Basis for developing samarium AMS for fuel cycle analysis
International Nuclear Information System (INIS)
Buchholz, Bruce A.; Biegalski, Steven R.; Whitney, Scott M.; Tumey, Scott J.; Jordan Weaver, C.
2010-01-01
Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of 146 Sm, 149 Sm, and 151 Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.
Optical isotype shifts of 146Sm and 151Sm
International Nuclear Information System (INIS)
Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; England, J.G.; Grant, I.S.
1984-01-01
We have measured the optical isotope shifts of 146 Sm and 151 Sm by laser resonance fluorescence. From these measurements the changes in the mean square nuclear radii are: delta 2 > (A=144 to 146)=0.266(10) fm 2 , and delta 2 > (A=151 to 152)=0.262(10) fm 2 . These results, together with those of the stable isotopes, show that the average nuclear expansion of samarium can be accounted for by the liquid drop model with deformations. (orig.)
Implementation of an analytical technique for Samarium
International Nuclear Information System (INIS)
Garcia G, N.
2004-01-01
Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10 - 2 M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)
Thermal diffusivity of samarium-gadolinium zirconate solid solutions
International Nuclear Information System (INIS)
Pan, W.; Wan, C.L.; Xu, Q.; Wang, J.D.; Qu, Z.X.
2007-01-01
We synthesized samarium-gadolinium zirconate solid solutions and determined their thermal diffusivities, Young's moduli and thermal expansion coefficients, which are very important for their application in thermal barrier coatings. Samarium-gadolinium zirconate solid solutions have extremely low thermal diffusivity between 20 and 600 deg. C. The solid solutions have lower Young's moduli and higher thermal expansion coefficients than those of pure samarium and gadolinium zirconates. This combination of characteristics is promising for the application of samarium and gadolinium zirconates in gas turbines. The mechanism of phonon scattering by point defects is discussed
Labeling fish with an activable element through their diet. [samarium
Energy Technology Data Exchange (ETDEWEB)
Michibata, Hitoshi (Toyama Univ. (Japan). Faculty of Science)
1981-10-01
Stable samarium, one of the rare earth elements, was fed to medaka (Oryzias latipes) and goldfish (Carassius auratus). The concentration of samarium in the labeled fish was determined by neutron activation analysis. In O. latipes, samarium was detectable even 1 yr after the labeled diet was eaten. In C. auratus, samarium was retained in the fifth brachial arch, scales, and gills.
Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline
Energy Technology Data Exchange (ETDEWEB)
Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)
2014-12-15
Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.
Chrome-free Samarium-based Protective Coatings for Magnesium Alloys
Hou, Legan; Cui, Xiufang; Yang, Yuyun; Lin, Lili; Xiao, Qiang; Jin, Guo
The microstructure of chrome-free samarium-based conversion coating on magnesium alloy was investigated and the corrosion resistance was evaluated as well. The micro-morphology, transverse section, crystal structure and composition of the coating were observed by scanning electron microscopy (SEM), X-ray diffraction (XRD), energy dispersive spectroscopy (EDS) and X- ray photoelectron spectroscopy (XPS), respectively. The corrosion resistance was evaluated by potentiodynamic polarization curve and electrochemical impedance spectroscopy (EIS). The results reveal that the morphology of samarium conversion coating is of crack-mud structure. Tiny cracks distribute in the compact coating deposited by samarium oxides. XRD, EDS and XPS results characterize that the coating is made of amorphous and trivalent-samarium oxides. The potentiodynamic polarization curve, EIS and OCP indicate that the samarium conversion coating can improve the corrosion resistance of magnesium alloys.
Anodic dissolution of samarium in acetonitrile solution of acetylacetone
International Nuclear Information System (INIS)
Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.
2003-01-01
Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru
High purity samarium oxide from mixed rare earth carbonates
International Nuclear Information System (INIS)
Queiroz, Carlos A. da S.; Seneda, Jose A.; Vasconcellos, Mari E. de; Pedreira Filho, Walter dos R.
2013-01-01
A simple and economical chemical process for the production of highly pure samarium oxides is discussed. The raw material, which was used in the form of rare earth carbonates was produced industrially from the chemical treatment of Brazilian monazite. Ion exchange chromatography was performed using a strong cationic resin that is typically employed in water treatment processes to fractionate rare earth elements (REE) without the use of retention ions. Under these conditions, 99.9% pure Sm 2 O 3 was eluted using the ammonium salt of ethylenediaminetetraacetic acid (EDTA) at a controlled pH. The EDTA-samarium complex was separated from EDTA and then precipitated as oxalate and fired to samarium oxide. Molecular absorption spectrophotometry was used to monitor the samarium content during the proposed process, and sector field inductively coupled plasma mass spectrometry was used to certify the purity of the samarium oxide. Typical samarium oxide obtained from the proposed procedure contained the following contaminants in micrograms per gram: Sc (20.90); Y (11.80); La (8.4); Ce (4.3); Pr (2.5); Nd (5.1); Eu (94); Gd (114); Tb (3.6); Dy (2.5), Ho (2.3); Er (3.0); Tm (2.3); Yb (38,2); Lu (25.6). The high-purity samarium oxides produced in the present study can be used as an alternative to imported products in research and development applications. (author)
Separation of lanthanum from samarium on solid aluminum electrode in LiCl-KCl eutectic melts
International Nuclear Information System (INIS)
De-Bin Ji; Mi-Lin Zhang; Xing Li; Xiao-Yan Jing; Wei Han; Yong-De Yan; Yun Xue; Zhi-Jian Zhang; Harbin Engineering University, Harbin
2015-01-01
This paper presents an electrochemical study on the separation of lanthanum from samarium on aluminum electrode at 773 K. The results from different electrochemical methods showed that Sm(III) and La(III) formed Al-Sm and Al-La intermetallic compounds on an aluminum electrode at electrode potential around -1.67 and -1.46 V, respectively. The electrochemical separation of lanthanum was carried out in LiCl-KCl-LaCl 3 -SmCl 3 melts on solid aluminum electrodes at 773 K by potentiostatic electrolysis at -1.45 V for 40 h and the separation efficiency was 99.1 %. (author)
Investigation of samarium solubility in the magnesium based solid solution
International Nuclear Information System (INIS)
Rokhlin, L.L.; Padezhnova, E.M.; Guzej, L.S.
1976-01-01
Electric resistance measurements and microscopic analysis were used to investigate the solubility of samarium in a magnesium-based solid solution. The constitutional diagram Mg-Sm on the magnesium side is of an eutectic type with the temperature of the eutectic transformation of 542 deg C. Samarium is partly soluble in solid magnesium, the less so, the lower is the temperature. The maximum solubility of samarium in magnesium (at the eutectic transformation point) is 5.8 % by mass (0.99 at. %). At 200 deg C, the solubility of samarium in magnesium is 0.4 % by mass (0.063 at. %)
Role of samarium additions on the shape memory behavior of iron based alloys
International Nuclear Information System (INIS)
Shakoor, R.A.; Khalid, F. Ahmad; Kang, Kisuk
2011-01-01
Research highlights: → The effect of samarium contents on shape memory behavior has been studied. → Addition of samarium increases the strength, c/a ratio and ε (hcp martensite). → Addition of samarium retards the nucleation of α (bcc martensite). → Improvement in shape memory effect with the increase in samarium contents. - Abstract: The effect of samarium contents on shape memory behavior of iron based shape memory alloys has been studied. It is found that the strength of the alloys increases with the increase in samarium contents. This effect can be attributed to the solid solution strengthening of austenite by samarium addition. It is also noticed that the shape memory effect increases with the increase in samarium contents. This improvement in shape memory effect presumably can be regarded as the effect of improvement in strength, increase in c/a ratio and obstruction of nucleation of α in the microstructure.
Plasma sprayed samarium--cobalt permanent magnets
International Nuclear Information System (INIS)
Willson, M.C.; Janowiecki, R.J.
1975-01-01
Samarium--cobalt permanent magnets were fabricated by arc plasma spraying. This process involves the injection of relatively coarse powder particles into a high-temperature gas for melting and spraying onto a substrate. The technique is being investigated as an economical method for fabricating cobalt--rare earth magnets for advanced traveling wave tubes and cross-field amplifiers. Plasma spraying permits deposition of material at high rates over large areas with optional direct bonding to the substrate, and offers the ability to fabricate magnets in a variety of shapes and sizes. Isotropic magnets were produced with high coercivity and good reproducibility in magnetic properties. Post-spray thermal treatments were used to enhance the magnetic properties of sprayed deposits. Samarium--cobalt magnets, sprayed from samarium-rich powder and subjected to post-spray heat treatment, displayed energy products in excess of 9 million gauss-oersteds and coercive forces of approximately 6000 oersteds. Bar magnet arrays were constructed by depositing magnets on ceramic substrates. (auth)
Behavior of Samarium III during the sorption process
International Nuclear Information System (INIS)
Ordonez R, E.; Garcia G, N.; Garcia R, G.
2004-01-01
In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)
Physico-chemical studies on samarium soaps in solid state
International Nuclear Information System (INIS)
Mehrotra, K.N.; Chauhan, M.; Shukla, R.K.
1989-01-01
The physico-chemical characteristics of samarium soaps (caproate and caprate) in solid state were investigated by IR, X-ray diffraction and TGA measurements. The IR results revealed that the fatty acids exist in dimeric state through hydrogen bonding and samarium soaps possess partial ionic character. The X-ray diffraction measurements were used to calculate the long spacings and the results confirmed the double layer structure of samarium soaps. The decomposition reaction was found kinetically of zero order and the values of energy of activation for the decomposition process for caproate and caprate were found to be 8,0 and 7,8 kcal mol -1 , respectively. (Authors)
The ion-exchange obtaining of high purity samarium oxide
International Nuclear Information System (INIS)
Brzyska, W.; Soltysiak, I.; Cygan, J.
1987-01-01
The use of lactic acid - EDTA mixture as an eluent for the obtaining of high purity samarium oxide was studied. The studies were carried out at room temperature on cation exchange resin Wofatit KPS X 8. The best results were obtained for lactic acid (0,26 mol/dm 3 ) - EDTA (0,013 mol/dm 3 ) mixture at pH 3,3. As the result of 57% samarium concentrate elution with column load 1:3 and flow rate 0,4 cm/min, over 99% pure samarium oxide with 73% yield has been obtained. The yield of spectrally pure Sm 2 O 3 exceeded 45%. (author)
Energy Technology Data Exchange (ETDEWEB)
Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)
2004-07-01
Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)
Samarium ion exchanged montmorillonite for high temperature cumene cracking reaction
International Nuclear Information System (INIS)
Binitha, N.N.
2009-01-01
Full text: Nano material Montmorillonite clay is cation exchanged with samarium and its catalytic influence in cumene cracking reaction is investigated. Effect of exchange with sodium ions on further exchange with samarium ions is also noted. Acidity measurements are done using TPD of ammonia. The retention of basic structure is proved from FTIR spectra and XRD patterns. Elemental analysis result shows that samarium exchange has occurred, which is responsible for the higher catalytic activity. Surface area and pore volume remains more or less unaffected upon exchange. Thermogravimetric analysis indicates the enhanced thermal stability on exchanging. Cumene cracking reaction is carried out at atmospheric pressure in a fixed bed glass reactor at 673 K. The predominance of Bronsted acidity is confirmed from high selectivity to benzene. (author)
International Nuclear Information System (INIS)
Korotkevich, I.B.; Kolesnikov, A.A.; Bomshtejn, V.E.
1990-01-01
Lanthanum (3) and samarium (3) extraction from nitric acid solutions by tributylphosphate in the presence of solid phase has been investigated. An increase in samarium α-nitrate distribution factor in the presence of solid phase with a decrease in its concentration in the initial solution and with lanthanum nitrate concentration increase is detected. The greatest effect of separation is observed in samarium nitrate microregion. The method of quantitative extraction of samarium from lanthanum nitrate solutions with samarium-lanthanum separation factor exceeding 50 has been suggested
International Nuclear Information System (INIS)
Meftahi, M.; Bahrami Samani, A.; Babaei, M. H.; Shamsaei Zafarghandi, M.; Ghannadi Maragheh, M.
2010-01-01
''1 53 Sm-EDTMP is one of the well known radiopharmaceuticals for pain palliation of bone metastases. Despite that, it is used just in a few countries. It is due to some reasons like being costly enriched samarium that usually used as target for irradiation and short half-life of 153 Sm. In this investigation, certain amounts of radiopharmaceuticals prepared by irradiation of enriched and natural samarium were injected to some normal rats. Then, the rodents were sacrificed and some of their organs were removed. All of the mentioned stages were performed in order to consider the possibility of exploiting natural samarium instead of enriched samarium by study of biodistribution of both radiopharmaceuticals in various organs especially in bone as the target tissue. At the end, the acceptable results were obtained using natural samarium in comparison with the enriched samarium from the point of view of the biodistribution studies.
Influence of tellurite on lifetime for samarium doped lanthanum lead borate glass
Madhu, A.; Eraiah, B.
2018-04-01
Samarium substituted tellurium lanthanum lead borate glass is prepared using melt quenching technique. Luminescence spectra have been recorded upon excitation with 402 nm various transitions from 4G5/2 level, for samarium doped tellurite glasses are studied and also lifetime for all the samples exhibit single exponential behaviour of decay curve. Luminescence spectra of present glasses show quenching effect due to cross-relation channels of samarium ions. The lifetime of glass samples decrease as the tellurite concentration is decreased. So, it evidences that to attain longer lifetime for lasing material one can tune the host by selecting concentration of tellurite.
A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...
African Journals Online (AJOL)
delocalized π-electrons of the pyridyl rings obtains increasing attention in ... BaSO4 plate was used as a reference (100% reflectance), on which the finely ground .... several are samarium-containing complex with bipy [41-45]. Figure 2.
International Nuclear Information System (INIS)
Starikova, L.I.
1991-01-01
Solubility in the system of samarium nitrate-amidopyrine nitrate-water at 25 and 50 deg C was studied. Solubility isotherms consist of three branches, corresponding to crystallization of samarium nitrate tetrahydrate, amidopyrine nitrate and congruently soluble compounds of Sm(NO 3 ) 3 · 2C 13 H 17 ON 3 ·HNO 3 composition. Its thermal behaviour was studied. The system of samarium nitrate-benzotriazole nitrate-water is referred to eutonic type
Sorption-desorption of samarium in Febex bentonite
International Nuclear Information System (INIS)
Ramirez-Guinart, O.; Rigol, A.; Vidal, M.; Fernandez-Poyatos, P.; Alba, M. D.
2012-01-01
with a Be window. Determination of Sm in the solutions derived from sorption-desorption experiments. Samarium concentrations were determined with ICP-OES and ICP-MS. The wavelength used in the ICP-OES was 359.3 nm, whereas the isotope 147 Sm was used in the ICP-MS. The quantification limits for the ICP-OES and ICP-MS were 30 μg L -1 and 10 ng L -1 , respectively. The initial sample shows an asymmetric 001 reflexion whose maximum corresponds to a basal spacing of 14.6 A and a shoulder to a higher 2θ. This is compatible with a heterogeneity composition of the interlayer space where divalent cations predominate. After sorption in water and at increasing Sm concentrations, the peaks became symmetric and the 001 reflexion shifted progressively to lower 2θ up to a basal spacing of 15.3 A compatible with a more homogeneous composition of the interlayer space and the exchange of the original interlayer divalent cations with Sm. These results indicated that whereas at lower concentration sorption was controlled by inner-sphere mechanisms, at higher initial Sm concentrations the predominant sorption mechanism was cationic exchange. The scenario differed when the sorption took place in the interstitial water medium, as the 001 reflexion did not shift to lower 2θ, but it widened and slightly shifted to higher 2θ. Both facts indicate competitiveness between Sm and the cations in the solution. Although the affinity for the interlayer space, in general, increases with the cation charge and then favors Sm, this was only observed for the highest initial Sm concentrations. Samarium sorption-desorption Samarium sorption was higher in water than in the interstitial, basically due to the cationic competition effect both for specific and for ionic-exchange, regular sites. This was consistent with results from the XRD analyses, and it was corroborated by the increase in the divalent cation concentrations in the final solutions after sorption when increasing samarium initial
4f and 5d magnetism in samarium
International Nuclear Information System (INIS)
Stunault, A.; Bernhoeft, N.; Vettier, C.; Dumesnil, K.; Dufour, C.
2001-01-01
We report on resonant magnetic X-ray scattering studies of a samarium epitaxial film at the samarium L 3 edge. We observe one quadrupolar resonance below the edge, reflecting the polarization of the 4f electrons, and two dipolar resonances above the edge, related to the polarization of the 5d band. We demonstrate, by following the thermal evolution of resonant magnetic intensities of both types, that the polarization of the 4f and 5d electrons present exactly the same temperature dependence, even very close to the ordering temperature, in agreement with the RKKY model for long-range magnetic order in rare earths
Studies on ultrasonic velocity and electrical conductivity of samarium soaps in non-aqueous medium
International Nuclear Information System (INIS)
Mehrotra, K.N.; Chauhan, M.; Shukla, R.K.
1990-01-01
The ultrasonic velocity of solutions of samarium soaps in non-aqueous medium has been measured at a constant temperature and the results have been used to evaluate the various acoustic parameters. The pre-micellar association and the formation of micelles in samarium soap solutions have been determined by conductometric measurements. The molar conductance at infinite dilution, degree of ionisation and ionisation constant have been evaluated. The results show that samarium soaps behave as weak electrolyte in dilute solutions. (Authors)
Myelotoxicity of Samarium Sm153 lexidronam in patients with painful bony metastases
International Nuclear Information System (INIS)
Ben Ghachem, T.; Mhiri, A.; Slim, I.; Bahloul, A.; Yeddes, I.; Elbez, I.; Meddeb, I.; Ben Slimene, M.F.
2015-01-01
Full text of publication follows. Introduction: the management of bone pain includes analgesia, radiation, hormones, radiofrequency (RF) ablation, chemotherapy, and surgery. Bone pain palliation therapy with radiopharmaceuticals is a cost-effective systemic therapy to relieve pain from skeletal metastases with a consequent decrease in morbidity and an improvement in quality of life. The aim of our study is to evaluate the effect of myelotoxicity of samarium lexidronam (Sm 153 ) in patients with painful bony metastasis. Methods: we reviewed 116 patients aged from 14 to 87 years old, 91 males (78%) and 25 females (22%), having received 1 to 4 treatments of Sm 153 (37 MBq/kg) for painful bony metastases from different primitive tumors: 67 cases of prostate cancer (57.7%), 22 cases of breast cancer (18.9%), 10 cases of pulmonary cancer (8.6%) and others in 14.6% of cases. Clinical follow-up was available for 159 treatments, consisting on blood count each week over at least two months, in order to evaluate myelotoxicity according to WHO classification. Results: no patients had grade 4 toxicity after its cures. A grade 2-3 myelotoxicity was observed after 52 treatments (34%) during the second week and after 50 treatments (32.6%) during the fourth week with a satisfactory reversibility. At 10 weeks of treatment, myelotoxicity was reclassified from 0 to 2 for 139 cures (90,8%). Moreover, we found that prior treatment with radiotherapy or chemotherapy did not affect the rates of myelotoxicity. Conclusion: multiple treatments with samarium Sm 153 lexidronam had no significant effect on myelotoxicity. Patients with bone predominant metastatic disease may survive for extended periods of time and may safely be treated with multiple modalities of therapy. (authors)
Diffusion of samarium into cobalt in the reduction-diffusion process
International Nuclear Information System (INIS)
Freitas Nogueira, P. de; Neto, F.B.; Landgraf, F.J.G.
1998-01-01
The presence of metallic cobalt in samarium-cobalt powders is a major cause for low magnetic properties in magnets. This paper intends to investigate the effect of time and temperature in the microstructure of powders produced by reduction-diffusion. This process, developed for the production of rare earth-transition metal alloys, consists on the reduction of the rare earth oxide with metallic calcium (or calcium hydride) and its subsequent diffusion into the cobalt particle. In the present work, a mixture of samarium oxide, cobalt powder and metallic calcium was heated to 1100 or 1200 C for 2 or 4 hours in a tubular furnace under one atmosphere of purified argon. The material thereof obtained, a sintered mass is disintegrated by aqueous crepitation. The powder was evaluated in terms of its chemical composition, its samarium yield and the intermetallic compounds present. The samarium, oxygen and calcium content of the powders produced were adequate for magnet production. However, despite the massive formation of the SmCo 5 compound after 2 hours at 1100 C, final homogeneity is attained only after 4 hours at 1200 C, with the presence of SmCo 5 and Sm 2 Co 7 and the absence of the Sm 5 Co 19 compound. Also, metallic cobalt and Sm 2 Co 17 were observed in the materials produced after 2 hours at 1100 or 1200 C. (orig.)
Nonlinear Faraday rotation in samarium vapor
International Nuclear Information System (INIS)
Barkov, L.M.; Melik-Pashaev, D.A.; Zolotorev, M.S.
1988-01-01
Experiments on nonlinear magnetic optical (Faraday) rotation on resonance transitions of atomic samarium are described. Measurements were carried out on transitions with different angular momenta of upper and lower states: 1→0, 0→1 and 1→1. Qualitative explanations of observed phenomena are given
Plasma sprayed samarium--cobalt permanent magnets
International Nuclear Information System (INIS)
Willson, M.C.; Janowiecki, R.J.
1975-01-01
Samarium--Co permanent magnets were fabricated by arc plasma spraying. This process involves the injection of relatively coarse powder particles into a high temperature gas for melting and spraying onto a substrate. The technique is being investigated as an economical method for fabricating Co--rare earth magnets for advanced traveling wave tubes and cross-field amplifiers. Plasma spraying permits deposition of material at high rates over large areas with optional direct bonding to the substrate, and offers the ability to fabricate magnets in a variety of shapes and sizes. Isotropic magnets were produced with high coercivity and good reproducibility in magnetic properties. Post-spray thermal treatments were used to enhance the magnetic properties of sprayed deposits. Samarium--Co magnets, sprayed from Sm-rich powder and subjected to post-spray heat treatment, displayed energy products in excess of 9 million G-Oe and coercive forces of approximately 6000 Oe. Bar magnet arrays were constructed by depositing magnets on ceramic substrates
Magnetoresistance of samarium in the 4.2-300 K range
International Nuclear Information System (INIS)
Trubitsyn, V.A.; Shalashov, V.F.
1980-01-01
Electric conductivity, transverse and longitudinal magnetoresistance of polycrystalline samarium with the purity of 99.9% in the 4.2-300 K temperature range and in magnetic fields up to 50 ke, are measured. The constituent of specific electric conductivity caused by spin disorder is 30.7 μOhmxcm, m*/m=2.6, the exchange parameter is G=3.1 eVxA 3 . Both transverse and longitudinal magnetoresistance are positive at 4.2 K; and the increase of temperature reveals a number of anomalies, evidently conditioned by the alteration of samarium magnetic structure
Conductometric investigations on samarium soaps
International Nuclear Information System (INIS)
Mehrotra, K.N.; Chauhan, Mithlesh; Shukla, R.K.
1989-01-01
The critical micelle concentration (CMC), degree of dissociation and dissociation constant of samarium soaps (valerate, caproate, caprylate and caprate) in a mixture of 60 per cent benzene and 40 per cent methanol were determined by using conductometric measurements. The soaps behaved as simple electrolyte in dilute solutions and the CMC was found to decrease with increasing chainlength of the fatty acid constituent of the soap. (author). 7 refs., 2 tabs
Optical isotope shifts for unstable samarium isotopes
International Nuclear Information System (INIS)
Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; Grant, I.S.; England, J.G.; Fawcett, M.J.
1984-01-01
Using a tunable dye laser beam intersecting a thermal atomic beam, optical isotope shifts and hyperfine splittings have been measured for the four unstable samarium isotopes between 144 Sm and 154 Sm, covering the well known transition region from spherical to deformed shapes. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Curran, D.P.; Totleben, M.J. [Univ. of Pittsburgh, PA (United States)
1992-07-15
This work shows that primary and secondary radicals are rapidly reduced in THF/HMPA to form primary- and secondary-alkylsamarium reagents. The primary- and secondary-radicals can be formed either by direct SmI{sup 2} reductions of primary- and secondary-halides or by a previous rapid radical cyclization. The samarium reagents have moderate stability in solution, and they react with a variety of typical electrophiles, including aldehydes and ketones. The work further shows that organosamarium intermediates can be involved in the traditional samarium Barbier reaction of aldehydes and ketones conducted in THF/HMPA. A new procedure called the {open_quotes}samarium Grignard{close_quotes} method is introduced, and it is suggested that this new procedure will have considerably more scope and generality than the samarium Barbier reaction. 37 refs., 4 tabs.
Energy Technology Data Exchange (ETDEWEB)
Shaorong Liu; Jian Meng (Beijing Research Institute of Chemical Engineering and Metallurgy (China)); Wenhua Liu (General Research Institute for Non-Ferrous Metals (China))
1992-08-24
When thenoyltrifluoroacetone-phenanthroline-Triton X-100 is used to determine samarium(III) and europium(III) fluorimetrically, only a limited amount of neodymium(III) can be tolerated. By using an on- line separation which can partially separate neodymium(III) from samarium(III), a practical and convenient method was developed to detect samarium(III) at concentrations >0.05% and europium(III) at concentrations >0.005% in neodymium oxide. (author). 7 refs.; 4 figs.; 3 tabs.
International Nuclear Information System (INIS)
Shaorong Liu; Jian Meng; Wenhua Liu
1992-01-01
When thenoyltrifluoroacetone-phenanthroline-Triton X-100 is used to determine samarium(III) and europium(III) fluorimetrically, only a limited amount of neodymium(III) can be tolerated. By using an on- line separation which can partially separate neodymium(III) from samarium(III), a practical and convenient method was developed to detect samarium(III) at concentrations >0.05% and europium(III) at concentrations >0.005% in neodymium oxide. (author). 7 refs.; 4 figs.; 3 tabs
ppt level detection of samarium(III) with a coated graphite sensor based on an antibiotic.
Ganjali, Mohammad Reza; Rezapour, Morteza; Pourjavid, Mohammad Reza; Haghgoo, Soheila
2004-07-01
N-[2-[4-[[[(Cyclohexylamino)carbonyl]amino]sulfonyl]phenyl]ethyl]-5-methyl pyrazine carboxamide (glipizid) was explored as an electro-active material for preparing a polymeric membrane-based sensor selective to samarium ions. The membrane incorporated 30% poly(vinyl chloride) (PVC), 53% benzyl acetate (BA), 11% glipizid and 6% sodium tetraphenyl borate. When coated on the surface of a graphite electrode, it exhibits Nernstian responses in the concentration range of 1.0 x 10(-5) to 1.0 x 10(-10) M, with a detection limit of 8.0 x 10(-11)M samarium. The electrode shows high selectivity towards samarium over several cations (alkali, alkaline earth, transition and heavy metal ions), and specially lanthanide ions. The proposed sensor has a very short response time (pH range for at least ten weeks. It was used as an indicator electrode in potentiometric titration of Sm(III) ions with an EDTA solution, and for determination of samarium in binary and ternary mixtures.
Adsorption and the initial stages of samarium condensation on iridium coated by graphite monolayer
International Nuclear Information System (INIS)
Abdullaev, R.M.; Tontegode, A.Ya.; Yusifov, F.K.
1978-01-01
Adsorption and the initial stages of vacuum samarium condensation on iridium coated by graphite monolayer (valent-saturated neutral substrate) were studied by the thermodesorption mass-spectrometry and thermoemission methods, and were compared with samarium adsorption and condensation on iridium. Desorption heat of samarium atoms with thin coating of Ir-C, equal to E approximately 1.9 eV has been determined. For desorption with Ir E is approximately 6 eV. Such a great difference in desorption heats is connected with the reduction of covalent constituent of adsorption bond in a neutral substrate. Samarium on Ir-C is found to be condensated in two states: loosely bound and tightly bound which sharply differ in properties. The tightly bound state is characterized by abnormally low vapour pressure. Possible nature of this state is discussed. Double effect on the condensation of the substrate valent saturation is noted. On the one hand, the reduction of the particle bond with the substrate decreases their concentration on the surface, preventing condensation. On the other hand, the release of the valent eloctrons of adatous brings about strong lateral interaction between them, which in its turn, promotes condensation during eased migration on the neutral substrate
Solar nebula heterogeneity in p-process samarium and neodymium isotopes.
Andreasen, Rasmus; Sharma, Mukul
2006-11-03
Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.
21 CFR 146.146 - Frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen concentrated orange juice. 146.146 Section... Fruit Juices and Beverages § 146.146 Frozen concentrated orange juice. (a) Frozen concentrated orange juice is the food prepared by removing water from the juice of mature oranges as provided in § 146.135...
Crystallization of Yttrium and Samarium Aluminosilicate Glasses
Lago, Diana Carolina; Prado, Miguel Oscar
2016-01-01
Aluminosilicate glasses containing samarium and yttrium (SmAS and YAS glasses) exhibit high glass transition temperatures, corrosion resistance, and glass stability on heating which make them useful for technological applications. Yttrium aluminosilicate glass microspheres are currently being used for internal selective radiotherapy of liver cancer. During the preparation process, crystallization needs to be totally or partially avoided depending on the final application. Thus knowing the cry...
Determination of 0.01–0.1% of samarium in 40–100 mg of lead chloride
Agterdenbos, J.; Jütte, B.A.H.G.; Schuring, J.
1971-01-01
A method is described for the determination of 5–25 μg of samarium in about 40 mg of lead chloride, based on the removal of the lead by electrolysis and determination of the samarium by extraction with PAN and measurement of the extinction of the complex at 552 nm.
Energy Technology Data Exchange (ETDEWEB)
Das, Suman; Anga, Srinivas; Harinath, Adimulam; Panda, Tarun K. [Department of Chemistry, Indian Institute of Technology, Hyderabad (India); Pada Nayek, Hari [Department of Applied Chemistry, Indian Institute of Technology, (ISM) Dhanbad, Jharkhand (India)
2017-12-29
An unprecedentate samarium complex of the molecular composition [{κ"3-{(Ph_2CH)N=CH}{sub 2}C{sub 4}H{sub 2}N}{κ"3-{(Ph_2CHN=CH)(Ph_2CHNCH)C_4H_2N}Sm}{sub 2}] (2), which was isolated by the reaction of a potassium salt of 2,5-bis{N-(diphenylmethyl)-iminomethyl}pyrrolyl ligand [K(THF){sub 2}{(Ph_2CH)N=CH}{sub 2}C{sub 4}H{sub 2}N] (1) with anhydrous samarium diiodide in THF at 60 C through the in situ reduction of imine bond is presented. The homoleptic samarium complex [[κ{sup 3}-{(Ph_2CH)-N=CH}{sub 2}C{sub 4}H{sub 2}N]{sub 3}Sm] (3) can also be obtained from the reaction of compound 1 with anhydrous samarium triiodide (SmI{sub 3}) in THF at 60 C. The molecular structures of complexes 2 and 3 were established by single-crystal X-ray diffraction analysis. The molecular structure of complex 2 reveals the formation of a C-C bond in the 2,5-bis{N-(diphenylmethyl)iminomethyl}pyrrole ligand moiety (Ph{sub 2}Py{sup -}). However, complex 3 is a homoleptic samarium complex of three bis-iminopyrrolyl ligands. In complex 2, the samarium ion adopts an octahedral arrangement, whereas in complex 3, a distorted three face-centered trigonal prismatic mode of nine coordination is observed around the metal ion. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Pratesa, Yudha; Ferdian, Deni; Ramadhan, Fajar Yusya; Maulana, Bramuda
2018-05-01
Sacrificial Anode Low voltage is the latest generation of the sacrificial anode that can prevent the occurrence of Hydrogen Cracking (HIC) due to overprotection. The Al-5n-0.5Cu alloy showed the potential to be developed as the new sacrificial anode. However, the main problem is copper made Al2Cu intermetallic in grain boundary. Samarium is added to modify the shape of the intermetallic to make it finer and make the corrosion uniform. Several characterizations were conducted to analyze the effect of Samarium. Scanning electron microscope (SEM) and Energy dispersive spectroscopy was used to analyzed the microstructure of the alloy. Metallography preparation was prepared for SEM analysis. Corrosion behavior was characterized by cyclic polarization in 3.5% NaCl solution. The results show samarium can change the shape of intermetallic and refine the grains. In addition, samarium makes better pitting resistance and exhibits a tendency for uniform corrosion. It is indicated by the loop reduction (ΔEpit-prot). Current density increased as an effect of samarium addition from 6x10-5 Ampere (Al-5Zn-0.5Cu) to 2.5x10-4 Ampere (Al-5Zn-0.5Cu-0.5Sm). Steel potential protection increased after addition of samarium which is an indication the possibility of Al-Zn-Cu-Sm to be used as low voltage sacrificial anode.
Ultrasonic and viscosimetric studies of samarium laurate in benzene-dimethylsulfoxide mixtures
International Nuclear Information System (INIS)
Mehrotra, K.N.; Anis, M.
1995-01-01
Ultrasonic and viscosity measurements of samarium laurate in benzene-DMSO mixtures of different compositions (7:3 and 1:1 V/V) have been used to determine the critical micelle concentration (CMC), soap-solvent interaction, and various acoustic parameters of the system. The values of critical micelle concentration increase with increasing amount of DMSO in the solvent mixtures. The viscosity results have been explained on the basis of equations proposed by Einstein, Vand. Moulik, and Jones-Dole. The values of CMC for samarium laurate obtained from the viscosity measurements are in agreement with the results obtained from ultrasonic measurements. The results show that the soap molecules do not aggregate appreciably below CMC there is a marked change in the aggregation behaviour at CMC. (author)
Energy Technology Data Exchange (ETDEWEB)
Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx
2004-07-01
In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)
International Nuclear Information System (INIS)
Reino, L.C.P.; Lordello, A.R.
1990-09-01
An inductively coupled plasma optical emission spectrometry method is described for the determination of Sm, Eu, La, Gd, Dy, Pr, Ho, Nd, Tb and Y in purified oxides of lanthanum, samarium and gadolinium. The method enables a simple, precise and readily available determination. Dissolution of the samples is achieved with diluted hydrochloric acid (1:1). The solutions are diluted to volume for a concentration of 1mg/ml. The lowest determination limit is 0,01% for most elements and 0,05 or 0,1% for a few rare earths in samarium and gadolinium matrices. Lanthanum, Samarium and Gadolinium concentrates with purity grade of 99,9%, 99,6% and 99,8%, respectively, can be analysed by this procedure. (author)
Directory of Open Access Journals (Sweden)
Amri Amin
2009-06-01
Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively. Keywords: liquid membrane, rare earth elements, samarium, yttrium
Preparation and examination of properties of samarium-153-EDTMP complex
International Nuclear Information System (INIS)
Nowak, M.; Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W.; Licinska, I.
1995-01-01
Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of 153 Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, β - -decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of 153 Sm-EDTMP chelate were examined in a broad range of samarium concentration and 153 Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of 153 Sm-EDTMP chelate as compared with molecules of ''free''EDTMP. The results of biodistribution of 153 Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of 153 Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs
Expedient Method for Samarium(II) Iodide Preparation Utilizing a Flow Approach
Czech Academy of Sciences Publication Activity Database
Voltrová, Svatava; Šrogl, Jiří
2013-01-01
Roč. 24, č. 3 (2013), s. 394-396 ISSN 0936-5214 R&D Projects: GA MŠk LH12013 Institutional support: RVO:61388963 Keywords : flow * samarium * iodide * reduction Subject RIV: CC - Organic Chemistry Impact factor: 2.463, year: 2013
Optical properties of zinc–vanadium glasses doped with samarium ...
Indian Academy of Sciences (India)
Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...
X-ray spectrum in the range (6-12) A emitted by laser-produced plasma of samarium
International Nuclear Information System (INIS)
Louzon, Einat; Henis, Zohar; Levi, Izhak; Hurvitz, Gilad; Ehrlich, Yosi; Fraenkel, Moshe; Maman, Shlomo; Mandelbaum, Pinchas
2009-01-01
A detailed analysis of the x-ray spectrum emitted by laser-produced plasma of samarium (6-12 A) is presented, using ab initio calculations with the HULLAC relativistic code and isoelectronic considerations. Resonance 3d-nf (n=4 to 7), 3p-4d, 3d-4p, and 3p-4s transitions in Ni samarium ions and in neighboring ionization states (from Mn to Zn ions) were identified. The experiment results show changes in the fine details of the plasma spectrum for different laser intensities.
Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer
Energy Technology Data Exchange (ETDEWEB)
Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)
2011-07-01
Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)
Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer
International Nuclear Information System (INIS)
Mendes, B.M.; Mendes, T.M.; Campos, T.P.R.
2011-01-01
Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)
International Nuclear Information System (INIS)
Abdurakhmanov, K.P.; Nazyrov, D.E.
2006-01-01
Full text: The raise of thermal and radiation stability as it is known, is one of actual problems of physics semiconductors. Recently it is established, that the rare-earth elements (REE) raise a stability of silicon to exterior action. In this connection the investigation of silicon doped REE by samarium and influence on its properties of heat treatments and radiation exposure is important. In sectional operation the outcomes of investigations of influence of samarium on thermal (600 degree C are reduced; 600 deg. + 900 deg. C; 900 deg. C; 900 deg. C + 600 deg. C; 1100 deg. C; 600 deg. C + 900 deg. C + 1100 deg. C; 900 deg. C + 600 deg. C + 1100 deg. C) thermal defect formation and radiation defect formation (exposure of γ-quanta 60 Co) both in beforehand wrought, and in thermally unfinished samples. After each cycle of heat treatments samples cool fast (throwing off in oil) or slowly (together with the furnace). Doping n-silicon REE by gadolinium and samarium was carried out during cultivation. The concentration of gadolinium and samarium in silicon, on sectional of a neutron-activation analysis was equaled 10 14 - 10 18 cm -3 . As control is model monocrystal silicon such as KEP-15/50. Para-meters of deep levels originating in control and doped REE samples, both past heat treatment or temperature cycling, and irradiated by the γ-quanta are defined by methods of a capacity spectroscopy: DLTS and IRC. The obtained outcomes have shown, that in irradiated with the γ-quanta 60 Co deep levels samples are formed with energies: E C -0,17 eV, E C -0,32 eV, EC-0,41 eV. Thus the parameters of deep levels vary depending on requirements of prestress heat treatment. For example heat treatment at 600 deg. C essentially increments a velocity of introduction of and centre (deep level of E C -0,17 eV), in comparison with a velocity of introduction of this level in samples with prestress heat treatment at 900 deg. C. In samples n-Si doped by samarium effectiveness of formation
Sorption of samarium in iron (II) and (III) phosphates in aqueous systems
International Nuclear Information System (INIS)
Diaz F, J.C.
2006-01-01
The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)
International Nuclear Information System (INIS)
Seminario, C.; Morales, R.; Castro, M.; Cano, R.A.; Mendoza, G.
2005-01-01
To educate is a difficult task but its results make efforts worthwhile. Many patients in Peru suffer from intractable bone pain due to metastases. Since 1993 radionuclides were used to palliate bone pain due to metastases in Peru. First, with the help of the IAEA, Peru participated in a clinical trial using Phosphorus 32 and Strontium 89. Then, efforts were performed to produce Samarium 153 EDMTP locally, which was achieved in 1995. Nevertheless, years passed and Samarium use did not increase proportionally to the needs of people with cancer and bone pain, mainly the poor. Educational strategies have been proven useful for delivering solutions to many health problems in other diseases and also in cancer. Health education makes patients and their relatives assume responsible care of their problems. The purpose of this work was to increase Samarium EDTMP use as palliative treatment in patients with bone pain due to metastases, using educational strategies as means to change attitudes towards this health problem. In September 2003, a task group conducted studies in order to apply several methods to achieve the goal of increasing Samarium EDTMP use. Educational strategies employed were performed to provide verbal and written information to patients, physicians, medical students, residents, pain specialists, oncologists and neurologists, as well as general public. Verbal information included radio interviews, television spots and a phone number (in charge of two secretaries, prepared for answering and if not possible, a physician was in charge of attending patient consultation), e-mail and a web page for consultation. Written material was delivered to several newspapers, including clinical use of Samarium, possibilities of being elected for treatment, benefits and risks and a photography of the product. Politics of the institution producing Samarium changed, in order to achieve minimum cost of the product and it was delivered to all publics at the lowest cost for a year
Lanthanum (samarium) nitrate-4-aminoantipyrine nitrate-water systems
International Nuclear Information System (INIS)
Starikova, L.I.; Zhuravlev, E.F.
1985-01-01
Using the isothermal method of cross-sections at 50 deg C systems lanthanum nitrate-4-aminoantipyrine nitrate-water (1), samarium nitrate-4-aminoantipyrine nitrate-water (2), are studied. Isotherms of system 1 consist of two crystallization branches of initial salt components. In system 2 formation of congruently soluble compounds of the composition Sm(No) 3 ) 3 xC 11 H 13 ON 3 xHNO 3 is established. Analytical, X-ray phase and thermogravimetric analysis of the isolated binary salt are carried out
Collective effects in even-mass samarium isotopes by polarized-proton scattering
Petit, R.M.A.L.; Hall, van P.J.; Klein, S.S.; Moonen, W.H.L.; Nijgh, G.J.; Overveld, van C.W.A.M.; Poppema, O.J.
1993-01-01
The even-mass samarium isotopes 148,...,152Sm have been investigated by polarized proton scattering at 20.4 MeV beam energy. The data have been analysed with an 'extended' optical model, where the intensities of the first maxima of the main inelastic channels are fitted in a coupled-channels
Synthesis of samarium, europium and ytterbium acetylenides
International Nuclear Information System (INIS)
Bochkarev, M.N.; Fedorova, E.A.; Glushkova, N.V.; Protchenko, A.V.; Druzhkov , O.N.; Khorshev, S.Ya.
1995-01-01
Ethynyl complexes of samarium, europium and ytterbium were prepared by interaction of naphthalinides of metals with acetylene in tetrahydrofuran. The compounds are isolated in the form of dark-coloured pyrophore powders. Data of magnetic measurements suggest that in the course of the reaction Sm(2) is oxidized completely to Sm(3), Yb(2) transforms into Yb(3) partially, whereas europium preserves its initial bivalent state. Hydrolysis of the compounds prepared provides acetylene, ethylene, ethane and hydrogen which indicates the presence of acethylenide Ln 2 C 2 and hydride LnH groupings (Ln = Sm, Eu, Yb). 9 refs., 2 tabs
Laser spectroscopy of atomic samarium
International Nuclear Information System (INIS)
Barkov, L.M.; Melik-Pashaev, D.A.; Zolotorev, M.S.
1988-01-01
Samarium spectrum was studied with a purpose to find transitions to be used in experiments on parity nonconservation. Macaluso-Corbino effect - Faraday rotation near resonance was used for the search and study of spectral lines. We have identified previously unknown energy levels belonging to the 4f 5 6s 2 5 D term: 15914.55(3) cm -4 (J=1), 17864.29(3) cm -4 (J=2), 20195.76(3) cm -4 (J=3). M1-transitions to these levels from the levels of the ground 4f 5 6s 2 7 F term were observed. There are several peculiarities of these transitions which are due to the fact that they occut within an inner 4f 5 -shell, particularly, a very small presuure broadening by inert gases. 44 refs.; 17 figs.; 7 tabs
International Nuclear Information System (INIS)
Lucas H, J.
2016-01-01
In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)
Removal of trivalent samarium from aqueous solutions by activated biochar derived from cactus fibres
Institute of Scientific and Technical Information of China (English)
Loukia Hadjittofi; Styliana Charalambous; Ioannis Pashalidis
2016-01-01
The efficiency of activated biochar fibres obtained fromOpuntia Ficus Indica regarding the sorption of trivalent samarium (Sm(III)) from aqueous solutions was investigated by batch experiments. The effect of various physicochemical parameters (e.g. pH, initial metal concentration, ionic strength, temperature and contact time) on the Sm(III) adsorption was studied and the surface species were characterized by FTIR spectroscopy prior to and after the lanthanide sorption. The experimental results showed that the acti-vated biochar fibres possessed extraordinary sorption capacity for Sm(III) in acidic solutions (qmax=90 g/kg, pH 3.0) and near neutral solutions (qmax=350 g/kg, pH 6.5). This was attributed to the formation of samarium complexes with the surface carboxylic moieties, available in high density on the lamellar structures of the bio-sorbent.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...
Pressure and irradiation effects on transport properties of samarium compounds with instable valence
International Nuclear Information System (INIS)
Morillo, J.
1981-01-01
Electron transport properties in samarium compounds with instable valence are studied in this thesis: from SmS in its integer valence phases at common pressure to SmB 6 compound IV at common pressure through SmSsub(1-x)Psub(x) (x 6 is presented [fr
International Nuclear Information System (INIS)
Daidoji, Hidehiro; Tamura, Shohei
1982-01-01
The determination of yttrium, samarium, and dysprodium by means of graphite-furnace atomic absorption spectrometry (AAS) was studied by a tantalum boat inserted into a graphite tube atomizer. These elements could not be determined by the use of a commercial graphite tube, In the atomization from a tantalum boat, better analytical sensitivities and negligible memory effects for these rare earths are obtained. The analytical sensitivities of yttrium, samarium, and dysprodium with the tantalum boat were 0.60 ng, 0.86 ng, and 0.17 ng respectively. This method was applied for the determination of yttrium, samarium, and dysprosium in a mish metal. The measurements were performed with slightly acidified solutions (0.01 mol dm 3 HCI or HNO 3 ). The sensitivities and the precisions for these elements decreased with increasing acid concentration. An enhancement in the sensitivities of yttrium and dysprosium upon the addition of a large excess of lanthanum, neodymium, and praseodymium salts were observed. The yttrium, samarium, and dysprosium in a mish metal were determined with both analytical curves of standard solutions containing an excess of lanthanum, cerium, and neodymium ions and of the standard addition. The precisions for this work were in the 3 - 9.3% range. (author)
Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng
2012-11-01
Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.
Peculiarities of electronic, phonon and magnon subsystems of lanthanum and samarium tetraborides
Energy Technology Data Exchange (ETDEWEB)
Novikov, V.V., E-mail: vvnovikov@mail.ru; Mitroshenkov, N.V.; Matovnikov, A.V.
2015-10-15
Experimental research was carried out to study the temperature dependences of heat capacity C{sub p}(T = 2–300 K), lattice parameters a(T), and ≿(T), (5–300 K) of lanthanum and samarium tetraborides. A comparison with data obtained previously for LuB{sub 4} reveals the peculiar influence of lanthanide contraction and the rare-earths mass on the thermodynamic properties of rare earth tetraborides at low and high temperatures. Sharp anomalies were found in the heat capacity and thermal expansion for SmB{sub 4} at T{sub N} = 25.1 K, conditioned by the phase transition into antiferromagnetic state. The more poorly defined heat capacity anomaly around 7 K is referred to the quadrupole orbital fluctuation of the atomic magnetic moments for Sm{sup 3+} ions. The electronic, lattice, and magnetic contributions to the heat capacity and thermal expansion of samarium tetraboride were defined. Our approach makes it possible to adequately approximate the lattice components of heat capacity and thermal expansion by combining the Debye and Einstein contributions, which are based on the joint analysis of calorimetric and X-ray data. The influence of the frustration of the atomic magnetic moment system for Sm{sup 3+} ions on the thermodynamic characteristics of the samarium tetraboride magnetic phase transition was revealed. - Highlights: • The heat capacity and lattice parameters for LaB{sub 4} and SmB{sub 4} were determined at 2–300 K. • The anomalies of C{sub p}(T), a(T), c(T) for SmB{sub 4} due to the phase transition are revealed. • The lattice contributions to the thermal properties of LaB{sub 4} and SmB{sub 4} are analyzed.
Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat
Directory of Open Access Journals (Sweden)
Maria Veronica Purwani
2017-05-01
Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.
Australian manufacture of QuadrametTM (Samarium-153 EDTMP)
International Nuclear Information System (INIS)
Wood, N.R.; Whitwell, J.
1997-01-01
Quadramet T (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200μg/mL whereas the overseas formulation has a level of 20-46μg/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet TM provides a further option in the management of these difficult cases
Energy Technology Data Exchange (ETDEWEB)
Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)
2012-11-15
Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.
Production of SmCo5 alloy by calciothermic reduction of samarium oxide
International Nuclear Information System (INIS)
Krishnan, T.S.; Gupta, C.K.
1988-01-01
Among the established permanent magnets, SmCo 5 magnet occupies the foremost position as it offers a unique combination of high energy product, coercivity and curie temperature. The SmCo 5 magnets are thus extensively used for high field applications. These are also best suited for use in environments where high demagnetizing field and high temperature are operative. Also, for applications where high performance and miniaturization are the over-riding considerations, the choice again falls on SmCo 5 magnets. The main deterrent to the widespread use of SmCo 5 magnet is its high cost. Both samarium and cobalt metals are high priced, and the magnets prepared from their directly melted alloy are thus naturally very expensive. An alternate process involving calcium reduction of their oxide intermediates has, therefore, been studied and the alloy prepared by this process has been evaluated and found satisfactory for magnet production. The process essentially involves compaction of the charge mix containing samarium oxide, cobalt oxide (or metal) and calcium metal and reduction of the charge compact at 1000-1300 degrees C in hydrogen atmosphere, followed by water and acid leaching, drying and classification
2010-10-01
... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...
Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles
CSIR Research Space (South Africa)
Mandiwana, V
2015-09-01
Full Text Available the biodistribution of poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([(sup153)Sm]Sm(sub2)O(sub3)) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear...
Synthesis of Samarium Cobalt Nanoblades
Energy Technology Data Exchange (ETDEWEB)
Darren M. Steele
2010-08-25
As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.
Neutron Capture and Transmission Measurements and Resonance Parameter Analysis of Samarium
International Nuclear Information System (INIS)
Leinweber, G.; Burke, J.A.; Knox, H.D.; Drindak, N.J.; Mesh, D.W.; Haines, W.T.; Ballad, R.V.; Block, R.C.; Slovacek, R.E.; Werner, C.J.; Trbovich, M.J.; Barry, D.P.; Sato, T.
2001-01-01
The purpose of the present work is to accurately measure the neutron cross sections of samarium. The most significant isotope is 149 Sm, which has a large neutron absorption cross section at thermal energies and is a 235 U fission product with a 1% yield. Its cross sections are thus of concern to reactor neutronics. Neutron capture and transmission measurements were performed by the time-of-flight technique at the Rensselaer Polytechnic institute (RPI) LINAC facility using metallic and liquid Sm samples. The capture measurements were made at the 25 meter flight station with a multiplicity-type capture detector, and the transmission total cross-section measurements were performed at 15- and 25-meter flight stations with 6 Li glass scintillation detectors. Resonance parameters were determined by a combined analysis of six experiments (three capture and three transmission) using the multi-level R-matrix Bayesian code SAMMY version M2. The significant features of this work are as follows. Dilute samples of samarium nitrate in deuterated water (D 2 O) were prepared to measure the strong resonances at 0.1 and 8 eV without saturation. Disk-shaped spectroscopic quartz cells were obtained with parallel inner surfaces to provide a uniform thickness of solution. The diluent feature of the SAMMY program was used to analyze these data. The SAMMY program also includes multiple scattering corrections to capture yield data and resolution functions specific to the RPI facility. Resonance parameters for all stable isotopes of samarium were deduced for all resonances up to 30 eV. Thermal capture cross-section and capture resonance integral calculations were made using the resultant resonance parameters and were compared to results obtained using resonance parameters from ENDF/B-VI updated through release 3. Extending the definition of the capture resonance integral to include the strong 0.1 eV resonance in 149 Sm, present measurements agree within estimated uncertainties with En
Identification of the lines in the L emission spectrum of cerium and samarium
International Nuclear Information System (INIS)
Shrivastava, B.D.; Singh, D.
1992-01-01
The occurrence of a line at 2.1556 A in the L emission spectrum of cerium and two lines at 1.6679 and 1.8379 A in the L emission spectrum of samarium, reported many years ago, has remained a puzzle. These have now been identified as EXAFS minima occurring at the L absorption edges of the respective elements. (author)
2010-01-01
... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...
Samarium-153-EDTMP in the metastatic bone pain treatment
International Nuclear Information System (INIS)
Lins Filho, M.L.M.; Santos, A.O.; Nappi, A.P.B.; Meirelles, M.B.; Arouca, P.T.; Ramos, C.D.; Etchebehere, E.C.S.C.; Teixeira, L.C.; Netto Junior, N.R.; D'Ancona Cal; Camargo, E.E.
1997-01-01
Full text: Bone metastasis is the most reason of pain in prostate and mammary cancer patients. The Samarium-153-EDTMP has been showed as an alternative to the treatment of the metastasis bone pain. With the objective to evaluate the use of the Sm-153-EDTMP as a systemic therapy for the metastasis bone pain, 30 patients (19 male, 11 female, average age of 64,5 years) were studied. 19 patients with prostate cancer and 11 with mammary cancer. All the patients presented previous bone scintiscanning with multiple metastasis; interruption of the chemotherapy or radiotherapy for two or more weeks and leukocyte count higher than 2,000 leukocytes/mm 3 and platelets higher than 80,000/mm 3 . The patients were classified previously to the radioisotope therapy, as far the intensity of the pain in a scale from 0 to 10 is concerned. All the patients received 37 MBq/kg (1m Ci/kg) of weight of Sm-153-EDTMP by venous via. The evaluation 6 weeks after the therapy showed complete or partial pain relief in 22 patients (73,3%). Complete or partial pain relief has been obtained in 91,0% (10 in 11) of the patients with mammary cancer and in 62,2% (12 in 19) of the patients with prostate cancer. Transitory leukopenia (lower than 2,000 leukocytes/mm 3 ) and platelet count (lower than 80,000/mm 3 ) occurred in 33,3% of the patients. 8 patients (26,7%) did not responded to the therapy. The therapy with Samarium-153-EDTMP is a simple, safe and efficient method in the treatment of the bone pain caused by metastasis
Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna
2018-03-01
The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.
Thermomechanical behavior of Fe-Mn-Si-Cr-Ni shape memory alloys modified with samarium
International Nuclear Information System (INIS)
Shakoor, R.A.; Khalid, F. Ahmad
2009-01-01
The deformation and training behavior of Fe-14Mn-3Si-10Cr-5Ni (wt.%) shape memory alloys containing samarium addition has been studied in the iron-based shape memory alloys. It is noticed that thermomechanical treatment (training) has significant influence on proof stress, critical stress and shape memory behavior of the alloys. The improvement in shape memory behavior can be attributed to the decrease in the proof stress and critical stress which facilitates the formation of ε (hcp martensite). It is also observed that alloy 2 containing samarium undergoes less softening as compared to alloy 1 with training which inhibits the formation of α (bcc martensite) and thus enhances the shape memory behavior. The excessive thermomechanical treatment with increase in the training cycle has led to the formation of α (bcc martensite) along with ε (hcp martensite) in the alloy 1 which appeared to have decline in the shape memory effect. This has been demonstrated by the examination of microstructure and identification of α (bcc martensite) martensite in the alloy 1 as compared to alloy 2
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
International Nuclear Information System (INIS)
Wang, Min; Niu, Chao; Liu, Jun; Wang, Qianwu; Yang, Changxiu; Zheng, Haoyan
2015-01-01
Nitrogen and samarium co-doped BiVO 4 (N–xSm–BiVO 4 ) nanoparticles were synthesized using a sol–gel method with a corn stem template. The physicochemical properties of the resultant N–xSm–BiVO 4 particles were characterized using various methods: XPS, XRD, SEM, BET, and UV–Vis DRS analyses. The visible-light photocatalytic activity was successfully demonstrated by degrading a model dye, namely, methyl orange. The dopant content was optimized, and the nitrogen and samarium co-doped BiVO 4 extended the light absorption spectrum toward the visible region, significantly enhancing the photodegradation of the model dye. The Sm and N co-doped BiVO 4 exhibited the highest photocatalytic activity compared to materials with a single dopant or no dopant. The significantly enhanced photocatalytic activity of the N–Sm co-doped BiVO 4 under visible-light irradiation can be attributed to the synergistic effects of the nitrogen and samarium. - Highlights: • The N–Sm codoped BiVO 4 were synthesized using a sol–gel method with a corn stem template. • The N and Sm codoped BiVO 4 has excellent photocatalytic activity of methyl orange degradation. • The maximum activity was observed when the molar ratio of Sm/Bi was 1.0. • The high photocatalytic activity was caused by the synergistic effects between N doping and Sm doping
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...
Electrochemical extraction of samarium from molten chlorides in pyrochemical processes
International Nuclear Information System (INIS)
Castrillejo, Y.; Fernandez, P.; Medina, J.; Hernandez, P.; Barrado, E.
2011-01-01
This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) ↔ Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al 3 Sm and Al 2 Sm.
Electrochemical extraction of samarium from molten chlorides in pyrochemical processes
Energy Technology Data Exchange (ETDEWEB)
Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)
2011-10-01
This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.
21 CFR 146.141 - Canned orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...
Resonances of coherent population trapping in samarium vapours
International Nuclear Information System (INIS)
Kolachevsky, Nikolai N; Akimov, A V; Kiselev, N A; Papchenko, A A; Sorokin, Vadim N; Kanorskii, S I
2001-01-01
Resonances of coherent population trapping were detected in atomic vapours of the rare-earth element samarium. The coherent population trapping was produced by two external-cavity diode lasers (672 and 686 nm) in a Λ-system formed by the three levels of 154 Sm: the 4f 6 6s 2 ( 7 F 0 ) ground state, the first fine-structure 4f 6 6s 2 ( 7 F 1 ) sublevel of the ground state and the 4f 6 ( 7 F)6s6p( 3 P o ) 9 F o 1 upper level. The dependence of the spectral shapes and resonance contrasts on the polarisation of the laser beams and the direction of the applied magnetic field was studied. The obtained results were analysed. (nonlinear optical phenomena)
The systems lanthanum (cerium, samarium) nitrate-tetramethyl-ammonium nitrate-water
International Nuclear Information System (INIS)
Zhuravlev, E.F.; Khisaeva, D.A.; Semenova, Eh.B.
1984-01-01
The method of cross sections at 25 and 50 deg C has been applied to study solubility in the systems lanthanum nitrate-tetramethyl ammonium nitrate-water (1), cesium (3) nitrate-tetramethyl ammonium nitrate-water (2) and samarium nitrate-tetramethyl ammonium nitrate-water (3). Crystallization fields of congruently dissolving compounds with 1:3 ratio of salt components (in system 1) and 1:2 ratio (in systems 2 and 3) are found in the systems. New solid phases are separated preparatively and subjected to chemical, differential thermal and IR spectroscopic analyses. Compositions of formed compounds are compared with the compositions known for nitrates of other representatives of light lanthanides
19 CFR 146.26 - System review.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...
22 CFR 146.525 - Fringe benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...
21 CFR 146.140 - Pasteurized orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...
The systems cerium(3) (samarium) nitrate-quinoline nitrate-water
International Nuclear Information System (INIS)
Khisaeva, D.A.; Zhuravlev, E.F.; Semenova, Eh.B.
1982-01-01
Using the method of cross sections at 25 and 50 deg C the solubility in the systems cerium (3) nitrate-quinoline nitrate-water and samarium nitrate-quinoline nitrate-water has been studied. It is established that in the systems during chemical interaction of components congruently melting compounds of the composition: Ce(NO 3 ) 2 x2[C 9 H 7 NxHNO 3 ]x6H 2 O and Sm(NO 3 ) 3 x2[C 9 H 7 NxHNO 3 ]x2H 2 O are formed. New solid phases are separated preparatively and are subjected to chemical, differential thermal and IR spectroscopic analyses. The investigation results are compared with similar ones for nitrates of other representatives of lanthanide group
Body composition analysis by DEXA by using dynamically changing samarium filtration
DEFF Research Database (Denmark)
Gotfredsen, Arne; Baeksgaard, L; Hilsted, J
1997-01-01
Dual-energy X-ray absorptiometry (DEXA) has a high accuracy for body composition analysis but is influenced by beam hardening and other error sources in the extremes of measurement. To compensate for beam hardening, the Norland XR-36 introduces a dynamically changing samarium filtration system......). Scans of six healthy volunteers covered with combinations of beef and lard (approximately 5-15 kg) showed a good agreement (r = 0.99) between reference and DEXA values of added soft tissue mass and fat percentage. We conclude that the DEXA method (and, in particular, the Norland XR-36 using dynamic...
19 CFR 146.3 - Customs supervision.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...
21 CFR 146.137 - Frozen orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...
21 CFR 146.145 - Orange juice from concentrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...
Energy Technology Data Exchange (ETDEWEB)
Wang, Min; Niu, Chao [College of Environmental and Chemical Engineering, Shenyang Ligong University, Shenyang 110165 (China); Liu, Jun, E-mail: minwang62@msn.com [Shenyang Military General Hospital, Shenyang 110016 (China); Wang, Qianwu; Yang, Changxiu; Zheng, Haoyan [College of Environmental and Chemical Engineering, Shenyang Ligong University, Shenyang 110165 (China)
2015-11-05
Nitrogen and samarium co-doped BiVO{sub 4} (N–xSm–BiVO{sub 4}) nanoparticles were synthesized using a sol–gel method with a corn stem template. The physicochemical properties of the resultant N–xSm–BiVO{sub 4} particles were characterized using various methods: XPS, XRD, SEM, BET, and UV–Vis DRS analyses. The visible-light photocatalytic activity was successfully demonstrated by degrading a model dye, namely, methyl orange. The dopant content was optimized, and the nitrogen and samarium co-doped BiVO{sub 4} extended the light absorption spectrum toward the visible region, significantly enhancing the photodegradation of the model dye. The Sm and N co-doped BiVO{sub 4} exhibited the highest photocatalytic activity compared to materials with a single dopant or no dopant. The significantly enhanced photocatalytic activity of the N–Sm co-doped BiVO{sub 4} under visible-light irradiation can be attributed to the synergistic effects of the nitrogen and samarium. - Highlights: • The N–Sm codoped BiVO{sub 4} were synthesized using a sol–gel method with a corn stem template. • The N and Sm codoped BiVO{sub 4} has excellent photocatalytic activity of methyl orange degradation. • The maximum activity was observed when the molar ratio of Sm/Bi was 1.0. • The high photocatalytic activity was caused by the synergistic effects between N doping and Sm doping.
Ferrites Ni0,5Zn0,5Fe2O4 doped with samarium: structural analysis, morphological and electromagnetic
International Nuclear Information System (INIS)
Costa, A.C.F.M.; Diniz, A.P.; Viana, K.M.S.; Cornejo, D.R.; Kiminami, R.H.G.A.
2010-01-01
This paper proposes to investigate the sintering at 1200 deg C/2h of Ni 0.5 Zn 0.5 Fe 2-x Sm x O 4 ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)
2011-06-01
... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...
42 CFR 410.146 - Diabetes outcome measurements.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...
21 CFR 146.150 - Canned concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...
Determination of micro amounts of samarium and europium by analogue derivative spectrophotometry
International Nuclear Information System (INIS)
Ishii, H.; Satoh, K.
1982-01-01
Derivative spectrophotometry using the analogue differentiation circuit was applied to the determination of samarium and europium at ppm levels. By measuring the second or the fourth derivative spectra of the characteristic absorption bands of both the rare earth ions around 400 nm, they can be determined directly and selectively in the presence of large amounts of most other rare earths without any prior separation. Further, aptly selecting conditions for the measurement of the derivative spectra, the simultaneous determination of both the rare earth elements was feasible. The principle and the characteristics of analogue derivative spectrophotometry are also described. (orig.) [de
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...
19 CFR 146.63 - Entry for consumption.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...
21 CFR 146.187 - Canned prune juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...
New reduced variant in gadolinium and samarium monoxide thin films
Energy Technology Data Exchange (ETDEWEB)
Bist, B M.S.; Kumar, J; Srivastava, O N [Banaras Hindu Univ. (India). Dept. of Physics
1977-01-01
A new reduced phase has been observed in the thin films of gadolinium and samarium monoxides. This phase results on imparting an annealing treatment to the monoxides and is formed as a result of the creation and ordering of vacancies in the oxygen sublattice. The new phase has been analysed to possess a rhombohedral unit cell with lattice parameters a/sub R/ = a/sub 0/ square root of (3/2) and c/sub R/ = a/sub 0/ square root of 3 (based on hexagonal axes, a/sub 0/ being the lattice parameter of the fundamental zinc blende type unit cell of the monoxide). Based on the proposed structure, the new phase can be assigned the solid state chemical formula RO/sub x/ where R = Gd, Sm and x = 0.66.
International Nuclear Information System (INIS)
Park, Ta-Ryeong
2004-01-01
We have applied uniaxial stress to samarium complexes by intercalating them into the gallery of a layered material and by using a diamond-anvil cell at 28 K. Although uniaxial stress reduces symmetry and removes degeneracy, the overall number of photoluminescence (PL) peaks evidently decreased with the application of uniaxial stress. This contradictory observation is explained by an increased electron-lattice coupling strength under uniaxial stress. This behavior is also confirmed by time-resolved PL data.
40 CFR 146.2 - Law authorizing these regulations.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...
Kim, Eunjeong; Ma, Eunsook
2007-04-01
The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.
Phase Composition of Samarium Niobate and Tantalate Thin Films Prepared by Sol-Gel Method
Bruncková, H.; Medvecký, Ľ.; Múdra, E.; Kovalčiková, A.; Ďurišin, J.; Šebek, M.; Girman, V.
2017-12-01
Samarium niobate SmNbO4 (SNO) and tantalate SmTaO4 (STO) thin films ( 100 nm) were prepared by sol-gel/spin-coating process on alumina substrates with PZT interlayer and annealing at 1000°C. The precursors of films were synthesized using Nb or Ta tartrate complexes. The improvement of the crystallinity of monoclinic M'-SmTaO4 phase via heating was observed through the coexistence of small amounts of tetragonal T-SmTa7O19 phase in STO precursor at 1000°C. The XRD results of SNO and STO films confirmed monoclinic M-SmNbO4 and M'-SmTaO4 phases, respectively, with traces of orthorhombic O-SmNbO4 (in SNO). In STO film, the single monoclinic M'-SmTaO4 phase was revealed. The surface morphology and topography of thin films were investigated by SEM and AFM analysis. STO film was smoother with roughness 3.2 nm in comparison with SNO (6.3 nm). In the microstructure of SNO film, small spherical ( 50 nm) and larger cuboidal particles ( 100 nm) of the SmNbO4 phase were observed. In STO, compact clusters composed of fine spherical SmTaO4 particles ( 20-50 nm) were found. Effect of samarium can contribute to the formation different polymorphs of these films for the application to environmental electrolytic thin film devices.
Evaluation of samarium-153 and holmium-166-EDTMP in the normal baboon model
Energy Technology Data Exchange (ETDEWEB)
Louw, W.K.A.; Dormehl, I.C.; Rensburg, A.J. van; Hugo, N.; Alberts, A.S.; Forsyth, O.E.; Beverley, G.; Sweetlove, M.A.; Marais, J.; Loetter, M.G.; Aswegen, A. van
1996-11-01
Bone-seeking radiopharmaceuticals such as ethylenediaminetetramethylene phosphonate (EDTMP) complexes of samarium-153 and holmium-166 are receiving considerable attention for therapeutic treatment of bone metastases. In this study, using the baboon experimental model, multicompartmental analysis revealed that with regard to pharmacokinetics, biodistribution, and skeletal localisation, {sup 166}Ho-EDTMP was significantly inferior to {sup 153}Sm-EDTMP and {sup 99m}Tc-MDP. A more suitable {sup 166}Ho-bone-seeking agent should thus be sought for closer similarity to {sup 153}Sm-EDTMP to exploit fully the therapeutic potential of its shorter half-life and more energetic beta radiation.
Performance analysis of samarium cobalt P.M. synchronous motor fed from PWM inverters
International Nuclear Information System (INIS)
Rahman, M.A.; Choudhury, M.A.
1985-01-01
This paper presents an analysis and performance of samarium cobalt permanent magnet (P.M.) synchronous motors fed from two types of voltage source pulse width modulated (PWM) inverters. The analysis and test results on the steady state performance of a P.M. motor fed from PWM inverters are presented. PWM inverters are used in variable voltage variable frequency applications to avoid a double conversion process of ordinary inverters. In drives, they are used for voltage and speed regulation of motors. Use of modulation technique in inverters also allow to eliminate or minimize selected harmonics from the inverter output voltage
International Nuclear Information System (INIS)
Kitamura, Akira; Fujiwara, Kenso; Yui, Mikazu
2010-01-01
Within the scope of the JAEA thermodynamic database project for performance assessment of geological disposal of high-level radioactive and TRU wastes, the refinement of the thermodynamic data for the inorganic compounds and complexes of trivalent actinoids (actinium(III), plutonium(III), americium(III) and curium(III)) and samarium(III) was carried out. Refinement of thermodynamic data for these elements was based on the thermodynamic database for americium published by the Nuclear Energy Agency in the Organisation for Economic Co-operation and Development (OECD/NEA). Based on the similarity of chemical properties among trivalent actinoids and samarium, complementary thermodynamic data for their species expected under the geological disposal conditions were selected to complete the thermodynamic data set for the performance assessment of geological disposal of radioactive wastes. (author)
22 CFR 146.400 - Education programs or activities.
2010-04-01
... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...
19 CFR 146.13 - Customs forms and procedures.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...
19 CFR 146.10 - Authority to examine merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...
19 CFR 146.51 - Customs control of merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...
International Nuclear Information System (INIS)
Garcia G, N.
2006-01-01
Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH PCN ) and density of surface sites (D s ). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)
DEFF Research Database (Denmark)
Pauly, N; Yubero, F; Espinós, J P
2017-01-01
Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 ke...
10 CFR 72.146 - Design control.
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...
21 CFR 146.151 - Orange juice for manufacturing.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...
21 CFR 146.152 - Orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...
Magnetic behavior study of samarium nitride using density functional theory
Som, Narayan N.; Mankad, Venu H.; Dabhi, Shweta D.; Patel, Anjali; Jha, Prafulla K.
2018-02-01
In this work, the state-of-art density functional theory is employed to study the structural, electronic and magnetic properties of samarium nitride (SmN). We have performed calculation for both ferromagnetic and antiferromagnetic states in rock-salt phase. The calculated results of optimized lattice parameter and magnetic moment agree well with the available experimental and theoretical values. From energy band diagram and electronic density of states, we observe a half-metallic behaviour in FM phase of rock salt SmN in while metallicity in AFM I and AFM III phases. We present and discuss our current understanding of the possible half-metallicity together with the magnetic ordering in SmN. The calculated phonon dispersion curves shows dynamical stability of the considered structures. The phonon density of states and Eliashberg functional have also been analysed to understand the superconductivity in SmN.
2010-07-07
... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...
International Nuclear Information System (INIS)
Agrueelles, M.G.; Luppi Berlanga, I.S.; Torres, E.A.; Rutty Sola, G.A.; Rimoldi, G.
1998-01-01
The preparation and labelling procedures of 153 Sm-hydroxyapatite ( 153 Sm-HA) are described in this paper. Hydroxyapatite (HA) was prepared and studied as a radiosynovectomy agent. HA particles were prepared from the reaction of calcium nitrate and ammonia phosphate at high pH Samarium-153 labelling was done in two steps with citric acid. A serie of experimental conditions, such as specific activity, citric acid mass, radioactive solution volume, in-vitro stability, have been carried out. Radiolabelling efficiency was greater than 95%. In vitro studies showed high stability (≥99%). Animal studies showed a good retention in the synovium, with a very low extra-articular leakage over 6 days after administration. (author)
21 CFR 146.135 - Orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...
International Nuclear Information System (INIS)
Zamani, Hassan Ali; Naghavi-Reyabbi, Fatemeh; Faridbod, Farnoush; Mohammadhosseini, Majid; Ganjali, Mohammad Reza; Tadjarodi, Azadeh; Rad, Maryam
2013-01-01
A new ion-selective electrode for Sm 3+ ion is described based on the incorporation of N,N′,N″-tris(4-pyridyl)trimesic amide (TPTA) in a poly(vinylchloride) (PVC) matrix. The membrane sensor comprises nitrobenzene (NB) as a plasticizer, and oleic acid (OA) as an anionic additive. The sensor with the optimized composition shows a Nernstian potential response of 19.8 ± 0.5 mV decade −1 over a wide concentration range of 1.0 × 10 −2 and 1 × 10 −6 mol L −1 , with a lower detection limit of 4.7 × 10 −7 mol L −1 and satisfactor applicable pH range of 3.6–9.2. Having a short response time of less than 10 s and a very good selectivity towards the Sm 3+ over a wide variety of interfering cations (e.g. alkali, alkaline earth, transition and heavy metal ions) the sensor seemed to be a promising analytical tool for determination of the Sm 3+ . Hence, it was used as an indicator electrode in the potentiometric titration of samarium ion with EDTA. It was also applied to the direct samarium recovery in binary mixtures. - Highlights: ► A new Sm 3+ -PVC membrane sensor is introduced for determination of Sm 3+ ions in the solutions. ► N,N′,N″-tris(4-pyridyl)trimesic amide was used as a suitable selectophore for samarium sensor. ► Detection limit of the sensor is 4.7 × 10 −7 mol L −1 with a short response time of less than 10 s.
Optical and physical properties of samarium doped lithium diborate glasses
Hanumantharaju, N.; Sardarpasha, K. R.; Gowda, V. C. Veeranna
2018-05-01
Sm3+ doped lithium di-borate glasses with composition 30Li2O-60B2O3-(10-x) PbO, (where 0 molar volume with samarium ion content indicates the openness of the glass structure. The gradual increase in average separation of boron-boron atoms with VmB clearly indicates deterioration of borate glass network, which in turn leads to decrease in the oxygen packing density. The replacements of Sm2O3 for PbO depolymerise the chain structure and that would increase the concentration of non-bridging oxygens. The marginal increase of optical band gap energy after 1.0 mol.% of Sm2O3 is explained by considering the structural modification in lead-borate. The influence of Sm3+ ion on physical and optical properties in lithium-lead-borate glasses is investigated and the results were discussed in view of the structure of borate glass network.
CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.
Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco
2016-10-01
Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.
Energy Technology Data Exchange (ETDEWEB)
Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)
1995-12-31
Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.
13 CFR 146.500 - Secretary of Defense.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...
13 CFR 146.600 - Semi-annual compilation.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...
Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.
Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan
2016-10-01
This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lifescience Database Archive (English)
Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA
29 CFR 4.146 - Contract obligations after award, generally.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...
34 CFR 300.146 - Responsibility of SEA.
2010-07-01
... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...
International Nuclear Information System (INIS)
Smolenskij, V.V.; Bove, A.L.; Del'mukhamedov, R.D.; Borodina, N.P.; Gavrilov, A.G.
1997-01-01
Interaction of trivalent samarium cations with oxide-ions in NaCl-2CsCl melt at 973 K has been studied by potentiometric method using electrochemical cell with two platinum-oxygen electrodes with a solid electrolyte membrane. The mechanism of the interaction and composition of the reaction products, depending on the medium oxyacidity, have been considered. Certain thermodynamic characteristics of the process have been calculated
19 CFR 146.93 - Inventory control and recordkeeping system.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...
Structural phase transition and electronic properties in samarium chalcogenides
Energy Technology Data Exchange (ETDEWEB)
Panwar, Y. S., E-mail: yspanwar2011@gmail.com [Department of Physics, Govt. New Science College Dewas-455001 (India); Aynyas, Mahendra [Department of Physics, C.S.A. Govt. P.G. College, Sehore, 466001 (India); Pataiya, J.; Sanyal, Sankar P. [Department of Physics, Barkatullah University, Bhopal, 462026 (India)
2016-05-06
The electronic structure and high pressure properties of samarium monochalcogenides SmS, SmSe and SmTe have been reported by using tight binding linear muffin-tin-orbital (TB-LMTO) method within the local density approximation (LDA). The total energy as a function of volume is evaluated. It is found that these monochalcogenides are stable in NaCl-type structure under ambient pressure. We predict a structural phase transition from NaCl-type (B{sub 1}-phase) structure to CsCl-type (B{sub 2}-type) structure for these compounds. Phase transition pressures were found to be 1.7, 4.4 and 6.6 GPa, for SmS, SmSe and SmTe respectively. Apart from this, the lattice parameter (a{sub 0}), bulk modulus (B{sub 0}), band structure (BS) and density of states (DOS) are calculated. From energy band diagram we observed that these compounds exhibit metallic character. The calculated values of equilibrium lattice parameter and phase transition pressure are in general good agreement with available data.
Energy Technology Data Exchange (ETDEWEB)
Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others
2013-01-15
The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.
Energy Technology Data Exchange (ETDEWEB)
Diaz F, J C
2006-07-01
The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)
Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.
Abou Asa, S
2017-07-01
MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.
Structural and luminescence properties of samarium doped lead alumino borate glasses
Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet
2017-11-01
The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.
Europium and samarium doped calcium sulfide thin films grown by PLD
International Nuclear Information System (INIS)
Christoulakis, S.; Suchea, M; Katsarakis, N.; Koudoumas, E
2007-01-01
Europium and samarium doped calcium sulfide thin films (CaS:Eu,Sm) with different thickness were prepared by the pulsed laser deposition technique using sintered targets. A typical homemade deposition chamber and XeCl excimer laser (308 nm) were employed and the films were deposited in helium atmosphere onto silicon and corning glass substrates. Structural investigations carried out by X-ray diffraction and atomic force microscopy showed a strong influence of the deposition parameters on the film properties. The films grown had an amorphous or polycrystalline structure depending on growth temperature and the number of pulses used, the same parameters affecting the film roughness, the grain shape and dimensions, the film thickness and the optical transmittance. This work indicates that pulsed laser deposition can be a suitable technique for the preparation of CaS:Eu,Sm thin films, the film characteristics being controlled by the growth conditions
The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS)
International Nuclear Information System (INIS)
Kaempfer, Tino
2009-01-01
The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [de
CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.
Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W
2018-04-01
CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.
33 CFR 146.120 - Manning of survival craft.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Manning of survival craft. 146.120 Section 146.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... craft. The owner, the owner's agent, or the person in charge shall assign a person to each life float...
Samarium (III Selective Membrane Sensor Based on Tin (IV Boratophosphate
Directory of Open Access Journals (Sweden)
Ashok S. K. Kumar
2004-08-01
Full Text Available Abstract: A number of Sm (III selective membranes of varying compositions using tin (IV boratophosphate as electroactive material were prepared. Polyvinyl chloride, polystyrene and epoxy resin were used as binding materials. Membrane having composition of 40% exchanger and 60% epoxy resin exhibited best performance. This membrane worked well over a wide concentration range of 1x10-5M to 1x10-1 M of samarium ions with a Super-Nernstian slope of 40 mV/decade. It has a fast response time of less than 10 seconds and can be used for at least six months without any considerable divergence in potentials. The proposed sensor revealed good selectivities with respect to alkali, alkaline earth, some transition and rare earth metal ions and can be used in the pH range of 4.0-10.0. It was used as an indicator electrode in the potentiometric titration of Sm (III ions against EDTA. Effect of internal solution was studied and the electrode was successfully used in non-aqueous media, too.
22 CFR 146.455 - Textbooks and curricular material.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Textbooks and curricular material. 146.455 Section 146.455 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...
International Nuclear Information System (INIS)
Dantas, E.S.K.
1990-01-01
A graphite furnace atomic-absorption spectrometry method for the determination of neodymium, europium, terbium, dysprosium and yttrium at trace level in samarium oxide; of samarium, europium, dysprosium, holmium, erbium and yttrium in terbium oxide and of europium, terbium, holmium, erbium and yttrium in dysprosium oxide was established. The best pyrolysis and atomization temperatures were determined for each lanthanide considered. Calibration curves were obtained for the pure elements, for binary mixtures formed by the matrix and each of the lanthanides studied and, finally, for the complex mixtures constituted by the matrix and all the other lanthanide of the group under scrutiny. This study has been carried out to examine the interference of the presence of one lanthanide on the behaviour of the other, since a lack of linearity on the calibration curves has been observed in some cases. Detection and determination limits have been determined as well. The detection limits encountered were within the range 0.002 to 0.3% for different elements. The precision of the method expressed as the relative standard deviation was calculated for each element present in each of the matrices studied. The conclusion arrived at is that the method can be applied for determining the above mentioned lanthanides present in the matrices studied with purity up to 99.50%. (author)
Levels in 146Ce and the N = 88 isotones
International Nuclear Information System (INIS)
Gowdy, G.M.; Chrien, R.E.; Chu, Y.Y.
1981-01-01
An investigation of the level structure of 146 Ce following the beta decay of the low-spin isomer of 146 La has been carried out at the ISOL facility TRISTAN at Brookhaven National Laboratory. The half-life for the low spin isomer was found to be 6.0 +- 0.4s. A partial level scheme for 146 Ce below 2 MeV is given. The level energies and some B(E2) values extracted from our data have been compared with IBA-2 calculations done entirely with extrapolated parameters from neighboring Z nuclei in order to check the predictive power of the model. Systematics of the Z = 58 isotopes and N = 88 isotones indicate that although 146 Ce is more deformed than its isotones with Z greater than or equal to 60, the transition to the well-deformed region can probably more correctly be thought to occur after 146 Ce, between N = 88 and N = 90, as it does for Z greater than or equal to 60. The abrupt onset of deformation present in the higher Z isotopes is not seen in the Ce isotopes where the trend is found to be rather smooth throughout
Excited states in 146Sm and 147Sm
International Nuclear Information System (INIS)
Kownacki, J.; Sujkowski, Z.; Hammaren, E.; Liukkonen, E.; Piiparinen, M.; Lindblad, Th.; Ryde, H.
1979-10-01
The sup(144,146)Nd(α,xn) and sup(146,148)Nd( 3 He,xn) reactions with Esub(α) = 20 - 43 MeV and E 3 sub(He) = 19 - 27 MeV are used to investigate excited states in the isotopes 146 Sm and 147 Sm. The experiments involve measurements of singles γ-ray spectra and conversion electron spectra, γ-ray angular distributions and three parameter (E sub(γ)E sub(γ) time) coincidences. From these experiments information is obtained for states with spin up to I = 13 + and I = 27/2 - , respectively, These states are interpeted within the framework of the cluster-vibration model (CVM) as well as the shell model. (author)
29 CFR 1990.146 - Issues to be considered in the rulemaking.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Issues to be considered in the rulemaking. 1990.146 Section 1990.146 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION... CARCINOGENS Regulation of Potential Occupational Carcinogens § 1990.146 Issues to be considered in the...
Energy Technology Data Exchange (ETDEWEB)
Lucas H, J.
2016-07-01
In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)
Energy Technology Data Exchange (ETDEWEB)
Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Naghavi-Reyabbi, Fatemeh [Resident of General Surgery, Endoscopic and Minimaly Invasive Surgery Research Center, Ghaem Hospital, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad (Iran, Islamic Republic of); Faridbod, Farnoush [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Tadjarodi, Azadeh; Rad, Maryam [Department of Chemistry, Iran University of Science and Technology, Tehran (Iran, Islamic Republic of)
2013-03-01
A new ion-selective electrode for Sm{sup 3+} ion is described based on the incorporation of N,N Prime ,N Double-Prime -tris(4-pyridyl)trimesic amide (TPTA) in a poly(vinylchloride) (PVC) matrix. The membrane sensor comprises nitrobenzene (NB) as a plasticizer, and oleic acid (OA) as an anionic additive. The sensor with the optimized composition shows a Nernstian potential response of 19.8 {+-} 0.5 mV decade{sup -1} over a wide concentration range of 1.0 Multiplication-Sign 10{sup -2} and 1 Multiplication-Sign 10{sup -6} mol L{sup -1}, with a lower detection limit of 4.7 Multiplication-Sign 10{sup -7} mol L{sup -1} and satisfactor applicable pH range of 3.6-9.2. Having a short response time of less than 10 s and a very good selectivity towards the Sm{sup 3+} over a wide variety of interfering cations (e.g. alkali, alkaline earth, transition and heavy metal ions) the sensor seemed to be a promising analytical tool for determination of the Sm{sup 3+}. Hence, it was used as an indicator electrode in the potentiometric titration of samarium ion with EDTA. It was also applied to the direct samarium recovery in binary mixtures. - Highlights: Black-Right-Pointing-Pointer A new Sm{sup 3+}-PVC membrane sensor is introduced for determination of Sm{sup 3+} ions in the solutions. Black-Right-Pointing-Pointer N,N Prime ,N Double-Prime -tris(4-pyridyl)trimesic amide was used as a suitable selectophore for samarium sensor. Black-Right-Pointing-Pointer Detection limit of the sensor is 4.7 Multiplication-Sign 10{sup -7} mol L{sup -1} with a short response time of less than 10 s.
Directory of Open Access Journals (Sweden)
Ting-Yu Chang
Full Text Available Functional impairment of endothelial colony-forming cells (ECFCs, a specific cell lineage of endothelial progenitor cells (EPCs is highly associated with the severity of coronary artery disease (CAD, the most common type of cardiovascular disease (CVD. Emerging evidence show that circulating microRNAs (miRNAs in CAD patients' body fluid hold a great potential as biomarkers. However, our knowledge of the role of circulating miRNA in regulating the function of ECFCs and the progression of CAD is still in its infancy. We showed that when ECFCs from healthy volunteers were incubated with conditioned medium or purified exosomes of cultured CAD ECFCs, the secretory factors from CAD ECFCs dysregulated migration and tube formation ability of healthy ECFCs. It is known that exosomes influence the physiology of recipient cells by introducing RNAs including miRNAs. By using small RNA sequencing (smRNA-seq, we deciphered the circulating miRNome in the plasma of healthy individual and CAD patients, and found that the plasma miRNA spectrum from CAD patients was significantly different from that of healthy control. Interestingly, smRNA-seq of both healthy and CAD ECFCs showed that twelve miRNAs that had a higher expression in the plasma of CAD patients also showed higher expression in CAD ECFCs when compared with healthy control. This result suggests that these miRNAs may be involved in the regulation of ECFC functions. For identification of potential mRNA targets of the differentially expressed miRNA in CAD patients, cDNA microarray analysis was performed to identify the angiogenesis-related genes that were down-regulated in CAD ECFCs and Pearson's correlation were used to identify miRNAs that were negatively correlated with the identified angiogenesis-related genes. RT-qPCR analysis of the five miRNAs that negatively correlated with the down-regulated angiogenesis-related genes in plasma and ECFC of CAD patients showed miR-146a-5p and miR-146b-5p up
40 CFR 146.9 - Criteria for establishing permitting priorities.
2010-07-01
....9 Criteria for establishing permitting priorities. In determining priorities for setting times for... priorities. 146.9 Section 146.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... (a), (c), (g) or § 144.22(f), the Director shall base these priorities upon consideration of the...
21 CFR 146.154 - Concentrated orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated orange juice with preservative complies with the requirements for composition and labeling of optional...
Energy Technology Data Exchange (ETDEWEB)
Huang, H; Hiraki, K; Nishikawa, Y [Kinki Univ., Higashi-Osaka, Osaka (Japan). Faculty of Science and Technology
1981-07-01
This communication reported the optimum conditions for the fluorometric determination of these ions, and the method was adopted in the simultaneous determination of samarium and europium in xenotime and monazite minerals. From the experimental results on the effect of diverse ions and the extraction pH of the aqueous phase, it became clear that TTA-TOPO hexane method was the best system for the determination of samarium and europium because of the highest fluorescence sensitivity of the ternary complex, and also because the lower extraction pH eliminated the effect of diverse ions. Moreover, the very high detection limit (2 ppb) of Sm was achieved by the use of a red sensitive photomultiplier. Which was used at 644 nm, and that of Eu (0.02 ppb) at 614 nm. The procedure was established as follows: The rare earth minerals (xenotime, monazite) sample was treated with hot conc. H/sub 2/SO/sub 4/ and twice precipitated with 0.5 mol dm/sup -3/ oxalic acid (pH was adjusted to 2.0 -- 2.2). Then the precipitate was filtered and ignited to give the rare earth oxide. Fifty milligrams of the oxide was dissolved in HCl and diluted with water in order to obtain the solution containing 5 ..mu..g cm/sup -3/ rare earth oxide. An aliquot of the solution ((1.0 -- 3.0) cm/sup 3/) was adjusted to pH 5.5 with sodium acetate and shaken with 1 x 10/sup -4/ mol dm/sup -3/ TTA- 2 x 10/sup -2/ mol dm/sup -3/ TOPO hexane solution. Then the fluorescence intensity of the organic layer was measured at 644 nm for Sm and 614 nm for Eu. In this procedure, the recovery of Sm and Eu was found to be about 96%. Xenotime contained 0.70% of Sm and 0.004% of Eu, and monazite contained 1.84% of Sm and 0.003% of Eu.
2010-01-01
... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Cattlemen's Beef Promotion and Research Board § 1260.146 Vacancies. To fill any...
19 CFR 146.61 - Constructive transfer to Customs territory.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Constructive transfer to Customs territory. 146.61 Section 146.61 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Constructive transfer to Customs territory. The port director shall accept receipt of any entry in proper form...
Memory effect of calcined layered samarium hydroxy chlorides in aqueous solution
International Nuclear Information System (INIS)
Lee, Byung Il; Byeon, Song Ho
2015-01-01
The decomposition and recovery behavior of layered samarium hydroxychloride (Sm 2 (OH) 5 Cl·nH 2 O, LSmH) has been closely studied in various conditions. Although the heat treatment of LSmH at 700 °C completely collapsed typical layered structure, the calcined LSmH (c-LSmH) recovered its layered characteristics and consequently its ability to intercalate anions into the interlayer space when it was rehydroxylated and rehydrated in aqueous solutions containing organic and inorganic anions. This phenomenon is similar to the memory effect observed in classical layered double hydroxides (LDHs), where LDHs calcined to a mixture of metal oxides can recover their layered structures in aqueous solutions. In contrast, the recovery reaction of c-LSmH in water without any counter anions was unsuccessful and instead resulted in the formation of Sm(OH) 3 . Such a difference was interpreted on the basis of the salt effect on Sm 2 (OH) 5 Cl·nH 2 O–Sm(OH) 3 phase equilibria in water
9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.
2010-01-01
...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...
2010-04-01
... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.105 Definitions. As used in these Title... financial assistance, or by a recipient, as a condition to becoming a recipient. Designated agency official... education, or an institution of vocational education, as defined in this section. Federal financial...
11 CFR 100.146 - Legal or accounting services to other political committees.
2010-01-01
... 11 Federal Elections 1 2010-01-01 2010-01-01 false Legal or accounting services to other political committees. 100.146 Section 100.146 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.146 Legal or accounting services to other...
Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells
Directory of Open Access Journals (Sweden)
Suning Huang
2014-01-01
Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.
Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang
2014-01-01
Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
STUDY OF THE HIGH-SPIN STRUCTURE OF PM-146
RZACAURBAN, T; DURELL, JL; PHILLIPS, WR; VARLEY, BJ; HESS, CP; PEARSON, CJ; VERMEER, WJ; VIEU, C; DIONISIO, JS; PAUTRAT, M; Urban, W
1995-01-01
Excited states in Pm-146 have been investigated through the Xe-136(N-15,5n) and the Nd-146(d,xn) compound-nucleus reactions. A level scheme extending up to 6.9 MeV of excitation energy and (I = 25HBAR) is proposed. Most of the high-spin levels are interpreted in terms of multi-particle-hole states
19 CFR 146.8 - Seals, authority of operator to break and affix.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seals, authority of operator to break and affix. 146.8 Section 146.8 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.8 Seals, authority of...
14 CFR 1260.146 - Procurement records.
2010-01-01
... Higher Education, Hospitals, and Other Non-Profit Organizations Procurement Standards § 1260.146... of competition when competitive bids or offers are not obtained, and (c) Basis for award cost or price. ...
2010-04-01
... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.146 Closing. A closing inventory shall be made by the export warehouse proprietor when he transfers ownership or concludes business. Where the proprietor transfers ownership the closing inventory shall be made...
Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.
Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E
2016-09-01
Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells
International Nuclear Information System (INIS)
Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun
2014-01-01
Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma
UL146 variability among clinical isolates of Human Cytomegalovirus from Japan
Directory of Open Access Journals (Sweden)
Francisco Aguayo
2010-01-01
Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.
CD146/MCAM defines functionality of human bone marrow stromal stem cell populations
DEFF Research Database (Denmark)
Harkness, Linda; Zaher, Walid; Ditzel, Nicholas
2016-01-01
BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...
Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.
Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying
2018-06-01
A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.
Schultz, A. B.; Spight, L. D.; Colegrove, P. T.; Disanti, M. A.; Fink, U.
1990-01-01
Four color maps of Arp 146 are given. The structure and color of the ring galaxy and its companion show evidence of a bridge of material between the companion and the remnant nucleus of the original galaxy now forming the ring. Broad band spatial coverage clearly defines regions of starburst occurrence.
19 CFR 146.23 - Accountability for merchandise in a zone.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accountability for merchandise in a zone. 146.23 Section 146.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY....23 Accountability for merchandise in a zone. (a) Identification of merchandise—(1) General. A zone...
Czech Academy of Sciences Publication Activity Database
Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján
2016-01-01
Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016
22 CFR 146.440 - Health and insurance benefits and services.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
21 CFR 146.148 - Reduced acid frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Reduced acid frozen concentrated orange juice. 146... Canned Fruit Juices and Beverages § 146.148 Reduced acid frozen concentrated orange juice. (a) Reduced acid frozen concentrated orange juice is the food that complies with the requirements for composition...
2010-04-01
... CONSUMPTION CANNED FRUIT JUICES General Provisions § 146.3 Definitions. For the purposes of this part: (a) The... hydrolyzed starch. (c) The term dried glucose sirup means the product obtained by drying glucose sirup. (d... following: Unless otherwise provided in a standard, a lot of canned fruits shall be deemed in compliance for...
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Cross sections for d-{sup 3}H neutron interactions with samarium isotopes
Energy Technology Data Exchange (ETDEWEB)
Luo, Junhua; He, Long [Hexi Univ., Zhangye (China). School of Physics and Electromechanical Engineering; Wu, Chunlei; Jiang, Li [Chinese Academy of Engineering Physics, Mianyang (China). Inst. of Nuclear Physics and Chemistry
2016-11-01
The cross sections for (n,x) reactions on samarium isotopes were measured at (d-T) neutron energies of 13.5 and 14.8 MeV with the activation technique. Samples were activated along with Nb and Al monitor foils to determine the incident neutron flux. Theoretical calculations of excitation functions were performed using the nuclear model codes TALYS-1.6 and EMPIRE-3.2 Malta with default parameters, at neutron energies varying from the reaction threshold to 20 MeV. The results were discussed and compared with experimental data found in the literature. At neutron energies 13.5 and 14.8 MeV, the cross sections of the {sup 149}Sm(n,p){sup 149}Pm reaction are reported for the first time. The cross sections of the {sup 150}Sm(n,p){sup 150}Pm, {sup 144}Sm(n,p){sup 144}Pm, {sup 152}Sm(n,α){sup 149}Nd and {sup 144}Sm(n,α){sup 141}Nd reactions at different neutron energies reported in the present work can be added as new data in the nuclear databases.
Charge and transition densities of samarium isotopes in the interacting Boson model
International Nuclear Information System (INIS)
Moinester, M.A.; Alster, J.; Dieperink, A.E.L.
1982-01-01
The interacting boson approximation (IBA) model has been used to interpret the ground-state charge distributions and lowest 2 + transition charge densities of the even samarium isotopes for A = 144-154. Phenomenological boson transition densities associated with the nucleons comprising the s-and d-bosons of the IBA were determined via a least squares fit analysis of charge and transition densities in the Sm isotopes. The application of these boson trasition densities to higher excited 0 + and 2 + states of Sm, and to 0 + and 2 + transitions in neighboring nuclei, such as Nd and Gd, is described. IBA predictions for the transition densities of the three lowest 2 + levels of 154 Gd are given and compared to theoretical transition densities based on Hartree-Fock calculations. The deduced quadrupole boson transition densities are in fair agreement with densities derived previously from 150 Nd data. It is also shown how certain moments of the best fit boson transition densities can simply and sucessfully describe rms radii, isomer shifts, B(E2) strengths, and transition radii for the Sm isotopes. (orig.)
International Nuclear Information System (INIS)
Pyartman, A.K.
1995-01-01
Reaction heats of homogeneous samarium (3) and yttrium (3) nitrate solvates coproportionation with neutral organophosphoric compounds (tri-n.-butylphosphate, diisooctylmethylphosphonate, diisoamylmethylphosphonate) at T=298.15 K in hexane have been measured by thermochemical method. It has been ascertained that enthalpies of coproportionation reactions practically do not depend on the nature, concentration of rare earth metal (3) nitrate solvates in hexane, nature of neutral organophosphoric compound and constitute 1.1±-.2 kJ/mol. The Gibbs free energy of coproportionation reactions is -5.43 kJ/mol, while entropy of the reactions in 14.5±0.7 J/mol·K. 8 refs., 1 tab
19 CFR 146.21 - General requirements.
2010-04-01
... TREASURY (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.21 General requirements. (a) Systems capability. The operator shall maintain either manual or automated inventory control... English language copy of its written inventory control and recordkeeping systems procedures manual in...
38 CFR 21.146 - Independent instructor course.
2010-07-01
.... Chapter 31 Special Rehabilitation Services § 21.146 Independent instructor course. (a) Definition. An... the customary channels leading to employment may not be readily available to a veteran requiring an...
22 CFR 146.120 - Transfers of property.
2010-04-01
... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.120 Transfers of property... financial assistance to a transferee that operates any education program or activity, and the Federal share...
21 CFR 146.185 - Pineapple juice.
2010-04-01
... reconstituted with water suitable for the purpose of maintaining essential composition and quality factors of... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUIT JUICES Requirements for Specific Standardized Canned Fruit Juices and Beverages § 146...
22 CFR 146.115 - Assurance required.
2010-04-01
... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.115 Assurance required. (a... applications for Federal financial assistance or awards of Federal financial assistance contain, be accompanied... assurance. (b) Duration of obligation. (1) In the case of Federal financial assistance extended to provide...
International Nuclear Information System (INIS)
Olea, E.; Quintana, J.C.; Nagel, J.; Arenas, L.; Tomicic, M.; Gil, M.C.; Araya, G.
2001-01-01
Samarium-153 emits medium-energy beta particles an a gamma photon with a physical half-life of 46,3 hours. When chelated to ethylenediaminetetramethylenephosphonic acid (EDTMP), it is remarkably stable in vitro and in vivo. In this study we administered randomly 0,5 and 1,0 mCi/Kg body weight (two groups), to 30 patients with painful metastatic bone cancer. Slight and spontaneously reversible myelotoxicity was observed. A bigger leukocyte and platelet suppression was obtained with 1,0 mCi/kg than 0,5 mCi/Kg dose. Pain palliation was obtained in 66% of the treated patients. Our preliminary results indicate that 153 Sm-EDTMP is a promising radiotherapeutic agent for palliative treatment of metastatic bone cancer pain where a reactor is available and at a very affordable cost. (author)
Energy Technology Data Exchange (ETDEWEB)
Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)
2016-11-15
Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146
International Nuclear Information System (INIS)
Barreau, Pierre.
1977-01-01
The theory of the nucleus-negative muon system in the case of electrical interactions is discussed. The interactions of muons with the samarium isotopes 152, 154, 144, 148, 150 are investigated. After a description of the experimental device, from muon beam production to data acquisition (detection of the gamma spectra), the results are analyzed and the nuclear charge distribution parameters determined: for each isotope the absolute value of c (half-density radius) and t (skin thickness); for 152 Sm and 154 Sm the parameter β 2 (quadrupolar defomation). Nuclear polarization was accounted for throughout the analysis [fr
10 CFR 1.46 - Office of Nuclear Security and Incident Response.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Office of Nuclear Security and Incident Response. 1.46... Headquarters Program Offices § 1.46 Office of Nuclear Security and Incident Response. The Office of Nuclear... evaluation and assessment of technical issues involving security at nuclear facilities, and is the agency...
Directory of Open Access Journals (Sweden)
Sylvie Bouvier
Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in
Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi
2016-03-30
Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis.
40 CFR 146.67 - Operating requirements.
2010-07-01
... serving as a water supply, place a notice in a newspaper of general circulation. (2) The Director may... 146.67 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... steps to determine the presence or absence of a leak; and (3) Notify the Director within 24 hours after...
Pharmacokinetics of labelled compounds with technetium-99m and samarium-153
International Nuclear Information System (INIS)
Borda O, L.B.; Torres L, M.N.
1997-01-01
The purpose of this investigation was to establish the different pharmacokinetics parameters of the main radiopharmaceuticals labeled with technetium-99m and samarium-153. These parameters could be subsequently used as reference to compare other products with the same use. Mathematical models and a computerized pharmacokinetic program were used to this purpose. A biodistribution study in quadruplicate and/or quintuplicate was conducted for each radiopharmaceutical, data was was obtained in injection dose percentages. The biodistribution study involved the injection of a predetermined dose of the radiopharmaceutical into animals (rats or mice), which were subsequently put away at different time intervals, removing the relevant organs. Activity in each organ was read by means of a well-type NaI scintillation counter, data obtained in activity counts was transformed into injection dose percentages. Based on these percentages, the mathematical model was constructed and the pharmacokinetic parameters were obtained using the computerized program Expo 2 v. 1, which is written in C language and works in windows. Analyzing the results obtained, we can conclude that the use of the Expo 2 v. 1 program for a bi compartmental analysis allowed us to obtain reliable pharmacokinetic parameters which describe what happens in the organism when the radiopharmaceutical passes from the central compartment to the peripheral one and vice versa
MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.
Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng
2016-01-01
MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.
Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics
Yao, Yingbang
2012-06-01
Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.
New levels and reinvestigation of octupole correlations in {sup 146,147}La
Energy Technology Data Exchange (ETDEWEB)
Wang, E.H.; Zachary, C.J.; Hamilton, J.H.; Ramayya, A.V.; Hwang, J.K.; Liu, S.H.; Brewer, N.T. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lewis, W. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Furman University, Department of Physics, Greenville, SC (United States); Luo, Y.X. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Zhu, S.J. [Tsinghua University, Department of Physics, Beijing (China); Ter-Akopian, G.M.; Oganessian, Yu.Ts. [Joint Institute for Nuclear Research, Dubna (Russian Federation)
2017-12-15
High spin states of neutron-rich {sup 146,147}La have been reinvestigated by γ-γ-γ and γ-γ-γ-γ coincidence data from a {sup 252}Cf spontaneous fission experiment by using Gammasphere. Thirty-two new transitions in {sup 146}La are observed. Two new bands in {sup 146}La have been established. One of them is proposed to be the octupole parity partner of the previously known band. Twenty new transitions in {sup 147}La are observed. The ground state band of {sup 147}La has been established with a proposed 5/2{sup +} band-head. Angular correlation of cascades has been used to study the spins and parities of the states. The B(E1)/B(E2) ratios and dipole moments of bands in {sup 146,} {sup 147}La have been measured. (orig.)
2010-04-01
... the risk and expense of the operator. The port director may require an accounting of all merchandise.... An operator shall make written application to the port director for approval of an alteration of an... accompanied by the supporting document requirements specified in § 146.6, as applicable. The port director may...
International Nuclear Information System (INIS)
Bizzeti, P.G.; Bizzetti-Sona, A.M.
1998-01-01
The mean lives of the lowest 9 - and 12 + states of 146 Sm have been measured by means of the RDM. Their (preliminary) values are r m (9 - )=0.97±0.05 ns and r m (12 + )=15±2 ps, respectively. The strengths of the collective E3 transitions of the 12 + →9 - →6 6 cascade are compared with the corresponding ones in 148 Gd
21 CFR 133.146 - Grated cheeses.
2010-04-01
... Products § 133.146 Grated cheeses. (a) Description. Grated cheeses is the class of foods prepared by..., and skim milk cheese for manufacturing may not be used. All cheese ingredients used are either made... ___ cheese”, the name of the cheese filling the blank. (ii) If only parmesan and romano cheeses are used and...
Singh, Harjinder; Slathia, Goldy; Gupta, Rashmi; Bamzai, K. K.
2018-04-01
Samarium coordinated with salicylic acid was successfully grown as a single crystal by low temperature solution technique using mixed solvent of methanol and water in equal ratio. Structural characterization was carried out by single crystal X-ray diffraction analysis and it crystallizes in centrosymmetric space group P121/c1. FTIR and UV-Vis-NIR spectroscopy confirmed the compound formation and help to determine the mode of binding of the ligand to the rare earth-metal ion. Dielectric constant and dielectric loss have been measured over the frequency range 100 Hz - 30MHz. The decrease in dielectric constant with increases in frequency is due to the transition from interfacial polarization to dipolar polarization. The small value of dielectric constant at higher frequency ensures that the crystal is good candidate for NLO devices. Dielectric loss represents the resistive nature of the material.
MicroRNA-146a Regulates Perfusion Recovery in Response to Arterial Occlusion via Arteriogenesis
Directory of Open Access Journals (Sweden)
Joshua L. Heuslein
2018-01-01
Full Text Available The growth of endogenous collateral arteries that bypass arterial occlusion(s, or arteriogenesis, is a fundamental shear stress-induced adaptation with implications for treating peripheral arterial disease. MicroRNAs (miRs are key regulators of gene expression in response to injury and have strong therapeutic potential. In a previous study, we identified miR-146a as a candidate regulator of vascular remodeling. Here, we tested whether miR-146a regulates in vitro angiogenic endothelial cell (EC behaviors, as well as perfusion recovery, arteriogenesis, and angiogenesis in response to femoral arterial ligation (FAL in vivo. We found miR-146a inhibition impaired EC tube formation and migration in vitro. Following FAL, Balb/c mice were treated with a single, intramuscular injection of anti-miR-146a or scramble locked nucleic acid (LNA oligonucleotides directly into the non-ischemic gracilis muscles. Serial laser Doppler imaging demonstrated that anti-miR-146a treated mice exhibited significantly greater perfusion recovery (a 16% increase compared mice treated with scramble LNA. Moreover, anti-miR-146a treated mice exhibited a 22% increase in collateral artery diameter compared to controls, while there was no significant effect on in vivo angiogenesis or muscle regeneration. Despite exerting no beneficial effects on angiogenesis, the inhibition of mechanosensitive miR-146a enhances perfusion recovery after FAL via enhanced arteriogenesis.
Pei, Kai; Li, Hongdong; Zou, Guangtian; Yu, Richeng; Zhao, Haofei; Shen, Xi; Wang, Liying; Song, Yanpeng; Qiu, Dongchao
2017-02-01
A novel electrolyte materials of introducing detonation nanodiamond (DNDs) into samarium doped ceria (SDC) is reported here. 1%wt. DNDs doping SDC (named SDC/ND) can enlarge the electrotyle grain size and change the valence of partial ceria. DNDs provide the widen channel to accelerate the mobility of oxygen ions in electrolyte. Larger grain size means that oxygen ions move easier in electrolyte, it can also reduce the alternating current (AC) impedance spectra of internal grains. The lower valence of partial Ce provides more oxygen vacancies to enhance mobility rate of oxygen ions. Hence all of them enhance the transportation of oxygen ions in SDC/ND electrolyte and the OCV. Ultimately the power density of SOFC can reach 762 mw cm-2 at 800 °C (twice higher than pure SDC, which is 319 mw cm-2 at 800 °C), and it remains high power density in the intermediate temperature (600-800 °C). It is relatively high for the electrolyte supported (300 μm) cells.
International Nuclear Information System (INIS)
Mallah, M.H.; Atomic Energy Organization of Iran, Tehran; Shemirani, F.; Ghannadi Maragheh, M.
2008-01-01
A new preconcentration method of dispersive liquid-liquid microextraction (DLLME) was developed for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium. DLLME technique was successfully used as a sample preparation method. In this preconcentration method, an appropriate mixture of extraction solvent, disperser solvent was injected rapidly into an aqueous solution containing Sm, Eu, Gd and Dy after complex formation using chelating reagent of the 1-(2-pyridylazo)-2-naphthol (PAN). After phase separation, 0.5 mL of the settled phase containing enriched analytes was determined by inductively coupled plasma optical emission spectrometry (ICP-OES). The main factors affected the preconcentration of Sm, Eu, Gd and Dy were extraction and dispersive solvent type and their volume, extraction time, volume of chelating agent (PAN), centrifuge speed and drying temperature of the samples. Under the best operating condition simultaneous preconcentration factors of 80, 100, 103 and 78 were obtained for Sm, Eu, Gd and Dy, respectively. (author)
22 CFR 146.100 - Purpose and effective date.
2010-04-01
... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.100 Purpose and... basis of sex in any education program or activity receiving Federal financial assistance, whether or not...
45 CFR 146.122 - Additional requirements prohibiting discrimination based on genetic information.
2010-10-01
... genetic information and should review the records to excise any genetic information. N assembles the data requested by M and, although N reviews it to delete genetic information, the data from a specific region... based on genetic information. 146.122 Section 146.122 Public Welfare DEPARTMENT OF HEALTH AND HUMAN...
2011-02-07
.... * * * * * * * * * * * [I]nvestigation by M-D showed that if any undetected crack was present at the time of the embodiment... terminating action for the repetitive inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB... optional closing action of EASA AD 2010-0001-E is embodiment of M-D B 146-32-150 (polishing and shot...
Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice.
Martin, Nellie A; Molnar, Viktor; Szilagyi, Gabor T; Elkjaer, Maria L; Nawrocki, Arkadiusz; Okarmus, Justyna; Wlodarczyk, Agnieszka; Thygesen, Eva K; Palkovits, Miklos; Gallyas, Ferenc; Larsen, Martin R; Lassmann, Hans; Benedikz, Eirikur; Owens, Trevor; Svenningsen, Asa F; Illes, Zsolt
2018-01-01
The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs) during remyelination, but its role has not been examined during demyelination. MicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray) and proteome (liquid chromatography tandem mass spectrometry) of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis. miR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP + oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2 + OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3 + and Iba1 + macrophages/microglia was
International Nuclear Information System (INIS)
Chacon-Roa, C; Guzman-Mendoza, J; Aguilar-Frutis, M; Garcia-Hipolito, M; Alvarez-Fragoso, O; Falcony, C
2008-01-01
Trivalent samarium (Sm 3+ ) doped hafnium oxide (HfO 2 ) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO 2 monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO 2 : SmCl 3 films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm 3+ ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed
The effect of stem cell factor on proliferation of human endometrial CD146+ cells
Directory of Open Access Journals (Sweden)
Mehri Fayazi
2016-07-01
Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies
International Nuclear Information System (INIS)
Goodman, J.H.; Gahbauer, R.A.; Kanellitsas, C.; Clendenon, N.R.; Laster, B.H.; Fairchild, R.G.
1989-01-01
High grade astrocytomas have proven resistant to all conventional therapy. A technique to produce radiation enhancement during interstitial brain tumor irradiation by using a radiation sensitizer (IdUrd) and by stimulation of Auger electron cascades through absorption of low energy photons in iodine (Photon activation) is described. Clinical studies using IdUrd, 192 Ir as a brachytherapy source, and external radiation have produced promising results. Substituting samarium-145 for 192 Ir in this protocol is expected to produce enhanced results. 15 refs
Enhancement of the fluorescence of the samarium (III) complex by gadolinium (III)
International Nuclear Information System (INIS)
Yun-Xiang, C.; Zhang-Hua, L.
1988-01-01
The increase in sensitivity and selectivity of reactions in which colored species are formed by the addition of different metal ions is an area of research that has recently been developed. This phenomenon, which is sometimes called cocolaration effect, has been explained by the formation of mixed metal complex. The authors found an analogous phenomenon of reactions forming fluorescent complexes. The complexes of Sm(III)-thenoyltrifluoroacetone (TTA)-phenanthroline (Phen)-Triton-X-100 (TX-100) and Gd(III) (or La(III), Lu(III) and Y(III))-TTA-Phen-TX-100 had practically no fluorescence separately. Instead, a fluorescence-enhancement phenomenon caused by adding Gd or La, Lu and Y ions to the system was observed for the first time. The intensity of the enhanced fluorescence of Sm(III) complex was increased in the following order: La< Y< Lu< Gd. By analogy with cocoloration effect, the authors call this new fluorescence-enhancement phenomenon the co-fluorescence effect. The object of this work was to study the enhancement effect of Gd(III) on the fluorescence of the Sm(III)-TTA-Phen-TX-100 system. The recommended fluorimetric method has been applied to the determination of trace amounts of samarium in ytterbium oxide with satisfactory results. A general reaction mechanism for the system studied was proposed
Promotion of Hendra Virus Replication by MicroRNA 146a
Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa
2013-01-01
Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523
45 CFR 146.120 - Interaction with the Family and Medical Leave Act. [Reserved
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Interaction with the Family and Medical Leave Act. [Reserved] 146.120 Section 146.120 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS... Interaction with the Family and Medical Leave Act. [Reserved] ...
BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles
Directory of Open Access Journals (Sweden)
Cong Li
2018-01-01
Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck
2000-01-01
cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...
Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice
Directory of Open Access Journals (Sweden)
Nellie A. Martin
2018-03-01
Full Text Available BackgroundThe cuprizone (CPZ model of multiple sclerosis (MS was used to identify microRNAs (miRNAs related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs during remyelination, but its role has not been examined during demyelination.MethodsMicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray and proteome (liquid chromatography tandem mass spectrometry of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis.ResultsmiR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP+ oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2+ OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3+ and
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, H M; Rassing, M R; Nielsen, Hanne Mørck
2000-01-01
The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey...
Results after therapy of pain from bone metastases with Samarium-153 in our centers in Lima, Peru
International Nuclear Information System (INIS)
Alvarado, N.; Eskenazi, S.; Valle, M.P.; Montoya, J.; Castro, M.; Montiel, L.; Velarde, V.; Jauregui, I.; Cueto, C.
2004-01-01
Full text: 105 patients with bone metastases from prostate and breast cancer; between 42 and 78 years age (median 61 years) were evaluated. Patients had intense pain that could not be managed with combinations of analgesic and anti tumoral drugs. All patients received 1.2 mCi/kg of Samarium-153 intravenously as treatment for pain due to bony metastases. The isotope obtained from atomic reactor placed in Lima - Peru, was provided by Peruvian Nuclear Energy Institute (IPEN). One week before therapy, all the patients had a bone scan study with Tc99m-MDP that showed the presence of multiple bone metastases with high blastic activity. Haematology and biochemical parameter checked were: Creatinine ( 150,000 mm3), Leukocytes (> 5,000 mm3), Red cells (>3,500,000 mm3). No problems were encountered during intravenous administration of the radioisotope. The side effects after treatment were: Primary effects: 16 cases of nausea, 2 of vomiting, 3 of headache, 28 had increment of pain, 6 had flushing. 50 patients did not have the primary symptoms. Secondary effects: 3 Patients showed drop in leukocyte count between 2nd and 3rd week of therapy. Red cells showed 10-15% decrease between 6th to 8th week. Platelets showed a decrease of about 15% with one peak between 1st and 2nd week post Samarium therapy. Data was analysed using an analogue visual scale of the pain with values from 0 - 10 (0-no pain; 10-maximum pain) and in the same way using the E.C.O.G. scale (Eastern Cooperative Oncology Group) in relationship with the Karnofsky index in order to establish functional recovery for each patient. The decrease of pain was seen between 4th-7th days (average 8 days). A second dose was given after 60 days in 12 patients and a third dose in 3 cases.11 patients died due to different causes between 30 - 60 days post treatment. The analgesic dose came down significantly in 80% of patients. We conclude that palliative therapy of metastatic bone pain in Peru is possible with radionuclides. It
miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.
Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili
2017-10-02
Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.
International Nuclear Information System (INIS)
Morillo, J.
1983-06-01
We present the first extensive study of electronic transport properties of ''quasi-stoichiometric'' SmS as a function of pressure P, temperature T, magnetic field B and defect concentration C. SmS which is a semiconductor, undergoes with increasing P a first order transition towards an homogeneous intermediate valence state. In the semiconducting phase (s.c.), the energie epsilon(f) necessary to delocalize a 4f electron increases greatly with T and is about 250meV at 300K. The phase diagram for the first order electronic transition Sm 2 + →Smsup(2+epsilon) with P has been determined for T 6 has been investigated by resistivity measurements under irradiation at 21K. The threshold energy Ed for displacement of Sm in SmS has been determined: Ed(Sm) = 20 +- 2 eV, and the observed effects of irradiation have been associated to samarium displacements (vacancies and interstitials) [fr
Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C
2018-02-01
The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.
MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias
Energy Technology Data Exchange (ETDEWEB)
Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy); Vitale, A; Foà, R [Department of Cellular Biotechnologies and Hematology, Division of Hematology, ‘Sapienza' University, Rome (Italy); Testa, U; Labbaye, C [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy)
2011-06-01
CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies.
MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias
International Nuclear Information System (INIS)
Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E; Vitale, A; Foà, R; Testa, U; Labbaye, C
2011-01-01
CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies
Janghouri, Mohammad; Amini, Mostafa M.
2018-02-01
Samarium complex [(Sm(III)] as a new host material was used for preparation of red organic light-emitting diodes (OLEDs). Devices with configurations of indium-doped tin oxide (ITO)/poly(3,4-ethylenedioxythiophene):(poly(styrenesulfonate) (PEDOT:PSS (50 nm)/polyvinyl carbazole (PVK):[zinc oxide (ZnO)] (50 nm)/[(Sm(III)]:[zinc(II) 2,3-tetrakis(dihydroxyphenyl)-porphyrin and Pt(II) 2,3-dimethoxyporphyrin] (60 nm)/2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline (BCP) (15 nm)/Al (150 nm) have been fabricated and investigated. An electroplex occurring at the (PVK/Sm: Pt(II) 2,3-dimethoxyporphyrin) interface has been suggested when ZnO nanoparticles were doped in PVK. OLED studies have revealed that the photophysical characteristics and electrical behavior of devices with ZnO nanoparticles are much better than those of devices with pure PVK. The efficiency of devices based on [(Sm(III)] was superior than that of known aluminum tris(8-hydroxyquinoline) (Alq3) and also our earlier reports on red OLEDs under the same conditions.
Solar Hydrogen Production via a Samarium Oxide-Based Thermochemical Water Splitting Cycle
Directory of Open Access Journals (Sweden)
Rahul Bhosale
2016-04-01
Full Text Available The computational thermodynamic analysis of a samarium oxide-based two-step solar thermochemical water splitting cycle is reported. The analysis is performed using HSC chemistry software and databases. The first (solar-based step drives the thermal reduction of Sm2O3 into Sm and O2. The second (non-solar step corresponds to the production of H2 via a water splitting reaction and the oxidation of Sm to Sm2O3. The equilibrium thermodynamic compositions related to the thermal reduction and water splitting steps are determined. The effect of oxygen partial pressure in the inert flushing gas on the thermal reduction temperature (TH is examined. An analysis based on the second law of thermodynamics is performed to determine the cycle efficiency (ηcycle and solar-to-fuel energy conversion efficiency (ηsolar−to−fuel attainable with and without heat recuperation. The results indicate that ηcycle and ηsolar−to−fuel both increase with decreasing TH, due to the reduction in oxygen partial pressure in the inert flushing gas. Furthermore, the recuperation of heat for the operation of the cycle significantly improves the solar reactor efficiency. For instance, in the case where TH = 2280 K, ηcycle = 24.4% and ηsolar−to−fuel = 29.5% (without heat recuperation, while ηcycle = 31.3% and ηsolar−to−fuel = 37.8% (with 40% heat recuperation.
Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.
Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin
2018-01-01
Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Arthur Villarim Neto
2009-02-01
Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi
22 CFR 146.445 - Marital or parental status.
2010-04-01
... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.445 Marital or parental status. (a) Status..., or marital status that treats students differently on the basis of sex. (b) Pregnancy and related...
Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.
Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M
2015-01-01
Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.
MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.
Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun
2016-03-01
Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
22 CFR 146.520 - Job classification and structure.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Job classification and structure. 146.520... IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the... and structure. A recipient shall not: (a) Classify a job as being for males or for females; (b...
40 CFR 146.4 - Criteria for exempted aquifers.
2010-07-01
... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.4 Criteria... of a permit application for a Class II or III operation to contain minerals or hydrocarbons that... public water system. (Clean Water Act, Safe Drinking Water Act, Clean Air Act, Resource Conservation and...
Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha
2011-01-01
Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267
Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a
Directory of Open Access Journals (Sweden)
Min-Ching Wang
2018-04-01
Full Text Available Background/Purpose: Bioaggregates such as Portland cement (PC can be an economical alternative for mineral trioxide aggregate (MTA with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM. Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP, bone morphogenic protein (BMP, and dentin matrix protein 1 (DMP1 expression. However, miR-31 and miR-146a modulates cementum protein 1 (CEMP1 expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Keywords: Portland cement, Bioaggregate, miR-146a, Osteogenic differentiation, Periodontal ligament (PDL
Zhang, Bin; Wang, Aihong; Xia, Cuiping; Lin, Qunfeng; Chen, Chunfu
2015-09-01
Alzheimer's disease (AD) is a progressive neurodegenerative disorder and is the most common form of dementia among the aging population. Although the incidence of the disease continues to increase, no cure has been developed. Effective treatment is restricted not only due to the lack of curative medicine, but also due to limited understanding of the underlying mechanisms and the difficulties in accurately diagnosing AD in its earliest stages prior to clinical symptoms. Micro (mi) RNAs (miR) have gained increasing attention in the investigation of neurodegenerative diseases. Previous reports have demonstrated that deregulation of miR‑146a‑5p is associated with the pathogenesis of human AD. In the present study, the coding region of primary (pri)‑miR‑146a in patients with AD was scanned and the rare C allele of rs2910164 was found to be associated with AD. Using reverse transcription quantitative polymerase chain reaction, it was demonstrated that site variation reduced the expression of mature miR‑146a‑5p. Notably, a reduction in the expression of miR‑146a‑5p led to less efficient inhibition of target genes, including Toll‑like receptor (TLR)2, which is important in the pathogenesis of AD. Biological function investigations in RAW264.7 cells indicated that, compared with the G allele, the rare C allele upregulated the expression of tumor necrosis factor‑α following stimulation with β‑amyloid. These findings suggested that one common polymorphism in pri‑miR‑146a may contribute to the genetic predisposition to AD by disrupting the production of miR‑146a‑5p and affecting the expression and function of TLR2.
miR-146a Suppresses Invasion of Pancreatic Cancer Cells
Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.
2010-01-01
The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-κB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-κB regulatory kinase interleukin 1 receptor–associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IκBα, NF-κB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3′-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-κB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents. PMID:20124483
146----10 Dec indd [ FINAL VERSION].indd
African Journals Online (AJOL)
23 Sep 2009 ... e o lo g ic a l S tu d ie s http://www.hts.org.za. HTS. Original Research. A ... phronēsis and Paul Ricoeur's movement from mimēsis1 ... It is not only pastors' knowledge of the Bible, theological tradition and ...... way that we are led into the truth and life (John 14:6). ..... human brain, Harper Collins, New York.
Deng, Minnan; Du, Ganqin; Zhao, Jiegang; Du, Xiaowei
2017-06-01
Increasing evidence confirms the involvement of virus infection and miRNA, such as miR-146a, in neuroinflammation-associated epilepsy. In the present study, we investigated the upregulation of miR-146a with RT-qPCR and in situ hybridization methods in a mice infection model of Japanese encephalitis virus (JEV) and in vitro. Subsequently we investigated the involvement of miR-146a in modulating JEV-induced neuroinflammation. It was demonstrated that JEV infection promoted miR-146a production in BALB/c mice brain and in cultured mouse microglial C8-B4 cells, along with pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IFN-β and IFN-α. We also found that miR-146a exerted negative regulatory effects upon IL-1β, IL-6, TNF-α, IFN-β and IFN-α in C8-B4 cells. Accordingly, miR-146a downregulation with a miR-146a inhibitor promoted the upregulation of IL-1β, IL-6, TNF-α, IFN-β and IFN-α, whereas miR-146a upregulation with miR-146a mimics reduced the upregulation of these cytokines. Moreover, miR-146a exerted no regulation upon JEV growth in C8-B4 cells. In conclusion, JEV infection upregulated miR-146a and pro-inflammatory cytokine production, in mice brain and in cultured C8-B4 cells. Furthermore, miR-146a negatively regulated the production of JEV-induced pro-inflammatory cytokines, in virus growth independent fashion, identifying miR-146a as a negative feedback regulator in JEV-induced neuroinflammation, and possibly in epilepsy.
MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
2015-09-01
determined whether miR-146a inhibitor promotes CRPC phenotype by upregulating SIAH2 in LNCaP and MDAPCa2b cells. First we determined the effect of DHT (5α...dihydrotestosterone) on proliferation of these cells grown in the presence of charcoal stripped calf serum. The results indicated that DHT increased...proliferation of both parental LNCaP and MDAPCa2b cells but DHT did not increase proliferation of miR-146a inhibitor expressing cell lines (Fig. 6
Experimental demyelination and axonal loss are reduced in MicroRNA-146a deficient mice
DEFF Research Database (Denmark)
Martin, Nellie A.; Molnar, Viktor; Szilagyi, Gabor T.
2018-01-01
Background: The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differ...
Shen, Jiangli; Yu, Zhaohui; Li, Na
2018-06-20
The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.
He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing
2018-03-21
Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.
International Nuclear Information System (INIS)
Srivastava, S.C.; Mausner, L.F.; Mease, R.C.; Meinken, G.E.; Joshi, V.; Kolsky, K.; Sweet, M.; Steplewski, Z.
1995-01-01
The potential of utilizing receptor-specific agents such as monoclonal antibodies (MAb), and MAb-derived smaller molecules, as carriers of radionuclides for the selective destruction of tumors has stimulated much research activity. The success of such applications depends on many factors, especially the tumor binding properties of the antibody reagent, the efficiency of labeling and in-vivo stability of the radioconjugate and, on the careful choice of the radionuclide best suited to treat the tumor under consideration. The radiolabeled antibody technique for radioimmunotherapy (RIT), however, has experienced many limitations, and its success has not matched the expectations that were raised more than a decade ago. The problems that have been identified include: (i) degradation of antibody immunoreactivity resulting from chemical manipulations required for labeling; (ii) lack of suitable radioisotopes and methods for stable attachment of the radiolabel; (iii) in-vivo instability of the radioimmunoconjugates; (iv) excessive accumulation of activity in non-target locations; and (v) lack of radioimmunoconjugate accessibility to cells internal to a tumor mass. A careful choice of the radionuclide(s) best suited to treat the tumor under consideration is one of the most important requirements for successful radioimmunotherapy. This study evaluates copper 67 and samarium 153 for tumor radioimmunotherapy
Energy Technology Data Exchange (ETDEWEB)
Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)
2015-07-10
Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.
Study of nano - second isomers near 146Gd
International Nuclear Information System (INIS)
Pramanik, Dibyadyuti; Sarkar, S.; Bisoi, Abhijit; Ray, Sudatta; Ray, I.; Pradhan, M.K.; Goswami, A.; Banerjee, P.; Mukherjee, A.; Bhattacharya, S.; Saha Sarkar, M.; Chakraborty, A.; Dey, Gautam; Krishichayan; Kshetri, R.; Ganguly, S.; Raut, R.; Ray Basu, M.; Ganguly, G.; Ghugre, S.S.; Sinha, A.K.; Basu, S.K.
2010-01-01
The nuclei near 146 Gd show rich variety in their excitation spectra. Spectra exhibiting characteristics of extreme single particle, multi-particle-hole excitation, magnetic bands to strong collectivity manifested through superdeformation, and triaxial superdeformation have been widely studied. In the present work, a few isomers in the mass ≅150 region using the RF - gamma coincidence data are studied
Evaluation of σ-1 receptor radioligand 18F-FTC-146 in rats and squirrel monkeys using PET
DEFF Research Database (Denmark)
James, Michelle L; Shen, Bin; Nielsen, Carsten Haagen
2014-01-01
. Pretreatment with known S1R compounds, haloperidol, or BD1047, before radioligand administration, significantly attenuated (18)F-FTC-146 accumulation in all rat brain regions by approximately 85% (P ...-FTC-146 was observed in rat plasma. Preliminary monkey PET/MRI studies demonstrated specific accumulation of (18)F-FTC-146 in the brain (mainly in cortical structures, cerebellum, and vermis) that could be attenuated by pretreatment with haloperidol. HPLC of monkey plasma suggested radioligand metabolism...
Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer
Directory of Open Access Journals (Sweden)
Wang P
2015-01-01
Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle
31 CFR 363.146 - May a certificate of indebtedness be pledged or used as collateral?
2010-07-01
... pledged or used as collateral? 363.146 Section 363.146 Money and Finance: Treasury Regulations Relating to... certificate of indebtedness be pledged or used as collateral? A certificate of indebtedness may not be pledged or used as collateral for the performance of an obligation. [69 FR 50309, Aug. 16, 2004. Redesignated...
Directory of Open Access Journals (Sweden)
Robert B Lochhead
2014-06-01
Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B
Si, Chengshuai; Yu, Qiao; Yao, Yufeng
2018-05-01
MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.
CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.
Directory of Open Access Journals (Sweden)
Mineo Iwata
Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.
International Nuclear Information System (INIS)
Kuang Wei; Tan Jiali; Duan Yinzhong; Duan Jianmin; Wang Weijian; Jin Fang; Jin Zuolin; Yuan Xiao; Liu Yanpu
2009-01-01
Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146a by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.
22 CFR 146.110 - Remedial and affirmative action and self-evaluation.
2010-04-01
... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.110 Remedial and affirmative action and self-evaluation. (a) Remedial action. If the...
9 CFR 146.23 - Terminology and classification; flocks and products.
2010-01-01
... layers through routine serological surveillance of each participating commercial table-egg layer flock. A... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR COMMERCIAL POULTRY Special Provisions for Commercial Table-Egg Layer Flocks § 146.23 Terminology and classification...
Study of samarium modified lead zirconate titanate and nickel zinc ferrite composite system
Energy Technology Data Exchange (ETDEWEB)
Rani, Rekha [Department of Physics, SD PG College, Panipat 132103 (India); School of Physics and Materials Science, Thapar University, Patiala 147004 (India); Juneja, J.K., E-mail: jk_juneja@yahoo.com [Department of Physics, Hindu College, Sonepat 131001 (India); Singh, Sangeeta [Department of Physics, GVM Girls College, Sonepat 131001 (India); Raina, K.K. [School of Physics and Materials Science, Thapar University, Patiala 147004 (India); Prakash, Chandra [Solid State Physics Laboratory, Timarpur, Delhi 110054 (India)
2015-03-15
In the present work, composites of samarium substituted lead zirconate titanate and nickel zinc ferrite with compositional formula 0.95Pb{sub 1−3x/2} Sm{sub x}Zr{sub 0.65}Ti{sub 0.35}O{sub 3}–0.05Ni{sub 0.8}Zn{sub 0.2}Fe{sub 2}O{sub 4} (x=0, 0.01, 0.02 and 0.03) were prepared by the conventional solid state route. X-ray diffraction analysis was carried out to confirm the coexistence of individual phases. Microstructural study was done by using scanning electron microscope. Dielectric constant and loss were studied as a function of temperature and frequency. To study ferroelectric and magnetic properties of the composite samples, corresponding P–E and M–H hysteresis loops were recorded. Change in magnetic properties of electrically poled composite sample (x=0.02) was studied to confirm the magnetoelectric (ME) coupling. ME coefficient (dE/dH) of the samples (x=0 and 0.02) was measured as a function of DC magnetic field. - Highlights: • We are reporting the effect of Sm substitution on PZT–NiZn ferrite composites. • Observation of both P–E and M–H loops confirms ferroelectric and magnetic ordering. • With Sm substitution, significant improvement in properties was observed. • Increase in magnetization for electrically poled sample is evidence of ME coupling. • Electric polarization is generated by applying magnetic field.
Bogema, Daniel R; Deutscher, Ania T; Woolley, Lauren K; Seymour, Lisa M; Raymond, Benjamin B A; Tacchi, Jessica L; Padula, Matthew P; Dixon, Nicholas E; Minion, F Chris; Jenkins, Cheryl; Walker, Mark J; Djordjevic, Steven P
2012-01-01
Mycoplasma hyopneumoniae causes enormous economic losses to swine production worldwide by colonizing the ciliated epithelium in the porcine respiratory tract, resulting in widespread damage to the mucociliary escalator, prolonged inflammation, reduced weight gain, and secondary infections. Protein Mhp684 (P146) comprises 1,317 amino acids, and while the N-terminal 400 residues display significant sequence identity to the archetype cilium adhesin P97, the remainder of the molecule is novel and displays unusual motifs. Proteome analysis shows that P146 preprotein is endogenously cleaved into three major fragments identified here as P50(P146), P40(P146), and P85(P146) that reside on the cell surface. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) identified a semitryptic peptide that delineated a major cleavage site in Mhp684. Cleavage occurred at the phenylalanine residue within sequence (672)ATEF↓QQ(677), consistent with a cleavage motif resembling S/T-X-F↓X-D/E recently identified in Mhp683 and other P97/P102 family members. Biotinylated surface proteins recovered by avidin chromatography and separated by two-dimensional gel electrophoresis (2-D GE) showed that more-extensive endoproteolytic cleavage of P146 occurs. Recombinant fragments F1(P146)-F3(P146) that mimic P50(P146), P40(P146), and P85(P146) were constructed and shown to bind porcine epithelial cilia and biotinylated heparin with physiologically relevant affinity. Recombinant versions of F3(P146) generated from M. hyopneumoniae strain J and 232 sequences strongly bind porcine plasminogen, and the removal of their respective C-terminal lysine and arginine residues significantly reduces this interaction. These data reveal that P146 is an extensively processed, multifunctional adhesin of M. hyopneumoniae. Extensive cleavage coupled with variable cleavage efficiency provides a mechanism by which M. hyopneumoniae regulates protein topography. Vaccines used to control Mycoplasma
Energy Technology Data Exchange (ETDEWEB)
Garcia G, N
2006-07-01
Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)
Directory of Open Access Journals (Sweden)
Wing Pui Tsang
Full Text Available The human umbilical cord perivascular cells (HUCPVCs have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+ pericyte marker. The purified CD146(+ HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+ HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+ HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+ HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+ HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+ HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness
Energy Technology Data Exchange (ETDEWEB)
Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais
2010-07-01
This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)
20 CFR 702.146 - Source of the special fund.
2010-04-01
... by the employer into the fund. Compensation orders shall be made and filed in accordance with the... during that period for compensation, and (2) the ratio of the amount of payments made by the special fund... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Source of the special fund. 702.146 Section...
9 CFR 146.14 - Diagnostic surveillance program for H5/H7 low pathogenic avian influenza.
2010-01-01
.../H7 low pathogenic avian influenza. 146.14 Section 146.14 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...
MicroRNA-146a expression as a potential biomarker for rheumatoid ...
African Journals Online (AJOL)
MicroRNA-146a expression as a potential biomarker for rheumatoid arthritis in Egypt. Heba Mohamed Abdelkader Elsayed, Walaa Shawky Khater, Ayman Asaad Ibrahim, Maha Salah El-din Hamdy, Nashwa Aly Morshedy ...
Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M
2018-02-01
Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.
19 CFR 146.2 - Port director as Board representative.
2010-04-01
...; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.2 Port director as Board representative. The appropriate port director shall be in charge of the zone as the representative of the Board. [T.D. 86-16, 51 FR 5049, Feb. 11, 1986, as amended by T.D. 99-27, 64 FR 13676, Mar. 22, 1999] ...
International Nuclear Information System (INIS)
Essman, Stephanie C.; Lewis, Michael R.; Fox, Derek B.
2008-01-01
Introduction: Targeted radiotherapy using samarium-153-ethylenediaminetetramethylene phosphonate ( 153 Sm-EDTMP) is currently under investigation for treatment of osteosarcoma. Osteosarcoma often occurs in children, and previous studies on a juvenile rabbit model demonstrated that clinically significant damage to developing physeal cartilage may occur as a result of systemic 153 Sm-EDTMP therapy. The aim of this study was to evaluate the late effects of 153 Sm-EDTMP on skeletal structures during growth to maturity and to determine if there is a dose response of 153 Sm-EDTMP on growth of long bones. Methods: Female 8-week-old New Zealand white rabbits were divided into three treatment groups plus controls. Each rabbit was intravenously administered a predetermined dose of 153 Sm-EDTMP. Multiple bones of each rabbit were radiographed every 2 months until physeal closure, with subsequent measurements made to assess for abbreviated bone growth. Statistical analyses were performed to determine the differences in bone length between groups, with significance set at P 153 Sm-EDTMP. Further investigation regarding the effects of bone-seeking radiopharmaceuticals on bone growth and physeal cartilage is warranted
40 CFR 146.73 - Financial responsibility for post-closure care.
2010-07-01
...-closure by using a trust fund, surety bond, letter of credit, financial test, insurance or corporate... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Financial responsibility for post... Standards Applicable to Class I Hazardous Waste Injection Wells § 146.73 Financial responsibility for post...
Siparex hits target with '146m for third mid-market fund
2003-01-01
Sigefi Private Equity has reached its target final closing of '146m ($155m) for its third mid-market buy-out and expansion capital fund. International investors contributed 26% of the capital including commitments from CERN, Switzerland (1 paragraph).
24 CFR 146.3 - Purpose of HUD's age discrimination regulation.
2010-04-01
... RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.3 Purpose of HUD's age discrimination regulation. The purpose of this part is to state HUD's policies and procedures under the Age Discrimination Act of 1975... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of HUD's age discrimination...
Energy Technology Data Exchange (ETDEWEB)
Chu, B [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Li, W L [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Hong, Z R [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Zang, F X [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Wei, H Z [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Wang, D Y [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Li, M T [Key Laboratory of the Excited States Process, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16-Dong NanHu Road, Economic Development Area, Changchun, 130033 (China); Lee, C S [Department of Physics and Materials Science, City University of Hong Kong, Hong Kong (China); Lee, S T [Department of Physics and Materials Science, City University of Hong Kong, Hong Kong (China)
2006-11-07
Samarium (dibenzoylmethanato){sub 3} bathophenanthroline (Sm(DBM){sub 3} bath) was employed as an emitting and electron transport layer in organic light emitting diodes (OLEDs), and narrow electroluminescent (EL) emissions of a Sm{sup 3+} ion were observed in the visible and near infrared (NIR) region, differing from those of the same devices with Eu{sup 3+}- or Tb{sup 3+}-complex EL devices with the same structure. The EL emissions of the Sm{sup 3+}-devices originate from transitions from {sup 4}G{sub 5/2} to the lower respective levels of Sm{sup 3+} ions. A maximum luminance of 490 cd m{sup -2} at 15 V and an EL efficiency of 0.6% at 0.17 mA cm{sup -2} were obtained in the visible region, and the improved efficiency should be attributed to introducing a transitional layer between the N,N'-diphenyl-N,N'-bis(3-methylphenyl)-1,1'-diphenyl-4,4'-diamine (TPD) film and the Sm(DBM){sub 3} bath film and the avoidance of interfacial exciplex emission in devices. Sharp emissions of Sm{sup 3+} ions in the NIR region were also observed under a lower threshold value less than 4.5 V.
Energy Technology Data Exchange (ETDEWEB)
Hanifehpour, Younes, E-mail: y_hanifehpour@yu.ac.kr [School of Mechanical Engineering, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Soltani, Behzad; Amani-Ghadim, Ali Reza; Hedayati, Behnam [Department of Chemistry, Faculty of Basic Sciences, Azarbaijan Shahid Madani University, Tabriz (Iran, Islamic Republic of); Khomami, Bamin [Department of Chemical and Biomolecular Engineering, University of Tennessee, Knoxville, TN 37996 (United States); Joo, Sang Woo, E-mail: swjoo1@gmail.com [School of Mechanical Engineering, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)
2016-04-15
Highlights: • Sm-doped ZnS Nanomaterials were synthesized by hydrothermal method. • The as-prepared compounds were characterized by XRD, TEM, XPS, SEM and UV techniques. • The photocatalytic effect of compounds was determined by Reactive Red 43 degradation. • The degradation of RRed 43 followed the Langmuir–Hinshelwood kinetic model. - Abstract: We prepared pure and samarium-doped ZnS (Sm{sub x}Zn{sub 1−x}S{sub 1+0.5x}) nanoparticles via hydrothermal process at 160 °C for 24 h. XRD analysis shows that the particles were well crystallized and corresponds to a cubic sphalerite phase. SEM and TEM images indicate that the sizes of the particles were in the range of 20–60 nm. The photocatalytic activity of Sm-doped ZnS nanoparticles was evaluated by monitoring the decolorization of Reactive Red 43 in aqueous solution under visible light irradiation. The color removal efficiency of Sm{sub 0.04}Zn{sub 0.96}S and pure ZnS was 95.1% and 28.7% after 120 min of treatment, respectively. Among the different amounts of dopant agent used, 4% Sm-doped ZnS nanoparticles indicated the highest decolorization. We found that the presence of inorganic ions such as Cl{sup −}, CO{sub 3}{sup 2−} and other radical scavengers such as buthanol and isopropyl alcohol reduced the decolorization efficiency.
International Nuclear Information System (INIS)
Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.
2009-01-01
MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.
International Nuclear Information System (INIS)
Caires, A.C.F.
1985-01-01
A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt
Yang, Xuecheng; Mao, Xin; Ding, Xuemei; Guan, Fengju; Jia, Yuefeng; Luo, Lei; Li, Bin; Tan, Hailin; Cao, Caixia
2018-02-26
Oxidative stress and miRNAs have been confirmed to play an important role in neurological diseases. The study aimed to explore the underlying effect and mechanisms of miR-146a in H 2 O 2 -induced injury of PC12 cells. Here, PC12 cells were stimulated with 200 μM of H 2 O 2 to construct oxidative injury model. Cell injury was evaluated on the basis of the changes in cell viability, migration, invasion, apoptosis, and DNA damage. Results revealed that miR-146a expression was up-regulated in H 2 O 2 -induced PC12 cells. Functional analysis showed that down-regulation of miR-146a alleviated H 2 O 2 -induced cytotoxicity in PC12 cells. Dual-luciferase reporter and western blot assay verified that MCL1 was a direct target gene of miR-146a. Moreover, anti-miR-146a-mediated suppression on cell cytotoxicity was abated following MCL1 knockdown in H 2 O 2 -induced PC12 cells. Furthermore, MCL1 activated JAK/STAT signaling pathway and MCL1 overexpression attenuated H 2 O 2 -induced cytotoxicity in PC12 cells by JAK/STAT signaling pathway. In conclusion, this study suggested that suppression of miR-146a abated H 2 O 2 -induced cytotoxicity in PC12 cells via regulating MCL1/JAK/STAT pathway.
Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor
Energy Technology Data Exchange (ETDEWEB)
Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)
2017-04-30
Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).
Directory of Open Access Journals (Sweden)
Michiel M. Harmsen
2017-08-01
Full Text Available Intact (146S foot-and-mouth disease virus (FMDVs can dissociate into specific (12S viral capsid degradation products. FMD vaccines normally consist of inactivated virions. Vaccine quality is dependent on 146S virus particles rather than 12S particles. We earlier isolated two llama single-domain antibody fragments (VHHs that specifically recognize 146S particles of FMDV strain O1 Manisa and shown their potential use in quality control of FMD vaccines during manufacturing. These 146S-specific VHHs were specific for particular O serotype strains and did not bind strains from other FMDV serotypes. Here, we describe the isolation of 146S-specific VHHs against FMDV SAT2 and Asia 1 strains by phage display selection from llama immune libraries. VHHs that bind both 12S and 146S particles were readily isolated but VHHs that bind specifically to 146S particles could only be isolated by phage display selection using prior depletion for 12S particles. We obtained one 146S-specific VHH—M332F—that binds to strain Asia 1 Shamir and several VHHs that preferentially bind 146S particles of SAT2 strain SAU/2/00, from which we selected VHH M379F for further characterization. Both M332F and M379F did not bind FMDV strains from other serotypes. In a sandwich enzyme-linked immunosorbent assay (ELISA employing unlabeled and biotinylated versions of the same VHH M332F showed high specificity for 146S particles but M379F showed lower 146S-specificity with some cross-reaction with 12S particles. These ELISAs could detect 146S particle concentrations as low as 2.3–4.6 µg/l. They can be used for FMD vaccine quality control and research and development, for example, to identify virion stabilizing excipients.
Ebrahimi, Seyed Omar; Reiisi, Somayeh; Parchami Barjui, Shahrbanou
2018-04-11
Polycystic ovary syndrome (PCOS) is an endocrinopathy in reproductive-age women believed to be affected by several genetics and environmental factors or both. Different miRNAs are one of such genetic factors that their associations with PCOS have been implicated. For instance, miR-146a that is well known for strongly regulating the immune response and inflammation was upregulated in serum plasma, follicular fluid and granulosa cells of PCOS patients. Different studies have shown that genetic changes in pre-miRNA can cause change in the expression or biological function of mature miRNA. Therefore, the main aim of this study was to investigate the association of miR-146a gene variation (rs2910164) with the susceptibility to PCOS. This study consists of 180 patients with PCOS and 192 healthy women matched by age and geographical region. Genotyping were determined by using PCR-RFLP in all subjects. The genotype frequency and allele distributions of all subjects were evaluated using Fisher's exact test directed by SPSS v.20. The genotype and allele frequencies of the miR-146a polymorphism (rs2910164) significantly differ between PCOS and healthy controls. The frequencies of CC genotype (p = .054) and 'C' allele (p = .0001) of the miR-146a variant indicated a significant incidence in cases compared to controls. Such association was obtained in co-dominant (OR = 3.16) and dominant (OR = 2.29) models. Result of this study can be proposed that women with miR-146a variation are at a higher risk for developing PCOS, which can be due to up-regulation of miR-146a.
9 CFR 146.53 - Terminology and classification; slaughter plants and premises.
2010-01-01
... from which the commercial waterfowl and commercial upland game bird industry may conduct a program to... COMMERCIAL POULTRY Special Provisions for Commercial Upland Game Birds, Commercial Waterfowl, Raised-for-Release Upland Game Birds, and Raised-for-Release Waterfowl § 146.53 Terminology and classification...
Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a.
Wang, Min-Ching; Hung, Pei-Shih; Tu, Hsi-Feng; Shih, Wen-Yu; Li, Wan-Chun; Chang, Kuo-Wei
2012-12-01
MicroRNAs are small noncoding RNAs that play crucial roles in regulating normal and pathologic functions. Bacterial lipopolysaccharide (LPS) is one of the key regulators of pulpal pathogenesis. This study investigated how LPS regulates microRNA expression and affects the phenotype of human dental pulp cells (DPCs). Primary DPCs were established and immortalized to achieve immortalized DPCs (I-DPCs). DPCs and I-DPCs were treated with LPS and examined to identify changes in microRNA expression, cell proliferation, and cell migration. Quantitative reverse-transcriptase polymerase chain reaction was used to detect changes in gene expression. Exogenous miR-146a expression was performed transfection with pre-mir-146a mimic. Knockdown of interleukin receptor-associated kinase (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) expression was performed by small interference oligonucleotide transfection. Western blot analysis was used to detect changes in the expression of the IRAK1 and TRAF6 proteins. The differentiation of DPCs was induced by osteogenic medium. I-DPCs had a higher level of human telomerase reverse transcriptase gene than the parental DPCs. Up-regulation of miR-146a expression and an increase in migration was induced by LPS treatment of DPCs and I-DPCs. Exogenous miR-146a expression increased the migration of DPCs and I-DPCs and down-regulated the expression of IRAK1 and TRAF6. Knockdown of IRAK1 and/or TRAF6 increased the migration of DPCs. The results suggested that LPS is able to increase the migration of DPCs by modulating the miR-146a-TRAF6/IRAK1 regulatory cascade. Copyright © 2012 American Association of Endodontists. All rights reserved.
Directory of Open Access Journals (Sweden)
Jiang Xiaoying
2010-06-01
Full Text Available Abstract Background Despite the widespread induction of miR-146a during the innate immune response little is known regarding its biogenesis, function and mechanism. We have therefore examined the role of miR-146a during the interleukin (IL-1β-stimulated IL-6 and IL-8 release and proliferation in primary human airway smooth muscle (HASM cells. Methods HASM cells were isolated from human lung re-section, cultured to a maximum of 3 - 6 passages and then exposed to IL-1β. miR-146a expression were determined by qRT-PCR, IL-6 and IL-8 release by ELISA and proliferation using bromodeoxyuridine incorporation. The role of NF-κB and the MAP kinase pathways was assessed using pharmacological inhibitors of IKK2 (TPCA-1, JNK (SP600125, p38 MAP kinase (SB203580 and MEK-1/2 (PD98059. miR-146a function was determined following transfection of HASM with inhibitors and mimics using Amaxa electroporation. Results IL-1β induced a time-dependent and prolonged 100-fold induction in miR-146a expression, which correlated with release of IL-6 and IL-8. Exposure to IL-1β had no effect upon HASM proliferation. Pharmacological studies showed that expression of primary miR-146a was regulated at the transcriptional levels by NF-κB whilst post-transcriptional processing to mature miR-146a was regulated by MEK-1/2 and JNK-1/2. Functional studies indicated that IL-1β-induced miR-146a expression does not negatively regulate IL-6 and IL-8 release or basal proliferation. However, inhibition of IL-1β-induced IL-6 and IL-8 release was observed at the super-maximal intracellular miR-146a levels obtained by transfection with miR-146a mimics and indicates that studies using miRNA mimics can produce false positive results. Mechanistic studies showed that in the presence of super-maximal levels, the action of miR-146a mimics was mediated at a step following IL-6 and IL-8 mRNA transcription and not through down-regulation of IL-1 receptor associated kinase 1 (IRAK-1 and TNF
International Nuclear Information System (INIS)
Lerat-Parizot, O.
1992-01-01
Instable valences of cations in solution are evidenced by pulse radiolysis, in spite of a lifetime often lower than a milli-second they participate to electron transfer reactions, owing to their redox potential. In this work are studied Cd + and Sm 2+ obtained respectively by reduction of Cd 2+ and Sm 3+ by a solvated electron. The reactivity of Cd + in a cryptand and in a coronand is studied; it is a powerful reducing agent (redox potential -2V) going back to the stable valence by electron transfer to an acceptor. Transfer kinetics is studied by reduction of organic molecules, effect of solvents and ligands is also examined. For samarium the reduction kinetics by hydrated electrons is increased when the ion is in a cryptand in agreement with electrochemical observations, showing that the valence 2+ is stabilized in respect to the valence 3+ for lanthanides. The difference of behaviour between Cd + and Sm 2+ is probably due to the fact that for Cd the transferred electron comes from the external layer and for Sm it is a f electron protected by the 5s and 5p orbitals
Spectroscopy of samarium isotopes in the sdg interacting boson model
International Nuclear Information System (INIS)
Devi, Y.D.; Kota, V.K.B.
1992-01-01
Successful spectroscopic calculations for the 0 1 + , 2 1 + , and 4 1 + levels in 146-158 Sm are carried out in sdg boson space with the restriction that the s-boson number n s ≥2 and the g-boson number n g ≤2. Observed energies, quadrupole and magnetic moments, E2 and E4 transition strengths, nuclear radii, and two-nucleon transfer intensities are reproduced with a simple two-parameter Hamiltonian. For a good simultaneous description of ground, β, and γ bands, a Hamiltonian interpolating the dynamical symmetries in the sdg model is employed. Using the resulting wave functions, in 152,154 Sm, the observed B(E4;0 1 + →4 γ + ) values are well reproduced and E4 strength distributions are predicted. Moreover, a particular ratio scrR involving two-nucleon transfer strengths showing a peak at neutron number 90 is well described by the calculations
Intranasal Delivery of miR-146a Mimics Delayed Seizure Onset in the Lithium-Pilocarpine Mouse Model
Directory of Open Access Journals (Sweden)
Hua Tao
2017-01-01
Full Text Available Unveiling the key mechanism of temporal lobe epilepsy (TLE for the development of novel treatments is of increasing interest, and anti-inflammatory miR-146a is now considered a promising molecular target for TLE. In the current study, a C57BL/6 TLE mouse model was established using the lithium-pilocarpine protocol. The seizure degree was evaluated according to the Racine scale, and level 5 was considered the threshold for generalized convulsions. Animals were sacrificed to analyze the hippocampus at three time points (2 h and 4 and 8 weeks after pilocarpine administration to evaluate the acute, latent, and chronic phases, resp.. After intranasal delivery of miR-146a mimics (30 min before pilocarpine injection, the percent of animals with no induced seizures increased by 6.7%, the latency to generalized convulsions was extended, and seizure severity was reduced. Additionally, hippocampal damage was alleviated. While the relative miR-146a levels significantly increased, the expression of its target mRNAs (IRAK-1 and TRAF-6 and typical inflammatory modulators (NF-κB, TNF-α, IL-1β, and IL-6 decreased, supporting an anti-inflammatory role of miR-146a via the TLR pathway. This study is the first to demonstrate that intranasal delivery of miR-146a mimics can improve seizure onset and hippocampal damage in the acute phase of lithium-pilocarpine-induced seizures, which provides inflammation-based clues for the development of novel TLE treatments.
International Nuclear Information System (INIS)
Wu, Hua-Yi; Wang, Hai-Bo; Liu, Xin-Hua; Li, Jian-Hui; Yang, Mei-Hua; Huang, Chuan-Jing; Weng, Wei-Zheng; Wan, Hui-Lin
2015-01-01
Graphical abstract: The addition of a small amount of Sm into VPO catalyst brought about great changes in its physicochemical properties such as surface area, surface morphology, phase composition and redox property, thus leading to a higher catalytic performance in the selective oxidation of n-butane to maleic anhydride, as compared to the undoped VPO catalyst. - Highlights: • The addition of Sm leads to great changes in the structure of VPO catalyst. • Sm improves performance of VPO for oxidation of n-butane to maleic anhydride. • Catalytic performance is closely related to structure of VPO catalyst. - Abstract: A series of samarium-modified vanadium phosphate catalysts were prepared and studied in selective oxidation of n-butane to maleic anhydride. The catalytic evaluation showed that Sm modification significantly increased the overall n-butane conversion and intrinsic activity. N 2 -adsorption, XRD, SEM, Raman, XPS, EPR and H 2 -TPR techniques were used to investigate the intrinsic difference among these catalysts. The results revealed that the addition of Sm to VPO catalyst can increase the surface area of the catalyst, lead to a significant change in catalyst morphology from plate-like structure into rosette-shape clusters, and largely promote the formation of (VO) 2 P 2 O 7 . All of these were related to the different catalytic performance of Sm-doped and undoped VPO catalysts. The roles of the different VOPO 4 phases and the influence of Sm were also described and discussed
Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza
2016-03-01
The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.
Lifescience Database Archive (English)
Full Text Available DG01196 Chemical ... DGroup Samarium (153Sm) lexidronam ... D08504 ... Samarium (153Sm) lexidron...am (INN) D05795 ... Samarium Sm 153 lexidronam pentasodium (USAN); Samarium (153Sm) lexidronam sodium (JA
Nicotine permeability across the buccal TR146 cell culture model and porcine buccal mucosa in vitro
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Rassing, Margrethe Rømer
2002-01-01
The present study was conducted to investigate and compare the effect of pH and drug concentration on nicotine permeability across the TR146 cell culture model and porcine buccal mucosa in vitro. As a further characterization of the TR146 cell culture model, it was explored whether the results were...... comparable for bi-directional and uni-directional transport in the presence of a transmembrane pH gradient. Nicotine concentrations between 10(-5) and 10(-2) M were applied to the apical side of the TR146 cell culture model or the mucosal side of porcine buccal mucosa. Buffers with pH values of 5.5, 7.......4 and 8.1 were used to obtain different fractions of non- and mono-ionized nicotine. The apparent permeability (P(app)) of nicotine across both models increased significantly with increasing pH, and the P(app) values obtained with the two models could be correlated in a linear manner. With increasing...
Up-regulation of miR-146a contributes to the inhibition of invasion of pancreatic cancer cells
Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.
2009-01-01
Pancreatic cancer (PC) is an aggressive malignancy with high mortality and is believed to be in part due to its highly invasive and metastatic behavior, which is associated with over-expression of EGFR and activation of NF-κB. Emerging evidence also suggest critical roles of microRNAs (miRNAs) in the regulation of various pathobiological processes including metastasis in PC and in other human malignancies. In the present study, we found lower expression of miR-146a in PC cells compared to normal human pancreatic duct epithelial (HPDE) cells. Interestingly, re-expression of miR-146a inhibited the invasive capacity of Colo357 and Panc-1 PC cells with concomitant down-regulation of EGFR and IRAK-1. Mechanistic studies including miR-146a re-expression, anti-miR-146 transfection, and EGFR knock-down experiment showed that there was a crosstalk between EGFR, MTA-2, IRAK-1, IκBα and NF-κB. Most importantly, we found that the treatment of PC cells with “natural agents” [3,3′-diinodolylmethane (DIM) or isoflavone] led to an increase in the expression of miR-146a and consequently down-regulated the expression of EGFR, MTA-2, IRAK-1 and NF-κB, resulting in the inhibition of invasion of Colo357 and Panc-1 cells. These results provide experimental evidence in support of the role of DIM and isoflavone as potential non-toxic agents as regulators of miRNA, which could be useful for the inhibition of cancer cell invasion and metastasis, and further suggesting that these agents could be important for designing novel targeted strategy for the treatment of PC. PMID:25242818
12 CFR 563.146 - Will the OTS permit my capital distribution?
2010-01-01
... under 12 U.S.C. 1831o(d)(1)(B). (b) Your proposed capital distribution raises safety or soundness... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Will the OTS permit my capital distribution... SAVINGS ASSOCIATIONS-OPERATIONS Capital Distributions § 563.146 Will the OTS permit my capital...
27 CFR 70.146 - 45-day period for making disbursements.
2010-04-01
... tax lien filing, to the lien imposed by 26 U.S.C. 6321 if, and to the extent, a right to payment has... Collection of Excise and Special (Occupational) Tax Lien for Taxes § 70.146 45-day period for making disbursements. Even though a notice of a lien imposed by 26 U.S.C. 6321 is filed in accordance with § 70.149 of...
MicroRNA-146 protects A549 and H1975 cells from LPS-induced ...
Indian Academy of Sciences (India)
Qiang Wang
2017-10-26
Oct 26, 2017 ... States, pneumonia is the sixth most common cause of dis- ease-related deaths. In addition, pneumonia is the most common hospital-acquired fatal infections. ... 146 targets the messengers of bacterial lipopolysaccharide.
Declining Physical Performance Associates with Serum FasL, miR-21, and miR-146a in Aging Sprinters
Directory of Open Access Journals (Sweden)
Reeta Kangas
2017-01-01
Full Text Available Aging is associated with systemic inflammation and cellular apoptosis accelerating physiological dysfunctions. Whether physically active way of life affects these associations is unclear. This study measured the levels of serum inflammatory and apoptotic molecules, their change over 10 years, and their associations with physical performance in sprint-trained male athletes. HsCRP, cell counts, HGB, FasL, miR-21, and miR-146a were measured cross-sectionally (n=67, 18–90 yrs and serum FasL, miR-21, and miR-146a and their aging-related associations with physical performance were assessed over a 10-year follow-up (n=49, 50–90 yrs. The cross-sectional study showed positive age correlations for neutrophils and negative for lymphocytes, red blood cells, HGB, FasL, and miR-146a. During the 10-year follow-up, FasL decreased (P=0.017 and miR-21 (P<0.001 and miR-146a (P=0.005 levels increased. When combining the molecule levels, aging, and physical performance, FasL associated with countermovement jump and bench press (P<0.001, miR-21 and miR-146a with knee flexion (P=0.023; P<0.001, and bench press (P=0.004; P<0.001 and miR-146a with sprint performance (P<0.001. The studied serum molecules changed in an age-dependent manner and were associated with declining physical performance. They have potential as biomarkers of aging-related processes influencing the development of physiological dysfunctions. Further research is needed focusing on the origins and targets of circulating microRNAs to clarify their function in various tissues with aging.
Evaluation of the miRNA-146a and miRNA-155 Expression Levels in Patients with Oral Lichen Planus.
Ahmadi-Motamayel, Fatemeh; Bayat, Zeynab; Hajilooi, Mehrdad; Shahryar-Hesami, Soroosh; Mahdavinezhad, Ali; Samie, Lida; Solgi, Ghasem
2017-12-01
Oral Lichen Planus (OLP) is a chronic autoimmune disease that could be considered as a potential premalignant status. To evaluate the miRNA-146a and miRNA-155 expression levels in patients with oral Lichen planus lesions compared to healthy subjects with normal oral mucosa. Forty patients with oral lichen planus and 18 healthy age and gender-matched controls were recruited in this case-control study. Oral lichen planus was diagnosed clinically and pathologically. The expression levels of two miRNAs in peripheral blood samples were determined using commercial TaqMan MicroRNA Assays. Relative quantification of gene expression was calculated by the 2-ΔΔct method. The expression levels of miRNA-146a and miRNA-155 in patients with oral Lichen planus were significantly higher than those of healthy controls. Also, a direct but insignificant correlation was found between miRNA-155 and miRNA-146a expression levels among the patient group. Our findings indicate that miRNA-146a and miRNA-155 could be potential biomarkers for the immunopathogenesis of oral lichen planus.
Energy Technology Data Exchange (ETDEWEB)
Showler, Allan T. [USDA-ARS IFNRRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States)]. E-mail: ashowler@weslaco.ars.usda.gov; James, William D. [Elemental Analysis Laboratory, 3144 Texas A and M University, College Station, TX 77843-3144 (United States); Armstrong, John S. [USDA-ARS BIRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States); Westbrook, John K. [USDA-ARS APMRU, 2771 F and B Road, College Station, TX 77845-4966 (United States)
2006-08-15
Studies on insect dispersal and other behaviors can benefit from using markers that will not alter flight and fitness. Rare earth elements, such as samarium (Sm), have been used as ingested markers of some insects and detected using neutron activation analysis (NAA). In this study, samarium nitrate hexahydrate was mixed into artificial diet for boll weevils, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), at different dosages and in water used to irrigate cotton, Gossypium hirsutum L. Samarium was detected in adult boll weevils fed on the samarium-labeled diet, but not after 5 or 10 days of being switched to non-labeled diet, even if the insects were given labeled diet for as long as 7 consecutive days. Introduced in irrigation water, 1% samarium (m/m) was detectable in cotton squares and leaf tissue. However, boll weevil adults fed samarium-labeled squares did not retain detectable levels of samarium, nor did boll weevil adults reared to adulthood from samarium-labeled squares. Fourth instar beet armyworms, Spodoptera exigua (Huebner) (Noctuidae: Lepidoptera), fed on samarium-labeled cotton leaves obtained enough samarium for NAA detection, but adult moths reared from them did not have detectable amounts of samarium. Although samarium can be useful as a marker when insects are presented with a continuous pulse of the label, elements that are assimilated by the insect would be more useful if a continuous infusion of the marker cannot be provided.
Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae
2016-04-01
Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required
24 CFR 146.1 - Purpose of the Age Discrimination Act of 1975.
2010-04-01
... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.1 Purpose of the Age Discrimination Act of... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of the Age Discrimination... programs or activities receiving Federal financial assistance. The Act, however, permits federally assisted...
19 CFR 146.52 - Manipulation, manufacture, exhibition or destruction; Customs Form 216.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Manipulation, manufacture, exhibition or... Merchandise in a Zone § 146.52 Manipulation, manufacture, exhibition or destruction; Customs Form 216. (a... application) on Customs Form 216 for permission to manipulate, manufacture, exhibit, or destroy merchandise in...
Luo, Xi; Hong, Haiyu; Tang, Jun; Wu, Xingmei; Lin, Zhibin; Ma, Renqiang; Fan, Yunping; Xu, Geng; Liu, Dabo; Li, Huabin
2016-03-01
MicroRNAs (miRs) were recently recognized to be important for immune cell differentiation and immune regulation. However, whether miRs were involved in allergen-specific immunotherapy (SIT) remains largely unknown. This study sought to examine changes in miR-146a and T regulatory cells in children with persistent allergic rhinitis (AR) after 3 months of subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT). Twenty-four HDM-sensitized children with persistent AR were enrolled and treated with SCIT (n=13) or SLIT (n=11) for 3 months. Relative miR-146a and Foxp3 mRNA expression, the TRAF6 protein level, and the ratio of post-treatment to baseline IL-10+CD4+ T cells between the SCIT and SLIT groups were examined in the peripheral blood mononuclear cells (PBMCs) of AR patients using quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry, and Western blot analysis, respectively. Serum levels of IL-5 and IL-10 were determined using ELISA. After 3 months of SIT, both the TNSS and INSS scores were significantly decreased compared to the baseline value (P<0.01). The relative expression of miR-146a and Foxp3 mRNA was significantly increased after both SCIT and SLIT (P<0.01). The ratio of post-treatment to baseline IL-10⁺CD4⁺ T cells and the serum IL-10 level were significantly increased in both the SCIT and SLIT groups (P<0.01), whereas the TRAF6 protein level and serum IL-5 level were significantly decreased (P<0.01). No significant differences in these biomarkers were observed between the SCIT and SLIT groups. Our findings suggest that miR-146a and its related biomarkers may be comparably modulated after both SCIT and SLIT, highlighting miR-146a as a potential therapeutic target for the improved management of AR.
Energy Technology Data Exchange (ETDEWEB)
Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)
2016-10-01
Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.
Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)
2015-09-15
Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.
Directory of Open Access Journals (Sweden)
Baskaran T
2018-01-01
Full Text Available Thermal barrier coatings (TBC with the metallic NiCrAlY bond coat are often used in many aircraft engines to protect superalloy components from high-temperature corrosion thereby to improve the life of gas turbine components. The search for new TBC material has been intensified in recent years due to lack of thermo-physical properties of conventionally used Yttria stabilized Zirconia (YSZ TBCs. Recently, the rare earth containing Samarium Strontium Aluminate (SSA based ceramic was proposed as a new TBC material due to its matching thermo-physical properties with the substrate. The present work focused on the synthesis of SSA ceramics for TBCs application and its coatings development on Ni-based superalloy Inconel 718 substrate by air plasma spray process. The X-ray photoelectron spectroscopy (XPS result confirmed the formation of single phase SSA ceramic after synthesis. The surface morphology of SSA TBCs is mainly composed of melted splats, semi and un-melted particles. The cross-sectional SEM micrographs did not show any spallation at the interface which indicated good mechanical interlocking between the bond coat and ceramic top coat. The Young’s modulus and hardness of SSA TBCs were found to be 80 and 6.1 GPa, respectively. The load-depth curve of SSA TBC showed good elastic recovery about 47 %.
MicroED Structure of Au146(p-MBA)57 at Subatomic Resolution Reveals a Twinned FCC Cluster.
Vergara, Sandra; Lukes, Dylan A; Martynowycz, Michael W; Santiago, Ulises; Plascencia-Villa, Germán; Weiss, Simon C; de la Cruz, M Jason; Black, David M; Alvarez, Marcos M; López-Lozano, Xochitl; Barnes, Christopher O; Lin, Guowu; Weissker, Hans-Christian; Whetten, Robert L; Gonen, Tamir; Yacaman, Miguel Jose; Calero, Guillermo
2017-11-16
Solving the atomic structure of metallic clusters is fundamental to understanding their optical, electronic, and chemical properties. Herein we present the structure of the largest aqueous gold cluster, Au 146 (p-MBA) 57 (p-MBA: para-mercaptobenzoic acid), solved by electron micro-diffraction (MicroED) to subatomic resolution (0.85 Å) and by X-ray diffraction at atomic resolution (1.3 Å). The 146 gold atoms may be decomposed into two constituent sets consisting of 119 core and 27 peripheral atoms. The core atoms are organized in a twinned FCC structure, whereas the surface gold atoms follow a C 2 rotational symmetry about an axis bisecting the twinning plane. The protective layer of 57 p-MBAs fully encloses the cluster and comprises bridging, monomeric, and dimeric staple motifs. Au 146 (p-MBA) 57 is the largest cluster observed exhibiting a bulk-like FCC structure as well as the smallest gold particle exhibiting a stacking fault.
Cui, Lili; Tao, Hua; Wang, Yan; Liu, Zhou; Xu, Zhien; Zhou, Haihong; Cai, Yujie; Yao, Lifen; Chen, Beichu; Liang, Wandong; Liu, Yu; Cheng, Wanwen; Liu, Tingting; Ma, Guoda; Li, You; Zhao, Bin; Li, Keshen
2015-04-01
Epilepsy is the third most common chronic brain disorder and is characterized by an enduring predisposition for seizures. Recently, a growing body of evidence has suggested that microRNA-146a (miR-146a) is upregulated in the brains of epilepsy patients and of mouse models; furthermore, miR-146a may be involved in the development and progression of seizures through the regulation of inflammation and immune responses. In this report, we performed a case-control study to analyze the relationship between the two potentially functional single nucleotide polymorphisms (SNPs) of the miR-146a gene (rs2910464 and rs57095329) and the risk of epilepsy in a Chinese population comprising 249 cases and 249 healthy controls. Our study comprised 249 epilepsy patients and 249 healthy controls in two regions of China. The DNA was genotyped using the ABI PRISM SNapShot method. The statistical analysis was estimated using the chi-square test or Fisher's exact test. Our results indicated a significant association between the rs57095329 SNP of the miR-146a gene and the risk of drug resistant epilepsy (DRE) (genotypes, p = 0.0258 and alleles, p = 0.0108). Moreover, the rs57095329 A allele was found to be associated with a reduced risk of seizures frequency in DRE patients (all p epilepsy. Our data indicate that the rs57095329 polymorphism in the promoter region of miR-146a is involved in the genetic susceptibility to DRE and the seizures frequency. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Qian Cheng
2017-01-01
Full Text Available Exosomes derived from cancer cells can affect various functions of mesenchymal stem cells (MSCs via conveying microRNAs (miRs. miR-21 and miR-146a have been demonstrated to regulate MSC proliferation and transformation. Interleukin-6 (IL-6 secreted from transformed MSCs in turn favors the survival of multiple myeloma (MM cells. However, the effects of MM exosomes on MSC functions remain largely unclear. In this study, we investigated the effects of OPM2 (a MM cell line exosomes (OPM2-exo on regulating the proliferation, cancer-associated fibroblast (CAF transformation, and IL-6 secretion of MSCs and determined the role of miR-21 and miR-146a in these effects. We found that OPM2-exo harbored high levels of miR-21 and miR-146a and that OPM2-exo coculture significantly increased MSC proliferation with upregulation of miR-21 and miR-146a. Moreover, OPM2-exo induced CAF transformation of MSCs, which was evidenced by increased fibroblast-activated protein (FAP, α-smooth muscle actin (α-SMA, and stromal-derived factor 1 (SDF-1 expressions and IL-6 secretion. Inhibition of miR-21 or miR-146a reduced these effects of OPM2-exo on MSCs. In conclusion, MM could promote the proliferation, CAF transformation, and IL-6 secretion of MSCs partially through regulating miR21 and miR146a.
Directory of Open Access Journals (Sweden)
Paula F T Cezar-de-Mello
2014-09-01
Full Text Available Mycobacterium leprae infects macrophages and Schwann cells inducing a gene expression program to facilitate its replication and progression to disease. MicroRNAs (miRNAs are key regulators of gene expression and could be involved during the infection. To address the genetic influence of miRNAs in leprosy, we enrolled 1,098 individuals and conducted a case-control analysis in order to study four miRNAs genes containing single nucleotide polymorphism (miRSNP. We tested miRSNP-125a (rs12975333 G>T, miRSNP-223 (rs34952329 *>T, miRSNP-196a-2 (rs11614913 C>T and miRSNP-146a (rs2910164 G>C. Amongst them, miRSNP-146a was the unique gene associated with risk to leprosy per se (GC OR = 1.44, p = 0.04; CC OR = 2.18, p = 0.0091. We replicated this finding showing that the C-allele was over-transmitted (p = 0.003 using a transmission-disequilibrium test. A functional analysis revealed that live M. leprae (MOI 100:1 was able to induce miR-146a expression in THP-1 (p<0.05. Furthermore, pure neural leprosy biopsies expressed augmented levels of that miRNA as compared to biopsy samples from neuropathies not related with leprosy (p = 0.001. Interestingly, carriers of the risk variant (C-allele produce higher levels of mature miR-146a in nerves (p = 0.04. From skin biopsies, although we observed augmented levels of miR-146a, we were not able to correlate it with a particular clinical form or neither host genotype. MiR-146a is known to modulate TNF levels, thus we assessed TNF expression (nerve biopsies and released by peripheral blood mononuclear cells infected with BCG Moreau. In both cases lower TNF levels correlates with subjects carrying the risk C-allele, (p = 0.0453 and p = 0.0352; respectively, which is consistent with an immunomodulatory role of this miRNA in leprosy.
22 CFR 146.425 - Counseling and use of appraisal and counseling materials.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Counseling and use of appraisal and counseling... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on...
The N=82 gap in /sup 146/Gd from beta -decay studies of Tb isotopes
Styczen, J; Kleinheinz, P; Piiparinen, M
1981-01-01
The beta -decay study of 23 s /sup 146/Tb suggests a ( pi h/sub 11/2/ nu d/sup -1//sub 3/2/) 5/sup -/ configuration for this activity. In its decay the authors have identified a pi h/sub 11/2/ to nu h/sub 9/2 / GT decay branch which populates neutron particle-hole states in /sup 146/Gd. Hence the N=82 single particle energy gap is less than 4 MeV. Neutron one-particle two-hole and two-particle one-hole states in /sup 145/Gd and /sup 147/Gd were identified in the beta -decays of 29 s /sup 145/Tb and 1.6 h /sup 147/Tb. (11 refs).
The effectiveness of samarium-153 (153Sm) lexidronam (EDTMP) in treatment of bone metastases
International Nuclear Information System (INIS)
Ma Yubo; Huang Gang; Liu Jianjun
2004-01-01
Objectives: To evaluate the effectiveness of samarium-153 (153Sm) lexidronam (EDTMP) in treatment of bone metastases. Methods: 380 patients with bone metastases were studied (221 men, 159 women; average age 65.3 y; ranged 27-91 y; average weight 59.3 kg, ranged 39-95 kg). The tumor types were prostate carcinoma (n=155), pulmonary carcinoma (n=92), breast cancer (n=57), gastric carcinoma (n=12), colorectal carcinoma (n=22), nasopharyngeal carcinoma (n=8), lymphoma (n=8), hepatic carcinoma (n=6), ovary carcinoma (n=4) and others (n=16). All patients were received 135Sm-EDTMP 0.8 or 1.0 mCi/kg during 1 to 7 course of treatment. Patients and physician evaluations were used to assess pain relief. Numbers of metastatic foci and activity of ROIs were used to observe post-therapy change in bone scanning. Results: In 380 patients, pain relief was observed in 257 patients (67.6%). Persistence of pain relief was seen through 2 to 24 weeks. The mean relief time is 5.8±3.4 weeks. KPS score was higher 10% than pre-therapy (71.2%±9.6% Vs 80.9%±10.3%, p<0.001). Numbers of metastatic foci (11.2+8.8 Vs 8.4±5.7, p<0.001) and activity of ROIs (3.28±2.04 Vs 2.15±0.94, p<0.01) were less than pre-therapy. Bone marrow suppression was mild and reversible (5.87±1.56 Vs 4.94±1.16 x 109/L). Conclusions: 153Sm-EDTMP provided relief of pain associated with bone metastases and inhibition of metastatic foci. As a relief drug of painful bone metastases, 153Sm-EDTMP is safe and effective. (authors)
Nizyaeva, N V; Kulikova, G V; Nagovitsyna, M N; Kan, N E; Prozorovskaya, K N; Shchegolev, A I; Sukhikh, G T
2017-07-01
We studied the expression of microRNA-146a and microRNA-155 in placental villi from 18 women (26-39 weeks of gestation) of reproductive age with early- or late-onset preeclampsia. The reference group consisted of women with physiological pregnancy and full-term gestation and with preterm birth after caesarian section on gestation week 26-31. MicroRNA-146a and microRNA-155 were detected by in situ hybridization with digoxigenin on paraffin sections. It was found that the expression of microRNA-146a in both syncytiotrophoblast of the intermediate villi and syncytial knots was lower at late-onset preeclampsia than at physiologic pregnancy of full-term period (p=0.037 and p=0.001 respectively). The expression of microRNA-155 in syncytiotrophoblast of intermediate placental villi in early-onset preeclampsia was higher than in group with preterm delivery (p=0.003). However, in syncytiotrophoblast of intermediate villi and in syncytial knots, the expression of microRNA-155 was lower at late-onset preeclampsia in comparison with full-term physiological pregnancy (p=0.005). In addition, the expression of microRNA-146a and microRNA-155 did not increase in the later terms in preeclampsia, while in the reference groups demonstrating gradual increase in the expression of these markers with increasing gestational age. Expression microRNA-146a and microRNA-155 little differed in early- and late-onset preeclampsia. These findings suggest that different variants of preeclampsia are probably characterized by common pathogenetic pathways. Damaged trophoblast cannot maintain of microRNAs synthesis at the required level, which determines the formation of a vicious circle in preeclampsia and further progression of the disease.
Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong
2017-08-01
MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.
Gysler, Stefan M; Mulla, Melissa J; Guerra, Marta; Brosens, Jan J; Salmon, Jane E; Chamley, Lawrence W; Abrahams, Vikki M
2016-07-01
What is the role of microRNAs (miRs) in antiphospholipid antibody (aPL)-induced trophoblast inflammation? aPL-induced up-regulation of trophoblast miR-146a-3p is mediated by Toll-like receptor 4 (TLR4), and miR-146a-3p in turn drives the cells to secrete interleukin (IL)-8 by activating the RNA sensor, TLR8. Obstetric antiphospholipid syndrome (APS) is an autoimmune disorder characterized by circulating aPL and an increased risk of pregnancy complications. We previously showed that aPL recognizing beta2 glycoprotein I (β2GPI) elicit human first trimester trophoblast secretion of IL-8 by activating TLR4. Since some miRs control TLR responses, their regulation in trophoblast cells by aPL and functional role in the aPL-mediated inflammatory response was investigated. miRs can be released from cells via exosomes, and therefore, miR exosome expression was also examined. A panel of miRs was selected based on their involvement with TLR signaling: miR-9; miR-146a-5p and its isomiR, miR-146a-3p; miR-155, miR-210; and Let-7c. Since certain miRs can activate the RNA sensor, TLR8, this was also investigated. For in vitro studies, the human first trimester extravillous trophoblast cell line, HTR8 was studied. HTR8 cells transfected to express a TLR8 dominant negative (DN) were also used. Plasma was evaluated from pregnant women who have aPL, either with or without systemic lupus erythematous (SLE) (n = 39); SLE patients without aPL (n = 30); and healthy pregnant controls (n = 20). Trophoblast HTR8 wildtype and TLR8-DN cells were incubated with or without aPL (mouse anti-human β2GPI mAb) for 48-72 h. HTR8 cells were also treated with or without aPL in the presence and the absence of a TLR4 antagonist (lipopolysaccharide from Rhodobacter sphaeroides; LPS-RS), specific miR inhibitors or specific miR mimics. miR expression levels in trophoblast cells, trophoblast-derived exosomes and exosomes isolated from patient plasma were measured by qPCR. Trophoblast IL-8 secretion was
Rowell, Justine-Anne; Fillion, Marc-Alexandre; Smith, Scott; Wilkinson, Kevin J
2018-06-01
As technological interest and environmental emissions of the rare earth elements increase, it is becoming more important to assess their potential environmental impact. Samarium (Sm) is a lanthanide of intermediate molar mass that is used in numerous high-technology applications including wind turbines, solar panels, and electric vehicles. The present study relates the speciation of Sm determined in the presence of natural organic matter (NOM) to its bioavailability to the unicellular green alga Chlamydomonas reinhardtii. The free ion concentration was determined using a cation exchange resin (ion exchange technique) in dynamic mode and compared with thermodynamic modeling. Short-term biouptake experiments were performed in the presence of 4 types of NOM: Suwannee River fulvic acids, Pahokee Peat fulvic acids, Suwannee River humic acids, and a Luther Marsh dissolved organic matter isolate (90-95% humic acids). It was clearly shown that even a small amount of NOM (0.5 mg C L -1 ) resulted in a significant decrease (10 times) in the Sm internalization fluxes. Furthermore, complexation with humic acids (and the corresponding reduction in Sm bioavailability) was stronger than that with fulvic acids. The results showed that the experimentally measured (free) Sm was a better predictor of Sm internalization than either the total concentrations or the free ion concentrations obtained using thermodynamic modeling. Environ Toxicol Chem 2018;37:1623-1631. © 2018 SETAC. © 2018 SETAC.
Samarium-153 Oksabifor in the treatment of metastatic bone disease
International Nuclear Information System (INIS)
Solodyannikova, O.; Voit, N.; Sukach, G.; Sagan, D.
2015-01-01
patients - reducing the number of foci and the level of radiopharmaceutical uptake in them. Conclusions: radionuclide therapy in patients with BM can effectively suppress pain and significantly reduce the number of analgesics. Post-treatment patients, life quality statistically significantly improved. Samarium-153 has the ability to reduce BM number and intensity of radiopharmaceutical accumulation in spots in the control study. (authors)
MS2 VLP-based delivery of microRNA-146a inhibits autoantibody production in lupus-prone mice
Directory of Open Access Journals (Sweden)
Pan Y
2012-12-01
Full Text Available Yang Pan,1,2 Tingting Jia,1,2 Yuan Zhang,1,2 Kuo Zhang,1 Rui Zhang,1 Jinming Li,1 Lunan Wang11National Center for Clinical Laboratories, Beijing Hospital of the Ministry of Health, Beijing, People’s Republic of China; 2Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, People’s Republic of ChinaBackground: Systemic lupus erythematosus (SLE is a chronic autoimmune disease characterized by the presence of pathogenic autoantibodies. Recent studies suggest that microRNAs (miRNAs play an essential role in immunoregulation and may be involved in the pathogenesis of SLE. Therefore, it was of interest to investigate the potential therapeutic application of miRNAs in SLE, a concept that has not been thoroughly investigated thus far. Virus-like particles (VLPs are a type of recombinant nanoparticle enveloped by certain proteins derived from the outer coat of a virus. Herein, we describe a novel miRNA-delivery approach via bacteriophage MS2 VLPs and investigate the therapeutic effects of miR-146a, a well-studied and SLE-related miRNA, in BXSB lupus-prone mice.Methods: VLPs containing miR-146a, and the control VLPs, were prepared using an Escherichia coli expression system and then administered to lupus-prone mice over a 12-day period. We performed an enzyme-linked immunosorbent assay to evaluate the anti-dsDNA antibody, autoantibody to nuclear antigen (ANA, total IgG and total IgM levels in serum. The expression of miR-146a was analyzed by qRT-PCR. SLE-related cytokines as well as some toll-like receptor signaling pathway molecules were also measured.Results: Treatment with MS2-miR146a VLP showed profound effects on lupus-prone BXSB mice, including an increased level of mature miR-146a, which led to a significant reduction in the expression of autoantibodies and total IgG. Remarkably, these mice also exhibited reduced levels of proinflammatorycytokines, including IFN-Interferon-α (IFN-α, Interleukin-1β (Il-1
Fluorescence properties of europium and samarium. beta. -diketonates and their use in fluorometry
Energy Technology Data Exchange (ETDEWEB)
Huang, H; Hiraki, K; Nishikawa, Y [Kinki Univ., Higashi-Osaka, Osaka (Japan). Faculty of Science and Technology
1981-01-01
Several europium and samarium ..beta..-diketonates (tta, ntfa, bfa) complexed with 1, 10-phenanthroline, or with trioctylphosphine oxide (topo) were synthesized. The fluorescence properties of these compounds in benzene or hexane have been studied. Absorption and fluorescence spectra, fluorescence quantum yield, fluorescence sensitivity index (F.S.I.), and fluorescence lifetime were measured. From the measurement of fluorescence lifetime of the ..beta..-diketonates, the velocity of radiative process (k sub(f)/phi sub(f)) has almost the same value for benzene and hexane solvent. The red fluorescence (Em. max. : 619 nm) of Eu(III) in these chelates is attributed to transitions from /sup 5/D/sub 0/ ..-->.. /sup 7/F/sub 2/ levels of this ion, and the three-band spectrum (Em. max. : 569 nm, 606 nm, 650 nm) indicates the transitions from the /sup 4/G sub(5/2) ..-->.. /sup 6/H sub(5/2), /sup 4/G sub(5/2) ..-->.. /sup 6/H sub(7/2), and /sup 4/G sub(5/2) ..-->.. /sup 6/H sub(9/2) levels of Sm(III), respectively. These spectra are not changed by any solvents and ligands. From the results, the fluorescence of the ..beta..-diketonates in organic solvent has been attributed to m* ..-->.. m luminescence transition. The complexes of Eu(III) and Sm(III) show radiative transition within orbitals, composed exclusively of 4f orbitals of rare earth ions (m* ..-->.. m radiative transition). Fluorinated ligands show better sensitivity than unfluorinated ligands, and the best sensitivity is obtained with TTA-phen system, and/or TTA-topo system for the spectrofluorometric determination of the two metals. In the case of Eu determination, 619 nm emission wavelength is used (the determinable range : 0.2 -- 10 ppb Eu), and in the case of Sm determination, 650 nm emission wavelength is adopted (the determinable range : 0.1 -- 1 ppm Sm), because of much higher sensitivity than the other two peaks (569, 606 nm) without interference from europium complex.
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Rassing, M R
1999-01-01
The aim of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability enhancement by different pH values, different osmolality values or bile salts. For this purpose, the increase in the apparent permeability (P...
DEFF Research Database (Denmark)
Li, Tong; Pires, Carlota; Nielsen, Troels Tolstrup
2016-01-01
Skin fibroblasts were obtained from a 46-year-old symptomatic man carrying a M146I mutation in the presenilin 1 gene (PSEN1), responsible for causing Alzheimer's disease (AD). Induced pluripotent stem cells (iPSCs) were derived via transfection with episomal vectors carrying hOCT4, hSOX2, hKLF2, h......L-MYC, hLIN28 and shTP53 genes. M146I-iPSCs were free of genomically integrated reprogramming genes, had the specific mutation but no additional genomic aberrancies, expressed the expected pluripotency markers and displayed in vitro differentiation potential to the three germ layers. The reported M146I...
MicroRNA-146a expression as a potential biomarker for rheumatoid ...
African Journals Online (AJOL)
Heba Mohamed Abdelkader Elsayed
2016-07-26
Jul 26, 2016 ... lows; enzyme activation at 95 °C, followed by 40 cycles of denaturation at 94 °C for 15s annealing at 55 °C for 30 s and extension at 70 °C for 30 s. The expression of the U6B small nuclear RNA (RNU6B) was used as endogenous control for data normalization. The RQ level (fold change) for miR-146a was ...
Directory of Open Access Journals (Sweden)
Xing He
2016-11-01
Full Text Available Schistosomiasis is a chronic disease caused by the parasite of the Schistosoma genus and is characterized by egg-induced hepatic granulomas and fibrosis. Macrophages play a central role in schistosomiasis with several studies highlighting their differentiation into M2 cells involved in the survival of infected mice through limitation of immunopathology. However, little is known regarding the mechanisms of regulating macrophage differentiation. Here, we showed that the early stage of infection by Schistosoma japonicum induced expression of type 1 T-helper-cell (Th1 cytokine, interferon-γ (IFN-γ, leading to increase in M1 cells. However, the presence of liver-trapped eggs induced the expression of Th2 cytokines including interleukin-4 (IL-4, IL-10, and IL-13 that upregulated the transcription of miR-146b by activating signal transducer and activator of transcription 3/6 (STAT3/6 that bind to the promoter of the pre-miR-146b gene. We found that the miR-146a/b was significantly upregulated in macrophages during the progression of hepatic schistosomiasis. The elevated miR-146a/b inhibited the IFN-γ-induced differentiation of macrophages to M1 cells through targeting STAT1. Our data indicate the protective roles of miR-146a/b in hepatic schistosomiasis through regulating the differentiation of macrophages into M2 cells.
29 CFR 780.146 - Importance of relationship of the practice to farming generally.
2010-07-01
... to include typical factory workers or industrial operations, and the sponsors of the bill made it clear that the erection and operation on a farm by a farmer of a factory, even one using raw materials... in Conjunction Withâ the Farming Operations § 780.146 Importance of relationship of the practice to...
45 CFR 146.136 - Parity in mental health and substance use disorder benefits.
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Parity in mental health and substance use disorder... Benefits § 146.136 Parity in mental health and substance use disorder benefits. (a) Meaning of terms. For... benefits and mental health or substance use disorder benefits must comply with paragraph (b)(2), (b)(3), or...
International Nuclear Information System (INIS)
Busch, M.R.; Mace, J.E.; Ho, N.T.; Ho, Chien
1991-01-01
Assessment of the roles of the carboxyl-terminal β146 histidyl residues in the alkaline Bohr effect in human and normal adult hemoglobin by high-resolution proton nuclear magnetic resonance spectroscopy requires assignment of the resonances corresponding to these residues. By a careful spectroscopic study of human normal adult hemoglobin, enzymatically prepared des(His146β)-hemoglobin, and the mutant hemoglobins Cowtown (β146His → Leu) and York (β146His → Pro), the authors have resolved some of these conflicting results. By a close incremental variation of pH over a wide range in chloride-free 0.1 M N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid buffer, a single resonance has been found to be consistently missing in the proton nuclear magnetic resonance spectra of these hemoglobin variants. The results indicate that the contribution of the β146 histidyl residues is 0.52 H + /hemoglobin tetramer at pH 7.6, markedly less than 0.8 H + /hemoglobin tetramer estimated by study of the mutant hemoglobin Cowtown (β146His → Leu) by Shih and Perutz. They have found that at least two histidyl residues in the carbonmonoxy form of this mutant have pK values that are perturbed, and they suggest that these pK differences may in part account for this discrepancy. The results show that the pK values of β146 histidyl residues in the carbonmonoxy form of hemoglobin are substantially affected by the presence of chloride and other anions in the solvent, and thus, the contribution of this amino acid residue to the alkaline Bohr effect can be shown to vary widely in magnitude, depending on the solvent composition. These results demonstrate that the detailed molecular mechanisms of the alkaline Bohr effect are not unique but are affected both by the hemoglobin structure and by the interactions with the solvent components in which the hemoglobin molecule resides
Directory of Open Access Journals (Sweden)
Lili Cui
Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.
Directory of Open Access Journals (Sweden)
Marcelo Tatit Sapienza
2004-01-01
Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm
Neutral V production with 14.6 x A GeV/c silicon beams
International Nuclear Information System (INIS)
Eiseman, S.E.; Etkin, A.; Foley, K.J.; Hackenburg, R.W.; Longacre, R.S.; Love, W.A.; Morris, T.W.; Platner, E.D.; Saulys, A.C.; Lindenbaum, S.J.; Chan, C.S.; Kramer, M.A.; Zhao, K.; Hallman, T.J.; Madansky, L.; Bonner, B.E.; Buchanan, J.A.; Chiou, C.N.; Clement, J.M.; Corcoran, M.D.; Kruk, J.W.; Mutchler, G.S.; Nessi-Tedaldi, F.; Nessi, M.; Roberts, J.B.
1990-01-01
We present the results of a measurement of neutral V production with 14.6xA GeV/c Si beams on Au and Cu targets. The Λ and K s 0 yields were measured as a function of negative particle multiplicity. Effective temperatures were determined from an exponential fit to the transverse mass distributions. (orig.)
Directory of Open Access Journals (Sweden)
Lu Liu
2016-01-01
Full Text Available Introduction. Inflammation in dental pulp cells (DPCs initiated by Lipopolysaccharide (LPS results in dental pulp necrosis. So far, whether there is a common system regulating inflammation response and tissue regeneration remains unknown. miR-146a is closely related to inflammation. Basic fibroblast growth factor (bFGF is an important regulator for differentiation. Methods. To explore the effect of miR-146a/bFGF on inflammation and tissue regeneration, polyethylene glycol-polyethyleneimine (PEG-PEI was synthesized, and physical characteristics were analyzed by dynamic light scattering and gel retardation analysis. Cell absorption, transfection efficiency, and cytotoxicity were assessed. Alginate gel was combined with miR-146a/PEG-PEI nanoparticles and bFGF. Drug release ratio was measured by ultraviolet spectrophotography. Proliferation and odontogenic differentiation of DPCs with 1 μg/mL LPS treatment were determined. Results. PEG-PEI prepared at N/P 2 showed complete gel retardation and smallest particle size and zeta potential. Transfection efficiency of PEG-PEI was higher than lipo2000. Cell viability decreased as N/P ratio increased. Drug release rate amounted to 70% at the first 12 h and then maintained slow release afterwards. Proliferation and differentiation decreased in DPCs with LPS treatment, whereas they increased in miR-146a/bFGF gel group. Conclusions. PEG-PEI is a promising vector for gene therapy. miR-146a and bFGF play critical roles in inflammation response and tissue regeneration of DPCs.
International Nuclear Information System (INIS)
Son, Hyeon-Taek; Lee, Jae-Seol; Kim, Dae-Guen; Yoshimi, Kyosuke; Maruyama, Kouichi
2009-01-01
Samarium (Sm) additions to as-cast Mg-5Al-3Ca-based alloys result in changes, such as equiaxed grains and a refined grain size. The microstructure of as-cast Mg-5Al-3Ca-xSm alloys consists of an α-Mg matrix, a (Mg, Al) 2 Ca eutectic phase, and an Al 2 Sm intermetallic compound. In as-cast alloys, the (Mg, Al) 2 Ca eutectic phase was located at grain boundaries with a chain structure, and the Al 2 Sm intermetallic compounds were homogeneously distributed at the α-Mg matrix and grain boundaries. The eutectic phase of the extruded alloys was elongated in the extrusion direction and crushed into fine particles because of severe deformation during hot extrusion, and the grain size was refined with an increased amount of Sm addition. The maximum values of the yield strength and tensile strength were 313 MPa and 330 MPa at 2 wt%Sm alloy content, respectively
Wang, Xiaofang; Yuan, Taixian; Yuan, Jun; Su, Yufeng; Sun, Xiaoyu; Wu, Jingwen; Zhang, Hong; Min, Xun; Zhang, Xuemei; Yin, Yibing
2018-03-01
The fusion protein DnaJ-ΔA146Ply could induce cross-protective immunity against pneumococcal infection via mucosal and subcutaneous immunization in mice in the absence of additional adjuvants. DnaJ and Ply are both Toll-like receptor 4 (TLR4) but not TLR2 ligands. However, we found that TLR2 -/- mice immunized subcutaneously with DnaJ-ΔA146Ply showed significantly lower survival rates and higher bacterial loads in nasal washes than did wild-type (WT) mice after being challenged with pneumococcal strain D39 or 19F. The gamma interferon (IFN-γ) level in splenocytes decreased in TLR2 -/- mice, indicating that Th1 immunity elicited by DnaJ-ΔA146Ply was impaired in these mice. We explored the mechanism of protective immunity conferred by DnaJ-ΔA146Ply and the role of TLR2 in this process. DnaJ-ΔA146Ply effectively promoted dendritic cell (DC) maturation via TLR4 but not the TLR2 signaling pathway. In a DnaJ-ΔA146Ply-treated DC and naive CD4 + T cell coculture system, the deficiency of TLR2 in DCs resulted in a significant decline of IFN-γ production and Th1 subset differentiation. The same effect was observed in adoptive-transfer experiments. In addition, TLR2 -/- DCs showed remarkably lower levels of the Th1-polarizing cytokine IL-12p70 than did WT DCs, suggesting that TLR2 was indispensable for DnaJ-ΔA146Ply-induced IL-12 production and Th1 proliferation. Thus, our findings illustrate that dendritic cell expression of TLR2 is essential for optimal Th1 immune response against pneumococci in mice immunized subcutaneously with DnaJ-ΔA146Ply. Copyright © 2018 American Society for Microbiology.
MiR-146a regulates PM1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells.
Liu, Limin; Wan, Chong; Zhang, Wei; Guan, Longfei; Tian, Guoxiong; Zhang, Fang; Ding, Wenjun
2018-04-18
Exposure to particulate matter (PM) leads to kinds of cardiopulmonary diseases, such as asthma, COPD, arrhythmias, lung cancer, etc., which are related to PM-induced inflammation. We have found that PM 2.5 (aerodynamics diameter <2.5 µm) exposure induces inflammatory response both in vivo and in vitro. Since the toxicity of PM is tightly associated with its size and components, PM 1 (aerodynamics diameter <1.0 µm) is supposed to be more toxic than PM 2.5 . However, the mechanism of PM 1 -induced inflammation is not clear. Recently, emerging evidences prove that microRNAs play a vital role in regulating inflammation. Therefore, we studied the regulation of miR-146a in PM 1 -induced inflammation in human lung bronchial epithelial BEAS-2B cells. The results show that PM 1 induces the increase of IL-6 and IL-8 in BEAS-2B cells and up-regulates the miR-146a expression by activating NF-κB signaling pathway. Overexpressed miR-146a prevents the nuclear translocation of p65 through inhibiting the IRAK1/TRAF6 expression, and downregulates the expression of IL-6 and IL-8. Taken together, these results demonstrate that miR-146a can negatively feedback regulate PM 1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells. © 2018 Wiley Periodicals, Inc.
Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi
2011-08-01
We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.
Search for hyperdeformation in 146Gd using the microball and gammasphere
International Nuclear Information System (INIS)
Hua, P.F.; LaFosse, D.; Korolija, M.; Sarantites, D.G.; Baktash, C.; Cross, C.; Cederwall, B.; Fallon, P.; Lee, I.Y.; Machiavelli, A.
1994-01-01
Results from the first attempt to observe hyperdeformation in 146 Gd by the 100 Mo( 51 V, p4n) reaction are presented. The γ-ray spectra were recorded with Gammasphere. The Microball was used to select protons with an efficiency of 90%. A total of 2 x 10 9 proton selected triple events were obtained. The pxn channels comprised ∼25% of the total events. The proton gating decreased the background from competing xn, αxn and fission by a factor of 4
DEFF Research Database (Denmark)
Crone, Stephanie Geisler; Jacobsen, Anders; Federspiel, Birgitte
2012-01-01
Gastric cancer is the second most common cause of cancer-related death in the world. Inflammatory signals originating from gastric cancer cells are important for recruiting inflammatory cells and regulation of metastasis of gastric cancer. Several microRNAs (miRNA) have been shown to be involved...... in development and progression of gastric cancer. miRNA-146a (miR-146a) is a modulator of inflammatory signals, but little is known about its importance in gastric cancer. We therefore wanted to identify targets of miR-146a in gastric cancer and examine its biological roles....
International Nuclear Information System (INIS)
Minyu, T.; Ning, T.; Yingli, Z.; Jiyuan, B.
1985-01-01
The solid complexes of rare earth nitrates perchlorates and thiocyanates with 2,2'-bipyridine-N,N'-dioxide (bipyO/sub 2/) have been reported. However, the corresponding complexes of other rear earth chlorides have not been investigated except lanthanum, cerium and yttrium. As an extension of our previous work on the synthesis of complexes of praseodymium and neodymium chlorides wiht bipoyO/sub 2/, the authors have now prepared fluorescent solid complexes of samarium, europium, gadolium and terbium chlorides with biphyO/sub 2/, using methanol as a reaction medium. The new synthesized compounds have been identified by means of elemental analysis, infrared spectrometry, conductometry, differential thermal analysis (DTA), thermogravimetry (TG) and X-ray powder diffraction
Measurement and Evaluation of the Activation Resonance Integral of 146Nd, 148Nd and 150Nd
International Nuclear Information System (INIS)
Ricabarra, M. D.; Turjanski, R.; Ricabarra, G. H.
2012-01-01
Values of the ratio of the reduced activation resonance integral to the thermal cross section, I'/σ 0 of 146 Nd, 148 Nd and 150 Nd were determined relative to gold by measuring cadmium ratios. A lithium-drifted germanium gamma ray spectrometer was used to resolve the activities of the irradiated samples. The results are for 146 Nd I'/σ 0 = 1.42±0.1 0 and with an assumed σ 0 = 1.4 barn, I' = 1 .99±0.20; for 148 Nd I'/ σ 0 = 4.22±0.1 4 and with an assumed σ 0 = 2.5 barn, I' = 10.5±0. 9 barn, and for 150 Nd I'/σ 0 = 13.7±0. 8 and with an assumed σ 0 = 1.2 barn, I' = 16.4±2.8. The resolved and unresolved epithermal integrals of 146 Nd, 148 Nd and 150 Nd were calculated. Values of the spectral correction factor were also calculated, so the resonance integral could be obtained from the epithermal integral data measured in our reactor spectrum in this experiment. Epithermal integral and spectral correction factors are listed in the text. The most important result of this investigation is that the 148 Nd activation reduced resonance integral is about half of the previously recommended value and consequently the radiative width for 148 Nd is also about half of the previously accepted value. (author)
Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A
2015-09-02
Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Maarten Hulsmans
Full Text Available BACKGROUND: Low adiponectin, a well-recognized antidiabetic adipokine, has been associated with obesity-related inflammation, oxidative stress and insulin resistance. Globular adiponectin is an important regulator of the interleukin-1 receptor-associated kinase (IRAK/NFκB pathway in monocytes of obese subjects. It protects against inflammation and oxidative stress by inducing IRAK3. microRNA (miR-146b-5p inhibits NFκB-mediated inflammation by targeted repression of IRAK1 and TNF receptor-associated factor-6 (TRAF6. Therefore, we measured the expression of miR-146b-5p in monocytes of obese subjects. Because it was low we determined the involvement of this miR in the anti-inflammatory, antioxidative and insulin signaling action of globular adiponectin. METHODS: miR-146b-5p expression in monocytes of obese subjects was determined by qRT-PCR. The effect of miR-146b-5p silencing on molecular markers of inflammation, oxidative stress and insulin signaling and the association with globular adiponectin was assessed in human THP-1 monocytes. RESULTS: miR-146b-5p was downregulated in monocytes of obese persons. Low globular adiponectin decreased miR-146b-5p and IRAK3 in THP-1 monocytes, associated with increased mitochondrial reactive oxygen species (ROS. Intracellular ROS and insulin receptor substrate-1 (IRS1 protein were unchanged. Silencing of miR-146b-5p with an antisense inhibitor resulted in increased expression of IRAK1 and TRAF6 leading to more NFκB p65 DNA binding activity and TNFα. As a response IRAK3 and IRS1 protein increased. Mitochondrial and intracellular ROS production did not increase despite more inflammation. In addition, exposure of miR-146b-5p-depleted THP-1 monocytes to high levels of globular adiponectin resulted in an increased production of TNFα and intracellular ROS. Still, they did not lose their potential to increase IRAK3 and IRS1 protein and to decrease mitochondrial ROS. CONCLUSION: miR-146b-5p, decreased in monocytes
Energy Technology Data Exchange (ETDEWEB)
Borda O, L B; Torres L, M N
1997-07-01
The purpose of this investigation was to establish the different pharmacokinetics parameters of the main radiopharmaceuticals labeled with technetium-99m and samarium-153. These parameters could be subsequently used as reference to compare other products with the same use. Mathematical models and a computerized pharmacokinetic program were used to this purpose. A biodistribution study in quadruplicate and/or quintuplicate was conducted for each radiopharmaceutical, data was was obtained in injection dose percentages. The biodistribution study involved the injection of a predetermined dose of the radiopharmaceutical into animals (rats or mice), which were subsequently put away at different time intervals, removing the relevant organs. Activity in each organ was read by means of a well-type NaI scintillation counter, data obtained in activity counts was transformed into injection dose percentages. Based on these percentages, the mathematical model was constructed and the pharmacokinetic parameters were obtained using the computerized program Expo 2 v. 1, which is written in C language and works in windows. Analyzing the results obtained, we can conclude that the use of the Expo 2 v. 1 program for a bi compartmental analysis allowed us to obtain reliable pharmacokinetic parameters which describe what happens in the organism when the radiopharmaceutical passes from the central compartment to the peripheral one and vice versa.
42 CFR 84.146 - Method of measuring the power and torque required to operate blowers.
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Method of measuring the power and torque required... RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.146 Method of measuring the power and torque.... These are used to facilitate timing. To determine the torque or horsepower required to operate the...
DEFF Research Database (Denmark)
Portero, Ana; Remuñán-López, Carmen; Nielsen, Hanne Mørck
2002-01-01
To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used.......To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used....
Zago, Michela; Rico de Souza, Angela; Hecht, Emelia; Rousseau, Simon; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J
2014-04-21
Diseases due to cigarette smoke exposure, including chronic obstructive pulmonary disease (COPD) and lung cancer, are associated with chronic inflammation typified by the increased expression of cyclooxygenase-2 (COX-2) protein. RelB is an NF-κB family member that suppresses cigarette smoke induction of COX-2 through an unknown mechanism. The ability of RelB to regulate COX-2 expression may be via miR-146a, a miRNA that attenuates COX-2 in lung fibroblasts. In this study we tested whether RelB attenuation of cigarette smoke-induced COX-2 protein is due to miR-146a. Utilizing pulmonary fibroblasts deficient in RelB expression, together with siRNA knock-down of RelB, we show the essential role of RelB in diminishing smoke-induced COX-2 protein expression despite robust activation of the canonical NF-κB pathway and subsequent induction of Cox-2 mRNA. RelB did not regulate COX-2 protein expression at the level of mRNA stability. Basal levels of miR-146a were significantly lower in Relb-deficient cells and cigarette smoke increased miR-146a expression only in Relb-expressing cells. Inhibition of miR-146a had no effects on Relb expression or induction of Cox-2 mRNA by cigarette smoke but significantly increased COX-2 protein. These data highlight the potential of a RelB-miR-146a axis as a novel regulatory pathway that attenuates inflammation in response to respiratory toxicants. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Dimitrios Kouroupis
2014-08-01
Full Text Available Adult stem cells are characterised by longer telomeres compared to mature cells from the same tissue. In this study, candidate CD146+ umbilical cord (UC mesenchymal stem cells (MSCs were purified by cell sorting from UC tissue digests and their telomere lengths were measured in comparison to donor-matched CD146-negative fraction. UC tissue fragments were enzymatically treated with collagenase and the cells were used for cell sorting, colony-forming fibroblast (CFU-F assay or for long-term MSC cultivation. Telomere lengths were measured by qPCR in both culture-expanded MSCs and candidate native UC MSCs. Immunohistochemistry was undertaken to study the topography of CD146+ cells. Culture-expanded UC MSCs had a stable expression of CD73, CD90 and CD105, whereas CD146 declined in later passages which correlated with the shortening of telomeres in the same cultures. In five out of seven donors, telomeres in candidate native UC MSCs (CD45-CD235α-CD31-CD146+ were longer compared to donor-matched CD146- population (CD45-CD235α-CD31-CD146-. The frequency of CD45-CD235α-CD31-CD146+ cells measured by flow cytometry was ~1000-fold above that of CFU-Fs (means 10.4% and 0.01%, respectively. CD146+ cells were also abundant in situ having a broad topography including high levels of positivity in muscle areas in addition to vessels. Although qPCR-based telomere length analysis in sorted populations could be limited in its sensitivity, very high frequency of CD146+ cells in UC tissue suggests that CD146 expression alone is unlikely to be sufficient to identify and purify native MSCs from the UC tissue.
Comparison of inclusive particle production in 14.6 GeV/c proton-nucleus collisions with simulation
International Nuclear Information System (INIS)
Jaffe, D.E.; Lo, K.H.; Comfort, J.R.; Sivertz, M.
2006-01-01
Inclusive charged pion, kaon, proton and deuteron production in 14.6 GeV/c proton-nucleus collisions measured by BNL experiment E802 is compared with results from the GEANT3, GEANT4 and FLUKA simulation packages. The FLUKA package is found to have the best overall agreement
Particle production in Si + A and p + A collisions at 14.6 A·GeV/c
International Nuclear Information System (INIS)
Miake, Y.
1990-01-01
Particle production (π ± , K ± , p) has been measured in both Si+A and p+A collisions at 14.6 A·GeV/c. Comparisons of m t and dn/dy distributions between p+Be, p+Au and central Si+Au collisions are discussed. 8 refs., 3 figs
Directory of Open Access Journals (Sweden)
Shirin Abdolvand
2017-06-01
Full Text Available Abstract Background: The incidence of gastric cancer is different in two sexes with ratio 2 to 1 that it is more common in men. The most important biologically reason is sexual hormones between two sexes that lead to sexual dimorphism and in turn can cause a sex bias in incidence of disease between two sexes. Recently, studies have shown that microRNA is involved in sexual dimorphism in gene expression. Given the sexual dimorphism in the incidence of gastric cancer and sex hormones response elements in the regulatory regions of miR-146a and miR-148a genes, in this study, the expression of these two genes in the stomach of healthy men and women at different age groups were compared. Materials and Methods: Using endoscopy, gastric antrum tissues of 35 healthy women and 35 healthy men were collected. After RNA extraction and synthesis of cDNA, the expression of miR-146a and miR-148a genes were compared between sexes by Real time RT-PCR and data were analyzed using independent sample t and ANOVA tests. Results: There was no difference between men and women in genes expression of miR-146a and miR-148a. However, expression of miR-146a gene was significantly more in men under 45 years than men over 45 years (p= 0.017, df= 14, t= 1.47. Also, expression of miR-148a gene was significantly more in men over 45 years than men under 45 years (p=0.001, df= 12, t= 1.28. But the expression of both genes had no significant difference between women under 45 years and women over 45 years. Conclusion: Expression of miR-146a and miR-148a genes in the stomach is increased and decreased with aging in men, respectively.
Energy Technology Data Exchange (ETDEWEB)
Essman, Stephanie C. [Department of Veterinary Medicine and Surgery, College of Veterinary Medicine, University of Missouri-Columbia, Columbia, MO 65211 (United States)], E-mail: essmans@missouri.edu; Lewis, Michael R. [Department of Veterinary Medicine and Surgery, College of Veterinary Medicine, University of Missouri-Columbia, Columbia, MO 65211 (United States); Department of Radiology, University of Missouri-Columbia, Columbia, MO 65211 (United States); Nuclear Science and Engineering Institute, University of Missouri-Columbia, Columbia, MO 65211 (United States); Research Service, Harry S. Truman Memorial Veterans' Hospital, Columbia, MO 65201 (United States); Fox, Derek B. [Department of Veterinary Medicine and Surgery, College of Veterinary Medicine, University of Missouri-Columbia, Columbia, MO 65211 (United States)
2008-02-15
Introduction: Targeted radiotherapy using samarium-153-ethylenediaminetetramethylene phosphonate ({sup 153}Sm-EDTMP) is currently under investigation for treatment of osteosarcoma. Osteosarcoma often occurs in children, and previous studies on a juvenile rabbit model demonstrated that clinically significant damage to developing physeal cartilage may occur as a result of systemic {sup 153}Sm-EDTMP therapy. The aim of this study was to evaluate the late effects of {sup 153}Sm-EDTMP on skeletal structures during growth to maturity and to determine if there is a dose response of {sup 153}Sm-EDTMP on growth of long bones. Methods: Female 8-week-old New Zealand white rabbits were divided into three treatment groups plus controls. Each rabbit was intravenously administered a predetermined dose of {sup 153}Sm-EDTMP. Multiple bones of each rabbit were radiographed every 2 months until physeal closure, with subsequent measurements made to assess for abbreviated bone growth. Statistical analyses were performed to determine the differences in bone length between groups, with significance set at P<.05. Results: Significant differences in lengths of multiple bones were detected between the high-dose group and other treatment groups and controls at each time interval. A significant difference in lengths of the tibias was also noted in the medium-treatment group, compared to controls. Mean reduction of bone length was first detected at 4 months and did not increase significantly over time. Conclusions: These data suggest that clinically significant bone shortening may occur as a result of high-dosage administration of {sup 153}Sm-EDTMP. Further investigation regarding the effects of bone-seeking radiopharmaceuticals on bone growth and physeal cartilage is warranted.
Development of frequency step tunable 1 MW gyrotron at 131 to 146.5 GHz
Energy Technology Data Exchange (ETDEWEB)
Samartsev, A.; Gantenbein, G.; Dammertz, G.; Illy, S.; Kern, S.; Leonhardt, W.; Schlaich, A.; Schmid, M.; Thumm, M., E-mail: andrey.samartsev@kit.edu [Karlsruhe Institute of Technology, Association EURATOM-KIT, Karlsruhe (Germany)
2011-07-01
Effective control of power absorption in tokamaks and stellarators could be achieved by the frequency tuning of ECH and CD power delivered by high-power gyrotrons. In this report some results of the development of a frequency tunable gyrotron with fused-silica Brewster window are presented. Excitation of several modes at 1 MW power level in the range of frequencies from 131 to 146.5 GHz is achieved. (author)
Papasavva-Stylianou, Penelope; Simmons, Marion Mathieson; Ortiz-Pelaez, Angel; Windl, Otto; Spiropoulos, John; Georgiadou, Soteria
2017-11-15
This report presents the results of experimental challenges of goats with scrapie by both the intracerebral (i.c.) and oral routes, exploring the effects of polymorphisms at codon 146 of the goat PRNP gene on resistance to disease. The results of these studies illustrate that while goats of all genotypes can be infected by i.c. challenge, the survival distribution of the animals homozygous for asparagine at codon 146 was significantly shorter than those of animals of all other genotypes (chi-square value, 10.8; P = 0.001). In contrast, only those animals homozygous for asparagine at codon 146 (NN animals) succumbed to oral challenge. The results also indicate that any cases of infection in non-NN animals can be detected by the current confirmatory test (immunohistochemistry), although successful detection with the rapid enzyme-linked immunosorbent assay (ELISA) was more variable and dependent on the polymorphism. Together with data from previous studies of goats exposed to infection in the field, these data support the previously reported observations that polymorphisms at this codon have a profound effect on susceptibility to disease. It is concluded that only animals homozygous for asparagine at codon 146 succumb to scrapie under natural conditions. IMPORTANCE In goats, like in sheep, there are PRNP polymorphisms that are associated with susceptibility or resistance to scrapie. However, in contrast to the polymorphisms in sheep, they are more numerous in goats and may be restricted to certain breeds or geographical regions. Therefore, eradication programs must be specifically designed depending on the identification of suitable polymorphisms. An initial analysis of surveillance data suggested that such a polymorphism in Cypriot goats may lie in codon 146. In this study, we demonstrate experimentally that NN animals are highly susceptible after i.c. inoculation. The presence of a D or S residue prolonged incubation periods significantly, and prions were detected
Li, Xin; Kroin, Jeffrey S; Kc, Ranjan; Gibson, Gary; Chen, Di; Corbett, Grant T; Pahan, Kalipada; Fayyaz, Sana; Kim, Jae-Sung; van Wijnen, Andre J; Suh, Joon; Kim, Su-Gwan; Im, Hee-Jeong
2013-12-01
The objective of this study was to examine whether altered expression of microRNAs in central nervous system components is pathologically linked to chronic knee joint pain in osteoarthritis. A surgical animal model for knee joint OA was generated by medial meniscus transection in rats followed by behavioral pain tests. Relationships between pathological changes in knee joint and development of chronic joint pain were examined by histology and imaging analyses. Alterations in microRNAs associated with OA-evoked pain sensation were determined in bilateral lumbar dorsal root ganglia (DRG) and the spinal dorsal horn by microRNA array followed by individual microRNA analyses. Gain- and loss-of-function studies of selected microRNAs (miR-146a and miR-183 cluster) were conducted to identify target pain mediators regulated by these selective microRNAs in glial cells. The ipsilateral hind leg displayed significantly increased hyperalgesia after 4 weeks of surgery, and sensitivity was sustained for the remainder of the 8-week experimental period (F = 341, p pain was correlated with pathological changes in the knee joints as assessed by histological and imaging analyses. MicroRNA analyses showed that miR-146a and the miR-183 cluster were markedly reduced in the sensory neurons in DRG (L4/L5) and spinal cord from animals experiencing knee joint OA pain. The downregulation of miR-146a and/or the miR-183 cluster in the central compartments (DRG and spinal cord) are closely associated with the upregulation of inflammatory pain mediators. The corroboration between decreases in these signature microRNAs and their specific target pain mediators were further confirmed by gain- and loss-of-function analyses in glia, the major cellular component of the central nervous system (CNS). MicroRNA therapy using miR-146a and the miR-183 cluster could be powerful therapeutic intervention for OA in alleviating joint pain and concomitantly regenerating peripheral knee joint cartilage. © 2013
Directory of Open Access Journals (Sweden)
Olfat Gamil Shaker
2018-05-01
Full Text Available Background/Aims: Rheumatoid arthritis (RA is a systemic autoimmune disease affecting up to 1% of the population worldwide. The aim of the present study was to investigate whether miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 polymorphisms are associated with susceptibility to RA in Egyptians and whether they influence disease severity and activity. Methods: The study was performed on 104 unrelated RA patients and 112 healthy subjects. RA patients were further subdivided into active and inactive RA groups. Polymorphisms were genotyped by using real-time polymerase chain reaction with TaqMan allelic discrimination assay. Results: Significant differences in the frequency of miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 alleles and genotypes were observed between RA patients and controls. Only CA and AA genotypes of IRAK1 rs3027898 shows a significant difference between active and inactive subgroups. MiRNA-146a rs2910164 and IRAK1 rs3027898 polymorphisms were a risk factor for predisposition to RA in codominant and dominant tested inheritance models, while, the miRNA-499 rs3746444 and PADI4 rs1748033 polymorphisms were a risk factor in codominant and recessive one. CG and GG genotypes of miRNA-146a rs2910164 were associated with positive erosions. CA genotype of IRAK1 rs3027898 was associated with low disease activity and negative erosions, while, the AA genotype was associated with high disease activity. CC genotype of PADI4 rs1748033 was associated with negative rheumatoid factor. Conclusion: The 4 studied SNPs were likely to play an important role in the susceptibility to RA and can influence disease severity and activity in Egyptian population.
Zhao, Haiyan; Su, Wuyun; Kang, Qingmei; Xing, Ze; Lin, Xue; Wu, Zhongjun
2018-01-01
Natural killer (NK) cells have exhibited promising efficacy in inhibiting cancer growth. We aimed to explorer the effect of NK cells on oxaliplatin-resistant colorectal cancer and the underlying molecular mechanism. Oxaliplatin-resistant colorectal cancer cell lines were co-cultured with NK cells to evaluate the effect on viability, proliferation, migration and invasion in vitro . Oxaliplatin-resistant colorectal cancer cells were also co-injected with NK cells into mice to establish xenograft tumor model, to assess the in vivo effect of NK cells on tumorigenesis of the oxaliplatin-resistant colorectal cancer cells. Expression of WBSCR22 gene was assessed in the oxaliplatin-resistant colorectal cancer cells following NK cell treatment to elucidate the mechanism. NK cell treatment significantly reduces growth of oxaliplatin-resistant colorectal cancer cells both in vitro and in vivo , as well as reduced WBSCR22 expression. MicroRNAs potentially targeting WBSCR22 were analyzed, and microRNA-146b-5p was found to be significantly upregulated following NK cell treatment. MicroRNA-146b-5p directly targeted WBSCR22 mRNA 3'-UTR to inhibit its expression, which was required for NK cell-induced inhibition of oxaliplatin-resistant colorectal cancer cell lines. NK cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p, both of which could serve as candidates for targeted therapy against oxaliplatin-resistant colorectal cancer.
Vouraki, Sotiria; Gelasakis, Athanasios I; Alexandri, Panoraia; Boukouvala, Evridiki; Ekateriniadou, Loukia V; Banos, Georgios; Arsenos, Georgios
2018-01-01
Polymorphisms at PRNP gene locus have been associated with resistance against classical scrapie in goats. Genetic selection on this gene within appropriate breeding programs may contribute to the control of the disease. The present study characterized the genetic profile of codons 146, 211 and 222 in three dairy goat breeds in Greece. A total of 766 dairy goats from seven farms were used. Animals belonged to two indigenous Greek, Eghoria (n = 264) and Skopelos (n = 287) and a foreign breed, Damascus (n = 215). Genomic DNA was extracted from blood samples from individual animals. Polymorphisms were detected in these codons using Real-Time PCR analysis and four different Custom TaqMan® SNP Genotyping Assays. Genotypic, allelic and haplotypic frequencies were calculated based on individual animal genotypes. Chi-square tests were used to examine Hardy-Weinberg equilibrium state and compare genotypic distribution across breeds. Genetic distances among the three breeds, and between these and 30 breeds reared in other countries were estimated based on haplotypic frequencies using fixation index FST with Arlequin v3.1 software; a Neighbor-Joining tree was created using PHYLIP package v3.695. Level of statistical significance was set at P = 0.01. All scrapie resistance-associated alleles (146S, 146D, 211Q and 222K) were detected in the studied population. Significant frequency differences were observed between the indigenous Greek and Damascus breeds. Alleles 222K and 146S had the highest frequency in the two indigenous and the Damascus breed, respectively (ca. 6.0%). The studied breeds shared similar haplotypic frequencies with most South Italian and Turkish breeds but differed significantly from North-Western European, Far East and some USA goat breeds. Results suggest there is adequate variation in the PRNP gene locus to support breeding programs for enhanced scrapie resistance in goats reared in Greece. Genetic comparisons among goat breeds indicate that separate
40 CFR 264.146 - Use of a mechanism for financial assurance of both closure and post-closure care.
2010-07-01
... facilities by using a trust fund, surety bond, letter of credit, insurance, financial test, or corporate... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Use of a mechanism for financial... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Financial Requirements § 264.146 Use of a...
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Verhoef, J C; Ponec, M
1999-01-01
The aim of the present study was to characterize the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability of test substances with different molecular weights (M(w)). For this purpose, the apparent permeability (P(app)) values for mannitol...... and for fluorescein isothiocyanate (FITC)-labelled dextrans (FD) with various M(w) (4000-40000) were compared to the P(app) values obtained using porcine buccal mucosa as an in vitro model of the human buccal epithelium. The effect of 10 mM sodium glycocholate (GC) on the P(app) values was examined. To identify...
Directory of Open Access Journals (Sweden)
Elina Simanovich
2018-01-01
Full Text Available Tumors survive and progress by evading killing mechanisms of the immune system, and by generating a tumor microenvironment (TME that reprograms macrophages in situ to produce factors that support tumor growth, angiogenesis, and metastasis. We have previously shown that by blocking the translation of the enzyme inducible nitric oxide synthase (iNOS, miR-146a-5p inhibits nitric oxide (NO production in a mouse renal carcinoma cell line (RENCA, thereby endowing RENCA cells with resistance to macrophage-induced cell death. Here, we expand these findings to the mouse colon carcinoma CT26 cell line and demonstrate that neutralizing miR-146a-5p’s activity by transfecting both RENCA and CT26 cells with its antagomir restored iNOS expression and NO production and enhanced susceptibility to macrophage-induced cell death (by 48 and 25%, respectively, p < 0.001. Moreover, miR-146a-5p suppression simultaneously inhibited the expression of the pro-angiogenic protein EMMPRIN (threefolds, p < 0.001, leading to reduced MMP-9 and vascular endothelial growth factor secretion (twofolds and threefolds, respectively, p < 0.05, and reduced angiogenesis, as estimated by in vitro tube formation and scratch assays. When we injected tumors with pro-inflammatory-stimulated RAW 264.7 macrophages together with i.v. injection of the miR-146a-5p antagomir, we found inhibited tumor growth (sixfolds, p < 0.001 and angiogenesis (twofolds, p < 0.01, and increased apoptosis (twofolds, p < 0.01. This combination therapy increased nitrites and reduced TGFβ concentrations in tumor lysates, alleviated immune suppression, and allowed enhanced infiltration of cytotoxic CD8+ T cells. Thus, miR-146a-5p functions as a control switch between angiogenesis and cell death, and its neutralization can manipulate the crosstalk between tumor cells and macrophages and profoundly change the TME. This strategy can be therapeutically utilized in combination with the macrophage
International Nuclear Information System (INIS)
Qiu, Hongxu; Yan, Hong; Hu, Zhi
2013-01-01
Highlights: •Sm affected the secondary dendrite arm spacing of Al–7Si–0.7Mg alloy. •The coarse plate-like eutectic silicon was fully modified into a fine branched and particle structure when 0.6 wt.% Sm added. •The tensile properties were enhanced by the addition of Sm. •Sm has marked effects on eutectic temperature and the latent heat ΔH R on remelting behavior. •The morphology and chemical composition of Sm-rich intermetallics were studied. -- Abstract: The effects of samarium (Sm) additions (0–0.9 wt.%) on the microstructures and mechanical properties of Al–7Si–0.7Mg alloys have been studied in this article. The microstructures of the as-cast samples were examined by optical microscopy (OM) and scanning electron microscopy (SEM). The experimental results indicated that the rare earth Sm affected the secondary dendrite arm spacing (SDAS) of Al–7Si–0.7Mg alloy. And it was found that Sm had great modification effects on the microstructures of eutectic silicon. When 0.6 wt.% Sm was added to the alloy, the coarse plate-like eutectic silicon was fully modified into a fine fibrous structure; the dendrites of Al–7Si–0.7Mg alloy was best refined. The mechanical properties were investigated by tensile test. The findings indicate that the tensile properties and elongation were improved by the addition of Sm. And a good combination of ultimate tensile strength (215 MPa) and elongation (3.3%) was obtained when the Sm addition was up to 0.6 wt.%. Furthermore the results of thermal analysis reveal that Sm addition had marked effects on eutectic temperature and the latent heat ΔH R on remelting behavior
International Nuclear Information System (INIS)
Stan, L; Holesinger, T G; Maiorov, B; Feldmann, D M; Usov, I O; DePaula, R F; Civale, L; Foltyn, S R; Jia, Q X; Chen, Y; Selvamanickam, V
2008-01-01
Textured samarium zirconate (SZO) films have been grown by reactive cosputtering directly on an ion beam assisted deposited (IBAD) MgO template, without an intermediate homoepitaxial MgO layer. The subsequent growth of 0.9 μm thick (Y,Gd)Ba 2 Cu 3 O 7-δ ((Y, Gd)BCO) films by metal organic chemical vapor deposition (MOCVD) yielded well textured films with a full width at half maximum of 1.9 0 and 3.4 0 for the out-of-plane and in-plane texture, respectively. Microstructural characterizations of the SZO buffered samples revealed clean interfaces. This indicates that the SZO not only provides a diffusion barrier, but also functions as a buffer for (Y, Gd)BCO grown by MOCVD. The achievement of self-field critical current densities (J c ) of over 2 MA cm -2 at 75.5 K is another proof of the effectiveness of SZO as a buffer on the IBAD-MgO template. The in-field measurements revealed an asymmetric angular dependence of J c and a shift of the ab-plane maxima due to the tilted nature of the template and (Y,Gd) 2 O 3 particles existing in the (Y, Gd)BCO matrix. The present results are especially important because they demonstrate that high temperature superconducting coated conductors with simpler architecture can be fabricated using commercially viable processes
Yang, Wei; Yu, Hongquan; Shen, Yueming; Liu, Yingying; Yang, Zhanshan; Sun, Ting
2016-01-01
A stem-like subpopulation existed in GBM cells, called glioma stem cells (GSCs), might contribute to cancer invasion, angiogenesis, immune evasion, and therapeutic resistance, providing a rationale to eliminate GSCs population and their supporting niche for successful GBM treatment. LincRNA-p21, a novel regulator of cell proliferation, apoptosis and DNA damage response, is found to be downregulated in several types of tumor. However, little is known about the role of lincRNA-p21 in stemness and radioresistance of GSCs and its regulating mechanisms. In this study, we found that lincRNA-p21 negatively regulated the expression and activity of β-catenin in GSCs. Downregulation of lincRNA-p21 in GSCs was resulted from upregulation of Hu antigen R (HuR) expression caused by miR-146b-5p downregulation. MiR-146b-5p overexpression increased apoptosis and radiosensitivity, decreased cell viability, neurosphere formation capacity and stem cell marker expression, and induced differentiation in GSCs. Moreover, knock-down lincRNA-p21 or HuR and β-catenin overexpression could rescue the phenotypic changes resulted from miR-146b-5p overexpression in GSCs. These findings suggest that targeting the miR-146b-5p/HuR/lincRNA-p21/β-catenin signaling pathway may be valuable therapeutic strategies against glioma. PMID:27166258
Sorption of samarium in soils: influence of soil properties and Sm concentration
Energy Technology Data Exchange (ETDEWEB)
Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)
2014-07-01
Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous
Multi-element analysis of crude-oil samples by 14.6 MeV neutron activation
International Nuclear Information System (INIS)
Cam, N.F.; Cigeroglu, F.; Erduran, M.N.
1997-01-01
The instrumental neutron activation technique, using the SAMEST T-400 neutron generator with 14.6 MeV neutrons produced from 3 H(d,n) 4 He reaction, is demonstrated for multi-element analysis of Saudi-Arabian crude-oil samples. The system parameters for the absolute method (e.g., the counting solid-angle, intrinsic efficiency of the γ-ray detector, effective neutron flux, activation cross sections, etc.)were determined and the results of elemental concentrations were presented with the corrections for all possible interferences having been carefully considered. (author)
Analysis of pion production data from E-802 at 14.6 GeV/c using ARC
International Nuclear Information System (INIS)
Kahana, D.; Torun, Yagmur
1995-07-01
We compared the invariant cross sections for pion production by a 14.6 GeV/c proton beam on Be, Al, Cu and Au targets from the measurements of Abbott et.al. with predictions of the ARC program. The agreement was found to be good in the region where data exists. Most pions are found at low momenta in the lab frame. Unfortunately very little data exists for low momentum pions
International Nuclear Information System (INIS)
Kanaji, Mariko; Sato, Haruo; Sasahira, Akira
1999-10-01
Organic acids in groundwater are considered to form complexes and increase the solubility of radionuclides released from vitrified waste in a high-level radioactive waste (HLW) repository. To investigate whether the solubility of samarium (Sm) is influenced by organic substances, we measured Sm solubility in the presence of different organic substances and compared those values with results from thermodynamic predictions. Humic acid (Aldrich) is commercially available and soluble organic matter originated from bentonite were used as organic substances in this study. Consequently, the solubility of Sm showed a tendency to apparently increase with increasing the concentration of humic acid, but in the presence of carbonate, thermodynamic predictions suggested that the dominant species are carbonate complexes and that the effect of organic substances are less than that of carbonate. Based on total organic carbon (TOC), the increase of Sm solubility measured with humic acid (Aldrich) was more significant than that in the case with soluble organic matter originated from bentonite. Since bentonite is presumed to include also simple organic matters of which stability constant for forming complexes is low, the effect of soluble organic matter originated from bentonite on the solubility of Sm is considered to be less effective than that of humic acid (Aldrich). Experimental values were compared with model prediction, proposed by Kim, based on data measured in a low pH region. Tentatively we calculated the increase in Sm solubility assuming complexation with humic acid. Trial calculations were carried out on the premise that the complexation reaction of metal ion with humic acid is based on neutralization process by 1-1 complexation. In this process, it was assumed that one metal ion coordinates with one unit of complexation sites which number of proton exchange sites is equal to ionic charge. Consequently, Kim's model indicated that carbonate complexes should be dominant
2010-04-01
... subsidiary, affiliate, or joint venture have on financial accountability to HUD and the Federal government... URBAN DEVELOPMENT PUBLIC HOUSING AGENCY CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.146 What impact does the use of a subsidiary, affiliate, or joint venture...
Study of intermittency of target fragments in the interactions of 28Si-Em collisions at 14.6 A GeV
International Nuclear Information System (INIS)
Ayaz Ahmad, M.; Ashraf T, M.; Ahmad, Shafiq
2008-01-01
An attempt has been made to investigate the intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles from 28 Si-emulsion interactions at 14.6 A GeV using nuclear emulsion in cosθ phase space
MiR-146a rs2910164 polymorphism increases the risk of digestive system cancer: A meta-analysis.
Xie, Wen Qun; Wang, Xiao Fan
2017-02-01
There is merging evidence suggesting that the miR-146a polymorphism might be associated with susceptibility to digestive system cancer. However, previous published studies have failed to achieve a definitive conclusion. To address this issue, an updated meta-analysis was performed. A comprehensive electronic search was conducted using the following source to identify the eligible studies: PubMed, Embase, China BioMedicine, the Cochrane Library, and Google Scholar. Odds ratios and its corresponding 95% confidence interval (CI) was used in the quantitative synthesis. The database search identified 1344 eligible studies, of which 32 (comprising 12,541 cases and 15,925 controls) were included. The results indicate that the miR-146a rs2910164 polymorphism was significantly associated with increased risk of digestive system cancer in heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.30, P=0.02), and recessive model (GG vs. GC+CC: OR=1.11, 95% CI: 1.04-1.17, P=0.006). Subgroup analysis by cancer site revealed increased risk in gastric cancer above heterozygote comparison (GG vs. GC: OR=1.13, 95% CI: 1.02-1.25, P=0.02), and recessive model (GG vs. GC+CC: OR=1.15, 95% CI: 1.04-1.26, P=0.006). Similarly, increased cancer risk was observed in hepatocellular carcinoma when compared with homozygote comparison (GG vs. CC: OR=1.21, 95% CI: 1.04-1.42, P=0.02), heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.29, P=0.02), and dominant model (GG+GC vs. CC: OR=1.16, 95% CI: 1.04-1.29, P=0.009). When stratified by ethnicity and quality score, increased cancer risks were also observed among Asians, Caucasians and high quality studies subgroup. The current study revealed that miR-146a G/C genetic polymorphism was more likely to be associated with digestive system cancer risk. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Vicente, Cláudia S L; Nascimento, Francisco X; Barbosa, Pedro; Ke, Huei-Mien; Tsai, Isheng J; Hirao, Tomonori; Cock, Peter J A; Kikuchi, Taisei; Hasegawa, Koichi; Mota, Manuel
2016-10-01
Pine wilt disease (PWD) results from the interaction of three elements: the pathogenic nematode, Bursaphelenchus xylophilus; the insect-vector, Monochamus sp.; and the host tree, mostly Pinus species. Bacteria isolated from B. xylophilus may be a fourth element in this complex disease. However, the precise role of bacteria in this interaction is unclear as both plant-beneficial and as plant-pathogenic bacteria may be associated with PWD. Using whole genome sequencing and phenotypic characterization, we were able to investigate in more detail the genetic repertoire of Serratia marcescens PWN146, a bacterium associated with B. xylophilus. We show clear evidence that S. marcescens PWN146 is able to withstand and colonize the plant environment, without having any deleterious effects towards a susceptible host (Pinus thunbergii), B. xylophilus nor to the nematode model C. elegans. This bacterium is able to tolerate growth in presence of xenobiotic/organic compounds, and use phenylacetic acid as carbon source. Furthermore, we present a detailed list of S. marcescens PWN146 potentials to interfere with plant metabolism via hormonal pathways and/or nutritional acquisition, and to be competitive against other bacteria and/or fungi in terms of resource acquisition or production of antimicrobial compounds. Further investigation is required to understand the role of bacteria in PWD. We have now reinforced the theory that B. xylophilus-associated bacteria may have a plant origin.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Shenlin; Hu, Qianglin [College of Mathematics and Physics, Jinggangshan University, Jian (China); Zhang, Jiuxing; Liu, Danmin [Key Laboratory of Advanced Functional Materials, Ministry of Education, College of Materials Science and Engineering, Beijing University of Technology, Beijing (China); Huang, Qingzhen [NIST Center for Neutron Research, National Institute of Standards and Technology, MD (United States)
2014-03-15
Single-phase polycrystalline solid solutions (La{sub 1-x}Sm{sub x})B{sub 6} (x = 0, 0.2, 0.4, 0.8, 1) are fabricated by spark plasma sintering (SPS). This study demonstrates a systematic investigation of structure-property relationships in Sm-doped LaB{sub 6} ternary rare-earth hexaborides. The microstructure, crystallographic orientation, electrical resistivity, and thermionic emission performance of these compounds are investigated. Analysis of the results indicates that samarium (Sm) doping has a noticeable effect on the structure and performance of lanthanum hexaboride (LaB{sub 6}). The analytical investigation of the electron backscatter diffraction confirms that (La{sub 0.6}Sm{sub 0.4})B{sub 6} exhibits a clear (001) texture that results in a low work function. Work functions are determined by pulsed thermionic diode measurements at 1500-1873 K. The (La{sub 0.6}Sm{sub 0.4})B{sub 6} possesses improved thermionic emission properties compared to LaB{sub 6}. The current density of (La{sub 0.6}Sm{sub 0.4})B{sub 6} is 42.4 A cm{sup -2} at 1873 K, which is 17.5% larger than that of LaB{sub 6}. The values of Φ{sub R} for (La{sub 0.6}Sm{sub 0.4})B{sub 6} and LaB{sub 6} are 1.98 ± 0.03 and 1.67 ± 0.03 eV, respectively. Furthermore, the Sm substitution of lanthanum (La) effectively increases the electrical resistivity. These results reveal that Sm doping lead to significantly enhanced thermionic emission properties of LaB{sub 6}. The compound (La{sub 0.6}Sm{sub 0.4})B{sub 6} appears most promising as a future emitter material. (copyright 2014 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Kabel, M.A.; Heijnis, W.H.; Bakx, E.J.; Kuijpers, I.J.; Voragen, A.G.J.; Schols, H.A.
2006-01-01
Various plant polysaccharide derived mono- and oligosaccharides were derivatized with the fluorescent 9-aminopyrene-1,4,6-trisulfonate (APTS) and subjected to capillary electrophoresis (CE) in combination with laser induced fluorescence (LIF) detection. CE-LIF was suitable for mol-based
Study of reaction mechanisms in 40Ar+68Zn interaction at 14.6 and 27.6 MeV/N
International Nuclear Information System (INIS)
Rami, F.
1985-01-01
The competing mechanisms in the 40 Ar+ 68 Zn reaction have been investigated at two bombarding energies: 14.6 and 27.6 MeV/nucleon. Mass, charge and energy spectra of the reaction products have been measured in a large angular range (3 0 0 ). The results show that important changes occur in this energy region. At 14.6 MeV/nucleon the production of the projectile-like fragments results mainly from deep inelastic and direct nucleon transfer reactions; while at 27.6 MeV/nucleon a strong component corresponding to process similar to projectile fragmentation is also observed. A distinction between the fragmentation process and direct transfer of few nucleons has been possible by analysing the linear momentum distributions of the detected fragments. The energy dependance of the fusion cross section indicates that this process should disappear for incident energies E/A > approximately 30 MeV/nucleon. The maximum temperature reached by the compound nucleus has been deduced i.e. Tmax approximately equal 7 MeV; this value is in agreement with recent theoretical predictions [fr
Aneurysm-Specific miR-221 and miR-146a Participates in Human Thoracic and Abdominal Aortic Aneurysms
Directory of Open Access Journals (Sweden)
Premakumari Venkatesh
2017-04-01
Full Text Available Altered microRNA expression is implicated in cardiovascular diseases. Our objective was to determine microRNA signatures in thoracic aortic aneurysms (TAAs and abdominal aortic aneurysms (AAAs compared with control non-aneurysmal aortic specimens. We evaluated the expression of fifteen selected microRNA in human TAA and AAA operative specimens compared to controls. We observed significant upregulation of miR-221 and downregulation of miR-1 and -133 in TAA specimens. In contrast, upregulation of miR-146a and downregulation of miR-145 and -331-3p were found only for AAA specimens. Upregulation of miR-126 and -486-5p and downregulation of miR-30c-2*, -155, and -204 were observed in specimens of TAAs and AAAs. The data reveal microRNA expression signatures unique to aneurysm location and common to both thoracic and abdominal pathologies. Thus, changes in miR-1, -29a, -133a, and -221 are involved in TAAs and miR-145, -146, and -331-3p impact AAAs. This work validates prior studies on microRNA expression in aneurysmal diseases.
López-Lozano, Xóchitl; Plascencia-Villa, G; Calero, G; Whetten, R L; Weissker, Hans-Christian
2017-12-07
The new water-soluble gold cluster Au 146 (p-MBA) 57 , the structure of which has been recently determined at sub-atomic resolution by Vergara et al., is the largest aqueous gold cluster ever structurally determined and likewise the smallest cluster with a stacking fault. The core presents a twinned truncated octahedron, while additional peripheral gold atoms follow a C 2 rotational symmetry. According to the usual counting rules of the superatom complex (SAC) model, the compound attains a number of 92 SAC electrons if the overall net charge is 3- (three additional electrons). As this is the number of electrons required for a major shell closing, the question arises of whether Au 146 (p-MBA) 57 should be regarded as a superatom complex. Starting from the experimental coordinates we have analyzed the structure using density-functional theory. The optimized (relaxed) structure retains all the connectivity of the experimental coordinates, while removing much of its irregularities in interatomic distances, thereby enhancing the C 2 -symmetry feature. On analyzing the angular-momentum-projected states, we show that, despite a small gap, the electronic structure does not exhibit SAC model character. In addition, optical absorption spectra are found to be relatively smooth compared to the example of the Au 144 (SR) 60 cluster. The Au 146 (SR) 57 does not derive its stability from SAC character; it cannot be considered as a superatom complex.
sup 8 sup 9 Sr and sup 1 sup 5 sup 3 Sm-EDTMP therapy of disseminated skeletal metastasis
Zhang Jun Ning; Zhu Shou Peng
2001-01-01
A retrospective analysis was performed on 72 patients with disseminated skeletal metastasis to evaluate the effect of strontium-89 or samarium-153 EDTMP therapy. There existed 87.88% of clinical response, 12.12% of no response in the group treated with strontium-89 as compared with 90.24% of clinical response, 9.76% no response in one treated with samarium-153 EDTMP; and there were no correlation between the treatment results and the amounts of isotopes administrated. The results suggest that strontium-89 or samarium-153 EDTMP therapy is a method of first choice in the palliative treatment for disseminated skeletal metastasis
89Sr and 153Sm-EDTMP therapy of disseminated skeletal metastasis
International Nuclear Information System (INIS)
Zhang Junning; Hong Chengjiao; Zhu Shoupeng
2001-01-01
A retrospective analysis was performed on 72 patients with disseminated skeletal metastasis to evaluate the effect of strontium-89 or samarium-153 EDTMP therapy. There existed 87.88% of clinical response, 12.12% of no response in the group treated with strontium-89 as compared with 90.24% of clinical response, 9.76% no response in one treated with samarium-153 EDTMP; and there were no correlation between the treatment results and the amounts of isotopes administrated. The results suggest that strontium-89 or samarium-153 EDTMP therapy is a method of first choice in the palliative treatment for disseminated skeletal metastasis
{sup 89}Sr and {sup 153}Sm-EDTMP therapy of disseminated skeletal metastasis
Energy Technology Data Exchange (ETDEWEB)
Junning, Zhang; Chengjiao, Hong; Shoupeng, Zhu [Suzhou Univ., Suzhou (China)
2001-07-01
A retrospective analysis was performed on 72 patients with disseminated skeletal metastasis to evaluate the effect of strontium-89 or samarium-153 EDTMP therapy. There existed 87.88% of clinical response, 12.12% of no response in the group treated with strontium-89 as compared with 90.24% of clinical response, 9.76% no response in one treated with samarium-153 EDTMP; and there were no correlation between the treatment results and the amounts of isotopes administrated. The results suggest that strontium-89 or samarium-153 EDTMP therapy is a method of first choice in the palliative treatment for disseminated skeletal metastasis.
International Nuclear Information System (INIS)
Boneva, S.T.; Khitrov, V.A.; Sukhovoj, A.M.; Vojnov, A.V.
1990-01-01
Intensities of two-quanta cascades are obtained for 2-3 final low-lying levels of the following nuclei 146 Nd, 174 Yb and 183 W. These measured intensities are compared with the intensities calculated in the frame of various models at primary transition energies ranging from 0.5 MeV to the neutron binding energy. Some excitation energy intervals are revealed, experimentally obtained intensities of cascade are inconsistent with model calculations. 15 refs.; 7 figs
Global observables in Si + nucleus collisions at 14.6 GeV per nucleon
International Nuclear Information System (INIS)
Shivakumar, B.; Greene, S.V.; Hemmick, T.K.; Majka, R.; Mitchell, J.T.; Rotondo, F.; Sandweiss, J.; Barrette, J.; Mark, S.K.; Pruneau, C.; Bellwied, R.; Braun-Munzinger, P.; David, G.; Herrmann, N.; Ingold, G.; Llope, W.J.; Muthuswamy, M.; Stachel, J.; Waters, L.; Cleland, W.E.; Jayananda, K.; Kraus, D.; Sonnadara, U.; Fatyga, M.; Hogue, R.W.; Lissauer, D.; Ludlam, T.; Makowiecki, D.; O'Brien, E.; Polychronakos, V.; Takai, H.; Throwe, T.; Woody, C.; Fox, D.; Sunier, J.; Van Hecke, H.; Hall, J.; Wolfe, D.; Heifetz, R.; Rawool-Sullivan, M.; Simon, J.; Sullivan, J.P.; Wolf, K.
1990-01-01
A simultaneous determination of the transverse energy produced, and the multiplicity of beam rapidity nucleons surviving nucleus interactions provides an effective way to quantify the extent of stopping achieved therein. The authors have studied collisions between 28 Si projectiles with energies E lab /A = 14.6 GeV and targets of Al, Cu, and Pb. Transverse energy production has been measured calorimetrically in a pseudorapidity interval -0.5 < η < 0.8, and correlated with the multiplicity of beam rapidity protons and neutrons detected in a 0.8 degree cone centered on the beam direction. Theoretical calculations have been performed to describe the data, and demonstrate quantitatively the large amount of nuclear stopping in these collisions. They also indicate the importance of rescattering in the production of transverse energy
Results of the radiological survey at 146 W. Central Avenue, Maywood, New Jersey (MJ034)
International Nuclear Information System (INIS)
Foley, R.D.; Carrier, R.F.
1989-11-01
Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and reining of thorium and thorium compounds from monazite ores from 1916 to 1956. MCW supplied rare earth metals and thorium compounds to the Atomic Energy Commission and various other government agencies from the late 1940s to the mid-1950s. Area residents used the sandlike waste from this thorium extraction process mixed with tea and cocoa leaves as mulch in their yards. Some of these contaminated wastes were also eroded from the site into Lodi Brook. At the request of the US Department of Energy (DOE), a group from OaK Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. These surveys typically include direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, a private property at 146 West Central Avenue, Maywood, New Jersey (MJ034), was conducted during 1987 and 1988. While some measurements at this property were greater than background levels typically encountered in the New jersey area, no radiation levels nor radionuclide concentrations exceeded the guidelines established by the DOE for the Maywood, New Jersey, area remedial action plan. However, because of the proximity of the railroad property, which will be remediated, and the DOE's ALARA (As Low As Reasonably Achievable) policy, concurrent removal of the slightly elevated soil layers at 146 W. Central Avenue may be justified. 6 refs., 6 figs., 3 tabs
Harrison, Stephanie R; Scambler, Thomas; Oubussad, Lylia; Wong, Chi; Wittmann, Miriam; McDermott, Michael F; Savic, Sinisa
2018-01-01
Tumor necrosis factor (TNF)-receptor-associated periodic fever syndrome (TRAPS) is a rare monogenic autoinflammatory disorder characterized by mutations in the TNFRSF1A gene, causing TNF-receptor 1 (TNFR1) misfolding, increased cellular stress, activation of the unfolded protein response (UPR), and hyperresponsiveness to lipopolysaccharide (LPS). Both microRNA (miR)-146a and miR-155 provide negative feedback for LPS-toll-like receptor 2/4 signaling and cytokine production, through regulation of nuclear factor kappa B (NF-κB). In this study, we hypothesized that proinflammatory cytokine signaling in TRAPS downregulates these two miRs, resulting in LPS-induced hyperresponsiveness in TRAPS dermal fibroblasts (DFs), irrespective of the underlying genetic mutation. Primary DF were isolated from skin biopsies of TRAPS patients and healthy controls (HC). TNFR1 cell surface expression was measured using immunofluorescence. DF were stimulated with LPS, interleukin (IL)-1β, thapsigargin, or TNF, with and without inositol-requiring enzyme 1 (IRE1) inhibitor (4u8C), following which miR-146a and miR-155 expression was measured by RT-qPCR. IL-1β, IL-6, and TNF secretion was measured by enzyme-linked immunosorbent assays, and baseline expression of 384 different miRs was assessed using microfluidics assays. TNFR1 was found to be expressed on the surface of HC DF but expression was deficient in all samples with TRAPS-associated mutations. HC DF showed significant dose-dependent increases in both miR-146a and miR-155 expression levels in response to LPS; however, TRAPS DF failed to upregulate either miR-146a or miR-155 under the same conditions. This lack of miR-146a and miR-155 upregulation was associated with increased proinflammatory cytokine production in TRAPS DF in response to LPS challenge, which was abrogated by 4u8C. Incubation of HC DF with IL-1β led to downregulation of miR-146a and miR-155 expression, which was dependent on IRE1 enzyme. We observed global
Wang, Rubing; Zhang, Xiaojie; Chen, Chengsheng; Chen, Guanglin; Sarabia, Cristian; Zhang, Qiang; Zheng, Shilong; Wang, Guangdi; Chen, Qiao-Hong
2017-06-16
To systematically investigate the structure-activity relationships of 1,7-diheteroarylhepta-1,4,6-trien-3-ones in three human prostate cancer cell models and one human prostate non-neoplastic epithelial cell model, thirty five 1,7-diarylhepta-1,4,6-trien-3-ones with different terminal heteroaromatic rings have been designed for evaluation of their anti-proliferative potency in vitro. These target compounds have been successfully synthesized through two sequential Horner-Wadsworth-Emmons reactions starting from the appropriate aldehydes and tetraethyl (2-oxopropane-1,3-diyl)bis(phosphonate). Their anti-proliferative potency against PC-3, DU-145 and LNCaP human prostate cancer cell lines can be significantly enhanced by the manipulation of the terminal heteroaromatic rings, further demonstrating the utility of 1,7-diarylhepta-1,4,6-trien-3-one as a potential scaffold for the development of anti-prostate cancer agents. The optimal analog 40 is 82-, 67-, and 39-fold more potent than curcumin toward the three prostate cancer cell lines, respectively. The experimental data also reveal that the trienones with two different terminal aromatic rings possess greater potency toward three prostate cancer cell lines, but also have greater capability of suppressing the proliferation of PWR-1E benign human prostate epithelial cells, as compared to the corresponding counterparts with two identical terminal rings and curcumin. The terminal aromatic rings also affect the cell apoptosis perturbation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Hocaoglu-Emre, F Sinem; Saribal, Devrim; Yenmis, Guven; Guvenen, Guvenc
2017-03-01
Type 2 diabetes mellitus (T2DM) is a multisystemic, chronic disease accompanied by microvascular complications involving various complicated mechanisms. Intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and cluster of differentiation-146 (CD146) are mainly expressed by endothelial cells, and facilitate the adhesion and transmigration of immune cells, leading to inflammation. In the present study, we evaluated the levels of soluble adhesion molecules in patients with microvascular complications of T2DM. Serum and whole blood samples were collected from 58 T2DM patients with microvascular complications and 20 age-matched healthy subjects. Levels of soluble ICAM-1 (sICAM-1) and soluble VCAM-1 (sVCAM-1) were assessed using enzyme-linked immunosorbent assay, while flow cytometry was used to determine CD146 levels. Serum sICAM-1 levels were lower in T2DM patients with microvascular complications than in healthy controls (Pmolecule levels were not correlated with the complication type. In the study group, most of the patients were on insulin therapy (76%), and 95% of them were receiving angiotensin-converting enzyme (ACE)-inhibitor agents. Insulin and ACE-inhibitors have been shown to decrease soluble adhesion molecule levels via various mechanisms, so we suggest that the decreased or unchanged levels of soluble forms of cellular adhesion molecules in our study group may have resulted from insulin and ACE-inhibitor therapy, as well as tissue-localized inflammation in patients with T2DM. Copyright © 2017 Korean Endocrine Society
Directory of Open Access Journals (Sweden)
Wan Peng
2018-02-01
Full Text Available Interferon gamma (IFNγ is a Th1 cytokine that is critical for innate and adaptive immunity. Toll-like receptors (TLRs signaling pathways are critical in early host defense against invading pathogens. miR-146a has been reported to participate in the regulation of host immunity. The known mechanisms of integrations between the IFNγ and TLR signaling pathways are incompletely understood, especially in teleosts. In this study, orange-spotted grouper (Epinephelus coioides IFNγ1 and IFNγ2, their biological activities, especially their involvements in TLR pathway, were explored. We identified and cloned two IFNγ genes of E. coioides, namely EcIFNγ1 and EcIFNγ2. The produced recombinant E. coioides IFNγ1 (rEcIFNγ1 and IFNγ2 (rEcIFNγ2 proteins showed functions, which are similar to those of other bony fishes, such as enhancing nitric oxide responses and respiratory burst response. rEcIFNγ2 could regulate TLR pathway by enhancing the promoter activity of miR-146a upstream sequence and thus increasing the expression level of miR-146a, which possibly targets TNF receptor-associated factor 6 (TRAF6, a key adapter molecule in TLR signaling pathway. Taken together, these findings unravel a novel regulatory mechanism of anti-inflammatory response by IFNγ2, which could mediate TLR pathway through IFNγ2–miR-146a–TRAF6 negative regulation loop. It is suggested that IFNγ2 may provide a promising therapeutic, which may help to fine tune the immune response.
Stable isotope tracer marking of individual boll weevils
International Nuclear Information System (INIS)
James, W.D.; Showler, A.T.; Armstrong, J.S.; Westbrook, J.K.
2006-01-01
Stable isotope markers have been used to study animal nutrition for several decades and more recently to study the foraging and cultural habits of imported fire ants. In this work, we have extended that effort to evaluate the potential for marking boll weevils, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), with the rare earth element samarium to aid in studies of insect invasion and pest eradication protocols. Neutron activation analysis (NAA) was performed on the marked boll weevils as well as plant material from the cotton squares on which the insects were fed. Samarium levels in non-dosed insects average about 20 ng/g or about 100 pg total element per insect. Our computed average determination limit was 36 pg samarium/weevil. The determination limit for cotton plant squares and leaves averaged 3.5 ng/g and 8.2 ng/g, respectively. These initial results indicate the NAA method is capable of identifying individual marked insects which have assimilated 1 ng of samarium, a ten-fold increase in content over average blank values. (author)
Hyperfine structure and isotope shift of the neutron-rich barium isotopes 139-146Ba and 148Ba
International Nuclear Information System (INIS)
Wendt, K.; Ahmad, S.A.; Klempt, W.; Neugart, R.; Otten, E.W.
1988-01-01
The hyperfine structure and isotope shift in the 6s 2 S 1/2 -6p 2 P 3/2 line of Ba II (455.4 nm) have been measured by collinear fast-beam laser spectroscopy for the neutron-rich isotopes 139-146 Ba and 148 Ba. Nuclear moments and mean square charge radii of these isotopes have been recalculated. The isotope shift of the isotope 148 Ba (T 1/2 = 0.64 s) could be studied for the first time, yielding δ 2 > 138,148 = 1.245(3) fm 2 . (orig.)
Bose-Einstein correlations in Si + Al and Si + Au collisions at 14.6A GeV/c
Abbott, T.; Akiba, Y.; Beavis, D.; Bloomer, M. A.; Bond, P. D.; Chasman, C.; Chen, Z.; Chu, Y. Y.; Cole, B. A.; Costales, J. B.
1992-01-01
The E802 Spectrometer at the Brookhaven Alternating Gradient Synchrotron has been used to measure the correlation in relative momentum between like-sign pions emitted in central Si + Al and Si + Au collisions at 14.6A GeV/c. Data are presented in terms of the correlation function for both identified pi(-) and pi(+) pairs near the nucleon-nucleon center-of-mass rapidity. All parametrizations of the correlation function are consistent with a spherically symmetric source of rms radius 3.5 +/- 0.4 fm and lifetime fm/c.
Energy Technology Data Exchange (ETDEWEB)
Stan, L; Holesinger, T G; Maiorov, B; Feldmann, D M; Usov, I O; DePaula, R F; Civale, L; Foltyn, S R; Jia, Q X [Los Alamos National Laboratory, PO Box 1663, Los Alamos, NM 87545 (United States); Chen, Y; Selvamanickam, V [SuperPower, Incorporated, 450 Duane Avenue, Schenectady, NY 12304 (United States)
2008-10-01
Textured samarium zirconate (SZO) films have been grown by reactive cosputtering directly on an ion beam assisted deposited (IBAD) MgO template, without an intermediate homoepitaxial MgO layer. The subsequent growth of 0.9 {mu}m thick (Y,Gd)Ba{sub 2}Cu{sub 3}O{sub 7-{delta}} ((Y, Gd)BCO) films by metal organic chemical vapor deposition (MOCVD) yielded well textured films with a full width at half maximum of 1.9{sup 0} and 3.4{sup 0} for the out-of-plane and in-plane texture, respectively. Microstructural characterizations of the SZO buffered samples revealed clean interfaces. This indicates that the SZO not only provides a diffusion barrier, but also functions as a buffer for (Y, Gd)BCO grown by MOCVD. The achievement of self-field critical current densities (J{sub c}) of over 2 MA cm{sup -2} at 75.5 K is another proof of the effectiveness of SZO as a buffer on the IBAD-MgO template. The in-field measurements revealed an asymmetric angular dependence of J{sub c} and a shift of the ab-plane maxima due to the tilted nature of the template and (Y,Gd){sub 2}O{sub 3} particles existing in the (Y, Gd)BCO matrix. The present results are especially important because they demonstrate that high temperature superconducting coated conductors with simpler architecture can be fabricated using commercially viable processes.
Directory of Open Access Journals (Sweden)
Alessandra Consonni
2017-09-01
Full Text Available Reinstating tissue-specific tolerance has attracted much attention as a means to treat autoimmune diseases. However, despite promising results in rodent models of autoimmune diseases, no established tolerogenic therapy is clinically available yet. In the experimental autoimmune myasthenia gravis (EAMG model several protocols have been reported that induce tolerance against the prime disease-associated antigen, the acetylcholine receptor (AChR at the neuromuscular junction. Using the whole AChR, the extracellular part or peptides derived from the receptor, investigators have reported variable success with their treatments, though, usually relatively large amounts of antigen has been required. Hence, there is a need for better formulations and strategies to improve on the efficacy of the tolerance-inducing therapies. Here, we report on a novel targeted fusion protein carrying the immunodominant peptide from AChR, mCTA1–T146, which given intranasally in repeated microgram doses strongly suppressed induction as well as ongoing EAMG disease in mice. The results corroborate our previous findings, using the same fusion protein approach, in the collagen-induced arthritis model showing dramatic suppressive effects on Th1 and Th17 autoaggressive CD4 T cells and upregulated regulatory T cell activities with enhanced IL10 production. A suppressive gene signature with upregulated expression of mRNA for TGFβ, IL10, IL27, and Foxp3 was clearly detectable in lymph node and spleen following intranasal treatment with mCTA1–T146. Amelioration of EAMG disease was accompanied by reduced loss of muscle AChR and lower levels of anti-AChR serum antibodies. We believe this targeted highly effective fusion protein mCTA1–T146 is a promising candidate for clinical evaluation in myasthenia gravis patients.
Bose-Einstein correlation of kaons in Si + Au collisions at 14.6 A GeV/c
Akiba, Y.; Beavis, D.; Beery, P.; Britt, H. C.; Budick, B.; Chasman, C.; Chen, Z.; Chi, C. Y.; Chu, Y. Y.; Cianciolo, V.
1993-01-01
The E-802 spectrometer at the Brookhaven Alternating Gradient Synchrotron, enhanced by a trigger for selection of events with one or more specified particles, has been used to measure the momentum-space correlation between pairs of K(+)s emitted in central Si + Au collisions at 14.6 A GeV/c. This correlation has been projected onto the Lorentz-invariant relative four-momentum axis. Fits to this correlation function yield a size for the kaon source that is comparable to that found using pi(+) pairs from a similar rapidity range, once a transformation from the particle-pair frames to a single source frame is made.
Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi
2017-04-01
Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.
Directory of Open Access Journals (Sweden)
Mohammed Najeeb Al Hallak
2009-08-01
Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center
Systematics of (n,t) reactions in medium and heavy mass nuclei at 14.6 MeV
International Nuclear Information System (INIS)
Woo, T.T.
1979-01-01
The production cross sections for (n,t) reactions of 14.6-MeV neutrons with isotopes of the natural elements Ca, Ti, Cr, Fe, Ni, Y, Mo, Pd, Cd, Sn, Pb, La, and with the enriched isotopes 86 Sr, 114 Cd, 130 Te, 205 Tl were measured by the activation technique using high-energy resolution gamma-ray spectrometry. The systematics for the (n,t) reactions were investigated as a function of the relative neutron excess. The experimentally determined values of the cross sections are in good agreement with values calculated by an empirical equation. The cross section ratios (n,t) and (n,p) reactions were calculated on the basis of the statistical model
Sun, Dezhong; Zhang, Xiaoyan; Zhang, Xiaolei
2018-02-28
Several studies have evaluated the association of miR-146a C/G with head and neck cancer (HNC) susceptibility, and overall cancer risk, but with inconclusive outcomes. To drive a more precise estimation, we carried out this meta-analysis. The literature was searched from MEDLINE (mainly PubMed), Embase, the Cochrane Library, and Google Scholar databases to identify eligible studies. A total of 89 studies were included. The results showed that miR-146a C/G was significantly associated with increased HNC risk in dominant model ( I 2 =15.6%, P heterogeneity =0.282, odds ratio (OR) =1.088, 95% confidence interval (CI) =1.002-1.182, P =0.044). However, no cancer risk was detected under all genetic models. By further stratified analysis, we found that rs4919510 mutation contributed to the risk of HNC amongst Asians under homozygote model ( I 2 =0, P heterogeneity =0.541, OR =1.189, 95% CI =1.025-1.378, P =0.022), and dominant model ( I 2 =0, P heterogeneity =0.959, OR =1.155, 95% CI =1.016-1.312, P =0.028). Simultaneously, in the stratified analysis by source of controls, a significantly increased cancer risk amongst population-based studies was found under homozygote model, dominant model, recessive model, and allele comparison model. However, no significant association was found in the stratified analysis by ethnicity and source of control. The results indicated that miR-146a C/G polymorphism may contribute to the increased HNC susceptibility and could be a promising target to forecast cancer risk for clinical practice. However, no significant association was found in subgroup analysis by ethnicity and source of control. To further confirm these results, well-designed large-scale case-control studies are needed in the future. © 2018 The Author(s).
Scattering of 14.6 MeV neutrons from Fe and evidence for structure in the emitted neutron spectra
International Nuclear Information System (INIS)
Gul, K.; Anwar, M.; Ahmad, M.; Saleem, S.M.; Khan, N.A.
1984-06-01
Structure in the spectra of neutrons emitted from iron on bombardment with 14.6 MeV neutrons has been investigated and explained in terms of excitation of levels in iron 56. The energies of scattered neutrons have been measured by the time-of-flight technique based on the associated particle method. The observed excitations have been correlated with the reported levels in a satisfactory manner. Evidence for new excitations at 8.8 +- 0.02, 9.8 +- 0.1, 10.2 +- 0.1, 12.44 +- 0.03 and 12.52 +- 0.03 MeV has been obtained. The excitation of possible components of Ml giant resonance in iron 56 is discussed. (author)
Applicability of IBAMA normative instruction 146-2007 to pipeline environmental licensing
Energy Technology Data Exchange (ETDEWEB)
Basbaum, Marcos A.; Fonseca, Renata A.A. [Servicos de Engenharia Emilio Baumgart Ltda. (SEEBLA), Rio de Janeiro, RJ(Brazil)], e-mail: mbasbaum.seebla@petrobras.com.br, e-mail: renataamorim.seebla@petrobras.com.br; Torggler, Bianca F.; Fernandes, Renato; Guimaraes, Ricardo Z.P. [Petroleo do Brasil S.A. (PETROBRAS), Rio de Janeiro, RJ (Brazil)], e-mail: torggler@petrobras.com.br, e-mail: renatofer@petrobras.com.br, e-mail: rzaluar@petrobras.com.br
2009-07-01
PETROBRAS has been conducting several wildlife programs in response to environmental licensing requirements from IBAMA (Brazilian environmental agency). Since 2007, IBAMA has been requiring the application of the Normative Instruction n. 146 (NI), which establishes criteria for wildlife management in the influence areas of new enterprises. However, experience from PETROBRAS has shown that many of the NI articles are not applicable to pipelines. Thus, a critical analysis of this NI was done based on data from company's wildlife programs. Our analysis indicated that the main NI items that do not apply to pipelines are: 1 - Animal rescue programs in deforested areas and selection of release areas, 2 - More than two fauna monitoring campaigns a year, 3 - Monitoring programs involving all groups of terrestrial vertebrates and also invertebrate classes. The non-applicability of these items is due to: 1 - The majority of pipelines are built in areas without significant native vegetation or with small fragments only, which are usually in secondary stage of ecological succession. Most pipelines scarcely involve removal of primary vegetation, 2 - Pipelines have an influence area restricted to a range of 800 m and the construction directly affects only strips from 20 m to 30 m, 3 - The most relevant impacts associated with pipelines are temporary, and do not persist during their operation. (author)
Energy Technology Data Exchange (ETDEWEB)
Moeller, E
1965-12-15
The use of the time dependent reaction rate method for the measurement of neutron slowing-down time distributions in hydrogen has been analyzed and applied to the case of sloping down in water. Neutrons with energies of about 1 MeV were slowed down, and the time-dependent neutron density at 1.46 eV and its space dependence was measured with a time resolution of 0.042 {mu}s. The results confirm the well known theory for time-dependent slowing down in hydrogen. The space dependence of the distributions is well described by the P{sub 1}-calculations by Claesson.
International Nuclear Information System (INIS)
Moeller, E.
1965-12-01
The use of the time dependent reaction rate method for the measurement of neutron slowing-down time distributions in hydrogen has been analyzed and applied to the case of sloping down in water. Neutrons with energies of about 1 MeV were slowed down, and the time-dependent neutron density at 1.46 eV and its space dependence was measured with a time resolution of 0.042 μs. The results confirm the well known theory for time-dependent slowing down in hydrogen. The space dependence of the distributions is well described by the P 1 -calculations by Claesson
Ciccacci, C; Conigliaro, P; Perricone, C; Rufini, S; Triggianese, P; Politi, C; Novelli, G; Perricone, R; Borgiani, P
2016-11-01
Rheumatoid arthritis (RA) is a systemic autoimmune disease resulting in chronic inflammation of the synovium and consequent cartilage and bone erosion. RA is associated strongly with the presence of rheumatoid factor (RF), and consists of clinical subsets of anti-citrullinated protein antibody (ACPA)-positive and -negative patients. This study was designed to evaluate whether relevant single nucleotide polymorphisms (SNPs) associated with RA and other autoimmune disorders are related to RF, ACPA and clinical phenotype in a cohort of biologic drugs naive Italian RA patients; 192 RA patients and 278 age-matched healthy controls were included. Clinical and laboratory data were registered. We analysed a total of 12 single nucleotide polymorphisms (SNPs) in signal transducer and activator of transcription-4 (STAT-4), interleukin (IL)-10, psoriasis susceptibility 1 candidate 1 (PSORS1C1), protein tyrosine phosphatase, non-receptor type 2 (PTPN2), endoplasmic reticulum aminopeptidase 1 (ERAP1), tumour necrosis factor receptor-associated 3 interacting protein 2 (TRAF3IP2) and microRNA 146a (MIR146A) genes by allelic discrimination assays. Case-control association studies and genotype/phenotype correlation analyses were performed. A higher risk to develop RA was observed for rs7574865 in the STAT-4 gene, while the rs1800872 in the IL-10 gene showed a protective effect. The presence of RF was associated significantly with rs1800872 variant in IL-10, while rs2910164 in MIR146A was protective. ACPA were associated significantly with rs7574865 in STAT-4. The SNP rs2233945 in the PSORS1C1 gene was protective regarding the presence of bone erosions, while rs2542151 in PTPN2 gene was associated with joint damage. Our results confirm that polymorphisms in STAT-4 and IL-10 genes confer susceptibility to RA. For the first time, we described that SNPs in PSORS1C1, PTPN2 and MIR146A genes were associated differently with a severe disease phenotype in terms of autoantibody status and
Ciccacci, C.; Conigliaro, P.; Rufini, S.; Triggianese, P.; Politi, C.; Novelli, G.; Perricone, R.; Borgiani, P.
2016-01-01
Summary Rheumatoid arthritis (RA) is a systemic autoimmune disease resulting in chronic inflammation of the synovium and consequent cartilage and bone erosion. RA is associated strongly with the presence of rheumatoid factor (RF), and consists of clinical subsets of anti‐citrullinated protein antibody (ACPA)‐positive and ‐negative patients. This study was designed to evaluate whether relevant single nucleotide polymorphisms (SNPs) associated with RA and other autoimmune disorders are related to RF, ACPA and clinical phenotype in a cohort of biologic drugs naive Italian RA patients; 192 RA patients and 278 age‐matched healthy controls were included. Clinical and laboratory data were registered. We analysed a total of 12 single nucleotide polymorphisms (SNPs) in signal transducer and activator of transcription‐4 (STAT‐4), interleukin (IL)‐10, psoriasis susceptibility 1 candidate 1 (PSORS1C1), protein tyrosine phosphatase, non‐receptor type 2 (PTPN2), endoplasmic reticulum aminopeptidase 1 (ERAP1), tumour necrosis factor receptor‐associated 3 interacting protein 2 (TRAF3IP2) and microRNA 146a (MIR146A) genes by allelic discrimination assays. Case‐control association studies and genotype/phenotype correlation analyses were performed. A higher risk to develop RA was observed for rs7574865 in the STAT‐4 gene, while the rs1800872 in the IL‐10 gene showed a protective effect. The presence of RF was associated significantly with rs1800872 variant in IL‐10, while rs2910164 in MIR146A was protective. ACPA were associated significantly with rs7574865 in STAT‐4. The SNP rs2233945 in the PSORS1C1 gene was protective regarding the presence of bone erosions, while rs2542151 in PTPN2 gene was associated with joint damage. Our results confirm that polymorphisms in STAT‐4 and IL‐10 genes confer susceptibility to RA. For the first time, we described that SNPs in PSORS1C1, PTPN2 and MIR146A genes were associated differently with a severe disease
Microwave studies on the dielectric properties of Sm3+ and Sm3+/CdTe doped sol-gel silica glasses
International Nuclear Information System (INIS)
Mathew, Siby; Rejikumar, P.R.; Yohannan, Jaimon; Mathew, K.T.; Unnikrishnan, N.V.
2008-01-01
Complex permittivity and conductivity studies of Samarium and Samarium/semiconductor cadmium telluride sol-gel silica glass samples were done. We use cavity perturbation technique at S band frequencies using TE 10p Mode. Structural evolution of the matrix on annealing is discussed based on FTIR analysis/XRD power diffraction. In cavity perturbation technique dielectric parameters like complex permittivity and conductivity are determined by measuring changes in resonant frequency due to small perturbation inside the cavity produced by the introduction of the samples. The addition of the semiconductor along with the samarium was found to lower the permittivity, loss factor and conductivity. Variations of permittivity values with annealing temperature find applications in IC Technology, optic fibre communication, etc. The Sm 3+ /CdTe doped glasses can also be used in the fabrication of new and improved materials for microwave electronic circuits and in electromagnetic shielding devices
Marinescu, R.C.I.
2014-01-01
The interpolated version of the French allegorical satire, the Roman de Fauvel, transmitted in manuscript Paris, Bibliothèque nationale de France, fonds français 146 (produced in Paris ca. 1317), targets the corruption within the French royal court in the last years of the rule of King Philip IV of
Combustion of Corn Stover Bales in a Small 146-kW Boiler
Directory of Open Access Journals (Sweden)
Joey Villeneuve
2011-07-01
Full Text Available Spring harvested corn stover was used for direct combustion in a 146 kW dual chamber boiler designed for wood logs. Stover had a very low moisture content (6.83 ± 0.17%, a gross calorific value (GCV of 18.57 MJ/kg of dry matter (±0.32 MJ/kg DM and an ash content of 5.88% (±1.15%. Small stover bales (8.83 ± 0.90 kg were placed manually in the upper combustion chamber at a rate of 10.5 to 12.8 kg/h over a 24-h period, with three replications, and compared to a control wood combustion trial (12.1 kg/h during 24 h. The overall heat transfer efficiency for stover was lower than for wood (57% vs. 77%. Stover bales produced on average 7.5% ash which included about 2% of unburned residues while wood produced 1.7% ash. CO gas emissions averaged 1324 mg/m³ for stover (118 mg/m³ for wood. The corn stover showed a good calorific potential, but it would have to be densified and the boiler should be modified to improve airflow, completeness of combustion and handling of the large amount of ash formed.
Enhanced E3 Excitations in 144,146Ba and the Evolution of Octupole Collectivity
Bucher, B.; Zhu, S.; ANL, LLNL, LBNL, INL, UAM, Rochester, Maryland Collaboration
2017-09-01
Recent Coulomb excitation studies on 144,146Ba using the GRETINA-CHICO2 detection system with post-accelerated CARIBU beams have confirmed the existence of enhanced E3 transitions in these isotopes which are centered in a region that has long been predicted to exhibit stable octupole-deformed shapes. Furthermore, the widely-varying E1 strength observed between these isotopes is well-accounted for by models having octupole-deformed potentials, and the variation has been linked to increased occupancies of specific single-particle orbitals in the reflection-asymmetric potential. This talk will summarize the most recent experimental and theoretical results. In addition, data on octupole-related properties in the surrounding isotopes will be discussed in an attempt to better understand the origin and evolution of octupole collectivity in this mass region. This work is supported by the U.S. Department of Energy, Office of Nuclear Physics, under Contract No. DE-AC02-06CH11357 (ANL), DE-AC02-05CH11231 (LBNL, GRETINA), DOE DE-AC52-07NA27344 (LLNL), DE-AC07-05ID14517 (INL), and MINECO (Spain).
International Nuclear Information System (INIS)
Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; France, G. de; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.R.
1991-01-01
Two discrete superdeformed (SD) bands have been identified in the nucleus 147 Gd and the twin-band mechanism studied by comparison with SD results for 146,148 Gd. Theoretical interprettion in terms of nucleonic orbitals with the Woods-Saxon potential is consistent with the pseudo-spin symmetry picture and the octupole susceptibility mechanism predicted by theory. (orig.)
Harper, Charles L., Jr.; Jacobsen, Stein B.
1992-01-01
The very early history of the Earth has been one of the great enduring puzzles in the history of geology. We report evidence which clearly can be described as a vestige of a beginning, because the evidence that we report cannot be interpreted in any other way except as a geochemical signal of processes active in the very early history of the Earth. The evidence itself is a very small anomaly in the abundance of SM-146. The primary aims of this study were to: (1) verify the existence of the 'lost continents' of the Hadean era; and (2) determine their mean age.
International Nuclear Information System (INIS)
Adamovich, M.I.; Aggarwal, M.M.; Arora, R.
1988-12-01
The multiplicity distributions of shower particles (n s ) are measured in inclusive inelastic oxygen emulsion interactions. Scaling in observed in the normalized variable n s / ave.(n s ) for 14.6, 60 and 200 A GeV. The dependence of ave. (n s ) on the charge flow in the forward direction (Q ZD ) and the distribution of the number of participating projectile protons is examined. The normalized multiplicities as a function of Q ZD seem also to be independent of incident energies. A comparison with the Lund Model Fritiof yields satisfactory agreement. (authors)
Analysis of Patients' X-ray Exposure in 146 Percutaneous Radiologic Gastrostomies.
Petersen, Tim-Ole; Reinhardt, Martin; Fuchs, Jochen; Gosch, Dieter; Surov, Alexey; Stumpp, Patrick; Kahn, Thomas; Moche, Michael
2017-09-01
Purpose Analysis of patient´s X-ray exposure during percutaneous radiologic gastrostomies (PRG) in a larger population. Materials and Methods Data of primary successful PRG-procedures, performed between 2004 and 2015 in 146 patients, were analyzed regarding the exposition to X-ray. Dose-area-product (DAP), dose-length-product (DLP) respectively, and fluoroscopy time (FT) were correlated with the used x-ray systems (Flatpanel Detector (FD) vs. Image Itensifier (BV)) and the necessity for periprocedural placement of a nasogastric tube. Additionally, the effective X-ray dose for PRG placement using fluoroscopy (DL), computed tomography (CT), and cone beam CT (CBCT) was estimated using a conversion factor. Results The median DFP of PRG-placements under fluoroscopy was 163 cGy*cm 2 (flat panel detector systems: 155 cGy*cm 2 ; X-ray image intensifier: 175 cGy*cm 2 ). The median DLZ was 2.2 min. Intraprocedural placement of a naso- or orogastric probe (n = 68) resulted in a significant prolongation of the median DLZ to 2.5 min versus 2 min in patients with an already existing probe. In addition, dose values were analyzed in smaller samples of patients in which the PRG was placed under CBCT (n = 7, median DFP = 2635 cGy*cm 2 ), or using CT (n = 4, median DLP = 657 mGy*cm). Estimates of the median DFP and DLP showed effective doses of 0.3 mSv for DL-assisted placements (flat panel detector 0.3 mSv, X-ray image converter 0.4 mSv), 7.9 mSv using a CBCT - flat detector, and 9.9 mSv using CT. This corresponds to a factor 26 of DL versus CBCT, or a factor 33 of DL versus CT. Conclusion In order to minimize X-ray exposure during PRG-procedures for patients and staff, fluoroscopically-guided interventions should employ flat detector systems with short transmittance sequences in low dose mode and with slow image frequency. Series recordings can be dispensed with. The intraprocedural placement of a naso- or orogastric probe
Udvikling af materialer til brintpermeable membraner
DEFF Research Database (Denmark)
Bentzer, Henrik Karnøe
doped samarium titanate, lanthanum magnesium titanate and strontium cerate doped with yttrium and nickel. Concentration cell measurements were used to estimate transport numbers for protons and oxide ions in yttrium doped strontium cerate and calcium doped samarium titanate. Furthermore, the voltage......Due to global warming as well as other factors, it is necessary to find alternatives to the current consumption of fossil fuels. Oxide materials with high protonic conductivity can potentially find application within many different technological fields in a society that is based on renewable energy...
Thermodynamics and statistical mechanics of some hydrides of the lanthanides and actinides
International Nuclear Information System (INIS)
Mintz, M.H.
1976-06-01
This work deals mainly with the thermodynamic and physical properties of the hydrides of the lanthanides and actinides. In addition, statistical models have been developed and applied to metal-hydrogen systems. A kinetic study of the uranium-hydrogen system was performed. The thermodynamic properties of the hydrides of neptunium, thorium, praseodymium, neodymium, samarium and europium were determined. In addition the samarium-europium-hydrogen ternary system was investigated. Moessbauer effect measurements of cubic neptunium hydrides were interpreted according to a model presented. A comparison. (author)
Geology of the Terre Adélie Craton (135 – 146˚ E)
Ménot, R.P.; Duclaux, G.; Peucat, J.J.; Rolland, Y.; Guillot, S.; Fanning, M.; Bascou, J.; Gapais, D.; Pêcher, A.
2007-01-01
More than 15 years of field and laboratory investigations on samples from Terre Adélie to the western part of George Vth Land (135 to 146°E) during the GEOLETA program allow a reassessment of the Terre Adélie Craton (TAC) geology. The TAC represents the largest exposed fragment of the East Antarctic Shield preserved from both Grenville and Ross tectono-metamorphic events. Therefore it corresponds to a well-preserved continental segment that developed from the Neoarchean to the Paleoproterozoic. Together with the Gawler Craton in South Australia, the TAC is considered as part of the Mawson continent, i.e. a striking piece of the Rodinia Supercontinent. However, this craton represents one of the less studied parts of the East Antarctic Shield. The three maps presented here clearly point out the extent of two distinct domains within the Terre Adélie Craton and suggest that the TAC was built up through a polyphased evolution during the Neoarchean-Siderian (c.a. 2.5Ga) and the Statherian (c.a. 1.7Ga) periods. These data support a complete re-assessment of the TAC geology and represent a valuable base for the understanding of global geodynamics changes during Paleoproterozoic times.
Energy Technology Data Exchange (ETDEWEB)
L. M. Dittmer
2006-08-25
The 100-F-33, 146-F Aquatice Biology Fish Ponds waste site was an area with six small rectangular ponds and one large circular pond used to conduct tests on fish using various mixtures of river and reactor effluent water. The current site conditions achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification and applicable confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.
Valency state changes in lanthanide-contained systems under high pressure
Energy Technology Data Exchange (ETDEWEB)
Jayaraman, A
1980-08-01
Changes in valency state induced by pressure in samarium sulphide SmS remind one of alchemy, as the mat black initial substance shines golden after the electron transition. The alchemist's dream is of course not realized, however the compound does exhibit an unusually interesting behaviour in the new state. The valency state of samarium as newly appeared fluctuated very rapidly between two electron configurations. Manipulation of the valency state by pressure or chemical substitution can basically change the physical properties of systems containing lanthanides. The phenomena are described and discussed in the following survey.
Abbondanno, U; Alvarez-Velarde, F; Alvarez-Pol, H; Andriamonje, Samuel A; Andrzejewski, J; Badurek, G; Baumann, P; Becvar, F; Benlliure, J; Berthoumieux, E; Calviño, F; Cano-Ott, D; Capote, R; Cennini, P; Chepel, V; Chiaveri, Enrico; Colonna, N; Cortés, G; Cortina-Gil, D; Couture, A; Cox, J; Dababneh, S; Dahlfors, M; David, S; Dolfini, R; Domingo-Pardo, C; Durán, I; Embid-Segura, M; Ferrant, L; Ferrari, A; Ferreira-Marques, R; Frais-Kölbl, H; Furman, W; Gonçalves, I; Gallino, R; Gonzalez-Romero, E; Goverdovski, A; Gramegna, F; Griesmayer, E; Gunsing, F; Haas, B; Haight, R; Heil, M; Herrera-Martínez, A; Isaev, S; Jericha, E; Kappeler, F; Kadi, Y; Karadimos, D; Kerveno, M; Ketlerov, V; Köhler, P; Konovalov, V; Krticka, M; Lamboudis, C; Leeb, H; Lindote, A; Lopes, I; Lozano, M; Lukic, S; Marganiec, J; Marrone, S; Martinez-Val, J; Mastinu, P; Mengoni, A; Milazzo, P M; Molina-Coballes, A; Moreau, C; Mosconi, M; Neves, F; Oberhummer, Heinz; O'Brien, S; Pancin, J; Papaevangelou, T; Paradela, C; Pavlik, A; Pavlopoulos, P; Perlado, J M; Perrot, L; Pignatari, M; Plag, R; Plompen, A; Plukis, A; Poch, A; Policarpo, Armando; Pretel, C; Quesada, J; Raman, S; Rapp, W; Rauscher, T; Reifarth, R; Rosetti, M; Rubbia, Carlo; Rudolf, G; Rullhusen, P; Salgado, J; Soares, J C; Stéphan, C; Tagliente, G; Taín, J L; Tassan-Got, L; Tavora, L; Terlizzi, R; Vannini, G; Vaz, P; Ventura, A; Villamarín, D; Vincente, M C; Vlachoudis, V; Voss, F; Wendler, H; Wiescher, M; Wissha, K
2004-01-01
The measurement of **1**5**1Sm(n, gamma)**1**5**2Sm (samarium) cross section showed improved performance of the new spallation neutron facility. It covered a wide energy range with good resolution, high neutron flux, low backgrounds and a favourable duty factor. The samarium cross section was found to be of great importance for characterizing neutron capture nucleosynthesis in asymptotic giant stars. The combination of these features provided a promising basis for a broad experimental program directed towards application in astrophysics and advanced nuclear technologies. (Edited abstract)
International Nuclear Information System (INIS)
Saraswathy, P.; Mehra, K.S.; Ranganatha, D.K.; Das, M.K.; Balasubramanian, P.S.; Ananthakrishnan, M.; Ramamoorthy, N.; Gunasekaran, S.; Shanthly, N.; Retna Ponmalar, J.; Narasimhan, S.
2001-01-01
The combination of ease of formulation and superior biological features of 153 Sm-EDTMP in terms of safety and efficacy for metastatic bone pain palliation, together with the prospect of better logistics of production, has prompted extensive efforts by many groups world over for its preparation and evaluation. Our efforts have been directed towards exploring the feasibility for formulation of 153 Sm-EDTMP suitable for human use by neutron activation in medium flux reactors of the freely available and inexpensive natural samarium oxide target. The emphasis in biological studies was placed on tests in larger animals (monkeys) as a prelude to clinical evaluation. Feasibility to achieve reasonably high specific activity of 300-700 mCi/mg Sm at EOB with natural samarium has been adequately demonstrated. The radioeuropium contamination, estimated by γ-spectrometry to be 153 Sm-EDTMP from natural samarium at high radioactive concentrations of 40-50 mCi 153 Sm/mL, acceptable biolocalization, as revealed by both biodistribution studies in rats (femur uptake of 2-3% injected dose at 1h p.i. and retention up to 120 h p.i.) and gamma camera images in monkeys and adequate stability have been feasible. Excellent quality bone images of monkeys were recorded showing rapid clearance from blood, visualization of skeleton, clearance from kidneys within 2 hours and retention in skeleton up to 116 hours p.i. No significant activity in other soft tissues was noted. Comparative evaluation of the product prepared from enriched samarium as well as using in-house synthesized EDTMP has, likewise, revealed identical biolocalization features. EDTMP dose tolerance test in mice showed a safety factor of about 100 for a product made from natural samarium at an adult human dose of 50 mCi 153 Sm. Feasibility for production, reasonable safety and satisfactory biolocalisation of the indigenous product has been adequately established so as to warrant clinical trials in patients. (author)
Investigation of nuclei near N = 82 and Z = 64 VIA radioactive decay of high-spin isomers
International Nuclear Information System (INIS)
Toth, K.S.
1979-01-01
An island of very high spin isomers was found recently in neutron-deficient Gd-Lu nuclei near the N = 82 closed shell in (H.I.,xn) measurements. This exciting discovery has led to a large number of experiments trying to identify the structures of these isomers and the nuclei in which they occur. These attempts have been helped in many instances by available spectroscopic information at low excitation energies. A systematic investigation of the low-lying structure of nuclei near N = 82 and Z greater than or equal to 64 was carried out. Heavy-ion beams were used to produce proton-rich isotopes which were then transported, with the use of gas-jet systems, to shielded areas where singles and coincidence γ-ray measurements could be made. Earlier investigations dealt with the decay of terbium ( 146-149 Tb) and dysprosium ( 147-152 Dy) nuclei. During the past two years the research program was extended to holmium nuclides (A less than or equal to 152) produced in 10 B bombardments of samarium. Two new isotopes, 149 Ho and 148 Ho, were identified. The decay data of 21-s 149 Ho supplement in-beam results and locate the hg/ 2 neutron state in 149 Dy to be at 1091 keV. The most intense γ-ray associated with 9-s 148 Ho has an energy of 1688 keV. It is possibly the first-excited to ground-state transition in 148 Dy. Recent in-beam measurements have shown that the first-excited state in 146 Gd is, unespectedly, 3 - in contrast to doubly evenN = 82 nuclei below gadolinium where it is 2 + . It would be interesting to determine whether the 1688-keV level in 148 Dy, the next nucleus in this isotonic series, is 2reverse arrow or 3 - in character. 12 references
Energy Technology Data Exchange (ETDEWEB)
Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; France, G. de; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.R. (Strasbourg-1 Univ., 67 (France). Centre de Recherches Nucleaires)
1991-01-24
Two discrete superdeformed (SD) bands have been identified in the nucleus {sup 147}Gd and the twin-band mechanism studied by comparison with SD results for {sup 146,148}Gd. Theoretical interprettion in terms of nucleonic orbitals with the Woods-Saxon potential is consistent with the pseudo-spin symmetry picture and the octupole susceptibility mechanism predicted by theory. (orig.).
International Nuclear Information System (INIS)
Tian Jia-he; Zhang Jin-ming; He Yi-jie; Hou Qing-tian; Oyang Qiao-hong; Wang Jian-min; Chuan Ling
1999-01-01
A multicentre trial was organized in China as part of an international coordinated research project to study the efficacy and toxicity of single-dose samarium-153 ethylene diamine tetramethylene phosphonate (EDTMP) as a palliative treatment for painful skeletal metastases. One hundred and five patients with painful bone metastases from various primaries were treated with 153 Sm-EDTMP at a dose of 37 MBq/kg(group I) or 18.5 MBq/kg (group II). The effects were evaluated according to change in daily analgesic consumption, pain score, sum of effect product (SEP), Physician's Global Assessment (PGA), blood counts, and organ function tests conducted regularly for 16 weeks. Fifty-eight of 70 patients in group I and 30 of 35 in group II had a positive response, with SEPs of 22.29±14.47 and 20.13±13.90 respectively. Of 72 patients who had been receiving analgesics, 63 reduced their consumption. PGA showed that the Karnofsky score (KS) increased from 58.54±25.90 to 71.67±26.53, indicating improved general condition, but the difference was not significant. Among subgroups of patients, only those with breast cancer showed a significant change in the Karnofsky score after treatment. Inter-group differences were found for net change in KS between patients with lung and patients with breast cancer, and between patients with lung and patients with oesophageal cancer. Seventeen patients showed no response. No serious side-effects were noted, except for falls in the white blood cell (nadir 1.5 x 10 9 /l) and platelet (nadir 6.0 x 10 10 /l) counts in 44/105 and 34/105 cases, respectively. Ten patients had an abnormal liver function test. Response and side-effects were both independent of dose. In conclusion, 153 Sm-EDTMP provided effective palliation in 83.8% of patients with painful bone metastases; the major toxicity was temporary myelosuppression. Further studies are needed to identify better ways of determining the appropriate dose in the individual case and the efficacy of
Molecular Gas Reservoirs in Cluster Galaxies at z = 1.46
Hayashi, Masao; Tadaki, Ken-ichi; Kodama, Tadayuki; Kohno, Kotaro; Yamaguchi, Yuki; Hatsukade, Bunyo; Koyama, Yusei; Shimakawa, Rhythm; Tamura, Yoichi; Suzuki, Tomoko L.
2018-04-01
We present molecular gas reservoirs of 18 galaxies associated with the XMMXCS J2215.9–1738 cluster at z = 1.46. From Band 7 and Band 3 data of the Atacama Large Millimeter/submillimeter Array, we detect dust continuum emission at 870 μm and the CO J = 2–1 emission line from 8 and 17 member galaxies, respectively, within a clustercentric radius of R 200. The molecular gas masses derived from the CO and/or dust continuum luminosities show that the fraction of molecular gas mass and the depletion timescale for the cluster galaxies are larger than expected from the scaling relations of molecular gas on stellar mass and offset from the main sequence of star-forming galaxies in general fields. The galaxies closer to the cluster center in terms of both projected position and accretion phase seem to show a larger deviation from the scaling relations. We speculate that the environment of the galaxy cluster helps feed the gas through inflow to the member galaxies and reduce the efficiency of star formation. The stacked Band 3 spectrum of 12 quiescent galaxies with M stellar ∼ 1011 M ⊙ within 0.5R 200 shows no detection of a CO emission line, giving the upper limit of molecular gas mass and molecular gas fraction to be ≲1010 M ⊙ and ≲10%, respectively. Therefore, the massive galaxies in the cluster core quench the star formation activity while consuming most of the gas reservoirs.
The Cytomegalovirus UL146 Gene Product vCXCL1 Targets Both CXCR1 and CXCR2 as an Agonist
DEFF Research Database (Denmark)
Luttichau, H.R.
2010-01-01
Large DNA viruses, such as herpesvirus and poxvirus, encode proteins that target and exploit the chemokine system of their host. UL146 and UL147 in the cytomegalovirus (CMV) genome encode the two CXC chemokines vCXCL1 and vCXCL2. In this study, vCXCL1 was probed against a panel of the 18 classified...... human chemokine receptors. In calcium mobilization assays vCXCL1 acted as an agonist on both CXCR1 and CXCR2 but did not activate or block any of the other 16 chemokine receptors. vCXCL1 was characterized and compared with CXCL1/GRO alpha, CXCL2/GRO beta, CXCL3/GRO gamma, CXCL5/ENA-78, CXCL6/GCP2, CXCL7...
Energy Technology Data Exchange (ETDEWEB)
Caro, G
2005-07-15
We present new ultra-high precision {sup 142}Nd/{sup 144}Nd measurements of early Archaean rocks using the new generation thermal ionization mass spectrometer TRITON. Repeated measurements of the Ames Nd standard demonstrate that the {sup 142}Nd/{sup 144}Nd ratio can be determined with external precision of 2 ppm (2s), allowing confident resolution of anomalies as small as 5 ppm. A major analytical improvement lies in the elimination of the double normalization procedure required to correct our former measurements from a secondary mass fractionation effect. Our new results indicate that metasediments, meta-basalts and orthogneisses from the 3.6 - 3.8 Ga West Greenland craton display positive {sup 142}Nd anomalies ranging from 8 to 15 ppm. Using a simple two-stage model with initial e{sup 143}Nd value of 1.9 {+-} 0.6 e-units, coupled {sup 147}Sm-{sup 143}Nd and {sup 146}Sm-{sup 142}Nd chronometry constrains mantle differentiation to 50 to 200 Ma after formation of the solar system. This chronological constraint is consistent with differentiation of the Earth's mantle during the late stage of crystallization of a magma ocean. We have developed a two-box model describing {sup 142}Nd and {sup 143}Nd isotopic evolution of depleted mantle during the subsequent evolution of the crust-mantle system. Our results indicate that early terrestrial proto-crust had a lifetime of ca. 500 Ma in order to produce the observed Nd isotope signature of Archaean rocks. In the context of this two box mantle-crust system, we model the evolution of isotopic and chemical heterogeneity of depleted mantle as a function of the mantle stirring time. Using the dispersion of {sup 142}Nd/{sup 144}Nd and {sup 143}Nd/{sup 144}Nd ratios observed in early Archaean rocks, we constrain the stirring time of early Earth's mantle to 100 - 150 Ma, a factor of 5 to 10 shorter than stirring time inferred from modern oceanic basalts. (author)
International Nuclear Information System (INIS)
Adamovich, M.I.; Alexandrov, Y.A.; Aggarwal, M.M.
1992-03-01
The energy and centrality dependence of local particle pseudorapidity densities as well as validity of various parametrizations of the distributions are examined. The dispersion, σ, of the rapidity density distribution of produced particles varies slowly with centrality and is 0.80, 0.98, 1.21 and 1.41 for central interactions at 3.7, 14.6, 60 and 200 A GeV incident energy, respectively. σ is found to be independent of the size of the interacting system at fixed energy. A novel way of representing the window dependence of the multiplicity as normalized variance versus inverse average multiplicity is outlined. (au)
International Nuclear Information System (INIS)
Adamovich, M.I.; Alexandrov, Y.A.; Chernyavsky, M.M.; Gerassimov, S.G.; Larionova, V.G.; Maslennikova, N.V.; Orlova, G.I.; Peresadko, N.G.; Rappoport, V.M.; Salmanova, N.A.; Tretyakova, M.I.; Aggarwal, M.M.; Arora, R.; Bhatia, V.S.; Mittra, I.S.; Andreeva, N.P.; Anson, Z.V.; Bubnov, V.I.; Chasnikov, I.Y.; Eligbaeva, G.Z.; Eremenko, L.E.; Gaitinov, A.S.; Kalyachkina, G.S.; Kanygina, E.K.; Lepetan, V.N.; Shakhova, T.I.; Avetyan, F.A.; Marutyan, N.A.; Sarkisova, L.G.; Sarkisyan, V.R.; Badyal, S.K.; Bhasin, A.; Gupta, V.K.; Kachroo, S.; Kaul, G.L.; Kitroo, S.; Mangotra, L.K.; Rao, N.K.; Basova, E.; Nasrulaeva, H.; Nasyrov, S.H.; Petrov, N.V.; Qarshiev, D.A.; Trofimova, T.P.; Tuleeva, U.; Bhalla, K.B.; Gupta, S.K.; Kumar, V.; Lal, P.; Lokanathan, S.; Mookerjee, S.; Palsania, H.S.; Raniwala, R.; Raniwala, S.; Bogdanaov, V.G.; Plyushchev, V.A.; Solovjeva, Z.I.; Burnett, T.H.; Grote, J.; Lord, J.; Skelding, D.; Wilkes, R.J.; Chernova, L.P.; Gulamov, K.G.; Lukicheva, N.S.; Navotny, V.S.; Saidkhanov, N.; Shpilev, S.N.; Surin, E.L.; Svechnikova, L.N.; Zhochova, S.I.; Ganssauge, E.R.; Rhee, J.T.; Garpman, S.; Jakobsson, B.; Nystrand, J.; Otterlund, I.; Soederstroem, K.; Stenlund, E.; Heckman, H.H.; Cai, X.; Huang, H.; Liu, L.S.; Qian, W.Y.; Wang, H.Q.; Zhou, D.C.; Judek, B.; Just, L.; Tothova, M.; Karabova, M.; Vokal, S.; Krasnov, S.A.; Kulikova, S.; Maksimkina, T.N.; Shabratova, G.S.; Tolstov, K.D.; Luo, S.B.; Qin, Y.M.; Zhang, D.H.; Weng, Z.Q.; Xia, Y.L.; Xu, G.F.; Zheng, P.Y.
1992-01-01
The energy and centrality dependence of local particle pseudorapidity densities as well as validity of various parameterizations of the distributions are examined. The dispersion, σ, of the rapidity density distribution of produced particles varies slowly with centrality and is 0.80, 0.98, 1.21 and 1.41 for central interactions at 3.7, 14.6, 60 and 200 A GeV incident energy, respectively, σ is found to be independent of the size of the interacting system at fixed energy. A novel, way of representing the window dependence of the multiplicity as normalized variance versus inverse average multiplicity is outlined. (orig.)
Determination of the {sup 151}Sm half-life
Energy Technology Data Exchange (ETDEWEB)
Be, Marie-Martine; Cassette, Philippe [CEA, LIST, Gif sur Yvette (France). LNE-Laboratoire National Henri Becquerel; Isnard, Helene [CEA-LANIE, Gif sur Yvette (France); and others
2015-07-01
New measurements have been undertaken to determine the half-life of {sup 151}Sm. A pure {sup 151}Sm solution was obtained after chemical separation from a samarium solution resulting from the dissolution of an irradiated samarium sample. The concentration of {sup 151}Sm in the solution was measured by mass spectrometry, combined with the isotope dilution technique. The activity of the solution was measured by liquid scintillation counting by six European laboratories as part of an international comparison. These combined results lead to a half-life of T{sub 1/2} = 94.6(6)a.
Early mantle differentiation: constraint from 146Sm-142Nd systematics
International Nuclear Information System (INIS)
Caro, G.
2005-07-01
We present new ultra-high precision 142 Nd/ 144 Nd measurements of early Archaean rocks using the new generation thermal ionization mass spectrometer TRITON. Repeated measurements of the Ames Nd standard demonstrate that the 142 Nd/ 144 Nd ratio can be determined with external precision of 2 ppm (2s), allowing confident resolution of anomalies as small as 5 ppm. A major analytical improvement lies in the elimination of the double normalization procedure required to correct our former measurements from a secondary mass fractionation effect. Our new results indicate that metasediments, meta-basalts and orthogneisses from the 3.6 - 3.8 Ga West Greenland craton display positive 142 Nd anomalies ranging from 8 to 15 ppm. Using a simple two-stage model with initial e 143 Nd value of 1.9 ± 0.6 e-units, coupled 147 Sm- 143 Nd and 146 Sm- 142 Nd chronometry constrains mantle differentiation to 50 to 200 Ma after formation of the solar system. This chronological constraint is consistent with differentiation of the Earth's mantle during the late stage of crystallization of a magma ocean. We have developed a two-box model describing 142 Nd and 143 Nd isotopic evolution of depleted mantle during the subsequent evolution of the crust-mantle system. Our results indicate that early terrestrial proto-crust had a lifetime of ca. 500 Ma in order to produce the observed Nd isotope signature of Archaean rocks. In the context of this two box mantle-crust system, we model the evolution of isotopic and chemical heterogeneity of depleted mantle as a function of the mantle stirring time. Using the dispersion of 142 Nd/ 144 Nd and 143 Nd/ 144 Nd ratios observed in early Archaean rocks, we constrain the stirring time of early Earth's mantle to 100 - 150 Ma, a factor of 5 to 10 shorter than stirring time inferred from modern oceanic basalts. (author)
Ultrasound-guided percutaneous transhepatic biliary drainage: Experiences in 146 patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Jai Keun [Sohwa Children' s Hospital, Seoul(Korea, Republic of); Yu, Jeong Sik; Kim, Ki Whang; Chung, Soo Yoon; Jeong, Mi Gyoung [Yonsei University College of Medicine, Seoul (Korea, Republic of); Choi, Deuk Lin; Kwon, Gui Hyang; Lee, Hae Kyung [Soonchunhyang University College of Medicine, Seoul (Korea, Republic of)
1999-03-15
Percutaneous biliary drainage is an important technique for palliative therapy of obstructive biliary disease and diagnostic information. The purpose of this study is to review and evaluate the experiences of ultrasound-guided percutaneous transhepatic biliary drainage. Ultrasound-guided percutaneous transhepatic biliary drainage was performed on 146 occasions in 134 patients. The causes of biliary obstruction were: benign diseases (19 cases, 14.2%) such as bile duct stones or stricture, cholangiocarcinoma (37 cases, 27.6%), pancreatic carcinoma (35 cases, 26.1%), metastasis (22 cases, 16.5%), gall bladder cancer (14 cases, 10.4%), ampulla of Vater cancer (4 cases, 3.0%), hepatocellular carcinoma (3 cases, 2.2%). Retrospectively reviewing medical records, we found out frequency of external or external/internal biliary drainages, puncture of left or right hepatic duct, and presence of bileinfection. Ultrasound-guided percutaneous transhepatic biliary drainage was compared with conventional biliary drainage of previous reports on the basis of frequency of complications. External (124 procedures, 84.9%) and external/internal biliary drainage (22 procedures, 15.1%) were carried out by puncture of dilated right (59.6%) or left (40.4%) intrahepatic duct. Sixty-nine complications occurred in 47 patients. Catheter related complications (33/69, 47.8%) were most common: catheter dislodgement (17/69, 24.6%), malfunction (9/69, 13.1%), leakage (7/69, 10.1%). Other minor complications such as simple fever (16/69, 23.2%), cholangitis (7/69, 10.1%), hemobilia (4/69, 5.8%), biloma (2/69, 2.9%) and wound infection (1/69, 1.5%) occurred. Major complications including sepsis (4/69, 5.8%) and bile peritonitis (2/69, 2.9%) were also noted. Puncture-related complications such as hemobilia, biloma and bile peritonitis occurred in 8 cases (5.5%). Comparing with conventional X-ray guided drainage, ultrasound-guided percutaneous transhepatic biliary drainage is a safe procedure for
International Nuclear Information System (INIS)
Rasulova, Nigora; Lyubshin, Vladimir; Arybzhanov, Dauranbek; Sagdullaev, Sh.; Krylov, Valery; Khodjibekov, Marat
2013-01-01
While bisphosphonates are indicated for prevention of skeletal-related events, radionuclide therapy is widely used for treatment of painful bone metastases. Combined radionuclide therapy with bisphosphonates has demonstrated improved effectiveness in achieving bone pain palliation in comparison to mono therapy with radionuclides or bisphosphonates alone. However, there are conflicting reports as to whether bisphosphonates adversely influence skeletal uptake of the bone-seeking radiotracers used for therapy. Recent studies analyzing influence of Zoledronic acid on total bone uptake of Samarium-153 EDTMP (Sm-153 EDTMP) by measuring cumulative urinary activity of Sm-153 on baseline study, as well as in combination with bisphosphonates (administrated 48 hours prior to Sm-153) did not provide any statistically significant difference in urinary excretion of Sm-153 between the two groups. It may be noted that the exact temporal sequence of bisphosphonate administration vis a vis radionuclide therapy has not yet been studied. One of the side effects of bisphosphonates is transient flare effect on bone pain. Radionuclide therapy may also have similar side effect. Keeping in view the above the current study was designed with the main objective of determining the exact timing of bisphosphonate administration in patients receiving combined therapy so as to achieve optimal efficacy of bone pain palliation. Ninety-three patients suffering from metastatic bone pain who received combination therapy with Sm-153 oxabifore (an analog of Sm-153 EDTMP) and Zoledronic acid were divided into three groups according to the timing of Zoledronic acid administration: Group I: 39 patients who received Zoledronic acid 7 or more days prior to Sm-153 oxabifore treatment; Group II: 32 patients who received Zoledronic acid 48-72 hours prior to Sm-153 oxabifore treatment and Group III: 22 patients who received Zoledronic acid 7 days after Sm-153 oxabifore treatment. Sm-153 oxabifore was administered
Transverse energy and charged particle multiplicity in 14.6 GeV/c proton-nucleus collisions
International Nuclear Information System (INIS)
Wang, Gang
1995-01-01
Transverse energy and charged particle multiplicity produced in 14.6 GeV/c p + Al and p + Pb collisions have been studied using the E814 set-up at the BNL-AGS. Measurements of dσ/dE T , dE T /dη,dσ/dN c , and dN c /dη are presented. From the present data the mean transverse energy per particle is obtained and it is compared to values observed in Si induced collisions at the same energy In contrast to what is observed in nucleus-nucleus collisions, a very weak correlation is found between the transverse energy and the charged particle multiplicity. These results are compared to the predictions of various theoretical models used to describe heavy-ion collisions. The event generators RQMD and HIJET reproduce well the pseudorapidity distribution of both the transverse energy and charged particle multiplicity, whereas FRITIOF fails to reproduce the measured distributions. Contrary to what had been suggested previously in a Si + A study, the present study shows that the pseudorapidity dependence of charged particle multiplicity distributions do not follow KNO scaling. (author)
International Nuclear Information System (INIS)
Dittmer, L.M.
2006-01-01
The 100-F-33, 146-F Aquatice Biology Fish Ponds waste site was an area with six small rectangular ponds and one large circular pond used to conduct tests on fish using various mixtures of river and reactor effluent water. The current site conditions achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification and applicable confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River
International Nuclear Information System (INIS)
Harada, Makoto; Adachi, Motonari; Kai, Yuichi; Koike, Kenichi
1987-01-01
The equilibrium distributions of neodymium and samarium between molten LiCl and liquid Bi-Li alloy were measured in a wide range of Li-mole fraction in the alloy phase, X Li . These lanthanide elements were extracted through redox reactions. In high X Li range, X Li > 0.03, the distributions of neodymium and bismuth in the salt phase increased markedly. The anomalous increase is attributed to the formation of the compound comprized of Nd, Li, Bi and oxygen in the salt phase. The reaction processes in samarium and neodymium were very fast and the extraction rates are controlled by the diffusion processes of the solutes and metallic lithium. (author)
Energy Technology Data Exchange (ETDEWEB)
Deacon, Glen B.; Guo, Zhifang [School of Chemistry, Monash University, VIC (Australia); Junk, Peter C.; Wang, Jun [College of Science and Engineering, James Cook University, Townsville, QLD (Australia)
2017-07-10
Reduction of tungsten hexacarbonyl by the divalent samarium(II) complex [Sm{sub 2}(N{sub 4}Et{sub 8})(thf){sub 4}] ((N{sub 4}Et{sub 8}){sup 4-}=meso-octaethylcalix[4]pyrrolide) in toluene at ambient temperature gave the remarkable heteronuclear mixed-valent samarium(II/III)/tungsten complex [{(thf)_2Sm"I"I(N_4Et_8)Sm"I"I"I(thf)}{sub 2}{(μ-OC)_2W_2(CO)_8}], which features the trapping of a rare [W{sub 2}(CO){sub 10}]{sup 2-} anion with an unsupported W-W bond. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)
Govindhan, M.; Viswanathan, V.; Karthikeyan, S.; Subramanian, K.; Velmurugan, D.
2017-08-01
Compound 1-(4-(6-fluorobenzo[d] isoxazol-3-yl) piperidin-1-yl)-2-(4-(hydroxymethyl)-1H-1, 2,3-triazol-1-yl) ethanone was synthesized in good yield by using click chemistry approach with 2-azido-1-(4-(6-flurobenzo[d]isooxazol-3-yl)piperidin-1-yl)ethanone as a starting material. The synthesized compound was characterized using IR, NMR and MS studies. Thermal stability of the compound was analyzed by using TGA and DSC technique. The single crystal XRD analysis was taken part, to confirm the structure of the compound. The intercontacts in the crystal structure are analyzed using Hirshfeld surfaces computational method. Cytotoxicity of the synthesized compound was evaluated and the results were reported. The binding analysis carried out between the newly synthesized molecule with human serum albumin using fluorescence spectroscopy technique to understand the pharmacokinetics nature of the compound for further biological application. The molecular docking studies were evaluated for the compound to elucidate insights of new molecules in carrier protein.
International Nuclear Information System (INIS)
Rasool, Mir Hashim; Ahmad, Shafiq; Ahmad, M. Ayaz
2013-01-01
The experimental data based on 951 and 380 events of 28 Si-emulsion and 32 S-emulsion interactions at 14.6 and 200 AGeV/c respectively have been analysed to investigate intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles. The observed increasing trend in the values of fractal moments, Fqcorr and modified Gq-moments with decreasing bin size clearly reflects the evaporation model and gives an evidence for an intermittency pattern of fluctuations. The experimental data have been compared with randomly generated uncorrelated Monte Carlo of 10,000 events to check the presence of the statistical fluctuations in the target fragmentation region
Directory of Open Access Journals (Sweden)
Xia Feng
Full Text Available The efficacy of an inactivated foot-and-mouth disease (FMD vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01. In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings.
Feng, Xia; Ma, Jun-Wu; Sun, Shi-Qi; Guo, Hui-Chen; Yang, Ya-Min; Jin, Ye; Zhou, Guang-Qing; He, Ji-Jun; Guo, Jian-Hong; Qi, Shu-yun; Lin, Mi; Cai, Hu; Liu, Xiang-Tao
2016-01-01
The efficacy of an inactivated foot-and-mouth disease (FMD) vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV) particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG) analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA) is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS) ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01). In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings. PMID:26930597
Energy Technology Data Exchange (ETDEWEB)
Doerr, W. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Medical University / AKH Vienna (Austria). Dept. of Radiation Oncology; Kallfels, S. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Kinder- und Jugendmedizin, Chemnitz [Germany; Herrmann, T. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology
2013-07-15
Purpose: The present retrospective study was initiated to characterize the effect of oncological treatments in children and adolescents on bone and soft tissues, and to assess their dependence on radiation dose and age at exposure. Patients and methods: The study included 146 patients treated between 1970 and 1997. All patients received external beam radiotherapy to the trunk or extremities, but no cranial irradiation. Median age at treatment was 8.8 years. Patients were screened at 18 years (median time interval since treatment 9.2 years, range 0.9-17.7 years) for pathological changes in the skeletal system and soft tissues (scoliosis, kyphosis, bony hypoplasia, soft tissue defects, asymmetries), which were classified as minor/moderate (grade 1) or substantial (grade 2). Results: Pathological findings were recorded in 75/146 patients (51 %). These were scored as minor in 44 (59 %) and substantial in 31 patients (41 %). Most pathological changes occurred in children treated under the age of 6 years. At 6 years and older, only doses > 35 Gy caused an effect, and no substantial changes were seen for treatment ages exceeding 12 years. Significant effects of radiation dose and age at exposure were observed for kyphoscoliosis (with vertebral body dose gradients < 35 Gy), hypoplasia and soft tissue defects and asymmetrical growth. Conclusion: Tolerance doses of 20 Gy need to be respected for growing bone, particularly in children treated under the age of 6 years. The late treatment sequelae analysed in the present study are largely avoided with the use of current therapeutic protocols. However, the systematic evaluation, documentation and continuous analysis of adverse events in paediatric oncology remains essential, as does the evaluation of novel radio(chemo)therapeutic approaches. (orig.)
Sm cluster superlattice on graphene/Ir(111)
Mousadakos, Dimitris; Pivetta, Marina; Brune, Harald; Rusponi, Stefano
2017-12-01
We report on the first example of a self-assembled rare earth cluster superlattice. As a template, we use the moiré pattern formed by graphene on Ir(111); its lattice constant of 2.52 nm defines the interparticle distance. The samarium cluster superlattice forms for substrate temperatures during deposition ranging from 80 to 110 K, and it is stable upon annealing to 140 K. By varying the samarium coverage, the mean cluster size can be increased up to 50 atoms, without affecting the long-range order. The spatial order and the width of the cluster size distribution match the best examples of metal cluster superlattices grown by atomic beam epitaxy on template surfaces.
Kureba, C. O.; Buthelezi, Z.; Carter, J.; Cooper, G. R. J.; Fearick, R. W.; Förtsch, S. V.; Jingo, M.; Kleinig, W.; Krugmann, A.; Krumbolz, A. M.; Kvasil, J.; Mabiala, J.; Mira, J. P.; Nesterenko, V. O.; von Neumann-Cosel, P.; Neveling, R.; Papka, P.; Reinhard, P.-G.; Richter, A.; Sideras-Haddad, E.; Smit, F. D.; Steyn, G. F.; Swartz, J. A.; Tamii, A.; Usman, I. T.
2018-04-01
The phenomenon of fine structure of the Isoscalar Giant Quadrupole Resonance (ISGQR) has been studied with high energy-resolution proton inelastic scattering at iThemba LABS in the chain of stable even-mass Nd isotopes covering the transition from spherical to deformed ground states. A wavelet analysis of the background-subtracted spectra in the deformed 146, 148, 150Nd isotopes reveals characteristic scales in correspondence with scales obtained from a Skyrme RPA calculation using the SVmas10 parameterization. A semblance analysis shows that these scales arise from the energy shift between the main fragments of the K = 0 , 1 and K = 2 components.
International Nuclear Information System (INIS)
Feiginov, Michael; Kanaya, Hidetoshi; Suzuki, Safumi; Asada, Masahiro
2014-01-01
In search for possibilities to increase the operating frequencies of resonant-tunneling diodes (RTDs), we are studying RTDs working in an unusual regime. The collector side of our diodes is so heavily doped that the collector depletion region is fully eliminated in our RTDs and the ground quantum-well subband stays immersed under (or stays close to) the collector quasi-Fermi level. The electron injection from the collector into the RTD quantum well is very strong in our diodes and stays comparable to that from the emitter in the whole range of RTD operating biases. Our RTDs exhibit well pronounced negative-differential-conductance region and peak-to-valley current ratio around 1.8. We demonstrate operation of our diodes in RTD oscillators up to 1.46 THz. We also observe a fine structure in the emission spectra of our RTD oscillators, when they are working in the regime close to the onset of oscillations.
President Barack Obama addresses the 146th annual meeting of the National Academy of Sciences.
2009-06-16
On April 27, 2009, President Barack Obama addressed members of the National Academy of Sciences (NAS) gathered at its 146th annual meeting in Washington, D.C. In his speech, the president shared his plans to give science and technology a central role in the nation's future and an immediate place in America's economic renewal. He outlined steps he is taking to increase research spending, achieve energy independence, and improve science education. Included was what Mr. Obama cited as the largest commitment to scientific research in American history-devoting more than 3% of our gross domestic product to research and development. "Next, we are restoring science to its rightful place," Mr. Obama told a packed NAS auditorium audience. "Under my administration, the days of science taking a backseat to ideology are over." He appealed to scientists' sense of personal responsibility to reach and educate young Americans: "I want to challenge you to use your love and knowledge of science to spark a sense of wonder and excitement in a new generation." President Obama was welcomed to the National Academy of Sciences by President Ralph J. Cicerone and John P. Holdren, Assistant to the President for Science and Technology and Director of the White House Office of Science and Technology Policy. The following is a transcript of that speech.
Directory of Open Access Journals (Sweden)
Ming-yang Song
Full Text Available BACKGROUND: MicroRNAs (miRNAs have been implicated in various human diseases. Single nucleotide polymorphisms (SNPs in inflammation-related miRNA may play an important role in Helicobacter pylori (H. pylori-induced gastric lesions. To evaluate the associations between miRNA SNPs, H. pylori and gastric lesions, a population-based study was conducted in Linqu County, China. METHODOLOGY/PRINCIPAL FINDINGS: Based on serum miRNA array conducted in this population, two SNP loci (miR-146a rs2910164: G>C and miR-27a rs895819: T>C were determined by polymerase chain reaction-restriction fragment length polymorphism in 2,380 participants with diverse gastric lesions. Using participants with superficial gastritis and mild chronic atrophic gastritis as the reference group, we found that rs2910164 CC carriers had a significantly increased risk of intestinal metaplasia [adjusted odds ratio (OR, 1.42; 95% confidence interval (CI, 1.03-1.97] and dysplasia (OR, 1.54; 95% CI, 1.05-2.25 compared to GG carriers, whereas no significant association was observed for rs895819. Stratified analysis by H. pylori infection indicated that rs2910164 C allele was associated with an increased risk of intestinal metaplasia and dysplasia only among individuals infected with H. pylori (CC vs. GG: OR, 1.53; 95% CI, 1.12-2.08, P for trend = 0.004. Participants who simultaneously carried variant alleles and H. pylori infection were more likely to develop intestinal metaplasia and dysplasia, although the interaction between genetic variants and H. pylori infection was not significant (P for interaction = 0.35 for rs2910164 and 0.92 for rs895819. CONCLUSIONS/SIGNIFICANCE: These findings suggest that miR-146a rs2910164 polymorphism may contribute to the evolution of H. pylori-associated gastric lesions in this high-risk population.
Energy Technology Data Exchange (ETDEWEB)
Petersen, Tim-Ole; Reinhardt, Martin; Fuchs, Jochen; Gosch, Dieter; Surov, Alexey; Stumpp, Patrick; Kahn, Thomas; Moche, Michael [Univ. Hospital Leipzig (Germany). Dept. of Diagnostic and Interventional Radiology
2017-09-15
Analysis of patient's X-ray exposure during percutaneous radiologic gastrostomies (PRG) in a larger population. Data of primary successful PRG-procedures, performed between 2004 and 2015 in 146 patients, were analyzed regarding the exposition to X-ray. Dose-area-product (DAP), dose-length-product (DLP) respectively, and fluoroscopy time (FT) were correlated with the used x-ray systems (Flatpanel Detector (FD) vs. Image Itensifier (BV)) and the necessity for periprocedural placement of a nasogastric tube. Additionally, the effective X-ray dose for PRG placement using fluoroscopy (DL), computed tomography (CT), and cone beam CT (CBCT) was estimated using a conversion factor. The median DFP of PRG-placements under fluoroscopy was 163 cGy{sup *}cm{sup 2} (flat panel detector systems: 155 cGy{sup *}cm{sup 2}; X-ray image intensifier: 175 cGy{sup *}cm{sup 2}). The median DLZ was 2.2min. Intraprocedural placement of a naso- or orogastric probe (n=68) resulted in a significant prolongation of the median DLZ to 2.5min versus 2min in patients with an already existing probe. In addition, dose values were analyzed in smaller samples of patients in which the PRG was placed under CBCT (n=7, median DFP=2635 cGy{sup *}cm{sup 2}), or using CT (n=4, median DLP=657mGy{sup *}cm). Estimates of the median DFP and DLP showed effective doses of 0.3mSv for DL-assisted placements (flat panel detector 0.3mSv, X-ray image converter 0.4mSv), 7.9mSv using a CBCT - flat detector, and 9.9mSv using CT. This corresponds to a factor 26 of DL versus CBCT, or a factor 33 of DL versus CT. In order to minimize X-ray exposure during PRG-procedures for patients and staff, fluoroscopically-guided interventions should employ flat detector systems with short transmittance sequences in low dose mode and with slow image frequency. Series recordings can be dispensed with. The intraprocedural placement of a naso- or orogastric probe significantly extends FT, but has little effect on the overall dose of the
Emission properties of Sm(III) complex having ten-coordination structure
International Nuclear Information System (INIS)
Hasegawa, Yasuchika; Tsuruoka, Shin-ichi; Yoshida, Takahiko; Kawai, Hideki; Kawai, Tsuyoshi
2008-01-01
Sammarium(III) complex having ten-coordination structure, bis-(1,10-phenanthroline)tris-(hexafluoroacetylacetonato)samarium(III) (Sm(hfa) 3 (phen) 2 ) was prepared by chelation of tris-(hexafluoroacetylacetonato) samarium(III) (Sm(hfa) 3 (H 2 O) 2 ) with 1,10-phenantroline (phen). The characteristic ten-coordination structure of Sm(hfa) 3 (phen) 2 was determined by 1 H NMR and elemental analyses. Strong deep-red emission (λ max =643 nm) and narrow emission band (FWHM=5 nm) of Sm(hfa) 3 (phen) 2 originated from electronic allowed transition from characteristics ten coordinate structure. The emission quantum yields Sm(hfa) 3 (phen) 2 excited at absorption bands of ligands and Sm(III) ion were found to be 0.36 and 1.4%, respectively
Kinoshita, N; Nakanishi, T
2003-01-01
The alpha-decay half-life of sup 1 sup 4 sup 7 Sm has been reevaluated. Known amounts of natural Sm and an alpha-emitter standard ( sup 2 sup 1 sup 0 Po, sup 2 sup 3 sup 8 U, or sup 2 sup 4 sup 1 Am) were mixed well to prepare thin sources for the simultaneous counting of sup 1 sup 4 sup 7 Sm and the alpha-emitter standard by means of an alpha-spectrometer using a silicon surface barrier detector. The alpha-disintegration rate of known amounts of sup 1 sup 4 sup 7 Sm was determined by reference to the alpha activity of the standard. The source preparation and counting were repeated to establish the reproducibility of the present half-life determination, and supplementary alpha spectrometry was carried out by a liquid-scintillation spectrometer. The arithmetic mean of the experimental half-life values was obtained to be (1.17 +- 0.02) x 10 sup 1 sup 1 y. This value is about 10% longer than the currently adopted value, (1.06 +- 0.02) x 10 sup 1 sup 1 y, and the possible factors for this difference are discussed...
Energy Technology Data Exchange (ETDEWEB)
Marzouk, M.A., E-mail: marzouk_nrc@yahoo.com [Glass Research Department, National Research Centre, 33 El Bohouth Street (former EL Tahrir), P.O. 12622, Dokki, Giza (Egypt); Hamdy, Y.M. [Spectroscopy Department, National Research Centre, 33 El Bohouth Street (former EL Tahrir), P.O. 12622, Dokki, Giza (Egypt); ElBatal, H.A. [Glass Research Department, National Research Centre, 33 El Bohouth Street (former EL Tahrir), P.O. 12622, Dokki, Giza (Egypt); Ezz ElDin, F.M. [National Institute for Radiation Research & Technology, Nasr City, Cairo (Egypt)
2015-10-15
/2} and {sup 6}H{sub 11/2}, respectively. The intensity of the emission spectra is observed to increase with the increase of Sm{sub 2}O{sub 3} content. The optical spectra within the visible–near IR region and photoluminescence spectra of Sm{sub 2}O{sub 3}-doped glasses are found to be stable and show almost no variations after gamma irradiation especially when rare-earth ions are present in noticeable contents (1–3%). FTIR spectra of all the studied glasses reveal repetitive and characteristic vibrational bands mainly due to phosphate groups with abundant of Q{sup 2} and Q{sup 3} groups due to the high content of P{sub 2}O{sub 5} (70 mol%). The introduction of 10% NaF and 20% AlF{sub 3} is observed to cause formation of mixed fluorophosphate groups (PO{sub 3}F){sup 2−}. The formation of (AlPO){sub 4} and/or (AlPO{sub 6}) groups needs further justification by combined techniques. The increase of Sm{sub 2}O{sub 3} content to 3% causes obvious increase of the IR absorption bands within the wavenumbers range of about 850–1400 cm{sup −1} due to suggested depolymerization effect. Gamma irradiation causes no distinct variations in the FTIR spectra due to suggested compactness through the formation of additional structural groups from AlF{sub 4} or AlF{sub 6}. - Highlights: • Samarium ions doped in host fluorophosphate glasses were prepared. • Optical and FT infrared absorption techniques were applied to study the spectral properties of the glasses. • Photoluminescence properties were measured. • Collective spectroscopic variations generated by gamma irradiation were investigated.
Energy Technology Data Exchange (ETDEWEB)
J. M. Capron
2008-06-27
The 100-F-52 waste site consisted of the soil under and around the former 146-FR Radioecology and Aquatic Biology Laboratory. The laboratory was used for studies of the effects of pre-reactor and post-reactor process water on fish eggs, young fish, and other small river creatures of interest. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.
Directory of Open Access Journals (Sweden)
Paknejad O
2011-02-01
Full Text Available "nBackground: Asthma is a life-threatening disease that can cause death due to bronchospasm. In addition to clinical symptoms such as wheezing, acute paroxysmal dyspnea, chronic cough after exposure to cold air or cough after exercise, spirometry is also necessary for the diagnosis of asthma. The association between respiratory symptoms and a positive methacholine challenge test (MCT is still controversial. The aim of this study was to determine the association between methacholine test results and respiratory symptoms and allergy."n "nMethods: One hundred and forty-six patients with respiratory symptoms and normal baseline pulmonary function tests were enrolled in this cross-sectional study. The participants were divided into two groups according to their positive or negative response to MCT. The association between MCT and the clinical symptoms and allergy was later evaluated statistically."n "nResults: Out of 146 participants of the study 59 (40.4% were female and 87 (59.6% were male. The mean age of the participants was 33.8±13.8 years. Sixty-one patients (41.8% had positive results for the test. There was an association between a history of allergy, wheezing and age with positive MCT results. The other clinical signs had no association with the test."n "nConclusion: Methacholine challenge test is the best diagnostic test for ruling out asthma in patients with normal pulmonary function tests in whom we cannot definitely rule out asthma based solely on clinical symptoms. Nevertheless, in adults with a history of allergy, wheezing and also in patients below 30, the probability for a positive MCT is high.
Boyet, M.; Bouvier, A.; Frossard, P.; Hammouda, T.; Garçon, M.; Gannoun, A.
2018-04-01
The 146Sm-142Nd extinct decay scheme (146Sm half-life of 103 My) is a powerful tool to trace early Earth silicate differentiation. Differences in 142Nd abundance measured between different chondrite meteorite groups and the modern Earth challenges the interpretation of the 142Nd isotopic variations found in terrestrial samples because the origin of the Earth and the nature of its building blocks is still an ongoing debate. As bulk meteorites, the enstatite chondrites (EC) have isotope signatures that are the closest to the Earth value with an average small deficit of ∼10 ppm in 142Nd relative to modern terrestrial samples. Here we review all the Nd isotope data measured on EC so far, and present the first measurements on an observed meteorite fall Almahata Sitta containing pristine fragments of an unmetamorphosed enstatite chondrite belonging to the EL3 subgroup. Once 142Nd/144Nd ratios are normalized to a common chondritic evolution, samples from the EC group (both EL and EH) have a deficit in 142Nd but the dispersion is important (μ142 Nd = - 10 ± 12 (2SD) ppm). This scatter reflects their unique mineralogy associated to their formation in reduced conditions (low fO2 or high C/O). Rare-earth elements are mainly carried by the sulfide phase oldhamite (CaS) that is more easily altered than silicates by weathering since most of the EC meteorites are desert finds. The EL6 have fractionated rare-earth element patterns with depletion in the most incompatible elements. Deviations in Nd mass independent stable isotope ratios in enstatite chondrites relative to terrestrial standard are not resolved with the level of analytical precision achieved by modern mass spectrometry techniques. Here we show that enstatite chondrites from the EL3 and EL6 subgroups may come from different parent bodies. Samples from the EL3 subgroup have Nd (μ142 Nd = - 0.8 ± 7.0, 2SD) and Ru isotope ratios undistinguishable from that of the Bulk Silicate Earth. EL3 samples have never been
DEFF Research Database (Denmark)
Holmstrøm, K; Pedersen, A E; Gad, M
2017-01-01
Regulatory CD4(+) T cells (Tregs) are pivotal for prevention of autoimmunity. The use of Tregs is therefore of increasing interest in in vitro drug screening assays as well as for a cytotherapy per se against autoimmune disorders. For both purposes, in vitro expansion of peripheral blood Tregs...... in the same markers in activated tTregs as opposed to naïve tTregs. In vitro-expanded Tregs could be identified based on FOXP3 expression, but with loss of a discriminate profile for miRNA candidates and a decline in FOXP3 when activated tTregs were expanded. Our data demonstrate miR-146a and 142-3p...... and cytotherapy as FOXP3 is pivotal for suppressive function....
Radiological re-survey results at 146 West Central Avenue, Maywood, New Jersey (MJ034)
International Nuclear Information System (INIS)
Murray, M.E.; Johnson, C.A.
1994-05-01
Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from 1916 to 1959. During the early years of operation, MCW stored wastes and residues in low-lying areas west of the processing facilities and consequently some of the residuals containing radioactive materials migrated offsite to the surrounding area. Subsequently, the U.S. Department of Energy (DOE) designated for remedial action the old MCW property and several vicinity properties. Additionally, in 1984, the property at 146 West Central Ave., Maywood, New Jersey and properties in its vicinity were included as a decontamination research and development project under the DOE Formerly Utilized Sites Remedial Action Program. In 1987 and 1988, at the request of DOE, Oak Ridge National Laboratory (ORNL) conducted a radiological survey on this property. A report describing this survey was published in 1989. A second radiological survey by ORNL was conducted on this property in May 1993 at the request of DOE after an ad hoc radiological survey, requested by the property owner and conducted by Bechtel National, Inc. (BNI), identified some contamination not previously found by ORNL. The purpose of the second ORNL survey was to determine whether radioactive materials from the old MCW were present on the property, and if so, if radioactive materials present were above guidelines. A certified civil survey was requisitioned by ORNL to determine actual property boundaries before beginning the radiological re-survey. The re-survey included a surface gamma scan and the collection of a large number of soil samples for radionuclide analyses. Results of this survey demonstrated that although elevated residual thorium-232 contamination was present in a few isolated spots on the southern end of the backyard, it did not exceed DOE guidelines
Linhares, Eduardo; Gonçalves, Rinaldo; Valadão, Marcus; Vilhena, Bruno; Herchenhorn, Daniel; Romano, Sergio; Ferreira, Maria Aparecida; Ferreira, Carlos Gil; Ramos, Cintia de Araujo; de Jesus, José Paulo
2011-01-01
To evaluate the treatment of GIST in INCA. We conducted a retrospective analysis of all cases of GIST treated at INCA in the period from 1997 to 2009. We analyzed 146 patients with a mean age of 44.5 years and female predominance. The main symptom was abdominal pain. We observed the occurrence of a second primary tumor in 22% of cases and 92% of the immunohistochemistry exams were positive for CD117. The most frequent location was in the stomach and the high-risk group was predominant. Surgery was considered R0 (extensive) in 70% of the cases and the main sites of metastases were liver and peritoneum. Overall survival in two and five years was, respectively, 86% and 59%. There was a significant difference between overall survival (p = 0.29) of the high-risk group versus the other. Our patients presented mainly in the form of high-risk disease, with obvious impact on survival. The use of imatinib improved survival of patients with recurrent and metastatic disease. We should study its use in the setting of adjuvant and neoadjuvant therapy to improve results of the high risk group. The creation of reference centers is a need for the study of rare diseases.
Preparation of plutonium waste forms with ICPP calcined high-level waste
Energy Technology Data Exchange (ETDEWEB)
Staples, B.A.; Knecht, D.A. [Lockheed Idaho Technologies Co., Idaho Falls, ID (United States); O`Holleran, T.P. [Argonne National Lab.-West, Idaho Falls, ID (United States)] [and others
1997-05-01
Glass and glass-ceramic forms developed for the immobilization of calcined high-level wastes generated by Idaho Chemical Processing Plant (ICPP) fuel reprocessing activities have been investigated for ability to immobilize plutonium and to simultaneously incorporate calcined waste as an anti-proliferation barrier. Within the forms investigated, crystallization of host phases result in an increased loading of plutonium as well as its incorporation into potentially more durable phases than the glass. The host phases were initially formed and characterized with cerium (Ce{sup +4}) as a surrogate for plutonium (Pu{sup +4}) and samarium as a neutron absorber for criticality control. Verification of the surrogate testing results were then performed replacing cerium with plutonium. All testing was performed with surrogate calcined high-level waste. The results of these tests indicated that a potentially useful host phase, based on zirconia, can be formed either by devitrification or solid state reaction in the glass studied. This phase incorporates plutonium as well as samarium and the calcined waste becomes part of the matrix. Its ease of formation makes it potentially useful in excess plutonium dispositioning. Other durable host phases for plutonium and samarium, including zirconolite and zircon have been formed from zirconia or alumina calcine through cold press-sintering techniques and hot isostatic pressing. Host phase formation experiments conducted through vitrification or by cold press-sintering techniques are described and the results discussed. Recommendations are given for future work that extends the results of this study.
Preparation of plutonium waste forms with ICPP calcined high-level waste
International Nuclear Information System (INIS)
Staples, B.A.; Knecht, D.A.; O'Holleran, T.P.
1997-05-01
Glass and glass-ceramic forms developed for the immobilization of calcined high-level wastes generated by Idaho Chemical Processing Plant (ICPP) fuel reprocessing activities have been investigated for ability to immobilize plutonium and to simultaneously incorporate calcined waste as an anti-proliferation barrier. Within the forms investigated, crystallization of host phases result in an increased loading of plutonium as well as its incorporation into potentially more durable phases than the glass. The host phases were initially formed and characterized with cerium (Ce +4 ) as a surrogate for plutonium (Pu +4 ) and samarium as a neutron absorber for criticality control. Verification of the surrogate testing results were then performed replacing cerium with plutonium. All testing was performed with surrogate calcined high-level waste. The results of these tests indicated that a potentially useful host phase, based on zirconia, can be formed either by devitrification or solid state reaction in the glass studied. This phase incorporates plutonium as well as samarium and the calcined waste becomes part of the matrix. Its ease of formation makes it potentially useful in excess plutonium dispositioning. Other durable host phases for plutonium and samarium, including zirconolite and zircon have been formed from zirconia or alumina calcine through cold press-sintering techniques and hot isostatic pressing. Host phase formation experiments conducted through vitrification or by cold press-sintering techniques are described and the results discussed. Recommendations are given for future work that extends the results of this study
International Nuclear Information System (INIS)
Tannenbaum, M.J.
1994-01-01
An 'intermittency' analysis of charged particle multiplicity data from the target multiplicy array (TMA) in central collisions of 16 O+Cu at 14.6 AxGeV/c has been published by the AGS-E802 collaboration. The centrality cut was made using the Zero degree Calorimeter and requiring that the forward energy be less than one projectile nucleon (i.e. T ZCAL 16 O+Cu collisions is found to exhibit an apparently linear increase with the δη interval, albeit with a much steeper slope than for the other reactions, and a non-zero intercept, k(0)≠0. True intermittency, ξ→0, would occur if the intercept k(0)→0, which is not observed in any experiment. The correlation length for central 16 O+Cu collisions, although smaller than expected, is quite finite and can be measured - which means that a length scale exists in these collisions and therefore there is no intermittency in the multiplicity fluctuations
Energy Technology Data Exchange (ETDEWEB)
Gonzalez Z, M A [Departamento de Medicina Nuclear, Instituto Nacional de Pediatria (Mexico); Ferro F, G [Departamento de Materiales Radiactivos, Instituto nacional de Investigaciones Nucleares, Salazar, Estado de Mexico C.P. 52045 (Mexico); Rivera M, T; Azorin N, J [Departamento de Fisica, UAM Iztapalapa, Mexico D.F. (Mexico)
1999-07-01
It was developed a new formulation of macro aggregates of Samarium 153 ({sup 153} Sm-MH) for the arthropaties treatment. The radio pharmaceutic was prepared by reaction of Samarium 153 chloride (SmCl{sub 3}) in aqueous environment with sodium boron hydride in NaOH 0.5 N. The microscopic analysis shown that the particles have an average size of 4% m (range 1-14 {mu} m). The velocity of sedimentation was 0.008 cm/min with high stability in vitro in human serum. The biological studies in healthy rabbits, shown that the complex is retained inside the articulation still eight days after of the administration of the radiopharmaceutical. Likewise, it is presented the data of absorbed dose in the different target organs, which was determined by thermoluminescent dosimetry (TLD) through the use of a REMCAL phantom (radiation equivalent manikin calibration). (Author)
Preparation and dosimetry of radiotherapeutic particles for arthropaties
International Nuclear Information System (INIS)
Gonzalez Z, M.A.; Ferro F, G.; Rivera M, T.; Azorin N, J.
1999-01-01
It was developed a new formulation of macro aggregates of Samarium 153 ( 153 Sm-MH) for the arthropaties treatment. The radio pharmaceutic was prepared by reaction of Samarium 153 chloride (SmCl 3 ) in aqueous environment with sodium boron hydride in NaOH 0.5 N. The microscopic analysis shown that the particles have an average size of 4% m (range 1-14 μ m). The velocity of sedimentation was 0.008 cm/min with high stability in vitro in human serum. The biological studies in healthy rabbits, shown that the complex is retained inside the articulation still eight days after of the administration of the radiopharmaceutical. Likewise, it is presented the data of absorbed dose in the different target organs, which was determined by thermoluminescent dosimetry (TLD) through the use of a REMCAL phantom (radiation equivalent manikin calibration). (Author)
Simplified syntheses of the water-soluble chiral shift reagents Sm-(R)-pdta and Sm-(S)-pdta
Czech Academy of Sciences Publication Activity Database
Hrubá, L.; Buděšínský, Miloš; Pícha, Jan; Jiráček, Jiří; Vaněk, Václav
2013-01-01
Roč. 54, č. 47 (2013), s. 6296-6297 ISSN 0040-4039 Institutional support: RVO:61388963 Keywords : NMR * chiral shift reagents * Sm-pdta * PDTA * samarium * 1,2-diaminopropane Subject RIV: CC - Organic Chemistry Impact factor: 2.391, year: 2013
Chemical ordering around open-volume regions in bulk metallic glass Zr52.5Ti5Al10Cu17.9Ni14.6
International Nuclear Information System (INIS)
Asoka-Kumar, P.; Hartley, J.; Howell, R.; Sterne, P. A.; Nieh, T. G.
2000-01-01
We provide direct experimental evidence for a nonrandom distribution of atomic constituents in Zr 52.5 Ti 5 Al 10 Cu 17.9 Ni 14.6 bulk metallic glass using positron annihilation spectroscopy. The Ti content around the open-volume regions is significantly enhanced at the expense of Ni and Cu. Our results indicate that Ni and Cu atoms closely occupy the volume bounded by their neighboring atoms while Al, Ti, and Zr are less closely packed, and more likely to be associated with the open-volume regions. The overall distribution of elements seen by the positron is not significantly altered by annealing or by crystallization. Theoretical calculations indicate that the observed elemental distribution is not consistent with the known crystalline phases Zr 2 Cu and NiZr 2 , while Al 3 Zr 4 shows some of the characteristics seen in the experiment. (c) 2000 American Institute of Physics
International Nuclear Information System (INIS)
Capron, J.M.
2008-01-01
The 100-F-52 waste site consisted of the soil under and around the former 146-FR Radioecology and Aquatic Biology Laboratory. The laboratory was used for studies of the effects of pre-reactor and post-reactor process water on fish eggs, young fish, and other small river creatures of interest. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River
A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...
African Journals Online (AJOL)
2017 Chemical Society of Ethiopia and The Authors ... 1Institute of Applied Chemistry, School of Chemistry and Chemical Engineering, Jinggangshan ... 3State Key Laboratory of Structural Chemistry, Fujian Institute of Research ... INTRODUCTION ..... Fenamate cocrystals with 4,4'-bipyridine: structural and thermodynamic ...
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... and theoretical aspects of fundamental symmetry violations in atoms .... The current status of and achievements in targets are provided and validation experiments are ... of samarium by spectrally resolved laser-induced fluorescence technique .... Surface roughness-aided hard X-ray emission from carbon nanotubes.
Analysis of bioactive glasses obtained by sol-gel processing for radioactive implants
Directory of Open Access Journals (Sweden)
Roberto Wanderley dos Santos
2003-01-01
Full Text Available This paper presents the chemical and physical characterizations of SiO2 and SiO2-CaO bioactive glasses incorporated with samarium atoms, produced by sol-gel synthesis. The objective is to provide biocompatible and biodegradable radioactive seeds as an alternative to be used in Brachytherapy for the treatment of prostate cancer. The glasses were produced and analyzed by X-ray fluorescence spectroscopy (XRF, energy dispersive X-ray spectroscopy (EDS, scanning electron microscopy (SEM, He picnometry and nitrogen adsorption analysis. A theoretical evaluation of the specific activity of the samples upon neutron activation is proposed. The XRF and EDS results demonstrate the incorporation of samarium atoms in the glass matrix. The experimental data coupled with the theoretical studies in neutron activation suggest that it is possible to obtain radioactive seeds with activities equivalent to 125I seeds used in brachytherapy prostatic.
International Nuclear Information System (INIS)
Ahle, L.; Baker, M.D.; Cianciolo, V.; Costales, J.B.; Dunlop, J.C.; Heintzelman, G.; Judd, E.; Kehoe, W.L.; Ledoux, R.J.; Morrison, D.P.; Morse, R.J.; Ogilvie, C.A.; Parsons, C.G.; Rothschild, P.; Soltz, R.A.; Steadman, S.G.; Stephans, G.S.F.; Sung, T.W.; Vutsadakis, V.; Woodruff, D.
2002-01-01
Two-pion correlation functions are analyzed at midrapidity for three systems (14.6A GeV/c Si+Al, Si+Au, and 11.6A GeV/c Au+Au), seven distinct centrality conditions, and different k T bins in the range 0.1-0.5 GeV/c. Source reference frames are determined from fits to the Yano-Koonin source parametrization. Bertsch-Pratt radius parameters are shown to scale linearly with both number of projectile and total participants as obtained from a Glauber model calculation. A finite lifetime parameter that increases linearly with system/centrality is also reported. The m T dependences of the Bertsch-Pratt radii for the central Si+Au and central Au+Au systems differ only by an overall normalization factor given by the measured system/centrality dependence
Pain therapy with Samario 153-EDTM in prostate cancer. Pilot experience in Paraguay
International Nuclear Information System (INIS)
Jara Yorg, Jorge
2001-07-01
To relieve the skeletal pain in metastasis disseminated in bones, numerous radiotracers have been used without achieving important clinical acceptance. The SAMARIUM 153 EDT (Etilendiaminetrametilen acid phosphonic) is a radiopharmaceutic that is chemically and biologically stable and preferably concentrates on the skeletal metastasis [es
Electric Field-Assisted Pressureless Sintering of Ceramic Protonic Conductors
DEFF Research Database (Denmark)
Muccillo, R.; Esposito, Vincenzo; Zanetti De Florio, Daniel
2017-01-01
Gadolinium, yttrium and samarium-doped barium cerate (BCGd, BCY and BCSm, respectively) polycrystalline green pellets were submitted to electric field-assisted pressureless sintering experiments isothermally in the temperature range 800-1200oC under 100-200 V cm-1 electric fields, limiting to 1-5...
A convenient method for the conversion of N-acyloxazolidinones to hydroxamic acids.
Sibi, Mukund P; Hasegawa, Hikaru; Ghorpade, Sandeep R
2002-10-03
Treatment of N-acyloxazolidinones with hydroxylamines using samarium triflate as a Lewis acid provides the corresponding hydroxamic acids in 50-98% yields at room temperature. The conversion proceeds with high degree of chemoselectivity and without racemization of chiral centers alpha- to the acyl group. [reaction: see text
Biological evaluation of 153Sm-ethylenediaminetetra methylene phosphonate (EDTMP)
International Nuclear Information System (INIS)
Ranganatha, D.K.; Lal, Ramji
1997-01-01
Samarium-153 EDTMP has been studied in rats to establish bone localisation in normal bone tissue and the uptake in the soft tissue. Biodistribution results were highly promising with >3% of the injected dose localizing in the femurs and 15 days. (author). 4 refs., 2 tabs
2. Home 3. Journals 4. Bulletin of Materials Science 5. Volume 28 6 ...
Indian Academy of Sciences (India)
483. Acceptor. Study on electrical properties of Ni-doped SrTiO3 ceramics .... Effect of Cr and Ni on diffusion bonding of Fe3Al with steel. 63. Creep ... Oriented growth of thin films of samarium oxide by MOCVD. 49 .... Grain boundary. Study on ...
Electric Field-Assisted Pressureless Sintering of Ceramic Protonic Conductors
DEFF Research Database (Denmark)
Muccillo, R.; Esposito, Vincenzo; de Florio, D. Z.
2017-01-01
Gadolinium, yttrium and samarium-doped barium cerate pressed pellets were submitted to flash sintering experiments isothermally in the temperature range 800-1300oC under 200 V cm-1 electric field. The pellets were positioned inside a dilatometer furnace with Pt-Ir electrodes connected either to a...
Energy Technology Data Exchange (ETDEWEB)
Tournier, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1964-10-15
In this work we have developed a simple method for determining the diffusion constants and the solid-state solubilities of a metal which is volatile and only slightly soluble in second metal. This method has been applied to the behaviour of certain fission products in {gamma} uranium: strontium, barium, lanthanum, samarium and cerium. This work has made it possible to show the effect of the atomic radius of the solute on the diffusion constants. (author) [French] Dans ce travail nous avons mis au point une methode simple permettant de determiner les constantes de diffusion ainsi que les solubilites a l'etat solide d'un metal volatil et peu soluble dans un autre. Cette methode a ete appliquee au comportement de certains produits de fission dans l'uranium {gamma}: strontium, baryum, lanthane, samarium et cerium. Cette etude a permis de mettre en evidence le role du rayon atomique du solute sur les constantes de diffusion. (auteur)
International Nuclear Information System (INIS)
Kobayashi, Tohru; Kato, Toshiyuki; Kurata-Nishimura, Mizuki; Matsuo, Yukari; Kawai, Jun; Motobayashi, Tohru; Hayashizaki, Yoshihide
2007-01-01
We report that the kinetic energy of samarium (Sm) atom and Sm + ion produced by femtosecond laser ablation of solid samarium is strongly dependent on the number of ablation laser shots in the range from 1 to 10. By ablating the fresh surface (i.e. 1st shot), we find the kinetic energy of both Sm and Sm + ion to be the largest (24 and 250 eV, respectively). Almost 10 times larger kinetic energy of Sm + ion than that of Sm clearly indicates the contribution of Coulomb explosion in the acceleration process. From the second shot, kinetic energies of Sm and Sm + ion are lower than those of the first shot and almost constant (ca. 12 and 80 eV, respectively). This behaviour suggests the change in the nature of the solid surface after femtosecond laser ablation, which can be explained by the amorphization of ablated sample surface reported in recent studies
Spontaneous and stimulated emission in Sm3+-doped YAl3(BO3)4 single crystal
International Nuclear Information System (INIS)
Ryba-Romanowski, Witold; Lisiecki, Radosław; Beregi, Elena; Martín, I.R.
2015-01-01
Single crystals of YAl 3 (BO 3 ) 4 doped with trivalent samarium were grown by the top-seeded high temperature solution method and their absorption and emission spectra were investigated. Optical pumping into prominent absorption band around 405 nm feeds the 4 G 5/2 metastable level giving rise to intense visible luminescence distributed in several spectral lines with the most intense line around 600 nm characterized by a branching ratio of 0.42 and peak emission cross section of 0.25×10 −20 cm 2 . Optical amplification at 600 nm with a gain coefficient of 2.9 cm −1 was achieved during a pump-and-probe experiment. - Highlights: • YAB:Sm crystal grown by the top-seeded high temperature solution method. • Spectroscopic qualities relevant for visible laser operation. • YAB:Sm single crystal used in a pump-and-probe experiment. • Optical amplification properties of samarium doped YAl 3 (BO 3 ) 4
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
It is observed that. the dielectric permittivity () and loss tangent (tan ) are dependent on frequency,; the temperature of dielectric permittivity maximum shifts toward lower temperature side with the increase of samarium ion (Sm+3) concentration at the Pb sites, and; observed and calculated -values of XRD patterns show ...
Tuning the activity of Pt alloy electrocatalysts by means of the lanthanide contraction
DEFF Research Database (Denmark)
Escribano, Maria Escudero; Malacrida, Paolo; Hansen, Martin Hangaard
2016-01-01
is lanthanum, cerium, samarium, gadolinium, terbium, dysprosium, thulium, or calcium. The materials are among the most active polycrystalline Pt-based catalysts reported, presenting activity enhancement by a factor of 3 to 6 over Pt. The active phase consists of a Pt overlayer formed by acid leaching. The ORR...
Bonnet, Fanny; Dyer, Hellen E.; El Kinani, Yassine; Dietz, Carin; Roussel, Pascal; Bria, Marc; Visseaux, Marc; Zinck, Philippe; Mountford, Philip
2015-01-01
New bis(phenolate)amine-supported neodymium borohydride complexes and their previously reported samarium analogues were tested as catalysts for the polymerisation of styrene and isoprene. Reaction of Na2O2NL (L = py, OMe, NMe2) with Nd(BH4)3(THF)3 afforded the borohydride complexes
Separation and purification of gadolinium and others rare earths, and yttrium
International Nuclear Information System (INIS)
Awwal, M.A.; Filgueiras, S.A.C.
1988-01-01
The experimental works in laboratories for developing a solvent extraction process with the purpose of gadolinium separation and purification, and secondarily samarium, europium, lanthanum and yttrium are described. Using as solvent di-2-ethylhexylphosphoric acid (DEHPA) a preliminary flow chart for separation for these elements are developed. (author)
Nonlinear elastic properties of bulk metallic glasses Zr52.5Ti5Cu17.9Ni14.6Al10 and Pd40Cu30Ni10P20
International Nuclear Information System (INIS)
Kobelev, N.P.; Kolyvanov, E.L.; Khonik, V.A.
2005-01-01
The influence of uniaxial compression on the propagation of ultrasonic vibrations in Zr 52.5 Ti 5 Cu 17.9 Ni 14.6 Al 10 and Pd 40 Cu 30 Ni 10 P 20 bulk metallic glasses produced by melt quenching at a rate of 100 K/s is investigated. Elastic deformation was realized by compression of the samples along their long axis up to strains of about 1 GPa. Deriving of major ratios used during the calculation of the third-order elastic moduli of the glasses is described in brief, the results of the calculations being provided. A qualitative agreement between the calculated results and available data on the influence of the uniform pressure on the sound wave propagation rate was obtained [ru
Directory of Open Access Journals (Sweden)
Rebecca C. Schugar
2009-01-01
Full Text Available Human umbilical cord blood is an excellent primitive source of noncontroversial stem cells for treatment of hematologic disorders; meanwhile, new stem cell candidates in the umbilical cord (UC tissue could provide therapeutic cells for nonhematologic disorders. We show novel in situ characterization to identify and localize a panel of some markers expressed by mesenchymal stromal cells (MSCs; CD44, CD105, CD73, CD90 and CD146 in the UC. We describe enzymatic isolation and purification methods of different UC cell populations that do not require manual separation of the vessels and stroma of the coiled, helical-like UC tissue. Unique quantitation of in situ cell frequency and stromal cell counts upon harvest illustrate the potential to obtain high numerical yields with these methods. UC stromal cells can differentiate to the osteogenic and chondrogenic lineages and, under specific culturing conditions, they exhibit high expandability with unique long-term stability of their phenotype. The remarkable stability of the phenotype represents a novel finding for human MSCs, from any source, and supports the use of these cells as highly accessible stromal cells for both basic studies and potentially therapeutic applications such as allogeneic clinical use for musculoskeletal disorders.
Measurement of total angular momentum values of high-lying even ...
Indian Academy of Sciences (India)
Spectrally resolved laser-induced fluorescence technique was used to uniquely assign total angular momentum () values to high-lying even-parity energy levels of atomic samarium. Unique value assignment was done for seven energy levels in the energy region 34,800–36,200 cm-1 , recently observed and reported in ...
Study of 148-152Sm nuclei employing γ - derived from B(E2) values and level energies
International Nuclear Information System (INIS)
Sharma, Aparna; Varshney, A.K.; Singh, M.; Gupta, D.K.; Singh, Yuvraj; Gupta, K.K.; Bihari, Chhail; Varshney, Mani
2011-01-01
The study of samarium nuclei has been a challenging theoretical problem, since they lie in the range from near spherical to well deformed shapes. 148 Sm was believed to be basically spherical while 154 Sm is thought to be well deformed nucleus and 150-15 '2Sm are transitional nuclei
International Nuclear Information System (INIS)
Del' Pino, Kh.; Chukurov, P.M.; Drakin, S.I.
1980-01-01
Analyzed are the results of experimental depermination of formation enthalpies of waterless nitrates of lanthane cerium, praseodymium, neodymium and samarium. Using method of comparative calculation computed are enthalpies of formation of waterless lanthanide and yttrium nitrates. Calculated values of enthalpies and Gibbs energies of waterless lanthanide nitrate formation are tabulated
Perovskite catalysts for oxidative coupling
Campbell, Kenneth D.
1991-01-01
Perovskites of the structure A.sub.2 B.sub.2 C.sub.3 O.sub.10 are useful as catalysts for the oxidative coupling of lower alkane to heavier hydrocarbons. A is alkali metal; B is lanthanide or lanthanum, cerium, neodymium, samarium, praseodymium, gadolinium or dysprosium; and C is titanium.
Samarium-cobalt type rare earth permanent magnets
International Nuclear Information System (INIS)
Kamat, S.V.
2014-01-01
Permanent magnets are one of the oldest and largest applications of magnetic materials and form an integral part of our modern industrial society. They belong to a special class of functional materials and are characterized for remanence (flux output from the magnet), coercivity (resistance to demagnetization) and energy product (material energy density) from the second quadrant of the magnetic hysteresis loop. The reliability, stability, size, weight, cost and performance of many electro-technical devices depend mainly on the properties of permanent magnets used in them. There are three important families of permanent magnets viz., Ferrites, Alnicos and Rare Earth Permanent Magnets (REPMs) with energy product values ranging from 3 to 50 MGOe and among the front ranking high performance REPMs, SmCo 5 , Sm 2 Co 17 type and NdFeB alloys are technologically the most important materials. They are used in a wide range of applications ranging from consumer products to very specialized areas of tele-communications, microelectronics, defence, space, avionics etc. While NdFeB has the highest energy product, Sm-Co based magnets are preferred for most critical applications where temperature stability of magnetic properties is essential because of their significantly higher Curie temperatures. In this presentation some of the key challenges associated with these Sm-Co based rare earth permanent magnets will be highlighted. (author)
Samarium-cobalt-copper-iron-titanium permanent magnets
International Nuclear Information System (INIS)
Inomata, K.; Yamada, M.
1980-01-01
A permanent magnet, which comprises a composition containing a Sm-Co compound and consisting essentially of 23 to 30 wt.% of Sm, 0.2 to 1.5 wt.% Ti, 9 to 13 wt., Cu, 3 to 12 wt.% Fe and the balance Co, said magnet having a residual flux density (Br) of about 10 (kG), a coercive force (IC) of about 8 (KOe) and a maximum energy product (BH max) of about 25 (MGOe), having the aforesaid magnetic properties without the necessity of an ageing treatment
Vaporization of Samarium trichloride studied by thermogravimetry
International Nuclear Information System (INIS)
Esquivel, Marcelo R.; Pasquevich, Daniel M.
2003-01-01
In the present work, the vaporization reaction of SmCl 3 (l) obtained from the 'in situ' reaction of Sm 2 O 3 (s) and Cl 2 (g)-C(s) was studied by thermogravimetry under controlled atmosphere. The effects of both the temperature between 825 C degrees and 950 C degrees and the total flow gas on the vaporization rate of the following reaction: SmCl 3 (l) = SmCl 3 (g) were analyzed. The vaporization rate of the process was found to be independent of then total gas flow rate and highly dependent on the temperature. E ap calculation led to a value of 240 ± 10 kJ.mol -1 . A comparison between this value and that of the molar enthalpy of vaporization allow to the conclusion that the reaction occur in conditions near to equilibrium. The SmCl 3 identity was determined by X-ray diffraction (XRD) and energy dispersive spectroscopy (EDS). (author)
Reactive Materials for Evaporating Samarium (Pre-Print)
2016-04-15
further below in the sample were not effectively heated and did not ignite. Heat transfer was improved in pressed pellets, which were, therefore...particles. This combustion regime is most desired for Sm evaporation based on the measured mass of the remaining coarse condensed combustion products...the evaporated Sm could condense on top of the cooled burned out pellet, forming the surface coating. Further EDX characterization qualitatively
Coupled IVPs to Investigate a Nuclear Reactor Poison Burn Up
Faghihi, F.; Saidi-Nezhad, M.
2009-09-01
A set of coupled IVPs that describe the change rate of an important poison, in a nuclear reactor, has been written herein. Specifically, in this article, we have focused on the samarium-149 (as a poison) burnup in a desired pressurized water nuclear reactor and its concentration are given using our MATLAB-linked "solver."
Coupled IVPs to Investigate a Nuclear Reactor Poison Burn Up
International Nuclear Information System (INIS)
Faghihi, F.
2009-01-01
A set of coupled IVPs that describe the change rate of an important poison, in a nuclear reactor, has been written herein. Specifically, in this article, we have focused on the samarium-149 (as a poison) burnup in a desired pressurized water nuclear reactor and its concentration are given using our MATLAB-linked 'solver'.
Energy Technology Data Exchange (ETDEWEB)
Caro, R; Gallego, J; Martinez Fanegas, R
1977-07-01
In this report the time evolution analysis of the nuclides concentration Xe-135 and Sm-149 as a function of the neutron flux is carried out. The neutron flux may be any function of time. It is analyzed as well the reactivity changes associated with the xenon and samarium concentration variations. (Author) 5 refs.
Xe-135 and Sm-149 Isotopic Evolution Analysis Xesamo code
International Nuclear Information System (INIS)
Caro, R.; Gallego, J.; Martinez Fanegas, R.
1977-01-01
In this report the time evolution analysis of the nuclides concentration Xe-135 and Sm-149 as a function of the neutron flux is carried out. The neutron flux may be any function of time. It is analyzed as well the reactivity changes associated with the xenon and samarium concentration variations. (Author) 5 refs
International Nuclear Information System (INIS)
DaSilva, J.N.; Crouzel, C.
1990-01-01
Glucocorticoids appear to exert physiologic, biochemical and behavioral effects on the central nervous system (1). The presence of glucocorticoid binding sites have been demonstrated in human brain by autoradiographic studies (2). In order to visualize the brain glucocorticoid binding sites by PET, the authors have synthesized n.c.a. 11,17β-dihydroxy-6-methyl-17α-(3-[ 18 F]fluoroprop-1-ynyl)androsta-1,4,6-trien-3-one, a fluorine-18 analog of the selective type II glucocorticoid receptor agonist RU 28362 (3). Biodistribution studies in mature male rats and in vivo distribution of 2 by PET on a baboon are in progress
Structural and Spectroscopic Studies of Sm3+/CdS Nanocrystallites in Sol-Gel TiO2-ZrO2 Matrix
Karthika, S.; Prathibha, Vasudevan; Ann, Mary K. A.; Viji, Vidyadharan; Biju, P. R.; Unnikrishnan, N. V.
2014-02-01
A sol-gel method was used to prepare titania-zirconia matrices doped with Sm3+/CdS nanocrystallites. The structural properties of the matrices were characterized using transmission electron microscopy (TEM), thermogravimetric analysis (TGA), differential thermal analysis (DTA), and Fourier-transform infrared spectroscopy studies. The thermal stability of the material was determined by TGA/DTA analysis. The absorption spectrum shows the characteristic peaks of the Sm3+ ions and the absorption peak corresponding to the CdS nanocrystallites. The optical bandgap and size of the CdS nanoparticles were calculated from the absorption spectrum. From TEM, the interplanar distance ( d) was estimated to be 3.533 Å, which matches with the (1 0 0) plane of bulk CdS. The measurements yield a nanocrystallite size of around 7.8 nm. The optical absorption and emission spectra confirmed the formation of CdS nanoparticles along with samarium ions in the titania-zirconia matrices. The fluorescence intensity of the samarium ions was found to be greatly enhanced by codoping with CdS nanocrystallites.
Viability of biocompatible and biodegradable seeds production with incorporated radionuclides
International Nuclear Information System (INIS)
Roberto, W.S.; Pereira, M.M.; Vasconcelos, W.L.; Campos, T.P.R.
2000-01-01
The present work aims the development of radioactive seeds, biocompatible and biodegradable, with the objective of adding options in the cancer treatment. The work focus on the production of seeds biodegradable that incorporate radioisotopes with half life inferior than the degradation time of the material. The idea of producing devices with biodegradable materials impregnated with radioisotopes of short half life will offer new possibilities in the cancer treatment, since they can be used following the same procedures of the permanent interstitial brachytherapy, but using degradable materials compatible with the physiological environment. It will be discussed in particular the possible application of these seeds in the treatment of prostate cancer. A review of the subject and a preliminary evaluation of the viability of production of the seeds will be presented. The method of production of the seeds is based on the incorporation of Iodine and Samarium in glass matrixes obtained by sol-gel processing. X-ray fluorescence was done in the samples produced and the incorporation of Iodine and Samarium atoms was confirmed. (author)