Christian; Ohl, Dana A


    OBJECTIVE: To investigate optimal test vial (TV) volume, utility and reliability of TVs, intermediate temperature exposure (-88°C to -93°C) before cryostorage, cryostorage in nitrogen vapor (VN2) and liquid nitrogen (LN2), and long-term stability of VN2 cryostorage of human semen. DESIGN: Prospective clinical laboratory study. SETTING: University assisted reproductive technology (ART) laboratory. PATIENT(S): A total of 594 patients undergoing semen analysis and cryopreservation. INTERVENTION(S): Semen analysis, cryopreservation with different intermediate steps and in different volumes (50-1,000 ?L), and long-term storage in LN2 or VN2. MAIN OUTCOME MEASURE(S): Optimal TV volume, prediction of cryosurvival (CS) in ART procedure vials (ARTVs) with pre-freeze semen parameters and TV CS, post-thaw motility after two- or three-step semen cryopreservation and cryostorage in VN2 and LN2. RESULT(S): Test vial volume of 50 ?L yielded lower CS than other volumes tested. Cryosurvival of 100 ?L was similar to thatof larger volumes tested. An intermediate temperature exposure (-88°C to -93°C for 20 minutes) during cryopreservation did not affect post-thaw motility. Cryosurvival of TVs and ARTVs from the same ejaculate were similar. Cryosurvival of the first TV in a series of cryopreserved ejaculates was similar to and correlated with that of TVs from different ejaculates within the same patient. Cryosurvival of the first TV was correlated with subsequent ARTVs. Long-term cryostorage in VN2 did not affect CS. CONCLUSION(S): This study provides experimental evidence for use of a single 100 ?L TV per patient to predict CS when freezing multiple ejaculates over a short period of time (<10 days). Additionally, semen cryostorage in VN2 provides a stable and safe environment over time.

  15. Herpesvírus bovino tipo 1 no sêmen Bovine herpesvirus-1 in semen

    Directory of Open Access Journals (Sweden)

    Maurilio Andrade Rocha


    Full Text Available O herpesvírus bovino tipo 1 (HVB-1 é o agente causador da rinotraqueíte infecciosa bovina, além de estar associado a doenças do trato genital em bovinos. A transmissão do HVB-1 através da inseminação artificial (IA pode ocasionar problemas reprodutivos nas vacas inseminadas, como endometrite, infertilidade, absorção embrionária e abortos. Animais infectados tornam-se portadores vitalícios do HVB-1 e podem apresentar episódios intermitentes de reexcreção viral. O HVB-1 poder ser encontrado no sêmen de touros, independente do desenvolvimento de anticorpos neutralizantes. Uma vez que os testes sorológicos não são suficientes para se estimar a presença do HVB-1 no sêmen e que as condições de processamento e armazenamento do sêmen são ideais para a preservação do vírus, somente o exame individual das partidas pode assegurar a comercialização de sêmen livre do vírus. Testes laboratoriais para detecção do HVB-1 no sêmen bovino e medidas adicionais para controlar a transmissão do vírus através da IA são apresentados.Bovine herpesvirus 1 (BHV-1 is the causative agent of infectious bovine rhinotracheitis (IBR and is also associated with genital disease in cattle. BHV-1 transmission by artificial insemination (AI may cause reproductive problems in inseminated cows, such as endometritis, infertility, embryonic absorption and abortion. Infected animals are lifelong reservoirs of BHV-1 and may go through intermittent episodes of virus reexcretion. It is important to note that conditions of semen storage are optimal for virus survival. Additionally, BHV-1 can be found in bovine semen despite of the development of neutralizing antibody. Since serological tests are not sufficient to ascertain the presence of the virus in semen, the laboratory testing of all semen batches for BHV-1 is the only way to ensure the BHV-1-free status of the semen for commercialization. Laboratory tests used for BHV-1 detection in bovine semen and additional approaches to prevent the spread of BHV-1 through AI are presented.


    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo


    Full Text Available La reproducción juega un papel fundamental en el mejoramiento genético de los equinos. La criopreservación del semen equino es una técnica complementaria a los procesos de biotecnología reproductiva; sin embargo, solamente el 40% de los caballos producen semen que se puede criopreservar, con una alta variabilidad en su fertilidad. La confiabilidad de los métodos de evaluación del semen es trascendente para determinar su fertilidad potencial; no obstante, el análisis convencional por evaluación microscópica ha sido poco efectivo, en este sentido. El análisis de semen asistido por computador (CASA permite una medición objetiva de la movilidad de semen. Esta investigación tuvo como objetivo comparar la evaluación de la movilidad del semen equino, mediante los métodos convencional y SCA® (CASA. El semen de tres caballos de la raza criollo colombiano (tres eyaculados cada uno fue congelado, en un diluyente (4% de yema de huevo, 5% de dimetilformamida. La movilidad del semen descongelado, se determinó de forma convencional por microscopia de contraste de fase y mediante el software SCA®. Para el análisis estadístico, se ajustó un modelo lineal generalizado (GLM y se determinó la asociación entre las variables, a través de análisis de correlación y regresión. Se hallaron promedios de movilidad total de 54,3 ± 10,1 y 61,8 ± 13,9, para evaluación convencional y por el sistema SCA®, respectivamente. No se encontró diferencia significativa entre los métodos de análisis. Se concluye que el análisis de semen equino, mediante el método convencional y el sistema SCA®, es equiparable, para analizar la movilidad del semen equino criopreservado.

  17. Comparison of Extraction Methods to Detect Porcine Circovirus-2 and Porcine Reproductive and Respiratory Syndrome Virus in Semen Samples

    Directory of Open Access Journals (Sweden)

    Won-Il Kim


    Full Text Available Since, Porcine Circo Virus-2 (PCV2 and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV are shed in semen for a long period of time after infection and artificial insemination is a common practice in pig farms, semen is an important source of spreading these viruses to naive populations. Therefore, rapid and accurate detection of PCV2 or PRRSV in semen could be critical at the standpoint of disease prevention and control. In this study, the performance of three different extraction methods on semen samples was compared to determine an optimal extraction method for semen samples to detect PCV2 or PRRSV. Seven or 115 semen samples were collected from the boars experimentally challenged with PRRSV or PCV2, respectively. These two sets of the semen samples were processed by three different extraction methods: High-Throughput Total Nucleic Acids Isolation kit (HT-TNA, High-Throughput Viral RNA Isolation kit with modified procedure (mHT-VR and DNeasy kit or RNeasy kit for PCV2 or PRRSV, respectively. Then, the efficiency of the extraction methods were compared by conducting the same real-time PCR for each virus. HT-TNA and mHT-VR kits were faster and more convenient to process semen samples and HT-TNA kit showed higher or compatible sensitivity as compared to the other two methods while all three methods demonstrated 100% specificity. In conclusion, the HT-TNA Extraction Method could significantly reduce testing time and effort to process semen samples and showed better sensitivity for detection of PCV2 and PRRSV in semen.

  18. Effect of Saffron on Semen Parameters of Infertile Men

    Directory of Open Access Journals (Sweden)

    Soudabeh Givrad


    Full Text Available

    Introduction: We conducted this study to determine the effects of saffron (Crocus sativus on the results of semen analysis in men with idiopathic infertility.

    Materials and Methods: In this clinical trial, 52 nonsmoker infertile men whose problem could not be solved surgically were enrolled. They were treated by saffron for 3 months. Saffron, 50 mg, was solved in drinking milk and administered 3 times a week during the study course. Semen analysis was done before and after the treatment and the results were compared.

    Results: The mean percentage of sperm with normal morphology was 26.50 ± 6.44% before the treatment which increased to 33.90 ± 10.45%, thereafter (P < .001. The mean percentage of sperm with Class A motility was 5.32 ± 4.57% before and 11.77 ± 6.07% after the treatment (P < .001. Class B and C motilities were initially 10.09 ± 4.20% and 19.79 ± 9.11% which increased to 17.92 ± 6.50% (P < .001 and 25.35 ± 10.22% (P < .001, respectively. No significant increase was detected in sperm count; the mean sperm count was 43.45 ± 31.29 × 106/mL at baseline and 44.92 ± 28.36× 106/mL after the treatment period (P = .30.

    Conclusion: Saffron, as an antioxidant, is positively effective on sperm morphology and motility in infertile men, while it does not increase sperm count. We believe further studies on larger sample sizes are needed to elucidate the potential role and mechanism of action of saffron and its ingredient in the treatment of male infertility.

  19. Motility of liquid stored ram spermatozoa is altered by dilution rate independent of seminal plasma concentration. (United States)

    Mata-Campuzano, M; Soleilhavoup, C; Tsikis, G; Martinez-Pastor, F; de Graaf, S P; Druart, X


    The fertility after use of liquid stored ram semen following cervical AI rapidly decreases if semen is stored beyond 12h. The dilution of seminal plasma is often cited as a key contributor to the diminished motility and fertility of ram spermatozoa subjected to liquid preservation. Two experiments were conducted to assess the effect of spermatozoa concentration (i.e. dilution rate) and percentage of seminal plasma on the motility and viability of liquid stored ram spermatozoa. In Experiment 1, semen was diluted to one of seven concentrations ranging from 0.2 to 1.4×10(9)spermatozoa/ml with milk and assessed for motility after 3 or 24h of storage at 15°C. In Experiment 2, semen was collected and washed to remove seminal plasma before re-dilution to 0.2-1.4×10(9)spermatozoa/ml with milk containing 0%, 20% or 40% (final v/v ratio) seminal plasma and assessed for viability and motility after 3 or 24h of storage at 15°C. Whereas motility was not affected by spermatozoa concentration after 3h of storage, the proportion of progressive spermatozoa decreased after 24h of storage when spermatozoa concentration was greater than 1.0×10(9)spermatozoa/ml. The duration of preservation and the spermatozoa concentration affected spermatozoa motility but had no impact on spermatozoa viability. This negative effect of greater spermatozoa concentrations on motility was independent of the presence and the concentration of seminal plasma. The seminal plasma at both concentrations (20% and 40%) had a protective effect on spermatozoa motility after 24h of storage. These findings have the potential to improve the efficiency of cervical AI with liquid stored ram semen. PMID:26421370

  20. Computer-assisted semen analysis parameters as predictors for fertility of men from the general population

    DEFF Research Database (Denmark)

    Larsen, L; Scheike, Thomas Harder; Jensen, Tina Kold; Bonde, Jens Peter; Ernst, Erik; Hjollund, N H; Zhou, Y; Skakkebaek, N E; Giwercman, Aleksander


    The predictive value of sperm motility parameters obtained by computer-assisted semen analysis (CASA) was evaluated for the fertility of men from general population. In a prospective study with couples stopping use of contraception in order to try to conceive, CASA was performed on semen samples...... from 358 men. A recently developed CASA system, Copenhagen Rigshospitalet Image house sperm Motility Analysis System (CRISMAS) was used for assessment of motility parameters. This system has an editing function which allows correction of tracks made by the computer. Probably due to this function, the...

  1. Some altered concentrations of elements in semen of workers exposed to trinitrotoluene.


    Liu, H. X.; Qin, W H; Wang, G R; Yang, Z.Z.; Chang, Y X; Jiang, Q G


    OBJECTIVES--A cross sectional study was performed to find the concentrations of elements contained in the semen of workers exposed to trinitrotoluene (TNT). SUBJECTS AND METHODS--Semen of exposed workers in two TNT plants located in He-Nan Province in 1992 were examined. RESULTS--The average TNT concentrations in the workplace, except the packing site, were found to have exceeded the maximal allowable concentration (MAC, 1 mg/m3); skin contaminations of male workers exposed to TNT were higher...

  2. Is maternal obesity related to semen quality in the male offspring? A pilot study

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia Høst; Nøhr, Ellen Aagaard; Thulstrup, A M; Bonde, Jens Peter; Storgaard, Lone; Olsen, Jørn


    underweight, and 25 sons of overweight, mothers. RESULTS: Inhibin B decreased with increasing maternal BMI (P = 0.04) and the point estimates for sperm concentration, semen volume, percent motile sperm, testosterone and FSH suggested an impaired reproductive status among sons of overweight mothers, but none...... of the trends were statistically significant. CONCLUSIONS: The results suggest that there may be an effect of high maternal BMI on the sons' semen quality, but the study had only enough power to justify a critical evaluation of the hypothesis in a larger study. Udgivelsesdato: 2007-Oct...

  3. Evaluation of buffalo semen by Trypan blue/Giemsa staining and related fertility in vitro


    B. Gasparrini; Mariotti, E.; L. Attanasio; De Rosa, A.; R. Di Palo; Boccia, L.


    The aim of this work was to verify the feasibility of an easy, quick double staining technique for evaluation of frozen-thawed semen to predict the fertilizing capability in vitro of buffalo bulls. In Experiment 1, frozen-thawed semen from 6 bulls was stained with double Trypan blue/ Giemsa and the incidence of acrosome-intact live (AIL), acrosome-intact dead (AID), acrosome-lost live (ALL) and acrosome-lost dead (ALD) sperm was recorded. In Experiment 2, sperm from the same bulls were used t...

  4. Survival of chlamydiae in human semen prepared for artificial insemination by donor

    DEFF Research Database (Denmark)

    Thorsen, Poul; Møller, Birger R.; Halkier-Sørensen, Lars; From, E; Nielsen, Niels Christian


    after storage when examined by enzyme immunoassay (Chlamydiazyme). When examined by cell culture, four proved chlamydia- positive before storage and two afterwards. The results indicate that testing for C. trachomatis has to be performed from the urethra of all donors of semen used for artificial......Semen specimens from 21 men with urethral infection with Chlamydia trachomatis were tested for the presence of the organism before and after cryopreservation for 3 weeks of storage at -196 degrees C. Five specimens were chlamydia-positive before preservation and four of them were still positive...

  5. Semen characteristics of goats with subacute, acute and chronic besnoitiosis : research communication

    Directory of Open Access Journals (Sweden)

    M.J. Njenga


    Full Text Available A study on the semen obtained from breeding goats suffering from mild to severe chronic besnoitiosis revealed marked changes in semen volume, colour, density, concentration, mass and individual motility and percentage live. There were also many neutrophils and spermatozoa with primary and secondary defects, including missing tails and deformed heads and tails. The observed changes were considered to be severe enough to account for the infertility observed in the flock. Sections of testes obtained for histopathology were characterised by massive blockage of the pampiniform plexus, degeneration of the germinal epithelium, tubular necrosis with an inflammatory infiltrate and, in some cases, accumulation of haemosiderin-like material in the tunica vaginalis.

  6. The relationship between sperm quality in cool-shipped semen and embryo recovery rate in horses. (United States)

    Love, C C; Noble, J K; Standridge, S A; Bearden, C T; Blanchard, T L; Varner, D D; Cavinder, C A


    The relationship between the quality of cool-shipped stallion semen and fertility has not been adequately described. This study evaluated sperm quality of cool-shipped semen from 459 ejaculates (N = 130 stallions) that were used for insemination of 196 embryo donor mares (n = 496 estrous cycles). Embryo recovery rate (ERR; %) increased, as all sperm measures (e.g., motility, viability, DNA quality, morphology, concentration, and total number) increased. Threshold values are reported for each sperm quality measure (e.g., total sperm motility ? 65%) that separate two ERR groups (e.g., average: ?50% ERR; high: ?65% ERR). PMID:26363735

  7. Compact and Light-Weight Automated Semen Analysis Platform Using Lensfree on-Chip Microscopy


    Su, Ting-wei; Erlinger, Anthony; Tseng, Derek; Ozcan, Aydogan


    We demonstrate a compact and lightweight platform to conduct automated semen analysis using a lensfree on-chip microscope. This holographic on-chip imaging platform weighs ~46 g, measures ~4.2 × 4.2 × 5.8 cm, and does not require any lenses, lasers or other bulky optical components to achieve phase and amplitude imaging of sperms over ~24 mm2 field-of-view with an effective numerical aperture of ~0.2. Using this wide-field lensfree on-chip microscope, semen samples are imaged for ~10 s, captu...

  8. Caffeine intake and semen quality in a population of 2,554 young Danish men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Swan, Shanna H; Skakkebaek, Niels E; Rasmussen, Sanne; Jørgensen, Niels


    The authors examined the association between semen quality and caffeine intake among 2,554 young Danish men recruited when they were examined to determine their fitness for military service in 2001-2005. The men delivered a semen sample and answered a questionnaire including information about caffeine intake from various sources, from which total caffeine intake was calculated. Moderate caffeine and cola intakes (101-800 mg/day and

  9. Effects of He-Ne laser irradiation on the storage of turkey semen

    Directory of Open Access Journals (Sweden)

    S. Passarella


    Full Text Available Maintenance or improvement of sperm quality during storage could prevent the loss of fertilizing capacity associated with stored turkey semen. Therefore the optimization of stored turkey semen could be useful to breeder industry since the commercial production of this bird relies almost entirely on artificial insemination. Previous research have shown that He-Ne laser irradiation in mammalian sperm increased the motility (Stato, 1986, decreased the mortality, promoted the acrosome reaction, which have a pivotal role in assisted fecundating programmes as therapy for resolving infertility in domestic animals..........

  10. The effect of cigarette smoking on semen quality of infertile men

    International Nuclear Information System (INIS)

    To evaluate the effects of cigarette smoking on semen quality of infertile men. Two hundred fourteen infertile men who had been smoking cigarette and one hundred thirty infertile non smokers men participated in this study. Seminal volume, sperm concentration, motility, viability, and morphology were examined. The quality of spermatozoa obtained from smokers were much lower than non-smokers (P<0.01). The sperm concentration, viability and forward progression were negatively correlated with cigarette smoking (P<0.01). Smoking does affect the semen quality of infertile men. (author)

  11. Vitamin E and reduced glutathione in Prochilodus lineatus (curimba) semen cryopreservation (Characiformes: Prochilodontidae)

    Scientific Electronic Library Online (English)

    Daniella A. J., Paula; Estefânia S., Andrade; Luis D. S., Murgas; Viviane O., Felizardo; Elissandra U., Winkaler; Walmes, Zeviani; Rilke T. F., Freitas.


    Full Text Available Este estudo avaliou a adição de antioxidantes vitamina E e glutationa reduzida no sêmen criopreservado de curimba (Prochilodus lineatus) e comparou solução de bicarbonato de sódio e água destilada como ativadores. O experimento foi conduzido na estação ambiental da CEMIG, em Itutinga-MG, entre Dezem [...] bro/2009 e Janeiro/2010. Sêmen de sete animais, com motilidade espermática acima de 80%, foi diluído em soluções crioprotetoras compostas por metanol 10% e lactose 15% em diferentes concentrações de antioxidantes: 50 (VE50), 100 (VE100) e 250 (VE250) µM de vitamina E, 0,5 (RG5.5), 1,0 (RG1.0) e 1,5 (RG1.5) mM glutationa reduzida e uma solução controle sem antioxidante. O sêmen foi diluído na proporção de 1:4 (100 µL de sêmen: 400 µL de solução crioprotetora). A toxicidade das soluções foi avaliada pela motilidade espermática após de 10 minutos em solução. O restante do sêmen diluído foi armazenado em palhetas de 0,5 mL mantidos em vapor de nitrogênio por 24 horas e estocado em cilindro de nitrogênio líquido por quatro dias. As amostras foram descongeladas em banho-maria a 60°C por 8 segundos e avaliada a taxa (%) e duração (s) pela ativação do sêmen com água destilada e bicarbonato de sódio a 1%. No teste de toxicidade, observamos que os antioxidantes da vitamina E e glutationa, nas diferentes concentrações, não foram tóxicos para o sêmen do curimba (P>0,05). A duração da motilidade foi maior (P0,05). Assim, os antioxidantes vitamina E e glutationa reduzida não melhoram a qualidade do sêmen criopreservado de curimba, mas não causam efeitos tóxicos para o sêmen in natura e criopreservados por não diminuir sua qualidade durante a criopreservação. Abstract in english This study investigated the addition of antioxidants vitamin E and reduced glutathione on curimba (Prochilodus lineatus) semen cryopreservation and compared sodium bicarbonate solution and distilled water as activators. The experiment was conducted at the environmental station of CEMIG, in Itutinga- [...] MG, Brazil, between December/2009 and January/2010. Semen samples (n = 7) with semen motility above 80% were diluted in cryoprotectant solutions composed of 10% methanol, 15% lactose and containing different concentrations of antioxidants: 50 (VE50), 100 (VE100) and 250 (VE250) µM of vitamin E, and 0.5 (RG0.5), 1.0 (RG1.0) and 1.5 (RG1.5) mM of reduced glutathione. A solution without antioxidants was used as a control. The semen was diluted at a ratio of 1:4 (100 ìL semen:400 ?L cryoprotectant solution). The toxicity of the solutions was evaluated by investigating semen motility after 10 min in the solution. The rest of the diluted semen was placed into 0.5 mL straws maintained in nitrogen vapour for 24 hours and packed into a nitrogen liquid cylinder for four days. The samples were thawed in a water bath at 60°C for 8 s and the rate (%) and duration (s) of semen activation with distilled water or sodium bicarbonate was evaluated. In the toxicity test, we found that vitamin E and reduced glutathione were not toxic to curimba semen at any of the tested concentrations (P>0.05). The duration of motility was longer (P0.05). Thus, the antioxidants vitamin E and reduced glutathione did not improve the quality of cryopreserved curimba semen, but they did not cause toxic effects to the semen in natura and they did not decrease its quality during cryopreservation.

  12. Vitamin E and reduced glutathione in Prochilodus lineatus (curimba semen cryopreservation (Characiformes: Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Daniella A. J. Paula


    Full Text Available This study investigated the addition of antioxidants vitamin E and reduced glutathione on curimba (Prochilodus lineatus semen cryopreservation and compared sodium bicarbonate solution and distilled water as activators. The experiment was conducted at the environmental station of CEMIG, in Itutinga-MG, Brazil, between December/2009 and January/2010. Semen samples (n = 7 with semen motility above 80% were diluted in cryoprotectant solutions composed of 10% methanol, 15% lactose and containing different concentrations of antioxidants: 50 (VE50, 100 (VE100 and 250 (VE250 µM of vitamin E, and 0.5 (RG0.5, 1.0 (RG1.0 and 1.5 (RG1.5 mM of reduced glutathione. A solution without antioxidants was used as a control. The semen was diluted at a ratio of 1:4 (100 ìL semen:400 ?L cryoprotectant solution. The toxicity of the solutions was evaluated by investigating semen motility after 10 min in the solution. The rest of the diluted semen was placed into 0.5 mL straws maintained in nitrogen vapour for 24 hours and packed into a nitrogen liquid cylinder for four days. The samples were thawed in a water bath at 60°C for 8 s and the rate (% and duration (s of semen activation with distilled water or sodium bicarbonate was evaluated. In the toxicity test, we found that vitamin E and reduced glutathione were not toxic to curimba semen at any of the tested concentrations (P>0.05. The duration of motility was longer (P0.05. Thus, the antioxidants vitamin E and reduced glutathione did not improve the quality of cryopreserved curimba semen, but they did not cause toxic effects to the semen in natura and they did not decrease its quality during cryopreservation.Este estudo avaliou a adição de antioxidantes vitamina E e glutationa reduzida no sêmen criopreservado de curimba (Prochilodus lineatus e comparou solução de bicarbonato de sódio e água destilada como ativadores. O experimento foi conduzido na estação ambiental da CEMIG, em Itutinga-MG, entre Dezembro/2009 e Janeiro/2010. Sêmen de sete animais, com motilidade espermática acima de 80%, foi diluído em soluções crioprotetoras compostas por metanol 10% e lactose 15% em diferentes concentrações de antioxidantes: 50 (VE50, 100 (VE100 e 250 (VE250 µM de vitamina E, 0,5 (RG5.5, 1,0 (RG1.0 e 1,5 (RG1.5 mM glutationa reduzida e uma solução controle sem antioxidante. O sêmen foi diluído na proporção de 1:4 (100 µL de sêmen: 400 µL de solução crioprotetora. A toxicidade das soluções foi avaliada pela motilidade espermática após de 10 minutos em solução. O restante do sêmen diluído foi armazenado em palhetas de 0,5 mL mantidos em vapor de nitrogênio por 24 horas e estocado em cilindro de nitrogênio líquido por quatro dias. As amostras foram descongeladas em banho-maria a 60°C por 8 segundos e avaliada a taxa (% e duração (s pela ativação do sêmen com água destilada e bicarbonato de sódio a 1%. No teste de toxicidade, observamos que os antioxidantes da vitamina E e glutationa, nas diferentes concentrações, não foram tóxicos para o sêmen do curimba (P>0,05. A duração da motilidade foi maior (P0,05. Assim, os antioxidantes vitamina E e glutationa reduzida não melhoram a qualidade do sêmen criopreservado de curimba, mas não causam efeitos tóxicos para o sêmen in natura e criopreservados por não diminuir sua qualidade durante a criopreservação.

  13. Correlation between chemical composition of seminal plasma and sperm motility characteristics of Prussian carp (Carassius gibelio

    Directory of Open Access Journals (Sweden)

    M. Mehdi Taati


    Full Text Available The objectives of the present study were to determine the relationships between chemicalscompositions of seminal plasma with sperm motility traits in Prussian carp, Carassius gibelio (Bloch,1782. There were significant positive correlations between sperm movment duration and Ca+2 of semen.Also, a significant positive relationship was found between percentage of motile spermatozoa and Ca+2 ofsemen. On the other hand, Na+, Cl- and pH correlated negatively with sperm movment duration.Understanding of such correlations can be useful to evaluation of sperm quality and make media(extender for dilution of semen and improving sperm motility parameters of Prussian carp.

  14. Infecciones de Transmisión Sexual en Semen: El Hombre como Vector de Transmisión Sexual Transmission Infections in Semen: Men as Vector Transmission


    Tamara Viscarra A; Priscilla Brebi M; Alejandra Andana V; Raúl Sánchez G


    En los últimos años el estudio de las infecciones de transmisión sexual ha cobrado gran importancia debido principalmente al incremento de estas en parejas heterosexuales y hombres que tienen sexo con hombres. En mujeres existe mucha información de epidemiología y patogénesis de estas infecciones, sin embargo, en hombres la información es muy escasa debido a que la mayoría no presenta sintomatología. En los últimos años se ha evidenciado un creciente interés en el estudio del semen como vía d...

  15. Infecciones de Transmisión Sexual en Semen: El Hombre como Vector de Transmisión / Sexual Transmission Infections in Semen: Men as Vector Transmission

    Scientific Electronic Library Online (English)

    Tamara, Viscarra A; Priscilla, Brebi M; Alejandra, Andana V; Raúl, Sánchez G.


    Full Text Available En los últimos años el estudio de las infecciones de transmisión sexual ha cobrado gran importancia debido principalmente al incremento de estas en parejas heterosexuales y hombres que tienen sexo con hombres. En mujeres existe mucha información de epidemiología y patogénesis de estas infecciones, s [...] in embargo, en hombres la información es muy escasa debido a que la mayoría no presenta sintomatología. En los últimos años se ha evidenciado un creciente interés en el estudio del semen como vía de transmisión, debido principalmente a la afinidad de algunos patógenos con los espermatozoides. Dentro de los principales microorganismos infectantes en semen se encuentran Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Virus de la Inmunodeficiencia Humana tipos 1 y 2, Virus Herpes Simplex 1 y 2, Virus Papiloma Humano, Virus de la Hepatitis B y C, Citomegalovirus, Virus Epstein-Barr y Trichomonas vaginalis. Abstract in english Sexually transmitted infections study has become an important issue in these days, mainly due to the increment of heterosexual and men have sex with men partners of people. In women, there is a lot information about epidemiology and pathogenesis of these infections. However, the information is very [...] limited in men, because most infected men are asymptomatic. In recent years, there has been an increasing interest in study of semen as a transmission way, due to the affinity of some pathogens to sperm. The most prevalent microorganisms infecting semen are: Chlamydia trachomatis, Neisseria gonorrhoeae, Mollicutes, Human Immunodeficiency Virus Types 1 and 2 Herpes Simplex Virus 1 and 2, Human Papillomavirus, Hepatitis B and C virus, Cytomegalovirus, Epstein-Barr and Trichomonas vaginalis.

  16. Cloned embryos from semen. Part 2: intergeneric nuclear transfer of semen-derived eland (Taurotragus oryx) epithelial cells into bovine oocytes. (United States)

    Nel-Themaat, Liesl; Gómez, Martha C; Pope, C Earle; Lopez, Monica; Wirtu, Gemechu; Jenkins, Jill A; Cole, Alex; Dresser, Betsy L; Bondioli, Kenneth R; Godke, Robert A


    The production of cloned offspring by nuclear transfer (NT) of semen-derived somatic cells holds considerable potential for the incorporation of novel genes into endangered species populations. Because oocytes from endangered species are scarce, domestic species oocytes are often used as cytoplasts for interspecies NT. In the present study, epithelial cells isolated from eland semen were used for intergeneric transfer (IgNT) into enucleated bovine oocytes and compared with bovine NT embryos. Cleavage rates of bovine NT and eland IgNT embryos were similar (80 vs. 83%, respectively; p > 0.05); however, development to the morula and blastocyst stage was higher for bovine NT embryos (38 and 21%, respectively; p or = 8 cells at 84 hpa, while 32% of the bovine NT embryos had > or = 8 cells at the same interval. However, 100 and 66% of bovine NT and eland IgNT embryos, respectively, that had > or = 8 cells synthesized DNA. From these results we concluded that (1) semen-derived epithelial cell nuclei can interact and be transcriptionally controlled by bovine cytoplast, (2) the first cell-cycle occurred in IgNT embryos, (3) a high frequency of developmental arrest occurs before the eight-cell stage in IgNT embryos, and (4) IgNT embryos that progress through the early cleavage stage arrest can (a) synthesize DNA, (b) progress through subsequent cell cycles, and (c) may have the potential to develop further. PMID:18241126

  17. A comparison of conventional and computer-assisted semen analysis (CRISMAS software) using samples from 166 young Danish men

    DEFF Research Database (Denmark)

    Vested, Anne; Ramlau-Hansen, Cecilia H


    The aim of the present study was to compare assessments of sperm concentration and sperm motility analysed by conventional semen analysis with those obtained by computer-assisted semen analysis (CASA) (Copenhagen Rigshospitalet Image House Sperm Motility Analysis System (CRISMAS) 4.6 software) using semen samples from 166 young Danish men. The CRISMAS software identifies sperm concentration and classifies spermatozoa into three motility categories. To enable comparison of the two methods, the four motility stages obtained by conventional semen analysis were, based on their velocity classifications, divided into three stages, comparable to the three CRISMAS motility categories: rapidly progressive (A), slowly progressive (B) and non-progressive (C+D). Differences between the two methods were large for all investigated parameters (P <0.001). CRISMAS overestimated sperm concentration and the proportion of rapidly progressive spermatozoa and, consequently, underestimated the percentages of slowly progressive and non-progressive spermatozoa, compared to the conventional method. To investigate whether results drifted according to time of semen analysis, results were pooled into quarters according to date of semen analysis. CRISMAS motility results appeared more stable over time compared to the conventional analysis; however, neither method showed any trends. Apparently, CRISMAS CASA results and results from the conventional method were not comparable with respect to sperm concentration and motility analysis. This needs to be accounted for in clinics using this software and in studies of determinants of these semen characteristics.

  18. Increase in post-thaw viability by adding seminal plasma proteins to Sanmartinero and Zebu sperm

    Directory of Open Access Journals (Sweden)

    Fabián L Rueda


    Full Text Available Background: cryopreservation decreases sperm viability by approximately 50%. Objective: the objective of this study was to determine the effect of the addition of seminal plasma proteins on post-thawing sperm viability in Sanmartinero and Zebu semen. Methods: semen samples from 10 bulls of each breed were used, and seminal plasma was subjected to two-dimensional electrophoresis to establish the relationship between the relative amount of each protein spot and sperm viability. Then, seminal plasma was subjected to exclusion chromatography to separate the fraction containing these proteins. This fraction was added in doses of 0.5, 1.0, 1.5 and 2.0 mg, to 1 x 10(6. Sperm was thawed and incubated at 37 °C for 1 h to determine its effect on postthaw viability. Sperm were frozen using two media (citrate-fructose-yolk and Bioxcell®. Results: we found one protein spot (16.20 kDa, PI 5.5 in Sanmartinero seminal plasma that correlated (r = 0.64 p<0.001 with viability. This spot was found in 21-25 chromatography fractions. The percentage of post-thaw viable sperm increased 20% (p<0.05 at 1.0 and 1.5 mg of the fraction when sperm was frozen using citrate-fructose-yolk; it increased 25% (p<0.01 with 0.5 mg when it was frozen with Bioxcell® media. Addition of 0.5 mg of the fraction to semen cryopreserved with Bioxcell® resulted in a greater (p<0.05 percentage increase of viable sperm in Sanmartinero semen (23 ± 8.3% compared with Zebu semen (6.0 ± 2.0%. Conclusions: these results show that seminal plasma proteins decrease cryopreservation damage in sperm. The effect depends on the cryoprotectant dose as well as the breed of bull.

  19. Apoptotic markers in semen of infertile men: association with cigarette smoking

    Scientific Electronic Library Online (English)

    Nagla T., El-Melegy; Mohamed-Esam M., Ali.


    Full Text Available OBJECTIVES: (i) To examine the role of apoptosis in the pathogenesis of DNA damage in semen from infertile men. (ii) To assess the effects of smoking on apoptotic markers and seminal parameters among infertile men. (iii) To assess the correlation of apoptosis with conventional semen parameters. MATE [...] RIALS AND METHODS: The study was carried out on 70 men with idiopathic infertility, divided into two groups: thirty infertile non smokers and forty infertile smokers. In addition to 60 fertile men (30 non smokers and 30 smokers) as control group. Each subject provided semen for analysis of parameters, determination of % of DNA fragmentation, s-Fas, caspase-3 activity levels and cotinine levels. RESULTS: The results revealed that infertile men, particularly smokers have significantly lower semen variables and significantly higher levels of apoptotic variables (% of DNA fragmentation, s-Fas and caspase-3 activity) in addition to cotinine. CONCLUSIONS: The present findings provide additional evidence supporting the importance of the evaluation of apoptotic markers to test male infertility particularly among smokers.

  20. Recent adverse trends in semen quality and testis cancer incidence among Finnish men

    DEFF Research Database (Denmark)

    Jorgensen, N.; Vierula, M.; Jacobsen, R.; Pukkala, E.; Perheentupa, A.; Virtanen, H. E.; Skakkebk, N. E.; Toppari, J.


    Impaired semen quality and testicular cancer may be linked through a testicular dysgenesis syndrome of foetal origin. The incidence of testis cancer has been shown to increase among Finnish men, whereas there is no recent publication describing temporal trends in semen quality. Therefore, we...... carried out a prospective semen quality study and a registry study of testis cancer incidence among Finnish men to explore recent trends. A total of 858 men were investigated in the semen quality study during 1998-2006. Median sperm concentrations were 67 (95% CI 57-80) million/mL, 60 (51-71) and 48 (39......-60) for birth cohorts 1979-81, 1982-83 and 1987; total sperm counts 227 (189-272) million, 202 (170-240) and 165 (132-207); total number of morphologically normal spermatozoa 18 (14-23) million, 15 (12-19) and 11 (8-15). Men aged 10-59 years at the time of diagnosis with testicular cancer during 1954...

  1. A comparative evaluation of semen parameters in pre- and post-Hurricane Katrina human population

    Directory of Open Access Journals (Sweden)

    Caner Baran


    Full Text Available A natural disaster leading to accumulation of environmental contaminants may have substantial effects on the male reproductive system. Our aim was to compare and assess semen parameters in a normospermic population residing in the Southern Louisiana, USA area pre- and post-Hurricane Katrina. We retrospectively evaluated semen analyses data (n = 3452 of 1855 patients who attended the Tulane University Andrology/Fertility Clinic between 1999 and 2013. The study inclusion criteria were men whose semen analyses showed ? 1.5 ml volume; ?15 million ml -1 sperm concentration; ?39 million total sperm count; ?40% motility; >30% morphology, with an abstinence interval of 2-7 days. After the inclusion criteria applied to the population, 367 normospermic patients were included in the study. Descriptive statistics and group-based analyses were performed to interpret the differences between the pre-Katrina (Group 1, 1999-2005 and the post-Katrina (Group 2, 2006-2013 populations. There were significant differences in motility, morphology, number of white blood cell, immature germ cell count, pH and presence of sperm agglutination, but surprisingly there were no significant differences in sperm count between the two populations. This long-term comparative analysis further documents that a major natural disaster with its accompanied environmental issues can influence certain semen parameters (e.g., motility and morphology and, by extension, fertility potential of the population of such areas.

  2. Mycoplasma agalactiae in semen and milk of goat from Pernambuco state, Brazil

    Directory of Open Access Journals (Sweden)

    Bruno H.L.S. Alves


    Full Text Available In goat and sheep flocks, mycoplasmosis is a disease that may cause severe economical losses associated with polyarthritis, mastitis, agalactia, conjunctivitis, pneumonia and reproductive failure. The latter may involve repeat breeding, granular vulvovaginitis, infertility and abortions. The aim of the present study was to assess the occurrence of Mycoplasma agalactiae (Ma in semen and milk samples from naturally infected goat in the semiarid region from Pernambuco State, Northeast from Brazil. Thirty-nine semen samples and 81 milk samples were submitted to DNA extraction using a commercially available kit and following the manufacturer's instructions. The polymerase chain reaction (PCR was then performed in accordance with protocols described in the literature. The results of the present study revealed the presence of Ma in the DNA of 17.9% (7/39 of the semen samples and 3.7% (3/81 of the milk samples. The results obtained in the present study confirm the elimination of the DNA of Ma in the semen and milk samples. The presence of this agent in goat flocks is considered very risky in terms of reproductive disorders and contagious agalactia outbreaks in the Northeast region of Brazil.

  3. Maternal folic acid supplement intake and semen quality in Danish sons: a follow-up study

    DEFF Research Database (Denmark)

    Jacobsen, Kristoffer; Ramlau-Hansen, Cecilia HØst


    OBJECTIVE: To examine whether maternal folic acid supplement intake during pregnancy is related to better semen quality in male offspring. DESIGN: A follow-up study. SETTING: Two major Danish municipalities, Aalborg and Odense. PATIENT(S): The study population included 347 singleton sons of mothers enrolled into the Healthy Habits for Two cohort when pregnant in 1984-87. INTERVENTION(S): Information on maternal folic acid supplement intake during pregnancy was provided by self-administered questionnaire in the 36th week of gestation. MAIN OUTCOME MEASURE(S): Semen characteristics and serum concentrations of sex hormones. RESULT(S): The distribution of semen characteristics among sons whose mothers took folic acid supplement during pregnancy (n = 88, 25%) did not differ from the distributions among those without (n = 75, 22%) or with unknown folic acid supplement intake (n = 84, 53%). On the contrary, serum levels of FSH and LH were significantly higher in the folic acid supplement group. CONCLUSION(S): The hypothesis that folic acid supplement intake during pregnancy will improve semen quality in male offspring was not corroborated by a follow-up study in young Danish men.

  4. Parental infertility and semen quality in male offspring : a follow-up study

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia HØst; Thulstrup, Ane Marie


    Jensen et al. (Am J Epidemiol 2007;165:583-90) reported for the first time that men whose mothers had received fertility treatment had poor semen quality. This result could be confounded by the mothers' body mass index. Obesity is a strong predictor of fecundity and could have a programming effect on semen quality through hormonal factors or links to fetal growth. The authors of the current study tried to replicate the finding of Jensen et al. after controlling for maternal body mass index and other covariates using data from a recently conducted, population-based, Danish follow-up study on the association between maternal smoking during pregnancy in 1984-1987 and sons' semen quality, in which the participants were sampled according to levels of maternal smoking during pregnancy. After adjustment, sons of mothers who reported that they had been examined or treated for childlessness (n = 30) had a lower sperm concentration and total sperm count and fewer motile and morphologically normal spermatozoa in comparison with sons of mothers who had not been examined or treated for childlessness (n = 295). None of the differences (except for semen concentration) between the groups reached statistical significance, but the study has limited power. The findings were in the same direction as those reported by Jensen et al. and do not indicate that their results are confounded by maternal body mass index.

  5. Semen Abnormalities, Sperm DNA Damage and Global Hypermethylation in Health Workers Occupationally Exposed to Ionizing Radiation


    Kumar, Dayanidhi; Salian, Sujith Raj; Kalthur, Guruprasad; Uppangala, Shubhashree; Kumari, Sandhya; Challapalli, Srinivas; Chandraguthi, Srinidhi Gururajarao; Krishnamurthy, Hanumanthappa; Jain, Navya; Kumar, Pratap; Adiga, Satish Kumar


    Background Cytogenetic studies have demonstrated that low levels of chronic radiation exposure can potentially increase the frequency of chromosomal aberrations and aneuploidy in somatic cells. Epidemiological studies have shown that health workers occupationally exposed to ionizing radiation bear an increased risk of hematological malignancies. Objectives To find the influence of occupational radiation exposure on semen characteristics, including genetic and epigenetic integrity of spermatoz...

  6. Alterations in semen parameters in men w?th epilepsy treated with valproate

    Directory of Open Access Journals (Sweden)

    Hatice Kose-Ozlece


    Full Text Available Background: Besides the well-known adverse effects of valproate (VPA, disorders related to male reproductive functions have been reported. Furthermore, only a limited number of previous studies have reported the relationship between VPA dose and impairment of the hormonal axis and semen quality. A patient with reversible changes that occurred in the sperm parameters after a dose increment of VPA.Methods: A 34-year-old male patient who was diagnosed with juvenile myoclonic epilepsy almost 15 years ago was admitted to our clinic. His seizures responded well to high doses of VPA treatment.Results: As the VPA dose was increased, consecutive semen analyses were performed and averaged for each dose; the results showed a remarkable decline in the sperm count and a manifest loss of sperm motility. VPA treatment was gradually diminished and stopped; meanwhile, treatment with another antiepileptic (lamotrigin was initiated to control the patient’s seizures. Nine months later, the patient’s semen analysis was within normal ranges. After modification of the patient’s treatment regimen, he and his wife had a healthy baby.Conclusion: We suggest that VPA-dependent impairments in the hormone and semen analysis parameters were reversible after the termination of medical treatment, and that the VPA treatment did not cause permanent hormonal deregulation and, these side effects are dose dependent.

  7. Factors affecting the distribution and abundance of the flagellated alga Gonyostomum semen (Ehrenberg) Diesing in Finland


    Sjönberg, Tuomo


    Limalevä Gonyostomum semen (Ehrenberg) Diesing on nykyisin laajalle levinnyt ja runsas siimalevä Pohjoismaiden järvien planktonleväyhteisöissä. Levää esiintyy etenkin humuspitoisissa järvissä ja se voi muodostaa runsaita kukintoja, jotka voivat haitata vedenpuhdistuslaitoksia ja uimareita. Järven pieni koko, tummavetisyys, vähän hapan vesi ja tyypilliset ravinnepitoisuudet ja lajin käyttäytymisen ominaispiirteet ovat olleet selityksinä lajin runsastumiselle. Tässä tutkimuksessa arvioidaan jär...

  8. Cryobiology and a new look at the preservation of stallion semen

    DEFF Research Database (Denmark)

    Grout, Brian William Wilson; Lehn-Jensen, Henrik; Petersen, Morten Rønn; Draper, Delene; Morris, John G.


      During freeze-preservation of high-viability ejaculates of horse semen the duration of the equilibration time for nucleated straws (achieved at -7 0C following induced nucleation and during controlled, slow cooling to -60 0C) has little impact on viability, measured using propidium iodide stain...

  9. Soybean lecithin-based extender preserves spermatozoa membrane integrity and fertilizing potential during goat semen cryopreservation. (United States)

    Chelucci, Sara; Pasciu, Valeria; Succu, Sara; Addis, Daniela; Leoni, Giovanni G; Manca, Maria E; Naitana, Salvatore; Berlinguer, Fiammetta


    Soybean lecithin may represent a suitable alternative to egg yolk for semen cryopreservation in livestock species. However, additional studies are needed to elucidate its effects on spermatozoa functional properties. Semen collected from five Sarda bucks was cryopreserved in Tris-based extender and glycerol (4% v:v) with different supplementations. In a preliminary experiment, different soybean lecithin concentrations were tested (1%-6% wt/vol) and results in terms of viability, percentages of progressive motile and rapid spermatozoa, and DNA integrity after thawing showed that the most effective concentration was 1%. In the second experiment, semen was frozen in a Tris-based extender with no supplementation (EXT), with 1% lecithin (EXT LC), and 20% egg yolk (EXT EY). The effectiveness of these extenders was also compared with a commercial extender. The EXT EY led to the highest viability and motility parameters after freezing and thawing (P preserved spermatozoa functionality, as demonstrated by the higher fertilization rates compared with the other media (66.2 ± 4.5% for EXT LC vs. 32.7 ± 4.5%, 38.7 ± 4.5%, 39.6 ± 5.2% for EXT, EXT EY, and commercial extender; P egg yolk in goat semen cryopreservation, because it ensures higher fertilization rates and a better protection from membrane damage by cold shock. PMID:25595356

  10. High Prevalence of TT Virus DNA in Human Saliva and Semen


    Inami, Tomoko; Konomi, Nami; Arakawa, Yasuyuki; ABE, KENJI


    Using the PCR assay, we found a high prevalence of TT virus (TTV) DNA in saliva and semen from patients who were seropositive for TTV. This finding suggests that the presence of TTV in body fluids other than serum may affect the routes of viral transmission.

  11. East-West gradient in semen quality in the Nordic-Baltic area

    DEFF Research Database (Denmark)

    Jørgensen, Niels; Carlsen, Elisabeth; Nermoen, Ingrid; Punab, Margus; Suominen, Jyrki; Andersen, Anne-Grethe; Andersson, Anna-Maria; Haugen, Trine B; Horte, Antero; Jensen, Tina Kold; Magnus, Øystein; Petersen, Jørgen Holm; Vierula, Matti; Toppari, Jorma; Skakkebaek, Niels E


    Denmark and Norway have a three-fold higher incidence of testicular cancer than Estonia and Finland. Groups of young men from Denmark, Norway, Finland and Estonia were investigated to elucidate whether semen parameters and other related parameters follow a gradient between these countries, as doe...

  12. Good semen quality and life expectancy: A cohort study of 43,277 men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Jacobsen, Rune; Christensen, Kaare; Nielsen, Niels Christian; Bostofte, Erik


    Fertility status may predict later mortality, but no studies have examined the effect of semen quality on subsequent mortality. Men referred to the Copenhagen Sperm Analysis Laboratory by general practitioners and urologists from 1963 to 2001 were, through a unique personal identification number,...

  13. Effect of boron supplementation on semen quality estimates in mature boars (United States)

    The objective of the study was to determine the effect of dietary boron supplementation on sperm production and semen quality estimates in mature boars. Twelve crossbred boars (Landrace x Large White x Duroc x Hampshire) that were 2.5 +/- 0.2 years of age and 215 +/- 5 kg were randomly assigned to ...

  14. A comparative evaluation of semen parameters in pre- and post-Hurricane Katrina human population. (United States)

    Baran, Caner; Hellstrom, Wayne J; Sikka, Suresh C


    A natural disaster leading to accumulation of environmental contaminants may have substantial effects on the male reproductive system. Our aim was to compare and assess semen parameters in a normospermic population residing in the Southern Louisiana, USA area pre- and post-Hurricane Katrina. We retrospectively evaluated semen analyses data (n = 3452) of 1855 patients who attended the Tulane University Andrology/Fertility Clinic between 1999 and 2013. The study inclusion criteria were men whose semen analyses showed ? 1.5 ml volume; ?15 million ml -1 sperm concentration; ?39 million total sperm count; ?40% motility; >30% morphology, with an abstinence interval of 2-7 days. After the inclusion criteria applied to the population, 367 normospermic patients were included in the study. Descriptive statistics and group-based analyses were performed to interpret the differences between the pre-Katrina (Group 1, 1999-2005) and the post-Katrina (Group 2, 2006-2013) populations. There were significant differences in motility, morphology, number of white blood cell, immature germ cell count, pH and presence of sperm agglutination, but surprisingly there were no significant differences in sperm count between the two populations. This long-term comparative analysis further documents that a major natural disaster with its accompanied environmental issues can influence certain semen parameters (e.g., motility and morphology) and, by extension, fertility potential of the population of such areas. PMID:25677132

  15. Cytogenetic study in piglets and swine embryos originated from irradiated semen

    International Nuclear Information System (INIS)

    The chromosomal constitution of embryos and projects obtained by artificial insemination with semen submitted to a gamma radiation was studied. The effects of this treatment on the prolificity (litter size) and the changes caused by irradiation were correlated with embryonic deaths, occurrence of rearrangements and others chromosomal abnormalities that interface upon reproductive characteristics in swine. (L.L.L.)

  16. Investigation of Chlamydiaceae in semen and cauda epididymidis and seroprevalence of Chlamydophila abortus in breeding bulls

    Directory of Open Access Journals (Sweden)

    Persson Ylva


    Full Text Available Abstract Background Reproductive disorders associated with chlamydial infection have been reported worldwide in cattle and there are indications of potential venereal transmission. Methods Semen samples from 21 dairy bulls and cauda epididymidis tissue samples from 43 beef bulls were analysed for chlamydial agent by real-time polymerase chain reaction (PCR including an internal amplification control (mimic. Additionally, presence of antibodies against Chlamydophila (Cp. abortus among the bulls was investigated with the commercial Pourquier® ELISA Cp. abortus serum verification kit. Results No chlamydial agent was detected by PCR in either the semen samples or in the tissue samples. Additionally, no antibodies against Cp. abortus were detected. Conclusions The results suggest that Cp. abortus is very rare, or absent in Swedish bulls and thus the risk for venereal transmission of chlamydial infection through their semen is low. However, because Chlamydophila spp. infection rates seem to differ throughout the world, it is essential to clarify the relative importance of transmission of the infection through semen on cattle fertility.

  17. The Correlation between Ultrasound Testicular Volume and Conventional Semen Parameters in Albanian Subfertile Males

    Directory of Open Access Journals (Sweden)

    Adrian Kristo


    CONCLUSION: Testicular volume has a direct correlation with semen parameters and the critical total testicular volume indicating normal testicular function is approximately 26.6 ml (the mean testicular volume 13.3 ml. The measurement of testicular volume can be helpful for assessing fertility at the initial physical examination.

  18. Increased prevalence of leukocytes and elevated cytokine levels in semen from Schistosoma haematobium-infected individuals

    DEFF Research Database (Denmark)

    Leutscher, Peter D C; Pedersen, Mette; Raharisolo, Clairette; Jensen, Jørgen Skov; Hoffmann, Steen; Lisse, Ida; Ostrowski, Sisse R; Reimert, Claus M; Mauclere, Philippe; Ullum, Henrik


    In this study, we investigated the seminal inflammatory response to egg infestation of the urogenital organs in 240 semen-donating men aged 15-49 years living in a Schistosoma haematobium-endemic area of Madagascar. In 29 subjects (12%) with excretion of > or =5 ova/ejaculate, leukocytospermia (>...

  19. Sperm selection techniques and antioxidant fortification in low grade semen of bulls: Review

    Directory of Open Access Journals (Sweden)

    Shailendra Chaurasia


    Full Text Available The low grade ejaculates are very common in bulls. Low grade ejaculates might be due to age or non specific factors like thermal stress, transport and vaccination stress during the dynamic life of bulls. Lipid peroxidation of membrane induced sperm damage further aggravates the situation. Researches reveal that selection of sperm and antioxidant fortification play crucial role in improving the quality of semen. Different methods used for semen up-gradation like washing, sedimentation, swim up procedure and filtration like percoll gradient, glass wool, sephadex and sephadex ion exchanger with significant improvement in motility, Hypo osmotic swelling test reactivity, viability and acrosomal integrity. Antioxidants are added directly to extender at standard dose rate with positive result. Among different filtration column used sephadex ion exchanger (FS+IE was superior over other in improving the semen quality especially when fortified with Vitamin E. Moreover a complete protocol is required, which contain both antioxidant fortification and sperm selection simultaneously to handle the low grade semen from sub-fertile bulls. [Vet World 2013; 6(8.000: 579-585

  20. 9 CFR 98.33 - Ports designated for the importation of certain animal semen. (United States)


    ... facilities for the entry of animal semen from Mexico: Douglas, Naco, Nogales, San Luis, and Sasabe, Arizona; Calexico and San Ysidro, California; Antelope Wells, Columbus, and Santa Teresa, New Mexico; Brownsville, Del Rio, Eagle Pass, El Paso, Hidalgo, Laredo, and Presidio, Texas. (d) Limited ports. The...

  1. Concurrent quantification and comparative pharmacokinetic analysis of bioactive compounds in the Herba Ephedrae-Semen Armeniacae Amarum herb pair. (United States)

    Song, Shuai; Chen, Feilong; Xing, Xuefeng; Ren, Mengyue; Ma, Qinhai; Xie, Ying; Tang, Qingfa; Luo, Jiabo


    The Mahuang-Xingren herb-pair (MX), the combination of Herba Ephedrae (Mahuang in Chinese) and Semen Armeniacae Amarum (Xingren in Chinese), is a classical combination used in traditional Chinese Medicine to treat asthma and bronchitis. A simple and reliable ultra-performance liquid chromatography-tandem mass spectrometry method was developed to simultaneously quantify and compare the pharmacokinetics of 5 ephedra alkaloids and epimers of amygdalin and prunasin in rat plasma after oral administration of Mahuang, Xingren, and MX aqueous extracts. Samples were pretreated by a single-step protein precipitation with acetonitrile, and diphenhydramine hydrochloride and puerarin were used as internal standards. Pharmacokinetic parameters were investigated using DAS 3.2.2 (Mathematical Pharmacology Professional Committee of China, Shanghai, China). The validated method demonstrated adequate sensitivity, selectivity, and process efficiency for the bioanalysis of 8 compounds, including 3 pairs of epimers. MX administration improved the bioavailability of amygdalin and prunasin. Furthermore, MX facilitated intake of lower doses of ephedra alkaloids and increased elimination rates in comparison with Mahuang alone. These results illustrate the rationale behind the preferred use of the combination of Mahuang and Xingren. To our knowledge, this is the first report of stereo-selective metabolism of amygdalin. Further, the metabolic mechanism underlying this phenomenon merits future research attention. PMID:25766850

  2. Changes in motility, morphology, plasma membrane and acrosome integrity during stages of cryopreservation of buck sperm

    Scientific Electronic Library Online (English)

    Mushtaq, Ahmad; Rashad, Nasrullah; Hasan, Riaz; Abdul, Sattar; Nasim, Ahmad.


    Full Text Available Changes in sperm structure and function occur during the processing of semen. The present study was designed to investigate the effect on buck sperm during different stages of semen preparation including dilution, cooling, equilibration and freeze-thawing. Semen ejaculates from three mature bucks (r [...] eplicates = 5) were diluted with tris-citric acid egg yolk glycerol extender at 37 °C, cooled to 4 °C over 90 min, equilibrated at 4 °C for 2 h, transferred to 0.5 mL straws, placed in nitrogen vapour, frozen and thawed and then analysed. Sperm samples were assessed for percentage motility, acrosomal and plasma membrane integrity, live sperm, and morphology after dilution, cooling, equilibration and thawing. Mean percentage motility after dilution (86.0 ± 1.4%) was reduced significantly (p

  3. Absence of lumpy skin disease virus in semen of vaccinated bulls following vaccination and subsequent experimental infection. (United States)

    Osuagwuh, U I; Bagla, V; Venter, E H; Annandale, C H; Irons, P C


    Twelve serologically negative bulls were used, six were vaccinated with a modified live LSD vaccine and six unvaccinated. All were then experimentally infected with a virulent field strain of LSDV. No clinical abnormality was detected following vaccination, and mild clinical signs were seen in four vaccinated bulls following challenge. Virus was not found in semen of vaccinated bulls. Two of the unvaccinated bulls developed severe LSD and four showed mild symptoms, all excreted the virus in the semen following challenge. This study confirmed the ability of LSD vaccination to prevent the excretion of LSDV in semen of vaccinated bulls. PMID:17250934

  4. Evaluación de dos diluyentes para la criopreservación de semen de caballos de la raza criollo colombiano

    Directory of Open Access Journals (Sweden)

    Giovanni Restrepo Betancur


    Full Text Available Introducción. La composición de los diluyentes para la criopreservación del semen equino es determinante en la criotolerancia y la capacidad fecundante post-descongelación de las células espermáticas. Objetivo. Evaluar dos diluyentes para la congelación de semen de caballos de la raza criollo colombiano. Materiales y métodos. El semen de cuatro caballos de la raza criollo colombiano fue criopreservado mediante un protocolo de congelación rápida con los diluyentes Equipro® y Gent®. La evaluación de la movilidad del semen posdescongelación se realizó mediante un sistema de análisis computarizado de clase (SCA®, con el cual se analizaron la movilidad total (MT, la movilidad progresiva (MP, la velocidad curvilínea (VCL, la velocidad lineal (VSL y la velocidad media (VAP. La vitalidad espermática (VE y la morfología normal (MN se evaluaron mediante tinción con eosina-nigrosina; la integridad de la membrana plasmática se determinó mediante la prueba hipo-osmótica (HOS. Para la evaluación estadística se ajustaron modelos lineales generalizados (GLM y las medias entre los tratamientos se compararon por la prueba de Tukey. Las asociaciones entre las variables estudiadas se evaluaron mediante un análisis de correlación de Pearson. Resultados. Se halló diferencia estadística significativa (P?0.05 para la MT con medias de 50.9 % ± 19.4 % y 42.2 % ± 15.1 %, para Equipro® y Gent®, respectivamente. A excepción de la VSL no se encontró diferencia entre los demás parámetros evaluados. Se encontró una alta correlación entre los parámetros de movilidad, vitalidad e integridad de membrana. Conclusión. El diluyente Equipro® produce tasas de movilidad total posdescongelación superiores al diluyente Gent® en el semen de caballos de la raza criollo colombiano.

  5. Increased conception rates in beef cattle inseminated with nanopurified bull semen. (United States)

    Odhiambo, John F; DeJarnette, J M; Geary, Thomas W; Kennedy, Chelsey E; Suarez, Susan S; Sutovsky, Miriam; Sutovsky, Peter


    Aberrant sperm phenotypes coincide with the expression of unique sperm surface determinants that can be probed by objective, biomarker-based semen analysis and targeted as ligands for semen purification. This study evaluated a nanoparticle-based magnetic purification method that removes defective spermatozoa (?30% of sample) from bull semen and improves sperm sample viability and fertilizing ability in vitro and in vivo. Two types of nanoparticles were developed: a particle coated with antibody against ubiquitin, which is present on the surface of defective spermatozoa, and a particle coated with the lectin peanut agglutinin, which binds to glycans exposed by acrosomal damage. In a 2 yr artificial insemination field trial with 798 cows, a conception rate of 64.5% ± 3.7% was achieved with a 10 × 10(6) sperm dose of peanut agglutinin-nanopurified spermatozoa, comparable to a control nonpurified full dose of 20 × 10(6) spermatozoa per dose (63.3% ± 3.2%) and significantly higher than a 10 × 10(6) sperm dose of nonpurified control semen (53.7% ± 3.2%; P < 0.05). A total of 466 healthy calves were delivered, and no negative side effects were observed in the inseminated animals or offspring. Because the method is inexpensive and can be fully integrated in current protocols for semen cryopreservation, it is feasible for use in the artificial insemination industry to improve fertility with reduced sperm dosage inseminations. Spermatology will benefit from nanopurification methodology by gaining new tools for the identification of candidate biomarkers of sperm quality such as binder of sperm protein 5 (BSP5), described in the present study. PMID:25232015

  6. Use of cryotubes for the cryopreservation of tambaqui fish semen (Colossoma macropomum). (United States)

    Maria, Alexandre Nizio; Carvalho, Allan Charles Marques; Araújo, Rafael Venâncio; Santos, Jadson Pinheiro; Carneiro, Paulo César Falanghe; Azevedo, Hymerson Costa


    Tambaqui (Colossoma macropomum) is a freshwater fish of great importance to aquaculture in several South American countries. Recent studies have developed a protocol for semen cryopreservation in 0.25 and 0.5 mL straws; however, this technique has limitations for fingerling production at a large scale due to the high fecundity of tambaqui. The main objective of this study was to evaluate the feasibility of using cryotubes (1.6 and 4.5 mL) for tambaqui semen cryopreservation. Semen samples were diluted in freezing solution (5% glucose solution, 10% methylglycol, 5% egg yolk), stored in 1.6 and 4.5 mL cryotubes, frozen in liquid nitrogen vapor at -175°C and transferred to a cryogenic container at -196°C. The cryotubes were thawed in a water bath at 60°C for 70 or 90 s and the motility (total motility - TM; progressive motility - PM; curvilinear velocity - VCL; straight line velocity - VSL and average path velocity - VAP) and the viability of sperm were evaluated. There was no significant difference in sperm motility and viability post-thawing between 1.6 and 4.5m L cryotubes, except for TM (47% and 40%, respectively). Thawing for 90 s provided better results, being used in fertilization trials. Although the fertilization rate did not differ between the cryotubes (41-45%), it was significantly lower than that for fresh semen (74%). A strong positive correlation was observed between the sperm motility and fertilization rate (r=0.69-0.89). We conclude that 1.6 and 4.5 mL cryotubes have high potential for tambaqui semen cryopreservation when thawed for a minimum time of 90 s at 60°C. PMID:25725470

  7. Association between environmental exposure to p, p'-DDE and lindane and semen quality. (United States)

    Pant, Niraj; Shukla, M; Upadhyay, A D; Chaturvedi, P K; Saxena, D K; Gupta, Y K


    Scientific concern exists about the toxic effect of dichlorodiphenyldichloroethylene (p, p'-DDE) and lindane on male infertility, and the mechanism underlying male reproductive toxicity of this pesticide remains unanswered. We investigated not only the possible association between the chlorinated pesticide levels and semen quality in nonoccupationally exposed men, but also the probable mode of action using mitochondrial membrane potential (MMP), reactive oxygen species (ROS), lipid peroxidation (LPO), and sperm chromatin structure assay (SCSA). A study in 278 men (21-40 years old) who visited Obstetrics and Gynecology Department, KGMU, Lucknow, for semen analysis was conducted. We performed semen analysis according to the WHO guidelines, while p, p'-DDE and lindane analysis was done by the GLC and LPO by the spectrophotometer, and the sperm mitochondrial status, ROS, and SCSA with the flow cytometer. The questionnaire data showed no significant difference in the demographic characteristics between the two groups, i.e., trying to conceive >1 year and proven fertility. However, a significant difference in the concentration of p, p'-DDE and lindane was observed between the groups. When the subjects were divided among four categories by quartile of exposure, the subjects in the highest quartile showed low sperm motility as compared to the subjects in the lowest quartile. Pearson's correlation showed a significant negative correlation between semen p, p'-DDE, lindane level, and sperm quality and positive association with the number of cells with depolarized mitochondria, elevation in ROS production and LPO, and DNA fragmentation index (DFI). The findings are suggestive that these toxicants might cause a decline in semen quality, and these effects might be ROS, LPO, and mitochondrial dysfunction mediated. PMID:24793071

  8. Effect of split ejaculation and seminal extenders on longevity of donkey semen preserved at 5° C

    Directory of Open Access Journals (Sweden)

    Mello S.L.V.


    Full Text Available The aim of this study was to evaluate the longevity of donkey sperm comparing the rich seminal fraction and the whole semen in two extenders, Kenney and modified Baken extenders. Semen of five donkeys were collected through an open-end artificial vagina once a week for five consecutive weeks. The two first jets (rich fraction of semen were collected separately from the rest of the ejaculate. Whole semen samples were obtained mixing proportionally part of the rich with part of the poor seminal fractions. Seminal samples were immediately diluted 1:1 in each extender and maintained at room temperature during sperm concentration analysis. Samples were further diluted to rich 50×10(6 sperm per ml, cooled in a refrigerator at the initial rate of -0.6° C/min and preserved at 5° C. Total motility (TM, progressive motility (PM and sperm vigor (V were examined after final dilution and cooling, and every 24 hours up to the decrease of total motility under 10%. Sperm morphology was evaluated using a phase contrast microscope directly after dilution, on days 3, 6 and 9 post collection. It was used a 2×2 factorial design in a randomised bloc experiment, and means were compared by Student?s t test. Longevity did not vary between the rich seminal fraction and the whole semen for both extenders used. TM, PM, V and sperm morphology were better preserved in the extender with egg yolk (modified Baken extender than in the one with skimmed milk (Kenney in both seminal fractions.

  9. Alergia al plasma seminal humano: ¿mito o realidad?

    Scientific Electronic Library Online (English)

    Jenniffer, Puerta-Suárez; Walter, Cardona-Maya.

    Full Text Available Antecedentes: La hipersensibilidad al plasma seminal humano abarca una amplia variedad de manifestaciones clínicas que comprenden desde prurito local y reacciones dérmicas localizadas, hasta situaciones que ponen en riesgo la vida, como la anafilaxia. Objetivo: Caracterizar este fenómeno, para el es [...] tudio a profundidad del tema y enfatizar en un problema que no está siendo valorado debido al poco conocimiento del evento. Método: Revisión de la literatura empleando los términos "semen allergy" y "human seminal plasma allergy" y sus equivalentes en español en diferentes bases de datos. Resultados: Este desorden inmunológico es más frecuente entre los 23 y los 35 años de edad, en la mayoría de los casos los síntomas se inician dentro de la primera hora después de culminada la relación sexual o inmediatamente después de tener contacto con el semen. El método de prevención más eficaz es el condón, aunque no es una opción adecuada para las parejas que desean concebir. Conclusión: Se requiere estudiar y caracterizar mejor este fenómeno para mejorar tanto su diagnóstico como su tratamiento. Abstract in english Background: Human seminal plasma hypersensitivity includes a wide variety of clinical manifestations comprising itching and localized dermal reactions to situations that threaten life as anaphylaxis. Aims: To characterize this phenomenon, for in-depth study of the subject and emphasize a problem tha [...] t is not being assessed due to poor knowledge of the event. Method: Review of the literature using the terms "semen allergy" and "human seminal plasma allergy" and their spanish equivalents in different databases. Results: This immune disorder is more common between 23 and 35 years of age, in most cases the symptoms begin within the first hour after culminating intercourse or immediately after contact with the semen and most effective prevention method is the condom, although not an adequate solution for couples who want to conceive. Conclusion: Further studies are required to further characterize this phenomenon to improve both diagnosis as treatment.

  10. Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad Micoplasma hominis, Ureaplasma urealyticum and aerobic bacteria present in the semen from men attending infertility service

    Directory of Open Access Journals (Sweden)

    Bertha Victoria Rodríguez Pendás


    Full Text Available Introducción: las infecciones en el semen humano pueden alterar la calidad espermática, y vincularse con problemas de infertilidad masculina. Objetivo: determinar la frecuencia de infecciones por Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad, e identificar si existe relación entre las infecciones encontradas y las alteraciones en las variables de calidad del semen. Métodos: se realizó un estudio descriptivo transversal, para evaluar muestras de semen de 140 hombres, con edades entre 20 y 45 años, provenientes de las consultas de infertilidad del Instituto Nacional de Endocrinología. Se realizó un espermograma completo, que incluyó leucocitospermia, siguiendo los lineamientos de la OMS, para determinar las variables cualitativas y cuantitativas del semen. Las muestras de semen fueron cultivadas en agar sangre y agar chocolate a 37° C en atmósfera de CO2 para investigar bacterias aeróbicas, y se utilizó un juego de reactivos (Mycoplasma System Plus que permite realizar el cultivo, la identificación, el conteo semicuantitativo y el antibiograma de micoplasmas/ureaplasma urogenitales. Se tuvo en cuenta los aspectos éticos, y los resultados obtenidos se analizaron mediante cálculo de por cientos y la aplicación de la prueba de chi cuadrado. Resultados: de las 140 muestras de semen evaluadas, 58 (41,4 % mostraron la presencia de infecciones, de ellas 37 correspondieron a Ureaplasma urealyticum (25,7 %, 2 a Micoplasma hominis (1,4 % y 19 a bacterias aeróbicas (13,8 %. Al comparar las variables cualitativas y cuantitativas del semen con los sujetos infectados y no infectados, no se observaron diferencias estadísticamente significativas en ninguna de las variables de calidad espermática evaluadas. Conclusiones: la frecuencia total de infecciones, en la muestra estudiada, fue relativamente alta, pero no asociada a alteraciones en las variables seminales.Introduction: human semen infections can alter the sperm quality and be associated to male infertility disorders. Objectives: to determine the frequency of infections from Micoplasma hominis, Ureaplasma urealyticum and other aerobic bacteria in the semen of men who attended the infertility service, and to identify whether there is some relation between the detected infections and the altered semen quality variables or not. Methods: a cross-sectional descriptive study was performed to evaluate semen samples from 140 men aged 20 to 45 years, who attended the infertility service at the National Institute of Endocrinology. According to the WHO guidelines, a complete spermiogram including leukocytospermia was performed in order to determine the qualitative and quantitative variables in the semen. The semen samples were cultured in blood agar and in chocolate agar at 37oC under CO2 environment to find out possible aerobic bacteria. To this end, a set of reagents known as Mycoplasma System Plus was used, allowing the culture, the identification, the semi-quantitative count and the antibiogram of urogenital mycoplasms/ureaplasms. The ethical aspects were allowed for; the results were analyzed through percentage estimations and the chi square test. Results: out of the 140 evaluated semen samples, 58 (41.4 % showed some infection, 37 of them were caused by Ureaplasma urealyticum (25.7 %, 2 by Micoplasma hominis (1.4 % and 19 by the aerobic bacteria (13.8 %. When making a comparison of the qualitative and quantitative variables of the semen from infected and non-infected subjects, there were not any statistically significant differences in the evaluated variables of the sperm quality. Conclusions: the total frequency of infections in the studied sample was relatively high, but was not associated to altered seminal variables.

  11. Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan por infertilidad / Micoplasma hominis, Ureaplasma urealyticum and aerobic bacteria present in the semen from men attending infertility service

    Scientific Electronic Library Online (English)

    Bertha Victoria, Rodríguez Pendás; Cecilia, Ortiz Rodríguez; Felipe, Santana Pérez; Emma, Domínguez Alonso; Blanca, Nurquez Guerra.


    Full Text Available Introducción: las infecciones en el semen humano pueden alterar la calidad espermática, y vincularse con problemas de infertilidad masculina. Objetivo: determinar la frecuencia de infecciones por Micoplasma hominis, Ureaplasma urealyticum y bacterias aeróbicas en el semen de hombres que consultan po [...] r infertilidad, e identificar si existe relación entre las infecciones encontradas y las alteraciones en las variables de calidad del semen. Métodos: se realizó un estudio descriptivo transversal, para evaluar muestras de semen de 140 hombres, con edades entre 20 y 45 años, provenientes de las consultas de infertilidad del Instituto Nacional de Endocrinología. Se realizó un espermograma completo, que incluyó leucocitospermia, siguiendo los lineamientos de la OMS, para determinar las variables cualitativas y cuantitativas del semen. Las muestras de semen fueron cultivadas en agar sangre y agar chocolate a 37° C en atmósfera de CO2 para investigar bacterias aeróbicas, y se utilizó un juego de reactivos (Mycoplasma System Plus) que permite realizar el cultivo, la identificación, el conteo semicuantitativo y el antibiograma de micoplasmas/ureaplasma urogenitales. Se tuvo en cuenta los aspectos éticos, y los resultados obtenidos se analizaron mediante cálculo de por cientos y la aplicación de la prueba de chi cuadrado. Resultados: de las 140 muestras de semen evaluadas, 58 (41,4 %) mostraron la presencia de infecciones, de ellas 37 correspondieron a Ureaplasma urealyticum (25,7 %), 2 a Micoplasma hominis (1,4 %) y 19 a bacterias aeróbicas (13,8 %). Al comparar las variables cualitativas y cuantitativas del semen con los sujetos infectados y no infectados, no se observaron diferencias estadísticamente significativas en ninguna de las variables de calidad espermática evaluadas. Conclusiones: la frecuencia total de infecciones, en la muestra estudiada, fue relativamente alta, pero no asociada a alteraciones en las variables seminales. Abstract in english Introduction: human semen infections can alter the sperm quality and be associated to male infertility disorders. Objectives: to determine the frequency of infections from Micoplasma hominis, Ureaplasma urealyticum and other aerobic bacteria in the semen of men who attended the infertility service, [...] and to identify whether there is some relation between the detected infections and the altered semen quality variables or not. Methods: a cross-sectional descriptive study was performed to evaluate semen samples from 140 men aged 20 to 45 years, who attended the infertility service at the National Institute of Endocrinology. According to the WHO guidelines, a complete spermiogram including leukocytospermia was performed in order to determine the qualitative and quantitative variables in the semen. The semen samples were cultured in blood agar and in chocolate agar at 37oC under CO2 environment to find out possible aerobic bacteria. To this end, a set of reagents known as Mycoplasma System Plus was used, allowing the culture, the identification, the semi-quantitative count and the antibiogram of urogenital mycoplasms/ureaplasms. The ethical aspects were allowed for; the results were analyzed through percentage estimations and the chi square test. Results: out of the 140 evaluated semen samples, 58 (41.4 %) showed some infection, 37 of them were caused by Ureaplasma urealyticum (25.7 %), 2 by Micoplasma hominis (1.4 %) and 19 by the aerobic bacteria (13.8 %). When making a comparison of the qualitative and quantitative variables of the semen from infected and non-infected subjects, there were not any statistically significant differences in the evaluated variables of the sperm quality. Conclusions: the total frequency of infections in the studied sample was relatively high, but was not associated to altered seminal variables.

  12. Qualidade espermática de sêmen de cães naturalmente infectados por Leishmania sp: / Semen quality of dogs naturally infected by Leishmania sp

    Scientific Electronic Library Online (English)

    É., Labat; J.T., Carreira; B.H., Matsukuma; M.T.A., Martins; V.M.F., Lima; S.R.M., Bomfim; S.H.V., Perri; M.B., Koivisto.


    Full Text Available Avaliaram-se alterações espermáticas associadas à infecção por leishmaniose no sêmen de cães naturalmente infectados, utilizando-se, durante oito semanas consecutivas, ejaculados de seis cães soronegativos e seis cães soropositivos. As amostras foram colhidas uma vez por semana e avaliadas quanto ao [...] volume, concentração, motilidade, vigor, morfologia espermática, integridade da cromatina, avaliação simultânea da integridade da membrana plasmática, acrossoma e potencial mitocondrial. Concomitantemente foram dosadas a proteína total do plasma seminal e sanguíneo. A leishmaniose visceral causou aumento dos defeitos maiores e menores nos espermatozoides dos animais acometidos pelo estágio moderado a severo da doença. Em estágios mais avançados da enfermidade, a integridade das membranas acrossomal e plasmática foi afetada negativamente. Não foi possível estabelecer um critério quanto à avaliação do potencial mitocondrial. A incidência de alterações morfológicas nos animais acometidos não promoveu aumento de injurias à cromatina. Todos os animais com leishmaniose apresentaram hiperproteinemia do sêmen. Abstract in english The spermatic changes associated with the natural infection in dogs by Leishmania sp was evaluated during eight consecutive weeks, using ejaculates of six seronegative and six seropositive dogs. The samples were collected once a week and evaluated for volume, concentration, motility, vigor, sperm mo [...] rphology, chromatin integrity, simultaneous evaluation of the plasmatic membrane integrity, acrosome, and mitochondrial potential. The total proteins of the seminal plasma and blood were measured. The visceral leishmaniasis caused increase of major and minor defects in spermatozoa of animals attacked by moderate to severe stages of the disease. In more advanced stages of the illness, the acrosomal and plasmatic membranes integrity was adversely affected. It was not possible to establish a pattern refering the evaluation of the mitochondrial potential. The incidence of morphological changes in the seropositive animals did not promote an increase of injuries to the chromatin. All animals with leishmaniasis presented hyperproteinemia of the semen.

  13. Detection of Chlamydia trachomatis, Mycoplasma hominis and Ureaplasma urealyticum by Multiplex PCR in Semen Sample of Infertile Men

    Directory of Open Access Journals (Sweden)

    M Golshani


    Full Text Available Background: The aim of this study was to detect Chlamydia trachomatis, Mycoplasma hominis and Ureaplasma urealyti¬cum from semen samples of infertile men by Multiplex PCR and investigation of influence of bacteriospermia on semen parame¬ters. Methods: Semen samples of 200 infertile men were evaluated by Multiplex PCR. In addition, analysis of semen parameters was performed according to the WHO guidelines. Results: All the patients were without clinical symptoms of urogenital tract infection. Thirty three percent of cases showed at least one bacterium. We found a noticeable relation between the presence of bacteriospermia and the rate of non motile and morphologically abnormal sperms (P 0.05. Conclusion: Asymptomatic existence of Chlamydia and Mycoplasmas in urogenital tracts might play an important role in sperm impairment due to infertility. Bacteriospermia can influence sperm's motility, morphology and concentration.

  14. Evaluation of bison (Bison bison) semen from Yellowstone National Park, Montana, USA, bulls for Brucella abortus shedding. (United States)

    Frey, Rebecca K; Clarke, P Ryan; McCollum, Matt P; Nol, Pauline; Johnson, Kammy R; Thompson, Brent D; Ramsey, Jennifer M; Anderson, Neil J; Rhyan, Jack C


    To determine if bison (Bison bison) bulls from Yellowstone National Park (YNP), Montana, USA, shed an infective dose of Brucella abortus in semen, 50 YNP bulls were captured on public lands in Montana during the winter and early spring (April-May) of 2010 and 2011. The bulls were immobilized, and blood and semen samples were collected for serology and Brucella culture. Thirty-five bulls (70%) were antibody-positive, and B. abortus was cultured from semen in three (9%) of the 35 antibody-positive or suspect bulls, though not at concentrations considered an infective dose. Eight bulls (six antibody-positive, two negative) had palpable lesions of the testes, epididymides, or seminal vesicles consistent with B. abortus infection. Breeding soundness exams and semen analysis suggested that antibody-positive bulls were more likely to have nonviable ejaculate (8/35; 23%) than bulls without detectable antibody (2/15; 13%). PMID:23778628

  15. 77 FR 74555 - Importation of Live Swine, Swine Semen, Pork, and Pork Products; Estonia, Hungary, Slovakia, and... (United States)


    ...Swine Semen, Pork, and Pork Products; Estonia, Hungary, Slovakia, and Slovenia AGENCY...We are also announcing the addition of Estonia, Hungary, Slovakia, and Slovenia to...European CSF region, the addition of Estonia, Slovakia, and Slovenia to the...

  16. The performance of Angora rabbit does and their progeny depending on the semen used for artificial insemination


    Eiben, C.; Szendrõ, Z.; Allain, D.; Thébault, R.G.; Radnai, I.; Bíróné Németh, E.; Lanszki, J



  17. Low semen volume in 47 adolescents and adults with 47,XXY Klinefelter or 46,XX male syndrome

    DEFF Research Database (Denmark)

    Aksglaede, L; Jørgensen, N; Skakkebaek, N E; Juul, A


    .0-43.8) years. Semen volume adjusted for duration of abstinence was significantly smaller in the patients [2.0 (0.2-5.7) mL] when compared with control group I [3.1 (0.3-12.5) mL, p <0.0001] and group II [3.6 (0.6-12.5) mL, p <0.0001]. There was no difference in semen volume between 47,XXY and 46,XX males. All...

  18. Liquid and Frozen Storage of Agouti (Dasyprocta leporina) Semen Extended with UHT Milk, Unpasteurized Coconut Water, and Pasteurized Coconut Water


    G. W. Garcia; W. M. Mollineau; Adogwa, A. O.


    This study evaluated the effects of semen extension and storage on forward progressive motility % (FPM%) in agouti semen. Three extenders were used; sterilized whole cow's milk (UHT Milk), unpasteurized (CW) and pasteurized coconut water (PCW), and diluted to 50, 100, 150, and 200 × 106 spermatozoa/ml. Experiment 1: 200 ejaculates were extended for liquid storage at 5?C and evaluated every day for 5 days to determine FPM% and its rate of deterioration. Experiment 2: 150 ejaculates were extend...

  19. Effects of In Vitro Zinc Sulphate Additive to The Semen Extender on Water Buffalo (Bubalusbubalis) Spermatozoa before and after Freezing


    Kamran Dorostkar; Sayed Mortaza Alavi Shoushtari; Amir Khaki


    Background: The objective of the study was to investigate the effects of in vitro zinc sulphate additive to semen extender on sperm parameters (progressive motility, viability, membrane integrity and DNA stability) after cryopreservation. Materials and Methods: In this Prospective longitudinal laboratory study, semen samples of 5 buffalo bulls of 3-5 years old were collected at 5 different occasions from Iran, Urmia during summer and autumn 2011, 25 samples were used in each ...

  20. Physical activity, fatness, educational level and snuff consumption as determinants of semen quality: findings of the ActiART study. (United States)

    Pärn, Triin; Grau Ruiz, Raúl; Kunovac Kallak, Theodora; Ruiz, Jonatan R; Davey, Eva; Hreinsson, Julius; Wånggren, Kjell; Salumets, Andres; Sjöström, Michael; Stavreus-Evers, Anneli; Ortega, Francisco B; Altmäe, Signe


    In this study, the association between physical activity and other potential determinants, objectively measured by accelerometry, was examined. Sixty-two men attending an infertility clinic participated in the study. Obese men (body mass index ? 30) and those with a waist circumference 102?cm or more had lower semen volume than the other men (P snuff, compared with the other participants (P snuff consumption are negatively related to semen quality. PMID:25999214

  1. The Effects of Frequent Electroejaculation on the Semen Characteristics of a Captive Siberian Tiger (Panthera tigris altaica)


    FUKUI, Daisuke; NAGANO, Masashi; Nakamura, Ryohei; BANDO, Gen; NAKATA, Shinichi; KOSUGE, Masao; SAKAMOTO, Hideyuki; MATSUI, Motozumi; YANAGAWA, Yojiro; Takahashi, Yoshiyuki


    Artificial insemination (AI) can help to avoid inbreeding and genetic degeneration for sustaining genetically healthy populations of endangered species in captivity. Collection of a sufficient quantity of viable sperm is an essential first step in the AI process. In the present study, we examined the effects of frequent electroejaculation on semen characteristics in a Siberian tiger. We collected semen in all 17 trials during 6 breeding seasons (6 years). The mean number of spe...

  2. Maternal alcohol consumption during pregnancy and semen quality in the male offspring: two decades of follow-up

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia; Toft, Gunnar; Jensen, Morten Søndergaard; Strandberg-Larsen, Katrine; Hansen, Mette Lausten; Olsen, Jørn


    BACKGROUND Concurrent alcohol exposure has been associated with reduced fecundity, but no studies have estimated the effect of prenatal alcohol exposure on male fecundity. The aim of this study was to investigate the association between maternal alcohol consumption during pregnancy, semen quality and levels of reproductive hormones in young, adult men. METHODS From a Danish pregnancy cohort established in 1984-1987, 347 sons were selected for a follow-up study conducted in 2005-2006. Semen and b...

  3. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men: a cross-sectional study


    Mocevic, Emina; Specht, Ina O.; Marott, Jacob L.; Giwercman, Aleksander; Jönsson, Bo AG; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens


    Several animal studies indicate that mercury is a male reproductive toxicant, but human studies are few and contradictory. We examined semen characteristics and serum levels of reproductive hormones in relation to environmental exposure to mercury. Blood and semen samples were collected from 529 male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml?1 in G...

  4. Semen quality according to prenatal coffee and present caffeine exposure: two decades of follow-up of a pregnancy cohort

    DEFF Research Database (Denmark)

    Ramlau-Hansen, C H; Thulstrup, A M; Bonde, J P; Olsen, J; Bech, B H


    BACKGROUND: A few studies have investigated the association between male caffeine consumption in adult life and semen quality with conflicting results, but so far no studies have explored the effect of prenatal coffee exposure. We studied the association between prenatal coffee and current caffeine exposure and semen quality and levels of reproductive hormones. METHODS: From a Danish pregnancy cohort established in 1984-1987, 347 sons out of 5109 were selected for a follow-up study conducted 200...

  5. Human semen quality in the new millennium: a prospective cross-sectional population-based study of 4867 men

    DEFF Research Database (Denmark)

    JØrgensen, N; Joensen, Ulla Nordström


    Objectives Considerable interest and controversy over a possible decline in semen quality during the 20th century raised concern that semen quality could have reached a critically low level where it might affect human reproduction. The authors therefore initiated a study to assess reproductive health in men from the general population and to monitor changes in semen quality over time. Design Cross-sectional study of men from the general Danish population. Inclusion criteria were place of residence in the Copenhagen area, and both the man and his mother being born and raised in Denmark. Men with severe or chronic diseases were not included. Setting Danish one-centre study. Participants 4867 men, median age 19?years, included from 1996 to 2010. Outcome measures Semen volume, sperm concentration, total sperm count, sperm motility and sperm morphology. Results Only 23% of participants had optimal sperm concentration and sperm morphology. Comparing with historic data of men attending a Copenhagen infertility clinic in the 1940s and men who recently became fathers, these two groups had significantly better semen quality than our study group from the general population. Over the 15?years, median sperm concentration increased from 43 to 48?million/ml (p=0.02) and total sperm count from 132 to 151 million (p=0.001). The median percentage of motile spermatozoa and abnormal spermatozoa were 68% and 93%, and did not change during the study period. Conclusions This large prospective study of semen quality among young men of the general population showed an increasing trend in sperm concentration and total sperm count. However, only one in four men had optimal semen quality. In addition, one in four will most likely face a prolonged waiting time to pregnancy if they in the future want to father a child and another 15% are at risk of the need of fertility treatment. Thus, reduced semen quality seems so frequent that it may impair the fertility rates and further increase the demand for assisted reproduction.

  6. Características seminales del macho cabrío Serrano Transmontano (Semen characteristics of the Serrano Transmontano buck

    Directory of Open Access Journals (Sweden)

    Almendra, L.


    Full Text Available Las características de producción espermática constituyen uno de los factores más importantes del desarrollo de programas de inseminación artificial. El objetivo del presente trabajo consistió en el estudio de algunas de las características del semen producido a lo largo del año por machos cabríos de la raza Serrana Ecotipo Transmontano. Fueron estudiados 8 animales (4 adultos datando la primera recogida de semen con más de 18 meses y 4 machos jóvenes con 6-10 meses de edad. Las variables analizadas fueron el volumen (n=378; 0,859 ± 0,337 ml, la concentración (n=227; 4,791 x 106 ± 1,694 espermatozóides/ml, la motilidad masal (n=314; 3,7 ± 0,8 y la motilidad individual (n=308; 69,2 ± 14,1 %. Se observó una influencia muy significativa (P0,05. A pesar de las variaciones observadas, las características seminales (volumen de eyaculado y motilidad espermática, no parecen constituir un factor adverso en la utilización del semen en inseminación artificial, cualquiera que sea la época del año. Sperm production is one of the most important factors for the development of artificial insemination programs. The objective of this study was the evaluation of some characteristics of semen produced throughout the year by bucks of the breed Serrana ecotype Transmontano. Eight male goats were studied (4 adult males, more than 18 months old at the first semen collection and 4 young males 6-10 months old. Variables studied were volume of ejaculate (n=378; 0.859 ± 0.337 ml, sperm number (n=227; 4.791 x 106 ± 1.694 sperm cells/ml, sperm mass motility (n=314; 3.7 ± 0.8 and sperm individual motility (n=308; 69.2 ± 14.1 %. Age of males influenced significantly (P0,05. In spite of the observed variations, the seminal characteristics (volume of the ejaculate and sperm motility don't seem to constitute an adverse factor to the use of the semen in artificial insemination in any season throughout the year

  7. Is prenatal exposure to tobacco smoking a cause of poor semen quality? : A follow-up study

    DEFF Research Database (Denmark)

    Ramlau-Hansen, Cecilia HØst; Thulstrup, Ane Marie


    A few studies indicate that exposure to maternal smoking during fetal life decreases semen quality in adult life, but the results are inconsistent and retrospectively collected smoking data were used in most studies. From a Danish pregnancy cohort established in 1984-1987, 347 of 5,109 sons were selected according to their exposure to tobacco smoke in fetal life. From February 2005 to January 2006, a semen sample from the 347 men was analyzed for conventional semen characteristics according to standardized criteria by using a mobile laboratory. The authors found an inverse association between maternal smoking during pregnancy and total sperm count (p = 0.002). Men exposed to more than 19 cigarettes daily during pregnancy had approximately 19% lower semen volume (p = 0.04), 38% lower total sperm count (p = 0.11), and 17% lower sperm concentration (p = 0.47) compared with unexposed men. The odds ratio for oligospermia was 2.16 (95% confidence interval: 0.68, 6.87) among exposed men compared with the unexposed. No associations were found for sperm motility or morphology. These results indicate that prenatal exposure to tobacco smoke may have an adverse effect on semen quality and, if these associations are causal, they could explain some of the reported differences between populations and secular changes in semen quality.

  8. Investigation the Effects of Dietary L-Carnitine Supplementation on Characteristics of Rooster Semen During Liquid Storage

    Directory of Open Access Journals (Sweden)

    Y.J. Ahangari


    Full Text Available The objective of present study was to investigate the effects of various levels of dietary L carnitine supplementation (0, 125, 250 and 500 mg kg?1 on rooster semen characteristics during liquid storage. Semen were collected from 16 rooster using abdominal massage and suitable samples were mixed together and sperm characteristics including percentage of motile, viable, abnormal, semen pH, volume and concentration were assessed. This experiment was carried out on the basis of completely randomized design. Results showed that during liquid storage, the effect of L carnitine on motility and viability percentage of sperm in beltsville extender were significant (p1 L-carnitine supplementation. Semen characteristics such as volume, pH and abnormal percentage of sperm did not differ significantly (p>0.05. Furthermore, semen concentration of birds fed dietary carnitine significantly differ from controls during experiment (p1 L-carnitine. Therefore, use of L-carnitine supplementation (250 mg kg?1 in broiler breeder male feeding is recommended to improve quality of rooster semen.

  9. Detection and dynamics of porcine circovirus 2 shedding in semen using conventional and real-time PCR

    Directory of Open Access Journals (Sweden)

    Priscilla F Gerber


    Full Text Available The dynamics of porcine circovirus type 2 (PCV2 shedding in semen of naturally infected boars was studied. Semen was collected serially each 15 or 20 days during 62 days from 5 boars from a herd and from 11 boars from an artificial insemination center. All boars were positive for PCV2 DNA by nested polymerase chain reaction of raw semen in at least two sampling dates, and most of them had detectable shedding in all sampling dates. Real-time quantitative PCR was performed in 23 samples. All samples showed low amounts of PCV2 DNA, ranging from 98 to 652 PCV2 copies/mL. No differences between the frequencies of PCV2 DNA shed in semen were found considering herds and age of boars. PCV2 shedding in the semen can occur continuously or intermittently up to 60 days in naturally infected boars at 12 to 42 months old in absence of PCV2 clinical signs. These results demonstrate sporadic and long-term shedding patterns of low amounts of PCV2 DNA in semen from naturally infected boars.

  10. Variations of protein profiles and calcium and phospholipase A2 concentrations in thawed bovine semen and their relation to acrosome reaction

    Directory of Open Access Journals (Sweden)

    V. Alonso Marques


    Full Text Available Just as calcium plays an integral role in acrosome capacitation and reaction, several spermatozoon proteins have been reported as binding to the ovum at fertilization. We examined the relationship between thawed bovine semen protein profiles, seminal plasma calcium ion concentration, spermatozoon phospholipase A2 (PLA2 activity and acrosome reaction. Electrophoretic profile analysis of spermatozoa and bovine seminal plasma proteins (total and membrane revealed qualitative and quantitative differences among bulls. Variations in PLA2 and seminal plasma calcium concentration indicated genetic diversity among individuals. A 15.7-kDa membrane protein was significantly correlated (r = 0.71 with acrosome reaction, which in turn has been associated with in vivo fertility.Várias proteínas que constituem o espermatozóide têm sido relatadas como sendo proteínas que se ligam ao óvulo no momento da fertilização, bem como íons cálcio têm um papel importante na capacitação e reação acrossômica. Baseado nisto, este estudo teve como objetivo analisar e correlacionar proteínas do sêmen congelado bovino de diferentes raças, concentração de íons cálcio no plasma seminal e atividade da fosfolipase A2 do espermatozóide com a reação acrossômica, visando encontrar fatores que influenciem no processo de fertilização bovina. Análises do perfil eletroforético das proteínas (totais e de membrana do espermatozóide e do plasma seminal bovino revelaram variabilidade protéica entre indivíduos na qual diferenças qualitativas e quantitativas foram identificadas. A quantificação da fosfolipase A2, bem como da concentração de cálcio no plasma seminal revelaram diversidade genética entre touros. Uma proteína de 15,7 kDa apresentou correlação significativa (0.71 com a reação acrossômica, que pode estar diretamente relacionada com a fertilização in vivo e deste modo outros experimentos podem ser realizados a fim de investigar a utilidade deste marcador protéico na verdadeira fertilidade.

  11. Cloned embryos from semen. Part 2: Intergeneric nuclear transfer of semen-derived eland (Taurotragus oryx) epithelial cells into bovine oocytes (United States)

    Nel-Themaat, L.; Gomez, M.C.; Pope, C.E.; Lopez, M.; Wirtu, G.; Jenkins, J.A.; Cole, A.; Dresser, B.L.; Bondioli, K.R.; Godke, R.A.


    The production of cloned offspring by nuclear transfer (NT) of semen-derived somatic cells holds considerable potential for the incorporation of novel genes into endangered species populations. Because oocytes from endangered species are scarce, domestic species oocytes are often used as cytoplasts for interspecies NT. In the present study, epithelial cells isolated from eland semen were used for intergeneric transfer (IgNT) into enucleated bovine oocytes and compared with bovine NT embryos. Cleavage rates of bovine NT and eland IgNT embryos were similar (80 vs. 83%, respectively; p > 0.05); however, development to the morula and blastocyst stage was higher for bovine NT embryos (38 and 21%, respectively; p < 0.0001), than for eland IgNT embryos (0.5 and 0%, respectively). DNA synthesis was not observed in either bovine NT or eland IgNT cybrids before activation, but in 75 and 70% of bovine NT and eland igNT embryos, respectively, cell-cycle resumption was observed at 16 h postactivation (hpa). For eland IgNT embryos, 13% had ???8 cells at 84 hpa, while 32% of the bovine NT embryos had ???8 cells at the same interval. However, 100 and 66% of bovine NT and eland IgNT embryos, respectively, that had ???8 cells synthesized DNA. From these results we concluded that (1) semen-derived epithelial cell nuclei can interact and be transcriptionally controlled by bovine cytoplast, (2) the first cell-cycle occurred in IgNT embryos, (3) a high frequency of developmental arrest occurs before the eight-cell stage in IgNT embryos, and (4) IgNT embryos that progress through the early cleavage stage arrest can (a) synthesize DNA, (b) progress through subsequent cell cycles, and (c) may have the potential to develop further. ?? 2008 Mary Ann Liebert, Inc.

  12. Does last week's alcohol intake affect semen quality or reproductive hormones? : A cross-sectional study among healthy young Danish men

    DEFF Research Database (Denmark)

    Hansen, M L; Thulstrup, A M


    The association between last 5 days of alcohol intake, semen quality and reproductive hormones was estimated in this cross-sectional study among 347 men. Conventional semen characteristics, DNA fragmentation index and reproductive hormones (testosterone, estradiol, sex hormone-binding globulin (SHBG), follicle-stimulating hormone (FSH), luteinizing hormone (LH) and inhibin B) were determined. There was a tendency towards lower semen characteristics at higher intake of alcohol past 5 days, albeit with no statistically significant dose-response association. The ratio between free estradiol and free testosterone was higher at higher alcohol intake during the 5 days preceding semen sampling. In conclusion, alcohol intake was associated with impairment of most semen characteristics but without a coherent dose-response pattern. The study indicates an association between recent alcohol intake and a hormonal shift towards higher estradiol/testosterone ratio. The hormonal changes observed may over time, lead to adverse effects on semen quality, but longitudinal studies are needed to study this.

  13. PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

    Scientific Electronic Library Online (English)

    Francisca Elda Ferreira, Dias; Cáris Marone, Nunes; Tânia Vasconcelos, Cavalcante; Andréa Azevedo Pires de, Castro; Jorge Luis, Ferreira; José Fernando, Garcia.


    Full Text Available Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas [...] à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial. Abstract in english This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by pheno [...] l/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

  14. Prognostic value of a pre-freeze hypo-osmotic swelling test on the post-thaw quality of dog semen. (United States)

    Karger, S; Geiser, B; Grau, M; Burfeind, O; Heuwieser, W; Arlt, S P


    Throughout cryopreservation, sperm are exposed to major osmotic challenges. Only intact membranes of sperm cells are able to regulate these volumetric changes, which can be determined by the hypo-osmotic swelling test (HOS test). Correlations between the HOS test and conventional semen variables are inconsistent. Therefore, the objectives of this study were (1) to examine relationships between HOS test results and standard semen variables before freezing and after thawing and (2) to evaluate the prognostic value of the HOS assessments on post-thaw quality of dog semen. Semen of 35 dogs was collected and analyzed before freezing and after thawing following a 7-day freeze-thaw interval. Conventional semen variables such as sperm cell motility, membrane integrity morphology were evaluated and the HOS test was conducted with results from this test being recorded. In fresh semen the HOS test was positively correlated with progressive motility of sperm cells: r=0.52, sperm cell membrane integrity: r=0.50 and normal sperm cell morphology: r=0.46 (P<0.05). In frozen-thawed semen, the data obtained with the HOS test were positively correlated with progressive sperm cell motility: r=0.67 and membrane integrity: r=0.86 (P<0.05). The data obtained with the HOS test in fresh semen were positively correlated with sperm cell membrane integrity: r=0.50 normal sperm cell morphology: r=0.55 and data from the HOS test (r=0.43; P<0.05) with frozen-thawed semen. For the prediction of individual cryopreservation capacity, results from assessment of the fresh semen variables of good and poor semen quality were statistically compared. Based on these results, it is not possible to predict the quality of frozen-thawed dog semen using the HOS test. PMID:26837622

  15. Effect of Estrus-AI interval on timed AI pregnancy rates in beef cows inseminated with fresh extended or frozen thawed semen


    R. K. Kasimanickam and W. D. Whittier


    We hypothesize that insemination with fresh extended semen will improve the AI pregnancy rate due to its prolonged longevity in female reproductive tract compared to frozen thawed semen. The objective of this trial was to determine the effect of fresh and frozen semen on fixed-time AI pregnancy rate in beef cows synchronized with progesterone based CO-Synch protocols and inseminated at different estrus-AI intervals. Angus cross beef cows (N=180) were synchronized with CO-Synch-CIDR protocols ...

  16. Cryopreservation of rabbit semen: effectiveness of different permeable and non-permeable cryoprotectants on post-thaw sperm quality and reproductive performances


    Di Iorio, Michele


    Rabbit breeding for meat production is based mainly on artificial insemination (AI) programs. In order to obtain many of potential advantages of AI, improvement of the storage of rabbit semen is necessary. Therefore, meat rabbit farming would greatly benefit if semen could be stored after collection and subsequently used for AI without affecting fertility. The rabbit sperm can be stored by refrigeration (in liquid or solid extenders) or freezing. The use of frozen semen would provide more p...

  17. Environmental mercury exposure, semen quality and reproductive hormones in Greenlandic Inuit and European men

    DEFF Research Database (Denmark)

    Mocevic, Emina; Specht, Ina O; Marott, Jacob Louis; Giwercman, Aleksander; Jönsson, Bo Ag; Toft, Gunnar; Lundh, Thomas; Peter Bonde, Jens


    0.110). The association may be due to beneficial effects of polyunsaturated fatty acids (PUFAs), which are contained in seafood and fish. No significant association (P>0.05) was found between blood concentrations of mercury and any of the other measured semen characteristics (semen volume, total...... male partners of pregnant women living in Greenland, Poland and Ukraine between May 2002 and February 2004. The median concentration of the total content of mercury in whole blood was 9.2 ng ml(-1) in Greenland (0.2-385.8 ng ml(-1)), 1.0 ng ml(-1) in Poland (0.2-6.4 ng ml(-1)) and 1.0 ng ml(-1) in...... exposure in Greenlandic and European men with median whole blood concentration up to 10 ng ml(-1) has adverse effects on biomarkers of male reproductive health....

  18. Good semen quality and life expectancy: A cohort study of 43,277 men

    DEFF Research Database (Denmark)

    Jensen, Tina Kold; Jacobsen, Rune; Christensen, Kaare; Nielsen, Niels Christian; Bostofte, Erik


    cohort were compared with those of all age-standardized Danish men or according to semen characteristics. Among 43,277 men without azospermia referred for infertility problems, mortality decreased as the sperm concentration increased up to a threshold of 40 million/mL. As the percentages of motile and......Fertility status may predict later mortality, but no studies have examined the effect of semen quality on subsequent mortality. Men referred to the Copenhagen Sperm Analysis Laboratory by general practitioners and urologists from 1963 to 2001 were, through a unique personal identification number......, linked to the Danish central registers that hold information on all cases of cancer, causes of death, and number of children in the Danish population. The men were followed until December 31, 2001, death, or censoring, whichever occurred first, and the total mortality and cause-specific mortality of the...

  19. Shorter anogenital distance predicts poorer semen quality in young men in Rochester, New York

    DEFF Research Database (Denmark)

    Mendiola, Jaime; Stahlhut, Richard W; Jørgensen, Niels; Liu, Fan; Swan, Shanna H


    BACKGROUND: In male rodents, anogenital distance (AGD) provides a sensitive and continuous correlate of androgen exposure in the intrauterine environment and predicts later reproductive success. Some endocrine-disrupting chemicals can alter male reproductive tract development, including shortening...... AGD, in both rodents and humans. Whether AGD is related to semen quality in human is unknown. OBJECTIVE: We examined associations between AGD and semen parameters in adult males. METHODS: We used multiple regression analyses to model the relationships between sperm parameters and two alternative...... measures of AGD [from the anus to the posterior base of the scrotum (AGD(AS)) and to the cephalad insertion of the penis (AGD(AP))] in 126 volunteers in Rochester, New York. RESULTS: AGD(AS), but not AGD(AP), was associated with sperm concentration, motility, morphology, total sperm count, and total motile...

  20. Human semen quality in relation to dietary pesticide exposure and organic diet

    DEFF Research Database (Denmark)

    Juhler, R. K.; Larsen, S. B.; Meyer, Otto A.; Jensen, N. D.; Spanò, M.; Givercman, A.; Bonde, J. P.


    The objective of the study was to corroborate or refute the hypothesis that farmers having a high intake of organic grown commodities have a high semen quality due to their expected lower level of dietary pesticides intake. Food frequency data and semen were collected from 256 farmers (171...... mean intake of single commodities, such as rice, potato, and pork meat. The current individual dietary intake of 40 pesticides was estimated using food frequencies and generalized serving size data in combination with data on pesticide concentrations in food commodities as obtained from the National...... Danish Food Monitoring Program. The estimated pesticide intake was significantly lower among farmers of group H, but for all three groups of farmers the average dietary intake of 40 pesticides was at or below 1% of the acceptable daily intake (ADI) except for the dithiocarbamates (max = 0.21 mu g/kg day...

  1. Effects of alpha-lipoic acids on sperm membrane integrity during liquid storage of boar semen

    Directory of Open Access Journals (Sweden)

    Laura Parlapan


    Full Text Available Preliminary studies have shown that sperm membrane from swine shows high sensitivity to cryopreservation process, causing a dramatic reduction in sperm quality. This has been attributed to the production of reactive oxygen species, that cause lipid peroxidation in sperm membranes. The aim of the present study was to minimize the oxidative attack by adding different concentration of alpha-lipoic acid into the sperm liquid storage at 17ºC for 7 days. Freshly ejaculated boar semen was diluted with Beltsville Thawing Solution (BTS and supplemented with 5 levels of alpha-lipoic  acid (0.015, 0.02, 0.05, 0.1, 0.15 mmol/ml. The membrane integrity was evaluated at days 0, 1, 3, 5 and 7 of liquid preservation, using flow cytometer FACSCanto II (BD Biociencias systems. The experiment indicate that supplementation of alpha-lipoic  acid to the semen liquid storage extender improve sperm membrane

  2. Hazard Analysis and Critical Control Points System for a Bull Semen Production Centre. (United States)

    Goularte, K L; Madeira, E M; Ferreira, C E R; Duval, E H; Vieira, A D; Mondadori, R G; Lucia, T


    Bull semen production centres (SPC) generally present satisfactory quality control for sperm processing, but non-standardized hygiene procedures. This study describes a Hazard Analysis and Critical Control Points (HACCP) system developed for bull SPC and subsequently implemented in a commercial SPC. After the identification of hazards at each step of semen processing and the determination of their risk and severity, monitoring and corrective procedures were designed to assess the system's efficiency. The HACCP system identified six microbiological hazards, 10 physical hazards, four chemical hazards and three critical control points. After the establishment of Good Processing Practices, Standard Operating Procedures and Standard Sanitizing Operating Procedures, the system was validated through an audit, to identify eventual failures and to define measures to correct them. PMID:26477334

  3. Two new types of chromosomal rearrangements in the swine species induced by semen irradiation

    International Nuclear Information System (INIS)

    In the present experiment were used one boar and 5 descendent of Landrace and Large White cross-breeding were used, all the animals were healthy concerning to the reproductive aspect and chromosome constitution. Initially semen was collected from the boar through the glove hand method, diluted and submitted to gamma irradiation. The total applied dose was of 800 R, with an exposition period of 3,76 min. The artificial insemination of the females with the treated semen was performed from the time of observation of positive tolerance reflex, with each animal receiving 2 inseminations with a 12 hour interval in between. after birth, the piglets had their blood aseptically collected for karyotype preparation and analysis. From 17 piglets born and cytogenetically analysed, 2 chromosomal rearrangements were detected, namely, a reciprocal translocation or insertion, 8q-; 14p+ in a female a pericentric inversion in chromosome 1 in a male. (author). 18 refs, 2 figs


    Directory of Open Access Journals (Sweden)

    R. TOMAN


    Full Text Available The aim of this study was to reveal the effect of diazinon on the rat spermatozoa motility characteristics using the computer-assisted semen analysis (CASA. Motility, progressive motility, DAP, DCL, DSL, VAP, VCL, VSL, STR, LIN, WOB, ALH, and BCF after the diazinon i.p. administration of 20 mg/kg b.w. were evaluated. 36 hours after the diazinon administration, only slight decrease in VCL, DCL and increase in percentage of progressive motility in the diazinon-treated group. Significant decrease (P<0.01 was only observed in BCF in diazinon-treated group. Computer-assisted semen analysis (CASA of rat sperm motility showed that acute diazinon administration slightly affected the rat sperm motility which can be the first step in the decreased fertilization capacity caused by pesticides. Further investigation of reproductive effects of diazinon is needed.

  5. Effect of semen extenders on frozen-thawed boar sperm characteristics and distribution in the female genital tract after deep intrauterine insemination in sows. (United States)

    Noguchi, Michiko; Yoshioka, Koji; Hikono, Hirokazu; Suzuki, Chie; Kikuchi, Kazuhiro


    We compared the effects of extenders of frozen-thawed semen on post-thaw sperm characteristics and the distribution of frozen-thawed spermatozoa in the female genital tract after fixed-timed deep intrauterine insemination (DIUI) in sows. Frozen semen samples were thawed and diluted in either modified Modena solution (mMS) or porcine fertilization medium (PFM) containing theophylline, adenosine and cysteine. Sperm quality, assessed in vitro based on motility using a computer-assisted sperm analyzer and the integrity of the plasma and acrosomal membranes using flow cytometry, was evaluated at 0.5, 1.5, 3 and 6h after thawing. Progressive motility and the percentage of spermatozoa with damaged acrosomal membranes in PFM were significantly better than in mMS throughout the 6h. Sows with estrus synchronized using prostaglandin F2 alpha, equine chorionic gonadotropin and human chorionic gonadotropin (hCG) were inseminated once with mMS- or PFM-diluted 5×10(8) frozen-thawed spermatozoa by DIUI at 34h after the hCG injection. At 4h after DIUI, reproductive tracts were recovered from 30 sows. There were significantly fewer polymorphonuclear leukocytes (PMNs) and more spermatozoa outside PMNs in the uterine horn after PFM treatment than with mMS. When 22 sows were administered DIUI with 10×10(8) frozen-thawed spermatozoa at 36h after hCG, the pregnancy rates did not differ significantly between the mMS- (36%) and PFM- (64%) treated groups. Thus, PFM enhanced progressive sperm motility but increased sperm membrane damage compared with mMS; it also suppressed the migration of PMNs into the uterine lumen. PMID:26588890

  6. Effect of varicocele on semen characteristics according to the new 2010 World Health Organization criteria: a systematic review and meta-analysis. (United States)

    Agarwal, Ashok; Sharma, Reecha; Harlev, Avi; Esteves, Sandro C


    This study investigated the effects of varicocele on semen parameters in infertile men based on the new 2010 World Health Organization laboratory manual for the examination of human semen. Semen analysis results (volume, sperm count, motility, and morphology) were the primary outcomes. An electronic search to collect the data was conducted using the Medline/PubMed, SJU discover, and Google Scholar databases. We searched articles published from 2010 to August 2015, i.e., after the publication of the 2010 WHO manual. We included only those studies that reported the actual semen parameters of adult infertile men diagnosed with clinical varicocele and contained a control group of either fertile men or normozoospermic men who were not diagnosed with varicocele. Ten studies were included in the meta-analysis, involving 1232 men. Varicocele was associated with reduced sperm count (mean difference: -44.48 × 10 [6] ml-1 ; 95% CI: -61.45, -27.51 × 10 [6] ml-1 ; P manual edition used for semen assessment. We conclude that varicocele is a significant risk factor that negatively affects semen quality, but the observed pooled effect size on semen parameters does not seem to be affected by the WHO laboratory manual edition. Given most of the studies published after 2010 still utilized the 1999 manual for semen analysis, further research is required to fully understand the clinical implication of the 2010 WHO laboratory manual on the association between varicocele and semen parameters. PMID:26780872

  7. Genomic selection strategies in dairy cattle breeding programmes: Sexed semen cannot replace multiple ovulation and embryo transfer as superior reproductive technology

    DEFF Research Database (Denmark)

    Pedersen, Louise Dybdahl; Kargo, Morten; Berg, Peer; Voergaard, Jacob; Buch, Line Hjortø; Sørensen, Anders Christian


    The aim of this study was to test whether the use of X-semen in a dairy cattle population using genomic selection (GS) and multiple ovulation and embryo transfer (MOET) increases the selection intensity on cow dams and thereby the genetic gain in the entire population. Also, the dynamics of using...... semen. However, when all young bull candidates were born following MOET, the results showed that the use of Y-semen in the breeding nucleus tended to decrease the rate of inbreeding as it enabled GS to increase within-family selection. This implies that the benefit from using sexed semen in a modern...

  8. Effect of improved diet on semen quality and scrotal circumference in the ram


    Kheradmand, Arash; Babaei, Homayoon; Ali Batavani, Rooz


    The aim of this investigation was to assess the effect of improved diet above maintenance requirement on reproductive parameters, including testicular size, semen volume, sperm concentration and viability. Twelve Bakhtiary rams were allocated to two groups of six animals and were fed during a 12-week experiment period with different diets which were designed to supply maintenance and above maintenance requirements (dry matter, energy and protein). Dry matter (DM), barley and soybean meal for ...

  9. Sexual behavior and its relationship with semen quality parameters in Sahiwal breeding bulls

    Directory of Open Access Journals (Sweden)

    Shushant Singh


    Full Text Available Aim: The study was conducted at Artificial Breeding Research Centre, NDRI, Karnal, to determine the sexual behavior and its relationship with semen quality parameters in Sahiwal breeding bulls. Materials and Methods: A total of 63 ejaculates were collected from six adult Sahiwal bulls (age ~47 mo and bwt ~466 kg, to study the relationship of sexual behavior and semen quality. The degree of association between different variables was estimated by Pearson’s correlation coefficient method. Results: The results depicted that, sexual aggressiveness showed significantly high positive correlation with libido score (LS and sexual behavior score (SBS. Reaction time (RT and total time taken in mounts (TTTM had a significant negative correlation with LS and SBS. Penile erection score and penile protrusion score (PPS both had a significant positive correlation with ejaculatory thrust score, mating ability score, and SBS. Results of correlation among seminal attributes and with sexual behavior depicted that ejaculate volume had positive significant correlation with initial progressive motility (IPM, sperm concentration (SCON, head abnormality, total abnormality, hypo-osmotic swelling test (HOST, acrosomal integrity (AI whereas, mass activity had positive significant correlation with IPM, SCON, non-eosinophilic spermatozoa count (NESC, HOST, AI, RT and TTTM and IPM had positive significant correlation with SCON, NESC, HOST, AI, and TTTM, whereas and HOST had positive significant correlation with AI. Among seminal attributes, SCON had a positive significant correlation with PPS where as head abnormalities had a positive significant correlation with RT and TTTM. Conclusion: It can be concluded that the relationship of sexual behavior and semen quality parameters are reflecting that the sexual behavior of individual bulls is important to harvest good quality and quantity of semen as desired type of sexual preparation can be provided.

  10. Seasonal and Genotype Variations in Libido, Semen Production and Quality in Artificial Insemination Boars


    Avis Joseph; Chukwuemeka Okere; Michael Ezekwe


    The aim of this study is to access libido (sex drive) and examine the quality of ejaculates collected from Yorkshire (Large White) and Landrace boars, taking into account the potential effects of season and breed over a test period of one year. Two sexually mature boars (one from each breed, Yorkshire and Landrace) were trained to mount a dummy and ejaculate. Libido scores were assigned to boars during each semen collection. Scores ranged from zero to four, with zero indicating minimum and fo...

  11. Genetic basis of semen traits and their relationship with growth rate in rabbits


    Tusell, Llibertat; Legarra, Andres; Garcia-Tomas, M.; Rafel, O.; Ramon, J.; Piles, M.


    This work aims to estimate the genetic parameters of seminal and production traits in a paternal line of rabbits selected for ADG during the fattening period. The onsidered traits were male libido (Lib) defi ned as successful mounting of an artificial vagina; presence of urine (Ur) and calcium carbonate deposits (Ca) in the ejaculate; semen pH; individual sperm motility (IM); the suitability for AI of the ejaculate (Sui), which involves the subjective combination of several quality traits; th...

  12. Effects of Methanolic Extract of Moringa Oleifera Leaves on Semen and biochemical Parameters in Cryptorchid Rats


    Afolabi, Ayobami Oladele; Aderoju, Hameed Adeola; Alagbonsi, Isiaka Abdullateef


    While anti-oxidant effects of Moringa oleifera in much oxidative stress related diseases have been well reported, cryptorchidism on the other hand has been shown to cause oxidative stress. However, study is scanty on the likely role of Moringa oleifera in reducing cryptorchidism-induced oxidative stress in rats has not been studied. The present study looked into the effects of methanolic extract of Moringa oleifera leaves (MEMO) on semen and biochemical parameters in cryptorchid rats. Twenty ...

  13. Semen quality and reproductive hormones before orchiectomy in men with testicular cancer

    DEFF Research Database (Denmark)

    Petersen, P M; Skakkebaek, N E; Vistisen, K; Rørth, M; Giwercman, A


    PURPOSE: To obtain information about preorchiectomy gonadal function in patients with testicular germ cell cancer to improve the clinical management of fertility and other andrologic aspects in these men. PATIENTS AND METHODS: In group 1, a group of 83 consecutive patients with testicular germ cell cancer (TGCC) investigated before orchiectomy, semen analysis was carried out in 63 patients and hormonal investigations, including measurement of follicle-stimulating hormone, luteinizing hormone (LH...

  14. Semen quality, reproductive hormones and fertility of men operated for hypospadias

    DEFF Research Database (Denmark)

    Asklund, C; Jensen, Tina Kold; Main, K M; Sobotka, T; Skakkebæk, Niels Erik; Jørgensen, N


    The testicular function of men previously operated for hypospadias has been sparsely investigated. Therefore, we investigated semen quality and reproductive hormones of 92 men with isolated hypospadias (IH) and 20 with hypospadias and additional genital disorders (HAGD) and compared with similar results from young men from the general Danish population. All participants lived the Copenhagen area of Denmark. Additionally, fertility information on 1083 men registered as operated for hypospadias wa...

  15. Effects of oncological treatments on semen quality in patients with testicular neoplasia or lymphoproliferative disorders


    DI BISCEGLIE, Cataldo; Bertagna, Angela; Composto, Emanuela R; LANFRANCO, Fabio; Baldi, Matteo; Motta, Giovanna; Barberis, Anna M; NAPOLITANO, EMANUELA; Castellano, Elena; MANIERI, Chiara


    Pretherapy sperm cryopreservation in young men is currently included in good clinical practice guidelines for cancer patients. The aim of this paper is to outline the effects of different oncological treatments on semen quality in patients with testicular neoplasia or lymphoproliferative disorders, based on an 8-year experience of the Cryopreservation Centre of a large public hospital. Two hundred and sixty-one patients with testicular neoplasia and 219 patients with lymphoproliferative disor...

  16. The effect of semen analysis factors regarding IUI with male factor infertility

    Directory of Open Access Journals (Sweden)

    A. Ghaseminezhad


    Full Text Available AbstractBackground and Purpose: There is evidence in literature that IUI is the first line treatment and the most cost-effective procedure for mild to moderate male factor sub-fertility, however, the relative influence of various semen characteristics with the likelihood of a successful outcome is controversial. This study is designed to show the correlation between semen parameters and the pregnancy rate in patients, with mild to moderate male factor sub-fertility and whose wives were normal and underwent hyper-stimulation, including IUI.Materials and Methods: From January 2005 to January of 2006, 95 couples with male factor infertility underwent 140 IUI cycles with husbands washed semen were included in this study .They were divided into two groups based on semen parameters, mild and moderate. Post- wash sperm parameters, type of infertility (primary and secondary, male/ female age and duration of infertility were evaluated and correlated with clinical pregnancy outcome.Results: The clinical pregnancy rate per cycle was 26 (18.5%; 15 (21.4% in mild group, while 11(15.7% in moderate group. The clinical pregnancy rate per couple was 27.3%.There were significant correlation between female age, duration of infertility, sperm concentration and progressive motility, and clinical pregnancy.Conclusion: Our findings suggest that post- wash sperm concentration and progressive motility, female age and duration of infertility are the most important factors for prediction of successful pregnancJ Mazand Univ Med Sci 2008; 18(65:10-18 (Persian

  17. Induction of Heat Shock Protein Expression in Cervical Epithelial Cells by Human Semen

    Directory of Open Access Journals (Sweden)

    S. S. Witkin


    Full Text Available Objective: The 70kD heat shock protein (Hsp70, induced when cells are subjected to environmental stress, prevents the denaturation and incorrect folding of polypeptides and may expedite replication and transmission of DNA and RNA viruses. We analyzed whether messenger RNA (mRNA for Hsp70 was expressed following exposure of a cultured human cervical cell line (HeLa cells to human semen or in cervical cells from sexually active women.

  18. Physical activity and television watching in relation to semen quality in young men

    DEFF Research Database (Denmark)

    Gaskins, Audrey Jane; Mendiola, Jaime; Afeiche, Myriam; Jørgensen, Niels; Swan, Shanna H; Chavarro, Jorge E


    BACKGROUND: Semen quality appears to have declined over the past decades but reasons for this decline are unresolved. The concurrent increase in sedentary behaviour may be a contributing factor. The objective of this study was to evaluate the relationship of physical activity and television (TV) watching with sperm parameters in a population of young, healthy men. METHODS: Men aged 18-22 years (n=189) from the Rochester Young Men's Study (2009-2010) participated in this analysis. Physical activi...

  19. Semen analysis parameters: Experiences and insight into male infertility at a tertiary care hospital in Punjab

    International Nuclear Information System (INIS)

    Objective: To determine the prevalence of low sperm count including oligospermia and azoospermia in male infertile population, and to assess the pattern and distribution of abnormal semen parameters in infertile men. Methods: The descriptive cross-sectional survey was carried out at the Department of Gynaecology and Obstetrics, Sharif Medical City Hospital, Lahore, from June 2009 to June 2010. A total of 500 consecutively consenting male partners of women fulfilling the inclusion criteria between 20 and 40 years of age were approached. Semen analysis was performed according to methods and standards defined by the World Health Organisation (WHO). Samples were categorised into normospermia, oligospermia and azoospermia on the basis of sperm count. After exclusion of azoospermic samples, normospermic and oligospermic