saltstone 4qcy09 tclp: Topics by WorldWideScience.org

Sample records for saltstone 4qcy09 tclp

Saltstone 4QCY08 TCLP Results

International Nuclear Information System (INIS)

Cozzi, A.

2009-01-01

The Saltstone Production Facility (SPF) receives waste from Tank 50H for treatment. In the fourth quarter of the 2008 calendar year (4QCY08), Tank 50 accepted transfers of approximately 15 kgal from the Effluent Treatment Project (ETP) waste, approximately 12 kgal from Tank 710-the H-Canyon General Purpose Evaporator, approximately 5 kgal from the H-Canyon Super Kukla campaign, and approximately 34 kgal from the Modular Caustic Side Solvent Extraction Unit (MCU) Decontaminated Salt Solution Hold Tank (DSS-HT). The Saltstone Grout Sampling plan provides the South Carolina Department of Health and Environmental Control (SCDHEC) with the chemical and physical characterization strategy for the salt solution which is to be disposed of in the Z-Area Solid Waste Landfill (ISWLF).1 During operation, samples were collected from Tank 50H and grout samples prepared to determine the non-hazardous nature of the grout to meet the requirements of the South Carolina Hazardous Waste Management Regulations (SCHWMR) R.61-79.261.24(b) and R.61-79.268.48(a). SRNL was asked to prepare saltstone from a sample of Tank 50H obtained October 29, 2008 during 4QCY08 to determine the non-hazardous nature of the grout. The samples were cured and shipped to Babcock and Wilcox Technical Services Group-Radioisotope and Analytical Chemistry Laboratory (B and WTSG-RACL) to perform the Toxic Characteristic Leaching Procedure (TCLP)2 and subsequent extract analysis on saltstone samples for the analytes required for the quarterly analysis saltstone sample. In addition to the eight toxic metals-arsenic, barium, cadmium, chromium, mercury, lead, selenium and silver-analytes included the underlying hazardous constituents (UHC) antimony, beryllium, nickel, and thallium which could not be eliminated from analysis by process knowledge.3 B and WTSG-RACL provided subsamples to GEL Laboratories, LLC for analysis for the UHCs benzene, phenols and total and amenable cyanide. A Saltstone waste form was prepared in
Saltstone 3QCY12 TCLP Results

Energy Technology Data Exchange (ETDEWEB)

Eibling, R. E.

2012-12-19

A Saltstone waste form was prepared in the Savannah River National Laboratory (SRNL) from a Tank 50H sample and Z-Area premix material for the third quarter of calendar year 2012 (3QCY12). After a 34 day cure, samples of the saltstone were collected, and the waste form was shown to meet the South Carolina Hazardous Waste Management Regulations (SCHWMR) R.61-79.261.24 and R.61-79.268.48(a) requirements for a nonhazardous waste form with respect to RCRA metals and underlying hazardous constituents. These analyses met all quality assurance specifications of USEPA SW-846.
1QCY17 Saltstone waste characterization analysis

Energy Technology Data Exchange (ETDEWEB)

Johnson, F. C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2017-07-25

In the first quarter of calendar year 2017, a salt solution sample was collected from Tank 50 on January 16, 2017 in order to meet South Carolina (SC) Regulation 61-107.19 Part I C, “Solid Waste Management: Solid Waste Landfills and Structural Fill – General Requirements” and the Saltstone Disposal Facility Class 3 Landfill Permit. The Savannah River National Laboratory (SRNL) was requested to prepare and ship saltstone samples to a United States Environmental Protection Agency (EPA) certified laboratory to perform the Toxicity Characteristic Leaching Procedure (TCLP) and subsequent characterization.
SALTSTONE VAULT CLASSIFICATION SAMPLES MODULAR CAUSTIC SIDE SOLVENT EXTRACTION UNIT/ACTINIDE REMOVAL PROCESS WASTE STREAM APRIL 2011

Energy Technology Data Exchange (ETDEWEB)

Eibling, R.

2011-09-28

Savannah River National Laboratory (SRNL) was asked to prepare saltstone from samples of Tank 50H obtained by SRNL on April 5, 2011 (Tank 50H sampling occurred on April 4, 2011) during 2QCY11 to determine the non-hazardous nature of the grout and for additional vault classification analyses. The samples were cured and shipped to Babcock & Wilcox Technical Services Group-Radioisotope and Analytical Chemistry Laboratory (B&W TSG-RACL) to perform the Toxic Characteristic Leaching Procedure (TCLP) and subsequent extract analysis on saltstone samples for the analytes required for the quarterly analysis saltstone sample. In addition to the eight toxic metals - arsenic, barium, cadmium, chromium, mercury, lead, selenium and silver - analytes included the underlying hazardous constituents (UHC) antimony, beryllium, nickel, and thallium which could not be eliminated from analysis by process knowledge. Additional inorganic species determined by B&W TSG-RACL include aluminum, boron, chloride, cobalt, copper, fluoride, iron, lithium, manganese, molybdenum, nitrate/nitrite as Nitrogen, strontium, sulfate, uranium, and zinc and the following radionuclides: gross alpha, gross beta/gamma, 3H, 60Co, 90Sr, 99Tc, 106Ru, 106Rh, 125Sb, 137Cs, 137mBa, 154Eu, 238Pu, 239/240Pu, 241Pu, 241Am, 242Cm, and 243/244Cm. B&W TSG-RACL provided subsamples to GEL Laboratories, LLC for analysis for the VOCs benzene, toluene, and 1-butanol. GEL also determines phenol (total) and the following radionuclides: 147Pm, 226Ra and 228Ra. Preparation of the 2QCY11 saltstone samples for the quarterly analysis and for vault classification purposes and the subsequent TCLP analyses of these samples showed that: (1) The saltstone waste form disposed of in the Saltstone Disposal Facility in 2QCY11 was not characteristically hazardous for toxicity. (2) The concentrations of the eight RCRA metals and UHCs identified as possible in the saltstone waste form were present at levels below the UTS. (3) Most of the
Characterization Of Core Sample Collected From The Saltstone Disposal Facility

International Nuclear Information System (INIS)

Cozzi, A.; Duncan, A.

2010-01-01

During the month of September 2008, grout core samples were collected from the Saltstone Disposal Facility, Vault 4, cell E. This grout was placed during processing campaigns in December 2007 from Deliquification, Dissolution and Adjustment Batch 2 salt solution. The 4QCY07 Waste Acceptance Criteria sample collected on 11/16/07 represents the salt solution in the core samples. Core samples were retrieved to initiate the historical database of properties of emplaced Saltstone and to demonstrate the correlation between field collected and laboratory prepared samples. Three samples were collected from three different locations. Samples were collected using a two-inch diameter concrete coring bit. In April 2009, the core samples were removed from the evacuated sample container, inspected, transferred to PVC containers, and backfilled with nitrogen. Samples furthest from the wall were the most intact cylindrically shaped cored samples. The shade of the core samples darkened as the depth of coring increased. Based on the visual inspection, sample 3-3 was selected for all subsequent analysis. The density and porosity of the Vault 4 core sample, 1.90 g/cm 3 and 59.90% respectively, were comparable to values achieved for laboratory prepared samples. X-ray diffraction analysis identified phases consistent with the expectations for hydrated Saltstone. Microscopic analysis revealed morphology features characteristic of cementitious materials with fly ash and calcium silicate hydrate gel. When taken together, the results of the density, porosity, x-ray diffraction analysis and microscopic analysis support the conclusion that the Vault 4, Cell E core sample is representative of the expected waste form.
Literature Review of the Effects of Tetraphenylborate on Saltstone Grout: Benzene Evolution and TCLP Performance

International Nuclear Information System (INIS)

HAY, MICHAEL

2004-01-01

As part of the program to disposition the tetraphenylborate (TPB) in Tank 48H and return the tank to service, Salt Processing Development requested a review of the literature to assess the state of knowledge pertaining to incorporation of tetraphenylborate slurries in saltstone grout with respect to benzene generation rates and leaching performance. Examination of past studies conducted at Savannah River Site (SRS) on the incorporation of TPB slurries in saltstone provides a basis for developing a more focused scope of experimental studies. Tank 48H currently contains potassium and cesium tetraphenylborate salts as a result of a demonstration of the In Tank Precipitation (ITP) process in 1983 and subsequent ITPradioactive start-up operations in 1995. The tank currently contains approximately 240,000 gallons of salt solution with approximately 19,000 kg of potassium and cesium tetraphenylborate salts. The presence of the TPB salts makes the waste incompatible with existing High Level Waste treatment facilities. The TPB salts in Tank 48H must be treated or removed to meet the scheduled return to service date of 2007. The two preferred options for disposition of the TBP slurries in Tank 48H include: (1) Aggregation of the material with the Defense Waste Processing Facility (DWPF) recycle stream and disposal in the Saltstone Processing Facility (SPF), and (2) In-Situ Thermal Decomposition using heat in combination with pH reduction and catalyst addition. The current literature review along with the current experimental studies provide a basis for determining the feasibility of the option to incorporate the TPB slurries into saltstone grout
Distribution Coeficients (Kd) Generated From A Core Sample Collected From The Saltstone Disposal Facility

International Nuclear Information System (INIS)

Almond, P.; Kaplan, D.

2011-01-01

Core samples originating from Vault 4, Cell E of the Saltstone Disposal Facility (SDF) were collected in September of 2008 (Hansen and Crawford 2009, Smith 2008) and sent to SRNL to measure chemical and physical properties of the material including visual uniformity, mineralogy, microstructure, density, porosity, distribution coefficients (K d ), and chemical composition. Some data from these experiments have been reported (Cozzi and Duncan 2010). In this study, leaching experiments were conducted with a single core sample under conditions that are representative of saltstone performance. In separate experiments, reducing and oxidizing environments were targeted to obtain solubility and Kd values from the measurable species identified in the solid and aqueous leachate. This study was designed to provide insight into how readily species immobilized in saltstone will leach from the saltstone under oxidizing conditions simulating the edge of a saltstone monolith and under reducing conditions, targeting conditions within the saltstone monolith. Core samples were taken from saltstone poured in December of 2007 giving a cure time of nine months in the cell and a total of thirty months before leaching experiments began in June 2010. The saltstone from Vault 4, Cell E is comprised of blast furnace slag, class F fly ash, portland cement, and Deliquification, Dissolution, and Adjustment (DDA) Batch 2 salt solution. The salt solution was previously analyzed from a sample of Tank 50 salt solution and characterized in the 4QCY07 Waste Acceptance Criteria (WAC) report (Zeigler and Bibler 2009). Subsequent to Tank 50 analysis, additional solution was added to the tank solution from the Effluent Treatment Project as well as from inleakage from Tank 50 pump bearings (Cozzi and Duncan 2010). Core samples were taken from three locations and at three depths at each location using a two-inch diameter concrete coring bit (1-1, 1-2, 1-3; 2-1, 2-2, 2-3; 3-1, 3-2, 3-3) (Hansen and Crawford
DISTRIBUTION COEFICIENTS (KD) GENERATED FROM A CORE SAMPLE COLLECTED FROM THE SALTSTONE DISPOSAL FACILITY

Energy Technology Data Exchange (ETDEWEB)

Almond, P.; Kaplan, D.

2011-04-25

Core samples originating from Vault 4, Cell E of the Saltstone Disposal Facility (SDF) were collected in September of 2008 (Hansen and Crawford 2009, Smith 2008) and sent to SRNL to measure chemical and physical properties of the material including visual uniformity, mineralogy, microstructure, density, porosity, distribution coefficients (K{sub d}), and chemical composition. Some data from these experiments have been reported (Cozzi and Duncan 2010). In this study, leaching experiments were conducted with a single core sample under conditions that are representative of saltstone performance. In separate experiments, reducing and oxidizing environments were targeted to obtain solubility and Kd values from the measurable species identified in the solid and aqueous leachate. This study was designed to provide insight into how readily species immobilized in saltstone will leach from the saltstone under oxidizing conditions simulating the edge of a saltstone monolith and under reducing conditions, targeting conditions within the saltstone monolith. Core samples were taken from saltstone poured in December of 2007 giving a cure time of nine months in the cell and a total of thirty months before leaching experiments began in June 2010. The saltstone from Vault 4, Cell E is comprised of blast furnace slag, class F fly ash, portland cement, and Deliquification, Dissolution, and Adjustment (DDA) Batch 2 salt solution. The salt solution was previously analyzed from a sample of Tank 50 salt solution and characterized in the 4QCY07 Waste Acceptance Criteria (WAC) report (Zeigler and Bibler 2009). Subsequent to Tank 50 analysis, additional solution was added to the tank solution from the Effluent Treatment Project as well as from inleakage from Tank 50 pump bearings (Cozzi and Duncan 2010). Core samples were taken from three locations and at three depths at each location using a two-inch diameter concrete coring bit (1-1, 1-2, 1-3; 2-1, 2-2, 2-3; 3-1, 3-2, 3-3) (Hansen and
REDUCTION CAPACITY OF SALTSTONE AND SALTSTONE COMPONENTS

Energy Technology Data Exchange (ETDEWEB)

Roberts, K.; Kaplan, D.

2009-11-30

The duration that saltstone retains its ability to immobilize some key radionuclides, such as technetium (Tc), plutonium (Pu), and neptunium (Np), depends on its capacity to maintain a low redox status (or low oxidation state). The reduction capacity is a measure of the mass of reductants present in the saltstone; the reductants are the active ingredients that immobilize Tc, Pu, and Np. Once reductants are exhausted, the saltstone loses its ability to immobilize these radionuclides. The reduction capacity values reported here are based on the Ce(IV)/Fe(II) system. The Portland cement (198 {micro}eq/g) and especially the fly ash (299 {micro}eq/g) had a measurable amount of reduction capacity, but the blast furnace slag (820 {micro}eq/g) not surprisingly accounted for most of the reduction capacity. The blast furnace slag contains ferrous iron and sulfides which are strong reducing and precipitating species for a large number of solids. Three saltstone samples containing 45% slag or one sample containing 90% slag had essentially the same reduction capacity as pure slag. There appears to be some critical concentration between 10% and 45% slag in the Saltstone formulation that is needed to create the maximum reduction capacity. Values from this work supported those previously reported, namely that the reduction capacity of SRS saltstone is about 820 {micro}eq/g; this value is recommended for estimating the longevity that the Saltstone Disposal Facility will retain its ability to immobilize radionuclides.
Saltstone Osmotic Pressure

International Nuclear Information System (INIS)

Nichols, Ralph L.; Dixon, Kenneth L.

2013-01-01

Recent research into the moisture retention properties of saltstone suggest that osmotic pressure may play a potentially significant role in contaminant transport (Dixon et al., 2009 and Dixon, 2011). The Savannah River Remediation Closure and Disposal Assessments Group requested the Savannah River National Laboratory (SRNL) to conduct a literature search on osmotic potential as it relates to contaminant transport and to develop a conceptual model of saltstone that incorporates osmotic potential. This report presents the findings of the literature review and presents a conceptual model for saltstone that incorporates osmotic potential. The task was requested through Task Technical Request HLW-SSF-TTR-2013-0004. Simulated saltstone typically has very low permeability (Dixon et al. 2008) and pore water that contains a large concentration of dissolved salts (Flach and Smith 2013). Pore water in simulated saltstone has a high salt concentration relative to pore water in concrete and groundwater. This contrast in salt concentration can generate high osmotic pressures if simulated saltstone has the properties of a semipermeable membrane. Estimates of osmotic pressure using results from the analysis of pore water collected from simulated saltstone show that an osmotic pressure up to 2790 psig could be generated within the saltstone. Most semi-permeable materials are non-ideal and have an osmotic efficiency 3 , KNO 3 , Na 3 PO 4 x12H 2 O, and K 3 PO 4 when exposed to a dilute solution. Typically hydraulic head is considered the only driving force for groundwater in groundwater models. If a low permeability material containing a concentrated salt solution is present in the hydrogeologic sequence large osmotic pressures may develop and lead to misinterpretation of groundwater flow and solute transport. The osmotic pressure in the semi-permeable material can significantly impact groundwater flow in the vicinity of the semi-permeable material. One possible outcome is that
SALTSTONE AND RADIONUCLIDE INTERACTIONS: RADIONUCLIDE SORPTION AND DESORPTION, AND SALTSTONE REDUCTION CAPACITY

International Nuclear Information System (INIS)

Kaplan, D; Roberts, Kimberly; Serkiz, Steven; Siegfried, Matthew

2008-01-01

the same value as the one measured for 100% blast furnace slag. The cause for this approximately four-fold greater reduction capacity than anticipated is not known, but may be the result of the higher pH of Saltstone (pH ∼11) compared to blast furnace slag (pH ∼8), the presence of reducing minerals in the fly ash used to make the Saltstone, or to the Saltstone possibly having semi-conductor properties. These reduction capacity values will result in a near four-fold increase in the estimated duration that the Saltstone facility will remain in a reduced chemical state. The implication of this result is that oxidation-state-sensitive contaminants, such as Pu, Np, and Tc, will remain for a longer duration in a much less mobile form than previously believed. The reduction capacity of vault concrete, which consisted of 10 wt-% blast furnace slag, was 240 (micro)eq/g. Essentially all Am, Cd, Ce, Co, Cs, Hg, Sr, and Y was (ad)sorbed within four hours, whereas 10 3 fold slower than (ad)sorption (under reducing conditions). An important implication of this finding is that if groundwater by-passes or short-circuits the reduction capacity of the Saltstone by flowing along a crack, the ability of the oxygenated water to promote Tc desorption is appreciably less than that predicted based on the K d value. Relatively low Tc K d values, 6 to 91 mL/g, were measured in these studies indicating that little if any of the Tc(VII) introduced into the Saltstone or Vault 2 concrete suspensions was reduced to Tc(IV). Such a reduction results in apparent K d values on the order of 10 4 mL/g. As such, these Tc sorption/desorption experiments need additional investigation to fully represent Saltstone environmental conditions. It is important to understand the limits of these data. They do not provide insight into how radionuclides cured and immobilized in Saltstone will leach from the Saltstone. However they do provide insight into how radionuclides once released into porewater will interact
Special Analysis: Revision of Saltstone Vault 4 Disposal Limits (U)

Energy Technology Data Exchange (ETDEWEB)

Cook, J

2005-05-26

New disposal limits have been computed for Vault 4 of the Saltstone Disposal Facility based on several revisions to the models in the existing Performance Assessment and the Special Analysis issued in 2002. The most important changes are the use of a more rigorous groundwater flow and transport model, and consideration of radon emanation. Other revisions include refinement of the aquifer mesh to more accurately model the footprint of the vault, a new plutonium chemistry model accounting for the different transport properties of oxidation states III/IV and V/VI, use of variable infiltration rates to simulate degradation of the closure system, explicit calculation of gaseous releases and consideration of the effects of settlement and seismic activity on the vault structure. The disposal limits have been compared with the projected total inventory expected to be disposed in Vault 4. The resulting sum-of-fractions of the 1000-year disposal limits is 0.2, which indicates that the performance objectives and requirements of DOE 435.1 will not be exceeded. This SA has not altered the conceptual model (i.e., migration of radionuclides from the Saltstone waste form and Vault 4 to the environment via the processes of diffusion and advection) of the Saltstone PA (MMES 1992) nor has it altered the conclusions of the PA (i.e., disposal of the proposed waste in the SDF will meet DOE performance measures). Thus a PA revision is not required and this SA serves to update the disposal limits for Vault 4. In addition, projected doses have been calculated for comparison with the performance objectives laid out in 10 CFR 61. These doses are 0.05 mrem/year to a member of the public and 21.5 mrem/year to an inadvertent intruder in the resident scenario over a 10,000-year time-frame, which demonstrates that the 10 CFR 61 performance objectives will not be exceeded. This SA supplements the Saltstone PA and supersedes the two previous SAs (Cook et al. 2002; Cook and Kaplan 2003).
Slag-based saltstone formulations

International Nuclear Information System (INIS)

Langton, C.A.

1987-01-01

Approximately 400 x 10 6 liters of low-level alkaline salt solution will be treated at the Savannah River Plant (SRP) Defense Waste Processing Facility (DWPF) prior to disposal in concrete vaults at SRP. Treatment involves removal of CS + and Sr +2 followed by solidification and stabilization of potential contaminants in saltstone, a hydrated ceramic waste form. Chromium, technetium, and nitrate releases from saltstone can be significantly reduced by substituting hydraulic blast furnace slag for portland cement in the formulation designs. Slag-based mixes are also compatible with Class F fly ash used in saltstone as a functional extender to control heat of hydration and reduce permeability. A monolithic waste form is produced by the hydration of the slag and fly ash. Soluble ion release (NO 3 - ) is controlled by the saltstone microstructure. Chromium and technetium are less leachable from slag mixes compared to cement-based waste forms because these species are chemically reduced to a lower valence state by ferrous iron in the slag and precipitated as relatively insoluble phases, such as CR(OH) 3 and TcO 2 . 5 refs., 4 figs., 4 tabs
HYDRAULIC AND PHYSICAL PROPERTIES OF MCU SALTSTONE

International Nuclear Information System (INIS)

Dixon, K; Mark Phifer, M

2008-01-01

The Saltstone Disposal Facility (SDF), located in the Z-Area of the Savannah River Site (SRS), is used for the disposal of low-level radioactive salt solution. The SDF currently contains two vaults: Vault 1 (6 cells) and Vault 4 (12 cells). Additional disposal cells are currently in the design phase. The individual cells of the saltstone facility are filled with saltstone., Saltstone is produced by mixing the low-level radioactive salt solution, with blast furnace slag, fly ash, and cement or lime to form a dense, micro-porous, monolithic, low-level radioactive waste form. The saltstone is pumped into the disposal cells where it subsequently solidifies. Significant effort has been undertaken to accurately model the movement of water and contaminants through the facility. Key to this effort is an accurate understanding of the hydraulic and physical properties of the solidified saltstone. To date, limited testing has been conducted to characterize the saltstone. The primary focus of this task was to estimate the hydraulic and physical properties of MCU (Modular Caustic Side Solvent Extraction Unit) saltstone relative to two permeating fluids. These fluids included simulated groundwater equilibrated with vault concrete and simulated saltstone pore fluid. Samples of the MCU saltstone were prepared by the Savannah River National Laboratory (SRNL) and allowed to cure for twenty eight days prior to testing. These samples included two three-inch diameter by six inch long mold samples and three one-inch diameter by twelve inch long mold samples
HYDRAULIC AND PHYSICAL PROPERTIES OF MCU SALTSTONE

Energy Technology Data Exchange (ETDEWEB)

Dixon, K; Mark Phifer, M

2008-03-19

The Saltstone Disposal Facility (SDF), located in the Z-Area of the Savannah River Site (SRS), is used for the disposal of low-level radioactive salt solution. The SDF currently contains two vaults: Vault 1 (6 cells) and Vault 4 (12 cells). Additional disposal cells are currently in the design phase. The individual cells of the saltstone facility are filled with saltstone., Saltstone is produced by mixing the low-level radioactive salt solution, with blast furnace slag, fly ash, and cement or lime to form a dense, micro-porous, monolithic, low-level radioactive waste form. The saltstone is pumped into the disposal cells where it subsequently solidifies. Significant effort has been undertaken to accurately model the movement of water and contaminants through the facility. Key to this effort is an accurate understanding of the hydraulic and physical properties of the solidified saltstone. To date, limited testing has been conducted to characterize the saltstone. The primary focus of this task was to estimate the hydraulic and physical properties of MCU (Modular Caustic Side Solvent Extraction Unit) saltstone relative to two permeating fluids. These fluids included simulated groundwater equilibrated with vault concrete and simulated saltstone pore fluid. Samples of the MCU saltstone were prepared by the Savannah River National Laboratory (SRNL) and allowed to cure for twenty eight days prior to testing. These samples included two three-inch diameter by six inch long mold samples and three one-inch diameter by twelve inch long mold samples.
SALTSTONE AND RADIONUCLIDE INTERACTIONS: RADIONUCLIDE SORPTION AND DESORPTION, AND SALTSTONE REDUCTION CAPACITY

Energy Technology Data Exchange (ETDEWEB)

Kaplan, D; Kimberly Roberts, K; Steven Serkiz, S; Matthew Siegfried, M

2008-10-30

gram ({micro}eq/g). This value was approximately the same value as the one measured for 100% blast furnace slag. The cause for this approximately four-fold greater reduction capacity than anticipated is not known, but may be the result of the higher pH of Saltstone (pH {approx}11) compared to blast furnace slag (pH {approx}8), the presence of reducing minerals in the fly ash used to make the Saltstone, or to the Saltstone possibly having semi-conductor properties. These reduction capacity values will result in a near four-fold increase in the estimated duration that the Saltstone facility will remain in a reduced chemical state. The implication of this result is that oxidation-state-sensitive contaminants, such as Pu, Np, and Tc, will remain for a longer duration in a much less mobile form than previously believed. The reduction capacity of vault concrete, which consisted of 10 wt-% blast furnace slag, was 240 {micro}eq/g. Essentially all Am, Cd, Ce, Co, Cs, Hg, Sr, and Y was (ad)sorbed within four hours, whereas <3% of the adsorbed metals desorbed from these solids after 90 hours of continuous leaching. In particular, desorption of Tc (under oxidizing conditions) was >10{sup 3} fold slower than (ad)sorption (under reducing conditions). An important implication of this finding is that if groundwater by-passes or short-circuits the reduction capacity of the Saltstone by flowing along a crack, the ability of the oxygenated water to promote Tc desorption is appreciably less than that predicted based on the K{sub d} value. Relatively low Tc K{sub d} values, 6 to 91 mL/g, were measured in these studies indicating that little if any of the Tc(VII) introduced into the Saltstone or Vault 2 concrete suspensions was reduced to Tc(IV). Such a reduction results in apparent K{sub d} values on the order of 10{sup 4} mL/g. As such, these Tc sorption/desorption experiments need additional investigation to fully represent Saltstone environmental conditions. It is important to
HYDRAULIC AND PHYSICAL PROPERTIES OF SALTSTONE GROUTS AND VAULT CONCRETES

International Nuclear Information System (INIS)

Dixon, K.; Harbour, J.; Phifer, M.

2008-01-01

The Saltstone Disposal Facility (SDF), located in the Z-Area of the Savannah River Site (SRS), is used for the disposal of low-level radioactive salt solution. The SDF currently contains two vaults: Vault 1 (6 cells) and Vault 4 (12 cells). Additional disposal cells are currently in the design phase. The individual cells of the saltstone facility are filled with saltstone. Saltstone is produced by mixing the low-level radioactive salt solution, with blast furnace slag, fly ash, and cement (dry premix) to form a dense, micro-porous, monolithic, low-level radioactive waste form. The saltstone is pumped into the disposal cells where it subsequently solidifies. Significant effort has been undertaken to accurately model the movement of water and contaminants through the facility. Key to this effort is an accurate understanding of the hydraulic and physical properties of the solidified saltstone. To date, limited testing has been conducted to characterize the saltstone. The primary focus of this task was to estimate the hydraulic and physical properties of three types of saltstone and two vault concretes. The saltstone formulations included saltstone premix batched with (1) Deliquification, Dissolution, and Adjustment (DDA) salt simulant (w/pm 0.60), (2) Actinide Removal Process (ARP)/Modular Caustic Side Solvent Extraction Unit (MCU) salt simulant (w/pm 0.60), and (3) Salt Waste Processing Facility (SWPF) salt simulant (w/pm 0.60). The vault concrete formulations tested included the Vault 1/4 concrete and two variations of the Vault 2 concrete (Mix 1 and Mix 2). Wet properties measured for the saltstone formulations included yield stress, plastic viscosity, wet unit weight, bleed water volume, gel time, set time, and heat of hydration. Hydraulic and physical properties measured on the cured saltstone and concrete samples included saturated hydraulic conductivity, moisture retention, compressive strength, porosity, particle density, and dry bulk density. These properties
Saltstone Osmotic Pressure

Energy Technology Data Exchange (ETDEWEB)

Nichols, Ralph L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Dixon, Kenneth L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRN

2013-09-23

Recent research into the moisture retention properties of saltstone suggest that osmotic pressure may play a potentially significant role in contaminant transport (Dixon et al., 2009 and Dixon, 2011). The Savannah River Remediation Closure and Disposal Assessments Group requested the Savannah River National Laboratory (SRNL) to conduct a literature search on osmotic potential as it relates to contaminant transport and to develop a conceptual model of saltstone that incorporates osmotic potential. This report presents the findings of the literature review and presents a conceptual model for saltstone that incorporates osmotic potential. The task was requested through Task Technical Request HLW-SSF-TTR- 2013-0004.
Computational Fluid Dynamics Model for Saltstone Vault 4 Vapor Space

International Nuclear Information System (INIS)

Lee, Si Young

2005-01-01

Computational fluid dynamics (CFD) methods have been used to estimate the flow patterns for vapor space inside the Saltstone Vault No.4 under different operating scenarios. The purpose of this work is to examine the gas motions inside the vapor space under the current vault configurations. A CFD model took three-dimensional transient momentum-energy coupled approach for the vapor space domain of the vault. The modeling calculations were based on prototypic vault geometry and expected normal operating conditions as defined by Waste Solidification Engineering. The modeling analysis was focused on the air flow patterns near the ventilated corner zones of the vapor space inside the Saltstone vault. The turbulence behavior and natural convection mechanism used in the present model were benchmarked against the literature information and theoretical results. The verified model was applied to the Saltstone vault geometry for the transient assessment of the air flow patterns inside the vapor space of the vault region using the boundary conditions as provided by the customer. The present model considered two cases for the estimations of the flow patterns within the vapor space. One is the reference baseline case. The other is for the negative temperature gradient between the roof inner and top grout surface temperatures intended for the potential bounding condition. The flow patterns of the vapor space calculated by the CFD model demonstrate that the ambient air comes into the vapor space of the vault through the lower-end ventilation hole, and it gets heated up by the Benard-cell type circulation before leaving the vault via the higher-end ventilation hole. The calculated results are consistent with the literature information
Results and analysis of saltstone cores taken from saltstone disposal unit cell 2A

Energy Technology Data Exchange (ETDEWEB)

Reigel, M. M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hill, K. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-03-01

As part of an ongoing Performance Assessment (PA) Maintenance Plan, Savannah River Remediation (SRR) has developed a sampling and analyses strategy to facilitate the comparison of field-emplaced samples (i.e., saltstone placed and cured in a Saltstone Disposal Unit (SDU)) with samples prepared and cured in the laboratory. The primary objectives of the Sampling and Analyses Plan (SAP) are; (1) to demonstrate a correlation between the measured properties of laboratory-prepared, simulant samples (termed Sample Set 3), and the field-emplaced saltstone samples (termed Sample Set 9), and (2) to validate property values assumed for the Saltstone Disposal Facility (SDF) PA modeling. The analysis and property data for Sample Set 9 (i.e. six core samples extracted from SDU Cell 2A (SDU2A)) are documented in this report, and where applicable, the results are compared to the results for Sample Set 3. Relevant properties to demonstrate the aforementioned objectives include bulk density, porosity, saturated hydraulic conductivity (SHC), and radionuclide leaching behavior.

Slag-based saltstone formulations

International Nuclear Information System (INIS)

Langton, C.A.

1987-08-01

Approximately 400 x 10 6 L of low-level alkaline salt solution will be treated at the Savannah River Plant (SRP) Defense Waste Processing Facility (DWPF) prior to disposal in concrete vaults at SRP. Treatment involves removal of Cs + and Sr +2 , followed by solidification and stabilization of potential contaminants in saltstone, a hydrated ceramic wasteform. Chromium, technetium, and nitrate releases from saltstone can be significantly reduced by substituting hydraulic blast furnace slag for portland cement in the formulation designs. Slag-based mixes are also compatible with the Class F flyash used in saltstone as a functional extender to control heat of hydration and reduce permeability. (Class F flyash is also locally available at SRP.) A monolithic wasteform is produced by the hydration of the slag and flyash. Soluble ion release (NO 3- ) is controlled by the saltstone microstructure. Chromium and technetium are less leachable from slag mixes because these species are chemically reduced to a lower valence state by ferrous iron in the slag and are precipitated as relatively insoluble phases, such as Cr(OH) 3 and TcO 2 . 3 refs., 3 figs., 2 tabs
Saltstone Matrix Characterization And Stadium Simulation Results

International Nuclear Information System (INIS)

Langton, C.

2009-01-01

SIMCO Technologies, Inc. was contracted to evaluate the durability of the saltstone matrix material and to measure saltstone transport properties. This information will be used to: (1) Parameterize the STADIUM(reg s ign) service life code, (2) Predict the leach rate (degradation rate) for the saltstone matrix over 10,000 years using the STADIUM(reg s ign) concrete service life code, and (3) Validate the modeled results by conducting leaching (water immersion) tests. Saltstone durability for this evaluation is limited to changes in the matrix itself and does not include changes in the chemical speciation of the contaminants in the saltstone. This report summarized results obtained to date which include: characterization data for saltstone cured up to 365 days and characterization of saltstone cured for 137 days and immersed in water for 31 days. Chemicals for preparing simulated non-radioactive salt solution were obtained from chemical suppliers. The saltstone slurry was mixed according to directions provided by SRNL. However SIMCO Technologies Inc. personnel made a mistake in the premix proportions. The formulation SIMCO personnel used to prepare saltstone premix was not the reference mix proportions: 45 wt% slag, 45 wt% fly ash, and 10 wt% cement. SIMCO Technologies Inc. personnel used the following proportions: 21 wt% slag, 65 wt% fly ash, and 14 wt% cement. The mistake was acknowledged and new mixes have been prepared and are curing. The results presented in this report are assumed to be conservative since the excessive fly ash was used in the SIMCO saltstone. The SIMCO mixes are low in slag which is very reactive in the caustic salt solution. The impact is that the results presented in this report are expected to be conservative since the samples prepared were deficient in slag and contained excess fly ash. The hydraulic reactivity of slag is about four times that of fly ash so the amount of hydrated binder formed per unit volume in the SIMCO saltstone samples
MEASUREMENT OF SPECIFIC HEAT CAPACITY OF SALTSTONE

International Nuclear Information System (INIS)

Harbour, J.; Williams, V.

2008-01-01

One of the goals of the Saltstone variability study is to identify (and quantify the impact of) the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. The heat capacity of the Saltstone waste form is one of the important properties of Saltstone mixes that was last measured at SRNL in 1997. It is therefore important to develop a core competency for rapid and accurate analysis of the specific heat capacity of the Saltstone mixes in order to quantify the impact of compositional and operational variations on this property as part of the variability study. The heat capacity, coupled with the heat of hydration data obtained from isothermal calorimetry for a given Saltstone mix, can be used to predict the maximum temperature increase in the cells within the vaults of the Saltstone Disposal Facility (SDF). The temperature increase controls the processing rate and the pour schedule. The maximum temperature is also important to the performance properties of the Saltstone. For example, in mass pours of concrete or grout of which Saltstone is an example, the maximum temperature increase and the maximum temperature difference (between the surface and the hottest location) are controlled to ensure durability of the product and prevent or limit the cracking caused by the thermal gradients produced during curing. This report details the development and implementation of a method for the measurement of the heat capacities of Saltstone mixes as well as the heat capacities of the cementitious materials of the premix and the simulated salt solutions used to batch the mixes. The developed method utilizes the TAM Air isothermal calorimeter and takes advantage of the sophisticated heat flow measurement capabilities of the instrument. Standards and reference materials were identified and used to validate the procedure and ensure accuracy of testing. Heat capacities of Saltstone mixes were �
MEASUREMENT OF SPECIFIC HEAT CAPACITY OF SALTSTONE

Energy Technology Data Exchange (ETDEWEB)

Harbour, J; Vickie Williams, V

2008-09-29

One of the goals of the Saltstone variability study is to identify (and quantify the impact of) the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. The heat capacity of the Saltstone waste form is one of the important properties of Saltstone mixes that was last measured at SRNL in 1997. It is therefore important to develop a core competency for rapid and accurate analysis of the specific heat capacity of the Saltstone mixes in order to quantify the impact of compositional and operational variations on this property as part of the variability study. The heat capacity, coupled with the heat of hydration data obtained from isothermal calorimetry for a given Saltstone mix, can be used to predict the maximum temperature increase in the cells within the vaults of the Saltstone Disposal Facility (SDF). The temperature increase controls the processing rate and the pour schedule. The maximum temperature is also important to the performance properties of the Saltstone. For example, in mass pours of concrete or grout of which Saltstone is an example, the maximum temperature increase and the maximum temperature difference (between the surface and the hottest location) are controlled to ensure durability of the product and prevent or limit the cracking caused by the thermal gradients produced during curing. This report details the development and implementation of a method for the measurement of the heat capacities of Saltstone mixes as well as the heat capacities of the cementitious materials of the premix and the simulated salt solutions used to batch the mixes. The developed method utilizes the TAM Air isothermal calorimeter and takes advantage of the sophisticated heat flow measurement capabilities of the instrument. Standards and reference materials were identified and used to validate the procedure and ensure accuracy of testing. Heat capacities of Saltstone mixes were
MEASUREMENT OF WASTE LOADING IN SALTSTONE

International Nuclear Information System (INIS)

Harbour, J; Vickie Williams, V

2008-01-01

One of the goals of the Saltstone variability study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. One of those properties of importance is the Waste Loading (WL) of the decontaminated salt solution (DSS) in the Saltstone waste form. Waste loading is a measure of the amount of waste that can be incorporated within a waste form. The value of the Saltstone waste loading ultimately determines the number of vaults that will be required to disposition all of the DSS. In this report, the waste loading is defined as the volume in milliliters of DSS per liter of Saltstone waste form. The two most important parameters that determine waste loading for Saltstone are water to cementitious material (w/cm) ratio and the cured grout density. Data are provided that show the dependence of waste loading on the w/cm ratio for a fixed DSS composition using the current premix material (45% Blast Furnace Slag (BFS), 45% Fly Ash (FA) and 10% Ordinary Portland Cement (OPC)). The impact of cured grout density on waste loading was also demonstrated. Mixes (at 0.60 w/cm) made with a Modular Caustic side extraction Unit (MCU) simulant and either OPC or BFS have higher cured grout densities than mixes made with premix and increase the WL to 709 mL/L for the OPC mix and 689 mL/L for the BFS mix versus the value of 653 mL/L for MCU in premix at 0.60 w/cm ratio. Bleed liquid reduces the waste loading and lowers the effective w/cm ratio of Saltstone. A method is presented (and will be used in future tasks) for correcting the waste loading and the w/cm ratio of the as-batched mixes in those cases where bleed liquid is present. For example, the Deliquification, Dissolution and Adjustment (DDA) mix at an as-batched 0.60 w/cm ratio, when corrected for % bleed, gives a mix with a 0.55 w/cm ratio and a WL that has been reduced from 662 to 625 mL/L. An example is provided that
Lysimeter study of vegetative uptake from saltstone

Energy Technology Data Exchange (ETDEWEB)

Murphy, C.E. Jr.

1990-06-08

At the Savannah River Site, liquid, low-level nuclear waste will be disposed of by incorporating the waste in concrete, a wasteform called saltstone. Saltstone monoliths will then be buried in the earth. To study the potential uptake of radionuclides by trees and other plants growing in the soil in the area containing buried saltstone, a lysimeter study has been in progress since 1984. Thirty two lysimeters were designed, constructed, and filled with soil. Saltstone samples, containing the liquid, low-level supernate from the tank 50 in-tank precipitation demonstration, were buried in some of the lysimeters. Other lysimeters, not containing saltstone, were used as controls. Crops, grass, and trees were planted in the lysimeters and sampled periodically to determine radionuclide concentrations. Water samples were also collected from the lysimeter sumps and analyzed for radionuclide content. This report documents the results of vegetative and lysimeter sump water measurements from the beginning of the project in November of 1984 through September of 1989. 6 refs., 22 figs., 6 tabs.
Leaching of saltstones containing fly ash

International Nuclear Information System (INIS)

Barnes, M.W.; Roy, D.M.; Langton, C.A.

1985-01-01

Two types of fly ash were incorporated in saltstones designed for potential encapsulation of Savannah River Plant low level defense waste. These fly ashes have some cementitious properties while at the same time their presence in substitution for cement slows early hydration. Class C fly ash has a high calcium content and is considered cementitious; Class F fly ash has a low calcium content and is not classified as cementitious. Leach tests were performed and physical properties were measured for saltstones containing each class, to see the differences in the effect of the fly ashes. The four waste ions nitrate, nitrite, sodium and sulfate were shown to leach by diffusion. Effective diffusivities were determined for these ions. Data for nitrate, the most important species from the environmental point of view, are shown in Table A. Saltstones made with Class C fly ash have substantially lower leach rates than those made with Class F fly ash. The leach rates, and therefore the square roots of the effective diffusivities, have been found to be proportional to the pore surface area per unit volume (or the ratio of pore volume to pore radius), to the fraction of waste containing solution, and to the inverse of the fraction of calcium in the saltstone. Rates and diffusivities are not proportional to the water to cement ratio, because this number depends on whether the fly ash is counted as cementitious, as in Class C cement, or not cementitious, as in Class F cement. In fact the relatively small amount of calcium in Class F cement contributes to the cementitious properties overall, though not so much as Class C cement. 4 refs., 2 figs., 6 tabs
Atmospheric Pathway Screening Analysis for Saltstone Disposal Facility Vault 4

International Nuclear Information System (INIS)

COOK, JAMES

2004-01-01

A sequential screening process using a methodology developed by the National Council on Radiation Protection and Measurements, professional judgment and process knowledge has been used to produce a list of radionuclides requiring detailed analysis to derive disposal limits for the Saltstone Disposal Facility based on the atmospheric pathway
Leaching of saltstone: Laboratory and field testing and mathematical modeling

International Nuclear Information System (INIS)

Grant, M.W.; Langton, C.A.; Oblath, S.B.; Pepper, D.W.; Wallace, R.M.; Wilhite, E.L.; Yau, W.W.F.

1987-01-01

A low-level alkaline salt solution will be a byproduct in the processing of high-level waste at the Savannah River Plant (SRP). This solution will be incorporated into a wasteform, saltstone, and disposed of in surface vaults. Laboratory and field leach testing and mathematical modeling have demonstrated the predictability of contaminant release from cement wasteforms. Saltstone disposal in surface vaults will meet the design objective, which is to meet drinking water standards in shallow groundwater at the disposal area boundary. Diffusion is the predominant mechanism for release of contaminants to the environment. Leach testing in unsaturated soil, at soil moisture levels above 1 wt %, has shown no difference in leach rate compared to leaching in distilled water. Field leach testing of three thirty-ton blocks of saltstone in lysimeters has been underway since January 1984. Mathematical models were applied to assess design features for saltstone disposal. One dimensional infinite-composite and semi-infinite analytical models were developed for assessing diffusion of nitrate from saltstone through a cement barrier. Numerical models, both finite element and finite difference, were validated by comparison of model predictions with the saltstone lysimeter results. Validated models were used to assess the long-term performance of the saltstone stored in surface vaults. The maximum concentrations of all contaminants released from saltstone to shallow groundwater are predicted to be below drinking water standards at the disposal area boundary. 5 refs., 11 figs., 5 tabs
GLASS COMPOSITION-TCLP RESPONSE MODEL FOR WASTE GLASSES

International Nuclear Information System (INIS)

Kim, Dong-Sang; Vienna, John D.

2004-01-01

A first-order property model for normalized Toxicity Characteristic Leaching Procedure (TCLP) release as a function of glass composition was developed using data collected from various studies. The normalized boron release is used to estimate the release of toxic elements based on the observation that the boron release represents the conservative release for those constituents of interest. The current TCLP model has two targeted application areas: (1) delisting of waste-glass product as radioactive (not mixed) waste and (2) designating the glass wastes generated from waste-glass research activities as hazardous or non-hazardous. This paper describes the data collection and model development for TCLP releases and discusses the issues related to the application of the model
Process Formulations And Curing Conditions That Affect Saltstone Properties

Energy Technology Data Exchange (ETDEWEB)

Reigel, M. M.; Pickenheim, B. R.; Daniel, W. E.

2012-09-28

The first objective of this study was to analyze saltstone fresh properties to determine the feasibility of reducing the formulation water to premix (w/p) ratio while varying the amount of extra water and admixtures used during processing at the Saltstone Production Facility (SPF). The second part of this study was to provide information for understanding the impact of curing conditions (cure temperature, relative humidity (RH)) and processing formulation on the performance properties of cured saltstone.
Concept development for saltstone and low level waste disposal

International Nuclear Information System (INIS)

Wilhite, E.L.

1987-03-01

A low-level alkaline salt solution will be a byproduct in the processing of high-level waste at the Savannah River Plant (SRP). This solution will be incorporated into a cement wasteform, saltstone, and placed in surface vaults. Laboratory and field testing and mathematical modeling have demonstrated the predictability of contaminant release from cement wasteforms. Saltstone disposal in surface vaults will meet drinking water standards in shallow groundwater at the disposal area boundary. Planning for new Low-Level Waste (LLW) disposal could incorporate concepts developed for saltstone disposal
TCLP Preparation and Analysis of K East Basin Composite Sludge Samples

International Nuclear Information System (INIS)

Silvers, K.L.; Wagner, J.J.; Steele, R.T.

2000-01-01

Sludge samples from the Hanford K East Basin were analyzed by the Toxicity Characterization Leaching Procedure (TCLP) to assist in the appropriate Resource Conservation and Recovery Act (RCIL4) designation of this material. Sludge samples were collected by Fluor Hanford, Inc. using the consolidated sludge sampling system (system that allows collection of a single sample from multiple sample locations). These samples were shipped to the Postirradiation Testing Laboratory (PTL, 327 Building) and then transferred to the Pacific Northwest National Laboratory (PNNL) Radiochemical Processing Laboratory (RPL, 325 Building) for recovery and testing. Two sludge composites were prepared, using the consolidated sludge samples, to represent K East canister sludge (sample KC Can Comp) and K East floor sludge (sample KC Floor Comp). Each composite was extracted in duplicate and analyzed in duplicate following pre-approved(a) TCLP extraction and analyses procedures. In addition, these samples and duplicates were analyzed for total RCRA metals (via acid digestion preparation). The work was conducted in accordance with the requirements of the Hanford Analytical Quality Assurance Requirements Document (HASQARD). A PNNL Quality Assurance Program compliant with J HASQARD was implemented for this effort. The results from the TCLP analyses showed that all RCRA metal concentrations were less than the TCLP limits for both the canister and floor composite samples and their respective duplicates
Saltstone studies using the scaled continuous processing facility

Energy Technology Data Exchange (ETDEWEB)

Fowley, M. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Cozzi, A. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hansen, E. K. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-08-01

The Savannah River National Laboratory (SRNL) has supported the Saltstone Facility since its conception with bench-scale laboratory experiments, mid-scale testing at vendor facilities, and consultations and testing at the Saltstone Facility. There have been minimal opportunities for the measurement of rheological properties of the grout slurry at the Saltstone Production Facility (SPF); thus, the Scaled Continuous Processing Facility (SCPF), constructed to provide processing data related to mixing, transfer, and other operations conducted in the SPF, is the most representative process data for determining the expected rheological properties in the SPF. These results can be used to verify the laboratory scale experiments that support the SPF using conventional mixing processes that appropriately represent the shear imparted to the slurry in the SPF.
Degradation Of Cementitious Materials Associated With Saltstone Disposal Units

International Nuclear Information System (INIS)

Flach, G. P; Smith, F. G. III

2013-01-01

(CE) and more defensible than the best estimate (BE). The combined effects of multiple phenomena are then considered to determine the most limiting degradation time scale for each cementitious material. Degradation times are estimated using a combination of analytic solutions from literature and numerical simulation codes provided through the DOE Cementitious Barriers Partnership (CBP) Software Toolbox (http://cementbarriers.org). For the SDU 2 design, the roof, wall, and floor components are projected to become fully degraded under Nominal conditions at 3866, 923, and 1413 years, respectively. For SDU 4 the roof and floor are estimated to be fully degraded under Nominal conditions after 1137 and 1407 years, respectively; the wall is assumed to be fully degraded at time zero in the most recent PA simulations. Degradation of these concrete barriers generally occurs from combined sulfate attack and corrosion of embedded steel following carbonation. Saltstone is projected to degrade very slowly by decalcification, with complete degradation occurring in excess of 200,000 years for any SDU type. Complete results are provided
Technical Insights for Saltstone PA Maintenance

International Nuclear Information System (INIS)

Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.

2011-01-01

The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure and Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and
Technical Insights for Saltstone PA Maintenance

Energy Technology Data Exchange (ETDEWEB)

Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.

2011-07-20

The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure & Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and
Large-scale demonstration of waste solidification in saltstone

International Nuclear Information System (INIS)

McIntyre, P.F.; Oblath, S.B.; Wilhite, E.L.

1988-05-01

The saltstone lysimeters are a large scale demonstration of a disposal concept for decontaminated salt solution resulting from in-tank processing of defense waste. The lysimeter experiment has provided data on the leaching behavior of large saltstone monoliths under realistic field conditions. The results also will be used to compare the effect of capping the wasteform on contaminant release. Biweekly monitoring of sump leachate from three lysimeters has continued on a routine basis for approximately 3 years. An uncapped lysimeter has shown the highest levels of nitrate and 99 Tc release. Gravel and clay capped lysimeters have shown levels equivalent to or slightly higher than background rainwater levels. Mathematical model predictions have been compared to lysimeter results. The models will be applied to predict the impact of saltstone disposal on groundwater quality. 9 refs., 5 figs., 3 tabs
EVALUATION OF SULFATE ATTACK ON SALTSTONE VAULT CONCRETE AND SALTSTONESIMCO TECHNOLOGIES, INC. PART1 FINAL REPORT

International Nuclear Information System (INIS)

Langton, C.

2008-01-01

This report summarizes the preliminary results of a durability analysis performed by SIMCO Technologies Inc. to assess the effects of contacting saltstone Vaults 1/4 and Disposal Unit 2 concretes with highly alkaline solutions containing high concentrations of dissolved sulfate. The STADIUM(reg s ign) code and data from two surrogate concretes which are similar to the Vaults 1/4 and Disposal Unit 2 concretes were used in the preliminary durability analysis. Simulation results for these surrogate concrete mixes are provided in this report. The STADIUM(reg s ign) code will be re-run using transport properties measured for the SRS Vaults 1/4 and Disposal Unit 2 concrete samples after SIMCO personnel complete characterization testing on samples of these materials. Simulation results which utilize properties measured for samples of Vaults 1/4 and Disposal Unit 2 concretes will be provided in Revision 1 of this report after property data become available. The modeling performed to date provided the following information on two concrete mixes that will be used to support the Saltstone PA: (1) Relationship between the rate of advancement of the sulfate front (depth of sulfate ion penetration into the concrete) and the rate of change of the concrete permeability and diffusivity. (2) Relationship between the sulfate ion concentration in the corrosive leachate and the rate of the sulfate front progression. (3) Equation describing the change in hydraulic properties (hydraulic conductivity and diffusivity) as a function of sulfate ion concentration in the corrosive leachate. These results have been incorporated into the current Saltstone PA analysis by G. Flach (Flach, 2008). In addition, samples of the Saltstone Vaults 1/4 and Disposal Unit 2 concretes have been prepared by SIMCO Technologies, Inc. Transport and physical properties for these materials are currently being measured and sulfate exposure testing to three high alkaline, high sulfate leachates provided by SRNL is
Key Factors That Influence The Performance Properties Of ARP/MCU Saltstone Mixes

International Nuclear Information System (INIS)

Harbour, J.; Edwards, T.; Williams, V.

2009-01-01

At the Saltstone Production Facility (SPF), decontaminated salt solution (DSS) is combined with premix (a cementitious mixture of portland cement (PC), blast furnace slag (BFS) and Class F fly ash (FA)) in a Readco mixer to produce fresh (uncured) Saltstone. After transfer to the Saltstone Disposal Facility (SDF) the hydration reactions initiated during the contact of the premix and salt solution continue during the curing period to produce the hardened waste form product. The amount of heat generated from hydration and the resultant temperature increase in the vaults depend on the composition of the decontaminated salt solution being dispositioned as well as the grout formulation (mix design). This report details the results from Task 3 of the Saltstone Variability Study for FY09 which was performed to identify, and quantify when possible, those factors that drive the performance properties of the projected ARP/MCU Batches. A baseline ARP/MCU mix (at 0.60 water to cementitious materials (w/cm) ratio) was established and consisted of the normal premix composition and a salt solution that was an average of the projected compositions of the last three ARP/MCU batches developed by T. A. Le. This task introduced significant variation in (1) wt % slag, w/cm ratio, and wt % portland cement about the baseline mix and (2) the temperature of curing in order to better assess the dependence of the performance properties on these factors. Two separate campaigns, designated Phase 10 and Phase 11, were carried out under Task 3. Experimental designs and statistical analyses were used to search for correlation among properties and to develop linear models to predict property values based on factors such as w/cm ratio, slag concentration, and portland cement concentration. It turns out that the projected salt compositions contained relatively high amounts of aluminate (0.22 M) even though no aluminate was introduced due to caustic aluminate removal from High Level Waste. Previous

Degradation Of Cementitious Materials Associated With Saltstone Disposal Units

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P; Smith, F. G. III

2013-03-19

estimate (CE) and more defensible than the best estimate (BE). The combined effects of multiple phenomena are then considered to determine the most limiting degradation time scale for each cementitious material. Degradation times are estimated using a combination of analytic solutions from literature and numerical simulation codes provided through the DOE Cementitious Barriers Partnership (CBP) Software Toolbox (http://cementbarriers.org). For the SDU 2 design, the roof, wall, and floor components are projected to become fully degraded under Nominal conditions at 3866, 923, and 1413 years, respectively. For SDU 4 the roof and floor are estimated to be fully degraded under Nominal conditions after 1137 and 1407 years, respectively; the wall is assumed to be fully degraded at time zero in the most recent PA simulations. Degradation of these concrete barriers generally occurs from combined sulfate attack and corrosion of embedded steel following carbonation. Saltstone is projected to degrade very slowly by decalcification, with complete degradation occurring in excess of 200,000 years for any SDU type. Complete results are provided.
Investigations of metal leaching from mobile phone parts using TCLP and WET methods.

Science.gov (United States)

Yadav, Satyamanyu; Yadav, Sudesh

2014-11-01

Metal leaching from landfills containing end-of-life or otherwise discarded mobile phones poses a threat to the environment as well as public health. In the present study, the metal toxicity of printed wire boards (PWBs), plastics, liquid crystal displays (LCDs) and batteries of mobile phones was assessed using the Toxicity Characteristics Leaching Procedures (TCLP) and the Waste Extraction Test (WET). The PWBs failed TCLP for Pb and Se, and WET for Pb and Zn. In WET, the two PWB samples for Pb and Zn and the battery samples for Co and Cu failed the test. Furthermore, the PWBS for Ni and the battery samples for Ni and Co failed the WET in their TCLP leachates. Both, Ni and Co are the regulatory metals in only WET and not covered under TCLP. These observations indicate that the TCLP seems to be a more aggressive test than the WET for the metal leaching from the mobile phone parts. The compositional variations, nature of leaching solution (acetate in TCLP and citrate in WET) and the redox conditions in the leaching solution of the PWBs resulted in different order of metals with respect to their amounts of leaching from PWBs in TCLP (Fe > Pb > Zn > Ni > Co > Cu) and WET (Zn > Fe > Ni > Pb > Cu). The metal leaching also varied with the make, manufacturing year and part of the mobile phone tested. PWBs, plastics and batteries should be treated as hazardous waste. Metal leaching, particularly of Se and Pb, from mobile phones can be harmful to the environment and human health. Therefore, a scientifically sound and environmentally safe handling and disposal management system needs to be evolved for the mobile phone disposal. Copyright © 2014 Elsevier Ltd. All rights reserved.
Development and Implementation of a Scaled Saltstone Facility at Savannah River National Laboratory - 13346

International Nuclear Information System (INIS)

Reigel, Marissa M.; Fowley, Mark D.; Hansen, Erich K.; Hera, Kevin R.; Marzolf, Athneal D.; Cozzi, Alex D.

2013-01-01

The Savannah River National Laboratory (SRNL) has supported the Saltstone Production Facility (SPF) since its conception. However, bench scaled tests have not always provided process or performance data related to the mixing, transfer, and other operations utilized in the SPF. A need was identified to better understand the SPF processes and to have the capabilities at SRNL to simulate the SPF unit operations to support an active low-level radioactive waste (LLW) processing facility. At the SPF, the dry premix is weighed, mixed and transferred to the Readco '10-inch' continuous mixer where it is mixed with the LLW salt solution from the Salt Feed Tank (SFT) to produce fresh Saltstone slurry. The slurry is discharged from the mixer into a hopper. The hopper feeds the grout pump that transfers the slurry through at least 457.2 meters of piping and discharges it into the Saltstone Disposal Units (SDU) for permanent disposal. In conjunction with testing individual SPF processes over several years, SRNL has designed and fabricated a scaled Saltstone Facility. Scaling of the system is primarily based on the volume capacity of the mixer and maintaining the same shear rate and total shear at the wall of the transfer line. At present, SRNL is utilizing the modular capabilities of the scaled Saltstone Facility to investigate the erosion issues related to the augers and paddles inside the SPF mixer. Full implementation of the scaled Saltstone Facility is still ongoing, but it is proving to be a valuable resource for testing alternate Saltstone formulations, cleaning sequences, the effect of pumping Saltstone to farther SDU's, optimization of the SPF mixer, and other operational variables before they are implemented in the SPF. (authors)
Leaching Behavior of Heavy Metals from Cement Pastes Using a Modified Toxicity Characteristic Leaching Procedure (TCLP).

Science.gov (United States)

Huang, Minrui; Feng, Huajun; Shen, Dongsheng; Li, Na; Chen, Yingqiang; Shentu, Jiali

2016-03-01

As the standard toxicity characteristic leaching procedure (TCLP) can not exhaust the acid neutralizing capacity of the cement rotary kiln co-processing solid wastes products which is particularly important for the assessment of the leaching concentrations of heavy metals. A modified TCLP was proposed. The extent of leaching of heavy metals is low using the TCLP and the leaching performance of the different metals can not be differentiated. Using the modified TCLP, however, Zn leaching was negligible during the first 180 h and then sharply increased (2.86 ± 0.18 to 3.54 ± 0.26 mg/L) as the acidity increased (pH leaching is enhanced using the modified TCLP. While Pb leached readily during the first 126 h and then leachate concentrations decreased to below the analytical detection limit. To conclude, this modified TCLP is a more suitable method for these cement rotary kiln co-processing products.
Nitrate Diffusional Releases from the Saltstone Facility, Vault 2, with Respect to Different Concrete Wall Thicknesses

International Nuclear Information System (INIS)

ROBERT, HIERGESELL

2005-01-01

To assist the Saltstone Vault 2 Design Team, an investigation was conducted to evaluate the effectiveness of alternative concrete wall thicknesses in limiting nitrate diffusion away from the planned facility. While the current design calls for 18-inch concrete walls, alternative thicknesses of 12-in, 8-in, and 6-in were evaluated using a simplified 1-D numerical model. To serve as a guide for Saltstone Vault 2 conceptual design, the results of this investigation were applied to Saltstone Vault 4 to determine what the hypothetical limits would be for concrete wall thicknesses thinner than the planned 18-inches. This was accomplished by adjusting the Vault 4 Limits, based on the increased nitrate diffusion rates through the thinner concrete walls, such that the 100-m well limit of 44 mg/L of nitrate as nitrate was not exceeded. The implication of these preliminary results is that as thinner vault walls are implemented there is a larger release of nitrate, thus necessitating optimal vault placement to minimize the number of vaults placed along a single groundwater flow path leading to the discharge zone
Savannah River Site - Salt-stone Disposal Facility Performance Assessment Update

International Nuclear Information System (INIS)

Newman, J.L.

2009-01-01

The Savannah River Site (SRS) Salt-stone Facility is currently in the midst of a Performance Assessment revision to estimate the effect on human health and the environment of adding new disposal units to the current Salt-stone Disposal Facility (SDF). These disposal units continue the ability to safely process the salt component of the radioactive liquid waste stored in the underground storage tanks at SRS, and is a crucial prerequisite for completion of the overall SRS waste disposition plan. Removal and disposal of low activity salt waste from the SRS liquid waste system is required in order to empty tanks for future tank waste processing and closure operations. The Salt-stone Production Facility (SPF) solidifies a low-activity salt stream into a grout matrix, known as salt-stone, suitable for disposal at the SDF. The ability to dispose of the low-activity salt stream in the SDF required a waste determination pursuant to Section 3116 of the Ronald Reagan National Defense Authorization Act of 2005 and was approved in January 2006. One of the requirements of Section 3116 of the NDAA is to demonstrate compliance with the performance objectives set out in Subpart C of Part 61 of Title 10, Code of Federal Regulations. The PA is the document that is used to ensure ongoing compliance. (authors)
Modified TCLP test for evaluating the leachability of site-specific wastes

International Nuclear Information System (INIS)

Pier, J.

1996-01-01

The Weldon Spring Site Remedial Action Project (WSSRAP) has developed a site-specific test to assess the leachability of wastes that will be placed in its on-site disposal cell. This test is modelled after the TCLP, but examines an expanded list of parameters and uses an extraction solution that is representative of conditions that are expected to exist in the disposal facility. Following the same logic that guided development of TCLP protocols, the WSSRAP developed concentration guidelines for non-TCLP parameters that were contaminants of concern in its wastes. Response actions, specific to the WSSRAP cell and wastes, were also developed to address constituents that failed to meet these guides. From 1955 to 1966, the US Atomic Energy Commission operated a uranium feed materials plant on this site. Nitroaromatic, and later, radiological wastes were disposed of in the quarry from 1945 until 1970. This paper describes testing to determine whether contaminant concentrations in leachates derived from the major waste-types that will be placed in its on-site disposal cell conform with the Department of Energy's (DOE) as low as reasonably achievable (ALARA) policy. Although the WSSRAP will continue to use the TCLP test to determine if any waste is classified RCRA-hazardous, the site-specific test described in this paper will be used to further assess whether leachate from any waste-type has the potential to adversely impact groundwater
Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

Energy Technology Data Exchange (ETDEWEB)

Almond, P. M. [Savannah River Site (SRS), Aiken, SC (United States); Kaplan, D. I. [Savannah River Site (SRS), Aiken, SC (United States); Langton, C. A. [Savannah River Site (SRS), Aiken, SC (United States); Stefanko, D. B. [Savannah River Site (SRS), Aiken, SC (United States); Spencer, W. A. [Savannah River Site (SRS), Aiken, SC (United States); Hatfield, A. [Clemson University, Clemson, SC (United States); Arai, Y. [Clemson University, Clemson, SC (United States)

2012-08-23

The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.
Verification of Sulfate Attack Penetration Rates for Saltstone Disposal Unit Modeling

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-05-12

Recent Special Analysis modeling of Saltstone Disposal Units consider sulfate attack on concrete and utilize degradation rates estimated from Cementitious Barriers Partnership software simulations. This study provides an independent verification of those simulation results using an alternative analysis method and an independent characterization data source. The sulfate penetration depths estimated herein are similar to the best-estimate values in SRNL-STI-2013-00118 Rev. 2 and well below the nominal values subsequently used to define Saltstone Special Analysis base cases.
Lessons Learned from an External Review of the Savannah River Site Saltstone Performance Assessment Program

International Nuclear Information System (INIS)

Cook, J.R.

2006-01-01

The Savannah River National Laboratory is actively working on a total revision of the Saltstone Performance Assessment. 'Lessons Learned' from the review are being applied to this effort. Examples of the areas in which significant new work is being done are development of a methodology to do probabilistic uncertainty analyses, employing quantitative analytical tools to represent long-term chemical degradation of both concrete and the Saltstone wasteform, and then using those tools to come to a better understanding of how changes in the vault and Saltstone will affect the performance of the overall disposal system over long periods of time. (authors)
Benzene Evolution Rates from Saltstone Prepared with 2X ITP Flowsheet Concentrations of Phenylborates and Heated to 85 Degrees C

International Nuclear Information System (INIS)

Poirier, M.R.

2000-01-01

The Saltstone Facility provides the final treatment and disposal of low level liquid wastes streams. At the Saltstone Facility, the waste is mixed with cement, flyash, and slag to form a grout, which is pumped into large concrete vaults where it cures. The facility started radioactive operations in June 1990. High Level Waste Engineering requested Savannah River Technology Center to determine the effect of TPB and its decomposition products (i.e., 3PB, 2PB, and 1PB) on the saltstone process. Previous testing performed by SRTC determined saltstone benzene evolution rates a function of ITP filtrate composition. Testing by the Thermal Fluids Laboratory has shown at design operation, the temperature in the Z-area vaults could reach 85 degrees Celsius. Saltstone asked SRTC to perform additional testing to determine whether curing at 85 degrees Celsius could change saltstone benzene evolution rates. This document describes the test performed to determine the effect of curing temperature on the benzene evolution rates
Saltstone processing startup at the Savannah River Plant

International Nuclear Information System (INIS)

Wilhite, E.L.; Langton, C.A.; Sturm, H.F.; Hooker, R.L.; Occhipinti, E.S.

1988-01-01

High-level nuclear wastes are stored in large underground tanks at the Savannah River Plant. Processing of this waste in preparation for ultimate disposal will begin in 1988. The waste will be processed to separate the high-level radioactive fraction from the low-level radioactive fraction. The separation will be made in existing waste tanks by a process combining precipitation, adsorption, and filtration. The high-level fraction will be vitrified into borosilicate glass in the Defense Waste Processing Facility (DWPF) for permanent disposal in a federal repository. The low-level fraction (decontaminated salt solution) will be mixed with a cementitious slag-flyash blend. The resulting wasteform, saltstone, will be disposed of onsite by emplacement in an engineered facility. Waste properties, disposal facility details, and wasteform characteristics are discussed. In particular, details of saltstone processing, focusing on experience obtained from facility startup, are presented
Evaluation of Proposed New LLW Disposal Activity: Disposal of Aqueous PUREX Waste Stream in the Saltstone Disposal Facility

International Nuclear Information System (INIS)

Cook, J.R.

2003-01-01

The Aqueous PUREX waste stream from Tanks 33 and 35, which have been blended in Tank 34, has been identified for possible processing through the Saltstone Processing Facility for disposal in the Saltstone Disposal Facility
Estimated release from the saltstone landfill effect of landfill caps and landfill-cap/monolith-liner combinations

International Nuclear Information System (INIS)

Wilhite, E.L.

1985-01-01

The effect of capping the entire saltstone landfill is dependent on the effectiveness of the clay cap in preventing infiltration. A cap that is 99% effective will reduce releases from the saltstone landfill by a factor of 7.7. Several combinations of landfill design alterations will result in meeting ground water standards
Composite analysis E-area vaults and saltstone disposal facilities

Energy Technology Data Exchange (ETDEWEB)

Cook, J.R.

1997-09-01

This report documents the Composite Analysis (CA) performed on the two active Savannah River Site (SRS) low-level radioactive waste (LLW) disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults (EAV) Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of SRS and contains all of the waste disposal facilities, chemical separations facilities and associated high-level waste storage facilities as well as numerous other sources of radioactive material. The analysis considered 114 potential sources of radioactive material containing 115 radionuclides. The results of the CA clearly indicate that continued disposal of low-level waste in the saltstone and EAV facilities, consistent with their respective radiological performance assessments, will have no adverse impact on future members of the public.
Composite analysis E-area vaults and saltstone disposal facilities

International Nuclear Information System (INIS)

Cook, J.R.

1997-09-01

This report documents the Composite Analysis (CA) performed on the two active Savannah River Site (SRS) low-level radioactive waste (LLW) disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults (EAV) Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of SRS and contains all of the waste disposal facilities, chemical separations facilities and associated high-level waste storage facilities as well as numerous other sources of radioactive material. The analysis considered 114 potential sources of radioactive material containing 115 radionuclides. The results of the CA clearly indicate that continued disposal of low-level waste in the saltstone and EAV facilities, consistent with their respective radiological performance assessments, will have no adverse impact on future members of the public
FOAM FORMATION IN THE SALTSTONE PRODUCTION FACILITY: EVALUATION OF SOURCES AND MITIGATION

Energy Technology Data Exchange (ETDEWEB)

Cozzi, A.

2011-01-18

The Saltstone Production Facility receives waste from Tank 50H for treatment. Influents into Tank 50H include the Effluent Treatment Project waste concentrate, H-Canyon low activity waste and General Purpose Evaporator bottoms, Modular Caustic Side Solvent Extraction Unit decontaminated salt solution, and salt solution from the Deliquification, Dissolution and Adjust campaign. Using the Waste Characterization System (WCS), this study tracks the relative amounts of each influent into Tank 50H, as well as the total content of Tank 50H, in an attempt to identify the source of foaming observed in the Saltstone Production Facility hopper. Saltstone has been using antifoam as part of routine processing with the restart of the facility in December 2006. It was determined that the maximum admix usage in the Saltstone Production Facility, both antifoam and set retarder, corresponded with the maximum concentration of H-Canyon low activity waste in Tank 50H. This paper also evaluates archived salt solutions from Waste Acceptance Criteria analysis for propensity to foam and the antifoam dosage required to mitigate foaming. It was determined that Effluent Treatment Project contributed to the expansion factor (foam formation) and General Purpose Evaporator contributed to foaminess (persistence). It was also determined that undissolved solids contribute to foam persistence. It was shown that additions of Dow Corning Q2-1383a antifoam reduced both the expansion factor and foaminess of salt solutions. The evaluation of foaming in the grout hopper during the transition from water to salt solution indicated that higher water-to-premix ratios tended to produce increased foaming. It was also shown that additions of Dow Corning Q2-1383a antifoam reduced foam formation and persistence.
Groundwater Monitoring Plan for the Z-Area Saltstone Disposal Facility, Revision 3

International Nuclear Information System (INIS)

WELLS, DANIEL

2005-01-01

Groundwater monitoring has been conducted at the Z-Area Saltstone Disposal Facility since 1987. At that time, groundwater monitoring was not required by the industrial landfill regulations, but a modest monitoring program was required by the operating permit. At the time of the 1996 permit renewal, it was determined that a more robust monitoring program was needed. The draft permit required new monitoring wells within 25 feet of each active disposal cell. As an alternative, SRS proposed a program based on direct push sampling. This program called for biennial direct push sampling within 25 feet of each waste-containing cell with additional samples being taken in areas where excessive cracking had been observed. The direct push proposal was accepted by The South Carolina Department of Health and Environmental Control (SCDHEC), and was incorporated by reference into the Z-Area Saltstone Industrial Solid Waste Permit, No.025500-1603. The Industrial Solid Waste Landfill Regulations were revised in 1998 and now include specific requirements for groundwater monitoring. SRS's plan for complying with those regulations is discussed below. The plan calls for a return to traditional monitoring with permanent wells. It also proposes a more technically sound monitoring list based on the actual composition of saltstone
IMPACT OF INCREASED ALUMINATE CONCENTRATIONS ON PROPERTIES OF SALTSTONE MIXES

International Nuclear Information System (INIS)

Harbour, J; Tommy Edwards, T; Erich Hansen, E; Vickie Williams, V

2007-01-01

trends observed as the aluminate concentration increased in the salt solution were decreased Bingham Plastic yield stress and plastic viscosity, greater flowability of the grout, and reduced gel times and bleed volume for SWPF based mixes. On the other hand, the set times increased significantly with increasing aluminate concentration in the salt solutions. For the SWPF mixes, the set time increased from 1 to 4 days and for the Tank 11 mixes, the set time increased from 1 to 2 days. Heat of hydration measurements were consistent with the increased set times with extended induction periods (2 to 4 days) as aluminate concentration increased in the salt solution. This extended induction period of heat evolution observed with increasing aluminate concentrations must be addressed for Saltstone operations to avoid exceeding temperature limits. It is anticipated that the induction period will be temperature dependent and should be measured for future projections and included in the thermal modeling. The overall heat generation was greater in the mixes containing higher concentrations of aluminate. In fact, for the total heat release values calculated using curve fitting for longer times, the amount of heat was increased by 33% for SWPF based solutions and by 46% for Tank 11 based solutions. The larger amount of heat from mixes containing higher aluminate concentration must be accounted for in the modeling effort which determines the pour schedule for Saltstone. The increased induction periods were shown to be associated with hydration reactions of the blast furnace slag. The rate of heat generation with high aluminate solutions and Portland cement were only accelerated whereas high aluminate mixes containing blast furnace slag only showed the characteristic increase in induction time that was observed with mixes prepared using the premix blend of cementitious materials. It was shown that fly ash does not react significantly during the first seven days of curing but then
SALTSTONE VARIABILITY STUDY - MEASUREMENT OF POROSITY

International Nuclear Information System (INIS)

Harbour, J; Vickie Williams, V; Tommy Edwards, T; Russell Eibling, R; Ray Schumacher, R

2007-01-01

One of the goals of the Saltstone Variability Study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone mixes. One of the key performance properties is porosity which is a measure of the volume percent of a cured grout that is occupied by salt solution (for the saturated case). This report presents (1) the results of efforts to develop a method for the measurement of porosity of grout samples and (2) initial results of porosity values for samples that have been previously produced as part of the Saltstone Variability Study. A cost effective measurement method for porosity was developed that provides reproducible results, is relatively fast (30 to 60 minutes per sample) and uses a Mettler Toledo HR83 Moisture Analyzer that is already operational and routinely calibrated at Aiken County Technology Laboratory. The method involves the heating of the sample at 105 C until no further mass loss is observed. This mass loss value, which is due to water evaporation, is then used to calculate the volume percent porosity of the mix. The results of mass loss for mixes at 105 C were equivalent to the results obtained using thermal gravimetric analysis. The method was validated by comparing measurements of mass loss at 105 C for cured portland cement in water mixes to values presented in the literature for this system. A stereopycnometer from Quantachrome Instruments was selected to measure the cured grout bulk densities. Density is a property that is required to calculate the porosities. A stereopycnometer was already operational at Aiken County Technology Laboratory, has been calibrated using a solid stainless steel sphere of known volume, is cost effective and fast (∼15 minutes per sample). Cured grout densities are important in their own right because they can be used to project the volume of waste form produced from a given amount of salt feed of known composition. For mixes

GAS MIXING ANALYSIS IN A LARGE-SCALED SALTSTONE FACILITY

Energy Technology Data Exchange (ETDEWEB)

Lee, S

2008-05-28

Computational fluid dynamics (CFD) methods have been used to estimate the flow patterns mainly driven by temperature gradients inside vapor space in a large-scaled Saltstone vault facility at Savannah River site (SRS). The purpose of this work is to examine the gas motions inside the vapor space under the current vault configurations by taking a three-dimensional transient momentum-energy coupled approach for the vapor space domain of the vault. The modeling calculations were based on prototypic vault geometry and expected normal operating conditions as defined by Waste Solidification Engineering. The modeling analysis was focused on the air flow patterns near the ventilated corner zones of the vapor space inside the Saltstone vault. The turbulence behavior and natural convection mechanism used in the present model were benchmarked against the literature information and theoretical results. The verified model was applied to the Saltstone vault geometry for the transient assessment of the air flow patterns inside the vapor space of the vault region using the potential operating conditions. The baseline model considered two cases for the estimations of the flow patterns within the vapor space. One is the reference nominal case. The other is for the negative temperature gradient between the roof inner and top grout surface temperatures intended for the potential bounding condition. The flow patterns of the vapor space calculated by the CFD model demonstrate that the ambient air comes into the vapor space of the vault through the lower-end ventilation hole, and it gets heated up by the Benard-cell type circulation before leaving the vault via the higher-end ventilation hole. The calculated results are consistent with the literature information. Detailed results and the cases considered in the calculations will be discussed here.
AcEST: DK950587 [AcEST

Lifescience Database Archive (English)

Full Text Available e uncharacterized protein OS=Oryza... 35 0.050 tr|Q68LQ2|Q68LQ2_9ROSI Maturase (Fragment) OS=Sapria himalaya...na ... 37 0.50 tr|Q5QCI0|Q5QCI0_9ROSI Maturase (Fragment) OS=Sapria himalayana ... 37 0.50 tr|Q6FQH7|Q6FQH7_...C Sbjct: 115 LSRTCGDVDFLLVMGDESDATRELC 139 >tr|Q68LQ2|Q68LQ2_9ROSI Maturase (Fragment) OS=Sapria himalayana ...ase (Fragment) OS=Sapria himalayana GN=matR PE=4 SV=1 Length = 584 Score = 37.4 b
PHYSICAL PROPERTY MEASUREMENTS OF LABORATORY PREPARED SALTSTONE GROUT

Energy Technology Data Exchange (ETDEWEB)

Hansen, E.; Cozzi, A.; Edwards, T.

2014-05-05

The Saltstone Production Facility (SPF) built two new Saltstone Disposal Units (SDU), SDU 3 and SDU 5, in 2013. The variable frequency drive (VFD) for the grout transfer hose pump tripped due to high current demand by the motor during the initial radioactive saltstone transfer to SDU 5B on 12/5/2013. This was not observed during clean cap processing on July 5, 2013 to SDU 3A, which is a slightly longer distance from the SPF than is SDU 5B. Saltstone Design Authority (SDA) is evaluating the grout pump performance and capabilities to transfer the grout processed in SPF to SDU 3/5. To assist in this evaluation, grout physical properties are required. At this time, there are no rheological data from the actual SPF so the properties of laboratory prepared samples using simulated salt solution or Tank 50 salt solution will be measured. The physical properties of grout prepared in the laboratory with de-ionized water (DI) and salt solutions were obtained at 0.60 and 0.59 water to premix (W/P) ratios, respectively. The yield stress of the DI grout was greater than any salt grout. The plastic viscosity of the DI grout was lower than all of the salt grouts (including salt grout with admixture). When these physical data were used to determine the pressure drop and fluid horsepower for steady state conditions, the salt grouts without admixture addition required a higher pressure drop and higher fluid horsepower to transport. When 0.00076 g Daratard 17/g premix was added, both the pressure drop and fluid horsepower were below that of the DI grout. Higher concentrations of Daratard 17 further reduced the pressure drop and fluid horsepower. The uncertainty in the single point Bingham Plastic parameters is + 4% of the reported values and is the bounding uncertainty. Two different mechanical agitator mixing protocols were followed for the simulant salt grout, one having a total mixing time of three minutes and the other having a time of 10 minutes. The Bingham Plastic parameters
Design of saltstone vaults

International Nuclear Information System (INIS)

Aiyar, G.S.; Hsiu, F.J.

1987-01-01

Radioactive waste from processed spent nuclear fuel at the Savannah River Plant, South Carolina, are stored in underground tanks. The wastes consist of sludge and supernate. Most of the radionuclides and some nonradioactive constituents are removed from the supernate. These along with the sludge are converted into a glass-crystallite matrix and cast into stainless steel cansisters for future disposal in a geological repository. The decontaminated salt solution is mixed with cement, fly ash, and a set-retarding agent, and the resulting grout is transferred to reinforced concrete vaults where it sets into a monolith termed saltstone. The vault is then capped with concrete. A total of 21 vaults measuring 600 x 100 x 27 ft are planned for disposal of the existing supernate plus any additional supernate generated up to the year 2000
Lysimeter study of vegetative uptake from saltstone. Part I. Design, installation, and data collection plan

International Nuclear Information System (INIS)

Johnson, T.L.

1986-02-01

A field test facility has been designed and installed to obtain data on the vegetative uptake of radionuclides from buried low-level radioactive waste. The waste is a cement-like, solidified salt solution known as saltstone. The facility consists of 32 lysimeters (containers 6 feet in diameter and 6 to 10 feet in depth) holding buried saltstone at varying depths, and with varying types of vegetation grown at the surface. Vegetation, soil, and groundwater samples will be analyzed for Tc-99, Sr-90, I-129, Cs-137, and other radionuclides. Groundwater will also be analyzed for other water quality parameters, including nitrates
Saltstone: cement-based waste form for disposal of Savannah River Plant low-level radioactive salt waste

International Nuclear Information System (INIS)

Langton, C.A.

1984-01-01

Defense waste processing at the Savannah River Plant will include decontamination and disposal of approximately 400 million liters of waste containing NaNO 3 , NaOH, Na 2 SO 4 , and NaNO 2 . After decontamination, the salt solution is classified as low-level waste. A cement-based waste form, saltstone, has been designed for disposal of Savannah River Plant low-level radioactive salt waste. Bulk properties of this material have been tailored with respect to salt leach rate, permeability, and compressive strength. Microstructure and mineralogy of leached and unleached specimens were characterized by SEM and x-ray diffraction analyses. The disposal system for the DWPF salt waste includes reconstitution of the crystallized salt as a solution containing 32 wt % solids. This solution will be decontaminated to remove 137 Cs and 90 Sr and then stabilized in a cement-based waste form. Laboratory and field tests indicate that this stabilization process greatly reduces the mobility of all of the waste constitutents in the surface and near-surface environment. Engineered trenches for subsurface burial of the saltstone have been designed to ensure compatibility between the waste form and the environment. The total disposal sytem, saltstone-trench-surrounding soil, has been designed to contain radionuclides, Cr, and Hg by both physical encapsulation and chemical fixation mechanisms. Physical encapsulation of the salts is the mechanism employed for controlling N and OH releases. In this way, final disposal of the SRP low-level waste can be achieved and the quality of the groundwater at the perimeter of the disposal site meets EPA drinking water standards
Performance Properties Of Saltstone Produced Using SWPF Simulants

International Nuclear Information System (INIS)

Harbour, J.; Edwards, T.

2010-01-01

The overwhelming majority of waste to be immobilized at the Saltstone Production Facility will come from the waste stream exiting the Salt Waste Processing Facility (SWPF). These SWPF batches are salt solutions that result from pretreatment of the High Level Waste (HLW) supernate by an Actinide Removal Process followed by Caustic Side Solvent Extraction. The concentration of aluminate within these streams will vary and be determined by (1) the concentration in the incoming salt waste stream, (2) the degree of aluminum leaching from the HLW, (3) the method for introducing the aluminate into the waste stream (continuous or batch) and (4) and any operational or regulatory limitations. The overall Performance Assessment outcome for the Saltstone Disposal Facility will depend significantly on the performance properties of the SWPF Saltstone grouts. This report identifies and quantifies, when possible, those factors that drive the performance properties of the projected SWPF grouts. Previous work has identified aluminate concentration in the salt waste stream as a key factor in determining performance. Consequently, significant variation in the aluminate concentration to a maximum level of 0.65 M was investigated in this report. The SWPF baseline grout is a mix with a 0.60 water to cementitious ratio and a premix composition of 45 wt % slag, 45 wt % fly ash and 10 wt % portland cement. The key factors that drive performance of the SWPF mixes were determined to be (1) the time/temperature profile for curing, (2) water to cementitious materials ratio, (3) aluminate concentration in the waste stream, and (4) wt % slag in the premix. An increase in the curing temperature for mixes with 45 wt % slag resulted in a 2.5 times decrease in Young's modulus. The reduction of Young's modulus measured at 60 C versus 22 C was mitigated by an increase in the aluminate concentration but was still significant. For mixes containing 60 wt % slag, the reduction in Young's modulus between
Adaptation of the TCLP and SW-846 methods to radioactive mixed waste

International Nuclear Information System (INIS)

Griest, W.H.; Schenley, R.L.; Caton, J.E.; Wolfe, P.F.

1994-01-01

Modifications of conventional sample preparation and analytical methods are necessary to provide radiation protection and to meet sensitivity requirements for regulated constituents when working with radioactive samples. Adaptations of regulatory methods for determining ''total'' Toxicity Characteristic Leaching Procedure (TCLP) volatile and semivolatile organics and pesticides, and for conducting aqueous leaching are presented
UK-Nuclear decommissioning authority and US Salt-stone waste management issues

International Nuclear Information System (INIS)

Lawless, William; Whitton, John

2007-01-01

Available in abstract form only. Full text of publication follows: We update two case studies of stakeholder issues in the UK and US. Earlier versions were reported at Waste Management 2006 and 2007 and at ICEM 2005. UK: The UK nuclear industry has begun to consult stakeholders more widely in recent years. Historically, methods of engagement within the industry have varied, however, recent discussions have generally been carried out with the explicit understanding that engagement with stakeholders will be 'dialogue based' and will 'inform' the final decision made by the decision maker. Engagement is currently being carried out at several levels within the industry; at the national level (via the Nuclear Decommissioning Authority's (NDA) National Stakeholder Group (NSG)); at a local site level (via Site Stakeholder Groups) and at a project level (usually via the Best Practicable Environmental Option process (BPEO)). This paper updates earlier results by the co-author with findings from a second questionnaire issued to the NSG in Phase 2 of the engagement process. An assessment is made regarding the development of stakeholder perceptions since Phase 1 towards the NDA process. US: The US case study reviews the resolution of issues on salt-stone by Department of Energy's (DOE) Savannah River Site (SRS) Citizens Advisory Board (CAB), in Aiken, SC. Recently, SRS-CAB encouraged DOE and South Carolina's regulatory Department of Health and Environmental Control (SC-DHEC) to resolve a conflict preventing SC-DHEC from releasing a draft permit to allow SRS to restart salt-stone operations. It arose with a letter sent from DOE blaming the Governor of South Carolina for delay in restarting salt processing. In reply, the Governor blamed DOE for failing to assure that Salt Waste Processing Facility (SWPF) would be built. SWPF is designed to remove most of the radioactivity from HLW prior to vitrification, the remaining fraction destined for salt-stone. (authors)
Large-scale demonstration of disposal of decontaminated salt as saltstone. Part I. Construction, loading, and capping of lysimeters

International Nuclear Information System (INIS)

Wolf, H.C.

1984-06-01

The installation phase of a large-scale demonstration of the disposal concept for decontaminated, low-level radioactive salt waste at the Savannah River Plant was completed in December 1983 and January 1984. The installation entailed immobilizing 7500 gallons of decontaminated salt solution with a blended cement formulation and pouring the resulting grout, saltstone, into three specially designed lysimeters for extended in-field leaching tests under natural conditions. 4 references, 35 figures, 4 tables
Waste Incidental to Reprocessing Evaluation for Disposing Saltcake to Saltstone

International Nuclear Information System (INIS)

Jones, R.T.

2002-01-01

This Waste Incidental to Reprocessing Evaluation is performed in accordance with Department of Energy Order 435.1, Radioactive Waste Management. This evaluation is performed in order to determine whether saltcake currently stored in the Tank Farms, when separated from supernate, meets WIR requirements and can therefore be managed as Low Level Waste and disposed in the Saltstone Production and Disposal Facility in Z-Area
Addendum to the composite analysis for the E-Area Vaults and Saltstone Disposal Facilities

Energy Technology Data Exchange (ETDEWEB)

Cook, J.R.

2000-03-13

This report documents the composite analysis performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility.
Addendum to the composite analysis for the E-Area Vaults and Saltstone Disposal Facilities

International Nuclear Information System (INIS)

Cook, J.R.

2000-01-01

This report documents the composite analysis performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility
Special Analysis: Revised 14C Disposal Limits for the Saltstone Disposal Facility

International Nuclear Information System (INIS)

Kaplan, D.I.

2004-01-01

The Saltstone Special Analysis calculated a limit for 14C based on the atmospheric pathway of 52 pCi/mL using some very conservative assumptions. This was compared to the estimated Low Curie Salt concentration of 0.45 pCi/mL and since the limit was two orders of magnitude greater than the estimated concentration, the decision was made that no further analysis was needed. The 14C concentration in Tank 41 has been found to be much greater than the estimated concentration and to exceed the limit derived in the Special Analysis. A rigorous analysis of the release of 14C via the air pathway that considers the chemical effects of the Saltstone system has shown that the flux of 14C is significantly less than that assumed in the Special Analysis. The net result is an inventory limit for 14C that is significantly higher than that derived in the Special Analysis that will also meet the performance objectives of DOE Order 435.1
PORFLOW Simulations Supporting Saltstone Disposal Unit Design Optimization

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hang, T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Taylor, G. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-12-10

SRNL was requested by SRR to perform PORFLOW simulations to support potential cost-saving design modifications to future Saltstone Disposal Units in Z-Area (SRR-CWDA-2015-00120). The design sensitivity cases are defined in a modeling input specification document SRR-CWDA-2015-00133 Rev. 1. A high-level description of PORFLOW modeling and interpretation of results are provided in SRR-CWDA-2015-00169. The present report focuses on underlying technical issues and details of PORFLOW modeling not addressed by the input specification and results interpretation documents. Design checking of PORFLOW modeling is documented in SRNL-L3200-2015-00146.
SENSITIVITY ANALYSIS FOR SALTSTONE DISPOSAL UNIT COLUMN DEGRADATION ANALYSES

Energy Technology Data Exchange (ETDEWEB)

Flach, G.

2014-10-28

PORFLOW related analyses supporting a Sensitivity Analysis for Saltstone Disposal Unit (SDU) column degradation were performed. Previous analyses, Flach and Taylor 2014, used a model in which the SDU columns degraded in a piecewise manner from the top and bottom simultaneously. The current analyses employs a model in which all pieces of the column degrade at the same time. Information was extracted from the analyses which may be useful in determining the distribution of Tc-99 in the various SDUs throughout time and in determining flow balances for the SDUs.
Comparative Study on the Leaching Characteristics of Industrial Sludge and Fly Ash using KSLP and TCLP Techniques

International Nuclear Information System (INIS)

Lee, B.K.; Hwang, H.W.

2010-01-01

Leaching characteristics of industrial sludge and fly ash using Korean Standard Leaching Procedure (KSLP) and Toxicity Characteristics Leaching Procedure (TCLP) were studied. Possibilities of re-adsorption of heavy metal ions on the surface of sludge and ash during the course of leaching were also investigated. KSLP looked relatively more aggressive than the TCLP in leaching heavy metal ions. Concentrations of metal ions leached in both the methods, however, were found very low in comparison to the concentration of ions present in the original samples. In case of sludge, heavy metal ions showed relatively high rate of leaching at fourth and fifth stages of sequential extraction while ash showed high rate of leaching at the first three stages of extraction. Some of the concentrations of heavy metal ions leached out in the tests also found to be adsorbed on the surface of sludge and ash. Heavy metal ions present in high concentrations in the sample showed lower rate of adsorption than their leaching rate. No distinct difference in the results of KSLP and TCLP was observed. However, variations in the leaching results could be due to the different nature of hazardous waste and leaching conditions. More information like kinetics of leaching, mineralogical characteristics of waste and site characteristics of landfill were required to predict more accurate leaching behavior of ions in natural conditions. (author)
Z-Area Saltstone Disposal Facility Groundwater Monitoring Report. 1997 Annual Report

International Nuclear Information System (INIS)

Roach, J.L. Jr.

1997-12-01

Samples from the ZBG wells at the Z-Area Saltstone Disposal Facility are analyzed for constituents required by South Carolina Department of Health and Environmental Control (SCDHEC) Industrial Solid Waste Permit number-sign 025500-1603 (formerly IWP-217). No constituents were reported above SCDHEC-proposed groundwater monitoring standards or final Primary Drinking Water Standards during first or third quareters 1997. No constituents were detected above SRS flagging criteria during first or third quarters 1997
Stabilization of inorganic mixed waste to pass the TCLP and STLC tests using clay and pH-insensitive additives

Energy Technology Data Exchange (ETDEWEB)

Bowers, J.S.; Anson, J.R.; Painter, S.M. [Lawrence Livermore National Lab., CA (United States)] [and others

1995-12-31

Stabilization is a best demonstrated available technology, or BDAT. This technology traps toxic contaminants in a matrix so that they do not leach into the environment. The stabilization process routinely uses pozzolanic materials. Portland cement, fly ash-lime mixes, gypsum cements, and clays are some of the most common materials. In many instances, materials that can pass the Toxicity Characteristic Leaching Procedure (TCLP the federal leach test) or the Soluble Threshold Leachate Concentration (STLC the California leach test) must have high concentrations of lime or other caustic material because of the low pH of the leaching media. Both leaching media, California`s and EPA`s, have a pH of 5.0. California uses citric acid and sodium citrate while EPA uses acetic acid and sodium acetate. The concentration in the leachate is approximately ten times higher for the STLC procedure than the TCLP. These media can form ligands that provide excellent metal leaching. Because of the aggressive nature of the leaching medium, stabilized wastes in many cases will not pass the leaching tests. At the Lawrence Livermore National Laboratory (LLNL), additives such as dithiocarbamates and thiocarbonates, which are pH-insensitive and provide resistance to ligand formation, are used in the waste stabilization process. Attapulgite, montmorillonite, and sepiolite clays are used because they are forgiving (recipe can be adjusted before the matrix hardens) when formulating a stabilization matrix, and they have a neutral pH. By using these clays and additives, LLNL`s highly concentrated wastewater treatment sludges have passed the TCLP and STLC tests. The most frequently used stabilization process consists of a customized recipe involving waste sludge, clay and dithiocarbamate salt, mixed with a double planetary mixer into a pasty consistency. TCLP and STLC data on this waste matrix have shown that the process matrix meets land disposal requirements.
[Evaluation of phosphate-containing amendments on remediation effect and influential factors in a lead/zinc mining tailings contaminated soil using TCLP and forms].

Science.gov (United States)

Chen, Jian-Jun; Yu, Tian-Ming; Wang, Bi-Ling; Xie, Zheng-Miao

2010-01-01

A pot experiment was conducted to evaluate the effects of phosphate-containing (P) amendments on the toxicity and bioavailability of Pb and Zn in a soil contaminated by mining tailings using toxicity characteristic leaching procedure (TCLP) and water soluble, exchangeable leaching procedures in order to find out the appropriate P application rates to reduce the soil TCLP extractable Pb to below the USA EPA's regulatory limit levels. The results showed that TCLP extractable Pb concentrations were significantly decreased by up to 93.3% for MPP treatments and up to 68.5% for SSP treatments after P application. The dose required to reduce leachable Pb below the EPA's regulatory limit level was found to be around the molar ratio of v(P/Pb) = 0.6 for MPP and 1.8 for SSP. It was also found both MPP and SSP could reduce the exchangeable Pb and Zn concentrations that all bio-available Zn forms including water soluble, exchangeable, and TCLP extractable forms in soil were significantly and negatively correlated to soil pH values, indicating that the content of Zn in the soil was mostly controlled by soil pH value even after P application. These results suggest that P as MPP and SSP could successfully decrease the toxicity and bioavailability of Pb and Zn in the contaminated soil.

Radiological performance assessment for the Z-Area Saltstone Disposal Facility

Energy Technology Data Exchange (ETDEWEB)

Cook, J.R.; Fowler, J.R. [Westinghouse Savannah River Co., Aiken, SC (United States)

1992-12-18

This radiological performance assessment (RPA) for the Savannah River Site (SRS) Saltstone Disposal Facility (SDF) was prepared in accordance with the requirements of Chapter III of the US Department of Energy Order 5820.2A. The Order specifies that an RPA should provide reasonable assurance that a low-level waste (LLW) disposal facility will comply with the performance objectives of the Order. The performance objectives require that: (1) exposures of the general public to radioactivity in the waste or released from the waste will not result in an effective dose equivalent of 25 mrem per year; (2) releases to the atmosphere will meet the requirements of 40 CFR 61; (3) inadvertent intruders will not be committed to an excess of an effective dose equivalent of 100 mrem per year from chronic exposure, or 500 mrem from a single acute exposure; and (4) groundwater resources will be protected in accordance with Federal, State and local requirements.
Radiological performance assessment for the Z-Area Saltstone Disposal Facility

International Nuclear Information System (INIS)

Cook, J.R.; Fowler, J.R.

1992-01-01

This radiological performance assessment (RPA) for the Savannah River Site (SRS) Saltstone Disposal Facility (SDF) was prepared in accordance with the requirements of Chapter III of the US Department of Energy Order 5820.2A. The Order specifies that an RPA should provide reasonable assurance that a low-level waste (LLW) disposal facility will comply with the performance objectives of the Order. The performance objectives require that: (1) exposures of the general public to radioactivity in the waste or released from the waste will not result in an effective dose equivalent of 25 mrem per year; (2) releases to the atmosphere will meet the requirements of 40 CFR 61; (3) inadvertent intruders will not be committed to an excess of an effective dose equivalent of 100 mrem per year from chronic exposure, or 500 mrem from a single acute exposure; and (4) groundwater resources will be protected in accordance with Federal, State and local requirements
4U 1907+09: an HMXB running away from the Galactic plane

Science.gov (United States)

Gvaramadze, V. V.; Röser, S.; Scholz, R.-D.; Schilbach, E.

2011-05-01

We report the discovery of a bow shock around the high-mass X-ray binary (HMXB) 4U 1907+09 using the Spitzer Space Telescope 24 μm data (after Vela X-1 the second example of bow shocks associated with HMXBs). The detection of the bow shock implies that 4U 1907+09 is moving through space with a high (supersonic) peculiar velocity. To confirm the runaway nature of 4U 1907+09, we measured its proper motion, which for an adopted distance to the system of 4 kpc corresponds to a peculiar transverse velocity of ≃ 160 ± 115 km s-1, meaning that 4U 1907+09 is indeed a runaway system. This also supports the general belief that most HMXBs possess high space velocities. The direction of motion of 4U 1907+09 inferred from the proper motion measurement is consistent with the orientation of the symmetry axis of the bow shock, and shows that the HMXB is running away from the Galactic plane. We also present the Spitzer images of the bow shock around Vela X-1 (a system similar to 4U 1907+09) and compare it with the bow shock generated by 4U 1907+09.
Delisting petition for 300-M saltstone (treated F006 sludge) from the 300-M liquid effluent treatment facility

Energy Technology Data Exchange (ETDEWEB)

1989-04-04

This petition seeks exclusion for stabilized and solidified sludge material generated by treatment of wastewater from the 300-M aluminum forming and metal finishing processes. The waste contains both hazardous and radioactive components and is classified as a mixed waste. The objective of this petition is to demonstrate that the stabilized sludge material (saltstone), when properly disposed, will not exceed the health-based standards for the hazardous constituents. This petition contains sampling and analytical data which justify the request for exclusion. The results show that when the data are applied to the EPA Vertical and Horizontal Spread (VHS) Model, health-based standards for all hazardous waste constituents will not be exceeded during worst case operating and environmental conditions. Disposal of the stabilized sludge material in concrete vaults will meet the requirements pertaining to Waste Management Activities for Groundwater Protection at the Savannah River Site in Aiken, S.C. Documents set forth performance objectives and disposal options for low-level radioactive waste disposal. Concrete vaults specified for disposal of 300-M saltstone (treated F006 sludge) assure that these performance objectives will be met.
Groundwater Monitoring Plan for the Z-Area Saltstone Facility

International Nuclear Information System (INIS)

Wells, D.

2002-01-01

Groundwater monitoring has been conducted at the Z-Area Saltstone Disposal Facility since 1987. At that time, groundwater monitoring was not required by the industrial landfill regulations, but a modest monitoring program was required by the operating permit. In 1996 SRS proposed a program based on direct push sampling. This program called for biennial direct push sampling within 25 feet of each waste-containing cell with additional samples being taken in areas where excessive cracking had been observed. The direct push proposal was accepted by The South Carolina Department of Health and Environmental Control (SCDHEC). The Industrial Solid Waste Landfill Regulations were revised in 1998 and now include requirements for groundwater monitoring. The major elements of those regulations and their application at Z-Area are discussed. These are a point of compliance, groundwater protection standards, the groundwater monitoring system, sampling and analysis, and data evaluation and reporting
Benzene TCLP results from saltstone prepared with 2X ITP flowsheet concentrations of phenylborates

International Nuclear Information System (INIS)

Poirier, M.R.

2000-01-01

The Savannah River Site (SRS) teamed with the Pacific Northwest National Laboratory (PNNL), Oak Ridge National Laboratory (ORNL), and ITT Flygt Corporation to conduct a test program evaluating shrouded axial propeller mixers (Flygt mixers) for heel removal in SRS Tank 19. SRS is identifying and investigating techniques to remove sludge heels from waste tanks such as Tank 19
Evaluation of ISDP Batch 2 Qualification Compliance to 512-S, DWPF, Tank Farm, and Saltstone Waste Acceptance Criteria

Energy Technology Data Exchange (ETDEWEB)

Shafer, A.

2010-05-05

The purpose of this report is to document the acceptability of the second macrobatch (Salt Batch 2) of Tank 49H waste to H Tank Farm, DWPF, and Saltstone for operation of the Interim Salt Disposition Project (ISDP). Tank 49 feed meets the Waste Acceptance Criteria (WAC) requirements specified by References 11, 12, and 13. Salt Batch 2 material is qualified and ready to be processed through ARP/MCU to the final disposal facilities.
Miscibility Evaluation Of The Next Generation Solvent With Polymers Currently Used At DWPF, MCU, And Saltstone

Energy Technology Data Exchange (ETDEWEB)

Fondeur, F. F.

2013-04-17

The Office of Waste Processing, within the Office of Technology Innovation and Development, funded the development of an enhanced Caustic-Side Solvent Extraction (CSSX) solvent for deployment at the Savannah River Site for removal of cesium from High Level Waste. This effort lead to the development of the Next Generation Solvent (NGS) with Tris (3,7-dimethyl octyl) guanidine (TiDG). The first deployment target for the NGS solvent is within the Modular CSSX Unit (MCU). Deployment of a new chemical within an existing facility requires verification that the new chemical components are compatible with the installed equipment. In the instance of a new organic solvent, the primary focus is on compatibility of the solvent with organic polymers used in the affected facility. This report provides the calculated data from exposing these polymers to the Next Generation Solvent. An assessment of the dimensional stability of polymers known to be used or present in the MCU, Defense Waste Processing Facility (DWPF), and Saltstone facilities that will be exposed to the NGS showed that TiDG could selectively affect the elastomers and some thermoplastics to varying extents, but the typical use of these polymers in a confined geometry will likely prevent the NGS from impacting component performance. The polymers identified as of primary concern include Grafoil® (flexible graphite), Tefzel®, Isolast®, ethylene-propylene-diene monomer (EPDM) rubber, nitrile-butadiene rubber (NBR), styrene-butadiene rubber (SBR), ultra high molecular weight polyethylene (UHMWPE), and fluorocarbon rubber (FKM). Certain polymers like NBR and EPDM were found to interact mildly with NGS but their calculated swelling and the confined geometry will impede interaction with NGS. In addition, it was found that Vellumoid (cellulose fibers-reinforced glycerin and protein) may leach protein and Polyvinyl Chloride (PVC) may leach plasticizer (such as Bis-Ethylhexyl-Phthalates) into the NGS solvent. Either case
Evaluation of Mobility, Bioavailability and Toxicity of Pb and Cd in Contaminated Soil Using TCLP, BCR and Earthworms

Science.gov (United States)

Kede, Maria Luiza F. M.; Correia, Fabio V.; Conceição, Paulo F.; Salles Junior, Sidney F.; Marques, Marcia; Moreira, Josino C.; Pérez, Daniel V.

2014-01-01

The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb) and cadmium (Cd) from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed) followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.)). The treatments applied (in triplicates) were: T1—potassium dihydrogen phosphate (KH2PO4); T2—reactive natural phosphate fertilizer (NRP) and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP); sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF) for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1) plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments. PMID:25386955
Evaluation of Mobility, Bioavailability and Toxicity of Pb and Cd in Contaminated Soil Using TCLP, BCR and Earthworms

Directory of Open Access Journals (Sweden)

Maria Luiza F. M. Kede

2014-11-01

Full Text Available The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb and cadmium (Cd from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.. The treatments applied (in triplicates were: T1—potassium dihydrogen phosphate (KH2PO4; T2—reactive natural phosphate fertilizer (NRP and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP; sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1 plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments.
Data Package for Secondary Waste Form Down-Selection-Cast Stone

International Nuclear Information System (INIS)

Serne, R. Jeffrey; Westsik, Joseph H.

2011-01-01

Available literature on Cast Stone and Saltstone was reviewed with an emphasis on determining how Cast Stone and related grout waste forms performed in relationship to various criteria that will be used to decide whether a specific type of waste form meets acceptance criteria for disposal in the Integrated Disposal Facility (IDF) at Hanford. After the critical review of the Cast Stone/Saltstone literature, we conclude that Cast Stone is a good candidate waste form for further consideration. Cast stone meets the target IDF acceptance criteria for compressive strength, no free liquids, TCLP leachate are below the UTS permissible concentrations and leach rates for Na and Tc-99 are suiteably low. The cost of starting ingredients and equipment necessary to generate Cast Stone waste forms with secondary waste streams are low and the Cast Stone dry blend formulation can be tailored to accommodate variations in liquid waste stream compositions. The database for Cast Stone short-term performance is quite extensive compared to the other three candidate waste solidification processes. The solidification of liquid wastes in Cast Stone is a mature process in comparison to the other three candidates. Successful production of Cast Stone or Saltstone has been demonstrated from lab-scale monoliths with volumes of cm3 through m3 sized blocks to 210-liter sized drums all the way to the large pours into vaults at Savannah River. To date over 9 million gallons of low activity liquid waste has been solidified and disposed in concrete vaults at Savannah River.
Data Package for Secondary Waste Form Down-Selection—Cast Stone

Energy Technology Data Exchange (ETDEWEB)

Serne, R. Jeffrey; Westsik, Joseph H.

2011-09-05

Available literature on Cast Stone and Saltstone was reviewed with an emphasis on determining how Cast Stone and related grout waste forms performed in relationship to various criteria that will be used to decide whether a specific type of waste form meets acceptance criteria for disposal in the Integrated Disposal Facility (IDF) at Hanford. After the critical review of the Cast Stone/Saltstone literature, we conclude that Cast Stone is a good candidate waste form for further consideration. Cast stone meets the target IDF acceptance criteria for compressive strength, no free liquids, TCLP leachate are below the UTS permissible concentrations and leach rates for Na and Tc-99 are suiteably low. The cost of starting ingredients and equipment necessary to generate Cast Stone waste forms with secondary waste streams are low and the Cast Stone dry blend formulation can be tailored to accommodate variations in liquid waste stream compositions. The database for Cast Stone short-term performance is quite extensive compared to the other three candidate waste solidification processes. The solidification of liquid wastes in Cast Stone is a mature process in comparison to the other three candidates. Successful production of Cast Stone or Saltstone has been demonstrated from lab-scale monoliths with volumes of cm3 through m3 sized blocks to 210-liter sized drums all the way to the large pours into vaults at Savannah River. To date over 9 million gallons of low activity liquid waste has been solidified and disposed in concrete vaults at Savannah River.
Stabilization of inorganic mixed waste to pass the TCLP and STLC tests using clay and pH-insensitive additives

International Nuclear Information System (INIS)

Bowers, J.S.; Anson, J.R.; Painter, S.M.; Maitino, R.E.

1995-03-01

Stabilization traps toxic contaminants (usually both chemically and physically) in a matrix so that they do not leach into the environment. Typical contaminants are metals (mostly transition metals) that exhibit the characteristic of toxicity. The stabilization process routinely uses pozzolanic materials. Portland cement, fly ash-lime mixes, gypsum cements, and clays are some of the most common materials. In many instances, materials that can pass the Toxicity Characteristic Leaching Procedure (TCLP-the federal leach test) or the Soluble Threshold Leachate Concentration (STLC-the California leach test) must have high concentrations of lime or other caustic material because of the low pH of the leaching media. Both leaching media, California's and EPA's, have a pH of 5.0. California uses citric acid and sodium citrate while EPA uses acetic acid and sodium acetate. These media can form ligands that provide excellent metal leaching. Because of the aggressive nature of the leaching medium, stabilized wastes in many cases will not pass the leaching tests. At the Lawrence Livermore National Laboratory, additives such as dithiocarbamates and thiocarbonates, which are pH-insensitive and provide resistance to ligand formation, are used in the waste stabilization process. Attapulgite, montmorillonite, and sepiolite clays are used because they are forgiving (recipe can be adjusted before the matrix hardens). The most frequently used stabilization process consists of a customized recipe involving waste sludge, clay and dithiocarbamate salt, mixed with a double planetary mixer into a pasty consistency. TCLP and STLC data on this waste matrix have shown that the process matrix meets land disposal requirements
NUMERICAL FLOW AND TRANSPORT SIMULATIONS SUPPORTING THE SALTSTONE FACILITY PERFORMANCE ASSESSMENT

Energy Technology Data Exchange (ETDEWEB)

Flach, G.

2009-02-28

The Saltstone Disposal Facility Performance Assessment (PA) is being revised to incorporate requirements of Section 3116 of the Ronald W. Reagan National Defense Authorization Act for Fiscal Year 2005 (NDAA), and updated data and understanding of vault performance since the 1992 PA (Cook and Fowler 1992) and related Special Analyses. A hybrid approach was chosen for modeling contaminant transport from vaults and future disposal cells to exposure points. A higher resolution, largely deterministic, analysis is performed on a best-estimate Base Case scenario using the PORFLOW numerical analysis code. a few additional sensitivity cases are simulated to examine alternative scenarios and parameter settings. Stochastic analysis is performed on a simpler representation of the SDF system using the GoldSim code to estimate uncertainty and sensitivity about the Base Case. This report describes development of PORFLOW models supporting the SDF PA, and presents sample results to illustrate model behaviors and define impacts relative to key facility performance objectives. The SDF PA document, when issued, should be consulted for a comprehensive presentation of results.
Addendum to the Composite Analysis for the E-Area Vaults and Saltstone Disposal Facilities

International Nuclear Information System (INIS)

Cook, J.R.

2002-01-01

Revision 1 of the Composite Analysis (CA) Addendum has been prepared to respond to the U.S. Department of Energy (DOE) Low-Level Waste Disposal Facilities Federal Review Group review of the CA. This addendum to the composite analysis responds to the conditions of approval. The composite analysis was performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of the Savannah River Site and contains all of the waste disposal facilities, the chemical separation facilities and associated high-level waste storage facilities, as well as numerous other sources of radioactive material
Energy Auditor and Quality Control Inspector Competency Model

Energy Technology Data Exchange (ETDEWEB)

Head, Heather R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Kurnik, Charles W [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Schroeder, Derek [U.S. Department of Energy; Cutchin, Kelly [Simonson Management Services

2018-05-02

The Energy Auditor (EA) and Quality Control Inspector (QCI) Competency model was developed to identify the soft skills, foundational competencies and define the levels of Knowledge, Skills, and Abilities (KSAs) required to successfully perform the tasks defined in the EA and QCI Job Task Analysis (JTAs), the U.S. Department of Energy (DOE) used the U.S. Department of Labor's (DOL) Competency Model Clearinghouse resources to develop a QCI and EA Competency Model. To keep the QCI and EA competency model consistent with other construction and energy management competency models, DOE and the National Renewable Energy Laboratory used the existing 'Residential Construction Competency Model' and the 'Advanced Commercial Building Competency Model' where appropriate.
A non-toxic fluorogenic dye for mitochondria labeling.

Science.gov (United States)

Han, Junyan; Han, Myung Shin; Tung, Ching-Hsuan

2013-11-01

Mitochondria, powerhouses of cells, are responsible for many critical cellular functions, such as cell energy metabolism, reactive oxygen species production, and apoptosis regulation. Monitoring mitochondria morphology in live cells temporally and spatially could help with the understanding of the mechanisms of mitochondrial functional regulation and the pathogenesis of mitochondria-related diseases. A novel non-cytotoxic fluorogenic compound, AcQCy7, was developed as a mitochondria-specific dye. AcQCy7 emitted no fluorescent signal outside of cells, but it became fluorescent after intracellular hydrolysis of the acetyl group. The hydrolyzed fluorescent product was well retained in mitochondria, enabling long-lasting fluorescence imaging of mitochondria without cell washing. A 2-day culture study using AcQCy7 showed no sign of cytotoxicity, whereas a commonly used mitochondria-staining probe, Mitochondria Tracker Green, caused significant cell death even at a much lower concentration. Apoptosis-causing mitochondria fission was monitored clearly in real time by AcQCy7. A simple add-and-read mitochondria specific dye AcQCy7 has been validated in various cell models. Bright mitochondria specific fluorescent signal in treated cells lasted several days without noticeable toxicity. The probe AcQCy7 has been proofed to be a non-toxic agent for long-term mitochondria imaging. © 2013.
QCI Common

Energy Technology Data Exchange (ETDEWEB)

2016-11-18

There are many common software patterns and utilities for the ORNL Quantum Computing Institute that can and should be shared across projects. Otherwise we find duplication of code which adds unwanted complexity. This is a software product seeks to alleviate this by providing common utilities such as object factories, graph data structures, parameter input mechanisms, etc., for other software products within the ORNL Quantum Computing Institute. This work enables pure basic research, has no export controlled utilities, and has no real commercial value.
Synthesis and electrochemical properties of xLiMn0.9Fe0.1PO4·yLi3V2(PO4)3/C composite cathode materials for lithium–ion batteries

International Nuclear Information System (INIS)

Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui

2014-01-01

Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates
A review on economic emission dispatch problems using quantum computational intelligence

Science.gov (United States)

Mahdi, Fahad Parvez; Vasant, Pandian; Kallimani, Vish; Abdullah-Al-Wadud, M.

2016-11-01

Economic emission dispatch (EED) problems are one of the most crucial problems in power systems. Growing energy demand, limitation of natural resources and global warming make this topic into the center of discussion and research. This paper reviews the use of Quantum Computational Intelligence (QCI) in solving Economic Emission Dispatch problems. QCI techniques like Quantum Genetic Algorithm (QGA) and Quantum Particle Swarm Optimization (QPSO) algorithm are discussed here. This paper will encourage the researcher to use more QCI based algorithm to get better optimal result for solving EED problems.

THE FERMI-GBM X-RAY BURST MONITOR: THERMONUCLEAR BURSTS FROM 4U 0614+09

International Nuclear Information System (INIS)

Linares, M.; Chakrabarty, D.; Connaughton, V.; Bhat, P. N.; Briggs, M. S.; Preece, R.; Jenke, P.; Kouveliotou, C.; Wilson-Hodge, C. A.; Van der Horst, A. J.; Camero-Arranz, A.; Finger, M.; Paciesas, W. S.; Beklen, E.; Von Kienlin, A.

2012-01-01

Thermonuclear bursts from slowly accreting neutron stars (NSs) have proven difficult to detect, yet they are potential probes of the thermal properties of the NS interior. During the first year of a systematic all-sky search for X-ray bursts using the Gamma-ray Burst Monitor aboard the Fermi Gamma-ray Space Telescope we have detected 15 thermonuclear bursts from the NS low-mass X-ray binary 4U 0614+09 when it was accreting at nearly 1% of the Eddington limit. We measured an average burst recurrence time of 12 ± 3 days (68% confidence interval) between 2010 March and 2011 March, classified all bursts as normal duration bursts and placed a lower limit on the recurrence time of long/intermediate bursts of 62 days (95% confidence level). We discuss how observations of thermonuclear bursts in the hard X-ray band compare to pointed soft X-ray observations and quantify such bandpass effects on measurements of burst radiated energy and duration. We put our results for 4U 0614+09 in the context of other bursters and briefly discuss the constraints on ignition models. Interestingly, we find that the burst energies in 4U 0614+09 are on average between those of normal duration bursts and those measured in long/intermediate bursts. Such a continuous distribution in burst energy provides a new observational link between normal and long/intermediate bursts. We suggest that the apparent bimodal distribution that defined normal and long/intermediate duration bursts during the last decade could be due to an observational bias toward detecting only the longest and most energetic bursts from slowly accreting NSs.
A theoretical study of the complexes of N2O with H+, Li+, and HF using various correlation methods

International Nuclear Information System (INIS)

Del Bene, J.E.; Stahlberg, E.A.; Shavitt, I.

1990-01-01

Binding energies for complexes of N 2 O with the acids H + , Li + , and HF have been computed using the following correlation methods: many-body (Moller-Plesset) perturbation theory at second (MP2), third (MP3), and fourth (MP4) order; the quadratic CI method with single and double excitations (QCISD) and with noniterative inclusion of triple excitations (QCISD(T)); the linearized coupled-cluster method (LCCM); the averaged coupled-pair functional (ACPF); configuration interaction with all single and double excitations (CISD); and CISD with the Davidson and Pople corrections. The convergence of the Moller-Plesset expansion is erratic, predicting that the terminal nitrogen is the preferred binding site for the complexes at the MP2 and MP4 levels, in disagreement with Hartree-Fock and MP3 and all other models (including the infinite-order QCI). The effect of triple excitations at MP4 and QCI is to destabilize complexes bound at O and stabilize those bound at N, but this effect is greatly overestimated at MP4 relative to QCI. Except for the LCCM result for N-protonated N 2 O, ACPF and LCCM binding energies are similar to the QCISD values. The size-consistency error in the ACPF binding energies of the complexes of N 2 O with HF is about 0.5 kcal/mol. The CISD size-consistency error for these complexes is 23 kcal/mol, leading to negative binding energies when computed relative to isolated N 2 O and HF
Literature review of the potential impact of glycolic acid on the technetium chemistry of srs tank waste

International Nuclear Information System (INIS)

Nash, Charles A.; McCabe, Daniel J.

2017-01-01

This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO 4 - ) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.
Stability of polymyxin B sulfate diluted in 0.9% sodium chloride injection and stored at 4 or 25 degrees C.

Science.gov (United States)

He, Jie; Figueroa, Deborah A; Lim, Tze-Peng; Chow, Diana S; Tam, Vincent H

2010-07-15

The stability of polymyxin B sulfate in infusion bags containing 0.9% sodium chloride injection stored at 4 and 25 degrees C was studied. Seven manufacturing batches of polymyxin B from different sources were tested. The products were reconstituted in sterile water for injection, diluted in infusion bags containing 0.9% sodium chloride injection, and stored at room temperature (25 degrees C) or under refrigeration (4 degrees C). Samples were withdrawn at the same time on days 0, 1, 2, 3, 5, and 7. A modified microbiological assay was used to determine the concentrations, as indicated by zones of inhibition, of polymyxin B. Bordetella bronchiseptica served as the reference organism. Stability was defined as retention of >90% of the initial concentration. The decomposition kinetics of polymyxin B in 0.9% sodium chloride injection were evaluated by plotting the polymyxin B concentration remaining versus time. On average, the samples retained over 90% of their initial concentration for up to two days at both storage temperatures. All samples retained over 90% of their initial concentration at 24 hours. The decomposition kinetics of polymyxin B in infusion bags containing 0.9% sodium chloride injection exhibited pseudo-first-order kinetics, with rate constants of 0.024-0.075 day(-1) at 25 degrees C and 0.022-0.043 day(-1) at 4 degrees C (p > 0.05). Polymyxin B was stable for at least one day when stored at 4 or 25 degrees C in infusion bags containing 0.9% sodium chloride injection. Stability did not differ significantly between the two storage temperatures.
Mechanisms of contaminant migration from grouted waste

International Nuclear Information System (INIS)

Magnuson, S.O.; Yu, A.D.

1992-01-01

Low-level radioactive decontaminated salt solution is generated at the Savannah River Site (SRS) from the In-Tank Precipitation process. The solution is mixed with cement, slag, and fly ash, to form a grout, termed ''Saltstone'', that will be disposed in concrete vaults at the Saltstone Disposal Facility (SDF) [1]. Of the contaminants in the Saltstone, the greatest concern to SRS is the potential release of nitrate to the groundwater because of the high initial nitrate concentration (0.25 g/cm 3 ) in the Saltstone and the low Safe Drinking Water Act (SDWA) maximum contaminant level (MCL) of 44 mg/L. The SDF is designed to allow a slow, controlled release over thousands of years. This paper addresses a modeling study of nitrate migration from intact non-degraded concrete vaults in the unsaturated zone for the Radiological Performance Assessment (PA) of the SRS Saltstone Disposal Facility [3]. The PA addresses the performance requirements mandated by DOE Order 5820.2A [4
Literature review of the potential impact of glycolic acid on the technetium chemistry of srs tank waste

Energy Technology Data Exchange (ETDEWEB)

Nash, Charles A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); McCabe, Daniel J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2017-10-09

This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO₄ ^-) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.
Alternate paddle configuration for improved wear resistance in the saltstone mixer

Energy Technology Data Exchange (ETDEWEB)

Reigel, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Fowley, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2013-09-23

The Saltstone Production Facility has a 10-inch Readco-Kurimoto continuous mixer that mixes the premix dry feeds and low-level waste salt solution to make fresh (uncured) saltstone. Inspection of the mixer in January 2013 showed significant wear on the third, fourth and fifth paddle pairs after the conveying augers. A 2-inch Readco-Kurimoto continuous mixer was used to test alternate paddle configurations for use in the 10-inch mixer to decrease the wear rate on the paddles. Two wear tests were conducted to investigate a method of reducing wear on the mixer paddles. The first test (wear test 2a) had a paddle configuration similar to the currently installed 10-inch mixer in the SPF. This test established baseline wear. The second test (wear test 2b) had a reconfigured paddle arrangement that replaced the flat paddles with helical paddles for paddle pairs 2 - 6 and aligned paddle pair 1 with the augers. The intent of the reconfiguration was to more effectively convey the partially wetted dry feeds through the transition region and into the liquid feed where paddle wear is reduced due to dry feeds and salt solution being mixed at the intended water to premix ratio. The design of the helical paddles provides conveyance through the transition region to the liquid feed inlet. The alignment with the auger is aimed to provide a smoother transition (minimizing the discontinuity between the auger and paddle pair 1) into the downstream paddles. A soft metal with low wear resistance (6000 series aluminum) was used for the wear testing paddles to determine wear patterns while minimizing run time and maximizing wear rate. For the two paddle configurations tested using the scaled 2-inch Readco-Kurimoto continuous mixer, with the first six paddles after the augers replaced by the wear paddles and the remaining paddles were stainless steel. Since the 10-inch SPF mixer is designed with the liquid inlet centered over paddle pairs 5 and 6, the scaled 2-inch mixer was configured the
Measurements of Cyclotron Features and Pulse Periods in the High-Mass X-Ray Binaries 4U 1538-522 and 4U 1907+09 with the International Gamma-Ray Astrophysics Laboratory

Science.gov (United States)

Hemphill, Paul B.; Rothschild, Richard E.; Caballero, Isabel; Pottschmidt, Katja; Kuhnel, Matthias; Furst, Felix; Wilms, Jorn

2013-01-01

We present a spectral and timing analysis of International Gamma-Ray Astrophysics Laboratory (INTEGRAL) observations of two high-mass X-ray binaries, 4U 1538-522 and 4U 1907+09. Our timing measurements for 4U 1538-522 find the pulse period to have exhibited a spin-up trend until approximately 2009, after which there is evidence for a torque reversal, with the source beginning to spin down to the most recently measured period of 525.407 plus or minus 0.001 seconds. The most recent INTEGRAL observations of 4U 1907+09 are not found to yield statistically significant pulse periods due to the significantly lower flux from the source compared with 4U 1538-522. A spectral model consisting of a power-law continuum with an exponential cutoff and modified by two cyclotron resonance scattering features is found to fit both sources well, with the cyclotron scattering features detected at approximately 22 and approximately 49 kiloelectronvolts for 4U 1538-522 and at approximately 18 and approximately 36 kiloelectronvolts for 4U 1907+09. The spectral parameters of 4U 1538-522 are generally not found to vary significantly with flux and there is little to no variation across the torque reversal. Examining our results in conjunction with previous work, we find no evidence for a correlation between cyclotron line energy and luminosity for 4U 1538-522. 4U 1907+09 shows evidence for a positive correlation between cyclotron line energy and luminosity, which would make it the fourth, and lowest luminosity, cyclotron line source to exhibit this relationship.
BENCH SCALE SALTSTONE PROCESS DEVELOPMENT MIXING STUDY

Energy Technology Data Exchange (ETDEWEB)

Cozzi, A.; Hansen, E.

2011-08-03

The Savannah River National Laboratory (SRNL) was requested to develop a bench scale test facility, using a mixer, transfer pump, and transfer line to determine the impact of conveying the grout through the transfer lines to the vault on grout properties. Bench scale testing focused on the effect the transfer line has on the rheological property of the grout as it was processed through the transfer line. Rheological and other physical properties of grout samples were obtained prior to and after pumping through a transfer line. The Bench Scale Mixing Rig (BSMR) consisted of two mixing tanks, grout feed tank, transfer pump and transfer hose. The mixing tanks were used to batch the grout which was then transferred into the grout feed tank. The contents of the feed tank were then pumped through the transfer line (hose) using a progressive cavity pump. The grout flow rate and pump discharge pressure were monitored. Four sampling stations were located along the length of the transfer line at the 5, 105 and 205 feet past the transfer pump and at 305 feet, the discharge of the hose. Scaling between the full scale piping at Saltstone to bench scale testing at SRNL was performed by maintaining the same shear rate and total shear at the wall of the transfer line. The results of scaling down resulted in a shorter transfer line, a lower average velocity, the same transfer time and similar pressure drops. The condition of flow in the bench scale transfer line is laminar. The flow in the full scale pipe is in the transition region, but is more laminar than turbulent. The resulting plug in laminar flow in the bench scale results in a region of no-mixing. Hence mixing, or shearing, at the bench scale should be less than that observed in the full scale, where this plug is non existent due to the turbulent flow. The bench scale tests should be considered to be conservative due to the highly laminar condition of flow that exists. Two BSMR runs were performed. In both cases, wall
Saltstone SDU6 Modeling Study

International Nuclear Information System (INIS)

Lee, Si Y.; Hyun, Sinjae

2013-01-01

A new disposal unit, designated as Saltstone Disposal Unit 6 (SDU6), is being designed for support of site accelerated closure goals and salt waste projections identified in the new Liquid Waste System Plan. The unit is a cylindrical disposal cell of 375 ft in diameter and 43 ft in height, and it has a minimum 30 million gallons of capacity. SRNL was requested to evaluate the impact of an increased grout placement height on the flow patterns radially spread on the floor and to determine whether grout quality is impacted by the height. The primary goals of the work are to develop the baseline Computational Fluid Dynamics (CFD) model and to perform the evaluations for the flow patterns of grout material in SDU6 as a function of elevation of grout discharge port and grout rheology. Two transient grout models have been developed by taking a three-dimensional multiphase CFD approach to estimate the domain size of the grout materials radially spread on the facility floor and to perform the sensitivity analysis with respect to the baseline design and operating conditions such as elevation height of the discharge port and fresh grout properties. For the CFD modeling calculations, air-grout Volume of Fluid (VOF) method combined with Bingham plastic and time-dependent grout models were used for examining the impact of fluid spread performance for the initial baseline configurations and to evaluate the impact of grout pouring height on grout quality. The grout quality was estimated in terms of the air volume fraction for the grout layer formed on the SDU6 floor, resulting in the change of grout density. The study results should be considered as preliminary scoping analyses since benchmarking analysis is not included in this task scope. Transient analyses with the Bingham plastic model were performed with the FLUENTTM code on the high performance parallel computing platform in SRNL. The analysis coupled with a transient grout aging model was performed by using ANSYS-CFX code
Synthesis, characterization, and photoactivity of InTaO4 and In0.9Ni0.1TaO4 thin films prepared by electron evaporation

International Nuclear Information System (INIS)

Rico, V. J.; Frutos, F.; Yubero, F.; Espinos, J. P.; Gonzales-Elipe, A. R.

2010-01-01

InTaO 4 and In 0.9 Ni 0.1 TaO 4 thin films have been prepared by electron evaporation of successive layers of the single oxide components and posterior annealing at T>800 deg. C. The annealed thin films presented the monoclinic crystallographic structure typical of these mixed oxides. The electrical and optical behaviors of the films, assessed by C-V measurements, surface conductivity as a function of temperature, and UV-vis absorption spectroscopy, indicate that these oxides are wide band gap semiconductors with a variable dielectric constant depending on the annealing conditions. By reflection electron energy loss spectroscopy some electronic states have been found in the gap at an energy that is compatible with the activation energy deduced from the conductivity versus 1/T plots for these oxides. The photoactivity of these materials has been assessed by looking to the evolution of the wetting contact angle as a function of the irradiation time. All the films became superhydrophilic when irradiated with UV light, while the In 0.9 Ni 0.1 TaO 4 thin films also presented a small partial decrease in wetting angle when irradiated with visible photons.
Preparation and electrochemical properties of homogeneous carbon-coated LiFe0.9Mn0.1PO4 as cathode material for lithium-ion batteries

International Nuclear Information System (INIS)

Xu, Yang; Yu, Jingang; Peng, Sui; Liu, Suqin; Wei, Zhongqiang; Li, Xianhong; Li, Yajuan

2012-01-01

Homogeneous carbon-coated LiFe 0.9 Mn 0.1 PO 4 cathode material was synthesized by one-step solid-state reaction using glucose as carbon source. Powder X-ray diffractometry (XRD), transmission electron microscopy (TEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and galvanostatic measurements were employed to characterize the samples. Mn-doping and carbon co-modification did not affect the olivine structure of LiFePO 4 , but improved its kinetics in terms of capacity delivery, polarization and rate capability. When compared with the undoped LiFePO 4 /C, the LiFe 0.9 Mn 0.1 PO 4 /C sample presented good size distribution - around 100-200 nm - and better electrochemical performance. At current rates of 0.1, 1.0, 3.0 and 10.0 C (C = 170 mA g -1 ), the LiFe 0.9 Mn 0.1 PO 4 /C electrode delivered discharge capacities of 154.1, 138.8, 120.0 and 94.0 mA h g -1 , respectively. Results obtained by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) indicated that the polarization and charge transfer resistance of the sample were greatly decreased by Mn-doping. (author)
Results For The Third Quarter Calendar Year 2016 Tank 50H Salt Solution Sample

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-10-13

In this memorandum, the chemical and radionuclide contaminant results from the Third Quarter Calendar Year 2016 (CY16) sample of Tank 50H salt solution are presented in tabulated form. The Third Quarter CY16 Tank 50H samples (a 200 mL sample obtained 6” below the surface (HTF-5-16-63) and a 1 L sample obtained 66” from the tank bottom (HTF-50-16-64)) were obtained on July 14, 2016 and received at Savannah River National Laboratory (SRNL) on the same day. Prior to obtaining the samples from Tank 50H, a single pump was run at least 4.4 hours, and the samples were pulled immediately after pump shut down. The information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering for the transfer of aqueous waste from Tank 50H to the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the Task Technical and Quality Assurance Plan (TTQAP) for the Tank 50H saltstone task. The chemical and radionuclide contaminant results from the characterization of the Third Quarter CY16 sampling of Tank 50H were requested by Savannah River Remediation (SRR) personnel and details of the testing are presented in the SRNL TTQAP.
A Spectral Analysis of the X-Ray Pulsar 4U 1907+09 obtained at thePeriastron Passage with the XMM-Newton Observatory

NARCIS (Netherlands)

Balman, Solen; Mendez, Mariano; Diaz Trigo, Maria; Inam, Cagdas; Baykal, Altan

2010-01-01

We present results from a 20 ksec observation of the wind-accreting X-ray pulsar 4U 1907+09 obtained using the XMM-Newton Observatory at the periastron passage. The XMM-Newton spectrum allows us to study the continuum emission and the emission line at 6.4 keV with the high sensitivity and
Defense waste salt disposal at the Savannah River Plant

International Nuclear Information System (INIS)

Langton, C.A.; Dukes, M.D.

1984-01-01

A cement-based waste form, saltstone, has been designed for disposal of Savannah River Plant low-level radioactive salt waste. The disposal process includes emplacing the saltstone in engineered trenches above the water table but below grade at SRP. Design of the waste form and disposal system limits the concentration of salts and radionuclides in the groundwater so that EPA drinking water standards will not be exceeded at the perimeter of the disposal site. 10 references, 4 figures, 3 tables
(Z)-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl) propene (H 102/09), a new selective inhibitor of the neuronal 5-hydroxytryptamine uptake

International Nuclear Information System (INIS)

Ross, S.B.; Oegren, S.-O.; Renyi, A.L.

1976-01-01

The inhibition of the uptake of 3 H-(-)-noradrenaline (NA), 3 H-dopamine and 14 C-5-hydroxytryptamine (5-HT) in mouse brain slices by (Z)-3-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl)propene(H 102/09), desipramine and chlorimipramine and their releasing effect on the 3 H-amines previously accumulated in the slices were examined. The interactions with reserpine produced hypothermia and sedation and the 5-hydroxytryptophan (5-HTP) syndrome in mice were also studied. Due to the poor inhibitory activity on the NA uptake H 102/09 was a more selective inhii.or of the 5-HT uptake than was chlorimipramine, particularly after administration in vivo, where it was as potent as chlorimipramine (ED50=19μmol/kg intraperitoneally). In vitro chlorimipramine was 6 to 12 times more active than H 102/09. Desipramine was a very selective inhibitor of the NA uptake in vitro and in vivo. The compounds were generally more potent in inhibiting the uptake than in releasing the amines. However, in striatal slices the inhibition of DA uptake could be due to the releasing effect since the difference in potencies were small. The effect of desipramine on 5-HT uptake and that of H102/09 on NA uptake could also involve a release component. The 5-HTP syndrome was potentiated by H 102/09 and chlorimipramine but not by desipramine. The reserpine hypothermia but not the sedation was potently antagonized and reversed by desipramine and by chlorimipramine at high doses but not by H 102/09, suggested that NA but not 5-HT is involved in the hypothermic action of reserpine. (author)
NCBI nr-aa BLAST: CBRC-GGAL-09-0008 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-09-0008 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 5e-61 23% ...
NCBI nr-aa BLAST: CBRC-OLAT-09-0016 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-OLAT-09-0016 sp|P43141|ADB4C_MELGA Beta-4C adrenergic receptor (Beta-4C adreno...ceptor) (Beta-4C adrenoreceptor) gb|AAA62151.1| beta-4C-adrenergic receptor gb|AAA62150.1| adrenergic beta-4c receptor P43141 1e-107 51% ...
The Constitutional Review Chamber of the Republic of Estonia : no. of the case 3-4-1-2-09 : date of decision 9 June 2009

Index Scriptorium Estoniae

2009-01-01

Kohtulahendi 3-4-1-2-09 (Tallinna Linnavolikogu taotlus tunnistada kehtetuks kohaliku omavalitsuse volikogu valimise seaduse § 7 lg 2 p 5 ja § 8 lg 4 ; või § 7 lg 2 p 5 ja § 9 lg 4 ; või § 7 lg 2 p 5, § 8 lg 4 ja § 9 lg 2.) tekst inglise keeles
Structure and substructure analysis of DAFT/FADA galaxy clusters in the [0.4–0.9] redshift range

Energy Technology Data Exchange (ETDEWEB)

Guennou, L.; et al.

2014-01-17

Context. The DAFT/FADA survey is based on the study of ~90 rich(masses found in the literature >2 x 10^14 M_⊙)and moderately distant clusters (redshifts 0.4 < z < 0.9), all withHST imaging data available. This survey has two main objectives: to constrain dark energy(DE) using weak lensing tomography on galaxy clusters and to build a database (deepmulti-band imaging allowing photometric redshift estimates, spectroscopic data, X-raydata) of rich distant clusters to study their properties.

Enhanced Electrochemical Activity and Chromium Tolerance of the Nucleation-Agent-Free La2Ni0.9Fe0.1O4+δ Cathode by Gd0.1Ce0.9O1.95 Incorporation

Science.gov (United States)

Ling, Yihan; Xie, Huixin; Liu, Zijing; Du, Xiaoni; Chen, Hui; Ou, Xuemei; Zhao, Ling; Budiman, Riyan Achmad

2018-03-01

For the sake of improving the electrochemical activity and chromium tolerance of the K2NiF4-type oxide, La2NiO4+δ (LNO), with nonnucleation agents like Mn and Sr elements, the electrochemical performance and degradation were comparatively studied at two cathodes La2Ni0.9Fe0.1O4+δ (LNF) and LNF-40wt%Gd0.1Ce0.9O1.95 (LNF-GDC) on the GDC electrolyte, where 5wt%Cr2O3 incorporation provides Cr-containing atmosphere. Compared with non-doped LNO, LNF shows a higher interstitial oxygen concentration (δ = 0.298) and a lower electrical conductivity, where bivalent Ni ion, {Ni}_{Ni}^{ × } , and trivalent Ni ion, {Ni}_{Ni}^{ \\cdot } , and trivalent Fe ion on Ni-site, {Fe}_{Ni}^{ \\cdot } , were observed from the XPS measurements. LNF-GDC shows greatly reduced interfacial polarization resistances (Rp), which are only half of those of LNF, indicating a better electrochemical performance. More importantly, no significant degradation of LNF-GDC in performance has been observed under exposure of Cr-containing atmosphere at 700 °C for 350 h, while Rp of LNF increased by nearly 20%, suggesting LNF by GDC incorporation can enhance the electrochemical performance as well as chromium tolerance for intermediate temperature solid oxide fuel cells (IT-SOFCs).
Shape-Control of a 0D/1D NaFe0.9Mn0.1PO4 Nano-Complex by Electrospinning

Science.gov (United States)

Shin, Mi-Ra; Son, Jong-Tae

2018-03-01

NaFePO4 with a maricite structure was one of the most promising candidates for sodium ion batteries (SIBs) due to its advantages of environmental friendly and having low cost. However, it has low electrochemical conductivity and energy density, which impose limitations on its application as commercial cathode materials. In this study, other transition-metal ions such as Mn2+ were substituted into the iron (Fe2+) site in NaFePO4 to increase the surface area and the number of nanofibers in the prepared one-dimensional (1D) nano-sized material with 0D/1D dimensions to enhance the energy density. Also, the 0D/1D NaFe0.9Mn0.1PO4 cathode material has increased electrochemical conductivity because the fiber size was reduced to the nano-scale level by using the electrospinning method in order to decrease the diffusion path of Na-ions. The morphology of the 0D/1D nanofiber was evaluated by Field-emission scanning electron microscope and atomic force microscope analyses. The NaFe0.9Mn0.1PO4 nanofibers had a diameter of approximately 180 nm, while the spherical particle had a diameter 1 μm. The 0D/1D nano-sized cathode material show a discharge capacity of 27 mAhg -1 at a 0.05 C rate within the 2.0 4.5 V voltage range and a low R ct of 110 Ω.
Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

2007-01-01

textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we
Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that
Quantum control for initiation and detection of explosives

International Nuclear Information System (INIS)

Greenfield, Margo T.; McGrane, Shawn D.; Scharff, R. Jason; Moore, David S.

2010-01-01

We employ quantum control methods towards detection and quantum controlled initiation (QCI) of energetic materials. Ultrafast pulse shaping of broadband Infrared (∼750 nm to 850 run) and ultraviolet (266 nm, 400 nm) light is utilized for control. The underlying principals behind optimal control can be utilized to both detect and initiate explosives. In each case, time dependent phase shaped electric fields drive the chemical systems towards a desired state. For optimal dynamic detection of explosives (ODD-Ex) a phase specific broadband infrared pulse is created which increases not only the sensitivity of detection but also the selectivity of an explosive's spectral signatures in a background of interferents. QCI on the other hand, seeks to initiate explosives by employing shaped ultraviolet light. QCI is ideal for use with explosive detonators as it removes the possibility of unintentional initiation from an electrical source while adding an additional safety feature, initiation only with the proper pulse shape. Quantum control experiments require: (1) the ability to phase and amplitude shape the laser pulse and (2) the ability to effectively search for the pulse shape which controls the reaction. In these adaptive experiments we utilize both global and local optimization search routines such as genetic algorithm, differential evolution, and downhill simplex. Pulse shaping the broadband IR light, produced by focusing 800 nm light through a pressurized tube of Argon, is straightforward as commercial pulse shapers are available at and around 800 nm. Pulse shaping in the UV requires a home built shaper. Our system is an acoustic optical modulator (AOM) pulse shaper in which consists of a fused silica AOM crystal placed in the Fourier plane of a 4-f zero dispersion compressor.
INTERNATIONAL PROGRAM: SUMMARY REPORT ON THE PROPERTIES OF CEMENTITIOUS WASTE FORMS

International Nuclear Information System (INIS)

Harbour, J

2007-01-01

This report provides a summary of the results on the properties of cementitious waste forms obtained as part of the International Program. In particular, this report focuses on the results of Task 4 of the Program that was initially entitled ''Improved Retention of Key Contaminants of Concern in Low Temperature Immobilized Waste Forms''. Task 4 was a joint program between Khlopin Radium Institute and the Savannah River National Laboratory. The task evolved during this period into a study of cementitious waste forms with an expanded scope that included heat of hydration and fate and transport modeling. This report provides the results for Task 4 of the International Program as of the end of FY06 at which time funding for Task 4 was discontinued due to the needs of higher priority tasks within the International Program. Consequently, some of the subtasks were only partially completed, but it was considered important to capture the results up to this point in time. Therefore, this report serves as the closeout report for Task 4. The degree of immobilization of Tc-99 within the Saltstone waste form was measured through monolithic and crushed grout leaching tests. An effective diffusion coefficient of 4.8 x 10 -12 (Leach Index of 11.4) was measured using the ANSI/ANS-16.1 protocol which is comparable with values obtained for tank closure grouts using a dilute salt solution. The leaching results show that, in the presence of concentrated salt solutions such as those that will be processed at the Saltstone Production Facility, blast furnace slag can effectively reduce pertechnetate to the immobile +4 oxidation state. Leaching tests were also initiated to determine the degree of immobilization of selenium in the Saltstone waste form. Results were obtained for the upper bound of projected selenium concentration (∼5 x 10 -3 M) in the salt solution that will be treated at Saltstone. The ANSI/ANS 16.1 leaching tests provided a value for the effective diffusivity of ∼5 x 10
16 CFR 0.9 - Organization structure.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0186 ref|XP_001213909.1| predicted protein [Aspergillus terreus NIH262...4] gb|EAU35178.1| predicted protein [Aspergillus terreus NIH2624] XP_001213909.1 0.076 27% ...
Interrelation of transport properties, defect structure and spin state of Ni3+ in La1.2Sr0.8Ni0.9Fe0.1O4+δ

Science.gov (United States)

Gilev, A. R.; Kiselev, E. A.; Zakharov, D. M.; Cherepanov, V. A.

2017-10-01

The total conductivity, Seebeck coefficient and oxygen non-stoichiometry for La1.2Sr0.8Ni0.9Fe0.1O4+δ have been measured vs temperature and oxygen partial pressure P(O2). The measurements were carried out at 800, 850, 900 and 950 °C within the P(O2) range of 10-5-0.21 atm. La1.2Sr0.8Ni0.9Fe0.1O4+δ was shown to be oxygen deficient in all temperature and P(O2) ranges studied. The calculated values of the partial molar enthalpy of oxygen depend very slightly on oxygen content (δ), indicating that La1.2Sr0.8Ni0.9Fe0.1O4+δ with the oxygen deficiency can be considered an ideal solution. The model of point defect equilibria in La1.2Sr0.8Ni0.9Fe0.1O4+δ has been proposed and fitted to experimental dependencies. Subsequent joint analysis of the defect structure and transport properties revealed that electron holes can coexist in both localized and quasi-delocalized states in the oxide: the former corresponded to high-spin state Ni3+ and the latter - to low-spin state Ni3+. The mobilities of localized electron holes were shown to be significantly lower in comparison to quasi-delocalized ones. The behavior of localized electron holes was explained in terms of a small polaron conduction mechanism; in contrast, quasi-delocalized electron holes were described in terms of a band conduction approach. The small polaron conduction mechanism was shown to be predominant in the Sr- and Fe-co-doped lanthanum nickelate.
Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy

International Nuclear Information System (INIS)

Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.

2006-01-01

X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions
Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS
33 CFR 151.09 - Applicability.

Science.gov (United States)

2010-07-01

....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...
Dicty_cDB: FC-AI09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik
Thermal equation of state of (Mg 0.9Fe 0.1) 2SiO 4 olivine

Science.gov (United States)

Liu, Wei; Li, Baosheng

2006-08-01

In situ synchrotron X-ray diffraction measurements have been carried out on San Carlos olivine (Mg 0.9Fe 0.1) 2SiO 4 up to 8 GPa and 1073 K. Data analysis using the high-temperature Birch-Murnaghan (HTBM) equation of state (EoS) yields the temperature derivative of the bulk modulus (∂ KT/∂ T) P = -0.019 ± 0.002 GPa K -1. The thermal pressure (TH) approach gives αKT = 4.08 ± 0.10 × 10 -3 GPa K -1, from which (∂ KT/∂ T) P = -0.019 ± 0.001 GPa K -1 is derived. Fitting the present data to the Mie-Grüneisen-Debye (MGD) formalism, the Grüneisen parameter at ambient conditions γ0 is constrained to be 1.14 ± 0.02 with fixed volume dependence q = 1. Combining the present data with previous results on iron-bearing olivine and fitting to MGD EoS, we obtain γ0 = 1.11 ± 0.01 and q = 0.54 ± 0.36. In this study the thermoelastic parameters obtained from various approaches are in good agreement with one another and previous results.
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0186 ref|ZP_01510169.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirm...ans PsJN] gb|EAV05032.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirmans PsJN] ZP_01510169.1 1.4 31% ...
Characterization of Laboratory Prepared Concrete Pastes Exposed to High Alkaline and High Sodium Salt Solutions

Energy Technology Data Exchange (ETDEWEB)

Langton, C. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-06-30

The objective of this study was to identify potential chemical degradation mechanisms for the Saltstone Disposal Unit (SDU) concretes, which over the performance life of the structures may be exposed to highly alkaline sodium salt solutions containing sulfate, hydroxide, and other potentially corrosive chemicals in salt solution and saltstone flush water, drain water, leachate and / or pore solution. The samples analyzed in this study were cement pastes prepared in the SIMCO Technologies, Inc. concrete laboratory. They were based on the paste fractions of the concretes used to construct the Saltstone Disposal Units (SDUs). SDU 1 and 4 concrete pastes were represented by the PV1 test specimens. The paste in the SDU 2, 3, 5, and 6 concrete was represented by the PV2 test specimens. SIMCO Technologies, Inc. selected the chemicals and proportions in the aggressive solutions to approximate proportions in the saltstone pore solution [2, 3, 5, and 6]. These test specimens were cured for 56 days in curing chamber before being immersed in aggressive solutions. After exposure, the samples were frozen to prevent additional chemical transport and reaction. Selected archived (retrieved from the freezer) samples were sent to the Savannah River National Laboratory (SRNL) for additional characterization using x-ray diffraction (XRD), scanning electron microscopy (SEM), and energy dispersive x-ray (EDX) spectroscopy. Characterization results are summarized in this report. In addition, a correlation between the oxide composition of the pastes and their chemical durability in the alkaline salt solutions is provided.
Results for the second quarter 2014 tank 50 WAC slurry sample chemical and radionuclide contaminants

International Nuclear Information System (INIS)

Bannochie, C.

2014-01-01

This report details the chemical and radionuclide contaminant results for the characterization of the 2014 Second Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System
Results for the Third Quarter 2014 Tank 50 WAC slurry sample: Chemical and radionuclide contaminants

Energy Technology Data Exchange (ETDEWEB)

Crawford, Charles L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-01-08

This report details the chemical and radionuclide contaminant results for the characterization of the 2014 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time.¹ Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
Results For The Fourth Quarter 2014 Tank 50 WAC Slurry Sample: Chemical And Radionuclide Contaminants

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-09-30

This report details the chemical and radionuclide contaminant results for the characterization of the Calendar Year (CY) 2014 Fourth Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
Results For The Third Quarter 2013 Tank 50 WAC Slurry Sample

Energy Technology Data Exchange (ETDEWEB)

Bannochie, Christopher J.

2013-11-26

This report details the chemical and radionuclide contaminant results for the characterization of the 2013 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.

Results For The Second Quarter 2013 Tank 50 WAC Slurry Sample: Chemical And Radionuclide Contaminants

Energy Technology Data Exchange (ETDEWEB)

Bannochie, Christopher J.

2013-07-31

This report details the chemical and radionuclide contaminant results for the characterization of the 2013 Second Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by Saltstone Facility Engineering (SFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
Leachability of Arsenic and Heavy Metals from Mine Tailings of Abandoned Metal Mines

Science.gov (United States)

Lim, Mihee; Han, Gi-Chun; Ahn, Ji-Whan; You, Kwang-Suk; Kim, Hyung-Seok

2009-01-01

Mine tailings from an abandoned metal mine in Korea contained high concentrations of arsenic (As) and heavy metals [e.g., As: 67,336, Fe: 137,180, Cu: 764, Pb: 3,572, and Zn: 12,420 (mg/kg)]. US EPA method 6010 was an effective method for analyzing total arsenic and heavy metals concentrations. Arsenic in the mine tailings showed a high residual fraction of 89% by a sequential extraction. In Toxicity Characteristic Leaching Procedure (TCLP) and Korean Standard Leaching Test (KSLT), leaching concentrations of arsenic and heavy metals were very low [e.g., As (mg/L): 0.4 for TCLP and 0.2 for KSLT; cf. As criteria (mg/L): 5.0 for TCLP and 1.5 for KSLT]. PMID:20049231
Fast optical and X-ray variability in the UCXB 4U0614+09

Science.gov (United States)

Hakala, P. J.; Charles, P. A.; Muhli, P.

2011-09-01

We present results from several years of fast optical photometry of 4U0614+091 (V1055 Orionis), a candidate ultracompact X-ray binary most likely consisting of a neutron star and a degenerate secondary. We find evidence for strong accretion-driven variability at all epochs, which manifests itself as red noise. This flickering produces transient peaks in the observed power spectrum in the 15-65 min period range. Only in one of our 12 optical data sets can we see evidence for a period that cannot be reproduced using the red noise model. This period of 51 min coincides with the strongest period detected by Shahbaz et al. and can thus be taken as the prime candidate for the orbital period of the system. Furthermore, we find some tentative evidence for the X-ray versus optical flux anticorrelation discovered by Machin et al. using our data together with the all-sky X-ray monitoring data from RXTE/All Sky Monitor. We propose that the complex time series behaviour of 4U0614+09 is a result of drastic changes in the accretion disc geometry/structure on time-scales from hours to days. Finally, we want to draw attention to the interpretation of moderately strong peaks in the power spectra of especially accreting sources. Many of such 'periods' can probably be attributed to the presence of red noise (i.e. correlated events) in the data. Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias. Uses results provided by the ASM/RXTE teams at MIT and at the RXTE SOF and GOF at NASA's GSFC.
Stabilization/solidification of selenium-impacted soils using Portland cement and cement kiln dust

International Nuclear Information System (INIS)

Moon, Deok Hyun; Grubb, Dennis G.; Reilly, Trevor L.

2009-01-01

Stabilization/solidification (S/S) processes were utilized to immobilize selenium (Se) as selenite (SeO 3 2- ) and selenate (SeO 4 2- ). Artificially contaminated soils were prepared by individually spiking kaolinite, montmorillonite and dredged material (DM; an organic silt) with 1000 mg/kg of each selenium compound. After mellowing for 7 days, the Se-impacted soils were each stabilized with 5, 10 and 15% Type I/II Portland cement (P) and cement kiln dust (C) and then were cured for 7 and 28 days. The toxicity characteristic leaching procedure (TCLP) was used to evaluate the effectiveness of the S/S treatments. At 28 days curing, P doses of 10 and 15% produced five out of six TCLP-Se(IV) concentrations below 10 mg/L, whereas only the 15% C in DM had a TCLP-Se(IV) concentration 3 .H 2 O) and selenate substituted ettringite (Ca 6 Al 2 (SeO 4 ) 3 (OH) 12 .26H 2 O), respectively.
Results for the first quarter calendar year 2017 tank 50H salt solution sample

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2017-04-12

In this memorandum, the chemical and radionuclide contaminant results from the First Quarter Calendar Year 2017 (CY17) sample of Tank 50H salt solution are presented in tabulated form. The First Quarter CY17 Tank 50H samples [a 200 mL sample obtained 6” below the surface (HTF-50-17-7) and a 1 L sample obtained 66” from the tank bottom (HTF-50-17-8)] were obtained on January 15, 2017 and received at Savannah River National Laboratory (SRNL) on January 16, 2017. Prior to obtaining the samples from Tank 50H, a single pump was run at least 4.4 hours and the samples were pulled immediately after pump shut down. All volatile organic analysis (VOA) and semi-volatile organic analysis (SVOA) were performed on the surface sample and all other analyses were performed on the variable depth sample. The information from this characterization will be used by Savannah River Remediation (SRR) for the transfer of aqueous waste from Tank 50H to the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. The chemical and radionuclide contaminant results from the characterization of the First Quarter CY17 sampling of Tank 50H were requested by SRR personnel and details of the testing are presented in the SRNL Task Technical and Quality Assurance Plan (TTQAP). This memorandum is part of Deliverable 2 from SRR request. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the TTQAP for the Tank 50H saltstone task.
Results for the Fourth Quarter Calendar Year 2015 Tank 50H Salt Solution Sample

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-01-11

In this memorandum, the chemical and radionuclide contaminant results from the Fourth Quarter Calendar Year 2015 (CY15) sample of Tank 50H salt solution are presented in tabulated form. The Fourth Quarter CY15 Tank 50H samples were obtained on October 29, 2015 and received at Savannah River National Laboratory (SRNL) on October 30, 2015. The information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering for the transfer of aqueous waste from Tank 50H to the Salt Feed Tank in the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the Task Technical and Quality Assurance Plan (TTQAP) for the Tank 50H saltstone task. The chemical and radionuclide contaminant results from the characterization of the Fourth Quarter Calendar Year 2015 (CY15) sampling of Tank 50H were requested by SRR personnel and details of the testing are presented in the SRNL Task Technical and Quality Assurance Plan.
Assessment of cement kiln dust (CKD) for stabilization/solidification (S/S) of arsenic contaminated soils.

Science.gov (United States)

Moon, Deok Hyun; Wazne, Mahmoud; Yoon, In-Ho; Grubb, Dennis G

2008-11-30

A stabilization/solidification (S/S) process for arsenic (As) contaminated soils was evaluated using cement kiln dust (CKD). Laboratory-prepared slurries, made of either kaolinite or montmorillonite, and field soils spiked with either As(3+) or As(5+) were prepared and treated with CKD ranging from 10 to 25 wt%. Sodium arsenite and sodium arsenate at 0.1 wt% were used to simulate arsenite (As(3+)) and arsenate (As(5+)) source contamination in soils, respectively. The effectiveness of treatment was evaluated at curing periods of 1- and 7-days based on the toxicity characteristic leaching procedure (TCLP). As-CKD and As-clay-CKD slurries were also spiked at 10 wt% to evaluate As immobilization mechanism using X-ray powder diffraction (XRPD) analyses. Overall, the TCLP results showed that only the As(5+) concentrations in kaolinite amended with 25 wt% CKD after 1 day of curing were less than the TCLP regulatory limit of 5mg/L. Moreover, at 7 days of curing, all As(3+) and As(5+) concentrations obtained from kaolinite soils were less than the TCLP criteria. However, none of the CKD-amended montmorillonite samples satisfied the TCLP-As criteria at 7 days. Only field soil samples amended with 20 wt% CKD complied with the TCLP criteria within 1 day of curing, where the source contamination was As(5+). XRPD and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX) results showed that Ca-As-O and NaCaAsO(4).7.5H(2)O were the primary phases responsible for As(3+) and As(5+) immobilization in the soils, respectively.
Assessment of cement kiln dust (CKD) for stabilization/solidification (S/S) of arsenic contaminated soils

International Nuclear Information System (INIS)

Moon, Deok Hyun; Wazne, Mahmoud; Yoon, In-Ho; Grubb, Dennis G.

2008-01-01

A stabilization/solidification (S/S) process for arsenic (As) contaminated soils was evaluated using cement kiln dust (CKD). Laboratory-prepared slurries, made of either kaolinite or montmorillonite, and field soils spiked with either As 3+ or As 5+ were prepared and treated with CKD ranging from 10 to 25 wt%. Sodium arsenite and sodium arsenate at 0.1 wt% were used to simulate arsenite (As 3+ ) and arsenate (As 5+ ) source contamination in soils, respectively. The effectiveness of treatment was evaluated at curing periods of 1- and 7-days based on the toxicity characteristic leaching procedure (TCLP). As-CKD and As-clay-CKD slurries were also spiked at 10 wt% to evaluate As immobilization mechanism using X-ray powder diffraction (XRPD) analyses. Overall, the TCLP results showed that only the As 5+ concentrations in kaolinite amended with 25 wt% CKD after 1 day of curing were less than the TCLP regulatory limit of 5 mg/L. Moreover, at 7 days of curing, all As 3+ and As 5+ concentrations obtained from kaolinite soils were less than the TCLP criteria. However, none of the CKD-amended montmorillonite samples satisfied the TCLP-As criteria at 7 days. Only field soil samples amended with 20 wt% CKD complied with the TCLP criteria within 1 day of curing, where the source contamination was As 5+ . XRPD and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX) results showed that Ca-As-O and NaCaAsO 4 .7.5H 2 O were the primary phases responsible for As 3+ and As 5+ immobilization in the soils, respectively
FINALNI REZULTAT NA TURNEJI 4 SKAKAONICE 2008/09 U ODNOSU NA REZULTATE UNUTAR POJEDINIH NATJECANJA

Directory of Open Access Journals (Sweden)

Žarko Bilić

2009-11-01

Full Text Available The aim of this article was relation determination of final score position on Ski- jump Tournament 2008/09 with particular competition phases. As methodological ex- ploration, research was conducted with intention of determination of competition phases of individual ski-jumping location. Data of 67 jumpers that at least once (of 4 possible situations take one of 50 best places were taken as official results. Correlation analysis were applied, and average correlation of individual matches also, for total sample as well as for sub-samples of 30, 20, 15 and 10 jumpers that were best positioned at the end of Tournament. Results have shown a set of information existence that is best to explain as: a tactical introduction, b real positioning, c technical test, and d value confirma- tion. Originality of research is expressed in the defining total logic of particular jumping location, and limitations of research could be defined in the part that correspond with extraordinary situations like whether conditions, bad mistakes of best jumpers and even- tually connected with total position of some jumpers in World cup. With those situations respect research for sure remains highly methodologically positioned
Changing structural properties of mixed crystals [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 1-x}Co{sub x}Cl{sub 4} (x = 0, 0.5, 0.7, 0.9, and 1) by magic angle spinning nuclear magnetic resonance

Energy Technology Data Exchange (ETDEWEB)

Lim, Ae Ran, E-mail: aeranlim@hanmail.net [Department of Science Education, Jeonju University, Jeonju 560-759 (Korea, Republic of); Department of Carbon Fusion Engineering, Jeonju University, Jeonju 560-759 (Korea, Republic of)

2016-03-01

Temperature dependences of the chemical shift and spin-lattice relaxation time in the rotating frame T{sub 1ρ} were measured for {sup 1}H and {sup 13}C nuclei in mixed crystals of the form [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 1-x} Co{sub x}Cl{sub 4} (x = 0, 0.5, 0.7, 0.9, and 1). The mixed crystals varied in color according to the amount of Co{sup 2+} ions, whereas the phase transition temperatures remained nearly unchanged. [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4} and [N(CH{sub 3}){sub 4}]{sub 2}CoCl{sub 4} crystals contain two nonequivalent types of a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4}. The two crystallographically different ions a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4} were distinguished using {sup 13}C CP/MAS NMR spectroscopy. The NMR spectrum and T{sub 1ρ} for {sup 1}H and {sup 13}C in case of x = 0.5 and x = 0.7 were similar to those for [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4}, whereas those for x = 0.9 were absolutely different. Additionally, [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 0.1}Co{sub 0.9}Cl{sub 4} exhibited the structural properties of both [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4} and [N(CH{sub 3}){sub 4}]{sub 2}CoCl{sub 4}. - Highlights: • Chemical shift and spin-lattice relaxation time in rotating frame. • Two crystallographically different ions a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4}. • Structural properties of mixed crystals.
Magnetic excitations of Nd in Nd{sub 2-x}Ce{sub x}CuO{sub 4} (x=0,0.09,0.13)

Energy Technology Data Exchange (ETDEWEB)

Henggeler, W.; Furrer, A. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Chattopadyay, T.; Roessli, B. [Institut Max von Laue - Paul Langevin, 75 - Paris (France); Vorderwisch, P. [Hahn-Meitner-Institut Berlin GmbH (Germany); Thalmeier, P. [MPI Dresden (Germany)

1997-09-01

We have studied the wave vector dependence of the magnetic excitation spectrum of Nd in Nd{sub 2-x}Ce{sub x}CuO{sub 4} (x=0,0.09,0.13) by inelastic neutron scattering experiments on single crystals. The results are analyzed with the help of model calculations which are performed in the context of the mean field random-phase approximation. This enables us to obtain direct information on the coupling constants between the rare earth ions. (author) 1 fig., 2 refs.
Registration of 'CP 09-2392' Sugarcane

Science.gov (United States)

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...
Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds

International Nuclear Information System (INIS)

Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.

2007-01-01

The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound
Optical rectification in a strained GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} quantum dot: Simultaneous effects of electric and magnetic fields

Energy Technology Data Exchange (ETDEWEB)

Vinolin, Ada [Dept. of Physics, Madurai Kamaraj University College, Alagarkoil Road, Madurai-625002 (India); Peter, A. John, E-mail: a.john.peter@gmail.com [Dept. of Physics, Government Arts College, Melur-625106, Tamilnadu (India)

2014-04-24

Simultaneous effects of electric field and magnetic field on exciton binding energy as a function of dot radius in a cylindrical GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} strained quantum dot are investigated. The strain contribution includes the strong built-in electric field induced by the spontaneous and piezoelectric polarizations. Numerical calculations are performed using variational procedure within the single band effective mass approximation. Optical rectification in the GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} quantum dot is computed in the presence of electric and magnetic fields.
Cephradine as corrosion inhibitor for copper in 0.9% NaCl solution

Science.gov (United States)

Tasić, Žaklina Z.; Petrović Mihajlović, Marija B.; Radovanović, Milan B.; Simonović, Ana T.; Antonijević, Milan M.

2018-05-01

The effect of (6R,7R)-7-[[(2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetyl]amino]-3-methyl-8-oxo-5-thia-1-azobicyclo[4.2.0]oct-2-ene-2-carboxylic acid (cephradine) on corrosion behavior of copper in 0.9% NaCl solution was investigated. The electrochemical methods including the open circuit potential measurements, potentiodynamic polarization and electrochemical impedance spectroscopy measurements, scanning electron microscopy with energy dispersive X-ray spectroscopy and quantum chemical calculations were used for this investigation. According to the results obtained by potentiodynamic polarization, cephradine acts as mixed type inhibitor. Also, the results obtained by electrochemical impedance spectroscopy indicate that cephradine provides good copper protection in 0.9% NaCl solution. The inhibition efficiency of cephradine increases with increasing its concentration. The scanning electron microscopy with energy dispersive X-ray spectroscopy confirms that a protective layer is formed on the copper surface due to the adsorption of cephradine on the active sites on the copper surface. Adsorption of cephradine in 0.9% NaCl solution follows the Langmuir adsorption isotherm. Quantum chemical calculations are in agreement with results obtained by electrochemical measurements.
iWork '09 pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.
Hong Kong domestic health spending: financial years 1989/90 to 2008/09.

Science.gov (United States)

Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V

2012-08-01

This report presents the latest estimates of Hong Kong domestic health spending for financial years 1989/90 to 2008/09, cross-stratified and categorised by financing source, provider and function. Total expenditure on health (TEH) was HK$84,391 million in financial year 2008/09, which represents an increase of HK$5030 million or 6.3% over the preceding year. Amid the financial tsunami in late 2008, TEH grew faster relative to gross domestic product (GDP) leading to a marked increase as a percentage of GDP from 4.8% in 2007/08 to 5.1% in 2008/09. During the period 1989/90 to 2008/09, TEH per capita (at constant 2009 prices) grew at an average annual rate of 4.9%, which was faster than that of per capita GDP by 2.0 percentage points. 6.4% when compared with 2007/08, reaching HK$41 257 million and HK$43 134 million, respectively. Consequently, public and private shares of total health expenditure remained the same in the 2 years at 48.9% and 51.1%, respectively. Regarding private spending, the most important source of health financing was out-of-pocket payments by households (35.4% of TEH), followed by employer-provided group medical benefits (7.5%) and private insurance (6.4%). During the period, a growing number of households (mostly in middle to high-income groups) subscribed to pre-payment plans for financing health care. As such, private insurance has taken on an increasingly important role for financing private spending. Of the HK$84 391 million total health expenditure in 2008/09, current expenditure comprised HK$81 186 million (96.2%), whereas HK$3206 million (3.8%) was for capital expenses (ie investment in medical facilities). Analysed by health care function, services for curative care accounted for the largest share of total health spending (66.1%), which was made up of ambulatory services (32.8%), in-patient curative care (28.8%), day patient hospital services (3.9%) and home care (0.5%). Notwithstanding the small share of total spending for day patient
Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069126)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...
Chemical, physical and profile oceanographic data collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069113)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...
Comparison of leach results from field and laboratory prepared samples

International Nuclear Information System (INIS)

Oblath, S.B.; Langton, C.A.

1985-01-01

The leach behavior of saltstone prepared in the laboratory agrees well with that from samples mixed in the field using the Littleford mixer. Leach rates of nitrates and cesium from the current reference formulation saltstone were compared. The laboratory samples were prepared using simulated salt solution; those in the field used Tank 50 decontaminated supernate. For both nitrate and cesium, the field and laboratory samples showed nearly identical leach rates for the first 30 to 50 days. For the remaining period of the test, the field samples showed higher leach rates with the maximum difference being less than a factor of three. Ruthenium and antimony were present in the Tank 50 supernate in known amounts. Antimony-125 was observed in the leachate and a fractional leach rate was calculated to be at least a factor of ten less than that of 137 Cs. No 106 Ru was observed in the leachate, and the release rate was not calculated. However, based on the detection limits for the analysis, the ruthenium leach rate must also be at least a factor of ten less than cesium. These data are the first measurements of the leach rates of Ru and Sb from saltstone. The nitrate leach rates for these samples were 5 x 10 -5 grams of nitrate per square cm per day after 100 days for the laboratory samples and after 200 days for the field samples. These values are consistent with the previously measured leach rates for reference formulation saltstone. The relative standard deviation in the leach rate is about 15% for the field samples, which all were produced from one batch of saltstone, and about 35% for the laboratory samples, which came from different batches. These are the first recorded estimates of the error in leach rates for saltstone

Degradation of cementitious materials associated with salstone disposal units

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Smith, F. G. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2014-09-01

The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed “saltstone”. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of a saltstone disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions.
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 ref|NP_689554.2| progestin and adipoQ receptor family member IV [...Homo sapiens] sp|Q8N4S7|PAQR4_HUMAN RecName: Full=Progestin and adipoQ receptor family member 4; AltName: Full=Progesti...n and adipoQ receptor family member IV gb|AAH33703.1| Progestin and adipoQ receptor family member... IV [Homo sapiens] gb|AAR08370.1| progestin and adipoQ receptor family member IV ...[Homo sapiens] gb|EAW85441.1| progestin and adipoQ receptor family member IV, isoform CRA_a [Homo sapiens] gb|EAW85443.1| progesti
Results for the First, Second, and Third Quarter Calendar Year 2015 Tank 50H WAC slurry samples chemical and radionuclide contaminants

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-02-18

This report details the chemical and radionuclide contaminant results for the characterization of the Calendar Year (CY) 2015 First, Second, and Third Quarter sampling of Tank 50H for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering (D&S-FE) to support the transfer of low-level aqueous waste from Tank 50H to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50H Waste Characterization System. Previous memoranda documenting the WAC analyses results have been issued for these three samples.
Pretreatment of Tc-Containing Waste and Its Effect on Tc-99 Leaching From Grouts

International Nuclear Information System (INIS)

Aloy, Albert; Kovarskaya, Elena N.; Harbour, John R.; Langton, Christine A.; Holtzscheiter, E. William

2007-01-01

A salt solution (doped with Tc-99), that simulates the salt waste stream to be processed at the Saltstone Production Facility, was immobilized in grout waste forms with and without (1) ground granulated blast furnace slag and (2) pretreatment with iron salts. The degree of immobilization of Tc-99 was measured through monolithic and crushed grout leaching tests. Although Fe (+2) was shown to be effective in reducing Tc-99 to the +4 state, the strong reducing nature of the blast furnace slag present in the grout formulation dominated the reduction of Tc-99 in the cured grouts. An effective diffusion coefficient of 4.75 x 10 -12 (Leach Index of 11.4) was measured using the ANSI/ANS-16.1 protocol. The leaching results show that, even in the presence of a concentrated salt solution, blast furnace slag can effectively reduce pertechnetate to the immobile +4 oxidation state. The measured diffusivity was introduced into a flow and transport model (PORFLOW) to calculate the release of Tc-99 from a Saltstone Vault as a function of hydraulic conductivity of the matrix. (authors)
40 CFR 61.09 - Notification of startup.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...
Magnetic and Moessbauer study of Mg{sub 0.9}Mn{sub 0.1}Cr{sub x}Fe{sub 2-x}O{sub 4} ferrites

Energy Technology Data Exchange (ETDEWEB)

Elzain, M., E-mail: elzain@squ.edu.om; Widatallah, H.; Gismelseed, A.; Bouziane, K.; Yousif, A.; Al Rawas, A.; Al-Omari, I.; Sellai, A. [Sultan Qaboos University, Department of Physics, College of Science (Oman)

2006-02-15

The ferrites Mg{sub 0.9}Mn{sub 0.1}Cr{sub x}Fe{sub 2-x}O{sub 4} (0x0.9) were prepared using the conventional double sintering method. The XRD showed that the samples maintain a single spinel cubic phase. The Moessbauer measurements were carried out at room and liquid nitrogen temperatures. From the area ratios of the A and B sites, it was found that the Fe cation population of the A and B sites decreases in proportion to Cr concentration. The contact hyperfine fields at the A and B sites were found to decrease with increasing Cr contents. This was found to be in approximate agreement with the results of magnetization measurement. The distributions of Mg and Mn cations versus Cr concentration were also determined using the Moessbauer and magnetization results. The Curie temperatures were determined and found to agree with the reported values. As the Cr contents increases the relative magnetization, was found to increase at low temperatures and decreases at higher temperatures.
Chemical and physical oceanographic profile data collected from CTD casts aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater Horizon oil spill event (NODC Accession 0068955)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...
Exon: CBRC-MMUS-09-0206 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...
Enhanced bioremediation of 4-nonylphenol and cadmium co-contaminated sediment by composting with Phanerochaete chrysosporium inocula.

Science.gov (United States)

Xu, Piao; Lai, Cui; Zeng, Guangming; Huang, Danlian; Chen, Ming; Song, Biao; Peng, Xin; Wan, Jia; Hu, Liang; Duan, Abing; Tang, Wangwang

2018-02-01

Composting is identified as an effective approach for solid waste disposal. The bioremediation of 4-nonylphenol (4NP) and cadmium (Cd) co-contaminated sediment was investigated by composting with Phanerochaete chrysosporium (P. chrysosporium) inocula. P. chrysosporium inocula and proper C/N ratios (25.51) accelerated the composting process accompanied with faster total organic carbon loss, 4NP degradation and Cd passivation. Microbiological analysis demonstrated that elevated activities of lignocellulolytic enzymes and sediment enzymes was conducive to organic chemical transformation. Bacterial community diversity results illustrated that Firmicutes and Proteobacteria were predominant species during the whole composting process. Aerobic cellulolytic bacteria and organic degrading species played significant roles. Toxicity characteristic leaching procedure (TCLP) extraction and germination indices results indicated the efficient detoxification of 4NP and Cd co-contaminated sediment after 120 days of composting. Overall, results demonstrated that P. chrysosporium enhanced composting was available for the bioremediation of 4NP and Cd co-contaminated sediment. Copyright © 2017 Elsevier Ltd. All rights reserved.
76 FR 60871 - In the Matter of Certain Toner Cartridges and Components Thereof; Notice of Commission Final...

Science.gov (United States)

2011-09-30

...-Toner''); Alpha Image Tech of South El Monte, California (``Alpha Image''); ACM Technologies, Inc. of Corona, California (``ACM''); Virtual Imaging Products Inc. of North York, Ontario; Acecom Inc.--San... Image, Copy Tech, LTT, C&R, ACM, Ink Master, Direct Billing, Ink Tech, QCI, IJSS, Acecom, Ninestar Tech...
Chemical and physical oceanographic profile data collected from CTD casts aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater Horizon oil spill event (NODC Accession 0069071)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...
Effect of MCM09, an active site-directed inhibitor of factor Xa, on B16-BL6 melanoma lung colonies in mice.

Science.gov (United States)

Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A

2006-03-01

Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.
Compatibility of butorphanol and droperidol in 0.9% sodium chloride injection.

Science.gov (United States)

Chen, Fu-Chao; Fang, Bao-Xia; Li, Peng; Yang, Jin-Guo; Zhou, Ben-Hong

2013-03-15

The compatibility and stability of butorphanol tartrate and droperidol in polyvinyl chloride (PVC) bags and glass bottles stored at 4°C and 25°C for up to 15 days were studied. Admixtures were assessed initially and for 15 days after preparation in PVC bags and glass bottles using 0.9% sodium chloride injection as a diluent and stored at 4°C and 25°C. The initial drug concentrations were 0.08 mg/mL for butorphanol tartrate and 0.05 mg/mL for droperidol. Samples were withdrawn from each container immediately after preparation and at predetermined intervals (2, 4, 8, 24, 48, 72, 120, 168, 240, and 360 hours after preparation). The solutions were visually inspected for precipitation, cloudiness, and discoloration at each sampling interval. Drug concentrations were determined using a validated high-pressure liquid chromatography method. After 15 days of storage, all formulations tested retained >98% of the initial concentrations of both drugs. The drug mixtures were clear in appearance, and no color change or precipitation was observed. Throughout this period, pH values remained stable. Admixtures of butorphanol tartrate 0.08 mg/mL and droperidol 0.05 mg/mL in 0.9% sodium chloride injection were stable for at least 360 hours when stored in PVC bags or glass bottles at 4°C and 25°C and protected from light.
Impact of natural and calcined starfish (Asterina pectinifera) on the stabilization of Pb, Zn and As in contaminated agricultural soil.

Science.gov (United States)

Lim, Jung Eun; Sung, Jwa Kyung; Sarkar, Binoy; Wang, Hailong; Hashimoto, Yohey; Tsang, Daniel C W; Ok, Yong Sik

2017-04-01

Metal stabilization using soil amendments is an extensively applied, economically viable and environmentally friendly remediation technique. The stabilization of Pb, Zn and As in contaminated soils was evaluated using natural starfish (NSF) and calcined starfish (CSF) wastes at different application rates (0, 2.5, 5.0 and 10.0 wt%). An incubation study was conducted over 14 months, and the efficiency of stabilization for Pb, Zn and As in soil was evaluated by the toxicity characteristic leaching procedure (TCLP) test. The TCLP-extractable Pb was reduced by 76.3-100 and 91.2-100 % in soil treated with NSF and CSF, respectively. The TCLP-extractable Zn was also reduced by 89.8-100 and 93.2-100 % in soil treated with NSF and CSF, respectively. These reductions could be associated with the increased metal adsorption and the formation of insoluble metal precipitates due to increased soil pH following application of the amendments. However, the TCLP-extractable As was increased in the soil treated with NSF, possibly due to the competitive adsorption of phosphorous. In contrast, the TCLP-extractable As in the 10 % CSF treatment was not detectable because insoluble Ca-As compounds might be formed at high pH values. Thermodynamic modeling by visual MINTEQ predicted the formation of ettringite (Ca 6 Al 2 (SO 4 ) 3 (OH) 12 ·26H 2 O) and portlandite (Ca(OH) 2 ) in the 10 % CSF-treated soil, while SEM-EDS analysis confirmed the needle-like structure of ettringite in which Pb was incorporated and stabilized in the 10 % CSF treatment.
75 FR 63177 - Availability of FY 09 Grantee Performance Evaluation Reports for the Eight States of EPA Region 4...

Science.gov (United States)

2010-10-14

... ENVIRONMENTAL PROTECTION AGENCY [FRL-9213-6] Availability of FY 09 Grantee Performance Evaluation... (EPA). ACTION: Notice of availability; Clean Air Act Section 105 grantee performance evaluation reports...-year evaluations of eight state air pollution control programs (Alabama Department of Environmental...
CD206+ Cell Number Differentiates Influenza A (H1N1pdm09 from Seasonal Influenza A Virus in Fatal Cases

Directory of Open Access Journals (Sweden)

Heidi G. Rodriguez-Ramirez

2014-01-01

Full Text Available In 2009, a new influenza A (H1N1 virus affected many persons around the world. There is an urgent need for finding biomarkers to distinguish between influenza A (H1N1pdm09 and seasonal influenza virus. We investigated these possible biomarkers in the lung of fatal cases of confirmed influenza A (H1N1pdm09. Cytokines (inflammatory and anti-inflammatory and cellular markers (macrophages and lymphocytes subpopulation markers were analyzed in lung tissue from both influenza A (H1N1pdm09 and seasonal influenza virus. High levels of IL-17, IFN-γ, and TNF-α positive cells were identical in lung tissue from the influenza A (H1N1pdm09 and seasonal cases when compared with healthy lung tissue (P<0.05. Increased IL-4+ cells, and CD4+ and CD14+ cells were also found in high levels in both influenza A (H1N1pdm09 and seasonal influenza virus (P<0.05. Low levels of CD206+ cells (marker of alternatively activated macrophages marker in lung were found in influenza A (H1N1pdm09 when compared with seasonal influenza virus (P<0.05, and the ratio of CD206/CD14+ cells was 2.5-fold higher in seasonal and noninfluenza group compared with influenza A (H1N1pdm09 (P<0.05. In conclusion, CD206+ cells differentiate between influenza A (H1N1pdm09 and seasonal influenza virus in lung tissue of fatal cases.
Lithium-deficient Li YMn2O4 spinels (0.9 ≤ Y < 1): Lithium content, synthesis temperature, thermal behaviour and electrochemical properties

International Nuclear Information System (INIS)

Pascual, Laura; Perez-Revenga, M. Luz; Rojas, Rosa M.; Rojo, Jose M.; Amarilla, J. Manuel

2006-01-01

Lithium-deficient Li Y Mn 2 O 4 spinels (LD-Li Y Mn 2 O 4 ) with nominal composition (0.9 ≤ Y 2 O 3 and LiNO 3 at temperatures ranging from 700 deg. C to 850 deg. C. X-ray diffraction data show that LD-Li Y Mn 2 O 4 spinels are obtained as single phases in the range Y = 0.975-1 at 700 deg. C and 750 deg. C. Morphological characterization by transmission electron microscopy shows that the particle size of LD-Li Y Mn 2 O 4 spinels increases on decreasing the Li-content. The influence of the Li-content and the synthesis temperature on the thermal and electrochemical behaviours has been systematically studied. Thermal analysis studies indicate that the temperature of the first thermal effect in the differential thermal analysis (DTA)/thermogravimetric (TG) curves, T C1 , linearly increases on decreasing the Li-content. The electrochemical properties of LD-Li Y Mn 2 O 4 spinels, determined by galvanostatic cycling, notably change with the synthesis conditions. So, the first discharge capacity, Q disch. , at C rate increases on rising the Li-content and the synthesis temperature. The sample Li 0.975 Mn 2 O 4 synthesized at 700 deg. C has a Q disch. = 123 mAh g -1 and a capacity retention of 99.77% per cycle. This LD-Li Y Mn 2 O 4 sample had the best electrochemical characteristics of the series
46 CFR 42.09-5 - All vessels-division into types.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...
UV-continuum slopes of >4000 z ∼ 4-8 galaxies from the HUDF/XDF, HUDF09, ERS, CANDELS-SOUTH, and CANDELS-NORTH fields

Energy Technology Data Exchange (ETDEWEB)

Bouwens, R. J.; Labbé, I.; Franx, M.; Smit, R. [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Illingworth, G. D.; Oesch, P. A.; Gonzalez, V.; Magee, D. [UCO/Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Van Dokkum, P. G. [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Trenti, M. [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom)

2014-10-01

We measure the UV-continuum slope β for over 4000 high-redshift galaxies over a wide range of redshifts z ∼ 4-8 and luminosities from the HST HUDF/XDF, HUDF09-1, HUDF09-2, ERS, CANDELS-N, and CANDELS-S data sets. Our new β results reach very faint levels at z ∼ 4 (–15.5 mag: 0.006 L{sub z=3}{sup ∗}), z ∼ 5 (–16.5 mag: 0.014 L{sub z=3}{sup ∗}), and z ∼ 6 and z ∼ 7 (–17 mag: 0.025 L{sub z=3}{sup ∗}). Inconsistencies between previous studies led us to conduct a comprehensive review of systematic errors and develop a new technique for measuring β that is robust against biases that arise from the impact of noise. We demonstrate, by object-by-object comparisons, that all previous studies, including our own and those done on the latest HUDF12 data set, suffered from small systematic errors in β. We find that after correcting for the systematic errors (typically Δβ ∼ 0.1-0.2) all β results at z ∼ 7 from different groups are in excellent agreement. The mean β we measure for faint (–18 mag: 0.1 L{sub z=3}{sup ∗}) z ∼ 4, z ∼ 5, z ∼ 6, and z ∼ 7 galaxies is –2.03 ± 0.03 ± 0.06 (random and systematic errors), –2.14 ± 0.06 ± 0.06, –2.24 ± 0.11 ± 0.08, and –2.30 ± 0.18 ± 0.13, respectively. Our new β values are redder than we have reported in the past, but bluer than other recent results. Our previously reported trend of bluer β's at lower luminosities is confirmed, as is the evolution to bluer β's at high redshifts. β appears to show only a mild luminosity dependence faintward of M {sub UV,AB} ∼ –19 mag, suggesting that the mean β asymptotes to ∼–2.2 to –2.4 for faint z ≥ 4 galaxies. At z ∼ 7, the observed β's suggest non-zero, but low dust extinction, and they agree well with values predicted in cosmological hydrodynamical simulations.
UV-continuum slopes of >4000 z ∼ 4-8 galaxies from the HUDF/XDF, HUDF09, ERS, CANDELS-SOUTH, and CANDELS-NORTH fields

International Nuclear Information System (INIS)

Bouwens, R. J.; Labbé, I.; Franx, M.; Smit, R.; Illingworth, G. D.; Oesch, P. A.; Gonzalez, V.; Magee, D.; Van Dokkum, P. G.; Trenti, M.

2014-01-01

We measure the UV-continuum slope β for over 4000 high-redshift galaxies over a wide range of redshifts z ∼ 4-8 and luminosities from the HST HUDF/XDF, HUDF09-1, HUDF09-2, ERS, CANDELS-N, and CANDELS-S data sets. Our new β results reach very faint levels at z ∼ 4 (–15.5 mag: 0.006 L z=3 ∗ ), z ∼ 5 (–16.5 mag: 0.014 L z=3 ∗ ), and z ∼ 6 and z ∼ 7 (–17 mag: 0.025 L z=3 ∗ ). Inconsistencies between previous studies led us to conduct a comprehensive review of systematic errors and develop a new technique for measuring β that is robust against biases that arise from the impact of noise. We demonstrate, by object-by-object comparisons, that all previous studies, including our own and those done on the latest HUDF12 data set, suffered from small systematic errors in β. We find that after correcting for the systematic errors (typically Δβ ∼ 0.1-0.2) all β results at z ∼ 7 from different groups are in excellent agreement. The mean β we measure for faint (–18 mag: 0.1 L z=3 ∗ ) z ∼ 4, z ∼ 5, z ∼ 6, and z ∼ 7 galaxies is –2.03 ± 0.03 ± 0.06 (random and systematic errors), –2.14 ± 0.06 ± 0.06, –2.24 ± 0.11 ± 0.08, and –2.30 ± 0.18 ± 0.13, respectively. Our new β values are redder than we have reported in the past, but bluer than other recent results. Our previously reported trend of bluer β's at lower luminosities is confirmed, as is the evolution to bluer β's at high redshifts. β appears to show only a mild luminosity dependence faintward of M UV,AB ∼ –19 mag, suggesting that the mean β asymptotes to ∼–2.2 to –2.4 for faint z ≥ 4 galaxies. At z ∼ 7, the observed β's suggest non-zero, but low dust extinction, and they agree well with values predicted in cosmological hydrodynamical simulations.

Variability Of KD Values In Cementitious Materials And Sediments

International Nuclear Information System (INIS)

Almond, P.; Kaplan, D.; Shine, E.

2012-01-01

Measured distribution coefficients (K d values) for environmental contaminants provide input data for performance assessments (PA) that evaluate physical and chemical phenomena for release of radionuclides from wasteforms, degradation of engineered components and subsequent transport of radionuclides through environmental media. Research efforts at SRNL to study the effects of formulation and curing variability on the physiochemical properties of the saltstone wasteform produced at the Saltstone Disposal Facility (SDF) are ongoing and provide information for the PA and Saltstone Operations. Furthermore, the range and distribution of plutonium K d values in soils is not known. Knowledge of these parameters is needed to provide guidance for stochastic modeling in the PA. Under the current SRS liquid waste processing system, supernate from F and H Tank Farm tanks is processed to remove actinides and fission products, resulting in a low-curie Decontaminated Salt Solution (DSS). At the Saltstone Production Facility (SPF), DSS is mixed with premix, comprised of blast furnace slag (BFS), Class F fly ash (FA), and portland cement (OPC) to form a grout mixture. The fresh grout is subsequently placed in SDF vaults where it cures through hydration reactions to produce saltstone, a hardened monolithic waste form. Variation in saltstone composition and cure conditions of grout can affect the saltstone's physiochemical properties. Variations in properties may originate from variables in DSS, premix, and water to premix ratio, grout mixing, placing, and curing conditions including time and temperature (Harbour et al. 2007; Harbour et al. 2009). There are no previous studies reported in the literature regarding the range and distribution of K d values in cementitious materials. Presently, the Savannah River Site (SRS) estimate ranges and distributions of K d values based on measurements of K d values made in sandy SRS sediments (Kaplan 2010). The actual cementitious material K d
Annual report 2008-09

International Nuclear Information System (INIS)

2009-01-01

The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).
Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling

International Nuclear Information System (INIS)

Bhaskar, U.K.; Bid, S.; Pradhan, S.K.

2011-01-01

Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N
iMovie '09 & iDVD pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of iMovie '09 or iDVD, put this savvy Portable Genius to work. Want to quickly turn raw footage into a polished movie? Crop, rotate, or delete clips? Add background music or sound effects? Customize your iDVD themes? You'll find cool and useful Genius tips, insider secrets, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy iMovie '09 and iDVD to the max.
Assessment of heavy metal mobility in mine tailings in the province of Huelva; Evaluacion de la movilidad de metales pesados en residuos mineros de flotacion de mineria metalica en la provincia de Huelva

Energy Technology Data Exchange (ETDEWEB)

Arranz Gonzalez, J. C.; Cala Rivero, V.

2011-07-01

Metallurgic mine wastes often contain high concentrations of potentially toxic elements, the mobility of which may pose an environmental hazard for water and surrounding ecosystems. We have examined the mobility of Ag, As, Cu, Pb and Zn from composite surface samples (0-20 cm) of different pyritic tailings impoundments in the province of Huelva (Spain). These samples were also subject to physical chemical and mineralogical (XRD) characterization. The total metal content of the tailings ranged between 1.89-11.2 ppm for Ag, 72-610 ppm for As, 245-1194 ppm for Cu, 220-11933 for Pb and 41-706 for Zn, all proving to be highly acidic. The mobility of these elements was assessed by using a seven-step sequential extraction procedure and applying the toxicity characteristic leaching procedure (TCLP). We investigated the applicability of TCLP to the tailings by comparing the results with those of the first steps of the sequential extraction procedure. It was found that the pH values remained buffered (close to 4.97) upon adding the TCLP extraction reagent and that the pH values differed significantly from those of the aqueous extracts. This could result in an underestimation of mobile forms compared with those dissolved in water. We may also conclude that due to the presence of specific minerals or to the preference of some elements for acetate ions the results of any assessment of metal mobility in pyritic tailings using the TCLP test may be questionable. (Author) 42 refs.
Bistand til risikovurdering (evt. ændringer af tidligere risikovurdering). Zea mays (MON863; MON863x810). Supplerende materiale til ansøgningen. Modtaget 07-09-2004, deadline 19-09-2004, svar 17-09-2004

DEFF Research Database (Denmark)

Kjellsson, Gøsta; Strandberg, Morten Tune

2012-01-01

"DMU har modtaget og vurderet de supplerende oplysninger (mail fra Skov- og Naturstyrelsen d. 07-09-2004) til ansøgningen om tilladelse til markedsføring af genetisk modificeret majs C/DE/02/09 (MON863 og MON863 x MON810). Vi har gennemgået oplysningerne i det tilsendte materiale for at se om de ...
17 CFR 210.12-09 - Valuation and qualifying accounts.

Science.gov (United States)

2010-04-01

... period Column C—Additions (1)—Charged to costs and expenses (2)—Charged to other accounts—describe Column... qualifying accounts and reserves by descriptive title. Group (a) those valuation and qualifying accounts... accounts. 210.12-09 Section 210.12-09 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...
Doping effects on the relaxation of frustration and magnetic properties of YMn0.9Cu0.1O3

Science.gov (United States)

Xiao, L. X.; Xia, Z. C.; Wang, X.; Ni, Y.; Yu, W.; Shi, L. R.; Jin, Z.; Xiao, G. L.

2017-12-01

The crystal structure and magnetic properties of hexagonal YMn0.9Cu0.1O3 single crystal are systematically investigated. The refinement results of XRD show the lattice constant decreases, which is unusually due to the doped Cu2+ ion has a larger ionic radius than the Mn3+ ions. The XPS results show that the coexistence of Mn2+, Mn3+ and Mn4+ ions in YMn0.9Cu0.1O3 single crystal. Magnetization measurements show that Cu doped YMn0.9Cu0.1O3 and parent YMnO3 have almost the same antiferromagnetic transition temperature TN, which indicates the AFM interaction is robust in the geometry frustrated system. Because doping directly destroy some of the Mn3+ ions nets, the relaxation of frustration of Mn in-plane 2D triangular geometry network leads to the significantly decrease of Mn3+ ions AFM interaction. In addition, the coexistence and competition between the ferromagnetic and antiferromagnetic interactions among the Mn2+, Mn3+ and Mn4+ ions lead to a complicated and irreversible magnetization behavior in YMn0.9Cu0.1O3 single crystal.
Altered response to A(H1N1)pnd09 vaccination in pregnant women

DEFF Research Database (Denmark)

Bischoff, Anne Louise; Følsgaard, Nilofar Vahman; Carson, Charlotte Giwercman

2013-01-01

BACKGROUND: Pregnant women were suspected to be at particular risk when H1N1pnd09 influenza became pandemic in 2009. Our primary objective was to compare the immune responses conferred by MF59®-adjuvanted vaccine (Focetria®) in H1N1pnd09-naïve pregnant and non-pregnant women. The secondary aims...... were to compare influences of dose and adjuvant on the immune response. METHODS: The study was nested in the Copenhagen Prospective Studies on Asthma in Childhood (COPSAC2010) pregnancy cohort in 2009-2010 and conducted as a single-blinded block-randomised [1∶1∶1] controlled clinical trial in pregnant...... women after gestational week 20: (1) 7.5 µg H1N1pnd09 antigen with MF59-adjuvant (Pa7.5 µg); (2) 3.75 µg antigen half MF59-adjuvanted (Pa3.75 µg); (3) 15 µg antigen unadjuvanted (P15 µg); and in non-pregnant women receiving (4) 7.5 µg antigen full adjuvanted (NPa7.5 µg). Blood samples were collected...
THE SUBLUMINOUS AND PECULIAR TYPE Ia SUPERNOVA PTF 09dav

International Nuclear Information System (INIS)

Sullivan, M.; Ofek, E. O.; Blake, S.; Podsiadlowski, P.; Kasliwal, M. M.; Cooke, J.; Quimby, R.; Kulkarni, S. R.; Nugent, P. E.; Thomas, R. C.; Poznanski, D.; Howell, D. A.; Arcavi, I.; Gal-Yam, A.; Hook, I. M.; Mazzali, P.; Bildsten, L.; Bloom, J. S.; Cenko, S. B.; Law, N.

2011-01-01

PTF 09dav is a peculiar subluminous Type Ia supernova (SN) discovered by the Palomar Transient Factory (PTF). Spectroscopically, it appears superficially similar to the class of subluminous SN1991bg-like SNe, but it has several unusual features which make it stand out from this population. Its peak luminosity is fainter than any previously discovered SN1991bg-like SN Ia (M B ∼ -15.5), but without the unusually red optical colors expected if the faint luminosity were due to extinction. The photospheric optical spectra have very unusual strong lines of Sc II and Mg I, with possible Sr II, together with stronger than average Ti II and low velocities of ∼6000 km s -1 . The host galaxy of PTF09dav is ambiguous. The SN lies either on the extreme outskirts (∼41 kpc) of a spiral galaxy or in an very faint (M R ≥ -12.8) dwarf galaxy, unlike other 1991bg-like SNe which are invariably associated with massive, old stellar populations. PTF 09dav is also an outlier on the light-curve-width-luminosity and color-luminosity relations derived for other subluminous SNe Ia. The inferred 56 Ni mass is small (0.019 ± 0.003 M sun ), as is the estimated ejecta mass of 0.36 M sun . Taken together, these properties make PTF 09dav a remarkable event. We discuss various physical models that could explain PTF 09dav. Helium shell detonation or deflagration on the surface of a CO white dwarf can explain some of the features of PTF 09dav, including the presence of Sc and the low photospheric velocities, but the observed Si and Mg are not predicted to be very abundant in these models. We conclude that no single model is currently capable of explaining all of the observed signatures of PTF 09dav.
Optical transition energy of magneto-polaron in a GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} quantum dot

Energy Technology Data Exchange (ETDEWEB)

Vinolin, Ada [Dept. of Physics, Madurai Kamaraj University College, Alagarkoil Road, Madurai-625002. India (India); Peter, A. John, E-mail: a.john.peter@gmail.com [Dept. of Physics, Govt. Arts College, Melur-625106. Madurai. India (India)

2015-06-24

Magneto-LO-polaron in a cylindrical GaAs{sub 0.9} P{sub 0.1} / GaAs{sub 0.6} P{sub 0.4} quantum dot is investigated taking into consideration of geometrical confinement effect. The effects of phonon on the exciton binding energy and the interband emission energy as a function of dot radius are found. The calculations are performed within the single band effective mass approximation using the variational method based on the Lee-Low-Pine LLP transformation.
Neptunium sorption and co-precipitation of strontium in simulated DWPF salt solution

International Nuclear Information System (INIS)

McIntyre, P.F.; Orebaugh, E.G.; King, C.M.

1988-01-01

Batch experiments performed using crushed slag saltstone (∼40 mesh) removed >80% of 237 Np from simulated Defense Waste Processing Facility (DWPF) salt solution. The concentration of 237 Np (110 pCi/ml) used was 1000x greater than levels in actual DWPF solutions. Neptunium-239 was used as a tracer and was formed by neutron activation of uranyl nitrate. Results showed that small amounts of crushed saltstone (as little as 0.05 grams), removed >80% of neptunium from 15 ml of simulated DWPF solution after several hours equilibration. The neptunium is sorbed on insoluble carbonates formed in and on the saltstone matrix. Further testing showed that addition of 0.01 and 0.10 ml of 1 molar Ca +2 (ie. Ca (NO 3 ) 2 , CaCl 2 ) into 15 ml of simulated DWPF solution yielded a white carbonate precipitate which also removed >80% of the neptunium after 1 hour equilibration. Further experiments were performed to determine the effectiveness of this procedure to co-precipitate strontium
Reduction of hexavalent chromium by Pannonibacter phragmitetus LSSE-09 stimulated with external electron donors under alkaline conditions

International Nuclear Information System (INIS)

Xu Lin; Luo Mingfang; Li Wangliang; Wei Xuetuan; Xie Keng; Liu Lijun; Jiang Chengying; Liu Huizhou

2011-01-01

Research highlights: → Growing cells have high Cr (VI) resistant and reducing ability aerobically. → Resting cells show strong anaerobic-reduction potential. → Acetate can highly stimulate both aerobic and anaerobic reduction process. - Abstract: A novel Cr (VI) resistant bacterial strain LSSE-09, identified as Pannonibacter phragmitetus, was isolated from industrial sludge. It has strong aerobic and anaerobic Cr (VI)-reduction potential under alkaline conditions. At 37 o C and pH 9.0, growing cells of strain LSSE-09 could completely reduce 100 and 1000 mg L -1 Cr (VI)-Cr (III) within 9 and 24 h, respectively under aerobic condition. Resting cells showed higher anaerobic reduction potential with the rate of 1.46 mg g -1 (dryweight) min -1 , comparing with their aerobic reduction rate, 0.21 mg g -1 min -1 . External electron donors, such as lactate, acetate, formate, pyruvate, citrate and glucose could highly increase the reduction rate, especially for aerobic reduction. The presence of 3000 mg L -1 acetate enhanced anaerobic and aerobic Cr (VI)-reduction rates up to 9.47 mg g -1 min -1 and 4.42 mg g -1 min -1 , respectively, which were 5 and 20 times faster than those without it. Strain LSSE-09 retained high activities over six batch cycles and NO 3 - and SO 4 2- had slightly negative effects on Cr (VI)-reduction rates. The results suggest that strain LSSE-09 has potential application for Cr (VI) detoxification in alkaline wastewater.
Stabilization/solidification of selenium-impacted soils using Portland cement and cement kiln dust.

Science.gov (United States)

Moon, Deok Hyun; Grubb, Dennis G; Reilly, Trevor L

2009-09-15

Stabilization/solidification (S/S) processes were utilized to immobilize selenium (Se) as selenite (SeO(3)(2-)) and selenate (SeO(4)(2-)). Artificially contaminated soils were prepared by individually spiking kaolinite, montmorillonite and dredged material (DM; an organic silt) with 1000 mg/kg of each selenium compound. After mellowing for 7 days, the Se-impacted soils were each stabilized with 5, 10 and 15% Type I/II Portland cement (P) and cement kiln dust (C) and then were cured for 7 and 28 days. The toxicity characteristic leaching procedure (TCLP) was used to evaluate the effectiveness of the S/S treatments. At 28 days curing, P doses of 10 and 15% produced five out of six TCLP-Se(IV) concentrations below 10mg/L, whereas only the 15% C in DM had a TCLP-Se(IV) concentration soil-cement slurries aged for 30 days enabled the identification of Se precipitates by X-ray powder diffraction (XRD) and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX). XRD and SEM-EDX analyses of the Se(IV)- and Se(VI)-soil-cement slurries revealed that the key selenium bearing phases for all three soil-cement slurries were calcium selenite hydrate (CaSeO(3).H(2)O) and selenate substituted ettringite (Ca(6)Al(2)(SeO(4))(3)(OH)(12).26H(2)O), respectively.
Tunable exchange bias effect in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles at temperatures up to 250K

DEFF Research Database (Denmark)

Basith, M. A.; Khan, F. A.; Ahmmad, Bashir

2015-01-01

that the strength of the exchange bias effect is tunable by the field cooling. The HEB values are also found to be dependent on the temperature. This magnetically tunable exchange bias obtained at temperatures up to 250K in Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles may be worthwhile for potential applications.......The exchange bias (EB) effect has been observed in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles.The influence of magnetic field cooling on the exchange bias effect has also been investigated. The magnitude of the exchange bias field (HEB) increases with the cooling magnetic field, showing...
Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes II. experimental determination

DEFF Research Database (Denmark)

Chatzichristodoulou, Christodoulos; Søgaard, Martin; Glasscock, Julie

2011-01-01

Thin (∼30 m), dense Ce0.9Gd0.1O1.95- (CGO10) membranes (5 5 cm2+) supported on a porous NiO/YSZ substrate were fabricated by tape casting, wet powder spraying and lamination. A La 0.58Sr0.4Co0.2Fe0.8O 3-δ/Ce0.9Gd0.1O1.95- (LSCF/CGO10) composite cathode was applied by screen printing. Oxygen...... compartment. The performance of the membrane was also investigated under varying CH 4 and H2O gas mixtures at 1106 K. The oxygen flux increased with decreasing steam to carbon ratio and was found to exceed 10 N mL min-1 cm-2 of O2 for steam to carbon ratios below 4:3. Post-test analysis of the tested membrane...
46 CFR 42.09-35 - Additional survey requirements for wood-hull vessels.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Additional survey requirements for wood-hull vessels. 42.09-35 Section 42.09-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES... Additional survey requirements for wood-hull vessels. (a) In addition to the requirements in § 42.09-25, the...
Effect of Chlorine Substitution on Sulfide Reactivity with OH Radicals

Science.gov (United States)

2008-09-01

Single point energy: MP2/6-311+G(3df,2p) (LRG) • Zero Point Energy from a vibrational frequency analysis: MP2/6-31++G** ( ZPE ) • Extrapolated energy...E(QCI) + E(LARG) – E(SML) + ZPE • Characterize the TS • Use a three-point fit methodology – fit a harmonic potential to three CCSD single point
Identification of 2,4-toluenediisocyanate (2,4-TDI) adducts with globin and albumin

Czech Academy of Sciences Publication Activity Database

Mráz, J.; Šimek, Petr; Nohová, H.; Boušková, Š.; Gálová, E.; Linhart, I.; Šmejkal, J.

1998-01-01

Roč. 14, - (1998), s. 40-41 [International Symposium on Biological Monitoring in Occupational and Environmental Health /4./. 23.09.1998-25.09.1998, Seoul] R&D Projects: GA ČR GA313/96/0375 Keywords : Streptomyces griseus Subject RIV: FR - Pharmacology ; Medidal Chemistry
Transverse momentum and pseudorapidity distributions of charged hadrons in pp collisions at $\\sqrt{s}$ = 0.9 and 2.36 TeV

CERN Document Server

Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Ero, Janos; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hoch, Michael; Hormann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schofbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; De Wolf, Eddi A.; Hashemi, Majid; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; D'Hondt, Jorgen; Devroede, Olivier; Kalogeropoulos, Alexis; Maes, Joris; Mozer, Matthias Ulrich; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Villella, Ilaria; Chabert, Eric Christian; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Marage, Pierre Edouard; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; Cortina Gil, Eduardo; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Gregoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Militaru, Otilia; Ovyn, Severine; Piotrzkowski, Krzysztof; Quertenmont, Loic; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Herquet, Philippe; Alves, Gilvan; Pol, Maria Elena; Henrique Gomes e Souza, Moacyr; Carvalho, Wagner; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Oguri, Vitor; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; Torres Da Silva De Araujo, Felipe; De Almeida Dias, Flavia; Dias, Marco Andre Ferreira; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Damgov, Jordan; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Stoykova, Stefka; Sultanov, Georgi; Trayanov, Rumen; Vankov, Ivan; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leandar; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Jian; Wang, Xianyou; Wang, Zheng; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Hu, Zhen; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhu, Bo; Andres Carrillo Montoya, Camilo; Gomez Moreno, Bernardo; Andres Ocampo Rios, Alberto; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Fereos, Reginos; Galanti, Mario; Mousa, Jehad; Papadakis, Antonakis; Ptochos, Fotios; Razis, Panos A.; Tsiakkouri, Demetra; Zinonos, Zinonas; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Muntel, Mait; Raidal, Martti; Rebane, Liis; Eerola, Paula; Czellar, Sandor; Harkonen, Jaakko; Heikkinen, Mika Aatos; Karimaki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampen, Tapio; Lassila-Perini, Kati; Lehti, Sami; Linden, Tomas; Luukka, Panja-Riina; Maenpaa, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Dejardin, Marc; Denegri, Daniel; Descamps, Julien; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, Francois-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, Andre; Rousseau, Delphine; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Bianchini, Lorenzo; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dobrzynski, Ludwik; Elgammal, Sherif; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Mine, Philippe; Paganini, Pascal; Sirois, Yves; Thiebaux, Christophe; Zabi, Alexandre; Agram, Jean-Laurent; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Conte, Eric; Drouhin, Frederic; Ferro, Cristina; Fontaine, Jean-Charles; Gele, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Ripp-Baudot, Isabelle; Speck, Joaquim; Van Hove, Pierre; Baty, Clement; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fassi, Farida; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Roinishvili, Vladimir; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Pandoulas, Demetrios; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Actis, Oxana; Bender, Walter; Biallass, Philipp; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Kirsch, Matthias; Klimkovich, Tatsiana; Kreuzer, Peter; Lanske, Dankfried; Merschmeyer, Markus; Meyer, Arnd; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sowa, Michael; Steggemann, Jan; Teyssier, Daniel; Zeidler, Clemens; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flugge, Gunter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrens, Ulf; Borras, Kerstin; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Meyer, Andreas Bernhard; Mnich, Joachim; Olzem, Jan; Parenti, Andrea; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Volyanskyy, Dmytro; Wissing, Christoph; Autermann, Christian; Draeger, Jula; Eckstein, Doris; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Sander, Christian; Schleper, Peter; Schroder, Matthias; Schum, Torben; Stadie, Hartmut; Steinbruck, Georg; Thomsen, Jan; Wolf, Roger; Bauer, Julia; Blum, Peter; Buege, Volker; Cakir, Altan; Chwalek, Thorsten; Daeuwel, Daniel; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Frey, Martin; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heinrich, Michael; Hoffmann, Karl-heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Muller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Renz, Manuel; Sabellek, Andreas; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jurgen; Stober, Fred-Markus; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Karafasoulis, Konstantinos; Kyriakis, Aristoteles; Loukas, Demitrios; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Petrakou, Eleni; Zachariadou, Aikaterini; Agapitos, Antonis; Gouskos, Loukas; Katsas, Panagiotis; Panagiotou, Apostolos; Saganis, Konstantinos; Xaxiris, Evangelos; Evangelou, Ioannis; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Sharma, Richa; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Chauhan, Sushil; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Ranjan, Kirti; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Suggisetti, Praveenkumar; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Nayak, Aruna; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Fahim, Ali; Jafari, Abideh; Mohammadi Najafabadi, Mojtaba; Moshaii, Ahmad; Paktinat Mehdiabadi, Saeid; Zeinali, Maryam; Felcini, Marta; Abbrescia, Marcello; Barbone, Lucia; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fedele, Francesca; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pierro, Giuseppe Antonio; Polese, Giovanni; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Capiluppi, Paolo; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Chiorboli, Massimiliano; Costa, Salvatore; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Broccolo, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Landi, Gregorio; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; Cerati, Giuseppe Benedetto; De Guio, Federico; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Menasce, Dario; Miccio, Vincenzo; Moroni, Luigi; Negri, Pietro; Paganoni, Marco; Pedrini, Daniele; Pullia, Antonino; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Salerno, Roberto; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Taroni, Silvia; Cimmino, Anna; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Biasotto, Massimo; Carlin, Roberto; Checchia, Paolo; De Mattia, Marco; Dorigo, Tommaso; Fanzago, Federica; Gasparini, Fabrizio; Giubilato, Piero; Gonella, Franco; Gresele, Ambra; Gulmini, Michele; Lacaprara, Stefano; Lazzizzera, Ignazio; Maron, Gaetano; Mattiazzo, Serena; Meneguzzo, Anna Teresa; Passaseo, Marina; Pegoraro, Matteo; Pozzobon, Nicola; Ronchese, Paolo; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Baesso, Paolo; Berzano, Umberto; Pagano, Davide; Ratti, Sergio P.; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fano, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Bocci, Andrea; Castaldi, Rino; Dell'Orso, Roberto; Dutta, Suchandra; Fiori, Francesco; Foa, Lorenzo; Gennai, Simone; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Borgia, Maria Assunta; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Dellacasa, Giulio; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Penzo, Aldo; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kong, Dae Jung; Park, Hyangkyu; Son, Dong-Chul; Kim, Jaeho; Song, Sanghyeon; Jung, Seung Yong; Hong, Byung-Sik; Kim, Hyunchul; Kim, Ji Hyun; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Sim, Kwang Souk; Kim, Jangho; Choi, Minkyoo; Park, In Kyu; Choi, Suyong; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Jo, Youngkwon; Kwon, Jeongteak; Lee, Jongseok; Lee, Sungeun; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla Valdez, Heriberto; Sanchez Hernandez, Alberto; Carrillo Moreno, Salvador; Ibarguen, Humberto Antonio Salazar; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Allfrey, Philip; Krofcheck, David; Aumeyr, Thomas; Butler, Philip H.; Signal, Tony; Williams, Jennifer C.; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Gorski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; Bargassa, Pedrame; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Musella, Pasquale; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wohri, Hermine Katharina; Altsybeev, Igor; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger, Michael, Jr.; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Vishnevskiy, Alexander; Volodko, Anton; Zarubin, Anatoli; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Obrant, Gennady; Shcheglov, Yury; Shchetkovskiy, Alexander; Smirnov, Igor; Sulimov, Valentin; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Ilina, Natalia; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Kuleshov, Sergey; Oulianov, Alexei; Safronov, Grigory; Semenov, Sergey; Shreyber, Irina; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Vardanyan, Irina; Dremin, Igor; Kirakosyan, Martin; Konovalova, Nina; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Datsko, Kirill; Kachanov, Vassili; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Sytine, Alexandre; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Maletic, Dimitrije; Puzovic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Fernandez Bedoya, Cristina; Fernandez Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Pelayo, Jesus Puerta; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; de Troconiz, Jorge F.; Cuevas, Javier; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; Iglesias, Lara Lloret; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Diaz Merino, Irma; Diez Gonzalez, Carlos; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Gonzalez Suarez, Rebeca; Jorda, Clara; Pardo, Patricia Lobelle; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Martinez Ruiz del Arbol, Pablo; Matorras, Francisco; Rodrigo, Teresa; Jimeno, Alberto Ruiz; Scodellaro, Luca; Sanudo, Mar Sobron; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Baillon, Paul; Ball, Austin; Barney, David; Beaudette, Florian; Beccati, Barbara; Bell, Alan James; Bellan, Riccardo; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bolognesi, Sara; Bona, Marcella; Breuker, Horst; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cattai, Ariella; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Covarelli, Roberto; Cure, Benoit; Dahms, Torsten; De Roeck, Albert; Elliott-Peisert, Anna; Funk, Wolfgang; Gaddi, Andrea; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gowdy, Stephen; Guiducci, Luigi; Gutleber, Johannes; Hartl, Christian; Harvey, John; Hegner, Benedikt; Henderson, Conor; Hoffmann, Hans Falk; Honma, Alan; Huhtinen, Mika; Innocente, Vincenzo; Janot, Patrick; Lecoq, Paul; Leonidopoulos, Christos; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Meridiani, Paolo; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mulders, Martijn; Noy, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimia, Martti; Racz, Attila; Rolandi, Gigi; Rovere, Marco; Ryjov, Vladimir; Sakulin, Hannes; Schafer, Christoph; Schlatter, Wolf-Dieter; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stockli, Fabian; Traczyk, Piotr; Tropea, Paola; Tsirou, Andromachi; Istvan Veres, Gabor; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Konig, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Caminada, Lea; Casella, Maria Chiara; Chen, Zhiling; Cittolin, Sergio; Dambach, Sarah; Dissertori, Gunther; Dittmar, Michael; Eggel, Christina; Eugster, Jurg; Freudenreich, Klaus; Grab, Christoph; Herve, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Milenovic, Predrag; Moortgat, Filip; Nardulli, Alessandro; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Sala, Leonardo; Sanchez, Ann-Karin; Sawley, Marie-Christine; Schinzel, Dietrich; Sordini, Viola; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Trub, Peter; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Rikova, Mirena Ivova; Regenfus, Christian; Robmann, Peter; Rommerskirchen, Tanja; Schmidt, Alexander; Snoek, Hella; Tsirigkas, Dimitrios; Wilke, Lotte; Chang, Yuan-Hann; Chen, E.Augustine; Chen, Wan-Ting; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Wu, Jing-Han; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Lei, Yeong-Jyi; Lin, Sheng-wen; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-ming; Ueno, Koji; Wang, Chin-chi; Wang, Minzu; Adiguzel, Aytul; Ayhan, Aydin; Bakirci, Mustafa Numan; Cerci, Salim; Demir, Zahide; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gurpinar, Emine; Karaman, Turker; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sahin, Ozge; Sengul, Ozden; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gulmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Cussans, David; Frazier, Robert; Goldstein, Joel; Hansen, Maria; Heath, Greg P.; Heath, Helen F.; Hill, Christopher; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Mackay, Catherine Kirsty; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Davies, Gavin; Della Negra, Michel; Foudas, Costas; Fulcher, Jonathan; Futyan, David; Hall, Geoffrey; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; MacEvoy, Barry C.; Magnan, Anne-Marie; Marrouche, Jad; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Stoye, Markus; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Reid, Ivan; Teodorescu, Liliana; Bose, Tulika; Clough, Andrew; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sulak, Lawrence; Andrea, Jeremy; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Esen, Selda; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Speer, Thomas; Tsang, Ka Vang; Breedon, Richard; Calderon de la Barca Sanchez, Manuel; Cebra, Daniel; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Wallny, Rainer; Babb, John; Chandra, Avdhesh; Clare, Robert; Ellison, John Anthony; Gary, J.William; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, Andre; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Norman, Matthew; Padhi, Sanjay; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Vartak, Adish; Wurthwein, Frank; Yagil, Avraham; Barge, Derek; Blume, Michael; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Garberson, Jeffrey; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lamb, James; Lowette, Steven; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Witherell, Michael; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Gataullin, Marat; Litvine, Vladimir; Ma, Yousi; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Jang, Dong Wook; Jun, Soon Yung; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Blekman, Freya; Cassel, David; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Patterson, Juliet Ritchie; Puigh, Darren; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Vaughan, Jennifer; Weng, Yao; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Albrow, Michael; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Binkley, Morris; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Green, Dan; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Limon, Peter; Lueking, Lee; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Prokofyev, Oleg; Sexton-Kennedy, Elizabeth; Sharma, Seema; Smith, Richard P.; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Piero Di Giovanni, Gian; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kotov, Khristian; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Pakhotin, Yuriy; Piedra Gomez, Jonatan; Prescott, Craig; Rapsevicius, Valdas; Remington, Ronald; Schmitt, Michael; Scurlock, Bobby; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Luis Rodriguez, Jorge; Adams, Todd; Askew, Andrew; Chen, Jie; Dharmaratna, Welathantri G.D.; Diamond, Brendan; Gleyzer, Sergei V.; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Sekmen, Sezen; Baarmand, Marc M.; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Mermerkaya, Hamit; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatian, Samvel; Mironov, Camelia; Shabalina, Elizaveta; Smoron, Agata; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Chung, Kwangzoo; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bandurin, Dmitry; Barfuss, Anne-fleur; Bolton, Tim; Chakaberia, Irakli; Kaadze, Ketino; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; D'Enterria, David; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristian Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Wyslouch, Bolek; Xie, Si; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Petyt, David; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A.; Sonnek, Peter; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Smith, Kenneth; Strang, Michael; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Reucroft, Steve; Swain, John; Wood, Darien; Anastassov, Anton; Kubik, Andrew; Ofierzynski, Radoslaw Adrian; Pozdnyakov, Andrey; Schmitt, Michael; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Ruchti, Randy; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Killewald, Phillip; Ling, Ta-Yung; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroue, Pierre; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatzerklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Potamianos, K.; Sedov, Alexey; Shipsey, Ian; Silvers, David; Yoo, Hwi Dong; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Matveev, Mikhail; Morales, Jafet; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel; Demina, Regina; Flacher, Henning; Garcia-Bellido, Aran; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Korjenevski, Sergey; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Demortier, Luc; Goulianos, Konstantin; Hatakeyama, Kenichi; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Gershtein, Yuri; Halkiadakis, Eva; Hits, Dmitry; Lath, Amitabh; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Nguyen, Chi Nhan; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Toback, David; Weinberger, Michael; Akchurin, Nural; Jeong, Chiyoung; Lee, Sung Won; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Brownson, Eric; Engh, Daniel; Florez, Carlos; Johns, Willard; Kurt, Pelin; Sheldon, Paul; Arenton, Michael Wayne; Balazs, Michael; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Hirosky, Robert; Ledovskoy, Alexander; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Gunthoti, Kranti; Harr, Robert; Karchin, Paul Edmund; Mattson, Mark; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Flood, Kevin; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Lomidze, David; Loveless, Richard; Mohapatra, Ajit; Reeder, Don; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc

2010-01-01

Measurements of inclusive charged-hadron transverse-momentum and pseudorapidity distributions are presented for proton-proton collisions at sqrt(s) = 0.9 and 2.36 TeV. The data were collected with the CMS detector during the LHC commissioning in December 2009. For non-single-diffractive interactions, the average charged-hadron transverse momentum is measured to be 0.46 +/- 0.01 (stat.) +/- 0.01 (syst.) GeV/c at 0.9 TeV and 0.50 +/- 0.01 (stat.) +/- 0.01 (syst.) GeV/c at 2.36 TeV, for pseudorapidities between -2.4 and +2.4. At these energies, the measured pseudorapidity densities in the central region, dN(charged)/d(eta) for |eta| < 0.5, are 3.48 +/- 0.02 (stat.) +/- 0.13 (syst.) and 4.47 +/- 0.04 (stat.) +/- 0.16 (syst.), respectively. The results at 0.9 TeV are in agreement with previous measurements and confirm the expectation of near equal hadron production in p-pbar and pp collisions. The results at 2.36 TeV represent the highest-energy measurements at a particle collider to date.

Power Systems Development Facility Gasification Test Run TC09

Energy Technology Data Exchange (ETDEWEB)

Southern Company Services

2002-09-30

This report discusses Test Campaign TC09 of the Kellogg Brown & Root, Inc. (KBR) Transport Gasifier train with a Siemens Westinghouse Power Corporation (Siemens Westinghouse) particle filter system at the Power Systems Development Facility (PSDF) located in Wilsonville, Alabama. The Transport Gasifier is an advanced circulating fluidized-bed gasifier designed to operate as either a combustor or a gasifier in air- or oxygen-blown mode of operation using a particulate control device (PCD). The Transport Gasifier was operated as a pressurized gasifier during TC09 in air- and oxygen-blown modes. Test Run TC09 was started on September 3, 2002, and completed on September 26, 2002. Both gasifier and PCD operations were stable during the test run, with a stable baseline pressure drop. The oxygen feed supply system worked well and the transition from air to oxygen was smooth. The gasifier temperature varied between 1,725 and 1,825 F at pressures from 125 to 270 psig. The gasifier operates at lower pressure during oxygen-blown mode due to the supply pressure of the oxygen system. In TC09, 414 hours of solid circulation and over 300 hours of coal feed were attained with almost 80 hours of pure oxygen feed.
Facilities Performance Indicators Report, 2008-09

Science.gov (United States)

Hills, Christina, Ed.

2010-01-01

This paper features another expanded Web-based Facilities Performance Indicators Report (FPI). The purpose of APPA's Facilities Performance Indicators is to provide a representative set of statistics about facilities in educational institutions. The 2008-09 iteration of the Web-based Facilities Performance Indicators Survey was posted and…
A Comprehensive Spectral Analysis of the X-Ray Pulsar 4U 1907+09 from Two Observations with the Suzaku X-Ray Observatory

Science.gov (United States)

Rivers, Elizabeth; Markowitz, Alex; Pottschmidt, Katja; Roth, Stefanie; Barragan, Laura; Furst, Felix; Suchy, Slawomir; Kreykenbohm, Ingo; Wilms, Jorn; Rothschild, Richard

2009-01-01

We present results from two observations of the wind-accreting X-ray pulsar 4U 1907+09 using the Suzaku observatory, The broadband time-averaged spectrum allows us to examine the continuum emission of the source and the cyclotron resonance scattering feature at approx. 19 keV. Additionally, using the narrow CCD response of Suzaku near 6 ke V allows us to study in detail the Fe K bandpass and to quantify the Fe Kp line for this source for the first time. The source is absorbed by fully-covering material along the line of sight with a column density of N(sub H) approx. 2 x 10(exp 22)/sq cm, consistent with a wind accreting geometry, and a high Fe abundance (approx. 3 - 4 x solar). Time and phase-resolved analyses allow us to study variations in the source spectrum. In particular, dips found in the 2006 observation which are consistent with earlier observations occur in the hard X-ray bandpass, implying a variation of the whole continuum rather than occultation by intervening material, while a dip near the end of the 2007 observation occurs mainly in the lower energies implying an increase in NH along the line of sight, perhaps indicating clumpiness in the stellar wind
Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09.

Science.gov (United States)

Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming

2014-11-01

Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.
Synthesis of Galaxite, Mn0.9Co0.1Al2O4, and its application as a novel nanocatalyst for electrochemical hydrogen evolution reaction

Science.gov (United States)

Saeidfirozeh, Homa; Shafiekhani, Azizollah; Beheshti-Marnani, Amirkhosro; Askari, Mohammad Bagher

2018-06-01

A new compound Mn0.9Co0.1Al2O4 nanowires were synthesized by thermal method. The resulting powder samples were characterized by scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDX), and X-ray diffraction (XRD). We found that a set of phase transformation occurred during the process. Eventually, five phases including three spinal phases, the corundum (á-Al2O3) and MnO were formed at 1100 °C.As dominant morphology, the cubic galaxite nanowires were identified by X-ray analysis. Moreover, X-ray analysis showed that Mn3O4 and Co3O4 nanoparticles were formed in tetragonal and cubic symmetry respectively. The SEM image revealed that a dominate morphology of product has cubic nanowires shape with an average diameter in range 38-43 nm. Furthermore, we observed that influence of temperature was very important in the nanowire formation process. Electrochemical hydrogen evolution reaction (HER) of synthetic composite was evaluated and the over potential of HER was calculated about 110 mV with low Tafel slope equal to 42 mV dec-1, which was comparable with amounts reported transition metal dichalcogenides with satisfying durability.
Structural analysis, optical and dielectric function of [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} nanocrystals

Energy Technology Data Exchange (ETDEWEB)

Herrera-Pérez, G., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Morales, D., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx; Paraguay-Delgado, F.; Reyes-Rojas, A.; Fuentes-Cobas, L. E. [Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Borja-Urby, R. [Centro de Nanociencias Micro y Nanotecnologías, Instituto Politécnico Nacional, 07300 México City (Mexico)

2016-09-07

This work presents the identification of inter-band transitions in the imaginary part of the dielectric function (ε{sub 2}) derived from the Kramers–Kronig analysis for [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} (BCZT) nanocrystals synthesized by the modified Pechini method. The analysis started with the chemical identification of the atoms that conform BCZT in the valence loss energy region of a high energy-resolution of electron energy loss spectroscopy. The indirect band energy (E{sub g}) was determined in the dielectric response function. This result is in agreement with the UV-Vis technique, and it obtained an optical band gap of 3.16 eV. The surface and volume plasmon peaks were observed at 13.1 eV and 26.2 eV, respectively. The X-ray diffraction pattern and the Rietveld refinement data of powders heat treated at 700 °C for 1 h suggest a tetragonal structure with a space group (P4 mm) with the average crystal size of 35 nm. The average particle size was determined by transmission electron microscopy.
Synthesis and electrical characterization of BaZr0.9Ho0.1O3-δ electrolyte ceramic for IT - SOFCs

Science.gov (United States)

Saini, Deepash S.; Singh, Lalit K.; Bhattacharya, D.

2018-04-01

A cost-effective modified combustion method using citric acid and glycine has recently been developed to synthesize high quality, and nanosized BaZr0.9Ho0.1O3 ceramic powder. BaZr0.9Ho0.1O3-δ ceramic powder was characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and field emission scanning electron microscopy (FESEM). XRD pattern of BaZr0.9Ho0.1O3-δ ceramic sintered at 1600 °C has shown that pure phase of BaZr0.9Ho0.1O3-δ with cubic Pm3¯m space group symmetry. The transmission electron microscopic investigation has shown that the particle size of the powder calcined at 1100 °C was in the range 30-80 nm. The FESEM image of sintered pellet at 1600 °C for 4 h reveals porous nature of BaZr0.9Ho0.1O3-δ with 83.7 relative density. Impedance analysis reveal three type relaxations in the temperature range 250 °C to 500 °C as studied at different frequencies over 100 Hz to 1 MHz in air. The grain boundary conductivity of BaZr0.9Ho0.1O3-δ ceramic is found lower then grain (bulk) conductivity due to core-space charge layer behavior in grain boundary.
A Comparative Study on Corrosion Behavior of Ti-35Nb-5Ta-7Zr Ti-6Al-4V and CP-Ti in 0.9 wt% NaCl

Energy Technology Data Exchange (ETDEWEB)

Saji, Viswanathan S.; Jeong, Yong Hoon; Choe, Han Cheol [Andong National University, Andong (Korea, Republic of)

2009-08-15

Recently, quaternary titanium alloys of the system Ti-Nb-Ta-Zr received considerable research considerable research interest as potential implant materials because of their excellent mechanical properties and biocompatibility. However, only few reported works were available on the corrosion behavior of such alloys. Hence, in the present work, electrochemical corrosion of Ti-35Nb-5Ta-7Zr alloy, which has been fabricated by are melting and heat treatment, was studied in 0.9 wt% NaCl at 37{+-}1 .deg. C, along with biomedical grade Ti-6Al-4V and CP-Ti. The phase and microstructure of the alloys were investigated employing XRD and SEM. The results of electrochemical studies indicated that the corrosion resistance of the quaternary alloy was inferior to that of Ti-6Al-4V and CP Ti.
First International Diagnosis Competition - DXC'09

Science.gov (United States)

Kurtoglu, tolga; Narasimhan, Sriram; Poll, Scott; Garcia, David; Kuhn, Lukas; deKleer, Johan; vanGemund, Arjan; Feldman, Alexander

2009-01-01

A framework to compare and evaluate diagnosis algorithms (DAs) has been created jointly by NASA Ames Research Center and PARC. In this paper, we present the first concrete implementation of this framework as a competition called DXC 09. The goal of this competition was to evaluate and compare DAs in a common platform and to determine a winner based on diagnosis results. 12 DAs (model-based and otherwise) competed in this first year of the competition in 3 tracks that included industrial and synthetic systems. Specifically, the participants provided algorithms that communicated with the run-time architecture to receive scenario data and return diagnostic results. These algorithms were run on extended scenario data sets (different from sample set) to compute a set of pre-defined metrics. A ranking scheme based on weighted metrics was used to declare winners. This paper presents the systems used in DXC 09, description of faults and data sets, a listing of participating DAs, the metrics and results computed from running the DAs, and a superficial analysis of the results.
Barcelona - Talent Latent 09 / Ahto Sooaru

Index Scriptorium Estoniae

Sooaru, Ahto

2010-01-01

Fotonäitusest "Talent Latent 09" Barcelonas Arts Santa Monica kunstikeskuses. Loetletud näitusel eksponeeritud fotode autorid. Pikemalt Rafael Milach'i (sünd. 1978), Lucia Ganieva, Javier Marquerie Thomas'i (sünd. 1986), Amaury da Cunha (sünd. 1976) töödest. Lühidalt ka teistest näitustest Arts Santa Monica kunstikeskuses
Oxygen transport properties of tubular Ce0.9Gd0.1O1.95-La0.6Sr0.4FeO3−d composite asymmetric oxygen permeation membranes supported on magnesium oxide

DEFF Research Database (Denmark)

Ovtar, Simona; Gurauskis, Jonas; Bjørnetun Haugen, Astri

2017-01-01

The oxygen permeation through dense Ce0.9Gd0.1O1.95-La0.6Sr0.4FeO3−d dual-phase composite asymmetric membranes supported on a porous MgO tube was studied. The membranes were prepared by thermoplastic extrusion, dip coating, co-sintering and infiltration of a catalyst. Oxygen permeation measureme...
Leachability characteristics of beryllium in redmud waste and its stabilization in cement

International Nuclear Information System (INIS)

Saradhi, I.V.; Mahadevan, T.N.; Krishnamoorthy, T.M.

1999-01-01

More than 70% of the beryl ore processed by the Beryllium Metal Plant at the BARC Vashi Complex ends up as redmud waste. The presence of significant quantities (0.4 to 0.8%) of beryllium in the redmud qualifies it as hazardous requiring safe handling, storage and disposal. The waste also contains 0.09% of water soluble fluoride. The various standard protocol of procedures were employed to estimate the leachability of beryllium from redmud for both short term and long term periods. Nearly 50% of beryllium present in redmud is leachable in water. We have tried the stabilization of redmud using portland cement. The proportion of redmud to cement was in the ratio of 1:1, 1:2 and 1:4. The blocks were cast, cured and used in the leachability experiments using standard protocols as above. The results of the TCLP test gave the levels of beryllium well below the standard limits in the TCLP extract of cement stabilized waste indicating the suitability of stabilization of redmud with cement whereas that of raw waste (redmud) are much higher than the prescribed limits. The total leach percent of beryllium in 1:2 block is 0.05% over period of 164 days whereas 1:1 and 1:4 gave a leach percent of 0.26 and 0.15% respectively. The DLT results indicate, diffusion controlled release of beryllium from the cement stabilized redmud blocks. The effective diffusion coefficient of beryllium obtained from the modelling study is 10 orders of magnitude less than the molecular diffusion coefficient of beryllium indicating the effectiveness of cement stabilization. From the detailed experiments performed, it is felt that 1:2 proportion of redmud and cement will be the best suited option for stabilization of redmud waste. The 1:1 proportion of redmud to cement mixture which could not be cast into compact cement blocks also exhibited very low leachability characteristics similar to 1:2 and 1:4 and can be be favourably considered for stabilization in case of space constraints at storage sites. The
Disposal of decontaminated salts at the Savannah River Plant by solidification and burial

International Nuclear Information System (INIS)

Dukes, M.D.; Wolf, H.C.; Langton, C.A.

1983-01-01

The current plan for disposal of waste salt at the Savannah River Plant (SRP) is to immobilize the decontaminated salt solution by mixing with cement and SRP soil, and bury the resulting grout (saltstone) in a landfill. The grout which contains 37.8 wt % salt solution, 22.8 wt % Portland I-P cement, and 39.2 wt % SRP soil, was specially formulated to have a low permeability ( -10 cm/sec). This material will be mixed and placed in trenches. After setting, the saltstone will be covered with a clay cap, and an overburden of compacted native soil will be replaced. 6 references
Residual mercury content and leaching of mercury and silver from used amalgam capsules.

Science.gov (United States)

Stone, M E; Pederson, E D; Cohen, M E; Ragain, J C; Karaway, R S; Auxer, R A; Saluta, A R

2002-06-01

The objective of this investigation was to carry out residual mercury (Hg) determinations and toxicity characteristic leaching procedure (TCLP) analysis of used amalgam capsules. For residual Hg analysis, 25 capsules (20 capsules for one brand) from each of 10 different brands of amalgam were analyzed. Total residual Hg levels per capsule were determined using United States Environmental Protection Agency (USEPA) Method 7471. For TCLP analysis, 25 amalgam capsules for each of 10 brands were extracted using a modification of USEPA Method 1311. Hg analysis of the TCLP extracts was done with USEPA Method 7470A. Analysis of silver (Ag) concentrations in the TCLP extract was done with USEPA Method 6010B. Analysis of the residual Hg data resulted in the segregation of brands into three groups: Dispersalloy capsules, Group A, retained the most Hg (1.225 mg/capsule). These capsules were the only ones to include a pestle. Group B capsules, Valliant PhD, Optaloy II, Megalloy and Valliant Snap Set, retained the next highest amount of Hg (0.534-0.770 mg/capsule), and were characterized by a groove in the inside of the capsule. Group C, Tytin regular set double-spill, Tytin FC, Contour, Sybraloy regular set, and Tytin regular set single-spill retained the least amount of Hg (0.125-0.266 mg/capsule). TCLP analysis of the triturated capsules showed Sybraloy and Contour leached Hg at greater than the 0.2 mg/l Resource Conservation and Recovery Act (RCRA) limit. This study demonstrated that residual mercury may be related to capsule design features and that TCLP extracts from these capsules could, in some brands, exceed RCRA Hg limits, making their disposal problematic. At current RCRA limits, the leaching of Ag is not a problem.
Electrochemical characterization of Pr2CuO4–Ce0.9Gd0.1O1.95 composite cathodes for solid oxide fuel cells

International Nuclear Information System (INIS)

Kolchina, L.M.; Lyskov, N.V.; Petukhov, D.I.; Mazo, G.N.

2014-01-01

Highlights: • PCO–GDC composites are studied as a cathode for SOFCs. • The rate-determined step of the overall electrode process vs. temperature was defined. • PCO–GDC33 composite gave the lowest area surface resistance of 0.41 Ω cm 2 at 700 °C. • PCO–GDC33 is preferred to use as a cathode material for IT-SOFCs. - Abstract: Pr 2 CuO 4 –Ce 0.9 Gd 0.1 O 1.95 (PCO–GDC) composites screen printed on Ce 0.9 Gd 0.1 O 1.95 (GDC) electrolyte were considered as a cathode material for intermediate temperature solid oxide fuel cells (IT-SOFCs). Phase composition, microstructure and electrochemical properties were investigated by X-ray powder diffraction (XRD), scanning electron microscopy and AC impedance spectroscopy, respectively. The oxygen reduction on porous PCO–GDC electrode applied on CGO electrolyte was studied in a symmetrical cell configuration by AC impedance spectroscopy at OCV conditions at 670–730 °C and p O 2 =10 -2 -0.21atm. The charge transfer process and the dissociation of adsorbed molecular oxygen were found to be rate-determining steps of the oxygen reduction reaction. Results reveal that both GDC addition and electrode morphology have strong influence on area specific resistance (ASR) of the electrode/electrolyte interface. The lowest ASR value of 0.41 Ω cm 2 was achieved for the composition containing 33 wt.% GDC at 700 °S in air. The data obtained allow to consider the PCO–GDC33 composite as a promising cathode material for IT-SOFCs
Screening for Influenza A(H1N1)pdm09, Auckland International Airport, New Zealand

Science.gov (United States)

Hale, Michael J.; Baker, Michael G.

2012-01-01

Entry screening for influenza A(H1N1)pdm09 at Auckland International Airport, New Zealand, detected 4 cases, which were later confirmed, among 456,518 passengers arriving April 27–June 22, 2009. On the basis of national influenza surveillance data, which suggest that ≈69 infected travelers passed through the airport, sensitivity for screening was only 5.8%. PMID:22516105
Coinfection with influenza A(H1N1)pdm09 and dengue virus in fatal cases.

Science.gov (United States)

Perdigão, Anne Carolinne Bezerra; Ramalho, Izabel Letícia Cavalcante; Guedes, Maria Izabel Florindo; Braga, Deborah Nunes Melo; Cavalcanti, Luciano Pamplona Góes; Melo, Maria Elisabeth Lisboa de; Araújo, Rafael Montenegro de Carvalho; Lima, Elza Gadelha; Silva, Luciene Alexandre Bié da; Araújo, Lia de Carvalho; Araújo, Fernanda Montenegro de Carvalho

2016-09-01

We report on four patients with fatal influenza A(H1N1)pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses' epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4). Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998). As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015). In April 2009, a new virus, inﬂuenza A/H1N1/pandemic (FluA/H1N1/09pdm), caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010). In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013). The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1)pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013). The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1)pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Coinfection with influenza A(H1N1pdm09 and dengue virus in fatal cases

Directory of Open Access Journals (Sweden)

Anne Carolinne Bezerra Perdigão

2016-01-01

Full Text Available Abstract We report on four patients with fatal influenza A(H1N1pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses’ epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4. Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998. As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015. In April 2009, a new virus, inﬂuenza A/H1N1/pandemic (FluA/H1N1/09pdm, caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010. In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013. The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013. The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Genomic and metabolic traits endow Bacillus velezensis CC09 with a potential biocontrol agent in control of wheat powdery mildew disease.

Science.gov (United States)

Cai, Xun-Chao; Liu, Chang-Hong; Wang, Bao-Tong; Xue, Ya-Rong

2017-03-01

Bacillus velezensis CC09, which was isolated from healthy leaves of Cinnamomum camphora and previously identified as Bacillus amyloliquefaciens CC09, shows great potential as a new biocontrol agent, in control of many phytopathogenic diseases. To extend our understanding of the potential antifungal capacities, we did a whole genome analysis of strain CC09. Result shows that strain CC09 has a relatively large genome size (4.17Mb) with an average GC content of 46.1%, and 4021 predicted genes. Thirteen secondary metabolites encoding clusters have been identified within the genome of B. velezensis CC09 using genome mining technique. Data of comparative genomic analysis indicated that 3 of the clusters are conserved by all strains of B. velezensis, B. amyloliquefaciens and B. subtilis 168, 9 by B. velezensis and B. amyloliquefaciens, and 2 by all strains of B. velezensis. Another 2 clusters encoding NRPS (Non-Ribosomal Peptide Synthetases) and NRPS-TransATPKS (NRPS and trans-Acyl Transferase Polyketide Synthetases) respectively are observed only in 15 B. velezensis strains, which might lead to the synthesis of novel bioactive compounds and could be explored as antimicrobial agents in the future. These clusters endow B. velezensis CC09 with strong and broad antimicrobial activities, for example, in control of wheat powdery mildew disease. Moreover, our data further confirmed the taxonomy of strain CC09 is a member of B. velezensis rather than a strain of B. amyloliquefaciens based on core genome sequence analysis using phylogenomic approach. Copyright © 2016 Elsevier GmbH. All rights reserved.
Salt-stone Oxidation Study: Leaching Method - 13092

International Nuclear Information System (INIS)

Langton, C.A.; Stefanko, D.B.; Burns, H.H.

2013-01-01

Cementitious waste forms can be designed to chemically stabilize selected contaminants, such as Tc +7 and Cr +6 , by chemically reduction to lower valance states, Tc +4 and Cr +3 , respectively, and precipitation of these species in alkaline media as low solubility solid phases. Data for oxidation of this type of cementitious waste form cured under field conditions as a function of time is required for predicting the performance of the waste form and disposal facility. The rate of oxidation (oxidation front advancement) is an important parameter for predicting performance because the solubilities of some radionuclide contaminants, e.g., technetium, are a function of the oxidation state. A non-radioactive experiment was designed for quantifying the oxidation front advancement using chromium, as an approximate redox-sensitive surrogate (Cr +6 / Cr +3 ) for technetium (Tc +7 / Tc +4 ). Nonradioactive cementitious waste forms were prepared in the laboratory and cured under both laboratory and 'field conditions'. Laboratory conditions were ambient temperature and sealed sample containers. Field conditions were approximated by curing samples in open containers which were placed inside a plastic container stored outdoors at SRS. The container had a lid and was instrumented with temperature and humidity probes. Sub-samples as thin as 0.2 mm were taken as a function of distance from the exposed surface of the as-cast sample. The sub-samples were leached and the leachates were analyzed for chromium, nitrate, nitrite and sodium. Nitrate, nitrite, and sodium concentrations were used to provide baseline data because these species are not chemically retained in the waste form matrix to any significant extent and are not redox sensitive. 'Effective' oxidation fronts for Cr were measured for samples containing 1000, 500 and 20 mg/kg Cr added as soluble sodium chromate, Na 2 CrO 4 . For a sample cured for 129 days under field conditions, leachable Cr (assumed to be the oxidized

Production, purification and characterization of an exo-polygalacturonase from Penicillium janthinellum sw09

Directory of Open Access Journals (Sweden)

YUPING MA

2016-01-01

Full Text Available ABSTRACT A soil isolate, Penicillium janthinellum sw09 has been found to produce significant amounts of an extracellular pectinase subsequently characterized as exo-polygalacturonase (exo-PG. By optimizing growth conditions, P. janthinellum sw09 produced high amount of exo-PG (16.54 units/mL. The crude enzyme was purified by gel filtration chromatography and two exo-PG activity peaks (designated as PGI and PGII were revealed. On SDS-PAGE analysis, purified PGII using DEAE-Sepharose FF column, was found to be a single band with a molecular mass of 66.2 kDa. The purified PGII exhibited maximal activity at the temperature of 45 oC and pH 5.0. The stability profiles show that PGII is more stable in the pH range of 4.0-8.0 and below 60 oC. The Km and Vmax for the enzyme was 1.74 mg/mL and 18.08 μmol/ (mL•min, respectively. Due to this enzymatic characterization, this pectinase is an attractive candidate for applications in degradation of pectin.
Unigene BLAST: CBRC-GGAL-09-0012 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-09-0012 gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken liver cDNA library Gallus gallus cDNA clone pnl...1s.pk003.f8 5' similar to histidine-rich glycoprotein - bovine (fragments), mRNA sequence /clone=pnl
ANALYSIS OF TANK 28F SALTCAKE CORE SAMPLES FTF-456 - 467

Energy Technology Data Exchange (ETDEWEB)

Martino, C; Daniel McCabe, D; Tommy Edwards, T; Ralph Nichols, R

2007-02-28

Twelve LM-75 core samplers from Tank 28F sampling were received by SRNL for saltcake characterization. Of these, nine samplers contained mixtures of free liquid and saltcake, two contained only liquid, and one was empty. The saltcake contents generally appeared wet. A summary of the major tasks performed in this work are as follows: (1) Individual saltcake segments were extruded from the samplers and separated into saltcake and free liquid portions. (2) Free liquids were analyzed to estimate the amount of traced drill-string fluid contained in the samples. (3) The saltcake from each individual segment was homogenized, followed by analysis in duplicate. The analysis used more cost-effective and bounding radiochemical analyses rather than using the full Saltstone WAC suite. (4) A composite was created using an approximately equal percentage of each segment's saltcake contents. Supernatant liquid formed upon creation of the composite was decanted prior to use of the composite, but the composite was not drained. (5) A dissolution test was performed on the sample by contacting the composite with water at a 4:1 mass ratio of water to salt. The resulting soluble and insoluble fractions were analyzed. Analysis focused on a large subset of the Saltstone WAC constituents.
Mõtteid tegevusetusdeliktist Riigikohtu praktika valguses. Riigikohtu kriminaalkolleegiumi otsus väärteoasjas 3-1-1-104-09 / Erkki Hirsnik

Index Scriptorium Estoniae

Hirsnik, Erkki, 1982-

2010-01-01

Riigikohtu lahendist 3-1-1-104-09: Edelaraudtee Infrastruktuuri AS kaitsja vandeadvokaat Leonid Tolstovi kassatsioon Pärnu Maakohtu 4. juuni 2009. a kohtuotsuse peale Edelaraudtee Infrastruktuuri AS väärteoasjas looduskaitseseaduse § 71 lg 2 järgi
Bacillus velezensis CC09: A Potential 'Vaccine' for Controlling Wheat Diseases.

Science.gov (United States)

Kang, Xingxing; Zhang, Wanling; Cai, Xunchao; Zhu, Tong; Xue, Yarong; Liu, Changhong

2018-04-11

Biocontrol bacteria that can act like a "vaccine", stimulating plant resistance to pathogenic diseases, are still not fully elucidated. In this study, an endophytic bacterium, Bacillus velezensis CC09, labeled with green fluorescent protein, was tested for its colonization, migration, and expression of genes encoding iturin A synthetase within wheat tissues and organs as well as for protective effects against wheat take-all and spot blotch diseases. The results showed that strain CC09 not only formed biofilm on the root surface but was also widely distributed in almost every tissue, including the epidermis, cortex, and xylem vessels, and even migrated to stems and leaves, resulting in 66.67% disease-control efficacy (DCE) of take-all and 21.64% DCE of spot blotch. Moreover, the gene cluster encoding iturin A synthase under the control of the p itu promoter is expressed in B. velezensis CC09 in wheat tissues, which indicates that iturin A might contribute to the in-vivo antifungal activity and leads to the disease control. All these data suggested that strain CC09 can act like a 'vaccine' in the control of wheat diseases, with a single treatment inoculated on roots through multiple mechanisms.
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09

Energy Technology Data Exchange (ETDEWEB)

Gustafsson, Jaana; Gustafsson, Christer (Malaa Geoscience AB (Sweden))

2010-01-15

This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09

International Nuclear Information System (INIS)

Gustafsson, Jaana; Gustafsson, Christer

2010-01-01

This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
Annual North Dakota Elevator Marketing Report, 2008-09

Science.gov (United States)

2009-12-01

The Annual North Dakota Elevator Marketing Report for 2008-09 was prepared by Kimberly Vachal and Laurel Benson, : Upper Great Plains Transportation Institute. The authors gratefully acknowledge the assistance of the North Dakota : Grain Dealers Asso...
Salt-stone Oxidation Study: Leaching Method - 13092

Energy Technology Data Exchange (ETDEWEB)

Langton, C.A.; Stefanko, D.B.; Burns, H.H. [Savannah River National Laboratory, Savannah River Remediation, LLC, Savannah River Site, Aiken, SC 29808 (United States)

2013-07-01

Cementitious waste forms can be designed to chemically stabilize selected contaminants, such as Tc{sup +7} and Cr{sup +6}, by chemically reduction to lower valance states, Tc{sup +4} and Cr{sup +3}, respectively, and precipitation of these species in alkaline media as low solubility solid phases. Data for oxidation of this type of cementitious waste form cured under field conditions as a function of time is required for predicting the performance of the waste form and disposal facility. The rate of oxidation (oxidation front advancement) is an important parameter for predicting performance because the solubilities of some radionuclide contaminants, e.g., technetium, are a function of the oxidation state. A non-radioactive experiment was designed for quantifying the oxidation front advancement using chromium, as an approximate redox-sensitive surrogate (Cr{sup +6} / Cr{sup +3}) for technetium (Tc{sup +7} / Tc{sup +4}). Nonradioactive cementitious waste forms were prepared in the laboratory and cured under both laboratory and 'field conditions'. Laboratory conditions were ambient temperature and sealed sample containers. Field conditions were approximated by curing samples in open containers which were placed inside a plastic container stored outdoors at SRS. The container had a lid and was instrumented with temperature and humidity probes. Sub-samples as thin as 0.2 mm were taken as a function of distance from the exposed surface of the as-cast sample. The sub-samples were leached and the leachates were analyzed for chromium, nitrate, nitrite and sodium. Nitrate, nitrite, and sodium concentrations were used to provide baseline data because these species are not chemically retained in the waste form matrix to any significant extent and are not redox sensitive. 'Effective' oxidation fronts for Cr were measured for samples containing 1000, 500 and 20 mg/kg Cr added as soluble sodium chromate, Na{sub 2}CrO{sub 4}. For a sample cured for 129 days
Ab initio investigation of isomerism, structure and stability of dimer molecules of (LiMgH3)2 and (LiMgF3)2salts and their fragments

International Nuclear Information System (INIS)

Charkin, O.P.; Klimenko, N.M.; MakKi, M.L.

2000-01-01

Ab initio calculations of potential energy surfaces in neighborhood of key structures of non rigid dimer molecules of lithium salts of (LiMgX 3 ) 2 and binuclear anions Mg 2 X 5 - , dianions MgX 6 2- and molecules Mg 2 X 4 (X=H, F) are done in the framework of QCI-SD(T)/6-31(+)G**//MP2/6-31G* + ZPE(MP2/6-31G*) and MP2/6-31G*//HF/6-31G* + ZPE(HF/6-31G*) approximations. Equilibrium geometric parameters, relative energy and energy of decomposition of isomers, frequencies and IR-intensities of normal vibrations are determined. Data obtained are compared with results of analogous calculations for beryllium related compounds [ru
MODIFIKASI DAN EVALUASI KINERJA MESIN PENYAWUT UBIKAYU (MPB-09 Modification and Performance evaluation of a Cassava Chipper

Directory of Open Access Journals (Sweden)

I. K. Tastra

2012-05-01

Full Text Available High moisture of fresh cassava root (65-75 % wet basis need appropriate post harvest handling that can reduce lossesdue to delayed drying process. To accelerate drying process, a cassava chipper (MPB-09 was modified and evaluated for chipping fresh cassava root. This machine included hopper, horizontal chipping cylinder, 5.5 hp gasoline engine, belt, pulley, frame and cover. The performance evaluation of the cassava chipper was done using the combination of four type chipping cylinder (3, 4, 5 and 6 knife and three level chipping cylinder speed (400, 500, 600 Rpm. Regression analysis and homogeneity test of the regression coefficient was used to evaluate the the performance of the cassava chipper. Based on the optimum combination of the type of chipping cylinder and its speed, financial analysis was conducted to evaluate its feasibility. The optimum effective capacity of MPB-09 chipper was at horizontal chipping cylinder with 6 knife and rotation speed 600 rpm. At effective capacity 2.5 t/hour, investment cost Rp 7,500,000 /unit, effective working hours 160 hours/years, two operator cost Rp 200,000 /day and chipping cost Rp 50 /kg chip ; the unit cost (BP was Rp 22 /kg chip; the break-even point (BEP was 90.3 t chip/year; the pay back periodl (PBP was0.7 years; the net present value (NPV was Rp 24,473,739; the benefit cost ratio (B/C was 1.8 and the internal rate of return (IRR was 149.8 %. Based on the results of the financial analysis. it was concluded that MPB-09 chipper was feasible to be applied at farm level. ABSTRAK Kadar air umbi ubikayu yang tinggi (65-70 % bb saat panen memerlukan penanganan yang cepat guna mengurangisusut mutu akibat keterlambatan proses pengeringan. Untuk mempercepat proses pengeringan telah dilakukan modifikasi mesin penyawut (MPB-09 dengan komponen pisau sawut masing-masing sebanyak 3, 4, 5 dan 6 buah per piringan dan dievaluasi kinerjanya pada putaran 400, 500 dan 600 Rpm. Evaluasi kinerja mesin MPB
iWork '09 The Missing Manual

CERN Document Server

Clark, Josh

2009-01-01

With iWork '09: The Missing Manual, you'll quickly learn everything you need to know about Apple's incredible productivity programs, including the Pages word-processor, the Numbers spreadsheet, and the Keynote presentation program that Al Gore and Steve Jobs made famous. This book gives you crystal-clear and jargon-free explanations of iWork's capabilities, advantages, and limitations to help you produce stunning documents and cinema-quality digital presentations in no time.
2-(4-Methylphenyl-5-[({[5-(4-methylphenyl-1,3,4-thiadiazol-2-yl]sulfanyl}methylsulfanyl]-1,3,4-thiadiazole

Directory of Open Access Journals (Sweden)

Jing-wen Yu

2012-03-01

Full Text Available In the title compound, C19H16N4S4, the molecules exhibit a butterfly conformation, where the thiadiazole and attached benzene rings in two wings are almost coplanar, with dihedral angles of 0.8 (3 and 0.9 (3°, respectively, while the two thiadiazole rings form a dihedral angle of 46.3 (3°.
Biochemical and Pharmacological Characterizations of ESI-09 Based EPAC Inhibitors: Defining the ESI-09 “Therapeutic Window”

OpenAIRE

Yingmin Zhu; Haijun Chen; Stephen Boulton; Fang Mei; Na Ye; Giuseppe Melacini; Jia Zhou; Xiaodong Cheng

2015-01-01

The cAMP signaling cascade is one of the most frequently targeted pathways for the development of pharmaceutics. A plethora of recent genetic and pharmacological studies suggest that exchange proteins directly activated by cAMP (EPACs) are implicated in multiple pathologies. Selective EPAC inhibitors have been recently developed. One specific inhibitor, ESI-09, has been shown to block EPAC activity and functions, as well as to recapitulate genetic phenotypes of EPAC knockout mice when applied...
The evolution of the cluster optical galaxy luminosity function between z = 0.4 and 0.9 in the DAFT/FADA survey

Science.gov (United States)

Martinet, Nicolas; Durret, Florence; Guennou, Loïc; Adami, Christophe; Biviano, Andrea; Ulmer, Melville P.; Clowe, Douglas; Halliday, Claire; Ilbert, Olivier; Márquez, Isabel; Schirmer, Mischa

2015-03-01

Context. There is some disagreement about the abundance of faint galaxies in high-redshift clusters, with contradictory results in the literature arising from studies of the optical galaxy luminosity function (GLF) for small cluster samples. Aims: We compute GLFs for one of the largest medium-to-high-redshift (0.4 ≤ z DAFT/FADA survey in the B,V,R, and I rest-frame bands. We used photometric redshifts computed from BVRIZJ images to constrain galaxy cluster membership. We carried out a detailed estimate of the completeness of our data. We distinguished the red-sequence and blue galaxies using a V - I versus I colour-magnitude diagram. We studied the evolution of these two populations with redshift. We fitted Schechter functions to our stacked GLFs to determine average cluster characteristics. Results: We find that the shapes of our GLFs are similar for the B,V,R, and I bands with a drop at the red GLF faint ends that is more pronounced at high redshift: αred ~ -0.5 at 0.40 ≤ z 0.1 at 0.65 ≤ z < 0.90. The blue GLFs have a steeper faint end (αblue ~ -1.6) than the red GLFs, which appears to be independent of redshift. For the full cluster sample, blue and red GLFs meet at MV = -20, MR = -20.5, and MI = -20.3. A study of how galaxy types evolve with redshift shows that late-type galaxies appear to become early types between z ~ 0.9 and today. Finally, the faint ends of the red GLFs of more massive clusters appear to be richer than less massive clusters, which is more typical of the lower redshift behaviour. Conclusions: Our results indicate that these clusters form at redshifts higher than z = 0.9 from galaxy structures that already have an established red sequence. Late-type galaxies then appear to evolve into early types, enriching the red sequence between this redshift and today. This effect is consistent with the evolution of the faint-end slope of the red sequence and the galaxy type evolution that we find. Finally, faint galaxies accreted from the field
17 CFR 8.09 - Review of investigation report.

Science.gov (United States)

2010-04-01

... PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.09 Review of investigation report. The disciplinary committee shall promptly review each investigation report. In the event the disciplinary committee determines that additional investigation or evidence is needed, it shall...
Stability of tacrolimus injection diluted in 0.9% sodium chloride injection and stored in Excel bags.

Science.gov (United States)

Myers, Alan L; Zhang, Yanping; Kawedia, Jitesh D; Shank, Brandon R; Deaver, Melissa A; Kramer, Mark A

2016-12-15

The chemical stability and physical compatibility of tacrolimus i.v. infusion solutions prepared in Excel bags and stored at 23 or 4 °C for up to nine days were studied. Tacrolimus admixtures (2, 4, and 8 μg/mL) were prepared in Excel bags using 0.9% sodium chloride injection and stored at 23 °C without protection from light or at 4 °C in the dark. Test samples were withdrawn from triplicate bag solutions immediately after preparation and at predetermined time intervals (1, 3, 5, 7, and 9 days). Chemical stability was assessed by measuring tacrolimus concentrations using a validated stability-indicating high-performance liquid chromatography assay. The physical stability of the admixtures was assessed by visual examination and by measuring turbidity, particle size, and drug content. All test solutions stored at 23 or 4 °C had a no greater than 6% loss of the initial tacrolimus concentration throughout the nine-day study period. All test samples of tacrolimus admixtures, under both storage conditions, were without precipitation and remained clear initially and throughout the nine-day observation period. Changes in turbidities were minor; measured particulates remained few in number in all samples throughout the study. Extemporaneously prepared infusion solutions of tacrolimus 2, 4, and 8 μg/mL in 0.9% sodium chloride injection in Excel bags were chemically and physically stable for at least nine days when stored at room temperature (23 °C) without protection from light and when stored in a refrigerator (4 °C) in the dark. Copyright © 2016 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
NCBI nr-aa BLAST: CBRC-HSAP-09-0006 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0006 ref|ZP_00960995.1| pyruvate carboxylase [Roseovarius nubinhibens ...ISM] gb|EAP76566.1| pyruvate carboxylase [Roseovarius nubinhibens ISM] ZP_00960995.1 1.2 28% ...
“Pesting”-like oxidation phenomenon of p-type filled skutterudite Ce{sub 0.9}Fe{sub 3}CoSb{sub 12}

Energy Technology Data Exchange (ETDEWEB)

Qiu, Pengfei [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Xia, Xugui; Huang, Xiangyang; Gu, Ming [CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Qiu, Yuting [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Chen, Lidong, E-mail: chenlidong@mail.sic.ac.cn [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China)

2014-11-05

Highlights: • Ce{sub 0.9}Fe{sub 3}Co{sub 1}Sb{sub 12} exhibits “pesting”-like oxidation phenomenon at high temperature. • The highest oxidation rate of Ce{sub 0.9}Fe{sub 3}Co{sub 1}Sb{sub 12} appears around 800 K. • Severe periodically oxide layer peeling-off behavior is observed around 800 K. • The co-existence of Fe and Co is responsible for the poor oxidation resistance. - Abstract: Oxidation behavior of p-type filled skutterudite Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} in air was investigated and the oxidation mechanism was discussed in this study. Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} exhibits interesting “pesting”-like oxidation phenomenon around 800 K. The bulk sample completely disintegrates into a crowd of plate-like particles under this temperature range after only 24 h exposure in air. However, this abnormal oxidation phenomenon is not observed at temperature below 750 K or above 850 K. This result is consistent with the thermogravimetry and derivative thermogravimetry measurements which show that the oxidation rate for Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} around 800 K is the highest among 650–900 K. Microstructure observations suggest that this “pesting”-like oxidation is related with the severe periodically oxide layer peeling-off behavior around 800 K, which makes the Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} samples are easy to be oxidized because the fresh substrate surface is always exposed to high concentration oxygen atmosphere. X-ray diffraction and X-ray photoelectron spectroscopy measurements indicated that in the oxide scale the direct contact of Fe{sup 3+}-oxide and CoSb{sub 2}O{sub 4} which possess different formation/growth rate and volume expansion coefficient should be responsible for this peculiar oxide layer peeling-off behavior around 800 K. This work can serve as an important reference for the designation of M{sub y}Fe{sub 4−x}Co{sub x}Sb{sub 12}-based skutterudite thermoelectric device.
Thulium pumped mid-infrared 0.9–9μm supercontinuum generation in concatenated fluoride and chalcogenide glass fibers

DEFF Research Database (Denmark)

Kubat, Irnis; Petersen, Christian Rosenberg; Møller, Uffe Visbech

2014-01-01

of ZBLAN spanning the 0.9–4.1μm SC at the −30dB level. The ZBLAN fiber SC is then coupled into 10cm of As2Se3 chalcogenide Microstructured Optical Fiber (MOF) designed to have a zero-dispersion wavelength (λZDW) significantly below the 4.1μm InfraRed (IR) edge of the ZBLAN fiber SC, here 3.55μm...

NCBI nr-aa BLAST: CBRC-GACU-09-0002 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0002 ref|YP_594114.1| amidohydrolase [Deinococcus geothermalis DSM 113...00] gb|ABF44040.1| amidohydrolase [Deinococcus geothermalis DSM 11300] YP_594114.1 5.5 28% ...
Properties of slag concrete for low-level waste containment

International Nuclear Information System (INIS)

Langton, C.A.; Wong, P.B.

1991-01-01

Ground granulated blast furnace slag was incorporated in the concrete mix used for construction of low-level radioactive waste disposal vaults. The vaults were constructed as six 100 x 100 x 25 ft cells with each cell sharing internal walls with the two adjacent cells. The vaults were designed to contain a low-level radioactive wasteform called saltstone and to isolate the saltstone from the environment until the landfill is closed. Closure involves backfilling with native soil, installation of clay cap, and run-off control. The design criteria for the slag-substituted concrete included compressive strength, 4000 psi after 28 days; slump, 6 inch; permeability, less than 10 -7 cm/sec; and effective nitrate, chromium and technetium diffusivities of 10 -8 , 10 -12 and 10 -12 cm 2 /sec, respectively. The reducing capacity of the slag resulted in chemically reducing Cr +6 to Cr +3 and Tc +7 to Tc +4 and subsequent precipitation of the respective hydroxides in the alkaline pore solution. Consequently, the concrete vault enhances containment of otherwise mobile waste ions and contributes to the overall protection of the groundwater at the disposal site
Comparative Effects of Biochar, Slag and Ferrous-Mn Ore on Lead and Cadmium Immobilization in Soil.

Science.gov (United States)

Mehmood, Sajid; Rizwan, Muhammad; Bashir, Saqib; Ditta, Allah; Aziz, Omar; Yong, Li Zhe; Dai, Zhihua; Akmal, Muhammad; Ahmed, Waqas; Adeel, Muhammad; Imtiaz, Muhammad; Tu, Shuxin

2018-02-01

A variety of remediation approaches have been applied to the heavy metals-contaminated soils, however, the immobilization of metals in co-contaminated soils still not cleared. Therefore, an incubation study was conducted to evaluate the instantaneous effects of different concentrations of biochar (BC), slag (SL) and Fe-Mn ore (FMO) on immobilization of Pb and Cd through the Toxicity Characteristic Leaching Procedure (TCLP) by following the the European Community Bureau of Reference (BCR), CaCl 2 and NH 4 NO 3 . The sequential extraction of BCR showed decrease in acid soluble fractions, while the residual proportions of Pb and Cd were enhanced with increasing concentrations of SL and BC. Addition of BC significantly lowered the extractable fractions of both metals by TCLP, NH 4 NO 3 and CaCl 2 as compared to SL and FMO. Among all amendments, BC incorporation into co-contaminated soil offered promising results for Pb and Cd immobilization. Overall, all amendments showed positive and long-term impact on the reclamation of co-contaminated soil with heavy metals and could deserve advance monitoring studies on a field scale.
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001564659.1| dynein heavy chain, putative [Leishmania brazil...iensis] emb|CAM38725.1| dynein heavy chain, putative [Leishmania braziliensis] XP_001564659.1 7.8 31% ...
Registration of ‘CP 09-1822’ Sugarcane

Science.gov (United States)

‘CP 09-1822’ (Reg. No. __; PI 686942 sugarcane (a complex hybrid of Saccharum spp.) was released in June 2016 for commercial cultivation on sand (mineral) soils in Florida. This cultivar was developed through a collaborative sugarcane cultivar development program of the USDA-ARS, the University of F...
NCBI nr-aa BLAST: CBRC-RMAC-09-0022 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RMAC-09-0022 ref|YP_026083.1| NADH dehydrogenase subunit 2 [Steinernema carpoc...apsae] gb|AAT00526.1| NADH dehydrogenase subunit 2 [Steinernema carpocapsae] YP_026083.1 1e-05 30% ...
Development of an accelerated leaching method for incineration bottom ash correlated to toxicity characteristic leaching protocol.

Science.gov (United States)

Lin, Shengxuan; Zhou, Xuedong; Ge, Liya; Ng, Sum Huan; Zhou, Xiaodong; Chang, Victor Wei-Chung

2016-10-01

Heavy metals and some metalloids are the most significant inorganic contaminants specified in toxicity characteristic leaching procedure (TCLP) in determining the safety of landfills or further utilization. As a consequence, a great deal of efforts had been made on the development of miniaturized analytical devices, such as Microchip Electrophoresis (ME) and μTAS for on-site testing of heavy metals and metalloids to prevent spreading of those pollutants or decrease the reutilization period of waste materials such as incineration bottom ash. However, the bottleneck lied in the long and tedious conventional TCLP that requires 18 h of leaching. Without accelerating the TCLP process, the on-site testing of the waste material leachates was impossible. In this study, therefore, a new accelerated leaching method (ALM) combining ultrasonic assisted leaching with tumbling was developed to reduce the total leaching time from 18 h to 30 min. After leaching, the concentrations of heavy metals and metalloids were determined with ICP-MS or ICP-optical emission spectroscopy. No statistical significance between ALM and TCLP was observed for most heavy metals (i.e., cobalt, manganese, mercury, molybdenum, nickel, silver, strontium, and tin) and metalloids (i.e., arsenic and selenium). For the heavy metals with statistical significance, correlation factors derived between ALM and TCLP were 0.56, 0.20, 0.037, and 0.019 for barium, cadmium, chromium, and lead, respectively. Combined with appropriate analytical techniques (e.g., ME), the ALM can be applied to rapidly prepare the incineration bottom ash samples as well as other environmental samples for on-site determination of heavy metals and metalloids. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Recent trends in television tip over-related injuries among children aged 0-9 years.

Science.gov (United States)

Murray, K J; Griffin, R; Rue, L W; McGwin, G

2009-08-01

To describe recent trends in television tip over-related injuries among children aged 0-9 years, and to compare injury rates with sales of newer digital televisions. Digital television sales data were obtained from marketing data provided by the Television Bureau of Advertising. Data regarding television tip over-related injuries among children aged 0-9 years were obtained from the 1998-2007 National Electronic Injury Surveillance System. A Wald chi(2) test, estimated from logistic analysis, was used to determine whether the distribution of injury types differed by age group. Pearson's correlation was used to estimate the association between digital television sales and television tip over-related injuries. An estimated 42 122 (95% CI 35 199 to 49 122) injuries from television tip-overs were treated in US emergency departments from 1998 to 2007. The injury rate was highest for children aged 1-4 years (18.6/100 000). A majority of injuries (63.9%) involved the head and neck for children under 1 year of age, while a higher proportion of injuries among children aged 1-4 involved the hip and lower extremity (42.9% and 31.0%, respectively), and shoulder and upper extremity (16.8%) for children aged 5-9. A strong, positive correlation was observed between television sales and annual injury rates (r = 0.89, pdigital television sales were strongly correlated with increased injury rates, the lack of information regarding the type of television involved prevents inference regarding causation.
Ratio dependence of the visible light photocatalytic efficiency for Zn{sub 2}Ti{sub 0.9}Cr{sub y}Fe{sub [0.1-y]}O{sub 4}: Cr/Fe (0.02 < y < 0.08) photocatalyst synthesized by using a solid state reaction method

Energy Technology Data Exchange (ETDEWEB)

Borse, P. H. [International Advanced Research Center for Powder Metallurgy and New Materials, Hyderabad (India); Cho, C. R. [Pusan National University, Miryang (Korea, Republic of); Lim, K. T. [Pukyong National University, Busan (Korea, Republic of); Lee, Y. J.; Bae, J. S.; Jeong, E. D.; Kim, H. G. [Korea Basic Science Institute, Busan (Korea, Republic of)

2011-07-15

We synthesized four different photocatalyst systems of Zn{sub 2}TiO{sub 4}, Zn{sub 2}Ti{sub 1-x}Fe{sub x}O{sub 4}, Zn{sub 2}Ti{sub 1-x}Cr{sub x}O{sub 4} (0 {<=} x < 0.8) and Zn{sub 2}Ti{sub 0.9}Cr{sub y}Fe{sub [0.1]-y}O{sub 4} (0.02 < y < 0.08) by using a solid state reaction method. For the first time, the UV-active photocatalyst Zn{sub 2}TiO{sub 4} was converted to a visible light active material by controlled doping/co-doping with Cr and Fe metal-ions at Ti substitutional sites, and investigated the structural, optical and photocatalytic water decomposition properties of that materials. The co-doping induces strong absorption bands (at {lambda} {approx} 480 nm and {lambda} {approx} 620 nm) within the Zn{sub 2}TiO{sub 4} band gap. The optimum system of Zn{sub 2}Ti{sub 0.9}Cr{sub 0.05}Fe{sub 0.05}O{sub 4} yielded maximum H{sub 2} generation. In contrast to the visible light inactivity of Fe- and Cr-doped Zn{sub 2}TiO{sub 4}, the H{sub 2} production from co-doped samples under visible light irradiation increased till the optimum 'y' value. Consequently, here exists an optimal co-dopant concentration for efficient photocatalytic hydrogen production under visible light ({lambda} {>=} 420 nm).
Phase-inversion tape-casting preparation and significant performance enhancement of Ce0.9Gd0.1O1.95- La0.6Sr0.4Co0.2Fe0.8O3-δ dual-phase asymmetric membrane for oxygen separation

DEFF Research Database (Denmark)

Huang, Hua; Cheng, Shiyang; Gao, Jianfeng

2014-01-01

The dual-phase Ce0.9Gd0.1O1.95–La0.6Sr0.4Co0.2Fe0.8O3−δ asymmetric membrane was prepared via a phase-inversion tape-casting method. The membrane consisted of a thicker porous support layer and a thinner dense layer. When the dense side of the membrane was coated with a La0.6Sr0.4CoO3−δ catalytic...
Registration of ‘CP 09-1430’ Sugarcane

Science.gov (United States)

‘CP 09-1430’ (Reg. No. ; PI 686940 sugarcane (a complex hybrid of Saccharum spp.) was developed and released (6 Jun. 2016) through cooperative research conducted by the USDA-ARS Sugarcane Field Station , Canal Point, the University of Florida, and the Florida Sugar Cane League, Inc. for use on ...
Ab initio investigation of isomerism, structure and stability of dimer molecules of Beryllate salts (LiBeH3)2, (LiBeF3)2 and their fragments

International Nuclear Information System (INIS)

Charkin, O.P.; Klimenko, N.M.; MakKi, M.L.

2000-01-01

In the framework of correlated approximation method QCI-SD(T)/6-31(+)G** + ZPE(MP2/6-31G*) and MP2/6-31(+)G* + ZPE(HF/6-31G*) ab initio calculations of surfaces and potential energy in the surroundings of key structures of not rigid dimer molecules of beryllate and fluoroberyllate complex salts (LiBeX 3 ) 2 , binuclear anions Be 2 X 5 - , dianions Be 2 X 6 2- and molecules Be 2 X 4 (X=H, F) are done. Equilibrium geometrical parameters of isomers, frequencies and relative IR intensities of normal vibrations, their relative energies and decomposition energies are determined. Similarity and differences of hydrides and fluorides, deformation and polarization of anions under cation effect in the case of their different mutual orientation are analyzed [ru
Res Sep 2014 Cover Tp 08.09.14.cdr

Indian Academy of Sciences (India)

Admin

2010). ISSN 0971-8044. Regn No.KRNAVBGE-340/2012-2014. Licenced to Post without prepayment No.6. Posted at MBC, GPO, Bangalore 560 001, 12.09.14. Registered with Registrar of Newspapers in India vide Regn. No. 66273/96.
NCBI nr-aa BLAST: CBRC-PTRO-09-0001 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PTRO-09-0001 ref|ZP_01444684.1| hypothetical protein R2601_22801 [Roseovarius ...sp. HTCC2601] gb|EAU45065.1| hypothetical protein R2601_22801 [Roseovarius sp. HTCC2601] ZP_01444684.1 0.32 34% ...
Charged particle multiplicities in pp interactions at sqrt(s) = 0.9, 2.36, and 7 TeV

Energy Technology Data Exchange (ETDEWEB)

Khachatryan, V. [Yerevan Physics Institute (Aremenia); et al.,

2011-01-01

Measurements of primary charged hadron multiplicity distributions are presented for non-single-diffractive events in proton-proton collisions at centre-of-mass energies of sqrt(s) = 0.9, 2.36, and 7 TeV, in five pseudorapidity ranges from |eta|<0.5 to |eta|<2.4. The data were collected with the minimum-bias trigger of the CMS experiment during the LHC commissioning runs in 2009 and the 7 TeV run in 2010. The multiplicity distribution at sqrt(s) = 0.9 TeV is in agreement with previous measurements. At higher energies the increase of the mean multiplicity with sqrt(s) is underestimated by most event generators. The average transverse momentum as a function of the multiplicity is also presented. The measurement of higher-order moments of the multiplicity distribution confirms the violation of Koba-Nielsen-Olesen scaling that has been observed at lower energies.
Charged particle multiplicities in pp interactions at $\\sqrt{s}$ = 0.9, 2.36, and 7 TeV

CERN Document Server

Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hartl, Christian; Hoch, Michael; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Kiesenhofer, Wolfgang; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; Ceard, Ludivine; Cerny, Karel; De Wolf, Eddi A.; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Devroede, Olivier; Kalogeropoulos, Alexis; Maes, Joris; Maes, Michael; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Hreus, Tomas; Marage, Pierre Edouard; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Costantini, Silvia; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Zaganidis, Nicolas; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Grégoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Ovyn, Severine; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Quertenmont, Loic; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Alves, Gilvan; De Jesus Damiao, Dilson; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Carvalho, Wagner; Da Costa, Eliza Melo; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Nogima, Helio; Oguri, Vitor; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; Torres Da Silva De Araujo, Felipe; De Almeida Dias, Flavia; Ferreira Dias, Marco Andre; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Tcholakov, Vanio; Trayanov, Rumen; Vankov, Ivan; Dyulendarova, Milena; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Marinova, Evelina; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Wang, Jian; Wang, Jian; Wang, Xianyou; Wang, Zheng; Yang, Min; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Li, Wenbo; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhu, Bo; Cabrera, Andrés; Gomez Moreno, Bernardo; Ocampo Rios, Alberto Andres; Osorio Oliveros, Andres Felipe; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Fereos, Reginos; Galanti, Mario; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A.; Rykaczewski, Hans; Assran, Yasser; Mahmoud, Mohammed; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Müntel, Mait; Raidal, Martti; Rebane, Liis; Azzolini, Virginia; Eerola, Paula; Czellar, Sandor; Härkönen, Jaakko; Heikkinen, Mika Aatos; Karimäki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, François-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, André; Shreyber, Irina; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Beaudette, Florian; Bianchini, Lorenzo; Bluj, Michal; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dobrzynski, Ludwik; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Ochando, Christophe; Paganini, Pascal; Porteboeuf, Sarah; Sabes, David; Salerno, Roberto; Sirois, Yves; Thiebaux, Christophe; Wyslouch, Bolek; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Ferro, Cristina; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Karim, Mehdi; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Van Hove, Pierre; Fassi, Farida; Mercier, Damien; Baty, Clement; Beaupere, Nicolas; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Falkiewicz, Anna; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sordini, Viola; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Roinishvili, Vladimir; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Ata, Metin; Bender, Walter; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Klimkovich, Tatsiana; Klingebiel, Dennis; Kreuzer, Peter; Lanske, Dankfried; Magass, Carsten; Masetti, Gianni; Merschmeyer, Markus; Meyer, Arnd; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flügge, Günter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Rennefeld, Jörg; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrenhoff, Wolf; Behrens, Ulf; Bergholz, Matthias; Borras, Kerstin; Cakir, Altan; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Eckstein, Doris; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Olzem, Jan; Parenti, Andrea; Raspereza, Alexei; Raval, Amita; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Tomaszewska, Justyna; Volyanskyy, Dmytro; Walsh, Roberval; Wissing, Christoph; Autermann, Christian; Bobrovskyi, Sergei; Draeger, Jula; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Pietsch, Niklas; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schröder, Matthias; Schum, Torben; Schwandt, Joern; Srivastava, Ajay Kumar; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Wolf, Roger; Bauer, Julia; Buege, Volker; Chwalek, Thorsten; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heindl, Stefan Michael; Heinrich, Michael; Held, Hauke; Hoffmann, Karl-Heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Müller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Renz, Manuel; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Troendle, Daniel; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Manolakos, Ioannis; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Petrakou, Eleni; Gouskos, Loukas; Mertzimekis, Theodoros; Panagiotou, Apostolos; Evangelou, Ioannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Patras, Vaios; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Suggisetti, Praveenkumar; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Hashemi, Majid; Jafari, Abideh; Khakzad, Mohsen; Mohammadi, Abdollah; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fedele, Francesca; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pierro, Giuseppe Antonio; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Trentadue, Raffaello; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; Cerati, Giuseppe Benedetto; De Guio, Federico; Di Matteo, Leonardo; Ghezzi, Alessio; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Massironi, Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Buontempo, Salvatore; Carrillo Montoya, Camilo Andres; Cimmino, Anna; De Cosa, Annapaola; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Merola, Mario; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Biasotto, Massimo; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Conti, Enrico; De Mattia, Marco; Dorigo, Tommaso; Fanzago, Federica; Gasparini, Fabrizio; Giubilato, Piero; Gresele, Ambra; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Nespolo, Massimo; Perrozzi, Luca; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Zumerle, Gianni; Baesso, Paolo; Berzano, Umberto; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fanò, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Taroni, Silvia; Valdata, Marisa; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Montanino, Damiana; Penzo, Aldo; Heo, Seong Gu; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Park, Hyangkyu; Son, Dohhee; Son, Dong-Chul; Kim, Jaeho; Kim, Jae Yool; Song, Sanghyeon; Choi, Suyong; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Ji Hyun; Kim, Tae Jeong; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Seo, Eunsung; Shin, Seungsu; Sim, Kwang Souk; Choi, Minkyoo; Kang, Seokon; Kim, Hyunyong; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Bilinskas, Mykolas Jurgis; Grigelionis, Ignas; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla Valdez, Heriberto; De La Cruz Burelo, Eduard; Lopez-Fernandez, Ricardo; Sánchez Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A.; Allfrey, Philip; Krofcheck, David; Tam, Jason; Butler, Philip H.; Doesburg, Robert; Silverwood, Hamish; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Sá Martins, Pedro; Musella, Pasquale; Nayak, Aruna; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wöhri, Hermine Katharina; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger Jr., Michael; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoli; Bondar, Nikolai; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Lychkovskaya, Natalia; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Snigirev, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Grishin, Viatcheslav; Kachanov, Vassili; Konstantinov, Dmitri; Korablev, Andrey; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Puerta Pelayo, Jesus; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; Codispoti, Giuseppe; de Trocóniz, Jorge F; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Vizan Garcia, Jesus Manuel; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chamizo Llatas, Maria; Chuang, Shan-Huei; Duarte Campderros, Jordi; Felcini, Marta; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Gonzalez Suarez, Rebeca; Jorda, Clara; Lobelle Pardo, Patricia; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz Jimeno, Alberto; Scodellaro, Luca; Sobron Sanudo, Mar; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bell, Alan James; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bocci, Andrea; Bolognesi, Sara; Breuker, Horst; Brona, Grzegorz; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Covarelli, Roberto; Curé, Benoît; D'Enterria, David; Dahms, Torsten; De Roeck, Albert; Duarte Ramos, Fernando; Elliott-Peisert, Anna; Funk, Wolfgang; Gaddi, Andrea; Gennai, Simone; Georgiou, Georgios; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gomez-Reino Garrido, Robert; Gouzevitch, Maxime; Govoni, Pietro; Gowdy, Stephen; Guiducci, Luigi; Hansen, Magnus; Harvey, John; Hegeman, Jeroen; Hegner, Benedikt; Henderson, Conor; Hoffmann, Hans Falk; Honma, Alan; Innocente, Vincenzo; Janot, Patrick; Karavakis, Edward; Lecoq, Paul; Leonidopoulos, Christos; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mozer, Matthias Ulrich; Mulders, Martijn; Nesvold, Erik; Nguyen, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Polese, Giovanni; Racz, Attila; Rolandi, Gigi; Rommerskirchen, Tanja; Rovelli, Chiara; Rovere, Marco; Sakulin, Hannes; Schäfer, Christoph; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stöckli, Fabian; Stoye, Markus; Tropea, Paola; Tsirou, Andromachi; Tsyganov, Andrey; Veres, Gabor Istvan; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Bortignon, Pierluigi; Caminada, Lea; Chen, Zhiling; Cittolin, Sergio; Dissertori, Günther; Dittmar, Michael; Eugster, Jürg; Freudenreich, Klaus; Grab, Christoph; Hervé, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Martinez Ruiz del Arbol, Pablo; Meridiani, Paolo; Milenovic, Predrag; Moortgat, Filip; Nef, Pascal; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Sala, Leonardo; Sanchez, Ann - Karin; Sawley, Marie-Christine; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Aguiló, Ernest; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Favaro, Carlotta; Ivova Rikova, Mirena; Millan Mejias, Barbara; Regenfus, Christian; Robmann, Peter; Schmidt, Alexander; Snoek, Hella; Wilke, Lotte; Chang, Yuan-Hann; Chen, Kuan-Hsin; Chen, Wan-Ting; Dutta, Suchandra; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Liu, Zong-kai; Lu, Yun-Ju; Wu, Jing-Han; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gökbulut, Gül; Güler, Yalcin; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karaman, Turker; Kayis Topaksu, Aysel; Nart, Alisah; Önengüt, Gülsen; Ozdemir, Kadri; Ozturk, Sertac; Polatöz, Ayse; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Zorbilmez, Caglar; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yildirim, Eda; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gülmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Özbek, Melih; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Clement, Emyr; Cussans, David; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Hansen, Maria; Hartley, Dominic; Heath, Greg P.; Heath, Helen F.; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Poll, Anthony; Senkin, Sergey; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Belyaev, Alexander; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Cutajar, Michael; Davies, Gavin; Della Negra, Michel; Fulcher, Jonathan; Futyan, David; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Martin, William; Reid, Ivan; Teodorescu, Liliana; Hatakeyama, Kenichi; Bose, Tulika; Carrera Jarrin, Edgar; Clough, Andrew; Fantasia, Cory; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; Sulak, Lawrence; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Esen, Selda; Ferapontov, Alexey; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Segala, Michael; Speer, Thomas; Tsang, Ka Vang; Borgia, Maria Assunta; Breedon, Richard; Calderon De La Barca Sanchez, Manuel; Cebra, Daniel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Schwarz, Thomas; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Deisher, Amanda; Duris, Joseph; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Plager, Charles; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Giordano, Ferdinando; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Pasztor, Gabriella; Satpathy, Asish; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tu, Yanjun; Vartak, Adish; Würthwein, Frank; Yagil, Avraham; Barge, Derek; Bellan, Riccardo; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Geffert, Paul; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lowette, Steven; Mccoll, Nickolas; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Gataullin, Marat; Kcira, Dorian; Litvine, Vladimir; Ma, Yousi; Mott, Alexander; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Traczyk, Piotr; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Jun, Soon Yung; Liu, Yueh-Feng; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Edelmaier, Christopher; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Fields, Laura Johanna; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Kuznetsov, Valentin; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Puigh, Darren; Riley, Daniel; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Vaughan, Jennifer; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Green, Dan; Gunthoti, Kranti; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; Hirschauer, James; Hooberman, Benjamin; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Khatiwada, Rakshya; Kilminster, Benjamin; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Limon, Peter; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Pordes, Ruth; Prokofyev, Oleg; Saoulidou, Niki; Sexton-Kennedy, Elizabeth; Sharma, Seema; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Goldberg, Sean; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Muniz, Lana; Pakhotin, Yuriy; Prescott, Craig; Remington, Ronald; Schmitt, Michael; Scurlock, Bobby; Sellers, Paul; Skhirtladze, Nikoloz; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bandurin, Dmitry; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Gleyzer, Sergei V; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Sekmen, Sezen; Veeraraghavan, Venkatesh; Baarmand, Marc M.; Dorney, Brian; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bai, Yuting; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Lacroix, Florent; O'Brien, Christine; Silvestre, Catherine; Smoron, Agata; Strom, Derek; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Noonan, Daniel; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bolton, Tim; Chakaberia, Irakli; Ivanov, Andrew; Makouski, Mikhail; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Lu, Ying; Mignerey, Alice; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; Dutta, Valentina; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristan Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Xie, Si; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Godshalk, Andrew; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Smith, Kenneth; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Chasco, Matthew; Kaadze, Ketino; Reucroft, Steve; Swain, John; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Kubik, Andrew; Odell, Nathaniel; Ofierzynski, Radoslaw Adrian; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Hill, Christopher; Killewald, Phillip; Kotov, Khristian; Ling, Ta-Yung; Rodenburg, Marissa; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hebda, Philip; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatserklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Potamianos, Karolos; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Boulahouache, Chaouki; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Morales, Jafet; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Flacher, Henning; Garcia-Bellido, Aran; Goldenzweig, Pablo; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Barker, Anthony; Duggan, Daniel; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Hits, Dmitry; Lath, Amitabh; Panwalkar, Shruti; Patel, Rishi; Richards, Alan; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Nguyen, Chi Nhan; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Tatarinov, Aysen; Toback, David; Weinberger, Michael; Akchurin, Nural; Bardak, Cemile; Damgov, Jordan; Jeong, Chiyoung; Kovitanggoon, Kittikul; Lee, Sung Won; Mane, Poonam; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Appelt, Eric; Brownson, Eric; Engh, Daniel; Florez, Carlos; Gabella, William; Johns, Willard; Kurt, Pelin; Maguire, Charles; Melo, Andrew; Sheldon, Paul; Velkovska, Julia; Arenton, Michael Wayne; Balazs, Michael; Boutle, Sarah; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Francis, Brian; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Mattson, Mark; Milstène, Caroline; Sakharov, Alexandre; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Lomidze, David; Loveless, Richard; Mohapatra, Ajit; Parker, William; Reeder, Don; Ross, Ian; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc

2011-01-01

Measurements of primary charged hadron multiplicity distributions are presented for non-single-diffractive events in proton-proton collisions at centre-of-mass energies of sqrt(s) = 0.9, 2.36, and 7 TeV, in five pseudorapidity ranges from |eta|<0.5 to |eta|<2.4. The data were collected with the minimum-bias trigger of the CMS experiment during the LHC commissioning runs in 2009 and the 7 TeV run in 2010. The multiplicity distribution at sqrt(s) = 0.9 TeV is in agreement with previous measurements. At higher energies the increase of the mean multiplicity with sqrt(s) is underestimated by most event generators. The average transverse momentum as a function of the multiplicity is also presented. The measurement of higher-order moments of the multiplicity distribution confirms the violation of Koba-Nielsen-Olesen scaling that has been observed at lower energies.
Long-term stability of FeSO{sub 4} and H{sub 2}SO{sub 4} treated chromite ore processing residue (COPR): Importance of H{sup +} and SO{sub 4}{sup 2−}

Energy Technology Data Exchange (ETDEWEB)

Wang, Xin [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Zhang, Jingdong [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Wang, Linling, E-mail: wanglinling@mail.hust.edu.cn [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Chen, Jing, E-mail: chenjing@mail.hust.edu.cn [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Hou, Huijie; Yang, Jiakuan [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Lu, Xiaohua [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)

2017-01-05

Highlights: • The long-term stability of the FeSO{sub 4}-H{sub 2}SO{sub 4} treated COPR was evaluated. • Reliable long-term stability for samples curing 400 days was achieved. • H{sub 2}SO{sub 4} significantly enhanced the stabilization efficiency of COPR using FeSO{sub 4}. • H{sup +} and SO{sub 4}{sup 2−} both reinforced Cr(VI) release from COPR core to react with Fe(II). - Abstract: In this study, the long-term stability of Cr(VI) in the FeSO{sub 4} and H{sub 2}SO{sub 4} (FeSO{sub 4}-H{sub 2}SO{sub 4}) treated chromite ore processing residue (COPR) after 400 curing days and the stabilization mechanisms were investigated. FeSO{sub 4}-H{sub 2}SO{sub 4} treatment significantly reduced toxicity characteristic leaching procedure (TCLP) and synthetic precipitation leaching procedure (SPLP) Cr(VI) concentrations to lower than the regulatory limit of 1.5 mg L{sup −1} (HJ/T 301-2007, China EPA) even for the samples curing 400 days, achieving an outstanding long-term stability. Our independent leaching tests revealed that H{sup +} and SO{sub 4}{sup 2−} have synergistic effect on promoting the release of Cr(VI), which would make Cr(VI) easier accessed by Fe(II) during stabilization. The contributions of H{sup +} and SO{sub 4}{sup 2−} to Cr(VI) release ratio were 25%–44% and 19%–38%, respectively, as 5 mol H{sub 2}SO{sub 4} per kg COPR was used. X-ray powder diffraction (XRD), X-ray photoelectron spectroscopy (XPS) and alkaline digestion analyses were also employed to interpret the possible stabilization mechanism. Cr(VI) released from COPR solid was reduced to Cr(III) by Fe(II), and then formed stable Fe{sub x}Cr{sub (1−x)}(OH){sub 3} precipitate. This study provides a facile and reliable scheme for COPR stabilization, and verifies the excellent long-term stability of the FeSO{sub 4}-H{sub 2}SO{sub 4} treated COPR.
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 ref|NP_001017377.1| progestin and adipoQ receptor family member I...V [Rattus norvegicus] gb|AAH92635.1| Progestin and adipoQ receptor family member IV [Rattus norvegicus] gb|EDM03772.1| progesti
Produksi Panel Dinding Bangunan Tahan Gempa dan Ramah Lingkungan dari Limbah Bahan Berbahaya dan Beracun Industri Minyak dan Gas

Directory of Open Access Journals (Sweden)

Luqman Hakim

2015-10-01

Full Text Available Berdasarkan hasil uji karakteristik fisik terhadap panel dinding dari komposit limbah industry migas berupa activated alumina, sandblasting dan glasswall yang telah dilakukan pada tahun pertama diketahui bahwa kuat lentur tertinggi diperoleh dari sampel B4 yaitu sebesar 67,8 Kg/Cm2 dengan standar DIN 1101 17 Kg/cm2, kuat desak sampel B 2 68,31 N/mm2 dengan standar bata merah 25 N/mm2 dan batako 20 N/mm2 dan tingkat keausan terendah diperoleh dari sampel 37 streap. Dari hasil tersebut diketahui bahwa uji telah memiliki kemampuan lebih tinggi jika dibandingkan dengan standar yang berlaku. Maka pada penelitian lanjutan yang akan dilakukan bertujuan untuk mempelajari apakah produk panel dinding ini ramah lingkungan sehingga aman bagi kesehatan manusia dan lingkungan sekitarnya.Penelitian dilakukan dengan menggunakan metode uji toxicity characteristic leaching procedure (TCLP dan LC50 terhadap produk panel dinding terbaik. Uji TCLP yang akan dilakukan yaitu dengan cara mendestruksi dan ekstraksi produk panel dinding dengan menggunakan rotating agitator selama 24 jam kemudian diuji dengan menggunakan AAS untuk mengetahui konsentrasi logam berat yang terdapat dalam produl panel dinding. Adapun untuk uji LC50 dilakukan dengan menggunakan hewan uji larva udang atau tikus.Berdasarkan hasil uji TCLP dan LC50 diketahui bahwa: a Kadar kandungan logam berat yang terdapat di dalam wall panel setelah dilakukan uji TCLP ternyata berada dibawah baku mutu seperti yang telah ditetapkan dalam PP No.85 Tahun 1999. Jadi ini artinya produk wall panel dalam penelitian ini ramah lingkungan, b pengujian terhadap bahan baku wall panel, Limbah Activated Alumina, Sandblasting dan Glasswoll sebelum di solidifikasi dapat mematikan sebesar 50% hewan uji pada konsentrasi 116.667 ppm dalam waktu 96 jam, dan c hasil uji LC50 terhadap produk wall panel selama 96 jam tidak menunjukkan adanya kematian hewan uji. Dari hasil penelitian ini dapat disimpulkan bahwa produk wall panel dari
HIV-1 and its gp120 inhibits the influenza A(H1N1)pdm09 life cycle in an IFITM3-dependent fashion.

Science.gov (United States)

Mesquita, Milene; Fintelman-Rodrigues, Natalia; Sacramento, Carolina Q; Abrantes, Juliana L; Costa, Eduardo; Temerozo, Jairo R; Siqueira, Marilda M; Bou-Habib, Dumith Chequer; Souza, Thiago Moreno L

2014-01-01

HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle in vitro. We show here that exposure of A(H1N1)pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1)pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs) to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1)pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA) gene from in vitro experiments and from samples of HIV-1/A(H1N1)pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1)pdm09 co-infected patients during the recent influenza form 2009/2010.

HIV-1 and its gp120 inhibits the influenza A(H1N1pdm09 life cycle in an IFITM3-dependent fashion.

Directory of Open Access Journals (Sweden)

Milene Mesquita

Full Text Available HIV-1-infected patients co-infected with A(H1N1pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1pdm09 life cycle in vitro. We show here that exposure of A(H1N1pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA gene from in vitro experiments and from samples of HIV-1/A(H1N1pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1pdm09 co-infected patients during the recent influenza form 2009/2010.
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0033 ref|YP_001510423.1| hypothetical protein Franean1_6173 [Frankia s...p. EAN1pec] gb|ABW15517.1| hypothetical protein Franean1_6173 [Frankia sp. EAN1pec] YP_001510423.1 0.097 29% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0004 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0004 ref|XP_747491.1| K+ homeostasis protein Kha1, putative [Aspergill...us fumigatus Af293] gb|EAL85453.1| K+ homeostasis protein Kha1, putative [Aspergillus fumigatus Af293] XP_747491.1 0.53 28% ...
NCBI nr-aa BLAST: CBRC-RMAC-09-0031 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RMAC-09-0031 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 0.0 97% ...
NCBI nr-aa BLAST: CBRC-TGUT-09-0014 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TGUT-09-0014 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 1e-144 67% ...
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0017 ref|NP_001025549.1| potassium voltage-gated channel, shaker-relat...ed subfamily, member 3 [Gallus gallus] gb|AAP94028.1| shaker subfamily potassium channel Kv1.3 [Gallus gallus] NP_001025549.1 0.0 83% ...
NCBI nr-aa BLAST: CBRC-PABE-09-0037 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0037 ref|YP_890142.1| hypothetical protein MSMEG_5916 [Mycobacterium sme...gmatis str. MC2 155] gb|ABK71889.1| hypothetical protein MSMEG_5916 [Mycobacterium smegmatis str. MC2 155] YP_890142.1 0.033 36% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...
Estudo histopatológico do efeito do tenoxicam com água bidestilada ou com cloreto de sódio a 0,9% no endotélio venoso de coelhos Estudio histopatológico del efecto del tenoxican con agua bidestilada o con cloreto de sodio a 0,9% en el endotélio venoso de conejos Histopathologic study on the effects of tenoxicam with bidistilled water or with 0.9% sodium chloride in rabbits venous endothelium

Directory of Open Access Journals (Sweden)

Taylor Brandão Schnaider

2002-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Em estudo com células endoteliais de veias umbilicais humanas expostas à indometacina, foi observado aumento da atividade pró-coagulante. Estudo em coelhos comprovou a presença de trombose nas veias auriculares após administração de tenoxicam com seu diluente ou de seu diluente isolado. Não foram encontrados estudos na literatura consultada que tenham avaliado o endotélio venoso após a administração do tenoxicam, em seres humanos. O objetivo desta pesquisa foi avaliar se o tenoxicam com cloreto de sódio a 0,9% (NaCl a 0,9% provoca alterações no endotélio venoso de coelhos, como as observadas quando associado ao seu diluente (água bidestilada. MÉTODO: Noventa coelhos (2.000 - 3.500 g foram distribuídos aleatoriamente em dois grupos: Controle, com administração de NaCl a 0,9%; Experimento, com tenoxicam (20 mg associado à água bidestilada ou ao NaCl a 0,9%. O volume injetado nos dois grupos foi constante de 2 ml. A anestesia foi induzida com maleato de acepromazina, cloridrato de cetamina e cloridrato de xilazina, sendo a punção das veias auriculares caudais direita e esquerda realizada com agulha tipo borboleta 27G. Os animais foram mantidos no biotério por 6 h, 12 h e 24 h, novamente anestesiados e submetidos à eutanásia, sendo então realizada exérese das aurículas em sua base e posterior avaliação microscópica das veias. RESULTADOS: Observou-se trombose no grupo Experimento, numa porcentagem de 19,4% após administração do tenoxicam com água bidestilada e 22,2% após administração do tenoxicam com NaCl a 0,9%. No grupo Controle, em que foi injetado somente NaCl a 0,9%, nenhuma das veias apresentou trombose. CONCLUSÕES: Os resultados encontrados permitem concluir que o tenoxicam, com água bidestilada ou com solução de cloreto de sódio a 0,9%, produziu trombose nas veias em que foi injetado.JUSTIFICATIVA Y OBJETIVOS: En estudio con células endoteliales de venas umbilicales
Undergraduate Education with the WIYN 0.9-m Telescope

Science.gov (United States)

Pilachowski, Catherine A.

2017-01-01

Several models have been explored at Indiana University Bloomington for undergraduate student engagement in astronomy using the WIYN 0.9-m telescope at Kitt Peak. These models include individual student research projects using the telescope, student observations as part of an observational techniques course for majors, and enrichment activities for non-science majors in general education courses. Where possible, we arrange for students to travel to the telescope. More often, we are able to use simple online tools such as Skype and VNC viewers to give students an authentic observing experience. Experiences with the telescope motivate students to learn basic content in astronomy, including the celestial sphere, the electromagnetic spectrum, telescopes and detectors, the variety of astronomical objects, date reduction processes, image analysis, and color image creation and appreciation. The WIYN 0.9-m telescope is an essential tool for our program at all levels of undergraduate education
Leaching Behavior of Selected Trace and Toxic Metals in Coal Fly Ash Samples Collected from Two Thermal Power Plants, India.

Science.gov (United States)

Sandeep, P; Sahu, S K; Kothai, P; Pandit, G G

2016-09-01

Studies on leaching behavior of metals associated with coal fly ash (FA) are of great concern because of possible contamination of the aquatic environment. In the present study, leaching behavior of metals (As, Se, Cr, Pb, V, Zn, etc.) in two different FA samples (FA1 and FA2) was investigated at various pH (2-12), temperatures of leachate solution and using TCLP. At pH 2, the highest leaching was observed for Fe (21.6 and 32.8 µg/g), whereas at pH 12, Arsenic was found to have the highest leaching (1.5 and 2.4 µg/g) in FA1 and FA2. Leachate solution temperature showed a positive effect on the metal's leachability. In TCLP, most of the metal's leachability was observed to be higher than that of batch leaching tests. The present study suggests that, leaching of As and Se from FA samples can moderately affect ground/surface water quality at the study locations.
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...
Mortality, severe acute respiratory infection, and influenza-like illness associated with influenza A(H1N1pdm09 in Argentina, 2009.

Directory of Open Access Journals (Sweden)

Eduardo Azziz-Baumgartner

Full Text Available INTRODUCTION: While there is much information about the burden of influenza A(H1N1pdm09 in North America, little data exist on its burden in South America. METHODS: During April to December 2009, we actively searched for persons with severe acute respiratory infection and influenza-like illness (ILI in three sentinel cities. A proportion of case-patients provided swabs for influenza testing. We estimated the number of case-patients that would have tested positive for influenza by multiplying the number of untested case-patients by the proportion who tested positive. We estimated rates by dividing the estimated number of case-patients by the census population after adjusting for the proportion of case-patients with missing illness onset information and ILI case-patients who visited physicians multiple times for one illness event. RESULTS: We estimated that the influenza A(H1N1pdm09 mortality rate per 100,000 person-years (py ranged from 1.5 among persons aged 5-44 years to 5.6 among persons aged ≥ 65 years. A(H1N1pdm09 hospitalization rates per 100,000 py ranged between 26.9 among children aged <5 years to 41.8 among persons aged ≥ 65 years. Influenza A(H1N1pdm09 ILI rates per 100 py ranged between 1.6 among children aged <5 to 17.1 among persons aged 45-64 years. While 9 (53% of 17 influenza A(H1N1pdm09 decedents with available data had obesity and 7 (17% of 40 had diabetes, less than 4% of surviving influenza A(H1N1pdm09 case-patients had these pre-existing conditions (p ≤ 0.001. CONCLUSION: Influenza A(H1N1pdm09 caused a similar burden of disease in Argentina as in other countries. Such disease burden suggests the potential value of timely influenza vaccinations.
Corrosion of Dental Au-Ag-Cu-Pd Alloys in 0.9 % Sodium Chloride Solution

International Nuclear Information System (INIS)

Chiba, Atsushi; Kusayanagi, Yukiharu

2005-01-01

Two Au-Ag-Cu-Pd dental casting alloys (Au:12% and 20%) used. The test solutions used 0.9 % NaCl solution (isotonic sodium chloride solution), 0.9 % NaCl solution containing 1 % lactic acid, and 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The surface of two samples in three sample solutions was not natural discoloration during one year. The alloy containing 12 % gold was easily alloyed and the composition was uniform comparing with the alloy containing 20 % gold. The rest potentials have not a little effect after three months. The kinds of metals could not definitely from the oxidation and reduction waves of metal on the cyclic voltammograms. The dissolutions of gold and palladium were 12 % Au sample in the 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The pH of solution had an affect on dissolution of copper, and sulfur ion had an affect on dissolution of silver. The copper dissolved amount from 20 % gold sample was about 26 times comparing with that of 12 % gold sample in the 0.9 % solution containing 1 % lactic acid. Corrosion products were silver chloride and copper chloride in NaCl solution, and silver sulfide and copper sulfide in NaCl solution containing Na 2 S
Immobilization of lead in shooting range soils by means of cement, quicklime, and phosphate amendments.

Science.gov (United States)

Cao, Xinde; Dermatas, Dimitris; Xu, Xuanfeng; Shen, Gang

2008-03-01

Lead (Pb) contamination at shooting range sites is increasingly under environmental concern. Controlling Pb leachability from shooting range soil media is an important step to minimize Pb exposure to the surrounding environment. This study investigated stabilization of Pb in shooting range soils treated with cement, quicklime, and phosphate. Two soils were used and collected from two shooting ranges, referred to as SR1 and SR2. The treatment additives were applied to the soils at rates from 2.5% to 10% (w/w). The effectiveness of each treatment was evaluated by Pb (w/w). The effectiveness of each treatment was evaluated by Pb leachability, measured by the Toxicity Characteristic Leaching Procedure (TCLP). The possible mechanisms for Pb immobilization were elucidated using X-ray powder diffraction (XRPD). Cement and quicklime treatments were effective in immobilizing Pb in SR1 soil, with reduction of Pb concentration in TCLP leachate (TCLP-Pb) to be below the U.S. EPA non-hazardous regulatory limit of 5 mg L(-1) at application rates of > or =5% and 28-d incubation. By contrast, cement and quicklime amendments were less effective for Pb stabilization in SR2 soil because the TCLP-Pb levels in the treated soil were still higher than the limit of 5 mg L(-1) at all application rates, although they were significantly reduced in comparison with the untreated soil. Phosphate application was most effective in reducing Pb leach ing in both soils. Even at an application rate as low as 5% and 1-d incubation, phosphate could reduce TCLP-Pb to be below the limit of 5 mg L(-1) in both soils. Immobilization of Pb in the SR1 soil amended with cement and quicklime was attributed to the formation of pozzolanic minerals (e.g., calcium silicate hydrate C-S-H and ettringite) that could encapsulate soil Pb. The pozzolanic reaction was limited in the SR2 soil upon the application of cement and quicklime. Reduction of the TCLP-Pb might result from complexation of Pb on the surface of the
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0017 ref|NP_001079227.1| shaker-like potassium channel subunit Kv1.3B ...[Xenopus laevis] gb|AAK83378.1|AF395810_1 shaker-like potassium channel subunit Kv1.3B [Xenopus laevis] NP_001079227.1 0.0 86% ...
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0033 ref|ZP_01901905.1| hypothetical protein RAZWK3B_08726 [Roseobacte...r sp. AzwK-3b] gb|EDM72321.1| hypothetical protein RAZWK3B_08726 [Roseobacter sp. AzwK-3b] ZP_01901905.1 0.13 31% ...
Oxygen Exchange and Transport in (La0.6Sr0.4)0.98FeO3-d – Ce0.9Gd0.1O1.95 Dual-Phase Composites

DEFF Research Database (Denmark)

Ovtar, Simona; Søgaard, Martin; Norrman, Kion

2018-01-01

The chemical diffusion coefficient and the effective surface exchange coefficient (kex) of dual-phase (La0.6Sr0.4)0.98FeO3-d (LSF) − Ce0.9Gd0.1O1.95 (CGO) composites containing between 30 and 70 vol.% of CGO were determined by electrical conductivity relaxation (ECR) at high oxygen partial...... pressures (10−3 .../s for a 70 vol.% of CGO in the composite at 750°C for a pO2 change from 0.2 to 1.0 atm. The experiments demonstrate that the kex is enhanced due to a synergistic effect between the two phases, and suggest a direct involvement of CGO phase in the oxygen surface exchange reaction. Possible mechanisms...
Synthesis and magnetic properties of LiFePO4 substitution magnesium

Science.gov (United States)

Choi, Hyunkyung; Kim, Min Ji; Hahn, Eun Joo; Kim, Sam Jin; Kim, Chul Sung

2017-06-01

LiFe0.9Mg0.1PO4 sample was prepared by using a solid-state reaction method, and the temperature-dependent magnetic properties of the sample were studied. The X-ray diffraction (XRD) pattern showed an olivine-type orthorhombic structure with space group Pnma based on Rietveld refinement method. The effect of Mg substitution in antiferromagnetic LiFe0.9Mg0.1PO4 was investigated using a vibrating sample magnetometer (VSM) and Mössbauer spectroscopy. The temperature-dependence of the magnetization curves of LiFe0.9Mg0.1PO4 shows abnormal antiferromagnetic behavior with ordering temperature. Sudden changes in both the magnetic hyperfine field (Hhf) and its slope below 15 K suggest that magnetic phase transition associated to the abrupt occurrence of spin-reorientation. The Néel temperature (TN) and spin-reorientation temperature (TS) of LiFe0.9Mg0.1PO4 are lower than those of pure LiFePO4 (TN = 51 K, TS = 23 K). This is due to the Fe-O-Fe superexchange interaction being larger than that of the Fe-O-Mg link. Also, we have confirmed a change in the electric quadrupole splitting (ΔEQ) by the spin-orbit coupling effect and the shape of Mössbauer spectrum has provided the evidence for TS and a strong crystalline field. We have found that Mg ions in LiFe0.9Mg0.1PO4 induce an asymmetric charge density due to the presence of Mg2+ ions at the FeO6 octahedral sites.
Catastrophic dechanneling resonance study of In0.1Ga0.9As/GaAs multilayers

International Nuclear Information System (INIS)

Siddiqui, A.M.; Pathak, A.P.

1998-10-01

Catastrophic Dechanneling Resonance (CDR) has bee used for probing important properties of Strained Layer Superlattices (SLS). We have undertaken a systematic study on strain and strain revealing mechanisms in technologically important SLS using ion channeling methods. Here we present the theoretical calculations on CDR for a 4 He ion beam along the (110) plane in In 0.1 Ga 0.9 As/GaAs superlattice using Moliere potential. CDR is found to have occurred at 1.2 MeV. Also the most regular feature of CDR, the Incident Angle Asymmetry has been observed. (author)

Neutral pion and $\\eta$ meson production in proton-proton collisions at $\\sqrt{s}$=0.9 TeV and $\\sqrt{s}$=7 TeV

CERN Document Server

Abelev, B.; Adamova, D.; Adare, A.M.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Agostinelli, A.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, N.; Masoodi, A.Ahmad; Ahn, S.U.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Molina, R.Alfaro; Alici, A.; Alkin, A.; Almaraz Avina, E.; Alt, T.; Altini, V.; Altinpinar, S.; Altsybeev, I.; Andrei, C.; Andronic, A.; Anguelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshauser, H.; Arbor, N.; Arcelli, S.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Arslandok, M.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bach, M.; Badala, A.; Baek, Y.W.; Bailhache, R.; Bala, R.; Ferroli, R.Baldini; Baldisseri, A.; Baldit, A.; Baltasar Dos Santos Pedrosa, F.; Ban, J.; Baral, R.C.; Barbera, R.; Barile, F.; Barnafoldi, G.G.; Barnby, L.S.; Barret, V.; Bartke, J.; Basile, M.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Beck, H.; Belikov, I.; Bellini, F.; Bellwied, R.; Belmont-Moreno, E.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bergmann, C.; Berzano, D.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, N.; Bianchi, L.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, F.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Boldizsar, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Bortolin, C.; Bose, S.; Bossu, F.; Botje, M.; Bottger, S.; Boyer, B.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broz, M.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Bugaiev, K.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Calvo Villar, E.; Camerini, P.; Canoa Roman, V.; Cara Romeo, G.; Carena, F.; Carena, W.; Carlin Filho, N.; Carminati, F.; Carrillo Montoya, C.A.; Casanova Diaz, A.; Caselle, M.; Castillo Castellanos, J.; Castillo Hernandez, J.F.; Casula, E.A.R.; Catanescu, V.; Cavicchioli, C.; Cepila, J.; Cerello, P.; Chang, B.; Chapeland, S.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chung, S.U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Coccetti, F.; Coffin, J.P.; Colamaria, F.; Colella, D.; Conesa Balbastre, G.; Conesa del Valle, Z.; Constantin, P.; Contin, G.; Contreras, J.G.; Cormier, T.M.; Corrales Morales, Y.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Alaniz, E.Cruz; Cuautle, E.; Cunqueiro, L.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, K.; Das, D.; Dash, A.; Dash, S.; De, S.; De Azevedo Moregula, A.; de Barros, G.O.V.; De Caro, A.; De Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; Delagrange, H.; Del Castillo Sanchez, E.; Deloff, A.; Demanov, V.; De Marco, N.; Denes, E.; De Pasquale, S.; Deppman, A.; Erasmo, G.D.; de Rooij, R.; Di Bari, D.; Dietel, T.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Divia, R.; Djuvsland, O.; Dobrin, A.; Dobrowolski, T.; Dominguez, I.; Donigus, B.; Dordic, O.; Driga, O.; Dubey, A.K.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, M.R.; Dutta Majumdar, A.K.; Elia, D.; Emschermann, D.; Engel, H.; Erdal, H.A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Eyyubova, G.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fearick, R.; Fedunov, A.; Fehlker, D.; Feldkamp, L.; Felea, D.; Feofilov, G.; Fernandez Tellez, A.; Ferretti, A.; Ferretti, R.; Figiel, J.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Finogeev, D.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gagliardi, M.; Gago, A.; Gallio, M.; Gangadharan, D.R.; Ganoti, P.; Garabatos, C.; Garcia-Solis, E.; Garishvili, I.; Gerhard, J.; Germain, M.; Geuna, C.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Gianotti, P.; Girard, M.R.; Giubellino, P.; Gladysz-Dziadus, E.; Glassel, P.; Gomez, R.; Ferreiro, E.G.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Goswami, A.; Gotovac, S.; Grabski, V.; Graczykowski, L.K.; Grajcarek, R.; Grelli, A.; Grigoras, C.; Grigoras, A.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerra Gutierrez, C.; Guerzoni, B.; Guilbaud, M.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Han, B.H.; Hanratty, L.D.; Hansen, A.; Harmanova, Z.; Harris, J.W.; Hartig, M.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heckel, S.T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Huang, M.; Huber, S.; Humanic, T.J.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Incani, E.; Innocenti, P.G.; Innocenti, G.M.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, M.; Ivanov, V.; Ivanov, A.; Ivanytskyi, O.; Jacholkowski, A.; Jacobs, P.M.; Jancurova, L.; Jang, H.J.; Jangal, S.; Janik, R.; Janik, M.A.; Jayarathna, P.H.S.Y.; Jena, S.; Jimenez Bustamante, R.T.; Jirden, L.; Jones, P.G.; Jung, W.; Jung, H.; Jusko, A.; Kaidalov, A.B.; Kakoyan, V.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kanaki, K.; Kang, J.H.; Kaplin, V.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, P.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, J.H.; Kim, D.J.; Kim, D.W.; Kim, J.S.; Kim, M.; Kim, S.H.; Kim, S.; Kim, B.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Kluge, A.; Knichel, M.L.; Koch, K.; Kohler, M.K.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskikh, A.; Korneev, A.; Kottachchi Kankanamge Don, C.; Kour, R.; Kowalski, M.; Kox, S.; Koyithatta Meethaleveedu, G.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Krawutschke, T.; Kretz, M.; Krivda, M.; Krizek, F.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kurashvili, P.; Kurepin, A.B.; Kurepin, A.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; Ladron de Guevara, P.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; La Rocca, P.; Lazzeroni, C.; Lea, R.; Le Bornec, Y.; Lee, S.C.; Lee, K.S.; Lefevre, F.; Lehnert, J.; Leistam, L.; Lenhardt, M.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Liu, L.; Loenne, P.I.; Loggins, V.R.; Loginov, V.; Lohn, S.; Lohner, D.; Loizides, C.; Loo, K.K.; Lopez, X.; Lopez Torres, E.; Lovhoiden, G.; Lu, X.G.; Luettig, P.; Lunardon, M.; Luo, J.; Luparello, G.; Luquin, L.; Luzzi, C.; Ma, R.; Ma, K.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Markert, C.; Martashvili, I.; Martinengo, P.; Martinez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Martynov, Y.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mayer, C.; Mazer, J.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mercado Perez, J.; Meres, M.; Miake, Y.; Michalon, A.; Midori, J.; Milano, L.; Milosevic, J.; Mischke, A.; Mishra, A.N.; Miskowiec, D.; Mitu, C.; Mlynarz, J.; Mohanty, A.K.; Mohanty, B.; Molnar, L.; Montano Zetina, L.; Monteno, M.; Montes, E.; Moon, T.; Morando, M.; Moreira De Godoy, D.A.; Moretto, S.; Morsch, A.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Nattrass, C.; Naumov, N.P.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nicassio, M.; Nielsen, B.S.; Niida, T.; Nikolaev, S.; Nikolic, V.; Nikulin, V.; Nikulin, S.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyanin, A.; Nyatha, A.; Nygaard, C.; Nystrand, J.; Obayashi, H.; Ochirov, A.; Oeschler, H.; Oh, S.K.; Oh, S.; Oleniacz, J.; Oppedisano, C.; Ortiz Velasquez, A.; Ortona, G.; Oskarsson, A.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Passfeld, A.; Pastircak, B.; Patalakha, D.I.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Perales, M.; Pereira De Oliveira Filho, E.; Peresunko, D.; Perez Lara, C.E.; Perez Lezama, E.; Perini, D.; Perrino, D.; Peryt, W.; Pesci, A.; Peskov, V.; Pestov, Y.; Petracek, V.; Petran, M.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Piyarathna, D.B.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta-Lerma, P.L.M.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Pop, A.; Porteboeuf-Houssais, S.; Pospisil, V.; Potukuchi, B.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puchagin, S.; Puddu, G.; Pulvirenti, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Qvigstad, H.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Raniwala, S.; Raniwala, R.; Rasanen, S.S.; Rascanu, B.T.; Rathee, D.; Read, K.F.; Real, J.S.; Redlich, K.; Reichelt, P.; Reicher, M.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rodriguez Cahuantzi, M.; Rohr, D.; Rohrich, D.; Romita, R.; Ronchetti, F.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Roy, P.; Roy, C.; Rubio Montero, A.J.; Rui, R.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahu, P.K.; Saini, J.; Sakaguchi, H.; Sakai, S.; Sakata, D.; Salgado, C.A.; Sambyal, S.; Samsonov, V.; Sanchez Castro, X.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H.R.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Scott, P.A.; Segato, G.; Selyuzhenkov, I.; Senyukov, S.; Seo, J.; Serci, S.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabetai, A.; Shabratova, G.; Shahoyan, R.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddhanta, S.; Siemiarczuk, T.; Silvermyr, D.; Simonetti, G.; Singaraju, R.; Singh, R.; Singha, S.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Sogaard, C.; Soltz, R.; Son, H.; Song, J.; Song, M.; Soos, C.; Soramel, F.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Stan, I.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Steinpreis, M.; Stenlund, E.; Steyn, G.; Stocco, D.; Stolpovskiy, M.; Strabykin, K.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sukhorukov, M.; Sultanov, R.; Sumbera, M.; Susa, T.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Tagridis, C.; Takahashi, J.; J.Tapia Takaki, D.; Tauro, A.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Thomas, J.H.; Thomas, D.; Tieulent, R.; Timmins, A.R.; Tlusty, D.; Toia, A.; Torii, H.; Toscano, L.; Tosello, F.; Traczyk, T.; Truesdale, D.; Trzaska, W.H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T.S.; Ulery, J.; Ullaland, K.; Ulrich, J.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vajzer, M.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van der Kolk, N.; Vande Vyvre, P.; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vechernin, V.; Veldhoen, M.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernekohl, D.C.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, L.; Vinogradov, Y.; Vinogradov, A.; Virgili, T.; Viyogi, Y.P.; Vodopyanov, A.; Voloshin, S.; Voloshin, K.; Volpe, G.; von Haller, B.; Vranic, D.; Ovrebekk, G.; Vrlakova, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, V.; Wan, R.; Wang, Y.; Wang, M.; Wang, D.; Wang, Y.; Watanabe, K.; Wessels, J.P.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilk, A.; Williams, M.C.S.; Windelband, B.; Karampatsos, L.Xaplanteris; Yang, H.; Yang, S.; Yano, S.; Yasnopolskiy, S.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I.K.; Yoon, J.; Yu, W.; Yuan, X.; Yushmanov, I.; Zach, C.; Zampolli, C.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zelnicek, P.; Zgura, I.S.; Zhalov, M.; Zhang, X.; Zhou, F.; Zhou, Y.; Zhou, D.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zinovjev, G.; Zoccarato, Y.; Zynovyev, M.

2013-07-16

The first measurements of the invariant differential cross sections of inclusive $\\pi^0$ and $\\eta$ meson production at mid-rapidity in proton-proton collisions at $\\sqrt{s}=0.9$ TeV and $\\sqrt{s}=7$ TeV are reported. The $\\pi^0$ measurement covers the ranges $0.440.9$ TeV, overestimate those of $\\pi^0$ and $\\eta$ mesons at $\\sqrt{s}=7$ TeV, but agree with the measured $\\eta/\\pi^0$ ratio at $\\sqrt{s}=7$ TeV.
22 CFR 231.09 - No acceleration of Eligible Notes.

Science.gov (United States)

2010-04-01

... Section 231.09 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11... have the right to pay any amounts in respect of the Eligible Notes other than in accordance with the...
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 gb|EAW85442.1| progestin and adipoQ receptor family member IV, is...oform CRA_b [Homo sapiens] gb|EAW85444.1| progestin and adipoQ receptor family member IV, isoform CRA_b [Homo sapiens] EAW85442.1 3e-94 65% ...
XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)

2013-12-25

Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.
33 CFR 88.09 - Temporary exemption from light and shape requirements when operating under bridges.

Science.gov (United States)

2010-07-01

... and shape requirements when operating under bridges. 88.09 Section 88.09 Navigation and Navigable... Temporary exemption from light and shape requirements when operating under bridges. A vessel's navigation lights and shapes may be lowered if necessary to pass under a bridge. ...
Enhanced Performance of Mg0.1Zn0.9O UV Photodetectors Using Photoelectrochemical Treatment and Silica Nanospheres

Directory of Open Access Journals (Sweden)

Hsin-Ying Lee

2014-01-01

Full Text Available The Mg0.1Zn0.9O films were grown using atomic layer deposition (ALD system and applied to metal-semiconductor-metal ultraviolet photodetectors (MSM-UPDs as an active layer. To suppress the dangling bonds on the Mg0.1Zn0.9O surface, the photoelectrochemical (PEC treatment was used to passivate the Mg0.1Zn0.9O surface, which could reduce the dark current of the MSM-UPDs about one order. Beside, to increase more incident light into the Mg0.1Zn0.9O active layer of the MSM-UPDs, the 500-nm-diameter silica nanospheres were spin-coated on the Mg0.1Zn0.9O active layer to improve the antireflection capability at the wavelength of 340 nm. The reflectivity of the Mg0.1Zn0.9O films with silica nanospheres antireflection layer decreased about 7.0% in comparison with the Mg0.1Zn0.9O films without silica nanospheres. The photocurrent and UV-visible ratio of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were enhanced to 5.85 μA and 1.44×104, respectively, at the bias voltage of 5 V. Moreover, the noise equivalent power and the specific detectivity of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were decreased to 2.60×10-13 W and increased to 1.21×1012 cmHz1/2W−1, respectively, at the bias voltage of 5 V. According to the above mentions, the PEC treatment and silica nanospheres antireflection layer could effectively enhance the performance of Mg0.1Zn0.9O MSM-UPDs.
ATLAS Monte Carlo tunes for MC09

CERN Document Server

The ATLAS collaboration

2010-01-01

This note describes the ATLAS tunes of underlying event and minimum bias description for the main Monte Carlo generators used in the MC09 production. For the main shower generators, pythia and herwig (with jimmy), the MRST LO* parton distribution functions (PDFs) were used for the first time in ATLAS. Special studies on the performance of these, conceptually new, PDFs for high pt physics processes at LHC energies are presented. In addition, a tune of jimmy for CTEQ6.6 is presented, for use with MC@NLO.
The leaching of lead from lead-based paint in landfill environments.

Science.gov (United States)

Wadanambi, Lakmini; Dubey, Brajesh; Townsend, Timothy

2008-08-30

Lead leaching from lead-based paint (LBP) was examined using standardized laboratory protocols and tests with leachate from actual and simulated landfill environments. Two different LBP samples were tested; leaching solutions included leachates from three municipal solid waste (MSW) landfills and three construction and demolition (C&D) debris landfills. The toxicity characteristic leaching procedure (TCLP) and the synthetic precipitation leaching procedure (SPLP) were also performed. Lead concentrations were many times higher using the TCLP compared to the SPLP and the landfill leachates. No significant difference (alpha=0.05) was observed in leached lead concentrations from the MSW landfill and C&D debris landfill leachates. The impact of other building materials present in LBP debris on lead leaching was examined by testing mixtures of LBP (2%) and different building materials (98%; steel, wood, drywall, concrete). The type of substrate present impacted lead leaching results, with concrete demonstrating the most dramatic impact; the lowest lead concentrations were measured in the presence of concrete under both TCLP and SPLP extractions.
Gamma-ray production cross sections for 0.9 to 20 MeV neutron interactions with 10B

International Nuclear Information System (INIS)

Bywater, R.L. Jr.

1986-09-01

Gamma-ray spectral data previously obtained at the 20-meter station of the Oak Ridge Electron Linear Accelerator flight-path 8 were studied to determine cross sections for 0.9- to 20-MeV neutron interactions with 10 B. Data reduction techniques, including those for determination of incident neutron fluences as well as those to compensate for Doppler-broadened gamma-ray-detection responses, are given in some detail in this report. 9 refs., 4 figs., 2 tabs
Chemical, physical and profile oceanographic data collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069059)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the...
Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069120)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the...
Establishment of new disposal capacity for the Savannah River Plant

International Nuclear Information System (INIS)

Albenesius, E.L.; Wilhite, E.L.

1987-01-01

Two new low-level waste (LLW) disposal sites for decontaminated salt solidified with cement and fly ash (saltstone) and for conventional solid LLW are planned for SRP in the next several years. An above-ground vault disposal system for saltstone was designed to minimize impact on the environment by controlling permeability and diffusivity of the waste form and concrete liner. The experimental program leading to the engineered disposal system included formulation studies, multiple approaches to measurement of permeability and diffusivity, extensive mathematical modeling, and large-scale lysimeter tests to validate model projections. The overall study is an example of the systems approach to disposal site design to achieve a predetermined performance objective. The same systems approach is being used to develop alternative designs for disposal of conventional LLW at the Savannah River Plant. 14 figures
Physical and profile oceanographic data collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0084590)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Physical and profile oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater...
Room temperature mechanosynthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan, 713103, West Bengal (India); Kar, T. [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700032, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India)

2016-02-01

This article reports the synthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C powder obtained by mechanical milling the mixture of Si, Al and graphite powders at room temperature under inert atmosphere. XRD patterns of ball-milled powders clearly reveal the nucleation of Si{sub 0.9}Al{sub 0.1}C phase after 5 h of milling and the stoichiometric cubic Si{sub 0.9}Al{sub 0.1}C is formed after 10 h of milling with crystallite size of ∼3 nm. Microstructure of ball-milled powders in terms of different lattice imperfections is characterized by employing both Rietveld's method of structure refinement using XRD data and high resolution transmission electron microscope (HRTEM). HRTEM micrographs of 10 h milled powder substantiate the formation of nanocrystalline Si{sub 0.9}Al{sub 0.1}C compound without any contamination and confirm the findings of Rietveld analysis using XRD data. - Highlights: • Cubic Si{sub 0.9}Al{sub 0.1}C is formed after 5 h of milling of Si, Al and graphite powders. • Nanocrystalline Si{sub 0.9}Al{sub 0.1}C with particle size ∼3 nm is obtained after 10 h milling. • Average particle size of Si{sub 0.9}Al{sub 0.1}C from XRD analysis and HRTEM is very close.
Electrochemical Activity of a La0.9Ca0.1Co1−xFexO3 Catalyst for a Zinc Air Battery Electrode

Directory of Open Access Journals (Sweden)

Seungwook Eom

2015-01-01

Full Text Available The optimum composition of cathode catalyst has been studied for rechargeable zinc air battery application. La0.9Ca0.1Co1−xFexO3 (x=0–0.4 perovskite powders were prepared using the citrate method. The substitution ratio of Co2+ with Fe3+ cations was controlled in the range of 0–0.4. The optimum substitution ratio of Fe3+ cations was determined by electrochemical measurement of the air cathode composed of the catalyst, polytetrafluoroethylene (PTFE binder, and Vulcan XC-72 carbon. The substitution by Fe enhanced the electrochemical performances of the catalysts. Considering oxygen reduction/evolution reactions and cyclability, we achieved optimum substitution level of x=0.1 in La0.9Ca0.1Co1−xFexO3.
Preliminary characterization of abandoned septic tank systems. Volume 2: Appendix D

International Nuclear Information System (INIS)

1995-12-01

In an effort to support remedial investigations of abandoned septic tanks by US DOE, this report contains the results of chemical analyses of the contents of these abandoned tanks. Analytical data are presented for the following: volatile/TCLP volatile organics; semivolatile/TCLP semivolatile organics; PCB organics; total petroleum hydrocarbons; and total metals. The abandoned systems potentially received wastes or effluent from buildings which could have discharged non-domestic, petroleum hydrocarbons, hazardous, radioactive and/or mixed wastes. The 20 sites investigated are located on the Nevada Test Site
An evaluation of trace element release associated with acid mine drainage

International Nuclear Information System (INIS)

Sullivan, P.J.; Yelton, J.L.

1988-01-01

The determination of trace element release from geologic materials, such as oil shale and coal overburden, is important for proper solid waste management planning. The objective of this study was to determine a correlation between release using the following methods: (1) sequential selective dissolution for determining trace element residencies, (2) toxicity characteristic leaching procedure (TCLP), and (3) humidity cell weathering study simulating maximum trace element release. Two eastern oil shales were used, a New Albany shale that contains 4.6 percent pyrite, and a Chattanooga shale that contains 1.5 percent pyrite. Each shale was analyzed for elemental concentrations by soluble, adsorbed, organic, carbonate, and sulfide phases. The results of the results of the selective dissolution studies show that each trace element has a unique distribution between the various phases. Thus, it is possible to predict trace element release based on trace element residency. The TCLP results show that this method is suitable for assessing soluble trace element release but does not realistically assess potential hazards. The results of the humidity cell studies do demonstrate a more reasonable method for predicting trace element release and potential water quality hazards. The humidity cell methods, however, require months to obtain the required data with a large number of analytical measurements. When the selective dissolution data are compared to the trace element concentrations in the TCLP and humidity cell leachates, it is shown that leachate concentrations are predicted by the selective dissolution data. Therefore, selective dissolution may represent a rapid method to assess trace element release associated with acid mine drainage
Ferroelectric and dielectric properties of BaTi0.9Zr0.1O3 doped with Li0.5Fe2.5O4 ceramics

Science.gov (United States)

Gajula, Ganapathi Rao; Buddiga, Lakshmi Rekha; Chidambara Kumar, K. N.; Ch, Arun Kumar; Samatha, K.; Kokkiragadda, Sreeramachandra Murthy; Dasari, Madhava Prasad

2018-06-01

We have prepared a composite BaTi0.9Zr0.1O3 (BTZr) doped with Li0.5Fe2.5O4 (LF) having chemical formulae (1- x) BTZr + (x) LF (x=0, 0.05, 0.1 and 0.15) conventional solid state reaction technique. We have sintered the grown composites at 1150 °C for 3 h. We have characterized the grown composites using XRD, FESEM, P-E loop tracer and LCR meter. The XRD measurements reveal the tetragonal nature of the composites. The morphological studies reveal that the composite exhibits dense microstructure with small pores. The P-E loops confirm that the composites exhibit remnant polarization and the coercive field increases with increasing concentration of Lithium Ferrite (LF). We have studied dielectric property of the composites by varying the temperature of the sample from 30 °C to 500 °C at 1 kHz, 10 kHz and also by varying the frequency from 1 Hz to 10 MHz at 30 °C. The dielectric property of BTZr has increased after doping LF in BTZr which reveals the enhancement of electrical properties of the grown composite.
Perovskite-based heterostructures integrating ferromagnetic-insulating La0.1Bi0.9MnO3

Science.gov (United States)

Gajek, M.; Bibes, M.; Barthélémy, A.; Varela, M.; Fontcuberta, J.

2005-05-01

We report on the growth of thin films and heterostructures of the ferromagnetic-insulating perovskite La0.1Bi0.9MnO3. We show that the La0.1Bi0.9MnO3 perovskite grows single phased, epitaxially, and with a single out-of-plane orientation either on SrTiO3 substrates or onto strained La2/3Sr1/3MnO3 and SrRuO3 ferromagnetic-metallic buffer layers. We discuss the magnetic properties of the La0.1Bi0.9MnO3 films and heterostructures in view of their possible potential as magnetoelectric or spin-dependent tunneling devices.
Postoperative impairment of motor function at train-of-four ratio ≥0.9 cannot be improved by sugammadex (1 mg kg-1).

Science.gov (United States)

Baumüller, E; Schaller, S J; Chiquito Lama, Y; Frick, C G; Bauhofer, T; Eikermann, M; Fink, H; Blobner, M

2015-05-01

A train-of-four ratio (TOFR) ≥0.9 measured by quantitative neuromuscular monitoring is accepted as an indication of sufficient neuromuscular recovery for extubation, even though many postsynaptic acetylcholine receptors may still be inhibited. We investigated whether antagonism with sugammadex after spontaneous recovery to TOFR≥0.9 further improves muscle function or subjective well-being. Following recovery to TOFR≥0.9 and emergence from anaesthesia, 300 patients randomly received either sugammadex 1.0 mg kg(-1) or placebo. Fine motor function (Purdue Pegboard Test) and maximal voluntary grip strength were measured before and after surgery (before and after test drug administration). At discharge from the postanaesthesia care unit, well-being was assessed with numerical analogue scales and the Quality-of-Recovery Score 40 (QoR-40). Patients' fine motor function [6 (sd 4) vs 15 (3) pegs (30 s)(-1), Psugammadex or placebo, motor function was significantly improved in both groups but did not reach the preoperative level. There was no difference between groups at any time. Global well-being was unaffected (QoR-40: placebo, 174 vs 185; sugammadex, 175 vs 186, P>0.05). Antagonizing rocuronium at TOF≥0.9 with sugammadex 1.0 mg kg(-) (1) did not improve patients' motor function or well-being when compared with placebo. Our data support the view that TOFR≥0.9 measured by electromyography signifies sufficient recovery of neuromuscular function. The trial is registered at ClinicalTrials.gov (NCT01101139). © The Author 2014. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Strategy for reduced calibration sets to develop quantitative structure-retention relationships in high-performance liquid chromatography

Energy Technology Data Exchange (ETDEWEB)

Andries, Jan P.M. [University of Professional Education, Department of Life Sciences, P.O. Box 90116, 4800 RA Breda (Netherlands); Claessens, Henk A. [University of Professional Education, Department of Life Sciences, P.O. Box 90116, 4800 RA Breda (Netherlands); Eindhoven University of Technology, Department of Chemical Engineering and Chemistry, Laboratory of Polymer Chemistry, P.O. Box 513 (Helix, STW 1.35), 5600 MB Eindhoven (Netherlands); Heyden, Yvan Vander [Department of Analytical Chemistry and Pharmaceutical Technology, Vrije Universiteit Brussel-VUB, Laarbeeklaan 103, B-1090 Brussels (Belgium); Buydens, Lutgarde M.C., E-mail: L.Buydens@science.ru.nl [Institute for Molecules and Materials, Radboud University Nijmegen, Toernooiveld 1, 6525 ED Nijmegen (Netherlands)

2009-10-12

In high-performance liquid chromatography, quantitative structure-retention relationships (QSRRs) are applied to model the relation between chromatographic retention and quantities derived from molecular structure of analytes. Classically a substantial number of test analytes is used to build QSRR models. This makes their application laborious and time consuming. In this work a strategy is presented to build QSRR models based on selected reduced calibration sets. The analytes in the reduced calibration sets are selected from larger sets of analytes by applying the algorithm of Kennard and Stone on the molecular descriptors used in the QSRR concerned. The strategy was applied on three QSRR models of different complexity, relating logk{sub w} or log k with either: (i) log P, the n-octanol-water partition coefficient, (ii) calculated quantum chemical indices (QCI), or (iii) descriptors from the linear solvation energy relationship (LSER). Models were developed and validated for 76 reversed-phase high-performance liquid chromatography systems. From the results we can conclude that it is possible to develop log P models suitable for the future prediction of retentions with as few as seven analytes. For the QCI and LSER models we derived the rule that three selected analytes per descriptor are sufficient. Both the dependent variable space, formed by the retention values, and the independent variable space, formed by the descriptors, are covered well by the reduced calibration sets. Finally guidelines to construct small calibration sets are formulated.
NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...
Ankle Brachial Index <0.9 Underestimates the Prevalence of Peripheral Artery Occlusive Disease Assessed with Whole-Body Magnetic Resonance Angiography in the Elderly

International Nuclear Information System (INIS)

Wikstroem, J.; Hansen, T.; Johansson, L.; Lind, L.; Ahlstroem, H.

2008-01-01

Background: Whole-body magnetic resonance angiography (WBMRA) permits noninvasive vascular assessment, which can be utilized in epidemiological studies. Purpose: To assess the relation between a low ankle brachial index (ABI) and high-grade stenoses in the pelvic and leg arteries in the elderly. Material and Methods: WBMRA was performed in a population sample of 306 subjects aged 70 years. The arteries below the aortic bifurcation were graded after the most severe stenosis according to one of three grades: 0-49% stenosis, 50-99% stenosis, or occlusion. ABI was calculated for each side. Results: There were assessable WBMRA and ABI examinations in 268 (right side), 265 (left side), and 258 cases (both sides). At least one ≥50% stenosis was found in 19% (right side), 23% (left side), and 28% (on at least one side) of the cases. The corresponding prevalences for ABI <0.9 were 4.5%, 4.2%, and 6.6%. An ABI cut-off value of 0.9 resulted in a sensitivity, specificity, and positive and negative predictive value of 20%, 99%, 83%, and 84% on the right side, and 15%, 99%, 82%, and 80% on the left side, respectively, for the presence of a ≥ 50% stenosis in the pelvic or leg arteries. Conclusion: An ABI <0.9 underestimates the prevalence of peripheral arterial occlusive disease in the general elderly population
Imagery, laboratory analysis and sediment analysis oceanographic data collected aboard the GYRE in the Gulf of Mexico from 2010-09-13 to 2010-09-16 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0084568)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Imagery, laboratory analysis and sediment analysis oceanographic data were collected aboard the GYRE in the Gulf of Mexico from 2010-09-13 to 2010-09-16 in response...
Pandemic vaccination strategies and influenza severe outcomes during the influenza A(H1N1)pdm09 pandemic and the post-pandemic influenza season

DEFF Research Database (Denmark)

Gil Cuesta, Julita; Aavitsland, Preben; Englund, Hélène

2016-01-01

During the 2009/10 influenza A(H1N1)pdm09 pandemic, the five Nordic countries adopted different approaches to pandemic vaccination. We compared pandemic vaccination strategies and severe influenza outcomes, in seasons 2009/10 and 2010/11 in these countries with similar influenza surveillance...... systems. We calculated the cumulative pandemic vaccination coverage in 2009/10 and cumulative incidence rates of laboratory confirmed A(H1N1)pdm09 infections, intensive care unit (ICU) admissions and deaths in 2009/10 and 2010/11. We estimated incidence risk ratios (IRR) in a Poisson regression model...... with the other countries. In 2010/11 Denmark had a significantly higher cumulative incidence of A(H1N1)pdm09 ICU admissions (IRR: 2.4; 95% confidence interval (CI): 1.9-3.0) and deaths (IRR: 8.3; 95% CI: 5.1-13.5). Compared with Denmark, the other countries had higher pandemic vaccination coverage...
Charged-particle multiplicity measurement in proton-proton collisions at $\\sqrt{s}$ = 0.9 and 2.36 TeV with ALICE at LHC

CERN Document Server

Aamodt, K.; Abeysekara, U.; Abrahantes Quintana, A.; Abramyan, A.; Adamova, D.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, A.; Ahmad, N.; Ahn, S.U.; Akimoto, R.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Avina, E.Almaraz; Alme, J.; Alt, T.; Altini, V.; Altinpinar, S.; Andrei, C.; Andronic, A.; Anelli, G.; Angelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antinori, S.; Antipin, K.; Antonczyk, D.; Antonioli, P.; Anzo, A.; Aphecetche, L.; Appelshauser, H.; Arcelli, S.; Arceo, R.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bablok, S.; Bach, M.; Badala, A.; Baek, Y.W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baldit, A.; Ban, J.; Barbera, R.; Barnafoldi, G.G.; Barnby, L.; Barret, V.; Bartke, J.; Barile, F.; Basile, M.; Basmanov, V.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Becker, B.; Belikov, I.; Bellwied, R.; Belmont-Moreno, E.; Belogianni, A.; Benhabib, L.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdermann, E.; Berdnikov, Y.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Bimbot, L.; Biolcati, E.; Blanc, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Bohm, J.; Boldizsar, L.; Bombara, M.; Bombonati, C.; Bondila, M.; Borel, H.; Borshchov, V.; Borisov, A.; Bortolin, C.; Bose, S.; Bosisio, L.; Bossu, F.; Botje, M.; Bottger, S.; Bourdaud, G.; Boyer, B.; Braun, M.; Braun-Munzinger, P.; Bravina, L.; Bregant, M.; Breitner, T.; Bruckner, G.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Buncic, P.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Camacho, E.; Camerini, P.; Campbell, M.; Canoa Roman, V.; Capitani, G.P.; Cara Romeo, G.; Carena, F.; Carena, W.; Carminati, F.; Casanova Diaz, A.; Caselle, M.; Castellanos, J.Castillo; Castillo Hernandez, J.F.; Catanescu, V.; Cattaruzza, E.; Cavicchioli, C.; Cerello, P.; Chambert, V.; Chang, B.; Chapeland, S.; Charpy, A.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Choi, K.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chuman, F.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Cobanoglu, O.; Coffin, J.P.; Coli, S.; Colla, A.; Conesa Balbastre, G.; Conesa del Valle, Z.; Conner, E.S.; Constantin, P.; Contin, G.; Contreras, J.G.; Corrales Morales, Y.; Cormier, T.M.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Cussonneau, J.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, S.; Dash, A.; Dash, S.; de Barros, G.O.V.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gaspari, M.; de Groot, J.; De Gruttola, D.; de Haas, A.P.; De Marco, N.; De Pasquale, S.; De Remigis, R.; de Rooij, R.; de Vaux, G.; Delagrange, H.; Dellacasa, G.; Deloff, A.; Demanov, V.; Denes, E.; Deppman, A.; D'Erasmo, G.; Derkach, D.; Devaux, A.; Di Bari, D.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Dialinas, M.; Diaz, L.; Diaz, R.; Dietel, T.; Divia, R.; Djuvsland, O.; Dobretsov, V.; Dobrin, A.; Dobrowolski, T.; Donigus, B.; Dominguez, I.; Dordic, O.; Dubey, A.K.; Dubuisson, J.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, A.K.; Dutta Majumdar, M.R.; Elia, D.; Emschermann, D.; Enokizono, A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Evrard, S.; Eyyubova, G.; Fabjan, C.W.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fateev, O.; Fearick, R.; Fedunov, A.; Fehlker, D.; Fekete, V.; Felea, D.; Fenton-Olsen, B.; Feofilov, G.; Fernandez Tellez, A.; Ferreiro, E.G.; Ferretti, A.; Ferretti, R.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Fodor, Z.; Foertsch, S.; Foka, P.; Fokin, S.; Formenti, F.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Frolov, A.; Fuchs, U.; Furano, F.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gadrat, S.; Gagliardi, M.; Gago, A.; Gallio, M.; Ganoti, P.; Ganti, M.S.; Garabatos, C.; Garcia Trapaga, C.; Gebelein, J.; Gemme, R.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Giraudo, G.; Giubellino, P.; Gladysz-Dziadus, E.; Glasow, R.; Glassel, P.; Glenn, A.; Gomez Jimenez, R.; Gonzalez Santos, H.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Gorbunov, Y.; Gotovac, S.; Gottschlag, H.; Grabski, V.; Grajcarek, R.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Gustafsson, H.A.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hamblen, J.; Han, B.H.; Harris, J.W.; Hartig, M.; Harutyunyan, A.; Hasch, D.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heide, M.; Heinz, M.; Helstrup, H.; Herghelegiu, A.; Hernandez, C.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hiei, A.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Hu, S.; Huang, M.; Huber, S.; Humanic, T.J.; Hutter, D.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Innocenti, P.G.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, A.; Ivanov, M.; Ivanov, V.; Iwasaki, T.; Jacholkowski, A.; Jacobs, P.; Jancurova, L.; Jangal, S.; Janik, R.; Jena, C.; Jena, S.; Jirden, L.; Jones, G.T.; Jones, P.G.; Jovanovic, P.; Jung, H.; Jung, W.; Jusko, A.; Kaidalov, A.B.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kamal, A.; Kamermans, R.; Kanaki, K.; Kang, E.; Kang, J.H.; Kapitan, J.; Kaplin, V.; Kapusta, S.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kikola, D.; Kileng, B.; Kim, D.J.; Kim, D.S.; Kim, D.W.; Kim, H.N.; Kim, J.; Kim, J.H.; Kim, J.S.; Kim, M.; Kim, M.; Kim, S.H.; Kim, S.; Kim, Y.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Klovning, A.; Kluge, A.; Kniege, S.; Koch, K.; Kolevatov, R.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskih, A.; Kornas, E.; Kour, R.; Kowalski, M.; Kox, S.; Kozlov, K.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Kravcakova, A.; Krawutschke, T.; Krivda, M.; Krumbhorn, D.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kumar, L.; Kumar, N.; Kupczak, R.; Kurashvili, P.; Kurepin, A.; Kurepin, A.N.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kutouski, M.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; La Rocca, P.; Lackner, F.; Ladron de Guevara, P.; Lafage, V.; Lal, C.; Lara, C.; Larsen, D.T.; Laurenti, G.; Lazzeroni, C.; Le Bornec, Y.; Le Bris, N.; Lee, H.; Lee, K.S.; Lee, S.C.; Lefevre, F.; Lenhardt, M.; Leistam, L.; Lehnert, J.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Li, Y.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Listratenko, O.; Liu, L.; Loginov, V.; Lohn, S.; Lopez, X.; Lopez Noriega, M.; Lopez-Ramirez, R.; Lopez Torres, E.; Lovhoiden, G.; Lozea Feijo Soares, A.; Lu, S.; Lunardon, M.; Luparello, G.; Luquin, L.; Lutz, J.R.; Ma, K.; Ma, R.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Makhlyueva, I.; Mal'Kevich, D.; Malaev, M.; Malagalage, K.J.; Maldonado Cervantes, I.; Malek, M.; Malkiewicz, T.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Martashvili, I.; Martinengo, P.; Martinez Hernandez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Maruyama, Y.; Marzari Chiesa, A.; Masciocchi, S.; Masera, M.; Masetti, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mazza, G.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mendez Lorenzo, P.; Meoni, M.; Mercado Perez, J.; Mereu, P.; Miake, Y.; Michalon, A.; Miftakhov, N.; Milosevic, J.; Minafra, F.; Mischke, A.; Miskowiec, D.; Mitu, C.; Mizoguchi, K.; Mlynarz, J.; Mohanty, B.; Molnar, L.; Mondal, M.M.; Montano Zetina, L.; Monteno, M.; Montes, E.; Morando, M.; Moretto, S.; Morsch, A.; Moukhanova, T.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Munoz, J.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Navach, F.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nendaz, F.; Newby, J.; Nianine, A.; Nicassio, M.; Nielsen, B.S.; Nikolaev, S.; Nikolic, V.; Nikulin, S.; Nikulin, V.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyatha, A.; Nygaard, C.; Nyiri, A.; Nystrand, J.; Ochirov, A.; Odyniec, G.; Oeschler, H.; Oinonen, M.; Okada, K.; Okada, Y.; Oldenburg, M.; Oleniacz, J.; Oppedisano, C.; Orsini, F.; Ortiz Velasquez, A.; Ortona, G.; Oskamp, C.J.; Oskarsson, A.; Osmic, F.; Osterman, L.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Ovrebekk, G.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Panse, R.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Pastircak, B.; Pastore, C.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Pepato, A.; Pereira, H.; Peressounko, D.; Perez, C.; Perini, D.; Perrino, D.; Peryt, W.; Peschek, J.; Pesci, A.; Peskov, V.; Pestov, Y.; Peters, A.J.; Petracek, V.; Petridis, A.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Peyre, J.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Platt, R.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta Lerma, P.L.M.; Poggio, F.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Polozov, P.; Polyakov, V.; Pommeresch, B.; Pop, A.; Posa, F.; Pospisil, V.; Potukuchi, B.; Pouthas, J.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puddu, G.; Pujahari, P.; Pulvirenti, A.; Punin, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Rammler, M.; Raniwala, R.; Raniwala, S.; Rasanen, S.S.; Rashevskaya, I.; Rath, S.; Read, K.F.; Real, J.S.; Redlich, K.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Ricaud, H.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rivetti, A.; Rodriguez Cahuantzi, M.; Roed, K.; Rohrich, D.; Roman Lopez, S.; Romita, R.; Ronchetti, F.; Rosinsky, P.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Rousseau, S.; Roy, C.; Roy, P.; Rubio-Montero, A.J.; Rui, R.; Rusanov, I.; Russo, G.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahoo, R.; Saini, J.; Saiz, P.; Sakata, D.; Salgado, C.A.; Salgueiro Domingues da Silva, R.; Salur, S.; Samanta, T.; Sambyal, S.; Samsonov, V.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Saturnini, P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schindler, H.; Schmidt, C.; Schmidt, H.R.; Schossmaier, K.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Segato, G.; Semenov, D.; Senyukov, S.; Seo, J.; Serci, S.; Serkin, L.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabratova, G.; Shahoyan, R.; Sharkov, G.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddi, E.; Siemiarczuk, T.; Silenzi, A.; Silvermyr, D.; Simili, E.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Snow, H.; Sogaard, C.; Soloviev, A.; Soltveit, H.K.; Soltz, R.; Sommer, W.; Son, C.W.; Son, H.; Song, M.; Soos, C.; Soramel, F.; Soyk, D.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Staley, F.; Stan, E.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Stenlund, E.; Steyn, G.; Stocco, D.; Stock, R.; Stolpovsky, P.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sumbera, M.; Susa, T.; Swoboda, D.; Symons, J.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Szuba, M.; Tadel, M.; Tagridis, C.; Takahara, A.; Takahashi, J.; Tanabe, R.; Takaki, D.J.Tapia; Taureg, H.; Tauro, A.; Tavlet, M.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Tieulent, R.; Tlusty, D.; Toia, A.; Tolyhy, T.; Torcato de Matos, C.; Torii, H.; Torralba, G.; Toscano, L.; Tosello, F.; Tournaire, A.; Traczyk, T.; Tribedy, P.; Troger, G.; Truesdale, D.; Trzaska, W.H.; Tsiledakis, G.; Tsilis, E.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Turvey, A.; Tveter, T.S.; Tydesjo, H.; Tywoniuk, K.; Ulery, J.; Ullaland, K.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vacchi, A.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van den Brink, A.; van der Kolk, N.; Vyvre, P.Vande; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasiliev, A.; Vassiliev, I.; Vasileiou, M.; Vechernin, V.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernet, R.; Verweij, M.; Vetlitskiy, I.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Viyogi, Y.P.; Vodopianov, A.; Voloshin, K.; Voloshin, S.; Volpe, G.; von Haller, B.; Vranic, D.; Vrlakova, J.; Vulpescu, B.; Wagner, B.; Wagner, V.; Wallet, L.; Wan, R.; Wang, D.; Wang, Y.; Watanabe, K.; Wen, Q.; Wessels, J.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilk, A.; Wilk, G.; Williams, M.C.S.; Willis, N.; Windelband, B.; Xu, C.; Yang, C.; Yang, H.; Yasnopolskiy, S.; Yermia, F.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I-K.; Yuan, X.; Yurevich, V.; Yushmanov, I.; Zabrodin, E.; Zagreev, B.; Zalite, A.; Zampolli, C.; Zanevsky, Yu.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zbroszczyk, H.; Zelnicek, P.; Zenin, A.; Zepeda, A.; Zgura, I.; Zhalov, M.; Zhang, X.; Zhou, D.; Zhou, S.; Zhu, J.; Zichichi, A.; Zinchenko, A.; Zinovjev, G.; Zoccarato, Y.; Zychacek, V.; Zynovyev, M.

2010-01-01

Charged-particle production was studied in proton-proton collisions collected at the LHC with the ALICE detector at centre-of-mass energies 0.9 TeV and 2.36 TeV in the pseudorapidity range |eta| < 1.4. In the central region (|eta| < 0.5), at 0.9 TeV, we measure charged-particle pseudorapidity density dNch/deta = 3.02 +- 0.01 (stat.) +0.08 -0.05 (syst.) for inelastic interactions, and dNch/deta = 3.58 +- 0.01 (stat.) +0.12 -0.12 (syst.) for non-single-diffractive interactions. At 2.36 TeV, we find dNch/deta = 3.77 +- 0.01 (stat.) +0.25 -0.12 (syst.) for inelastic, and dNch/deta = 4.43 +- 0.01 (stat.) +0.17 -0.12 (syst.) for non-single-diffractive collisions. The relative increase in charged-particle multiplicity from the lower to higher energy is 24.7% +- 0.5% (stat.) +5.7% -2.8% (syst.) for inelastic and 23.7% +- 0.5% (stat.) +4.6% -1.1% (syst.) for non-single-diffractive interactions. This increase is consistent with that reported by the CMS collaboration for non-single-diffractive events and larger th...
Equilibrium leaching of toxic elements from cement stabilized soil.

Science.gov (United States)

Voglar, Grega E; Leštan, Domen

2013-02-15

The toxicity characteristics leaching procedure (TCLP) is commonly used to assess the efficiency of solidification/stabilization (S/S) of pollutants in wastes, despite recent objections to this method. In this study, formulations of 7, 10, 15 and 20% (w/w) of calcium aluminate cement (CAC) and sulfate resistant Portland cement (SRC) were used for S/S of soil from brownfield contaminated with 43,149, 10,115, 7631, 6130, 90, 82 mg kg(-1) of Zn, Pb, Cu, As, Cd and Ni, respectively. CAC produced S/S soil monoliths of higher mechanical strength (up to 7.65 N mm(-2)). Mass-transfer analysis indicated surface wash-off as a mechanism of toxic elements release, and equilibrium leaching as a crucial parameter of S/S efficiency assessment. In the expected range of field soil pH after S/S (pH 7-9), the TCLP gave markedly different results than the multi-point pH equilibrium leaching method (using nine targeted pH values): up to 2953-, 94-, 483-, 1.3-, 27- and 1.5-times more Zn, Pb, Cu, As, Cd and Ni, respectively, was determined in the TCLP leachate. S/S with CAC reduced leachability of toxic elements more effectively than SRC. Our results indicate that, under given field conditions, the TCLP significantly underrates the efficiency of S/S of contaminated soil with cementitious binders. Copyright © 2012 Elsevier B.V. All rights reserved.
1,3-Di-4-pyridylpropane–4,4′-oxydibenzoic acid (1/1

Directory of Open Access Journals (Sweden)

Hirofumi Hinode

2008-12-01

Full Text Available The hydrothermal reaction of Cd(NO32·4H2O, 1,3-di-4-pyridylpropane (BPP and 4,4′-oxydibenzoic acid (OBA led to the formation of the title compound, C13H14N2·C14H10O5. The asymmetric unit consists of one molecule of OBA and one of BPP. In the OBA molecule, one COOH group is nearly planar with its attached benzene ring [dihedral angle = 0.9 (1°], while the other COOH group is slightly twisted with a dihedral angle of 10.8 (3°. The carboxyl groups form strong intermolecular O—H...N hydrogen bonds with N atoms of the pyridine rings in BPP, linking the molecules into zigzag chains.
Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069110)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in...
Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-03 to 2010-09-07 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069108)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-03 to 2010-09-07 in...
Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-15 to 2010-09-22 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069079)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-15 to 2010-09-22 in...
Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-23 to 2010-09-28 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069080)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-23 to 2010-09-28 in...
ChemSession'09 - 6. Warsaw Seminar of the PhD Students in Chemistry - Abstracts; ChemSession'09 - 6. Warszawskie Seminarium Doktorantow Chemikow - Streszczenia

Energy Technology Data Exchange (ETDEWEB)

NONE

2009-07-01

Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6{sup th} Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found.
76 FR 41501 - Notice of Intent To Award Affordable Care Act (ACA) Funding, EH09-907

Science.gov (United States)

2011-07-14

... network expansion and enhancement. Funding is appropriated under the Affordable Care Act (Pub. L. 111-148... Intent To Award Affordable Care Act (ACA) Funding, EH09-907 AGENCY: Centers for Disease Control and... in their FY 2011 applications submitted under funding opportunity EH09-907, ``National Environmental...
A 0.9-V 12-bit 40-MSPS Pipeline ADC for Wireless Receivers

Science.gov (United States)

Ito, Tomohiko; Itakura, Tetsuro

A 0.9-V 12-bit 40-MSPS pipeline ADC with I/Q amplifier sharing technique is presented for wireless receivers. To achieve high linearity even at 0.9-V supply, the clock signals to sampling switches are boosted over 0.9V in conversion stages. The clock-boosting circuit for lifting these clocks is shared between I-ch ADC and Q-ch ADC, reducing the area penalty. Low supply voltage narrows the available output range of the operational amplifier. A pseudo-differential (PD) amplifier with two-gain-stage common-mode feedback (CMFB) is proposed in views of its wide output range and power efficiency. This ADC is fabricated in 90-nm CMOS technology. At 40MS/s, the measured SNDR is 59.3dB and the corresponding effective number of bits (ENOB) is 9.6. Until Nyquist frequency, the ENOB is kept over 9.3. The ADC dissipates 17.3mW/ch, whose performances are suitable for ADCs for mobile wireless systems such as WLAN/WiMAX.
Incidence rates of enterovirus 71 infections in young children during a nationwide epidemic in Taiwan, 2008-09.

Directory of Open Access Journals (Sweden)

Min-Shi Lee

Full Text Available OBJECTIVE: Enterovirus 71 (EV71 is causing life-threatening outbreaks in tropical Asia. In Taiwan and other tropical Asian countries, although nationwide EV71 epidemics occur cyclically, age-specific incidence rates of EV71 infections that are critical to estimate disease burden and design vaccine trials are not clear. A nationwide EV71 epidemic occurred in 2008-09 in Taiwan, which provided a unique opportunity to estimate age-specific incidence rates of EV71 infections. STUDY DESIGN: We prospectively recruited 749 healthy neonates and conducted follow-ups from June 2006 to December 2009. Sera were obtained from participants at 0, 6, 12, 24, and 36 months of age for measuring EV71 neutralizing antibody titers. If the participants developed suspected enterovirus illnesses, throat swabs were collected for virus isolation. RESULTS: We detected 28 EV71 infections including 20 symptomatic and 8 asymptomatic infections. Age-specific incidence rates of EV71 infection increased from 1.71 per 100 person-years at 0-6 months of age to 4.09, 5.74, and 4.97 per 100 person-years at 7-12, 13-24, and 25-36 months of age, respectively. Cumulative incidence rate was 15.15 per 100 persons by 36 months of age, respectively. CONCLUSIONS: Risk of EV71 infections in Taiwan increased after 6 months of age during EV71 epidemics. The cumulative incidence rate was 15% by 36 months of age, and 29% of EV71 infections were asymptomatic in young children.
In situ stabilization remediation of cadmium contaminated soils of wastewater irrigation region using sepiolite.

Science.gov (United States)

Sun, Yuebing; Sun, Guohong; Xu, Yingming; Wang, Lin; Lin, Dasong; Liang, Xuefeng; Shi, Xin

2012-01-01

The effects of immobilization remediation of Cd-contaminated soils using sepiolite on soil pH, enzyme activities and microbial communities, TCLP-Cd (toxicity characteristic leaching procedure-Cd) concentration, and spinach (Spinacia oleracea) growth and Cd uptake and accumulation were investigated. Results showed that the addition of sepiolite could increase soil pH, while the TCLP-Cd concentration in soil was decreased with increasing sepiolite. The changes of soil enzyme activities and bacteria number indicated that a certain metabolic recovery occurred after the sepiolite treatments, and spinach shoot biomass increased by 58.5%-65.5% in comparison with the control group when the concentration of sepiolite was < or = 10 g/kg. However, the Cd concentrations in the shoots and roots of spinach decreased with an increase in the rate of sepiolite, experiencing 38.4%-59.1% and 12.6%-43.6% reduction, respectively, in contrast to the control. The results indicated that sepiolite has the potential for success on a field scale in reducing Cd entry into the food chain.
2008-09 National Rivers and Streams Assessment Fish Tissue Data Dictionary

Science.gov (United States)

The Office of Science and Technology (OST) is providing the fish tissue results from the 2008-09 National Rivers and Streams Assessment (NRSA). This document includes the “data dictionary” for Mercury, Selenium, PBDEs, PCBs, Pesticides and PFCs.
Secular changes in intakes of foods among New Zealand adults from 1997 to 2008/09.

Science.gov (United States)

Smith, Claire; Gray, Andrew R; Mainvil, Louise A; Fleming, Elizabeth A; Parnell, Winsome R

2015-12-01

To examine changes in the food choices of New Zealand (NZ) adults, between the 1997 National Nutrition Survey (NNS97) and the 2008/09 NZ Adult Nutrition Survey (2008/09 NZANS). The 2008/09 NZANS and the NNS97 were cross-sectional surveys of NZ adults (aged 15 years and over). Dietary intake data were collected using a computer-based 24 h diet recall. Logistic regression models were used to examine changes over time in the percentage reporting each food group, with survey year, sex and age group (19-30 years, 31-50 years, 51-70 years, ≥71 years) as the variables. NZ households. Adults aged 19 years and over (NNS97, n 4339; 2008/09 NZANS, n 3995). In the 2008/09 NZANS compared with NNS97, males and females were less likely to report consuming bread, potatoes, beef, vegetables, breakfast cereal, milk, cheese, butter, pies, biscuits, cakes and puddings, and sugar/confectionery (all Psnacks and snack bars (e.g., crisps, extruded snacks, muesli bars; P=0.007) and pasta and pasta dishes (P=0.017). Although food choices were associated with sex and age group, there were few differential changes between the surveys by sex or age group. For all age groups there was a shift in the percentage who reported consuming the traditional NZ foods, namely bread, beef, potatoes and vegetables, towards more rice and rice dishes. Declines in the consumption of butter, pies, biscuits, cakes and puddings are congruent with current dietary guidelines.
Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0074853)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in...

Chemical and physical oceanographic profile data collected from CTD casts aboard the Wes Bordelon in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069085)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Wes Bordelon in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...
Chemical and physical oceanographic profile data collected from CTD casts aboard the BUNNY BORDELON in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069117)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the BUNNY BORDELON in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...
Chemical and physical oceanographic profile data collected from CTD casts aboard the Rachel Bordelon in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069078)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Rachel Bordelon in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...
Enhanced acquired antibodies to a chimeric Plasmodium falciparum antigen; UB05-09 is associated with protective immunity against malaria.

Science.gov (United States)

Dinga, J N; Gamua, S D; Titanji, V P K

2017-08-01

It has been shown that covalently linking two antigens could enhance the immunogenicity of the chimeric construct. To prioritize such a chimera for malaria vaccine development, it is necessary to demonstrate that naturally acquired antibodies against the chimera are associated with protection from malaria. Here, we probe the ability of a chimeric construct of UB05 and UB09 antigens (UB05-09) to better differentiate between acquired immune protection and susceptibility to malaria. In a cross-sectional study, recombinant UB05-09 chimera and the constituent antigens were used to probe for specific antibodies in the plasma from children and adults resident in a malaria-endemic zone, using the enzyme-linked immunosorbent assay (ELISA). Anti-UB05-09 antibody levels doubled that of its constituent antigens, UB09 and UB05, and this correlated with protection against malaria. The presence of enhanced UB05-09-specific antibody correlated with the absence of fever and parasitaemia, which are the main symptoms of malaria infection. The chimera is more effective in detecting and distinguishing acquired protective immunity against malaria than any of its constituents taken alone. Online B-cell epitope prediction tools confirmed the presence of B-cell epitopes in the study antigens. UB05-09 chimera is a marker of protective immunity against malaria that needs to be studied further. © 2017 John Wiley & Sons Ltd.
Chemical and physical oceanographic profile data collected from CTD casts aboard the JACK FITZ in the Gulf of Mexico from 2010-09-04 to 2010-09-12 in response to the Deepwater Horizon oil spill event (NODC Accession 0069075)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the JACK FITZ in the Gulf of Mexico from 2010-09-04 to 2010-09-12 in response to the Deepwater...
Comparison of SureSight autorefractor and plusoptiX A09 photoscreener for vision screening in rural Honduras.

Science.gov (United States)

Silbert, David I; Matta, Noelle S; Ely, Amanda L

2014-02-01

To evaluate the SureSight autorefractor and compare it to the plusoptiX A09 photoscreener in the detection of amblyopia risk factors in a cohort of Honduran children examined during medical mission work and to assess the utility of both devices in the rural setting. The medical records of patients who had undergone SureSight autorefractor screening, plusoptiX photoscreening, and a gold standard pediatric ophthalmology examination, including cycloplegic refraction, during a recent medical mission trip to Honduras were retrospectively reviewed. A total of 216 children were examined. Of these, 9 (4%) were found to have amblyopia risk factors based on the current referral criteria of the American Association for Pediatric Ophthalmology and Strabismus on ophthalmological examination. The plusoptiX was found to have 89% sensitivity and 80% specificity; the SureSight, using manufacturer's referral criteria, was found to have sensitivity of 89% and specificity of 71%. Both devices were found to be reliable vision screening devices when used on the general population of remote villages in Honduras, although the specificity of the plusoptiX A09 was higher. Copyright © 2014 American Association for Pediatric Ophthalmology and Strabismus. Published by Mosby, Inc. All rights reserved.
Results For The Third Quarter 2010 Tank 50 WAC Slurry Sample: Chemical And Radionuclide Contaminant Results

International Nuclear Information System (INIS)

Reigel, M.; Bibler, N.

2010-01-01

This report details the chemical and radionuclide contaminant results for the characterization of the 2010 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC). Information from this characterization will be used by Liquid Waste Operations (LWO) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System. The following conclusions are drawn from the analytical results provided in this report: (i) The concentrations of the reported chemical and radioactive contaminants were less than their respective WAC targets or limits unless noted in this section. (ii) The reported detection limits for 94 Nb, 247 Cm and 249 Cf are above the requested limits from Reference 4. However, they are below the limits established in Reference 3. (iii) The reported detection limit for 242m Am is greater than the requested limit from Attachment 8.4 of the WAC. (iv) The reported detection limit for Isopar L is greater than the limit from Table 3 of the WAC. (v) The reported concentration of Isopropanol is greater than the limit from Table 4 of the WAC. (vi) Isopar L and Norpar 13 have limited solubility in aqueous solutions making it difficult to obtain consistent and reliable sub-samples. The values reported in this memo are the concentrations in the sub-sample as detected by the GC/MS; however, the results may not accurately represent the concentrations of the analytes in Tank 50.
High School Longitudinal Study of 2009 (HSLS:09): Base-Year Data File Documentation. NCES 2011-328

Science.gov (United States)

Ingels, Steven J.; Pratt, Daniel J.; Herget, Deborah R.; Burns, Laura J.; Dever, Jill A.; Ottem, Randolph; Rogers, James E.; Jin, Ying; Leinwand, Steve

2011-01-01

The High School Longitudinal Study of 2009 (HSLS:09) is the fifth in a series of National Center for Education Statistics (NCES) secondary longitudinal studies. The core research questions for HSLS:09 explore secondary to postsecondary transition plans and the evolution of those plans; the paths into and out of science, technology, engineering,…
The Division III Financial Aid Reporting Process: Findings and Review Results, 2005-06 through 2008-09

Science.gov (United States)

National Collegiate Athletic Association (NJ1), 2009

2009-01-01

This report marks the completion of the 2008-09 reporting cycle and the fourth year of the Division III Financial Aid Reporting Program. The report examines findings for all reporting institutions from each of the four reporting cycles, and details the outcomes of the Division III Financial Aid Committee's 2008-09 review process. Four calculations…
Characterization of Secondary Solid Wastes in Trench Water in Waste Area Grouping 6 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Taylor, P.A.; Kent, T.E.

1994-02-01

This project was undertaken to demonstrate that new liquid waste streams, generated as a consequence of closure activities at Waste Area Grouping (WAG) 6 and other sites, can be treated at the existing wastewater treatment facilities at Oak Ridge National Laboratory (ORNL) to meet discharge requirements without producing hazardous secondary solid wastes. Previous bench and pilot-scale treatability studies have shown that ORNL treatment operations will adequately remove the contaminants and that the secondary solid wastes produced were not hazardous when treating water from two trenches in WAG 6. This study used WAG 6 trench water spiked with the minimum concentration of Toxicity Characteristics Leaching Procedure (TCLP) constituents (chemicals that can make a waste hazardous) found in any groundwater samples at ORNL. The Wastewater Treatment Test Facility (WTTF), a 0.5 L/min pilot plant that simulates the treatment capabilities of the Process Waste Treatment Plant (PWPT) and Nonradiological Wastewater Treatment Plant (NRWTP), was used for this test. This test system, which is able to produce secondary wastes in the quantities necessary for TCLP testing, was operated for a 59-d test period with a minimum of problems and downtime. The pilot plant operating data verified that WAG 6 trench waters, spiked with the minimum concentration of TCLP contaminants measured to date, can be treated at the PWTP and NRWTP to meet current discharge limits. The results of the TCLP analysis indicated that none of the secondary solid wastes produced during the treatment of these wastewaters will be considered hazardous as defined by the Resource Conservation and Recovery Act
Dissolved inorganic carbon, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the METEOR in the North Atlantic Ocean from 1997-08-15 to 1997-09-09 (NODC Accession 0113914)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113914 includes chemical, discrete sample, physical and profile data collected from METEOR in the North Atlantic Ocean from 1997-08-15 to 1997-09-09...
Dissolved inorganic carbon, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the KNORR in the South Pacific Ocean from 1992-09-01 to 1992-09-15 (NODC Accession 0115700)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0115700 includes chemical, discrete sample, physical and profile data collected from KNORR in the South Pacific Ocean from 1992-09-01 to 1992-09-15...
Effect of Sb and Si doping on the superconducting properties of FeSe0.9

International Nuclear Information System (INIS)

Sudesh,; Rani, S.; Varma, G.D.

2013-01-01

Highlights: ► We synthesized all the samples using two-step solid state reaction method. ► Si and Sb doping is done at the Se site of the compound FeSe 0.9 . ► H c2 (0) is calculated with GL-Fit and also using WHH model. ► Behavior of activation energy is studied with applied field. -- Abstract: In the present work, we have studied the effect of doping Sb and Si at the Se-site of FeSe 0.9 on the superconducting properties, such as transition temperature (T c ), upper critical field (H c2 ) and irreversibility field (H irr ). The polycrystalline samples have been synthesized via two step solid state reaction route with nominal compositions Fe[Se 1−x (Sb/Si) x ] 0.9 (x = 0.0, 0.05, 0.10, 0.15 and 0.20). The X-ray diffraction results show the presence of tetragonal α-FeSe phase with the P4/nmm space group symmetry in all the samples. The highest superconducting onset temperatures, T c onset ∼9.42Kand9.20K, respectively, for Si and Sb doped samples have been found for x = 0.05. The temperature dependence of H c2 (T) and H irr (T) have been calculated from the magnetoresistance data using the criteria of 90% and 10% of normal state resistivity (ρ n ) values, respectively. The values of H c2 (0) estimated from Werthamer–Helfand–Hohenberg (WHH) and Ginzburg–Landau (GL) theories are found to follow the same trends and maximum H c2 (0) is found for the composition x = 0.10 for both the Si and Sb doped samples. The irreversibility field, H irr and activation energy, U 0 have also been calculated to study the vortex motion behavior of the samples. A clear cut correlation between H irr and U 0 has been found
Extracellular biosynthesis of silver nanoparticle using Streptomyces sp. 09 PBT 005 and its antibacterial and cytotoxic properties

Science.gov (United States)

Saravana Kumar, P.; Balachandran, C.; Duraipandiyan, V.; Ramasamy, D.; Ignacimuthu, S.; Al-Dhabi, Naif Abdullah

2015-02-01

The application of microorganisms for the synthesis of nanoparticles as an eco-friendly and promising approach is welcome due to its non-toxicity and simplicity. The aim of this study was to synthesize silver nanoparticle using Streptomyces sp. (09 PBT 005). 09 PBT 005 was isolated from the soil sample of the agriculture field in Vengodu, Thiruvannamalai district, Tamil Nadu, India. 09 PBT 005 was subjected to molecular characterization by 16S rRNA sequence analysis. It was found that 09 PBT 005 belonged to Streptomyces sp. The isolate Streptomyces sp. 09 PBT 005 was inoculated in fermentation medium and incubated at 30 ºC for 12 days in different pH conditions. The 0.02 molar concentration showed good antibacterial activity against Gram-positive and Gram-negative bacteria at pH-7. The synthesis of silver nanoparticles was investigated by UV-Vis spectroscopy, scanning electron microscopy and Fourier Transform Infrared analysis. The synthesized AgNPs sizes were found to be in the dimensions ranging between 198 and 595 nm. The cytotoxicity of the synthesized nanoparticles was studied against A549 adenocarcinoma lung cancer cell line. It showed 83.23 % activity at 100 μl with IC 50 value of 50 μl. This method will be useful in the biosynthesis of nanoparticles.
First-principles study of electronic properties of Si doped FeSe{sub 0.9} alloys

Energy Technology Data Exchange (ETDEWEB)

Kumar, Sandeep, E-mail: sandeep@phy.iitb.ac.in; Singh, Prabhakar P. [Department of Physics, Indian Institute of Technology Bombay, Powai, Mumbai 400076 (India)

2016-05-23

We have performed first-principles study of electronic and superconducting properties of FeSe{sub 0.9-x}Si{sub x} (x = 0.0, 0.05) alloys using Korringa-Kohn-Rostoker Atomic Sphere Approximation within the coherent potential approximation (KKR-ASA-CPA). In our calculations, we used the local density approximation (LDA) for the exchange correlation potential. Our calculations show that these alloys are nonmagnetic in nature. We found that the substitution of Si at Se site into FeSe{sub 0.9} made subtle affects in the electronic structure with respect to the parent FeSe. The results have been analyzed in terms of changes in the density of states (DOS), band structures, Fermi surfaces and the superconducting transition temperature of FeSe{sub 0.9} and FeSe{sub 0.85}Si{sub 0.05} alloys.
SDU6 Interior Liner Testing & Evaluation

International Nuclear Information System (INIS)

Skidmore, T. E.

2016-01-01

Two liner materials (Marseal® M-3500 and REMA Chemoline® 4CN) proposed for use as a liner inside the Saltstone Disposal Unit 6 (SDU6) were subjected to specific ASTM tests (tensile and lap-shear) after immersion in 50% and 100% simulant solutions for 1000 hours at the Savannah River Ecology Laboratory. Both liner materials exhibited good resistance to the simulant chemistry, at least based on the tests performed and the test duration/conditions imposed. In lap-shear tests, both materials failed in the base material rather than peeling apart, confirming good adhesion. The REMA 4CN bromobutyl elastomer showed superior bonding characteristics and absence of warping or delamination at the conditions tested. The Marseal M-3500 material (PVC/EVA blend with polyester reinforcement) exhibited deformation and debonding in some locations. The cause of the deformation and delamination observed in the Marseal M-3500 material is not fully known, but possibly attributed to thermomechanical stress at immersion temperatures, and the thermoplastic nature of the material. The immersion temperature (68 °C) is slightly greater than the maximum use temperature limit quoted for the Marseal M- 3500 liner (65 °C), though the basis for the service limit is unknown. The testing performed was limited in scope and only for these two liner materials. These tests were primarily performed to screen for severe incompatibility or short-term degradation in Saltstone bleedwater simulants at bounding solution temperatures. Additional testing is recommended to assess long-term performance and the overall service life of the liner.
SDU6 Interior Liner Testing & Evaluation

Energy Technology Data Exchange (ETDEWEB)

Skidmore, T. E. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-10-14

Two liner materials (Marseal® M-3500 and REMA Chemoline® 4CN) proposed for use as a liner inside the Saltstone Disposal Unit 6 (SDU6) were subjected to specific ASTM tests (tensile and lap-shear) after immersion in 50% and 100% simulant solutions for 1000 hours at the Savannah River Ecology Laboratory. Both liner materials exhibited good resistance to the simulant chemistry, at least based on the tests performed and the test duration/conditions imposed. In lap-shear tests, both materials failed in the base material rather than peeling apart, confirming good adhesion. The REMA 4CN bromobutyl elastomer showed superior bonding characteristics and absence of warping or delamination at the conditions tested. The Marseal M-3500 material (PVC/EVA blend with polyester reinforcement) exhibited deformation and debonding in some locations. The cause of the deformation and delamination observed in the Marseal M-3500 material is not fully known, but possibly attributed to thermomechanical stress at immersion temperatures, and the thermoplastic nature of the material. The immersion temperature (68 °C) is slightly greater than the maximum use temperature limit quoted for the Marseal M- 3500 liner (65 °C), though the basis for the service limit is unknown. The testing performed was limited in scope and only for these two liner materials. These tests were primarily performed to screen for severe incompatibility or short-term degradation in Saltstone bleedwater simulants at bounding solution temperatures. Additional testing is recommended to assess long-term performance and the overall service life of the liner.
Chemical and physical oceanographic profile data collected from CTD casts aboard the Specialty Diver I in the Gulf of Mexico from 2010-09-10 to 2010-09-15 in response to the Deepwater Horizon oil spill event (NODC Accession 0069081)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Specialty Diver I in the Gulf of Mexico from 2010-09-10 to 2010-09-15 in response to the...
Chemical and physical oceanographic profile data collected from CTD casts aboard the Meg L. Skansi in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the Deepwater Horizon oil spill event (NODC Accession 0069076)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Meg L. Skansi in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...
Compatibility of butorphanol with granisetron in 0.9% sodium chloride injection packaged in glass bottles or polyolefin bags.

Science.gov (United States)

Chen, Fu-Chao; Xiong, Hui; Liu, Hui-Min; Fang, Bao-Xia; Li, Peng

2015-08-15

The stability of admixtures containing butorphanol and granisetron in polyolefin bags and glass bottles stored at 4 and 25 °C was studied. Commercial solutions of butorphanol tartrate and granisetron hydrochloride were combined and further diluted with 0.9% sodium chloride injection to final concentrations of butorphanol tartrate 0.08 mg/mL and granisetron 0.03 or 0.06 mg/mL; the resulting mixtures were packaged in polyolefin bags and glass bottles. The admixtures were assessed for periods of up to 48 hours after storage at 25 °C without protection from room light and up to 14 days at 4 °C with protection from room light. The chemical stability of the admixtures was evaluated by a validated high-performance liquid chromatography (HPLC) method and by measurement of pH values. Solution appearance and color were assessed by observing the samples against room light and dark backgrounds. HPLC analysis demonstrated that the percentages of the initial concentrations of butorphanol and granisetron in the various solutions remained above 97% during the testing period. No changes in color or turbidity were observed in any of the prepared solutions. Throughout this period, pH values remained stable. Admixtures of butorphanol tartrate 0.08 mg/mL and granisetron 0.03 or 0.06 mg/mL in 0.9% sodium chloride injection in polyolefin bags or glass bottles remained stable for 48 hours when stored at 25 °C exposed to room light and for 14 days when stored at 4 °C protected from room light. Copyright © 2015 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

PREFACE: International Conference on Computing in High Energy and Nuclear Physics (CHEP'09)

Science.gov (United States)

Gruntorad, Jan; Lokajicek, Milos

2010-11-01

Physics Milos Lokajicek (co-chair), Institute of Physics AS CR, v.v.i., Prague Vojtech Petracek, Czech Technical University in Prague, Faculty of Nuclear Sciences and Physical Engineering and especially the Programme Committee for their careful choice of conference contributions and their enormous work with organization of 340 post conference proceedings paper review Ludek Matyska (chair), CESNET Online Computing Volker Gülzow, DESY Jiri Masik, University of Manchester/on leave from Institute of Physics AS CR, Prague Event Processing Elizabeth Sexton-Kennedy, FNAL Tomas Davidek, Charles University, Prague Software Components, Tools and Databases Paolo Calafiura, LBNL Julius Hrivnac, LAL Track 4 Hardware and Computing Fabrics Takashi Sasaki, KEK Jiri Chudoba, Institute of Physics AS CR, Prague Grid Middleware and Networking Technologies Francesco Giacomini, CERN Ales Krenek, Masaryk University, Brno/CESNET Distributed Processing and Analysis Latchezar Betev, CERN Simon Lin, ASGC, Taipei Dagmar Adamova, Nuclear Physics Institute AS CR, Prague Collaborative Tools Eva Hladka, Masaryk University, Brno/CESNET Thank you to all who made CHEP'09 a success. Jan Gruntorad and Milos Lokajicek CHEP'09 Conference Chairs Prague, March 2010 The PDF and HTML files contain a list of all CHEP'09 contributions.
Zinc substituted ferrite nanoparticles with Zn{sub 0.9}Fe{sub 2.1}O{sub 4} formula used as heating agents for in vitro hyperthermia assay on glioma cells

Energy Technology Data Exchange (ETDEWEB)

Hanini, Amel [Interface Traitement Organisation et Dynamique des Systèmes (TODYS), Université Paris Diderot, Sorbonne Paris Cité, CNRS UMR-7086, 75013, Paris (France); Institut Cochin, Université Paris Descartes, Sorbonne Paris Cité, CNRS UMR-8104, INSERM U1016, 75005 Paris (France); Laboratoire de Physiologie Intégrée (LPI), Université de Carthage, 7021, Jarzouna (Tunisia); Lartigue, Lenaic [Matière et Systèmes Complexes (MSC), Université Paris Diderot, Sorbonne Paris Cité, CNRS UMR-7057, 75013, Paris (France); Gavard, Julie [Institut Cochin, Université Paris Descartes, Sorbonne Paris Cité, CNRS UMR-8104, INSERM U1016, 75005 Paris (France); Kacem, Kamel [Laboratoire de Physiologie Intégrée (LPI), Université de Carthage, 7021, Jarzouna (Tunisia); Wilhelm, Claire; Gazeau, Florence [Matière et Systèmes Complexes (MSC), Université Paris Diderot, Sorbonne Paris Cité, CNRS UMR-7057, 75013, Paris (France); Chau, François [Interface Traitement Organisation et Dynamique des Systèmes (TODYS), Université Paris Diderot, Sorbonne Paris Cité, CNRS UMR-7086, 75013, Paris (France); and others

2016-10-15

In this paper we investigate the ability of zinc rich ferrite nanoparticles to induce hyperthermia on cancer cells using an alternating magnetic field (AMF). First, we synthesized ferrites and then we analyzed their physico-chemical properties by transmission electron microscopy, X-ray diffraction and magnetic and magnetocalorimetric measurements. We found that the polyol-made magnetically diluted particles are of 11 nm in size. They are superparamagnetic at body temperature (310 K) with a low but non-negligible magnetization. Interestingly, as nano-ferrimagnets they exhibit a Curie temperature of 366 K, close to the therapeutic temperature range. Their effect on human healthy endothelial (HUVEC) and malignant glioma (U87-MG) cells was also evaluated using MTT viability assays. Incubated with the two cell lines, at doses ≤100 µg mL{sup −1} and contact times ≤4 h, they exhibit a mild in vitro toxicity. In these same operating biological conditions and coupled to AMF (700 kHz and 34.4 Oe) for 1 h, they rapidly induce a net temperature increase. In the case of tumor cells it reaches 4 K, making the produced particles particularly promising for self-regulated magnetically-induced heating in local glioma therapy. - Highlights: • Highly crystallized monodisperse 11 nm sized Zn{sub 0.9}Fe{sub 2.1}O{sub 4} particles were produced in polyol. • They exhibit a superparamagnetic behavior at 37 °C with a magnetization of 12 emu g{sup −1} at 50 kOe. • Their Curie temperature reaches 88 °C, close to the therapeutic hyperthermia temperatures. • Incubated with glioma cells and exposed to ac-magnetic field they induce a 4 °C temperature increase. • They can be considered as potential self-regulated heating probes for glioma therapy.
Prompt $K_{S}^{0}$ production in $pp$ collisions at $\\sqrt{s}$ = 0.9 TeV

CERN Document Server

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Agari, M; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alfonsi, M; Alvarez Cartelle, P; Alves Jr, A.A; Amato, S; Amhis, Y; Amoraal, J; Anderson, J; Antunes Nobrega, R; Appleby, R; Aquines Gutierrez, O; Arefyev, A; Arrabito, L; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Bagaturia, Y; Bailey, D.S; Balagura, V; Baldini, W; Barber, G; Barham, C; Barlow, R.J; Barsuk, S; Basiladze, S; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Bellunato, T; Belous, K; Belyaev, I; Benayoun, M; Bencivenni, G; Bernet, R; Bernhard, R.P; Bettler, M-O; van Beuzekom, M; Bibby, J.H; Bifani, S; Bizzeti, A; Bjrnstad, P.M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bochin, B; Bonaccorsi, E; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bos, E; Bowcock, T.J.V; Bozzi, C; Brambach, T; van den Brand, J; Brarda, L; Bressieux, J; Brisbane, S; Britsch, M; Brook, N.H; Brown, H; Brusa, S; Buchler-Germann, A; Bursche, A; Buytaert, J; Cadeddu, S; Caicedo Carvajal, J.M; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Cameron, W; Camilleri, L; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carroll, J; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Chadaj, B; Charles, M; Charpentier, Ph; Cheng, J; Chiapolini, N; Chlopik, A; Christiansen, J; Ciambrone, P; Cid Vidal, X; Clark, P.J; Clarke, P.E.L; Clemencic, M; Cliff, H.V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Conti, G; Contu, A; Cooke, P; Coombes, M; Corajod, B; Corti, G; Cowan, G.A; Currie, R; DAlmagne, B; DAmbrosio, C; DAntone, I; Da Silva, W; Dane, E; David, P; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J.M; De Paula, L; De Simone, P; Decamp, D; Decreuse, G; Degaudenzi, H; Deissenroth, M; Del Buono, L; Densham, C.J; Deplano, C; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Dima, M; Donleavy, S; Dornan, P; Dossett, D; Dovbnya, A; Dumps, R; Dupertuis, F; Dwyer, L; Dzhelyadin, R; Eames, C; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Eklund, L; d'Enterria, D; Esperante Pereira, D; Est`eve, L; Fanchini, E; Farber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Felici, G; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Flegel, W; Fontanelli, F; Forti, C; Forty, R; Fournier, C; Franek, B; Frank, M; Frei, C; Frosini, M; Fungueirino Pazos, J.L; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garrido, L; Gascon, D; Gaspar, C; Gaspar De Valenzuela Cue, A; Gassner, J; Gauvin, N; Gavillet, P; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gilitsky, Yu; Gligorov, V.V; Gobel, C; Golubkov, D; Golutvin, A; Gomes, A; Gong, G; Gong, H; Gordon, H; Grabalosa Gandara, M; Gracco, V; Graciani Diaz, R; Granado Cardoso, L.A; Grauges, E; Graziani, G; Grecu, A; Gregson, S; Guerrer, G; Gui, B; Gushchin, E; Guz, Yu; Guzik, Z; Gys, T; Haefeli, G; Haines, S.C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, P.F; He, J; Hennessy, K; Henrard, P; Hernando Morata, J.A; van Herwijnen, E; Hicheur, A; Hicks, E; Hilke, H.J; Hofmann, W; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R.S; Hutchcroft, D; Iacoangeli, F; Iakovenko, V; Iglesias Escudero, C; Ilgner, C; Imong, J; Jacobsson, R; Jahjah Hussein, M; Jamet, O; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; John, M; Johnson, D; Jones, C.R; Jost, B; Kapusta, F; Karbach, T.M; Kashchuk, A; Katvars, S; Keaveney, J; Kerzel, U; Ketel, T; Keune, A; Khalil, S; Khanji, B; Kim, Y.M; Knecht, M; Koblitz, S; Konoplyannikov, A; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kristic, R; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryashov, I; Kukulak, S; Kumar, R; Kvaratskheliya, T; La Thi, V.N; Lacarrere, D; Lai, A; Lambert, R.W; Lanfranchi, G; Langenbruch, C; Latham, T; Le Gac, R; Lees, J-P; Lef`evre, R; Leflat, A; Lefrancois, J; Lehner, F; Lenzi, M; Leroy, O; Lesiak, T; Li, L; Li, Y.Y; Li Gioi, L; Libby, J; Lieng, M; Lindner, R; Lindsey, S; Linn, C; Liu, B; Liu, G; Lochner, S; Lopes, J.H; Lopez Asamar, E; Lopez-March, N; Loveridge, P; Luisier, J; Mcharek, B; Machefert, F; Machikhiliyan, I.V; Maciuc, F; Maev, O; Magnin, J; Maier, A; Malde, S; Mamunur, R.M.D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Marki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martinez Santos, D; Massaferri, A; Mathe, Z; Matteuzzi, C; Matveev, V; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Mclean, C; Merk, M; Merkel, J; Merkin, M; Messi, R; Metlica, F.C.D; Miglioranzi, S; Minard, M-N; Moine, G; Monteil, S; Moran, D; Morant, J; Morris, J.V; Moscicki, J; Mountain, R; Mous, I; Muheim, F; Muresan, R; Murtas, F; Muryn, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nardulli, J; Nawrot, A; Nedos, M; Needham, M; Neufeld, N; Neustroev, P; Nicol, M; Nicolas, L; Nies, S; Niess, V; Nikitin, N; Noor, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Ostankov, A; Palacios, J; Palutan, M; Panman, J; Papadelis, A; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C.J; Passaleva, G; Patel, G.D; Patel, M; Paterson, S.K; Patrick, G.N; Patrignani, C; Pauna, E; Pauna (Chiojdeanu), C; Pavel (Nicorescu), C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D.L; Perez Trigo, E; Perez-Calero Yzquierdo, A; Perret, P; Pessina, G; Petrella, A; Petrolini, A; Picatoste Olloqui, E; Pie Valls, B; Piedigrossi, D; Pietrzyk, B; Pinci, D; Playfer, S; Plo Casasus, M; Poli-Lener, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Poss, S; Potterat, C; Powell, A; Pozzi, S; du Pree, T; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J.H; Rakotomiaramanana, B; Raniuk, I; Raven, G; Redford, S; Reece, W; dos Reis, A.C; Ricciardi, S; Riera, J; Rinnert, K; Roa Romero, D.A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Cobo, C; Rodriguez Perez, P; Rogers, G.J; Romanovsky, V; Rondan Sanabria, E; Rosello, M; Rospabe, G; Rouvinet, J; Roy, L; Ruf, T; Ruiz, H; Rummel, C; Rusinov, V; Sabatino, G; Saborido Silva, J.J; Sagidova, N; Sail, P; Saitta, B; Sakhelashvili, T; Salzmann, C; Sambade Varela, A; Sannino, M; Santacesaria, R; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savidge, T; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schmelling, M; Schmidt, B; Schneider, O; Schneider, T; Schopper, A; Schune, M-H; Schwemmer, R; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Serra, N; Serrano, J; Shao, B; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Sigurdsson, S; Simioni, E; Skottowe, H.P; Skwarnicki, T; Smale, N; Smith, A; Smith, A.C; Smith, N.A; Sobczak, K; Soler, F.J.P; Solomin, A; Somogy, P; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spiridenkov, E; Spradlin, P; Srednicki, A; Stagni, F; Stahl, S; Steiner, S; Steinkamp, O; Stenyakin, O; Stoica, S; Stone, S; Storaci, B; Straumann, U; Styles, N; Szczekowski, M; Szczypka, P; Szumlak, T; TJampens, S; Tarkovskiy, E; Teodorescu, E; Terrier, H; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Topp-Joergensen, S; Tran, M.T; Traynor, S; Trunk, U; Tsaregorodtsev, A; Tuning, N; Ukleja, A; Ullaland, O; Uwer, U; Vagnoni, V; Valenti, G; Van Lysebetten, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J.J; Veltri, M; Vervink, K; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, An; Voss, H; Wacker, K; Wandernoth, S; Wang, J; Ward, D.R; Webber, A.D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M.P; Williams, M; Wilson, F.F; Wishahi, J; Witek, M; Witzeling, W; Woodward, M.L; Wotton, S.A; Wyllie, K; Xie, Y; Xing, F; Yang, Z; Ybeles Smit, G; Young, R; Yushchenko, O; Zeng, M; Zhang, L; Zhang, Y; Zhelezov, A; Zverev, E

2010-01-01

The production of K_short mesons in pp collisions at a centre-of-mass energy of 0.9 TeV is studied with the LHCb detector at the Large Hadron Collider. The luminosity of the analysed sample is determined using a novel technique, involving measurements of the beam currents, sizes and positions, and is found to be 6.8 +/- 1.0 microbarn^-1. The differential prompt K_short production cross-section is measured as a function of the K_short transverse momentum and rapidity in the region 0 < pT < 1.6 GeV/c and 2.5 < y < 4.0. The data are found to be in reasonable agreement with previous measurements and generator expectations.
Mineralogy and environmental stability of slags from the Tsumeb smelter, Namibia

International Nuclear Information System (INIS)

Ettler, Vojtech; Johan, Zdenek; Kribek, Bohdan; Sebek, Ondrej; Mihaljevic, Martin

2009-01-01

Three types of smelting slags originating from historically different smelting technologies in the Tsumeb area (Namibia) were studied: (i) slags from processing of carbonate/oxide ore in a Cu-Pb smelter (1907-1948), (ii) slags from Cu and Pb smelting of sulphide ores (1963-1970) and (iii) granulated Cu smelting slags (1980-2000). Bulk chemical analyses of slags were combined with detailed mineralogical investigation using X-ray diffraction analysis (XRD), scanning electron microscopy (SEM/EDS) and electron microprobe (EPMA). The slags are significantly enriched in metals and metalloids: Pb (0.97-18.4 wt.%), Cu (0.49-12.2 wt.%), Zn (2.82-12.09 wt.%), Cd (12-6940 mg/kg), As (930-75,870 mg/kg) and Sb (67-2175 mg/kg). Slags from the oldest technology are composed of primary Ca- and Pb-bearing feldspars, spinels, complex Cu-Fe and Cu-Cr oxides, delafossite-mcconnellite phases and Ca-Pb arsenates. The presence of arsenates indicates that these slags underwent long-term alteration. More recent slags are composed of high-temperature phases: Ca-Fe alumosilicates (olivine, melilite), Pb- and Zn-rich glass, spinel oxides and small sulphide/metallic inclusions embedded in glass. XRD and SEM/EDS were used to study secondary alteration products developed on the surface of slags exposed for decades to weathering on the dumps. Highly soluble complex Cu-Pb-(Ca) arsenates (bayldonite, lammerite, olivenite, lavendulan) associated with litharge and hydrocerussite were detected. To determine the mineralogical and geochemical parameters governing the release of inorganic contaminants from slags, two standardized short-term batch leaching tests (European norm EN 12457 and USEPA TCLP), coupled with speciation-solubility modelling using PHREEQC-2 were performed. Arsenic in the leachate exceeded the EU regulatory limit for hazardous waste materials (2.5 mg/L). The toxicity limits defined by USEPA for the TCLP test were exceeded for Cd, Pb and As. The PHREEQC-2 calculation predicted that
Rational design of novel highly potent and selective phosphatidylinositol 4-kinase III-beta (PI4KB) inhibitors as broad-spectrum antiviral agents and tools for chemical biology

Czech Academy of Sciences Publication Activity Database

Mejdrová, Ivana; Humpolíčková, Jana; Nencka, Radim; Bouřa, Evžen

2017-01-01

Roč. 284, Suppl 1 (2017), s. 333 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR GJ15-21030Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : PI4KB * antivirals Subject RIV: CE - Biochemistry
Magnetoelectrochemistry of 4,4'-bis(dimethylamino)biphenyl and 4,4'-dinitrobiphenyl azacrown macrocyclic lactams

Energy Technology Data Exchange (ETDEWEB)

Domenech, Antonio [Departament de Quimica Analitica, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot, Valencia (Spain); Costero, Ana Maria; Banuls, Maria Jose; Aurell, Maria Jose [Departament de Quimica Organica, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot, Valencia (Spain)

2005-07-25

The voltammetric behaviour at carbon fibre microelectrodes under the application of static magnetic fields of two series of macrolactams containing in their structure 4,4'-bis(dimethylamino)biphenyl or 4,4'-dinitrobiphenyl groups in MeCN solution is described. The response of 4,4'-dinitrobiphenyl receptors is dominated by two successive one-electron reduction processes at -0.9 and -1.6 V versus AgCl/Ag. 4,4'-bis(dimethylamino)biphenyl-containing receptors display two one-electron oxidations above +0.8 and +1.0 V. In both cases, a dihedral/planar interconversion precedes the second electron transfer step. Upon application of moderate (0.05-0.2 T) static magnetic fields to the electrochemical cell, the rate of such dihedral/planar interconversion is lowered for both the reduction of 4,4'-dinitrobiphenyl receptors and the oxidation of 4,4'-bis(dimethylamino)biphenyl lactams. The electrochemical response of N-methylated receptors, for which different cisoid-cisoid, cisoid-transoid, and transoid-transoid forms exist, exhibits a significant peak splitting that can be associated to the presence of such conformational isomers. Application of magnetic fields produces a relative enhancement of some peaks that can be interpreted in terms of differential magnetoconvection involving such conformational isomers. (author)
Piezoresistance of Silicon and Strained Si0.9Ge0.1

DEFF Research Database (Denmark)

Richter, Jacob; Hansen, Ole; Larsen, A. Nylandsted

2005-01-01

We present experimentally obtained results of the piezoresistive effect in p-type silicon and strained Si0.9Ge0.1. Today, strained Si1-xGex is used for high speed electronic devices. This paper investigates if this area of use can be expanded to also cover piezoresistive micro electro mechanical...... systems (MEMS) devices. The measurements are performed on microfabricated test chips where resistors are defined in layers grown by molecular beam epitaxy on (0 0 1) silicon substrates. A uniaxial stress along the [1 1 0] direction is applied to the chip, with the use of a four point bending fixture....... The investigation covers materials with doping levels of N-A = 10(18) cm(-3) and NA = 1019 cm(-3), respectively. The results show that the pi(66) piezoresistive coefficient in strained Si0.9Ge0.1 is approximately 30% larger than the comparable pi(44) piezoresistive coefficient in silicon at a doping level of N...
NCBI nr-aa BLAST: CBRC-PTRO-09-0020 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PTRO-09-0020 ref|NP_000671.2| alpha-1A-adrenergic receptor isoform 1 [Homo sap...iens] sp|P35348|ADA1A_HUMAN Alpha-1A adrenergic receptor (Alpha 1A-adrenoceptor) (Alpha 1A-adrenoreceptor) (Alpha-1C adrenergic... receptor) (Alpha adrenergic receptor 1c) gb|AAB60353.1| adrenergic alpha-1c receptor pro...tein dbj|BAC05926.1| seven transmembrane helix receptor [Homo sapiens] gb|AAQ91331.1| adrenergic
Impedance spectroscopy studies on lead free Ba1-xMgx(Ti0.9Zr0.1)O3 ceramics

Science.gov (United States)

Ben Moumen, S.; Neqali, A.; Asbani, B.; Mezzane, D.; Amjoud, M.; Choukri, E.; Gagou, Y.; El Marssi, M.; Luk'yanchuk, Igor A.

2018-06-01

Ba1-xMgx(Ti0.9Zr0.1)O3 (x = 0.01 and 0.02) ceramics were prepared using the conventional solid state reaction. Rietveld refinement performed on X-ray diffraction patterns indicates that the samples are tetragonal crystal structure with P4mm space group. By increasing Mg content from 1 to 2% the unit cell volume decreased. Likewise, the grains size is greatly reduced from 10 μm to 4 μm. The temperature dependence of dielectric constants at different frequencies exhibited typical relaxor ferroelectric characteristic, with sensitive dependence in frequency and temperature for ac conductivity. The obtained activation energy values were correlated to the proposed conduction mechanisms.
Reduction of Direct Health Costs Associated with Pertussis Vaccination with Acellular Vaccines in Children Aged 0-9 Years with Pertussis in Catalonia (Spain).

Science.gov (United States)

Plans-Rubió, Pedro; Navas, Encarna; Godoy, Pere; Carmona, Gloria; Domínguez, Angela; Jané, Mireia; Muñoz-Almagro, Carmen; Brotons, Pedro

2018-05-14

The aim of this study was to assess direct health costs in children with pertussis aged 0-9 years who were vaccinated, partially vaccinated, and unvaccinated during childhood, and to assess the association between pertussis costs and pertussis vaccination in Catalonia (Spain) in 2012-2013. Direct healthcare costs included pertussis treatment, pertussis detection, and preventive chemotherapy of contacts. Pertussis patients were considered vaccinated when they had received 4-5 doses, and unvaccinated or partially vaccinated when they had received 0-3 doses of vaccine. The Chi square test and the odds ratios were used to compare percentages and the t test was used to compare mean pertussis costs in different groups, considering a p case after taking into account the effect of other study variables, and €200 per case after taking into account pertussis severity. Direct healthcare costs were lower in children with pertussis aged 0-9 years vaccinated with 4-5 doses of acellular vaccines than in unvaccinated or partially vaccinated children with pertussis of the same age.
Structural and biophysical characterization of the PI4KB:14-3-3 protein complex

Czech Academy of Sciences Publication Activity Database

Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

2017-01-01

Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 proteins Subject RIV: CE - Biochemistry
Demonstration of New Technologies Required for the Treatment of Mixed Waste Contaminated with {ge}260 ppm Mercury

Energy Technology Data Exchange (ETDEWEB)

Morris, M.I.

2002-02-06

The Resource Conservation and Recovery Act (RCRA) defines several categories of mercury wastes, each of which has a defined technology or concentration-based treatment standard, or universal treatment standard (UTS). RCRA defines mercury hazardous wastes as any waste that has a TCLP value for mercury of 0.2 mg/L or greater. Three of these categories, all nonwastewaters, fall within the scope of this report on new technologies to treat mercury-contaminated wastes: wastes as elemental mercury; hazardous wastes with less than 260 mg/kg [parts per million (ppm)] mercury; and hazardous wastes with 260 ppm or more of mercury. While this report deals specifically with the last category--hazardous wastes with 260 ppm or more of mercury--the other two categories will be discussed briefly so that the full range of mercury treatment challenges can be understood. The treatment methods for these three categories are as follows: Waste as elemental mercury--RCRA identifies amalgamation (AMLGM) as the treatment standard for radioactive elemental mercury. However, radioactive mercury condensates from retorting (RMERC) processes also require amalgamation. In addition, incineration (IMERC) and RMERC processes that produce residues with >260 ppm of radioactive mercury contamination and that fail the RCRA toxicity characteristic leaching procedure (TCLP) limit for mercury (0.20 mg/L) require RMERC, followed by AMLGM of the condensate. Waste with <260 ppm mercury--No specific treatment method is specified for hazardous wastes containing <260 ppm. However, RCRA regulations require that such wastes (other than RMERC residues) that exceed a TCLP mercury concentration of 0.20 mg/L be treated by a suitable method to meet the TCLP limit for mercury of 0.025 mg/L. RMERC residues must meet the TCLP value of {ge}0.20 mg/L, or be stabilized and meet the {ge}0.025 mg/L limit. Waste with {ge}260 ppm mercury--For hazardous wastes with mercury contaminant concentrations {ge}260 ppm and RCRA
Hazardous waste status of discarded electronic cigarettes

Energy Technology Data Exchange (ETDEWEB)

Krause, Max J.; Townsend, Timothy G., E-mail: ttown@ufl.edu

2015-05-15

Highlights: • Electronic cigarettes were tested using TCLP and WET. • Several electronic cigarette products leached lead at hazardous waste levels. • Lead was the only element that exceeded hazardous waste concentration thresholds. • Nicotine solution may cause hazardous waste classification when discarded unused. - Abstract: The potential for disposable electronic cigarettes (e-cigarettes) to be classified as hazardous waste was investigated. The Toxicity Characteristic Leaching Procedure (TCLP) was performed on 23 disposable e-cigarettes in a preliminary survey of metal leaching. Based on these results, four e-cigarette products were selected for replicate analysis by TCLP and the California Waste Extraction Test (WET). Lead was measured in leachate as high as 50 mg/L by WET and 40 mg/L by TCLP. Regulatory thresholds were exceeded by two of 15 products tested in total. Therefore, some e-cigarettes would be toxicity characteristic (TC) hazardous waste but a majority would not. When disposed in the unused form, e-cigarettes containing nicotine juice would be commercial chemical products (CCP) and would, in the United States (US), be considered a listed hazardous waste (P075). While household waste is exempt from hazardous waste regulation, there are many instances in which such waste would be subject to regulation. Manufactures and retailers with unused or expired e-cigarettes or nicotine juice solution would be required to manage these as hazardous waste upon disposal. Current regulations and policies regarding the availability of nicotine-containing e-cigarettes worldwide were reviewed. Despite their small size, disposable e-cigarettes are consumed and discarded much more quickly than typical electronics, which may become a growing concern for waste managers.
Hazardous waste status of discarded electronic cigarettes

International Nuclear Information System (INIS)

Krause, Max J.; Townsend, Timothy G.

2015-01-01

Highlights: • Electronic cigarettes were tested using TCLP and WET. • Several electronic cigarette products leached lead at hazardous waste levels. • Lead was the only element that exceeded hazardous waste concentration thresholds. • Nicotine solution may cause hazardous waste classification when discarded unused. - Abstract: The potential for disposable electronic cigarettes (e-cigarettes) to be classified as hazardous waste was investigated. The Toxicity Characteristic Leaching Procedure (TCLP) was performed on 23 disposable e-cigarettes in a preliminary survey of metal leaching. Based on these results, four e-cigarette products were selected for replicate analysis by TCLP and the California Waste Extraction Test (WET). Lead was measured in leachate as high as 50 mg/L by WET and 40 mg/L by TCLP. Regulatory thresholds were exceeded by two of 15 products tested in total. Therefore, some e-cigarettes would be toxicity characteristic (TC) hazardous waste but a majority would not. When disposed in the unused form, e-cigarettes containing nicotine juice would be commercial chemical products (CCP) and would, in the United States (US), be considered a listed hazardous waste (P075). While household waste is exempt from hazardous waste regulation, there are many instances in which such waste would be subject to regulation. Manufactures and retailers with unused or expired e-cigarettes or nicotine juice solution would be required to manage these as hazardous waste upon disposal. Current regulations and policies regarding the availability of nicotine-containing e-cigarettes worldwide were reviewed. Despite their small size, disposable e-cigarettes are consumed and discarded much more quickly than typical electronics, which may become a growing concern for waste managers
In-situ stabilization of the Geiger (C and M Oil) Superfund Site

International Nuclear Information System (INIS)

Andromalos, K.B.; Ameel, M.E.

1994-01-01

The Geiger (C and M Oil) Superfund Site is the first US Army Corps of Engineers managed soil remediation project which utilized the in-situ stabilization/solidification technique to remediate the soil. This project involved the remediation of approximately 23,000 cubic yards of contaminated soil. Contaminants of concern included chromium, lead, PCB'S, toluene, benzene, and other organic compounds. Clean-up criteria for the stabilized material was equal to the National Primary Drinking Water Regulations, when tested using the TCLP leachate extraction method. Chromium, lead, and toluene were the main contaminants of concern, with TCLP clean-up goals of 150, 15 and 1,000 parts per billion (ppb), respectively. This National Priorities List (NPL) site is located near Charleston, SC and was an abandoned old waste oil facility that utilized unlined shallow trenches for the storage of waste oil. This paper summarizes the initial testing programs and the final production work at the site. Extensive testing was performed throughout all phases of the project. This testing was performed for the purpose of mix optimization, quality assurance, and verification testing. Specific parameters tested included: TCLP testing of organics, metals and PCBs, permeability testing, and unconfirmed compression strength
Synthesis, Magnetization, and Electrical Transport Properties of Mn3Zn0.9Cu0.1N

Directory of Open Access Journals (Sweden)

Y. Yin

2013-01-01

Full Text Available We synthesized Mn3Zn0.9Cu0.1N by solid state reaction, and magnetic as well as electrical transport properties were investigated. It is found that Mn3Zn0.9Cu0.1N exhibits a first-order antiferromagnetism (AFM to paramagnetic (PM transition with the Néel temperature TN ~163 K, and substitution of Cu for Zn would favor ferromagnetism (FM state and weaken AFM ground state, leading to a convex curvature character of M(T curve. With high external fields 10 kOe–50 kOe, magnetic transition remains a robust AFM-PM feature while FM phase is completely suppressed. Thermal hysteresis of M(T under 500 Oe is also suppressed when the magnetic field exceeds 10 kOe. Mn3Zn0.9Cu0.1N exhibits a good metallic behavior except for a slope change around TN, which is closely related to AFM-PM magnetic transition. Compared with the first differential of resistivity with respect to temperature for (dρ/dTMn3ZnN in transition temperature range, the absolute value of (dρ/dTMn3Zn0.9Cu0.1N is much lower which is close to zero.
Study on uranium leaching behavior from coal fly ash samples

International Nuclear Information System (INIS)

Police, S.; Maity, S.; Chaudhary, D.K.; Sahu, S.K.; Pandit, G.G.

2017-01-01

Leachability of trace and toxic metals from coal fly ash (FA) poses significant environmental problems especially ground and surface water contamination. In the present study, leachability of U using batch leaching tests (i.e., at various leachate pH values) and using TCLP was studied. Results of pH variation study indicate that, U has higher leachability in acidic medium as compared to slightly alkaline medium. The leachable U concentrations observed in pH variation study are well below the WHO safety limits. In TCLP leachates, the leachable U concentrations are found to be higher than that observed in pH variation study. (author)
Peru : Country Program Evaluation for the World Bank Group, 2003-09

OpenAIRE

Independent Evaluation Group

2011-01-01

Since 2003, Peru has emerged as an open, rapidly growing economy. Over the review period of 2003-09, successive governments adopted policy platforms aimed at maintaining macroeconomic stability, furthering the private sector supply response, broadening participation in growth, improving social service delivery, and strengthening public institutions. The World Bank Group (WBG) supported each of ...
Magnetic and photoluminescence properties of Fe{sub 3}O{sub 4}-SiO{sub 2}-YP{sub 1-x}V{sub x}O{sub 4}:Dy{sup 3+} nanocomposites

Energy Technology Data Exchange (ETDEWEB)

Shi Jianhui; Liu Deming; Tong Lizhu; Yang Xuwei [College of Chemistry, Jilin University, Changchun, 130012 (China); Yang Hua, E-mail: huayang86@sina.com [College of Chemistry, Jilin University, Changchun, 130012 (China)

2011-10-20

Highlights: > Bifunctional Fe{sub 3}O{sub 4}-SiO{sub 2}-YP{sub 0.1}V{sub 0.9}O{sub 4}:Dy{sup 3+} nanocomposite was fabricated by a sol-gel method. > The structure, luminescent and magnetic properties were characterized of the nanocomposites. > It is shown that the nanocomposite with a core-shell structure has excellent fluorescent and magnetic properties. > The effects of the magnetic field on the luminescence properties of nanocomposite were discussed. - Abstract: In this paper, we report on the bifunctional Fe{sub 3}O{sub 4}-SiO{sub 2}-YP{sub 0.1}V{sub 0.9}O{sub 4}:Dy{sup 3+} nanocomposites were prepared by the solvothermal method and sol-gel method. The structure, photoluminescence (PL) and magnetic properties of the nanocomposites were characterized by means of X-ray diffraction, scanning electron microscope, transmission electron microscope, PL excitation and emission spectra and vibration sample magnetometry. It is shown that Fe{sub 3}O{sub 4}-SiO{sub 2}-YP{sub 0.1}V{sub 0.9}O{sub 4}:Dy{sup 3+} nanocomposites with a core-shell structure present excellent fluorescent and magnetic properties. Additionally, the effects of the magnetic field on the luminescence properties of nanocomposites were discussed.
Secondary Waste Cementitious Waste Form Data Package for the Integrated Disposal Facility Performance Assessment

Energy Technology Data Exchange (ETDEWEB)

Cantrell, Kirk J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Westsik, Joseph H. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Serne, R Jeffrey [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Um, Wooyong [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Cozzi, Alex D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2016-05-16

A review of the most up-to-date and relevant data currently available was conducted to develop a set of recommended values for use in the Integrated Disposal Facility (IDF) performance assessment (PA) to model contaminant release from a cementitious waste form for aqueous wastes treated at the Hanford Effluent Treatment Facility (ETF). This data package relies primarily upon recent data collected on Cast Stone formulations fabricated with simulants of low-activity waste (LAW) and liquid secondary wastes expected to be produced at Hanford. These data were supplemented, when necessary, with data developed for saltstone (a similar grout waste form used at the Savannah River Site). Work is currently underway to collect data on cementitious waste forms that are similar to Cast Stone and saltstone but are tailored to the characteristics of ETF-treated liquid secondary wastes. Recommended values for key parameters to conduct PA modeling of contaminant release from ETF-treated liquid waste are provided.

Emergence of influenza A (H1N1) PDM09 in the remote Islands of India--a molecular approach.

Science.gov (United States)

Muruganandam, N; Bhattacharya, D; Chaaithanya, I K; Bhattacharya, H; Reesu, R; Maile, A; Bharathi, G S J; Sugunan, A P; Vijayachari, P

2015-01-01

A disease outbreak of A (H1N1) PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1) PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1) PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1) PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1) PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. A (H1N1) PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
Electron-deficient N-alkyloyl derivatives of thieno[3,4-c]pyrrole-4,6-dione yield efficient polymer solar cells with open-circuit voltages > 1 v

KAUST Repository

Warnan, Julien; Cabanetos, Clement; Bude, Romain; El Labban, Abdulrahman; LI, LIANG; Beaujuge, Pierre

2014-01-01

Poly(benzo[1,2-b:4,5-b′]dithiophene-thieno[3,4-c]pyrrole-4,6-dione) (PBDTTPD) polymer donors yield some of the highest open-circuit voltages (V OC, ca. 0.9 V) and fill factors (FF, ca. 70%) in conventional bulk-heterojunction (BHJ) solar cells
A structural, magnetic and Moessbauer spectral study of the magnetocaloric Mn1.1Fe0.9P1-xGex compounds

International Nuclear Information System (INIS)

Sougrati, Moulay T; Hermann, Raphael P; Grandjean, Fernande; Long, Gary J; Brueck, E; Tegus, O; Trung, N T; Buschow, K H J

2008-01-01

The structural, magnetic and Moessbauer spectral properties of the magnetocaloric Mn 1.1 Fe 0.9 P 1-x Ge x compounds, with 0.19 1.1 Fe 0.9 P 0.74 Ge 0.26 . The temperature dependence of the magnetization reveals a ferromagnetic to paramagnetic transition with a Curie temperature between approximately 250 and 330 K and hysteresis width of 10 to 4 K, for 0.19 1.1 Fe 0.9 P 0.78 Ge 0.22 shows the largest isothermal entropy change of approximately 10 J/(kgKT) at 290 K. The Moessbauer spectra have been analysed with a binomial distribution of hyperfine fields correlated with a change in isomer shift and quadrupole shift, a distribution that results from the distribution of phosphorus and germanium among the near neighbours of the iron. The coexistence of paramagnetic and magnetically ordered phases in ranges of temperature of up to 50 K around the Curie temperature is observed in the Moessbauer spectra and is associated with the first-order character of the ferromagnetic to paramagnetic transition. The temperature dependence of the weighted average hyperfine field is well fitted within the magnetostrictive model of Bean and Rodbell. Good fits of the Moessbauer spectra could only be achieved by introducing a difference between the isomer shifts in the paramagnetic and ferromagnetic phases, a difference that is related to the magnetostriction and electronic structure change.
The Solar Neighborhood. XXXX. Parallax Results from the CTIOPI 0.9 m Program: New Young Stars Near the Sun

Energy Technology Data Exchange (ETDEWEB)

Bartlett, Jennifer L.; Finch, Charlie T. [U.S. Naval Observatory, Washington, DC 20392 (United States); Lurie, John C. [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Riedel, Adric [California Institute of Technology, Pasadena, CA 91125 (United States); Ianna, Philip A.; Henry, Todd J. [RECONS Institute, Chambersburg, PA 17201 (United States); Jao, Wei-Chun [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30302 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Subasavage, John P., E-mail: jennifer.bartlett@navy.mil, E-mail: charlie.finch@usno.navy.mil, E-mail: lurie@uw.edu, E-mail: adric.riedel@gmail.com, E-mail: philianna3@gmail.com, E-mail: thenry@chara.gsu.edu, E-mail: jao@chara.gsu.edu, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: jsubasavage@nofs.usno.navy.mil [U.S. Naval Observatory, Flagstaff, AZ 86001 (United States)

2017-10-01

As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr{sup −1}, including 2MASS J02511490-0352459, which exceeds 2.″0 yr{sup −1}. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11–22 mag and spectral types M3.0V–L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na i and K i gravity indicators, H α measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ∼120 Myr.
The Solar Neighborhood. XXXX. Parallax Results from the CTIOPI 0.9 m Program: New Young Stars Near the Sun

Science.gov (United States)

Bartlett, Jennifer L.; Lurie, John C.; Riedel, Adric; Ianna, Philip A.; Jao, Wei-Chun; Henry, Todd J.; Winters, Jennifer G.; Finch, Charlie T.; Subasavage, John P.

2017-10-01

As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr-1, including 2MASS J02511490-0352459, which exceeds 2.″0 yr-1. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11-22 mag and spectral types M3.0V-L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na I and K I gravity indicators, Hα measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ˜120 Myr.
Effectiveness of A(H1N1)pdm09 influenza vaccine in adults recommended for annual influenza vaccination.

NARCIS (Netherlands)

Gefenaite, G.; Tacken, M.; Bos, J.; Stirbu-Wagner, I.; Korevaar, J.C.; Stolk, R.P.; Wolters, B.; Bijl, M.; Postma, M.J.; Wilschut, J.; Nichol, K.L.; Hak, E.

2013-01-01

Introduction: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we conducted a study in the adults belonging to the risk groups to assess the A(H1N1)pdm09 MF59-adjuvanted influenza vaccine effectiveness. Methods: VE against influenza and/or pneumonia was
Stability of methadone hydrochloride in 0.9% sodium chloride injection in single-dose plastic containers.

Science.gov (United States)

Denson, D D; Crews, J C; Grummich, K W; Stirm, E J; Sue, C A

1991-03-01

The stability of methadone hydrochloride in 0.9% sodium chloride injection in flexible polyvinyl chloride containers was studied. Commercially available methadone hydrochloride 20 mg/mL and 25-mL single-dose bags of 0.9% sodium chloride injection were used. Six samples each were prepared at methadone hydrochloride concentrations of 1, 2, and 5 mg/mL. The solutions were stored at room temperature and were not protected from light. Immediately after preparation and after two, three, and four weeks of storage, each of the 18 samples was divided into three aliquots, each of which was analyzed in duplicate for methadone hydrochloride concentration by gas chromatography. There was less than 10% change in methadone hydrochloride concentration in any sample throughout the four-week study period. Methadone hydrochloride at concentrations of 1, 2, and 5 mg/mL prepared in commercially available flexible polyvinyl chloride containers of 0.9% sodium chloride injection and stored at room temperature without deliberate protection from light is stable for at least four weeks.
Process development and characterization of centrosymmetric semiorganic nonlinear optical crystal: 4-dimethylaminopyridine potassium chloride

Science.gov (United States)

Johnson, J.; Srineevasan, R.; Sivavishnu, D.

2018-06-01

Centrosymmetric semiorganic crystal 4-dimethylaminopyridine potassium chloride (4-DMAPKC) has been grown successfully by using slow evaporation solution growth technique. Powder x-ray diffraction shows the 4-DMAPKC crystal has good crystalline nature. Single crystal XRD shows that the grown 4-DMAPKC is cubic crystal system with cell parameters a = 3.09 Å, b = 3.09 Å, c = 3.09 Å. Investigation has been carried out to assign the Vibrational frequencies of the grown crystal by FTIR spectral studies. UVsbnd Visible NIR optical absorption spectral studies in the range of 200-1100 nm shows low absorption in UVsbnd Visible region with lower cutoff wave length at 261 nm and optical band gap energy was found as Eg = 5.52 eV. Optically transmittance spectral shows 4-DMAPKC crystal is very good transparency in UV-Visible NIR region. Thermogravimetry and differential thermal (TG-DTA) analysis were carried out. Dielectric studies of as grown crystal sample exhibit low dielectric constant and loss at higher frequencies and attests the nonlinear optical activity. Micro hardness studies of as grown crystal were discussed. Second harmonic generation (SHG) efficiency of the 4-DMAPKC is 0.69 times as that of KDP.
Measures for Assessing Student Attitudes toward Older People

Science.gov (United States)

Lin, Xiaoping; Bryant, Christina; Boldero, Jennifer

2011-01-01

Measuring medical and allied health students' attitudes towards older people has been identified as an important research area. The present study compared the use of implicit and explicit attitude measures. Sixty-five undergraduates completed one explicit measure, the Fraboni Scale of Ageism (FSA), (Fraboni, Saltstone, & Hughes, 1990) and one…
In vitro dynamics of supra-posomal structures in RSK4 rat sarcoma cells

Czech Academy of Sciences Publication Activity Database

Veselý, Pavel; Blase, C.; Matoušková, Eva; Sukhorukov, V.; Bereiter-Hahn, J.

2005-01-01

Roč. 40, č. 1 (2005), s. 36 ISSN 0035-9017. [Cytokinematics 2004. International Symposium on Microscopy of Live Cells in the Post Genomics Era /8./. 05.09.2004-07.09.2004, Hradec Králové] Institutional research plan: CEZ:AV0Z5052915 Keywords : RSK4 rat sarcoma cells * podosomes Subject RIV: EB - Genetics ; Molecular Biology
Statistical experimental design for saltstone mixtures

International Nuclear Information System (INIS)

Harris, S.P.; Postles, R.L.

1991-01-01

We used a mixture experimental design for determining a window of operability for a process at the Savannah River Site Defense Waste Processing Facility (DWPF). The high-level radioactive waste at the Savannah River Site is stored in large underground carbon steel tanks. The waste consists of a supernate layer and a sludge layer. 137 Cs will be removed from the supernate by precipitation and filtration. After further processing, the supernate layer will be fixed as a grout for disposal in concrete vaults. The remaining precipitate will be processed at the DWPF with treated waste tank sludge and glass-making chemicals into borosilicate glass. The leach rate properties of the supernate grout, formed from various mixes of solidified salt waste, needed to be determined. The effective diffusion coefficients for NO 3 and Cr were used as a measure of leach rate. Various mixes of cement, Ca(OH) 2 , salt, slag and flyash were used. These constituents comprise the whole mix. Thus, a mixture experimental design was used
Statistical experimental design for saltstone mixtures

International Nuclear Information System (INIS)

Harris, S.P.; Postles, R.L.

1992-01-01

The authors used a mixture experimental design for determining a window of operability for a process at the U.S. Department of Energy, Savannah River Site, Defense Waste Processing Facility (DWPF). The high-level radioactive waste at the Savannah River Site is stored in large underground carbon steel tanks. The waste consists of a supernate layer and a sludge layer. Cesium-137 will be removed from the supernate by precipitation and filtration. After further processing, the supernate layer will be fixed as a grout for disposal in concrete vaults. The remaining precipitate will be processed at the DWPF with treated waste tank sludge and glass-making chemicals into borosilicate glass. The leach-rate properties of the supernate grout formed from various mixes of solidified coefficients for NO 3 and chromium were used as a measure of leach rate. Various mixes of cement, Ca(OH) 2 , salt, slag, and fly ash were used. These constituents comprise the whole mix. Thus, a mixture experimental design was used. The regression procedure (PROC REG) in SAS was used to produce analysis of variance (ANOVA) statistics. In addition, detailed model diagnostics are readily available for identifying suspicious observations. For convenience, trillinear contour (TLC) plots, a standard graphics tool for examining mixture response surfaces, of the fitted model were produced using ECHIP
Emergence of influenza A (H1N1 PDM09 in the remote Islands of India - A molecular approach

Directory of Open Access Journals (Sweden)

N Muruganandam

2015-01-01

Full Text Available Background: A disease outbreak of A (H1N1 PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1 PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. Materials and Methods: During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1 PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Result: Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1 PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1 PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. Conclusion: A (H1N1 PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
Radon measurements at IC-09 well of Chingshui geothermal field (Taiwan): A case study

International Nuclear Information System (INIS)

Chen, Y.; Kuo, T.; Fan, K.; Liang, H.; Tsai, C.; Chiang, C.; Su, C.

2011-01-01

Radon concentration was monitored during the flow tests of well IC-09 at the Chingshui geothermal field. The radon concentration was found to increase from 54 ± 29 to 983 ± 65 Bq/m 3 as a step function of production time, or cumulative production. The observed radon behavior can be explained by a radial composite model with the carbonate scales deposited in the skin zone near the well. The radius of skin zone near well IC-09 can be estimated with radon data at about 20 m using a plug flow model. Monitoring natural radon during the well flow tests is a helpful tracer to diagnose the formation damage near the well.
Collision broadening and shift of the potassium 4p-ns and 4p-nd lines by argon

International Nuclear Information System (INIS)

Hohimer, J.P.; Gee, J.

1982-01-01

A two-step laser excitation technique was used to investigate the collisional broadening and shift of excited-state potassium transitions. Measurements were also made to determine that the broadening and shift constants were unaffected by optical pumping and saturation effects. Values for the argon collisional-broadening and shift constants for the potassium 4p-ns (n = 8--11) and 4p-nd (n = 6--9) transitions were determined from line-shape measurements. The values of these constants (in units of 10 -9 rad s -1 atom -1 cm 3 at 110 0 C) and their one-sigma statistical uncertainties are (4P/sub 1/2/-8S/sub 1/2/): γ = 17.03 +- 0.15, β = -14.58 +- 0.29; (4P/sub 3/2/-8S/sub 1/2/): γ = 17.45 +- 0.24, β = -14.71 +- 0.30; (4P/sub 1/2/-9S/sub 1/2/): γ = 17.29 +- 0.15, β = -24.16 +- 0.15; (4P/sub 3/2/-9S/sub 1/2/): γ = 17.35 +- 0.12, β = -24.16 +- 0.09; (4P/sub 1/2/-10S/sub 1/2/): γ = 15.62 +- 0.07, β = -29.49 +- 0.22; (4P/sub 3/2/-10S/sub 1/2/): γ = 15.80 +- 0.11, β = -29.86 +- 0.27; (4P/sub 1/2/-11S/sub 1/2/): γ = 12.69 +- 0.09, β = -33.66 +- 0.11; (4P/sub 3/2/-11S/sub 1/2/): γ = 12.85 +- 0.17, β = -35.10 +- 0.23; (4P/sub 1/2/-6D/sub 3/2/): γ = 13.75 +- 0.27, β = -8.28 +- 0.16; (4P/sub 3/2/-6D/sub 5/2/): γ = 15.15 +- 0.41, β = -8.96 +- 0.10; (4P/sub 1/2/-7D/sub 3/2/): γ = 18.60 +- 0.21, β = -16.00 +- 0.18; (4P/sub 3/2/-7D/sub 5/2/): γ = 19.64 +- 0.25, β = -15.16 +- 0.21; (4P/sub 1/2/-8D/sub 3/2/): γ = 19.94 +- 0.09, β = -24.14 +- 0.22; (4P/sub 3/2/-8D/sub 5/2/): γ = 19.80 +- 0.06, β = -24.16 +- 0.18; (4P/sub 1/2/-9D/sub 3/2/): γ = 17.40 +- 0.13, β = -30.17 +- 0.28; (4P/sub 3/2/-9D/sub 5/2/): γ = 17.50 +- 0.27, β = -29.47 +- 0.12. The overall accuracy of these measurements is estimated to be about 5%
Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

Directory of Open Access Journals (Sweden)

P.B. Lintongan

2004-06-01

Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.
Outcomes of influenza A(H1N1)pdm09 virus infection

DEFF Research Database (Denmark)

Lynfield, Ruth; Davey, Richard; Dwyer, Dominic E

2014-01-01

BACKGROUND: Data from prospectively planned cohort studies on risk of major clinical outcomes and prognostic factors for patients with influenza A(H1N1)pdm09 virus are limited. In 2009, in order to assess outcomes and evaluate risk factors for progression of illness, two cohort studies were...
Electrochemical synthesis of novel polymer based on (4-(2,3-dihydrothieno[3,4-6][1,4][dioxin-5-yl) aniline) in aqueous solution: Characterization and application

Energy Technology Data Exchange (ETDEWEB)

Shahhosseini, Leyla [Chemistry Department, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Nateghi, Mohammad Reza, E-mail: mnateghi@iauyazd.ac.ir [Chemistry Department, Yazd Branch, Islamic Azad University, Yazd (Iran, Islamic Republic of); Kazemipour, Maryam [Chemistry Department, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Borhani Zarandi, Mahmoud [Department of Physics, Yazd University, P.O. Box 97175/615, Yazd (Iran, Islamic Republic of)

2016-07-01

4-(2,3-dihydrothieno[3,4-6][1,4][dioxin-5-yl) aniline, an interesting novel monomer was successfully synthesized in which α-carbon on ethylenedioxythiophene was linked to aniline at para position. The structure of the monomer was approved by infrared (IR), gas chromatography-mass spectrometry (GC-MS) and {sup 1}H nuclear magnetic resonance ({sup 1}H NMR) spectroscopies. Poly (4-(2,3-dihydrothieno[3,4-6][1,4][dioxin-5-yl) aniline) and its composite with graphene were electrochemically synthesized in aqueous solution by cyclic potential sweep method. The Polymer was characterized by IR and UV–vis spectroscopies, scanning electron microscopy, cyclic voltammetry, and electrochemical impedance spectroscopy techniques. Electrochemical synthesis conditions were optimized to prepare high conducting and porous polymer so it can be efficiently used as a counter electrode in fabrication of dye sensitized solar cells. Photovoltaic experiments revealed that energy conversion efficiency of the solar cell fabricated using polymer composite (7.52%) is 21% greater than that prepared by Pt counter electrode (6.19%). - Highlights: • A Novel monomer comprising aniline and EDOT was synthesized by a simple process. • Poly (ANI-EDOT) was synthesized and characterized by cyclic potential sweep method. • The copolymer changes from yellow at −0.9 V to dark green color at +0.9 V reversibly. • Poly (ANI-EDOT)/graphene is porous with electrocatalytic effect on I{sub 3}{sup −} reduction.
Electrochemical synthesis of novel polymer based on (4-(2,3-dihydrothieno[3,4-6][1,4][dioxin-5-yl) aniline) in aqueous solution: Characterization and application

International Nuclear Information System (INIS)

Shahhosseini, Leyla; Nateghi, Mohammad Reza; Kazemipour, Maryam; Borhani Zarandi, Mahmoud

2016-01-01

4-(2,3-dihydrothieno[3,4-6][1,4][dioxin-5-yl) aniline, an interesting novel monomer was successfully synthesized in which α-carbon on ethylenedioxythiophene was linked to aniline at para position. The structure of the monomer was approved by infrared (IR), gas chromatography-mass spectrometry (GC-MS) and "1H nuclear magnetic resonance ("1H NMR) spectroscopies. Poly (4-(2,3-dihydrothieno[3,4-6][1,4][dioxin-5-yl) aniline) and its composite with graphene were electrochemically synthesized in aqueous solution by cyclic potential sweep method. The Polymer was characterized by IR and UV–vis spectroscopies, scanning electron microscopy, cyclic voltammetry, and electrochemical impedance spectroscopy techniques. Electrochemical synthesis conditions were optimized to prepare high conducting and porous polymer so it can be efficiently used as a counter electrode in fabrication of dye sensitized solar cells. Photovoltaic experiments revealed that energy conversion efficiency of the solar cell fabricated using polymer composite (7.52%) is 21% greater than that prepared by Pt counter electrode (6.19%). - Highlights: • A Novel monomer comprising aniline and EDOT was synthesized by a simple process. • Poly (ANI-EDOT) was synthesized and characterized by cyclic potential sweep method. • The copolymer changes from yellow at −0.9 V to dark green color at +0.9 V reversibly. • Poly (ANI-EDOT)/graphene is porous with electrocatalytic effect on I_3"− reduction.
Whole genome characterization of human influenza A(H1N1)pdm09 viruses isolated from Kenya during the 2009 pandemic.

Science.gov (United States)

Gachara, George; Symekher, Samuel; Otieno, Michael; Magana, Japheth; Opot, Benjamin; Bulimo, Wallace

2016-06-01

An influenza pandemic caused by a novel influenza virus A(H1N1)pdm09 spread worldwide in 2009 and is estimated to have caused between 151,700 and 575,400 deaths globally. While whole genome data on new virus enables a deeper insight in the pathogenesis, epidemiology, and drug sensitivities of the circulating viruses, there are relatively limited complete genetic sequences available for this virus from African countries. We describe herein the full genome analysis of influenza A(H1N1)pdm09 viruses isolated in Kenya between June 2009 and August 2010. A total of 40 influenza A(H1N1)pdm09 viruses isolated during the pandemic were selected. The segments from each isolate were amplified and directly sequenced. The resulting sequences of individual gene segments were concatenated and used for subsequent analysis. These were used to infer phylogenetic relationships and also to reconstruct the time of most recent ancestor, time of introduction into the country, rates of substitution and to estimate a time-resolved phylogeny. The Kenyan complete genome sequences clustered with globally distributed clade 2 and clade 7 sequences but local clade 2 viruses did not circulate beyond the introductory foci while clade 7 viruses disseminated country wide. The time of the most recent common ancestor was estimated between April and June 2009, and distinct clusters circulated during the pandemic. The complete genome had an estimated rate of nucleotide substitution of 4.9×10(-3) substitutions/site/year and greater diversity in surface expressed proteins was observed. We show that two clades of influenza A(H1N1)pdm09 virus were introduced into Kenya from the UK and the pandemic was sustained as a result of importations. Several closely related but distinct clusters co-circulated locally during the peak pandemic phase but only one cluster dominated in the late phase of the pandemic suggesting that it possessed greater adaptability. Copyright © 2016 Elsevier B.V. All rights reserved.

NCBI nr-aa BLAST: CBRC-MMUS-09-0191 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0191 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r
NCBI nr-aa BLAST: CBRC-GACU-09-0018 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0018 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenergic... receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AAB59487.1| alpha 1a/d adre...nergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenergic
NCBI nr-aa BLAST: CBRC-MMUS-09-0013 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0013 ref|NP_005950.1| melatonin receptor 1B [Homo sapiens] sp|P49286|M...TR1B_HUMAN Melatonin receptor type 1B (Mel-1B-R) (Mel1b melatonin receptor) gb|AAC50612.1| Mel1b-melatonin r...eceptor dbj|BAA92315.1| melatonin 1b receptor [Homo sapiens] gb|AAS00461.1| melatonin receptor 1B [Homo sapi...ens] gb|AAH69163.1| Melatonin receptor 1B [Homo sapiens] gb|EAW66891.1| melatonin receptor 1B [Homo sapiens] NP_005950.1 1e-164 80% ...
Association between the 2008-09 seasonal influenza vaccine and pandemic H1N1 illness during Spring-Summer 2009: four observational studies from Canada.

Directory of Open Access Journals (Sweden)

Danuta M Skowronski

2010-04-01

Full Text Available In late spring 2009, concern was raised in Canada that prior vaccination with the 2008-09 trivalent inactivated influenza vaccine (TIV was associated with increased risk of pandemic influenza A (H1N1 (pH1N1 illness. Several epidemiologic investigations were conducted through the summer to assess this putative association.(1 test-negative case-control design based on Canada's sentinel vaccine effectiveness monitoring system in British Columbia, Alberta, Ontario, and Quebec; (2 conventional case-control design using population controls in Quebec; (3 test-negative case-control design in Ontario; and (4 prospective household transmission (cohort study in Quebec. Logistic regression was used to estimate odds ratios for TIV effect on community- or hospital-based laboratory-confirmed seasonal or pH1N1 influenza cases compared to controls with restriction, stratification, and adjustment for covariates including combinations of age, sex, comorbidity, timeliness of medical visit, prior physician visits, and/or health care worker (HCW status. For the prospective study risk ratios were computed. Based on the sentinel study of 672 cases and 857 controls, 2008-09 TIV was associated with statistically significant protection against seasonal influenza (odds ratio 0.44, 95% CI 0.33-0.59. In contrast, estimates from the sentinel and three other observational studies, involving a total of 1,226 laboratory-confirmed pH1N1 cases and 1,505 controls, indicated that prior receipt of 2008-09 TIV was associated with increased risk of medically attended pH1N1 illness during the spring-summer 2009, with estimated risk or odds ratios ranging from 1.4 to 2.5. Risk of pH1N1 hospitalization was not further increased among vaccinated people when comparing hospitalized to community cases.Prior receipt of 2008-09 TIV was associated with increased risk of medically attended pH1N1 illness during the spring-summer 2009 in Canada. The occurrence of bias (selection, information or
Electronic structure of Rh-based CuRh0.9Mg0.1O2 oxide thermoelectrics

Science.gov (United States)

Vilmercati, P.; Martin, E.; Cheney, C. Parks; Bondino, F.; Magnano, E.; Parmigiani, F.; Sasagawa, T.; Mannella, N.

2013-03-01

The electronic structure of the Rh-based CuRh0.9Mg0.1O2 oxide thermoelectric compound has been studied with a multitechnique approach consisting of photoemission, x-ray absorption, and x-ray emission spectroscopies. The data indicate that the region of the valence band in the proximity of the Fermi level is dominated by Rh-derived states. These findings outline the importance of the electronic structure of the Rh ions for the large thermoelectric power in CuRh0.9Mg0.1O2 at high temperature.
Effect of A-site deficiency in LaMn_0_._9Co_0_._1O_3 perovskites on their catalytic performance for soot combustion

International Nuclear Information System (INIS)

Dinamarca, Robinson; Garcia, Ximena; Jimenez, Romel; Fierro, J.L.G.; Pecchi, Gina

2016-01-01

Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La_1_-_xAg_xMn_0_._9Co_0_._1O_3) and A-site deficient (La_1_-_xMn_0_._9Co_0_._1O_3_-_δ) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O_2-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag_2O segregated phases and the redox pair Mn"4"+/Mn"3"+. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn"4"+/Mn"3"+, which is attributed to the cubic crystalline structure.
Two-particle Bose--Einstein correlations in $pp$ collisions at $\\mathbf {\\sqrt{s} =}$ 0.9 and 7 TeV measured with the ATLAS detector

CERN Document Server

Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Almond, John; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batley, Richard; Battaglia, Marco; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boddy, Christopher Richard; Boehler, Michael; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Chen, Yujiao; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirkovic, Predrag; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Do Valle Wemans, André; Dobos, Daniel; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franconi, Laura; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hopkins, Walter; Horii, Yasuyuki; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Tadashi; Maeno Kataoka, Mayuko; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marques, Carlos; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarkisyan-Grinbaum, Edward; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R~Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

2015-10-01

The paper presents studies of Bose--Einstein Correlations (BEC) for pairs of like-sign charged particles measured in the kinematic range $p_{\\rm T} >$ 100 MeV and $|\\eta|<$ 2.5 in proton--proton collisions at centre-of-mass energies of 0.9 and 7 TeV with the ATLAS detector at the CERN Large Hadron Collider. The integrated luminosities are approximately 7 $\\mu$b$^{-1}$, 190 $\\mu$b$^{-1}$ and 12.4 nb$^{-1}$ for 0.9 TeV, 7 TeV minimum-bias and 7 TeV high-multiplicity data samples, respectively. The multiplicity dependence of the BEC parameters characterizing the correlation strength and the correlation source size are investigated for charged-particle multiplicities of up to 240. A saturation effect in the multiplicity dependence of the correlation source size is observed using the high-multiplicity 7 TeV data sample. The dependence of the BEC parameters on the average transverse momentum of the particle pair is also investigated.
A search for new vector mesons in the mass range between 0.9 and 2.2 GeV

International Nuclear Information System (INIS)

Bartalucci, S.; Bertolucci, S.; Bradaschia, C.; Fiori, M.; Fong, D.; McCorriston, T.; Giromini, P.; Guiducci, S.; Rippich, C.; Rohde, M.; Sermoneta, A.; Trasatti, L.

1977-01-01

The yield of e + e - pairs in the reaction γp→ pe + e - in the invariant mass region 0.9( 2 has been measured. The result, based on 2x10 4 events, shows with a statistical significance of 7 standard deviations a new resonance-like single structure with width 5(<=)30 MeV at M approximately 1100 MeV. For 1.2(<=)M (<=)1.8 GeV the data exhibit an additional wide structure, which can be accounted for by two broad resonances at about 1400 and 1700 MeV. The existence of the rho'(1250) and rho''(1600) is neither proven nor excluded by the data
Stability of i.v. admixture containing metoclopramide, diphenhydramine hydrochloride, and dexamethasone sodium phosphate in 0.9% sodium chloride injection.

Science.gov (United States)

Kintzel, Polly E; Zhao, Ting; Wen, Bo; Sun, Duxin

2014-12-01

The chemical stability of a sterile admixture containing metoclopramide 1.6 mg/mL, diphenhydramine hydrochloride 2 mg/mL, and dexamethasone sodium phosphate 0.16 mg/mL in 0.9% sodium chloride injection was evaluated. Triplicate samples were prepared and stored at room temperature without light protection for a total of 48 hours. Aliquots from each sample were tested for chemical stability immediately after preparation and at 1, 4, 8, 24, and 48 hours using liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis. Metoclopramide, diphenhydramine hydrochloride, and dexamethasone sodium phosphate were selectively monitored using multiple-reaction monitoring. Samples were diluted differently for quantitation using three individual LC-MS/MS methods. To determine the drug concentration of the three compounds in the samples, three calibration curves were constructed by plotting the peak area or the peak area ratio versus the concentration of the calibration standards of each tested compound. Apixaban was used as an internal standard. Linearity of the calibration curve was evaluated by the correlation coefficient r(2). Constituents of the admixture of metoclopramide 1.6 mg/mL, diphenhydramine hydrochloride 2 mg/mL, and dexamethasone sodium phosphate 0.16 mg/mL in 0.9% sodium chloride injection retained more than 90% of their initial concentrations over 48 hours of storage at room temperature without protection from light. The observed variability in concentrations of these three compounds was within the limits of assay variability. An i.v. admixture containing metoclopramide 1.6 mg/mL, diphenhydramine hydrochloride 2 mg/mL, and dexamethasone sodium phosphate 0.16 mg/mL in 0.9% sodium chloride injection was chemically stable for 48 hours when stored at room temperature without light protection. Copyright © 2014 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
Effect of Precursor Synthesis on Catalytic Activity of Co3O4 in N2O Decomposition.

Czech Academy of Sciences Publication Activity Database

Chromčáková, Ž.; Obalová, L.; Kovanda, F.; Legut, D.; Titov, A.; Ritz, M.; Fridrichová, D.; Michalik, S.; Kustrowski, P.; Jirátová, Květa

2015-01-01

Roč. 257, Part 1 (2015), s. 18-25 ISSN 0920-5861. [AWPAC2014 - International Symposium on Air & Water Pollution Abatement Catalysis. Krakow, 01.09.2014-05.09.2014] R&D Projects: GA ČR GA14-13750S Institutional support: RVO:67985858 Keywords : cobalt spinel * Co3O4 * N2O decomposition * precursor synthesis Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 4.312, year: 2015
Source removal strategy development for manufactured gas plant sites

International Nuclear Information System (INIS)

Golchin, J.; Nelson, S.

1994-01-01

A source removal action plan was developed by Midwest Gas and the Iowa Department of Natural Resources to address the source coal tar contamination within the underground gas holder basin at former Manufactured Gas Plant (MGP) sites. The procedure utilizes a mixture of coal, contaminated soil and coal rat sludge to provide a material that had suitable material handling characteristics for shipment and burning in high efficiency utility boilers. Screening of the mixture was required to remove oversized debris and ferrous metal. The resulting mixture did not exhibit toxic characteristics when tested under the Toxicity Characteristics Leaching Procedure (TCLP). Test results on the coal tar sludges have indicated that the more pure coal tar materials may fail the TCLP test and be classified as a RCRA hazardous waste. The processing procedure was designed to stabilize the coal tar sludges and render those sludges less hazardous and, as a result, able to pass the TCLP test. This procedure was adopted by the Edison Electric Institute to develop a national guidance document for remediation of MGP sites. The EPA Office of Solid Waste and Emergency Response recommended this strategy to the Regional Waste Management Directors as a practical tool for handling wastes that may exhibit the RCRA characteristics
Luminescence properties of Sr{sub 3-x-3y/2}M{sub x}Ce{sub y}AlO{sub 4}F (M=Ca, Ba, 0{<=}x{<=}0.9, 0.001{<=}y{<=}0.05) phosphors

Energy Technology Data Exchange (ETDEWEB)

Choi, Hye-Min [Department of Engineering in Energy and Applied Chemistry, Silla University, Busan 617-736 (Korea, Republic of); Park, Sangmoon, E-mail: spark@silla.ac.kr [Department of Engineering in Energy and Applied Chemistry, Silla University, Busan 617-736 (Korea, Republic of)

2012-09-15

Luminescent materials composed of Sr{sub 3-x-3y/2}M{sub x}Ce{sub y}AlO{sub 4}F (M=Ca, Ba, 0{<=}x{<=}0.9, 0.001{<=}y{<=}0.05) were prepared by the solid-state reaction method. X-ray diffraction (XRD) patterns of the obtained oxyfluorides are exhibited for indexing peak positions. Dynamic excitation and emission spectra of the Ce{sup 3+}-activated oxyfluoride phosphors are clearly monitored. The critical emission quenching as a function of Ce{sup 3+} contents in Sr{sub 2.5-3y/2}M{sub 0.5}Ce{sub y}AlO{sub 4}F phosphors is revealed at quite low concentrations of the activator. CIE coordinates of blue and green Sr{sub 2.5-3y/2}M{sub 0.5}Ce{sub y}AlO{sub 4}F phosphors are clearly measured. The relative quantum efficiency of Sr{sub 2.4985}Ca{sub 0.5}Ce{sub 0.005}AlO{sub 4}F based on the integrated emission is determined. The Sr{sub 3-x-3y/2}M{sub x}Ce{sub y}AlO{sub 4}F phosphors excited near 410 nm light could be prominent phosphors in applications of NUV-LED. - Highlights: Black-Right-Pointing-Pointer Blue and green emitting oxyfluoride phosphors are excitated near 410 nm Black-Right-Pointing-Pointer Ce{sup 3+}-activated oxyfluoride phosphors are quite effective to prepare white light for near-UV LED applications. Black-Right-Pointing-Pointer Gradual substitution of Ce{sup 3+} content in the oxyfluoride hosts changes CIE values.
Extended stability of intravenous 0.9% sodium chloride solution after prolonged heating or cooling.

Science.gov (United States)

Puertos, Enrique

2014-03-01

The primary objective of this study was to evaluate the stability and sterility of an intravenous 0.9% sodium chloride solution that had been cooled or heated for an extended period of time. Fifteen sterile 1 L bags of 0.9% sodium chloride solution were randomly selected for this experiment. Five bags were refrigerated at an average temperature of 5.2°C, 5 bags were heated at an average temperature of 39.2°C, and 5 bags were stored at an average room temperature of 21.8°C to serve as controls. All samples were protected from light and stored for a period of 199 days prior to being assayed and analyzed for microbial and fungal growth. There was no clinically significant difference in the mean sodium values between the refrigerated samples, the heated samples, and the control group. There were no signs of microbial or fungal growth for the duration of the study. A sterile intravenous solution of 0.9% sodium chloride that was heated or cooled remained stable and showed no signs of microbial or fungal growth for a period of 199 days. This finding will allow hospitals and emergency medical technicians to significantly extend the expiration date assigned to these fluids and therefore obviate the need to change out these fluids every 28 days as recommended by the manufacturer.
Influenza A (H1N1pdm09)-Related Critical Illness and Mortality in Mexico and Canada, 2014.

Science.gov (United States)

Dominguez-Cherit, Guillermo; De la Torre, Alethse; Rishu, Asgar; Pinto, Ruxandra; Ñamendys-Silva, Silvio A; Camacho-Ortiz, Adrián; Silva-Medina, Marco Antonio; Hernández-Cárdenas, Carmen; Martínez-Franco, Michel; Quesada-Sánchez, Alejandro; López-Gallegos, Guadalupe Celia; Mosqueda-Gómez, Juan L; Rivera-Martinez, Norma E; Campos-Calderón, Fernando; Rivero-Sigarroa, Eduardo; Hernández-Gilsoul, Thierry; Espinosa-Pérez, Lourdes; Macías, Alejandro E; Lue-Martínez, Dolores M; Buelna-Cano, Christian; Ramírez-García Luna, Ana-Sofía; Cruz-Ruiz, Nestor G; Poblano-Morales, Manuel; Molinar-Ramos, Fernando; Hernandez-Torre, Martin; León-Gutiérrez, Marco Antonio; Rosaldo-Abundis, Oscar; Baltazar-Torres, José Ángel; Stelfox, Henry T; Light, Bruce; Jouvet, Philippe; Reynolds, Steve; Hall, Richard; Shindo, Nikki; Daneman, Nick; Fowler, Robert A

2016-10-01

The 2009-2010 influenza A (H1N1pdm09) pandemic caused substantial morbidity and mortality among young patients; however, mortality estimates have been confounded by regional differences in eligibility criteria and inclusion of selected populations. In 2013-2014, H1N1pdm09 became North America's dominant seasonal influenza strain. Our objective was to compare the baseline characteristics, resources, and treatments with outcomes among critically ill patients with influenza A (H1N1pdm09) in Mexican and Canadian hospitals in 2014 using consistent eligibility criteria. Observational study and a survey of available healthcare setting resources. Twenty-one hospitals, 13 in Mexico and eight in Canada. Critically ill patients with confirmed H1N1pdm09 during 2013-2014 influenza season. None. The main outcome measures were 90-day mortality and independent predictors of mortality. Among 165 adult patients with H1N1pdm09-related critical illness between September 2013 and March 2014, mean age was 48.3 years, 64% were males, and nearly all influenza was community acquired. Patients were severely hypoxic (median PaO2-to-FIO2 ratio, 83 mm Hg), 97% received mechanical ventilation, with mean positive end-expiratory pressure of 14 cm H2O at the onset of critical illness and 26.7% received rescue oxygenation therapy with prone ventilation, extracorporeal life support, high-frequency oscillatory ventilation, or inhaled nitric oxide. At 90 days, mortality was 34.6% (13.9% in Canada vs 50.5% in Mexico, p Mexico (odds ratio, 7.76 [95% CI, 2.02-27.35]). ICUs in Canada generally had more beds, ventilators, healthcare personnel, and rescue oxygenation therapies. Influenza A (H1N1pdm09)-related critical illness still predominantly affects relatively young to middle-aged patients and is associated with severe hypoxemic respiratory failure. The local critical care system and available resources may be influential determinants of patient outcome.
Kaasaaitamine. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-97-09 / Jaan Sootak

Index Scriptorium Estoniae

Sootak, Jaan, 1948-

2009-01-01

Riigikohtu lahendist 3-1-1-97-09: I. V. kaitsja vandeadvokaat Aivar Ennoki kassatsioon Tallinna Ringkonnakohtu 15. juuni 2009. a kohtuotsuse peale kriminaalasjas I. V. süüdistuses KarS § 200 lg 2 p 7 - § 22 lg 3; § 215 lg 2 p 3 - § 22 lg 3 järgi
33 CFR 165.T09-1080 - Safety Zone and Regulated Navigation Area, Chicago Sanitary and Ship Canal, Romeoville, IL.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Safety Zone and Regulated Navigation Area, Chicago Sanitary and Ship Canal, Romeoville, IL. 165.T09-1080 Section 165.T09-1080 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY REGULATED NAVIGATION AREAS AND LIMITED...
Effectiveness of the influenza a(H1N1)PDM09 vaccine in adults recommended for annual influenza vaccination : A case-control study

NARCIS (Netherlands)

Gefenaite, Giedre; Tacken, Margot; Bos, Jens; Stirbu-Wagner, Irina; Korevaar, Joke C.; Stolk, Ronald P.; Wolters, Bert; Bijl, Marc; Postma, Maarten J.; Wilschut, Jan; Nichol, Kristin L.; Hak, Eelko

Background: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we aimed to assess the effectiveness of MF59-adjuvanted A(H1N1)pdm09 vaccine in a matched case-control study. Objectives: We aimed to assess the effectiveness of MF59- adjuvanted A(H1N1)pdm09
Reactive Hippocampal Astrocytes Display an Increased Expression of Trpv4 Channels After Cerebral Hypoxia/Ischemia

Czech Academy of Sciences Publication Activity Database

Butenko, Olena; Džamba, Dávid; Prajerová, Iva; Benešová, Jana; Honsa, Pavel; Benfenati, V.; Ferroni, S.; Anděrová, Miroslava

2011-01-01

Roč. 59, Supplement 1 (2011), S126-S127 ISSN 0894-1491. [European meeting on Glia l Cells in Health and Disease /10./. 13.09.2011-17.09.2011, Prague] Institutional research plan: CEZ:AV0Z50390703; CEZ:AV0Z50520701 Keywords : TRPV4 * astrocytes * cerebral hypoxia/ischemia Subject RIV: FH - Neurology
Analysis of failed ramps during the RHIC FY09 run

Energy Technology Data Exchange (ETDEWEB)

Minty, M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.

2014-08-15

The Relativistic Heavy Ion Collider (RHIC) is a versatile accelerator that supports operation with polarized protons of up to 250 GeV and ions with up to 100 GeV/nucleon. During any running period, various operating scenarios with different particle species, beam energies or accelerator optics are commissioned. In this report the beam commissioning periods for establishing full energy beams (ramp development periods) from the FY09 run are summarized and, for the purpose of motivating further developments, we analyze the reasons for all failed ramps.
Analysis of failed ramps during the RHIC FY09 run

International Nuclear Information System (INIS)

Minty, M.

2014-01-01

The Relativistic Heavy Ion Collider (RHIC) is a versatile accelerator that supports operation with polarized protons of up to 250 GeV and ions with up to 100 GeV/nucleon. During any running period, various operating scenarios with different particle species, beam energies or accelerator optics are commissioned. In this report the beam commissioning periods for establishing full energy beams (ramp development periods) from the FY09 run are summarized and, for the purpose of motivating further developments, we analyze the reasons for all failed ramps.

Stability of La0.6Sr0.4Co0.2Fe0.8O3/Ce0.9Gd0.1O2 cathodes during sintering and solid oxide fuel cell operation

DEFF Research Database (Denmark)

Kiebach, Ragnar; Zhang, Weiwei; Zhang, Wei

2015-01-01

Degradation phenomena of La0.58Sr0.4Co0.2Fe0.8O3/Ce0.9Gd0.1O2 (LSCF/CGO) cathodes were investigated via post-mortem analyses of an experimental solid oxide fuel cell (SOFC) stack tested at 700 °C for 2000 h using advanced electron microscopy (SEM-EDS, HR-TEM-EDS) and time-of-flight secondary ion...... mass spectrometry (TOF-SIMS). Similar studies were carried out on non-tested reference cells for comparison. The analysis focused on the LSCF/CGO cathode and the CGO barrier layer, as the cathode degradation can be a major contributor to the overall degradation in this type of SOFC. SEM-EDS and TOF......-SIMS were used to investigate inter-diffusion across the barrier layer - electrolyte interface and the barrier layer - cathode interface. In addition, TOF-SIMS data were employed to investigate impurity distribution before and after testing. HR-TEM-EDS was used to investigate possible phase segregation...
Report on the working conference on requirements engineering: foundation for software quality (REFSQ'09)

NARCIS (Netherlands)

Glinz, Martin; Heymans, Patrick; Persson, Anne; Sindre, Guttorm; Aurum, Aybüke; Madhavji, Nazim; Madhavji, N.; Paech, Barbara; Regev, Gil; Wieringa, Roelf J.

This report summarizes the presentations and discussions at REFSQ’09, the 15th International Working Conference on Requirements Engineering: Foundation for Software Quality which was held on June 8-9, 2009 in Amsterdam, The Netherlands.
Development of phosphate rock integrated with iron amendment for simultaneous immobilization of Zn and Cr(VI) in an electroplating contaminated soil.

Science.gov (United States)

Zhao, Ling; Ding, Zhenliang; Sima, Jingke; Xu, Xiaoyun; Cao, Xinde

2017-09-01

This study aims to develop an amendment for simultaneous immobilization of Zn and Cr(VI) in an abandoned electroplating contaminated soil. Nature phosphate rock was first activated with oxalic acid (O-PR) and then combined with FeSO 4 or zero-valent iron (ZVI) for immobilization of Zn and Cr(VI) from aqueous solutions. Finally, the optimized approach showing the highest immobilization ability in solution was applied in an electroplating contaminated soil. The O-PR combined with FeSO 4 was more effective in simultaneously removing Zn and Cr(VI) than the O-PR integrated with ZVI within the tested solution pH range of 5.5-8.5. Both O-PR with FeSO 4 and with ZVI removed over 95% of Zn from the solution; however, only 42-46% of Cr(VI) was immobilized by O-PR with ZVI, while O-PR with FeSO 4 almost precipitated all Cr(VI). Moreover, there were 75-95% Zn and 95-100% Cr(VI) remaining in the exhausted O-PR with FeSO 4 solid after toxicity characteristic leaching test (TCLP) while the exhausted O-PR with ZVI solid only retained 44-83% Zn and 32-72% Cr(VI). Zinc was immobilized mainly via formation of insoluble Fe-Zn phosphate co-precipitates, while iron-induced reduction of Cr(VI) into stable Cr(OH) 3 or Cr x Fe (1-x) (OH) 3 was responsible for Cr(VI) immobilization. Application of the O-PR integrated with FeSO 4 in the electroplating contaminated soil rapidly reduced the TCLP extractable Zn and Cr(VI) to below the standard limits, with decrease by 50% and 94%, respectively. This study revealed that combination of oxalic acid activated phosphate rock with FeSO 4 could be an effective amendment for remediation of Zn and Cr(VI) contaminated soil. Copyright © 2017 Elsevier Ltd. All rights reserved.
Structural basis for hijacking of human ACBD3 and PI4KB proteins by picornaviruses

Czech Academy of Sciences Publication Activity Database

Klíma, Martin; Chalupská, Dominika; Rozycki, B.; Humpolíčková, Jana; Smola, Miroslav; Horová, Vladimíra; Hexnerová, Rozálie; Veverka, Václav; Toth, D.; Balla, T.; Bouřa, Evžen

2017-01-01

Roč. 284, Suppl 1 (2017), s. 129 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR(CZ) GJ17-07058Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : picornavirus * ACBD3 * PI4KB Subject RIV: CE - Biochemistry
Autogenous shrinkage of Ducorit S5R ASTM C 1698-09 test method

DEFF Research Database (Denmark)

Damkilde, Lars

The report deals with experimental measurement of autogenous shrinkage of Ducorit S5R according to the test method ASTM C 1698-09. This test method measures the bulk strain of a sealed cementitious specimen, at constant temperature and not subjected to external forces, from the time of final...
THE APPLICATION OF NATURAL ZEOLITE FROM CIAMIS AS TiO2 PHOTOCATALYST SUPPORT FOR RHODAMINE B DYE PHOTODEGRADATION

Directory of Open Access Journals (Sweden)

Intan Cahaya Dani

2016-04-01

Full Text Available Heavy metals such as nickel and cadmium from the waste of human activities (industry, domestic, can lead the pollution and sediments deposited on the seabed. Water pH changing, can lead to the release (leaching metals in the sediment into the water body and then it will be bioaccumulated on biota arround the environment. To see the effect of pH changing on the release (leaching of these metals, extracting the sediment at pH variations has done (TCLP method. From the results of detection metals cadmium (Cd and nickel (Ni release studies, to see the hazards of cadmium and nickel metal, carried out a simulation of bioaccumulation test on biota using bioindikator Cyprinus carpio (OECD Guideline 305. Based on the analysis of data obtained in the nickel content in the sediment extract pH 3, 5 and 7 reached 2.55 to 27.94 µg/g, while for cadmium reaches 4.31 to 4.68 µg/g. Observation of metallic nickel and cadmium bioaccumulation in fish hass done for 28 days by looking at levels of cadmium and nickel on the gills of fish and meat. In the flesh of fish, the highest cadmium concentration of 3.179 µg/g while in the gills is 5.392 µg/g. The highest nickel concentrations in fish flesh is equal to 4.557 µg/g while for gill is equal to 10.417 µg/g. The study results indicate the presence of cadmium and nickel metal accumulation on biota. Keywords: TCLP method, biota, Cyprinus carpio
Comparison of the predictive performance of the BIG, TRISS, and PS09 score in an adult trauma population derived from multiple international trauma registries.

Science.gov (United States)

Brockamp, Thomas; Maegele, Marc; Gaarder, Christine; Goslings, J Carel; Cohen, Mitchell J; Lefering, Rolf; Joosse, Pieter; Naess, Paal A; Skaga, Nils O; Groat, Tahnee; Eaglestone, Simon; Borgman, Matthew A; Spinella, Philip C; Schreiber, Martin A; Brohi, Karim

2013-07-11

The BIG score (Admission base deficit (B), International normalized ratio (I), and Glasgow Coma Scale (G)) has been shown to predict mortality on admission in pediatric trauma patients. The objective of this study was to assess its performance in predicting mortality in an adult trauma population, and to compare it with the existing Trauma and Injury Severity Score (TRISS) and probability of survival (PS09) score. A retrospective analysis using data collected between 2005 and 2010 from seven trauma centers and registries in Europe and the United States of America was performed. We compared the BIG score with TRISS and PS09 scores in a population of blunt and penetrating trauma patients. We then assessed the discrimination ability of all scores via receiver operating characteristic (ROC) curves and compared the expected mortality rate (precision) of all scores with the observed mortality rate. In total, 12,206 datasets were retrieved to validate the BIG score. The mean ISS was 15 ± 11, and the mean 30-day mortality rate was 4.8%. With an AUROC of 0.892 (95% confidence interval (CI): 0.879 to 0.906), the BIG score performed well in an adult population. TRISS had an area under ROC (AUROC) of 0.922 (0.913 to 0.932) and the PS09 score of 0.825 (0.915 to 0.934). On a penetrating-trauma population, the BIG score had an AUROC result of 0.920 (0.898 to 0.942) compared with the PS09 score (AUROC of 0.921; 0.902 to 0.939) and TRISS (0.929; 0.912 to 0.947). The BIG score is a good predictor of mortality in the adult trauma population. It performed well compared with TRISS and the PS09 score, although it has significantly less discriminative ability. In a penetrating-trauma population, the BIG score performed better than in a population with blunt trauma. The BIG score has the advantage of being available shortly after admission and may be used to predict clinical prognosis or as a research tool to risk stratify trauma patients into clinical trials.
Design, Build & Test of a Double Crystal Monochromator for Beamlines I09 & I23 at the Diamond Light Source

Science.gov (United States)

Kelly, J.; Lee, T.; Alcock, S.; Patel, H.

2013-03-01

A high stability Double Crystal Monochromator has been developed at The Diamond Light Source for beamlines I09 and I23. The design specification was a cryogenic, fixed exit, energy scanning monochromator, operating over an energy range of 2.1 - 25 keV using a Si(111) crystal set. The novel design concepts are the direct drive, air bearing Bragg axis, low strain crystal mounts and the cooling scheme. The instrument exhibited superb stability and repeatability on the B16 Test Beamline. A 20 keV Si(555), 1.4 μrad rocking curve was demonstrated. The DCM showed good stability without any evidence of vibration or Bragg angle nonlinearity.
Imagery - Lake Ashtabula, ND - 2009 4-Band Orthophoto

Data.gov (United States)

Army Corps of Engineers, Department of the Army, Department of Defense — 4-band aerial imagery was collected by Fugro Horizons using the Leica ADS40(SH52) camera with 30 percent side overlap on 8/26/09. The flight height was 9,600 feet...
Immunogenicity and Safety of a Trivalent Inactivated Influenza Vaccine in Children 6 Months to 17 Years of Age, Previously Vaccinated with an AS03-Adjuvanted A(H1N1)Pdm09 Vaccine: Two Open-label, Randomized Trials.

Science.gov (United States)

Vesikari, Timo; Richardus, Jan Hendrik; Berglund, Johan; Korhonen, Tiina; Flodmark, Carl-Erik; Lindstrand, Ann; Silfverdal, Sven Arne; Bambure, Vinod; Caplanusi, Adrian; Dieussaert, Ilse; Roy-Ghanta, Sumita; Vaughn, David W

2015-07-01

During the influenza pandemic 2009-2010, an AS03-adjuvanted A(H1N1)pdm09 vaccine was used extensively in children 6 months of age and older, and during the 2010-2011 influenza season, the A(H1N1)pdm09 strain was included in the seasonal trivalent inactivated influenza vaccine (TIV) without adjuvant. We evaluated the immunogenicity and safety of TIV in children previously vaccinated with the AS03-adjuvanted A(H1N1)pdm09 vaccine. Healthy children were randomized (1:1) to receive TIV or a control vaccine. Children were aged 6 months to 9 years (n = 154) and adolescents 10-17 years (n = 77) when they received AS03-adjuvanted A(H1N1)pdm09 vaccine at least 6 months before study enrolment. Hemagglutination inhibition (HI) and neutralizing antibody responses against the A(H1N1)pdm09 strain were evaluated before (day 0) and at day 28 and month 6 after study vaccination. Reactogenicity was assessed during the 7 day postvaccination period, and safety was assessed for 6 months. At day 0, >93.9% of all children had HI titers ≥1:40 for the A(H1N1)pdm09 strain, which increased to 100% at both day 28 and month 6 in the TIV group. Between days 0 and 28, HI antibody geometric mean titers against A(H1N1)pdm09 increased by 9-fold and 4-fold in children 6 months to 9 years of age and 10-17 years of age, respectively. AS03-adjuvanted A(H1N1)pdm09 vaccine-induced robust immune responses in children that persisted into the next season, yet were still boosted by TIV containing A(H1N1)pdm09. The reactogenicity and safety profile of TIV did not appear compromised by prior receipt of AS03-adjuvanted A(H1N1)pdm09 vaccine.
Enhanced reducibility and electronic conductivity of Nb or W doped Ce0.9Gd0.1O1.95 - δ

DEFF Research Database (Denmark)

Chatzichristodoulou, Christodoulos; Ricote, Sandrine; Foghmoes, Søren Preben Vagn

2015-01-01

The transport and thermomechanical properties of acceptor (Gd) and donor (Nb or W) co-doped ceria were investigated. The solubility limit of Nb in Ce0.9Gd0.1O2 - δ (CGO10) exceeds 4 at.%, whereas that of W is approximately 2 at.%. Both the thermal and stoichiometric expansion coefficients...... are decreased relative to that of CGO10. Charge compensation of the donor dopants takes place primarily by annihilation of oxide ion vacancies, and a sharp decrease in ionic mobility is observed upon Nb or W doping of CGO10. On the other hand, the n-type electronic conductivity, associated with the reduction...... of Ce4+, increases upon doping with Nb or W, due to enhanced reducibility of cerium. This is beneficial for applications where electronic conductivity is also required, like oxygen permeation membranes. Modeling shows that 4 at.% Nb or W doped CGO10 will deliver higher oxygen fluxes than CGO10, due...
Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09

OpenAIRE

Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong

2016-01-01

Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B.?velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and vo...
Bases, Assumptions, and Results of the Flowsheet Calculations for the Decision Phase Salt Disposition Alternatives

Energy Technology Data Exchange (ETDEWEB)

Elder, H.H.

2001-07-11

The HLW salt waste (salt cake and supernate) now stored at the SRS must be treated to remove insoluble sludge solids and reduce the soluble concentration of radioactive cesium radioactive strontium and transuranic contaminants (principally Pu and Np). These treatments will enable the salt solution to be processed for disposal as saltstone, a solid low-level waste.
Fixation of chiral smectic liquid crystal (S)-(+)-4-(2-methyl-1-butyloyloxy)phenyl 4-[1-(propenoyloxy) butiloxy] benzoate using UV curing techniques

Energy Technology Data Exchange (ETDEWEB)

Afrizal,, E-mail: rizalunj04@yahoo.com; Nurdelima,; Umeir [Faculty of Mathemathics and Natural Science, University of State Jakarta, Jakarta (Indonesia); Hikam, Muhammad; Soegiyono, Bambang [Department of Materials Science, University of Indonesia, Depok (Indonesia); Riswoko, Asep [Center for Material Technology, BPPT, Jl. MH.Thamrin 8 Jakarta (Indonesia)

2014-03-24

Chiral Smectic Liquid Crystal (S)-(+)-4-(2-methyl-1-butyloyloxy)phenyl 4-[1-(propenoyloxy) butiloxy] benzoate has been synthesized using method of steglich esterification at room temperature. The mesomorphic behavior of chiral smectic at 55°C that showed schlieren texture in POM analysis. Fixation of structure chiral smectic liquid crystal by means of photopolymerization of monomer (S)-(+)-4-(2-methyl-1-butyloyloxy)phenyl 4-[1-(propenoyloxy) butiloxy] benzoate under UV irradiation which called UV curing techniques. The curing process using UV 3 lamps 100 volt at 60°C for an hour. The product of photopolymerization could be seen by analysis of FTIR spectra both monomer and polymer. FTIR spectra of monomer, two peaks for ester carbonyl and C-C double bond groups appeared at 1729.09 cm-1and 3123.46 cm{sup −1}. After UV curing process, peak for the carbonyl group at 1729.09 cm{sup −1} decreased and a new peak at 1160.21 cm{sup −1} appeared due to the carbonyl group attached to a C-C bond group and then peak at 3123.46 cm{sup −1} for C-C double bond group was disappeared.
Natural co-infection of influenza A/H3N2 and A/H1N1pdm09 viruses resulting in a reassortant A/H3N2 virus.

Science.gov (United States)

Rith, Sareth; Chin, Savuth; Sar, Borann; Y, Phalla; Horm, Srey Viseth; Ly, Sovann; Buchy, Philippe; Dussart, Philippe; Horwood, Paul F

2015-12-01

Despite annual co-circulation of different subtypes of seasonal influenza, co-infections between different viruses are rarely detected. These co-infections can result in the emergence of reassortant progeny. We document the detection of an influenza co-infection, between influenza A/H3N2 with A/H1N1pdm09 viruses, which occurred in a 3 year old male in Cambodia during April 2014. Both viruses were detected in the patient at relatively high viral loads (as determined by real-time RT-PCR CT values), which is unusual for influenza co-infections. As reassortment can occur between co-infected influenza A strains we isolated plaque purified clonal viral populations from the clinical material of the patient infected with A/H3N2 and A/H1N1pdm09. Complete genome sequences were completed for 7 clonal viruses to determine if any reassorted viruses were generated during the influenza virus co-infection. Although most of the viral sequences were consistent with wild-type A/H3N2 or A/H1N1pdm09, one reassortant A/H3N2 virus was isolated which contained an A/H1N1pdm09 NS1 gene fragment. The reassortant virus was viable and able to infect cells, as judged by successful passage in MDCK cells, achieving a TCID50 of 10(4)/ml at passage number two. There is no evidence that the reassortant virus was transmitted further. The co-infection occurred during a period when co-circulation of A/H3N2 and A/H1N1pdm09 was detected in Cambodia. It is unclear how often influenza co-infections occur, but laboratories should consider influenza co-infections during routine surveillance activities. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Ni4Ti3 precipitate structures in Ni-rich NiTi shape memory alloys

Czech Academy of Sciences Publication Activity Database

Holec, David; Bojda, Ondřej; Dlouhý, Antonín

2008-01-01

Roč. 481, Sp. Iss. (2008), s. 462-465 ISSN 0921-5093. [ESOMAT 2006. Bochum, 10.09.2006-15.09.2006] R&D Projects: GA ČR(CZ) GA106/05/0918 Institutional research plan: CEZ:AV0Z20410507 Keywords : NiTi shape memory alloys * Ni4Ti3 precipitates * Multi-step martensitic transformations Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.806, year: 2008
The Effects of Voluntary Return Programmes on Migration Flows in the Context of the 1973/74 and 2008/09 Economic Crises

Directory of Open Access Journals (Sweden)

Piotr Plewa

2012-10-01

Full Text Available The article analyses Spain’s voluntary return policies, including the programme instituted specifically to assist migrants affected by the 2008/09 crisis. Voluntary return policies were implemented in Europe in the context of the 1973/4 crisis. Just like the Western European programmes of the 1970s and the 1980s, the current Spanish voluntary return policies also only elicited the cooperation of small numbers of migrants and countries of origin. The article recommends four broader policy measures to tackle the emerging trend whereby a considerable proportion of migrants will stay in Spain rather than repatriate.
RESEARCH OF SYNERGETIC RELIABILITY OF PEARLITE-REDUCED STRUCTURAL STEEL 09G2FB

Directory of Open Access Journals (Sweden)

Gustov Yuriy Ivanovich

2012-10-01

Full Text Available The primary objective of the research is the synergetic reliability of perlite-reduced structural steel 09G2FB exposed to various thermal and mechanical treatments. In the aftermath of the above exposure, the steel in question has proved to assume a set of strength-related and plastic mechanical properties (σσδ and ψ.
[Transformation and mobility of arsenic in the rhizosphere and non-rhizosphere soils at different growth stages of rice].

Science.gov (United States)

Yang, Wen-Tao; Wang, Ying-Jie; Zhou, Hang; Yi, Kai-Xin; Zeng, Min; Peng, Pei-Qin; Liao, Bo-Han

2015-02-01

Speciation and bioavailability of arsenic in the rhizosphere and non-rhizosphere soils at different growth stages (tillering stage, jointing stage, booting stage, filling stage and maturing stage) of rice (Oryza sativa L.) were studied using toxicity characteristic leaching procedure (TCLP) and arsenic speciation analysis. Pot experiments were conducted and the soil samples were taken from a certain paddy soil in Hunan Province contaminated by mining industry. The results showed that: (1) With the extension of rice growth period, pH values and TCLP extractable arsenic levels in the rhizosphere and non-rhizosphere soils increased gradually. Soil pH and TCLP extractable arsenic levels in non-rhizosphere soils were higher than those in the rhizosphere soils at the same growth stage. (2) At the different growth stages of rice, contents of exchangeable arsenic (AE-As) in rhizosphere and non-rhizosphere soils were lower than those before the rice planting, and increased gradually with the extension of the rice growing period. Contents of Al-bound arsenic (Al-As), Fe-bound arsenic (Fe-As) and Ca-bound arsenic (Ca-As) increased gradually after rice planting, but not significantly. Residual arsenic (O-As) and total arsenic (T-As) decreased gradually after rice planting, by 37.30% and 14.69% in the rhizosphere soils and by 31.38% and 8.67% in the non-rhizosphere soils, respectively. (3) At the different growth stages of rice, contents of various forms of arsenic in the soils were in the following order: residual arsenic (O-As) > Fe-bound arsenic ( Fe-As) > Al-bound arsenic (Al-As) > Ca-bound arsenic (Ca-As) > exchangeable arsenic (AE-As). In the pH range of 5.0- 5.8, significant positive linear correlations were found between most forms of arsenic or TCLP extractable arsenic levels and pH values, while the Ca-bound arsenic was poorly correlated with pH values in the rhizosphere soils.
Advanced Power Batteries for Renewable Energy Applications 3.09

Energy Technology Data Exchange (ETDEWEB)

Shane, Rodney [East Penn Manufacturing Company, Inc., Lyon Station, PA (United States)

2011-12-01

This report describes the research that was completed under project title Advanced Power Batteries for Renewable Energy Applications 3.09, Award Number DE-EE0001112. The report details all tasks described in the Statement of Project Objectives (SOPO). The SOPO includes purchasing of test equipment, designing tooling, building cells and batteries, testing all variables and final evaluation of results. The SOPO is included. There were various types of tests performed during the project, such as; gas collection, float current monitoring, initial capacity, high rate partial state of charge (HRPSoC), hybrid pulse power characterization (HPPC), high rate capacity, corrosion, software modeling and solar life cycle tests. The grant covered a period of two years starting October 1, 2009 and ending September 30, 2011.

Fast Homoepitaxial Growth of 4H-SiC Films on 4° off-Axis Substrates in a SiH4-C2H4-H2 System

International Nuclear Information System (INIS)

Liu Bin; Sun Guo-Sheng; Liu Xing-Fang; Zhang Feng; Dong Lin; Zheng Liu; Yan Guo-Guo; Liu Sheng-Bei; Zhao Wan-Shun; Wang Lei; Zeng Yi-Ping; Wang Zhan-Guo; Li Xi-Guang; Yang Fei

2013-01-01

Homoepitaxial growth of 4H-SiC epilayers is conducted in a SiH 4 -C 2 H 4 -H 2 system by low pressure hot-wall vertical chemical vapor deposition (CVD). Thick epilayers of 45 μm are achieved at a high growth rate up to 26 μm/h under an optimized growth condition, and are characterized by using a Normaski optical microscope, a scanning electronic microscope (SEM), an atomic force microscope (AFM) and an x-ray diffractometer (XRD), indicating good crystalline quality with mirror-like smooth surfaces and an rms roughness of 0.9 nm in a 5 μm × 5μm area. The dependence of the 4H-SiC growth rate on growth conditions on 4° off-axis 4H-SiC substrates and its mechanism are investigated. It is found that the H 2 flow rate could influence the surface roughness, while good surface morphologies without Si droplets and epitaxial defects such as triangular defects could be obtained by increasing temperature
16 CFR Table 4 to Part 1512 - Relative Energy Distribution of Sources

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Relative Energy Distribution of Sources 4... SUBSTANCES ACT REGULATIONS REQUIREMENTS FOR BICYCLES Pt. 1512, Table 4 Table 4 to Part 1512—Relative Energy Distribution of Sources Wave length (nanometers) Relative energy 380 9.79 390 12.09 400 14.71 410 17.68 420 21...
FY09 recycling opportunity assessment for Sandia National Laboratories/New Mexico.

Energy Technology Data Exchange (ETDEWEB)

McCord, Samuel Adam

2010-07-01

This Recycling Opportunity Assessment (ROA) is a revision and expansion of the FY04 ROA. The original 16 materials are updated through FY08, and then 56 material streams are examined through FY09 with action items for ongoing improvement listed for most. In addition to expanding the list of solid waste materials examined, two new sections have been added to cover hazardous waste materials. Appendices include energy equivalencies of materials recycled, trends and recycle data, and summary tables of high, medium, and low priority action items.
Assessing Metal Mobilization from Industrially Lead-Contaminated Soils Located at an Urban Site

Science.gov (United States)

A series of leaching and partitioning tests (Toxicity Characteristic Leaching Procedure (TCLP), Synthetic Precipitation Leaching Procedure (SPLP), Controlled Acidity Leaching Protocol (CALP), Acid Neutralization Capacity (ANC), and sequential extraction) were applied to three dif...
Consumer Behaviour: a Bibliometric Study in Enanpads 2007-09 Comportamento do Consumidor: Um Estudo Bibliométrico nos Enanpads 2007-09

Directory of Open Access Journals (Sweden)

Patrícia Prado Faria

2011-12-01

Full Text Available The fundamental role of knowledge creation is to serve as a reference for practitioners and for researchers. Therefore, the comprehension of the knowledge status referring to a certain subject, in a certain moment, is necessary for science evolution. This article is a bibliometric research, studying the state of art of the articles approved for publication in 2007-09 Enanpads in its Consumer Behaviour theme of interest in the Marketing Academic Division. The quantitative distribution of the articles was studied, along with the number of authors by article, the institutions that took part in the congresses considering their geographic region, their state and their capital origin, the frequency of the researchers´ participation, their affiliation, and methodological aspects of the articles. Among the various conclusions brought by this research, it was found that the referred theme remains important in the congress, that the government schools of southern and southeastern Brazil have a predominant presence, and that the quantitative approach remains dominant for researchersO papel fundamental da produção do conhecimento é o de servir de referência para praticantes e para estudiosos. Portanto, a compreensão do estado de conhecimento sobre determinado tema, em determinado momento, é necessária ao processo de evolução da ciência. Este artigo contribui com levantamento bibliométrico na área de Marketing, pesquisando o estado da arte dos trabalhos aprovados nos Enanpads do triênio 2007-09 na Divisão Acadêmica Marketing, especificamente no tema de interesse Comportamento do Consumidor. Foram avaliados a distribuição quantitativa dos trabalhos, o número de autores por trabalho, as instituições participantes dos eventos, suas representatividades estaduais, regionais e por origem do capital, a intensidade da participação dos pesquisadores por instituição de afiliação, e aspectos metodológicos dos artigos apresentados. Dentre as
The 4p-5d, 6d and 4p-6s, 7s transitions of Mo IX

International Nuclear Information System (INIS)

Khatoon, S.; Chaghtai, M.S.Z.; Rahimullah, K.

1979-01-01

The transitions 4p-5d, 6d and 4p-6s, 7s have been studied for the first time in Mo IX. The authors have identified 42 4p-5d, 36 4p-6d, 22 4p-6s and 22 4p-7s transitions, establishing 16 4p 3 5d, 14 4p 3 6d and all the ten 4p 3 6s, 7s levels of the spectrum concerned. The ionization energy is estimated to be (1 323 700 +- 700)cm -1 or (164.11 +- 0.09)eV. The spectrum was recorded in sliding and open spark discharges with a 5 m grazing incidence spectrograph of Lund University (Sweden) from about 40 A to 440 A. (Auth.)
Advantages of Stainless Steel Sieves as Support for Catalytic N2O Decomposition over K-doped Co3O4.

Czech Academy of Sciences Publication Activity Database

Klyushina, A.; Pacultová, K.; Krejčová, S.; Slowik, G.; Jirátová, Květa; Kovanda, F.; Ryczkowski, J.; Obalová, L.

2015-01-01

Roč. 257, Part 1 (2015), s. 2-10 ISSN 0920-5861. [AWPAC2014 - International Symposium on Air & Water Pollution Abatement Catalysis. Krakow, 01.09.2014-05.09.2014] R&D Projects: GA ČR GA14-13750S Institutional support: RVO:67985858 Keywords : N2O catalytic decomposition * Co3O4 * stainless steel support * potassium promoter * TiO2 support Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 4.312, year: 2015
4-Deoxy-substrates for B-N-acetylhexosaminidases: How to make use of their loose specificity

Czech Academy of Sciences Publication Activity Database

Slámová, Kristýna; Gažák, Radek; Bojarová, Pavla; Kulik, Natallia; Ettrich, Rüdiger; Pelantová, Helena; Sedmera, Petr; Křen, Vladimír

2010-01-01

Roč. 20, č. 8 (2010), s. 1002-1009 ISSN 0959-6658 R&D Projects: GA ČR GP203/09/P024; GA ČR GD305/09/H008; GA MŠk(CZ) LC06010 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z60870520 Keywords : beta-N-acetylhexosaminidase * 4-deoxy-glycoside * enzymatic synthesis Subject RIV: CC - Organic Chemistry Impact factor: 3.791, year: 2010
Development of 650 MHz (β=0.9) single-cell SCRF cavity

International Nuclear Information System (INIS)

Bagre, M.; Jain, V.; Yedle, A.; Maurya, T.; Yadav, A.; Puntambekar, A.; Goswami, S.G.; Choudhary, R.S.; Sandha, S.; Dwivedi, J.; Kane, G.V.; Mahawar, A.; Mohania, P.; Shrivastava, P.; Sharma, S.; Gupta, R.; Sharma, S.D.; Joshi, S.C.; Mistri, K.K.; Prakash, P.N.

2013-01-01

Raja Ramanna Centre for Advanced Technology has initiated the work on development of Superconducting Radio Frequency (SCRF) cavities and associated technologies as part of R and D activities for upcoming Spallation Neutron Source (SNS) project involving superconducting Linear Accelerator (LINAC). It is planned to use 650 MHz SCRF cavities for the medium and high energy section of the proposed LINAC. Under Indian Institution Fermilab Collaboration (IIFC), Raja Ramanna Centre for Advanced Technology is also working on development of 650 MHz (β=0.9) SCRF cavities proposed to be used in the high energy section of Project-X at FNAL. The work has been initiated with design and development of 650 MHz single cell SCRF cavity. FE analysis was done to estimate change in frequency with temperature as well as to estimate the frequency of the cavity at different cavity manufacturing stages. The development cycle comprises of design and manufacturing of forming tooling, machining, welding and RF measurement fixtures as well as design for manufacturing. The half-cell and beam tubes forming and machining of all parts were done using in-house facilities. The Electron beam welding was carried out at Inter-University Accelerator Centre (IUAC), New Delhi under a MoU. One 650 MHz single cell SCRF cavity has been recently manufactured. In this paper we present the development efforts on manufacturing and pre-qualification of 650 MHz (β=0.9) single cell SCRF cavity. (author)
Development of new exploration tools for seabed mineral resources - Result of R/V YOKOSUKA research cruise YK09-09 -

Science.gov (United States)

Harada, M.; Sayanagi, K.; Kasaya, T.; Sawa, T.; Goto, T.; Tada, N.; Ichihara, H.; Asada, M.; Nakajima, T.; Isezaki, N.

2009-12-01

Detailed information on subsurface structure under seafloor is necessary for the estimation of seabed resources such as the hydrothermal deposit and methane hydrate. Although advantages of geophysical exploration near seafloor are expected for the seabed resource survey, efficient method has not been well-established. The authors started a project to develop exploration tools for seabed resources under the financial support of MEXT-Japan. We carry out research and development mainly regarding measurement of the magnetic field with high-resolution and high-sampling rate electric exploration devices with accurately controlled active source signals. Developed tools will be mounted underwater platforms such as deep-tow system, ROV (remotely operated vehicle), and AUV (autonomous undersea vehicle). We carried out the research cruise (vessel: JAMSTEC R/V YOKOSUKA YK09-09, cruise period: 19-29 July 2009, area surveyed: Kumano-nada, off Kii Peninsula, Japan) to investigate the performance of developed equipments for magnetic exploration. We mounted an Overhauser and two flux-gate magnetometers on the deep-tow and the AUV URASHIMA. To inspect the efficiency of equipments, it is better to measure the magnetic anomaly which is caused by known magnetic source. Therefore, we made a magnetic target which is consisted of 50 neodymium magnets. Before the navigation, the magnetic target was put under water and its position was measured by the acoustic method. The depth of target is about 2,050 meters, and the measurement was performed in the circle of a radius of about 300 meters. The vehicles were navigated at heights of 25 meters for AUV, and about 15 meters for deep-tow. Each of underwater navigation was practiced for two times. Both performances were carried out successfully, which means that we detected the significant magnetic anomalies caused by the target. We will be able to estimate three-dimensional distribution of anomalous magnetic field, and the source property of
LLNL Contribution to LLE FY09 Annual Report: NIC and HED Results

International Nuclear Information System (INIS)

Heeter, R.F.; Landen, O.L.; Hsing, W.W.; Fournier, K.B.

2009-01-01

In FY09, LLNL led 238 target shots on the OMEGA Laser System. Approximately half of these LLNL-led shots supported the National Ignition Campaign (NIC). The remainder was dedicated to experiments for the high-energy-density stewardship experiments (HEDSE). Objectives of the LLNL led NIC campaigns at OMEGA included: (1) Laser-plasma interaction studies in physical conditions relevant for the NIF ignition targets; (2) Demonstration of Tr = 100 eV foot symmetry tuning using a reemission sphere; (3) X-ray scattering in support of conductivity measurements of solid density Be plasmas; (4) Experiments to study the physical properties (thermal conductivity) of shocked fusion fuels; (5) High-resolution measurements of velocity nonuniformities created by microscopic perturbations in NIF ablator materials; (6) Development of a novel Compton Radiography diagnostic platform for ICF experiments; and (7) Precision validation of the equation of state for quartz. The LLNL HEDSE campaigns included the following experiments: (1) Quasi-isentropic (ICE) drive used to study material properties such as strength, equation of state, phase, and phase-transition kinetics under high pressure; (2) Development of a high-energy backlighter for radiography in support of material strength experiments using Omega EP and the joint OMEGA-OMEGA-EP configuration; (3) Debris characterization from long-duration, point-apertured, point-projection x-ray backlighters for NIF radiation transport experiments; (4) Demonstration of ultrafast temperature and density measurements with x-ray Thomson scattering from short-pulse laser-heated matter; (5) The development of an experimental platform to study nonlocal thermodynamic equilibrium (NLTE) physics using direct-drive implosions; (6) Opacity studies of high-temperature plasmas under LTE conditions; and (7) Characterization of copper (Cu) foams for HEDSE experiments.
G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements

Energy Technology Data Exchange (ETDEWEB)

Silva, Cleuton de Souza [Instituto de Química, Universidade Estadual de Campinas, Barão Geraldo, P.O. Box 6154, 13083-970 Campinas, São Paulo (Brazil); Instituto de Ciências Exatas e Tecnologia, Universidade Federal do Amazonas, Campus de Itacoatiara, 69100-021 Itacoatiara, Amazonas (Brazil); Pereira, Douglas Henrique [Departamento de Ciências Exatas e Biotecnológicas, Universidade Federal do Tocantins, Campus de Gurupi, 77410-530 Gurupi, Tocantins (Brazil); Custodio, Rogério, E-mail: roger@iqm.unicamp.br [Instituto de Química, Universidade Estadual de Campinas, Barão Geraldo, P.O. Box 6154, 13083-970 Campinas, São Paulo (Brazil)

2016-05-28

The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol{sup −1}, while the original method presents a deviation corresponding to 0.83 kcal mol{sup −1}. The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol{sup −1}) is compared to 1.29 kcal mol{sup −1} from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol{sup −1}, the G4CEP deviation is ±2.72 kcal mol{sup −1}. Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.
Charged-particle multiplicity distributions over a wide pseudorapidity range in proton-proton collisions at √(s) = 0.9, 7, and 8 TeV

Energy Technology Data Exchange (ETDEWEB)

Acharya, S. [Variable Energy Cyclotron Centre, Kolkata (India); Adamova, D. [Academy of Sciences of the Czech Republic, Rez u Prahy (Czech Republic). Nuclear Physics Inst.; Adolfsson, J. [Lund Univ. (Sweden). Div. of Experimental High Energy Physics; Collaboration: ALICE Collaboration; and others

2017-12-15

We present the charged-particle multiplicity distributions over a wide pseudorapidity range (-3.4<η<5.0) for pp collisions at √(s) = 0.9, 7, and 8 TeV at the LHC. Results are based on information from the Silicon Pixel Detector and the Forward Multiplicity Detector of ALICE, extending the pseudorapidity coverage of the earlier publications and the high-multiplicity reach. The measurements are compared to results from the CMS experiment and to PYTHIA, PHOJET and EPOS LHC event generators, as well as IP-Glasma calculations. (orig.)
E119D Neuraminidase Mutation Conferring Pan-Resistance to Neuraminidase Inhibitors in an A(H1N1)pdm09 Isolate From a Stem-Cell Transplant Recipient.

Science.gov (United States)

L'Huillier, Arnaud G; Abed, Yacine; Petty, Tom J; Cordey, Samuel; Thomas, Yves; Bouhy, Xavier; Schibler, Manuel; Simon, Audrey; Chalandon, Yves; van Delden, Christian; Zdobnov, Evgeny; Boquete-Suter, Patricia; Boivin, Guy; Kaiser, Laurent

2015-12-01

An influenza A(H1N1)pdm09 infection was diagnosed in a hematopoietic stem cell transplant recipient during conditioning regimen. He was treated with oral oseltamivir, later combined with intravenous zanamivir. The H275Y neuraminidase (NA) mutation was first detected, and an E119D NA mutation was identified during zanamivir therapy. Recombinant wild-type (WT) E119D and E119D/H275Y A(H1N1)pdm09 NA variants were generated by reverse genetics. Susceptibility to NA inhibitors (NAIs) was evaluated with a fluorometric assay using the 2'-(4-methylumbelliferyl)-α-D-N-acetylneuraminic acid (MUNANA) substrate. Susceptibility to favipiravir (T-705) was assessed using plaque reduction assays. The NA affinity and velocity values were determined with NA enzymatic studies. We identified an influenza A(H1N1)pdm09 E119D mutant that exhibited a marked increase in the 50% inhibitory concentrations against all tested NAIs (827-, 25-, 286-, and 702-fold for zanamivir, oseltamivir, peramivir, and laninamivir, respectively). The double E119D/H275Y mutation further increased oseltamivir and peramivir 50% inhibitory concentrations by 790- and >5000-fold, respectively, compared with the WT. The mutant viruses remained susceptible to favipiravir. The NA affinity and velocity values of the E119D variant decreased by 8.1-fold and 4.5-fold, respectively, compared with the WT. The actual emergence of a single NA mutation conferring pan-NAI resistance in the clinical setting reinforces the pressing need to develop new anti-influenza strategies. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Effect of second introduced phase on magnetic and magnetotransport properties of (1-x)La0.7Sr0.3Mn0.9Co0.1O3/x% Ag (x=0%, 2%, 4%) nanocomposites

Science.gov (United States)

Shah, Hiral D.; Bhalodia, J. A.

2018-05-01

The structural, magnetic and magnetotransport properties of (1-x)La0.7Sr0.3Mn0.9Co0.1O3(LSMCO)/x% Ag (x=0%, 2%, 4%) nanocomposites were investigated to explore the role of second introduced phase. (1-x) LSMCO/x% Ag (x=0%, 2%, 4%) nanocomposites are prepared via solid-state reaction method. X-ray diffraction (XRD) and SEM analysis indicated that x% of Ag are not substituted into the main LSMCO phase and remains an additive to the second phase at grain boundaries [1]. The structural parameters and the reliability factors for all the samples were successfully determined by the Rietveld refinement. Magnetization and transport properties of (1-x)LSMCO/x% Ag nanocomposites have been reported. Resistivity of the composite samples increases with Ag content in comparison with the pure LSMCO, and suppressed with applied magnetic field in all the composite samples [2]. The metal-insulator transition (TMI) and accompanied paramagnetic-ferromagnetic transition (TC) temperatures decrease with increase in Ag content. The electrical resistivity of the experimental results is explored by theoretical model below TMI. The maximum MR was observed to be 55% in the x=4% sample at 5 K temperature under 7 T magnetic field, this value is larger than that of pure LSMCO (19% at 5 K and 7 T), which is encouraging for practical application. Summarily, the addition of Ag in LSMCO improves MR% values significantly due to the more grain boundary contribution and result in better physical properties of the parent manganite system.
1- 4 Falodun

African Journals Online (AJOL)

DR. AMIN

45.3. 2.31 (dd, J = 7.5, 12.8). CH2. 9. 70.7. 5.62 m. CH. 10. 122.9. 5.09 m. CH. 11. 131.2. -. C. 12. 25.5. 1.71 s. CH3. 13. 27.8. 1.30 s. CH3. 14. 16.8. 1.59 s. CH3. 15. 18.2. 1.70 s. CH3. CH3CO. 171.4. -. CH3. CH3CO. 20.2. 1.89 s. CH3. Organisms. Concentrations of seed extracts (mg/ml). 2.5. 5. 10. 20. 25. 50. 100. 200. E.coli.
Corrosion characteristics of the Sm2(Fe0.9Co0.1)17N2.9 magnets stabilized by zinc-coating

International Nuclear Information System (INIS)

Arlot, R.; Machida, K.; Adachi, G.; Rango, P. de; Fruchart, D.

1998-01-01

The effect of powder particle size and of zinc coatings ( 2 (Fe 0.9 Co 0.1 ) 17 N 2.9 magnets has been investigated and compared to those obtained for Sm 2 Fe 17 N 3 and Nd 2 Fe 14 B magnets. Potentiokinetic polarisation behaviour in 0.5 N H 2 SO 4 and in Ringer's solution was studied. It was found that in 0.5 N H 2 SO 4 solution, the corrosion resistance is very weak, whereas in Ringer's solution, Zn coating and epoxy embedding provided a very efficient protection to the magnet. This result is quite unexpected as regarding the very weak amount of Zn (0.73 wt%) and epoxy (2.5-5 wt%) used to stabilize those very reactive ground powders which easily burn in air. Also, we characterized the magnetic properties of severely corroded magnets. (orig.)
Epizootic rabbit enteropathy inoculum (TEC4): antibiograms and antibiotic fractionation.

Science.gov (United States)

Huybens, Nathalie; Houeix, Julien; Licois, Dominique; Mainil, Jacques; Marlier, Didier

2011-01-01

Epizootic rabbit enteropathy (ERE) emerged and spread in Europe within the last 13 years causing major economical loss. The aims of the study was to evaluate antibiograms of TEC4, an inoculum composed of an extract of intestinal content of affected rabbits, and to test the potential of different antibiotic-based TEC4 fractions to reproduce the disease. Twenty nine different antibiotic discs were incubated for determining bacteria resistance. In a complementary study, nine tubes of liquid medium were inoculated with TEC4, incubated and added individually with amoxicillin/clavulanic acid, bacitracin, ceftiofur, doxycycline, novobiocin, streptomycyin, tylosin, vancomycin and 0.9% saline solution as control. The content of each tube was washed by centrifugation and suspended in saline. The three most effective antibiotics are florfenicol, amoxycillin/clavulanic acid and tylosin. A high concentration of Clostridium sordelli and Bacillus firmus were isolated in all fractions. Species never cultured from TEC4 were identified as Fusobacterium necrogenes (in vancomycin fraction), Cellulomonas sp (in novobiocin fraction) and Bacteroides distasonis (in doxycycline fraction). The ERE was reproduced when bacitracin, doxycycline and 0.9% fractions were inoculated. Rabbits showed ERE clinical signs with the specific drop in daily weight gain.
ICU-treated influenza A(H1N1 pdm09 infections more severe post pandemic than during 2009 pandemic: a retrospective analysis

Directory of Open Access Journals (Sweden)

Pekka Ylipalosaari

2017-11-01

Full Text Available Abstract Background We compared in a single mixed intensive care unit (ICU patients with influenza A(H1N1 pdm09 between pandemic and postpandemic periods. Methods Retrospective analysis of prospectively collected data in 2009–2016. Data are expressed as median (25th–75th percentile or number (percentile. Results Seventy-six influenza A(H1N1 pdm09 patients were admitted to the ICU: 16 during the pandemic period and 60 during the postpandemic period. Postpandemic patients were significantly older (60 years vs. 43 years, p < 0.001 and less likely to have epilepsy or other neurological diseases compared with pandemic patients (5 [8.3%] vs. 6 [38%], respectively; p = 0.009. Postpandemic patients were more likely than pandemic patients to have cardiovascular disease (24 [40%] vs. 1 [6%], respectively; p = 0.015, and they had higher scores on APACHE II (17 [13–22] vs. 14 [10–17], p = 0.002 and SAPS II (40 [31–51] vs. 31 [25–35], p = 0.002 upon admission to the ICU. Postpandemic patients had higher maximal SOFA score (9 [5–12] vs. 5 [4–9], respectively; p = 0.03 during their ICU stay. Postpandemic patients had more often septic shock (40 [66.7%] vs. 8 [50.0%], p = 0.042, and longer median hospital stays (15.0 vs. 8.0 days, respectively; p = 0.006. During 2015–2016, only 18% of the ICU- treated patients had received seasonal influenza vaccination. Conclusions Postpandemic ICU-treated A(H1N1 pdm09 influenza patients were older and developed more often septic shock and had longer hospital stays than influenza patients during the 2009 pandemic.
Synthesis dependent characteristics of Sr1−xMnxTiO3 (x=0.03, 0.05, 0.07 and 0.09)

International Nuclear Information System (INIS)

Preethi Meher, K.R.S.; Bogicevic, Christine; Janolin, Pierre-Eymeric; Varma, K.B.R.

2012-01-01

Sr 1−x Mn x TiO 3 (where x=0.03, 0.05, 0.07 and 0.09) was synthesized via different routes that include solid-state, oxalate precipitation and freeze drying. In oxalate precipitation technique, compositions corresponding to 3 and 5 mol% doping of Mn were monophasic whereas the higher compositions revealed the presence of the secondary phases such as MnO, Mn 3 O 4 etc., as confirmed by high resolution X-ray diffraction (XRD) studies. The decomposition behavior of the precursors prepared using oxalate precipitation method corresponding to the above mentioned compositions was studied. Nanopowders of compositions pertaining to 5 to 9 mol% of Mn doping were obtained using freeze–drying technique. The average crystallite size of these nanopowders was found to be in the 35 to 65 nm range. The microstructural studies carried out on the sintered ceramics, fabricated using powders synthesized by different routes established the fine grained nature ( 1−x Mn x TiO 3 (x=0.03 and 0.05) obtained by oxalate precipitation technique along with that of the nanopowders for x=0.05, 0.07 and 0.09 obtained by freeze drying method, microstructural characterization and synthesis dependent dielectric behavior. Highlights: ► Monophasic samples obtained for compositions Sr 1−x Mn x TiO 3 with x=0.03 and 0.05. ► Nanopowders of Sr 1−x Mn x TiO 3 with x=0.05, 0.07 and 0.09 were synthesized by freeze–drying method. ► Phase purity of samples synthesized using freeze drying method were studied at different sintering temperatures. ► Analysis of Raman spectra for samples prepared by both oxalate precipitation and freeze–drying. ► Microstructure dependent dielectric characteristics have been illustrated.

Anion complexation by calix[4]arene–TTF conjugates

Czech Academy of Sciences Publication Activity Database

Flídrová, K.; Tkadlecová, M.; Lang, Kamil; Lhoták, P.

2012-01-01

Roč. 92, č. 1 (2012), s. 668-673 ISSN 0143-7208 R&D Projects: GA ČR GA203/09/0691 Institutional research plan: CEZ:AV0Z40320502 Keywords : calix[4]arene * tetrathiafulvalene * anion recognition * receptor * NMR titration * UV/vis spectroscopy Subject RIV: CA - Inorganic Chemistry Impact factor: 3.532, year: 2012
Comparison of heparinized saline and 0.9% sodium chloride for maintaining peripheral intravenous catheter patency in dogs.

Science.gov (United States)

Ueda, Yu; Odunayo, Adesola; Mann, F A

2013-01-01

To determine whether heparinized saline would be more effective in maintaining the patency of peripheral IV catheters in dogs compared to 0.9% sodium chloride. Prospective blinded randomized study. University Veterinary Teaching Hospital. Thirty healthy purpose bred dogs, intended for use in the junior surgery laboratory, were utilized. The dogs were randomized into 1 of 3 groups, 2 treatment groups and a control group. An 18-Ga cephalic catheter was placed in the cephalic vein of each dog. Each dog in the treatment group had their catheter flushed with either 10 IU/mL heparinized saline or 0.9% sodium chloride every 6 hours for 42 hours. The dogs in the control group did not have their catheters flushed until the end of the study period. Immediately prior to flushing catheters, each catheter was evaluated for patency by aspiration of blood and the catheter site was evaluated for phlebitis. All dogs in the heparinized saline and 0.9% sodium chloride group had catheters that flushed easily at each evaluation point. More dogs in the saline group had catheters from which blood could not be aspirated, but there was no significant difference between these groups. All dogs in the control group had catheters that flushed easily at the end of the assigned 6 hour interval except in 1 dog. Phlebitis was not detected in any dog. Flushes of 0.9% sodium chloride were found to be as effective as 10 IU/mL heparinized saline flushes in maintaining patency of 18-Ga peripheral venous catheters in dogs for up to 42 hours. For peripheral catheters placed with the intention of performing serial blood draws, heparinized flushes may be warranted. © Veterinary Emergency and Critical Care Society 2013.
Reversible operation of microtubular solid oxide cells using La0.6Sr0.4Co0.2Fe0.8O3-δ-Ce0.9Gd0.1O2-δ oxygen electrodes

Science.gov (United States)

López-Robledo, M. J.; Laguna-Bercero, M. A.; Larrea, A.; Orera, V. M.

2018-02-01

Yttria stabilized zirconia (YSZ) based microtubular solid oxide fuel cells (mT-SOFCs) using La0.6Sr0.4Co0.2Fe0.8O3-δ (LSCF) and Ce0.9Gd0.1O2-δ (GDC) as the oxygen electrode, along with a porous GDC electrolyte-electrode barrier layer, were fabricated and characterized in both fuel cell (SOFC) and electrolysis (SOEC) operation modes. The cells were anode-supported, the NiO-YSZ microtubular supports being made by Powder Extrusion Moulding (PEM). The cells showed power densities of 695 mW cm-2 at 800 °C and 0.7 V in SOFC mode, and of 845 mA cm-2 at 800 °C and 1.3 V in SOEC mode. AC impedance experiments performed under different potential loads demonstrated the reversibility of the cells. These results showed that these cells, prepared with a method suitable for using on an industrial scale, are highly reproducible and reliable, as well as very competitive as reversible SOFC-SOEC devices operating at intermediate temperatures.
Design, Build and Test of a Double Crystal Monochromator for Beamlines I09 and I23 at the Diamond Light Source

International Nuclear Information System (INIS)

Kelly, J; Lee, T; Alcock, S; Patel, H

2013-01-01

A high stability Double Crystal Monochromator has been developed at The Diamond Light Source for beamlines I09 and I23. The design specification was a cryogenic, fixed exit, energy scanning monochromator, operating over an energy range of 2.1 – 25 keV using a Si(111) crystal set. The novel design concepts are the direct drive, air bearing Bragg axis, low strain crystal mounts and the cooling scheme. The instrument exhibited superb stability and repeatability on the B16 Test Beamline. A 20 keV Si(555), 1.4 μrad rocking curve was demonstrated. The DCM showed good stability without any evidence of vibration or Bragg angle nonlinearity.
Sales of veterinary antibacterial agents in nine European countries during 2005-09: trends and patterns.

Science.gov (United States)

Grave, Kari; Greko, Christina; Kvaale, Mari K; Torren-Edo, Jordi; Mackay, David; Muller, Arno; Moulin, Gerard

2012-12-01

To identify trends and patterns of sales of veterinary antimicrobial agents in nine European countries during 2005-09 in order to document the situation. Existing sales data, in tonnes of active ingredients, of veterinary antimicrobial agents by class were collected from nine European countries in a standardized manner for the years 2005-09 (one country for 2006-09). A population correction unit (PCU) is introduced as a proxy for the animal population potentially treated with antimicrobial agents. The sales data are expressed as mg of active substance/PCU. Data coverage was reported to be 98%-100% for the nine countries. Overall, sales of veterinary antimicrobials agents, in mg/PCU, declined during the reporting period in the nine countries. Substantial differences in the sales patterns and in the magnitude of sales of veterinary antimicrobial agents, expressed as mg/PCU, between the nine countries are observed. The major classes sold were penicillins, sulphonamides and tetracyclines. The sales accounted for by the various veterinary antimicrobial agents have changed substantially for most countries. An increase in the sales of third- and fourth-generation cephalosporins and fluoroquinolones were observed for the majority of the countries. Through re-analysis of existing data by application of a harmonized approach, an overall picture of the trends in the sales of veterinary antimicrobial agents in the nine countries was obtained. Notable differences in trends in sales between the countries were observed. Further studies, preferably including data by animal species, are needed to understand the factors that explain these observations.
Biological Treatment of Solvent-Based Paint

Science.gov (United States)

2011-01-01

ESTCP Environmental Security Technology Certification Program FK-WTP Fort Kamehameha Wastewater Treatment Plant FTIR Fourier Transform Infrared...established by the Fort Kamehameha Wastewater Treatment Plant (FK-WTP) for the water; toxicity characteristic leaching procedure (TCLP) requirements for
PRESERVATIVE LEACHING FROM WEATHERED CCA-TREATED WOOD

Science.gov (United States)

Disposal of discarded CCA-treated wood in landfills raises concerns with respect to leaching of preservative compounds. When unweathered CCA-treated wood is leached using the toxicity characteristic leaching procedure (TCLP), arsenic concentrations exceed the toxicity characteris...
EDS'09: 13th International Conference on Elastic & Diffractive Scattering

CERN Document Server

CERN. Geneva

2009-01-01

The series of International Conferences on Elastic and Diffractive Scattering was founded in 1985 in the picturesque old French town of Blois, famous for its XIV - XVIIth century château, inside of which the first meeting took place. Since then, meetings have been organised every two years in different places of the world: New York (1987), Evanston (1989), Isola d'Elba (1991), Providence (1993), Blois (1995), Seoul (1997), Protvino (1999), Prague (2001), Helsinki (2003), Blois (2005) and Hamburg (2007). The conference will focus on the most recent experimental and theoretical results in particle physics with an emphasis on Quantum Chromodynamics (QCD). http://cern.ch/eds09/ The conference agenda is now full. No further contributions can be accepted.
Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09.

Science.gov (United States)

Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong

2016-09-29

Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B. velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and volatile organic compound synthesis were identified in the genome. Copyright © 2016 Cai et al.
Excretome of the chitinolytic bacterium Clostridium paraputrificum J4

Czech Academy of Sciences Publication Activity Database

Šimůnek, Jiří; Koppová, Ingrid; Tiščenko, Galina; Dohnálek, Jan; Dušková, Jarmila

2012-01-01

Roč. 57, č. 4 (2012), s. 335-339 ISSN 0015-5632 R&D Projects: GA ČR GA310/09/1407 Institutional research plan: CEZ:AV0Z50450515; CEZ:AV0Z40500505 Keywords : chitinase * purification * enzymes Subject RIV: EE - Microbiology, Virology Impact factor: 0.791, year: 2012
Hazardous waste status of discarded electronic cigarettes.

Science.gov (United States)

Krause, Max J; Townsend, Timothy G

2015-05-01

The potential for disposable electronic cigarettes (e-cigarettes) to be classified as hazardous waste was investigated. The Toxicity Characteristic Leaching Procedure (TCLP) was performed on 23 disposable e-cigarettes in a preliminary survey of metal leaching. Based on these results, four e-cigarette products were selected for replicate analysis by TCLP and the California Waste Extraction Test (WET). Lead was measured in leachate as high as 50mg/L by WET and 40mg/L by TCLP. Regulatory thresholds were exceeded by two of 15 products tested in total. Therefore, some e-cigarettes would be toxicity characteristic (TC) hazardous waste but a majority would not. When disposed in the unused form, e-cigarettes containing nicotine juice would be commercial chemical products (CCP) and would, in the United States (US), be considered a listed hazardous waste (P075). While household waste is exempt from hazardous waste regulation, there are many instances in which such waste would be subject to regulation. Manufactures and retailers with unused or expired e-cigarettes or nicotine juice solution would be required to manage these as hazardous waste upon disposal. Current regulations and policies regarding the availability of nicotine-containing e-cigarettes worldwide were reviewed. Despite their small size, disposable e-cigarettes are consumed and discarded much more quickly than typical electronics, which may become a growing concern for waste managers. Copyright © 2015 Elsevier Ltd. All rights reserved.
Supervalent doping of LiFePO4 for enhanced electrochemical performance

Directory of Open Access Journals (Sweden)

N. V. Kosova

2015-12-01

Full Text Available The orthophosphates LiFe0.9M0.1PO4 with the structure of olivine doped with vanadium and titanium were obtained by mechanochemically stimulated solidphase synthesis using high-energy planetary mill AGO-2 and subsequent annealing at 750 °C. It is shown that V- and Ti- ions do not completely substitute for Fe2+ ions in the LiFePO4 structure. The remaining part of these ions involve in the formation of second phase with nashiko-like structure: monoclinic Li3V2(PO43 (space group P21/n and rhombohedral LiTi2(PO43 (space group R-3c. According to TEM, the average size of the particle of nanocomposites is about 100-300 nm. EMF of microanalysis showed that the small particles of secondary phases are segregated at the surface of larger particles of LiFePO4. On the charge-discharge curves of LiFe0.9M0.1PO4 there are plateau corresponding to LiFePO4 and the second phase. The doping with vanadium increases the resistance of the cycling of LiFePO4 and improves its cyclability at high speeds to a greater extent than in the case of doping with titanium.
Efficiency modeling of solidification/stabilization of multi-metal contaminated industrial soil using cement and additives.

Science.gov (United States)

Voglar, Grega E; Leštan, Domen

2011-08-30

In a laboratory study, formulations of 15% (w/w) of ordinary Portland cement (OPC), calcium aluminate cement (CAC) and pozzolanic cement (PC) and additives: plasticizers cementol delta ekstra (PCDE) and cementol antikorodin (PCA), polypropylene fibers (PPF), polyoxyethylene-sorbitan monooleate (Tween 80) and aqueous acrylic polymer dispersion (Akrimal) were used for solidification/stabilization (S/S) of soils from an industrial brownfield contaminated with up to 157, 32,175, 44,074, 7614, 253 and 7085mg kg(-1) of Cd, Pb, Zn, Cu, Ni and As, respectively. Soils formed solid monoliths with all cementitious formulations tested, with a maximum mechanical strength of 12N mm(-2) achieved after S/S with CAC+PCA. To assess the S/S efficiency of the used formulations for multi-element contaminated soils, we propose an empirical model in which data on equilibrium leaching of toxic elements into deionized water and TCLP (toxicity characteristic leaching procedure) solution and the mass transfer of elements from soil monoliths were weighed against the relative potential hazard of the particular toxic element. Based on the model calculation, the most efficient S/S formulation was CAC+Akrimal, which reduced soil leachability of Cd, Pb, Zn, Cu, Ni and As into deionized water below the limit of quantification and into TCLP solution by up to 55, 185, 8750, 214, 4.7 and 1.2-times, respectively; and the mass transfer of elements from soil monoliths by up to 740, 746, 104,000, 4.7, 343 and 181-times, respectively. Copyright © 2011 Elsevier B.V. All rights reserved.
Cadmium telluride leaching behavior: Discussion of Zeng et al. (2015).

Science.gov (United States)

Sinha, Parikhit

2015-11-01

Zeng et al. (2015) evaluate the leaching behavior and surface chemistry of II-VI semiconductor materials, CdTe and CdSe, in response to pH and O2. Under agitation in acidic and aerobic conditions, the authors found approximately 3.6%-6.4% (w/w) solubility of Cd content in CdTe in the Toxicity Characteristic Leaching Procedure (TCLP), Waste Extraction Test (WET), and dissolution test, with lower solubility (0.56-0.58%) under agitation in acidic and anoxic conditions. This range is comparable with prior long-term transformation and dissolution testing and bio-elution testing of CdTe (2.3%-4.1% w/w solubility of Cd content in CdTe). The implications for potential leaching behavior of CdTe-containing devices require further data. Since CdTe PV modules contain approximately 0.05% Cd content by mass, the starting Cd content in the evaluation of CdTe-containing devices would be lower by three orders of magnitude than the starting Cd content in the authors' study, and leaching potential would be further limited by the monolithic glass-adhesive laminate-glass structure of the device that encapsulates the semiconductor material. Experimental evaluation of leaching potential of CdTe PV modules crushed by landfill compactor has been conducted, with results of TCLP and WET tests on the crushed material below regulatory limits for Cd. CdTe PV recycling technology has been in commercial operation since 2005 with high yields for semiconductor (95%) and glass (90%) recovery. Copyright © 2015 Elsevier Ltd. All rights reserved.
Recovery of valuable metals from electroplating sludge with reducing additives via vitrification.

Science.gov (United States)

Huang, Ruth; Huang, Kuo-Lin; Lin, Zih-Yi; Wang, Jian-Wen; Lin, Chitsan; Kuo, Yi-Ming

2013-11-15

In this study, vitrification was applied to treat Ni-Cu electroplating sludge. The sludge was mixed with additives (limestone:cullet = 4:6) and then heated to 1450 °C. The cooled product could be separated into slag and ingot. An atomic absorption spectrometer was used to determine the metal levels of specimens and toxicity characteristic leaching procedure (TCLP) tests, whereas the crystalline and surface characteristics were examined using quantitative X-ray diffraction (XRD) analysis and scanning electron microscopy, respectively. With a glassy structure, the slag was mainly composed of Ca, Si, and Mg. The TCLP results of slags met the Taiwan regulated standards, suggesting that slag can be used for recycling purposes. With the aid of additives, the crystalline phase of slag was transformed form CaMgSiO4 into CsSiO3. The ingots were mainly composed of Ni (563,000-693,800 mg/kg), Cu (79,900-87,400 mg/kg), and Fe (35,000-43,600 mg/kg) (target metals) due the gravity separation during vitrification. At appropriate additives/sludge ratios (>0.2), >95% of target metals gathered in the ingot as a recoverable form (Ni-Fe alloy). The high Ni level of slag suggests that the ingot can be used as the raw materials for smelters or the additives for steel making. Therefore, the vitrification approach of this study is a promising technology to recover valuable metals from Ni-Cu electroplating sludge. Copyright © 2013 Elsevier Ltd. All rights reserved.
Solidified structure and leaching properties of metallurgical wastewater treatment sludge after solidification/stabilization process.

Science.gov (United States)

Radovanović, Dragana Đ; Kamberović, Željko J; Korać, Marija S; Rogan, Jelena R

2016-01-01

The presented study investigates solidification/stabilization process of hazardous heavy metals/arsenic sludge, generated after the treatment of the wastewater from a primary copper smelter. Fly ash and fly ash with addition of hydrated lime and Portland composite cement were studied as potential binders. The effectiveness of the process was evaluated by unconfined compressive strength (UCS) testing, leaching tests (EN 12457-4 and TCLP) and acid neutralization capacity (ANC) test. It was found that introduction of cement into the systems increased the UCS, led to reduced leaching of Cu, Ni and Zn, but had a negative effect on the ANC. Gradual addition of lime resulted in decreased UCS, significant reduction of metals leaching and high ANC, due to the excess of lime that remained unreacted in pozzolanic reaction. Stabilization of more than 99% of heavy metals and 90% of arsenic has been achieved. All the samples had UCS above required value for safe disposal. In addition to standard leaching tests, solidificates were exposed to atmospheric conditions during one year in order to determine the actual leaching level of metals in real environment. It can be concluded that the EN 12457-4 test is more similar to the real environmental conditions, while the TCLP test highly exaggerates the leaching of metals. The paper also presents results of differential acid neutralization (d-AN) analysis compared with mineralogical study done by scanning electron microscopy and X-ray diffraction analysis. The d-AN coupled with Eh-pH (Pourbaix) diagrams were proven to be a new effective method for analysis of amorphous solidified structure.
ChemSession'09 - 6. Warsaw Seminar of the PhD Students in Chemistry - Abstracts

International Nuclear Information System (INIS)

2009-01-01

Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6 th Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found
Magnetic properties of zigzag (0,9 GaAs nanotube doped with 3d transition metals

Directory of Open Access Journals (Sweden)

R Fathi

2016-06-01

Full Text Available of 3d transition metals (Sc, Ti, Cr, Mn , Fe, Co, Ni in both far and close situations were studied based on spin polarised density functional theory using the generalized gradient approximation (LDA with SIESTA code. The electronic structures show that zigzag (0,9 GaAs nanotubes are non-magnetic semiconductors with direct band gap. It was revealed that doping of 11.11 % Fe and Mn concentrations substituted in Ga sites in ferromagnetic phase in far situation and Cr sites in ferromagnetic phase in near situation introduces half metallic behavior with %100 spin polarization. The unique structure of spin polarised energy levels is primarily attributed to strong hybridization of 3d transition metal and its nearest-neighbor As-4p orbitals. The results of this study can be useful for empirical studies on diluted magnetic semiconductors (DMSs and systemic investigation in 3d transitional metals. We suggest that GaAs nanotubes doped by transition metals would have a potential application as a spin polarised electron source for spintronic devices in the future.
Temperature profiles from expendable bathythermograph (XBT) casts from the USCGC CAMPBELL in the North Pacific Ocean in support of the Integrated Global Ocean Services System (IGOSS) from 1979-08-09 to 1979-09-23 (NODC Accession 8000079)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected from the USCGC CAMPBELL in support of the Integrated Global Ocean Services System (IGOSS). Data were collected by the US Coast Guard from 09...
Temperature profiles from expendable bathythermograph (XBT) casts from the USCGC CAMPBELL in the North Pacific Ocean in support of the Integrated Global Ocean Services System (IGOSS) from 1975-09-09 to 1975-10-01 (NODC Accession 7500994)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected from the USCGC CAMPBELL in support of the Integrated Global Ocean Services System (IGOSS). Data were collected by the US Coast Guard from 09...

Methyl 4-toluenesulfonyloxymethylphosphonate, a new and versatile reagent for the convenient synthesis of phosphonate-containing compounds

Czech Academy of Sciences Publication Activity Database

Kóšiová, Ivana; Točík, Zdeněk; Buděšínský, Miloš; Šimák, Ondřej; Liboska, Radek; Rejman, Dominik; Pačes, Ondřej; Rosenberg, Ivan

2009-01-01

Roč. 50, č. 49 (2009), s. 6745-6747 ISSN 0040-4039 R&D Projects: GA ČR GA202/09/0193; GA ČR GA203/09/0820; GA MŠk(CZ) LC06061; GA MŠk(CZ) LC06077; GA AV ČR KAN200520801 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleoside phosphonates * phosphonylation * methyl 4-toluenesulfonyloxymethylphosphonate Subject RIV: CC - Organic Chemistry Impact factor: 2.660, year: 2009
Chrodrimanins O-S from the fungus Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculusnudus.

Science.gov (United States)

Kong, Fan-Dong; Zhang, Ren-Shuai; Ma, Qing-Yun; Xie, Qing-Yi; Wang, Pei; Chen, Peng-Wei; Zhou, Li-Man; Dai, Hao-Fu; Luo, Du-Qiang; Zhao, You-Xing

2017-10-01

Five new meroterpenoids, chrodrimanins O-S (1-5), as well as a known one (6), were isolated from the fermentation broth of Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculusnudus, from Haikou Bay, China. The structures including the absolute configurations of the new compounds were unambiguously elucidated by spectroscopic data and ECD spectra analysis along with quantum ECD calculations. Among them, compound 1 represents the first example of an unusual trichlorinated meroterpenoid with an unique dichlorine functionality. Compounds 1 and 4-6 displayed inhibitory activity of protein tyrosine phosphatase 1B (PTP1B) with IC 50 values of 71.6, 62.5, 63.1, and 39.6μM, respectively, and showed no apparent activity against three tumor cell lines (A549, HepG2, and Hela) and human umbilical vein endothelial cells (HUVEC) at 10μM. Copyright © 2017 Elsevier B.V. All rights reserved.
Low toxicity binder systems for tape cast Ce0.9Gd0.1O1.95 laminates

DEFF Research Database (Denmark)

Klemensø, Trine; Menon, Mohan; Ramousse, Severine

2010-01-01

Conventional binder systems for tape casting contain toxic phthalate plasticizers and butanone (MEK) as part of the solvent. The effects of exchanging the phthalate with a non-toxic alternative, and butanone with ethanol, were studied on laminates of high-green density CGO (Ce0.9Gd0.1O1.95) tapes....... Samples were prepared with a binder system containing DBP (dibutyl phthalate) plasticizer and MEK solvent, and with a binder system based on a non-toxic non-phthalate plasticizer and ethanol. In both systems, the weight ratio of plasticizer to the PVB (polyvinyl butyral) binder was varied between 0.......4 and 0.7. Substitution to the less toxic binder system had no adverse impacts on the microstructure. In fact, denser packing and improved homogeneity were observed with the non-phthalate-based system at ratio 0.5 indicating improved dispersion in this system. The denser packing also coincided...
WE-AB-202-09: Feasibility and Quantitative Analysis of 4DCT-Based High Precision Lung Elastography

International Nuclear Information System (INIS)

Hasse, K; Neylon, J; Low, D; Santhanam, A

2016-01-01

Purpose: The purpose of this project is to derive high precision elastography measurements from 4DCT lung scans to facilitate the implementation of elastography in a radiotherapy context. Methods: 4DCT scans of the lungs were acquired, and breathing stages were subsequently registered to each other using an optical flow DIR algorithm. The displacement of each voxel gleaned from the registration was taken to be the ground-truth deformation. These vectors, along with the 4DCT source datasets, were used to generate a GPU-based biomechanical simulation that acted as a forward model to solve the inverse elasticity problem. The lung surface displacements were applied as boundary constraints for the model-guided lung tissue elastography, while the inner voxels were allowed to deform according to the linear elastic forces within the model. A biomechanically-based anisotropic convergence magnification technique was applied to the inner voxels in order to amplify the subtleties of the interior deformation. Solving the inverse elasticity problem was accomplished by modifying the tissue elasticity and iteratively deforming the biomechanical model. Convergence occurred when each voxel was within 0.5 mm of the ground-truth deformation and 1 kPa of the ground-truth elasticity distribution. To analyze the feasibility of the model-guided approach, we present the results for regions of low ventilation, specifically, the apex. Results: The maximum apical boundary expansion was observed to be between 2 and 6 mm. Simulating this expansion within an apical lung model, it was observed that 100% of voxels converged within 0.5 mm of ground-truth deformation, while 91.8% converged within 1 kPa of the ground-truth elasticity distribution. A mean elasticity error of 0.6 kPa illustrates the high precision of our technique. Conclusion: By utilizing 4DCT lung data coupled with a biomechanical model, high precision lung elastography can be accurately performed, even in low ventilation regions of
WE-AB-202-09: Feasibility and Quantitative Analysis of 4DCT-Based High Precision Lung Elastography

Energy Technology Data Exchange (ETDEWEB)

Hasse, K; Neylon, J; Low, D; Santhanam, A [UCLA, Los Angeles, CA (United States)

2016-06-15

Purpose: The purpose of this project is to derive high precision elastography measurements from 4DCT lung scans to facilitate the implementation of elastography in a radiotherapy context. Methods: 4DCT scans of the lungs were acquired, and breathing stages were subsequently registered to each other using an optical flow DIR algorithm. The displacement of each voxel gleaned from the registration was taken to be the ground-truth deformation. These vectors, along with the 4DCT source datasets, were used to generate a GPU-based biomechanical simulation that acted as a forward model to solve the inverse elasticity problem. The lung surface displacements were applied as boundary constraints for the model-guided lung tissue elastography, while the inner voxels were allowed to deform according to the linear elastic forces within the model. A biomechanically-based anisotropic convergence magnification technique was applied to the inner voxels in order to amplify the subtleties of the interior deformation. Solving the inverse elasticity problem was accomplished by modifying the tissue elasticity and iteratively deforming the biomechanical model. Convergence occurred when each voxel was within 0.5 mm of the ground-truth deformation and 1 kPa of the ground-truth elasticity distribution. To analyze the feasibility of the model-guided approach, we present the results for regions of low ventilation, specifically, the apex. Results: The maximum apical boundary expansion was observed to be between 2 and 6 mm. Simulating this expansion within an apical lung model, it was observed that 100% of voxels converged within 0.5 mm of ground-truth deformation, while 91.8% converged within 1 kPa of the ground-truth elasticity distribution. A mean elasticity error of 0.6 kPa illustrates the high precision of our technique. Conclusion: By utilizing 4DCT lung data coupled with a biomechanical model, high precision lung elastography can be accurately performed, even in low ventilation regions of
Effect of A-site deficiency in LaMn{sub 0.9}Co{sub 0.1}O{sub 3} perovskites on their catalytic performance for soot combustion

Energy Technology Data Exchange (ETDEWEB)

Dinamarca, Robinson [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile); Garcia, Ximena; Jimenez, Romel [Department of Chemical Engineering, Faculty of Engineering, University of Concepción, Concepción (Chile); Fierro, J.L.G. [Instituto de Catálisis y Petroleoquímica, CSIC, Cantoblanco, 28049 Madrid (Spain); Pecchi, Gina, E-mail: gpecchi@udec.cl [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile)

2016-09-15

Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La{sub 1-x}Ag{sub x}Mn{sub 0.9}Co{sub 0.1}O{sub 3}) and A-site deficient (La{sub 1-x}Mn{sub 0.9}Co{sub 0.1}O{sub 3-δ}) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O{sub 2}-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag{sub 2}O segregated phases and the redox pair Mn{sup 4+}/Mn{sup 3+}. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn{sup 4+}/Mn{sup 3+}, which is attributed to the cubic crystalline structure.
Magnetic-entropy change in Mn1.1Fe0.9P0.7As0.3-xGe x

International Nuclear Information System (INIS)

Tegus, O.; Fuquan, B.; Dagula, W.; Zhang, L.; Brueck, E.; Si, P.Z.; Boer, F.R. de; Buschow, K.H.J.

2005-01-01

We have studied the magnetic properties and magnetic-entropy changes of Mn 1.1 Fe 0.9 P 0.7 As 0.3-x Ge x compounds with x = 0, 0.05, 0.1, 0.15 and 0.3. X-ray diffraction (XRD) study shows all the compounds crystallize in the Fe 2 P-type structure. Magnetic measurements show that the Curie temperature increases from 150 K for Mn 1.1 Fe 0.9 P 0.7 As 0.3 to 380 K for Mn 1.1 Fe 0.9 P 0.7 Ge 0.3 . A field-induced first-order magnetic phase transition is observed above the Curie temperature for the compounds with x up to 0.15. There exists an optimal composition in which the first-order phase transition is the sharpest. The optimal composition for this system is x = 0.1. The maximal magnetic-entropy change derived from the magnetization data is about 40 J/(kg K) for a field change from 0 to 3 T
Optical and vibrational spectroscopy of Ba0.85Ca0.15Zr0.1Ti0.9O3 modified lithium borate glass ceramics

Science.gov (United States)

Viswanath, Pamarti; Prashanth, Sadhu Sai Pavan; Molli, Muralikrishna; Wicram, Jaschin Prem; Sai Muthukumar, V.

2018-04-01

Glass ceramics are excellent replacement for single crystalline materials which are expensive and difficult to fabricate. In this context, we have attempted to fabricate glass nanocomposites comprising of Lithium Borate glass matrix embedded with lead free ferroelectric Ba0.85Ca0.15Zr0.1Ti0.9O3 (BCZT). Both of these functional materials are known to exhibit excellent ferroelectric behavior and are currently explored for various device applications. We have prepared these novel glass nanocomposite using melt-quenching techniquein various chemical composition involving different molar ratio. x(Ba0.85Ca0.15Zr0.1Ti0.9O3)-(1-x)(Li2O.2B2O3) where (x=0.1,0.2,0.3,0.4). The as-quenched samples exhibited amorphous nature as revealed by X-ray Diffraction studies. With the increase in BCZT content we have observed significant alteration in optical bandgap and Urbach energy. The tailoring of optical properties by tuning the structure was probed by Raman vibrational spectroscopy which confirmed the dominant role played by BCZT as a network modifier in these borate glasses. Concomitantly, these glass nanocomposites were found to be excellent UV absorbers.
Final Technical Report 09 LW 112

Energy Technology Data Exchange (ETDEWEB)

Lenhoff, R J

2010-11-28

Since the development of new antibiotics is out-paced by the emergence of bacterial resistance to existing antibiotics, it is crucial to understand the genetic mechanisms underlying resistance existing antibiotics. At the center of this mystery is a poorly understood phenomenon, heteroresistance: the coexistence of multiple subpopulations with varying degrees of antibiotic resistance. A better understanding of the fundamental basis of heteroresistance could result in sorely needed breakthroughs in treatment options. This project proposed to leverage a novel microfluidic (microchemostat) technology to probe the heteroresistance phenomenon in bacteria, with the aim of restoring the efficacy of existing {beta}-lactam antibiotics. The clinically important bacteria Methicillin Resistant S. aureus (MRSA) was used as the test case of bacteria that exhibits antibiotic heteroresistance. MRSA is difficult to treat because it is resistant to all {beta}-lactam antibiotics, as well as other classes of antimicrobials. Whereas {beta}-lactams such as methicillin and oxacillin are the preferred antibiotics to treat S. aureus infections due to their efficacy and low side effects, accurate determination and use of oxacillin/methicillin dosage is hampered by heteroresistance. In fact, invasive MRSA infections now account for about 95,000 deaths per year, a number that exceeds the deaths due to either influenza or HIV (12). In some MRSA strains, two subpopulations of cells may coexist: both populations carry the mecA gene that confers resistance, but mecA is differentially expressed so that only a small number of cells are observed during in vitro testing. Why this occurs is not understood. Prior experiments have sought to explain this phenomenon with conflicting results, with technology being the primary barrier to test the system sufficiently. This is the final report on work accomplished under the Lab-wide LDRD project 09-LW-112. This project was awarded to Frederick Balagadde who
A Novel Hydroxamate-Based Compound WMJ-J-09 Causes Head and Neck Squamous Cell Carcinoma Cell Death via LKB1-AMPK-p38MAPK-p63-Survivin Cascade.

Science.gov (United States)

Yen, Chia-Sheng; Choy, Cheuk-Sing; Huang, Wei-Jan; Huang, Shiu-Wen; Lai, Pin-Ye; Yu, Meng-Chieh; Shiue, Ching; Hsu, Ya-Fen; Hsu, Ming-Jen

2018-01-01

Growing evidence shows that hydroxamate-based compounds exhibit broad-spectrum pharmacological properties including anti-tumor activity. However, the precise mechanisms underlying hydroxamate derivative-induced cancer cell death remain incomplete understood. In this study, we explored the anti-tumor mechanisms of a novel aliphatic hydroxamate-based compound, WMJ-J-09, in FaDu head and neck squamous cell carcinoma (HNSCC) cells. WMJ-J-09 induced G2/M cell cycle arrest and apoptosis in FaDu cells. These actions were associated with liver kinase B1 (LKB1), AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (p38MAPK) activation, transcription factor p63 phosphorylation, as well as modulation of p21 and survivin. LKB1-AMPK-p38MAPK signaling blockade reduced WMJ-J-09's enhancing effects in p63 phosphorylation, p21 elevation and survivin reduction. Moreover, WMJ-J-09 caused an increase in α-tubulin acetylation and interfered with microtubule assembly. Furthermore, WMJ-J-09 suppressed the growth of subcutaneous FaDu xenografts in vivo . Taken together, WMJ-J-09-induced FaDu cell death may involve LKB1-AMPK-p38MAPK-p63-survivin signaling cascade. HDACs inhibition and disruption of microtubule assembly may also contribute to WMJ-J-09's actions in FaDu cells. This study suggests that WMJ-J-09 may be a potential lead compound and warrant the clinical development in the treatment of HNSCC.
EX1504L4 Dive09 Ancillary Data Collection including reports, kmls, spreadsheets, images and data

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Standard suite of ancillary data files generated through a scripting process following an ROV dive on NOAA Ship Okeanos Explorer during EX1504L4: Campaign to Address...
Fabrication and Characterization of Targets for Shock Propagation and Radiation Burnthrough Measurements on Be-0.9 AT. % Cu Alloy

International Nuclear Information System (INIS)

Nobile, A.; Dropinski, S.C.; Edwards, J.M.; Rivera, G.; Margevicius, R.W.; Sebring, R.J.; Olson, R. E.; Tanner, D.L.

2004-01-01

Beryllium-copper alloy (Be0.9%Cu) ICF capsules are being developed for the pursuit of thermonuclear ignition at the National Ignition Facility (NIF). Success of this capsule material requires that its shock propagation and radiation burnthrough characteristics be accurately understood. To this end, experiments are being conducted to measure the shock propagation and radiation burnthrough properties of Be0.9%Cu alloy. These experiments involve measurements on small Be0.9%Cu wedge, step and flat samples. Samples are mounted on 1.6-mm-diameter x 1.2-mm-length hohlraums that are illuminated by the OMEGA laser at the University of Rochester. X-rays produced by the hohlraum drive the sample. A streaked optical pyrometer detects breakout of the shock produced by the X-ray pulse. In this paper we describe synthesis of the alloy material, fabrication and characterization of samples, and assembly of the targets. Samples were produced from Be0.9%Cu alloy that was synthesized by hot isostatic pressing of Be powder and copper flake. Samples were 850 μm diameter disks with varying thickness in the case of wedge and step samples, and uniform thickness in the case of flat samples. Sample thickness varied in the range 10-90 μm. Samples were prepared by precision lathe machining and electric discharge machining. The samples were characterized by a Veeco white light interferometer and an optical thickness measurement device that simultaneously measured the upper and lower surface contours of samples using two confocal laser probes. Several campaigns with these samples have been conducted over the past two years
Clinical and Immune Responses to Inactivated Influenza A(H1N1)pdm09 Vaccine in Children

Science.gov (United States)

Kotloff, Karen L.; Halasa, Natasha B.; Harrison, Christopher J.; Englund, Janet A.; Walter, Emmanuel B.; King, James C.; Creech, C. Buddy; Healy, Sara A.; Dolor, Rowena J.; Stephens, Ina; Edwards, Kathryn M.; Noah, Diana L.; Hill, Heather; Wolff, Mark

2014-01-01

Background As the influenza AH1N1 pandemic emerged in 2009, children were found to experience high morbidity and mortality and were prioritized for vaccination. This multicenter, randomized, double-blind, age-stratified trial assessed the safety and immunogenicity of inactivated influenza A(H1N1)pdm09 vaccine in healthy children aged 6 months to 17 years. Methods Children received two doses of approximately 15 μg or 30 μg hemagglutin antigen 21 days apart. Reactogenicity was assessed for 8 days after each dose, adverse events through day 42, and serious adverse events or new-onset chronic illnesses through day 201. Serum hemagglutination inhibition (HAI) titers were measured on days 0 (pre-vaccination), 8, 21, 29, and 42. Results A total of 583 children received the first dose and 571 received the second dose of vaccine. Vaccinations were generally well-tolerated and no related serious adverse events were observed. The 15 μg dosage elicited a seroprotective HAI (≥1:40) in 20%, 47%, and 93% of children in the 6-35 month, 3-9 year, and 10-17 year age strata 21 days after dose 1 and in 78%, 82%, and 98% of children 21 days after dose 2, respectively. The 30 μg vaccine dosage induced similar responses. Conclusions The inactivated influenza A(H1N1)pdm09 vaccine exhibited a favorable safety profile at both dosage levels. While a single 15 or 30 μg dose induced seroprotective antibody responses in most 10-17 year olds, younger children required 2 doses, even when receiving dosages 4-6 fold higher than recommended. Well-tolerated vaccines are needed that induce immunity after a single dose for use in young children during influenza pandemics. PMID:25222307
The SARA Consortium: Providing Undergraduate Access to a 0.9-m Telescope at Kitt Peak National Observatory

Science.gov (United States)

Wood, M. A.

2003-12-01

The Southeastern Research for Astronomy (SARA) operates a 0.9-m telescope at Kitt Peak National Observatory (KPNO). The member institutions are Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia at Athens, Valdosta State University, and Clemson University. The NSF awarded the KPNO #1 0.9-m telescope to the SARA Consortium in 1990. We built a new facility and began routine on-site observations in 1995. We began routine remote observations in 1999 using VNC to export the telescope and CCD control screens, and a web-cam in the dome to provide critical visual feedback on the status of the telescope and dome. The mission of the SARA Consortium is to foster astronomical research and education in the Southeastern United States. Although only two of the member institutions have no graduate programs, all six have a strong emphasis on undergraduate research and education. By pooling our resources, we are able to operate a research-grade facility that none of the individual schools could manage by itself, and in the process we can offer our undergraduate students the opportunity to assist in our research projects as well as to complete their own independent research projects using a facility at a premier site. The SARA Consortium also hosts a NSF REU Summer Intern Program in Astronomy, in which we support 11-12 students that work one-on-one with a SARA faculty mentor. Most of these interns are selected from primarily undergraduate institutions, and have not had significant previous research experience. As part of the program, interns and mentors travel to KPNO for a 4-5 night observing run at the telescope. The SARA NSF REU Program is funded through NSF grant AST-0097616.
Effects of the copper content on the structural and electrical properties of Cu2ZnSnSe4 bulks

Science.gov (United States)

Tsega, Moges; Dejene, F. B.; Koao, L. F.

2016-01-01

We have investigated the concept of defect in CuxZnSnSe4 (x=1.6-2.0) and Cuy(Zn0.9Sn1.1)Se4 (y= 1.6-2.0) bulks prepared by liquid-phase sintering at 600 °C for 2 h with soluble sintering aids of Sb2S3 and Te. All samples were found to exhibit p-type semiconductor for CuxZnSnSe4, while n-type of behavior obtained at y= 1.8-2.0 for Cuy(Zn0.9Sn1.1)Se4 pellets. The Cu vacancy acts as an acceptor point defect to form the p-type semiconductor, and Sn4+ acts as a donor to form the n-type behavior for the Sn-rich CZTSe. SEM images of pellets show dense surface morphology, and increase in grain size upon Cu inclusion. The largely increased Hall mobility and the slightly changed carrier concentration for Cuy(Zn0.9Sn1.1)Se4 with increasing the Cu content is related to the types of its defects. At y=2.0 with carrier concentration of 4.88×1017 cm-3 showed the highest mobility of around 58 cm2/V s. Based upon the proposed point defects, the CZTSe property can be consistently explained.
EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 12, Revision 4 (FGE.12Rev4): primary saturated or unsaturated alicyclic alcohols, aldehydes, acids and esters from chemical groups 1 and 7

DEFF Research Database (Denmark)

Beltoft, Vibe Meister; Binderup, Mona-Lise; Frandsen, Henrik Lauritz

The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate 12 flavouring substances in Flavouring Group Evaluation 12, Revision 4 (FGE.12Rev4), including two additional substances, using the Procedure in Commission...... (the Procedure) that integrates information on structure–activity relationships, intake from current uses and the toxicological threshold of concern and available data on metabolism and toxicity. The Panel concluded that none of the 12 substances [FL-nos: 02.134, 02.186, 02.216, 02.217, 05.157, 05.......182, 05.183, 05.198, 08.135, 09.342, 09.670 and 09.829] gives rise to safety concerns at their levels of dietary intake, estimated on the basis of the maximised survey-derived daily intake approach. Besides the safety assessment of these flavouring substances, the specifications for the materials...
Microwave Integrated Circuit Amplifier Designs Submitted to Qorvo for Fabrication with 0.09-micron High Electron Mobility Transistors (HEMTs) using 2-mil Gallium Nitride (GaN) on Silicon Carbide (SiC)

Science.gov (United States)

2016-03-01

ARL-TN-0743 ● MAR 2016 US Army Research Laboratory Microwave Integrated Circuit Amplifier Designs Submitted to Qorvo for...originator. ARL-TN-0743 ● MAR 2016 US Army Research Laboratory Microwave Integrated Circuit Amplifier Designs Submitted to Qorvo...To) October 2015–January 2016 4. TITLE AND SUBTITLE Microwave Integrated Circuit Amplifier Designs Submitted to Qorvo for Fabrication with 0.09
Characterization of the perovskite La0,9Sr0,1Ga0,2O2,85 prepared by cation complexation

International Nuclear Information System (INIS)

Reis, S.L.; Grosso, R.L.; Muccillo, E.N.S.

2012-01-01

Strontium and magnesium doped lanthanum gallate exhibits perovskite-type structure and high ionic conductivity. Other features of this ceramic material are large electrolytic regime and negligible electronic conductivity. These characteristics are responsible for the potential use of this solid electrolyte in solid oxide fuel cells operating at intermediate temperatures (~∼500-700 deg C). In this work, the composition La 0.9 Sr 0.1 Ga 0.8 Mg 0.2 O 2.85 was prepared by the cation complexation technique aiming to obtain powder and sintered specimens with good chemical and structural homogeneities. X-ray diffraction results evidence that single phase was obtained, within the limitations of the technique, in samples sintered at 1350 deg C/4 h, with relative density above 92%. (author)
A DEFICIENCY OF ALPHA-SYNTROPHIN, THE ANCHORING PROTEIN OF AQUAPORIN-4 CHANNELS, AFFECTS CELL SWELLING IN CORTICAL TISSUE DURING HYPOOSMOTIC AND HYPERKALEMIC STRESS

Czech Academy of Sciences Publication Activity Database

Cicanič, Michal; Vargová, Lýdia; Syková, Eva

2011-01-01

Roč. 59, Supplement: 1 (2011), S102-S103 ISSN 0894-1491. [European meeting on Glia l Cells in Health and Disease /10./. 13.09.2011-17.09.2011, Prague] Institutional research plan: CEZ:AV0Z50390703 Keywords : cell swelling * aquaporin-4 * diffusion Subject RIV: FH - Neurology
Stability of tranexamic acid in 0.9% sodium chloride, stored in type 1 glass vials and ethylene/propylene copolymer plastic containers.

Science.gov (United States)

McCluskey, Susan V; Sztajnkrycer, Matthew D; Jenkins, Donald A; Zietlow, Scott P; Berns, Kathleen S; Park, Myung S

2014-01-01

Tranexamic acid has recently been demonstrated to decrease all-cause mortality and deaths due to hemorrhage in trauma patients. The optimal administration of tranexamic acid is within one hour of injury, but not more than three hours from the time of injury. To aid with timely administration, a premixed solution of 1 gram tranexamic acid and 0.9% sodium chloride was proposed to be stocked as a medication in both the aeromedical transport helicopters and Emergency Department at Mayo Clinic Hospital--Rochester Saint Marys Campus. Since no published stability data exists for tranexamic acid diluted with 0.9% sodium chloride, this study was undertaken to determine the stability of tranexamic acid diluted with 0.9% sodium chloride while being stored in two types of containers. Stability was determined through the use of a stability-indicating high-performance liquid reverse phase chromatography assay, pH, and visual tests. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 65 mL were studied at predetermined intervals for 90 days in ethylene/propylene copolymer plastic containers, protected from light, and at both controlled room and refrigerated temperatures. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 50 mL were studied at predetermined intervals for 180 days in clear Type 1 borosilicate glass vials sealed with intact elastomeric, Flourotec-coated stoppers, stored protected from light at controlled room temperature. Solutions stored in the ethylene/propylene copolymer plastic containers at both storage temperatures maintained at least 98% of initial potency throughout the 90-day study period. Solutions stored in glass vials at controlled room temperature maintained at least 92% of initial potency throughout the 180-day study period. Visual and pH tests revealed stable, clear, colorless, and particulate-free solutions throughout the respective study periods.

Hospitalized cases of influenza A(H1N1pdm09 in the French territories of the Americas, July 2009-March 2010 Casos hospitalizados de gripe A(H1N1pdm09 en los territorios franceses de las Américas entre julio de 2009 y marzo de 2010

Directory of Open Access Journals (Sweden)

Marie Barrau

2012-08-01

Full Text Available OBJECTIVE: To describe the methodology used for implementing a surveillance system specifically for influenza A(H1N1pdm09 in the French West Indies and French Guiana during an outbreak of this new virus in 2009-2010, and to report its main results. METHODS: This was an observational descriptive study of confirmed and probable cases of influenza A(H1N1pdm09 hospitalized for at least 24 hours in 23 July 2009-3 March 2010. Reverse transcription polymerase chain reaction was performed on nasopharyngeal swab samples according to the Centers for Disease Control and Prevention protocol. A probable case was defined as fever > 38ºC or aches or asthenia with respiratory symptoms (cough or dyspnea. All confirmed and probable hospitalized cases were reported, along with patient's age, sex, clinical condition at admission, place and length of hospitalization, antiviral treatment, underlying conditions, complications, and clinical evolution. A case was classified as severe if respiratory assistance or intensive care was required or if death resulted. RESULTS: A total of 331 confirmed and 16 probable cases were hospitalized, with a hospitalization rate ranging from 4.3 per 1 000 clinical cases in Saint Martin to 10.3 in French Guiana. Of these, 36 were severe, and subsequently, 10 were fatal. The median length of stay was 4 days for non-severe cases and 9 days for severe (P OBJETIVO: Describir la metodología usada para implementar un sistema de vigilancia específico para la gripe A(H1N1pdm09 en las Indias Occidentales Francesas y la Guayana Francesa durante un brote ocasionado por este virus nuevo ocurrido en 20092010 y presentar sus principales resultados. MÉTODOS: Se llevó a cabo un estudio de observación descriptivo de los casos confirmados y probables de gripe por A(H1N1pdm09 hospitalizados durante al menos 24 horas entre el 23 de julio de 2009 y el 3 de marzo de 2010. De conformidad con el protocolo de los Centros para el Control y la Prevención de
Instrumentos de avaliação de leitura em adultos: um estudo psicométrico

Directory of Open Access Journals (Sweden)

Natália Martins Dias

Full Text Available RESUMO Objetivo: investigar as propriedades psicométricas de um teste de desempenho para avaliação de reconhecimento de palavras e de um checklist de autorrelato de dificuldades de leitura/indicadores de dislexia, em uma amostra de adultos. Métodos: foram avaliados 54 sujeitos, idades entre 18 e 57 anos (M=24,16; DP = 7,34, com Ensino Médio completo ou cursando a graduação. As avaliações foram realizadas utilizando o Teste Computadorizado de Competência de Leitura de Palavras para Adultos (TCLP-2 e o questionário de autorrelato Adult Dyslexia Checklist (ADC. Resultados: não foram observadas diferenças de desempenho em função da escolaridade e do gênero. O tempo de resposta foi menor no julgamento dos itens Corretos do TCLP-2 em relação aos itens incorretos (inversão, troca fonológica, erro ortográfico e pseudopalavra homófona. 18,5% dos participantes relataram dificuldades mais severas no ADC. Análise de grupos extremos mostrou que participantes com maiores pontuações/dificuldades no ADC tiveram pior desempenho nos itens Corretos do TCLP-2. Análise fatorial retornou solução com fator único para tipos de itens do TCLP-2. Dados de precisão se mostraram adequados para ambos os instrumentos, com valores de Spearman-Brown e alfa de Cronbach maiores que 0,70. Relações de baixa a moderadas foram observadas entre os dois instrumentos, provendo evidências de validade a ambos. Conclusão: o estudo apresentou dados psicométricos de dois instrumentos para avaliação de leitura em adultos. Ambos mostraram índices satisfatórios de precisão e evidências de validade por relação com outras variáveis. Frente à carência de instrumentos padronizados para avaliação de leitura em adultos no contexto nacional, o estudo estende sua contribuição à futura instrumentalização desta área.
Chrodrimanins K-N and Related Meroterpenoids from the Fungus Penicillium sp. SCS-KFD09 Isolated from a Marine Worm, Sipunculus nudus.

Science.gov (United States)

Kong, Fan-Dong; Ma, Qing-Yun; Huang, Sheng-Zhuo; Wang, Pei; Wang, Jun-Feng; Zhou, Li-Man; Yuan, Jing-Zhe; Dai, Hao-Fu; Zhao, You-Xing

2017-04-28

Six new meroterpenoids, chrodrimanins K-N (1-4), including two uncommon chlorinated ones (1 and 2), and verruculides B2 (5) and B3 (6), as well as seven known ones (7-13), were isolated from the fermentation broth of Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculus nudus, from Haikou Bay, China. The structures including the absolute configurations of the new compounds were unambiguously elucidated by spectroscopic data, X-ray diffraction analysis, and ECD spectra analysis along with quantum ECD calculations. In addition, the X-ray crystal structures and absolute configurations of two previously reported meroterpenoids, chrodrimanins F (9) and A (11), are described for the first time. Compounds 1, 4, and 7 displayed anti-H1N1 activity with IC 50 values of 74, 58, and 34 μM, respectively, while compound 5 showed weak inhibitory activity against Staphylococcus aureus with an MIC of 32 μg/mL.
Barium titanate nanocomposite capacitor FY09 year end report.

Energy Technology Data Exchange (ETDEWEB)

Stevens, Tyler E.; DiAntonio, Christopher Brian; Yang, Pin; Chavez, Tom P.; Winter, Michael R.; Monson, Todd C.; Roesler, Alexander William; Fellows, Benjamin D.

2009-11-01

This late start RTBF project started the development of barium titanate (BTO)/glass nanocomposite capacitors for future and emerging energy storage applications. The long term goal of this work is to decrease the size, weight, and cost of ceramic capacitors while increasing their reliability. Ceramic-based nanocomposites have the potential to yield materials with enhanced permittivity, breakdown strength (BDS), and reduced strain, which can increase the energy density of capacitors and increase their shot life. Composites of BTO in glass will limit grain growth during device fabrication (preserving nanoparticle grain size and enhanced properties), resulting in devices with improved density, permittivity, BDS, and shot life. BTO will eliminate the issues associated with Pb toxicity and volatility as well as the variation in energy storage vs. temperature of PZT based devices. During the last six months of FY09 this work focused on developing syntheses for BTO nanoparticles and firing profiles for sintering BTO/glass composite capacitors.
Charged-particle multiplicities in proton–proton collisions at $\\sqrt{s} = 0.9$ to 8 TeV

OpenAIRE

Adam, Jaroslav; Adamova, Dagmar; Akindinov, Alexander; Bjelogrlic, Sandro; Blair, Justin Thomas; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Alam, Sk Noor; Borel, Herve

2017-01-01

A detailed study of pseudorapidity densities and multiplicity distributions of primary charged particles produced in proton–proton collisions, at $\\sqrt{s} =$ 0.9, 2.36, 2.76, 7 and 8 TeV, in the pseudorapidity range $|\\eta |
2018-05-09T06:49:17Z https://www.ajol.info/index.php/index/oai oai ...

African Journals Online (AJOL)

article/48419 2018-05-09T06:49:17Z wajm:ART Reported Occupational Hazards and Illnesses among Hairdressers in Ibadan, ... BACKGROUND: Hairdressers work in small scale enterprises with little or no health supervision in the workplace.
VHE gamma-rays from radio pulsars and cataclysmic variables. [PSR 1055-52; PSR 1509-58; PSR 1620-26; PSR 1747-46; PSR 1800-21; PSR 1818-04; PSR 1821-24; PSR 1822-09; PSR 1823-13; PSR 1855+09; PSR 1929+10; PSR 1957+20

Energy Technology Data Exchange (ETDEWEB)

De Jager, O.C.; Brink, C.; Meintjies, P.J.; Nel, H.I.; North, A.R.; Raubenheimer, B.C.; Van der Walt, D.J. (Potchefstroom Univ. for C.H.E. (South Africa). Dept. of Physics)

1990-03-01

We present the results of observations (above 1 TeV) of radio pulsars and cataclysmic variables with the Potchefstroom air Cerenkov facility. We were able to confirm our previous detection of PSR 1509-58 and the final significance is 1.7x10{sup -5}. A DC enhancement at the 10{sup -3} significance level was seen from the L{sub 4} Lagrange position in the PSR 1957+20 system. This result was confirmed by COS-B data. We were also able to detect the 5.4 ms pulsar PSR 1855+09 at a marginal significance level of 5%. However, the best and longest observation indicates non-uniformity at the 0.005 significance level. The TeV light curve resembles the radio light curve. The latter is also reminiscent of other millisecond pulsar observed above 1 TeV. The intermediate polar AEAQR (P = 33.08s) shows a period shift which is consistent with recent model predictions. However, the present significance of this results does not allow an unambiguous claim. (orig.).
Mezinárodní konference ENHR 09 – Prague Changing Housing Markets: Integration and Segmentation

Czech Academy of Sciences Publication Activity Database

Lux, Martin; Vojtková, Michaela

2009-01-01

Roč. 45, č. 5 (2009), s. 1141-1142 ISSN 0038-0288. [ENHR 09 Prague: Changing Housing Markets : Integration and Segmentation. Praha, 28.06.2009-01.07.2009] Institutional research plan: CEZ:AV0Z70280505 Keywords : international conference * housing * integration Subject RIV: AO - Sociology, Demography Impact factor: 0.562, year: 2009 www.enhr2009.cz
Polymorphism of HLA class I and class II alleles in influenza A(H1N1)pdm09 virus infected population of Assam, Northeast India.

Science.gov (United States)

Dutta, Mousumi; Dutta, Prafulla; Medhi, Subhash; Borkakoty, Biswajyoti; Biswas, Dipankar

2018-05-01

Human leucocyte antigen (HLA) represents one of the most highly polymorphic systems which plays a central role in the immune response. Genetic polymorphism of HLA in influenza A(H1N1)pdm09 infected population may be an important factor in disease progression and severity that needs further probing. In this study, a total of 110 Influenza like illness patients were recruited from the population of Assam, Northeast India, from which 35 cases infected by A(H1N1)pdm09 viruses and 35 controls were typed for HLA-A, B and DRB1 locus by PCR-SSP method. A total of seven alleles of HLA-A, 16 alleles of HLA-B, and 11 alleles of HLA-DRB1 locus were identified. The most common alleles within each locus in cases were HLA-A*11 (85.71%, P = 0.046), HLA-B*35 (25%, P = 0.0001), and HLA-DRB1*15 (49.35%, P = 0.133) as compared to the controls, HLA-A*11 (40.82%), HLA-B*35 (0.00%), and HLA-DRB1*15 (67.53%). The frequency of HLA-A*11 and HLA-B*35 were significantly higher in cases as compared to the controls. In DRB1 locus, HLA-DRB1*10 was significantly higher in cases (20.78%, P = 0.005) than that of controls (0.00%). Whereas, HLA-DRB1*15 showed a higher frequency in controls than in cases. In addition, HLA-DRB3*01 (P = 0.053), DRB4*01 (P = 1.000), and DRB5*01(P = 0.591) were also identified along with HLA-DRB1 haplotype. From this preliminary study, it is suspected that there may be a role of HLA-A*11, HLA-B*35 and HLA-DRB1*10 in conferring susceptibility to influenza A(H1N1)pdm09 infection in the study population. A larger extended study on HLA polymorphism may explain the association between HLA and influenza A(H1N1)pdm09 infection and provide insights for HLA restricted peptide based vaccines. © 2018 Wiley Periodicals, Inc.
77 FR 30242 - Safety Zone; City of Tonawanda July 4th Celebration, Niagara River, Tonawanda, NY

Science.gov (United States)

2012-05-22

...-AA00 Safety Zone; City of Tonawanda July 4th Celebration, Niagara River, Tonawanda, NY AGENCY: Coast... vessels from a portion of the Niagara River during the City of Tonawanda July 4th Celebration fireworks... read as follows: Sec. 165.T09-0352 Safety Zone; City of Tonawanda July 4th Celebration, Niagara River...
Fluidized-bed-combustion ash for the solidification and stabilization of a metal-hydroxide sludge.

Science.gov (United States)

Knoll, K L; Behr-Andres, C

1998-01-01

Fluidized-bed-combustion (FBC) ash is a by-product from a developing technology for coal-fired power plants that will economically reduce air emissions to meet requirements of the Clean Air Act. FBC ash has physical and chemical properties similar to Portland cement, but only has moderate success as a pozzolan in concrete applications due to low compressive strengths. However, FBC ash has proven effective for use as a binder for the solidification and stabilization (S/S) of metal-bearing sludges. Physical and chemical characterization procedures were used to analyze FBC ash and a metal-bearing sludge obtained from a hazardous waste treatment facility to develop 12 different S/S mix designs. The mix designs consist of four binder designs to evaluate sludge-to-binder ratios of approximately 0, 0.5, and 1. Portland cement is used as a control binder to compare unconfined compressive strengths and Toxicity Characteristic Leaching Procedure (TCLP) analyses from different ratios of the FBC ash streams: fly ash, char, and spent bed material (SBM). Compressive strengths ranging from 84 lbs per square inch (psi) to 298 psi were obtained from various mix designs containing different sludge-to-ash ratios cured for 28 days. All the mix designs passed the TCLP. Recoveries from leaching for each metal were less than 5% for most mix designs. Results of unconfined compressive strengths, TCLP, and percent recovery calculations indicate that the mix design containing approximately a 1:1 ratio of fly ash to char-and-sludge is the best mix design for the S/S of the metal-bearing sludge.
Metal loss from treated wood products in contact with municipal solid waste landfill leachate

Energy Technology Data Exchange (ETDEWEB)

Dubey, Brajesh [Department of Environmental Health, PO Box 70682, East Tennessee State University, Johnson City, TN 37614 (United States); Department of Environmental Engineering Sciences, University of Florida, Gainesville, FL 32611-6450 (United States); Townsend, Timothy, E-mail: ttown@ufl.edu [Department of Environmental Engineering Sciences, University of Florida, Gainesville, FL 32611-6450 (United States); Solo-Gabriele, Helena [Department of Civil, Architectural and Environmental Engineering, University of Miami, Coral Gables, FL 33124-0630 (United States)

2010-03-15

The research presented in this paper evaluates the potential impact of municipal solid waste (MSW) landfill leachate quality on the loss of metals from discarded treated wood during disposal. The loss of arsenic (As), chromium (Cr), copper (Cu), and boron (B) from several types of pressure-treated wood (CCA: chromated copper arsenate, ACQ: alkaline copper quaternary, CBA: copper boron azole, and DOT: disodium octaborate tetrahydrate) using leachate collected from 26 MSW landfills in Florida was examined. The toxicity characteristic leaching procedure (TCLP), the synthetic precipitation leaching procedure (SPLP), and California's waste extraction test (WET) were also performed. The results suggested that loss of preservative components was influenced by leachate chemistry. Copper loss from CCA-, ACQ- and CBA-treated wood was similar in magnitude when in contact with landfill leachates compared to synthetic TCLP and SPLP solutions. Ammonia was found as one of the major parameters influencing the leaching of Cu from treated wood when leached with MSW landfill leachates. The results suggest that disposal of ACQ- and CBA-treated wood in substantial quantity in MSW landfills may elevate the Cu concentration in the leachate; this could be of potential concern, especially for a bioreactor MSW landfill in which relatively higher ammonia concentrations in leachate have been reported in recent literature. For the As, Cr and B the concentrations observed with the landfill leachate as the leaching solutions were over a range from some sample showing the concentrations below and some showing above the observed value from corresponding SPLP and TCLP tests. In general the WET test showed the highest concentrations.
Frequency of respiratory virus infections and next-generation analysis of influenza A/H1N1pdm09 dynamics in the lower respiratory tract of patients admitted to the ICU.

Directory of Open Access Journals (Sweden)

Antonio Piralla

Full Text Available Recent molecular diagnostic methods have significantly improved the diagnosis of viral pneumonia in intensive care units (ICUs. It has been observed that 222G/N changes in the HA gene of H1N1pdm09 are associated with increased lower respiratory tract (LRT replication and worse clinical outcome. In the present study, the frequency of respiratory viruses was assessed in respiratory samples from 88 patients admitted to 16 ICUs during the 2014-2015 winter-spring season in Lombardy. Sixty-nine out of 88 (78.4% patients were positive for a respiratory viral infection at admission. Of these, 57/69 (82.6% were positive for influenza A (41 A/H1N1pdm09 and 15 A/H3N2, 8/69 (11.6% for HRV, 2/69 (2.9% for RSV and 2/69 (2.9% for influenza B. Phylogenetic analysis of influenza A/H1N1pdm09 strains from 28/41 ICU-patients and 21 patients with mild respiratory syndrome not requiring hospitalization, showed the clear predominance of subgroup 6B strains. The median influenza A load in LRT samples of ICU patients was higher than that observed in the upper respiratory tract (URT (p<0.05. Overall, a greater number of H1N1pdm09 virus variants were observed using next generation sequencing on partial HA sequences (codons 180-286 in clinical samples from the LRT as compared to URT. In addition, 222G/N/A mutations were observed in 30% of LRT samples from ICU patients. Finally, intra-host evolution analysis showed the presence of different dynamics of viral population in LRT of patients hospitalized in ICU with a severe influenza infection.
Characterization of Rn-222 production in Campo do Cercado C/09 Pocos de Caldas, Minas Gerais State

International Nuclear Information System (INIS)

Pereira, E.B.

1977-01-01

A systematic study for correlating the Rn-222 escape with the main geochemical and mineralogical factors for understanding of some change processes from uranium deposits in Campo do Cercado C-09 in Pocos de Caldas, Minas Gerais State is described. (author)
2018-02-21T09:46:29Z https://www.ajol.info/index.php/index/oai oai ...

African Journals Online (AJOL)

article/55713 2018-02-21T09:46:29Z ajrh:ART HIV/AIDS - Related Stigma and Discrimination in Nigeria: Review of Research Studies and future directions for Prevention Strategies Monjok, E Smesny, A Essien, EJ HIV/AIDS, Stigma, ...
Avaliação nutricional do feno das folhas da amoreira (Morus alba L. em frangos de corte - doi: 10.4025/actascianimsci.v33i4.10679 Nutritional assessment of mulberry (Morus alba L. leaf hay in broilers - doi: 10.4025/actascianimsci.v33i4.10679

Directory of Open Access Journals (Sweden)

Euclides Braga Malheiros

2011-09-01

Full Text Available O experimento foi conduzido com o objetivo de avaliar nutricionalmente o feno das folhas de amoreira, utilizando-se de frangos de corte. Foram utilizados cinco tratamentos (Testemunha (sem amoreira, 3,16% FB, 15% de amoreira (4,14% FB, 30% de amoreira (5,09% FB, Sem amoreira (4,14% FB e Sem amoreira (5,09% FB usando-se o delineamento em blocos casualizados, com dois blocos e três repetições dentro de cada bloco e avaliados os índices de desempenho, o exame histopatológico dos órgãos viscerais e medidas morfométricas do núcleo dos hepatócitos e ácinos pancreáticos. Foi verificado o pior desempenho produtivo para as aves que ingeriram feno de folhas de amoreira, além de lesões tais como esteatose, proliferação de células de ductos hepáticos e necrose focal múltipla no fígado das aves alimentadas com o tratamento 30% de amoreira (5,09% FB, além da diminuição nas dimensões do núcleo dos hepatócitos e dos ácinos pancreáticos.The trial was carried to evaluate the nutritional effects of mulberry leaf hay in broiler chickens. Five treatments were used: control (no mulberry, 3.16% CF; 15% mulberry (4.14% CF; 30% mulberry (5.09% CF, no mulberry (4.14% CF; no mulberry (5.09% CF. A randomized blocks design was used, with two blocks and three replications into the blocks to evaluate performance index, histopathological examination of the visceral organs and morphometric measurements of the hepatocyte nucleus and pancreatic acini. A poor performance index was observed for broilers feeding on mulberry leaves; lesions such as steatosis, proliferation of hepatic duct cells and multiple necrosis were found in the livers of the chickens fed with 30% mulberry (5.09% CF, as well as size reduction of the hepatocyte nucleus and pancreatic acini. From these data, it is concluded that mulberry probably has some toxic substance which can interfere in the improvement of diet ingredients, resulting in damage to broiler chickens.
Some observations on the synthesis and electrolytic properties of (Ba1-xCax (M0.9Y0.1O3, M = Ce, Zr-based samples modified with calcium

Directory of Open Access Journals (Sweden)

Dudek Magdalena

2016-03-01

Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.
Digital amateur observations of Venus at 0.9μm

Science.gov (United States)

Kardasis, E.

2017-09-01

Venus atmosphere is extremely dynamic, though it is very difficult to observe any features on it in the visible and even in the near-IR range. Digital observations with planetary cameras in recent years routinely produce high-quality images, especially in the near-infrared (0.7-1μm), since IR wavelengths are less influenced by Earth's atmosphere and Venus's atmosphere is partially transparent in this spectral region. Continuous observations over a few hours may track dark atmospheric features in the dayside and determine their motion. In this work we will present such observations and some dark-feature motion measurements at 0.9μm. Ground-based observations at this wavelength are rare and are complementary to in situ observations by JAXA's Akatsuki orbiter, that studies the atmospheric dynamics of Venus also in this band with the IR1 camera.
Mechanical analysis of a $\\beta=0.09 $ 162.5MHz taper HWR cavity

OpenAIRE

Fan, Peiliang; Zhu, Feng; Zhong, Hutianxiang; Quan, Shengwen; Liu, Kexin

2015-01-01

One superconducting taper-type half-wave resonator (HWR) with frequency of 162.5MHz, \\b{eta} of 0.09 has been developed at Peking University, which is used to accelerate high current proton ($\\sim$ 100mA) and $D^{+}$($\\sim$ 50mA). The radio frequency (RF) design of the cavity has been accomplished. Herein, we present the mechanical analysis of the cavity which is also an important aspect in superconducting cavity design. The frequency shift caused by bath helium pressure and Lorenz force, and...
Science, Technology and Arts Research Journal - Vol 3, No 4 (2015)

African Journals Online (AJOL)

Correlation and Divergence Analysis for Phenotypic Traits in Sesame (Sesamum indicum L.) Genotypes · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. G Hika, N Geleta, Z Jaleta, 01-09. http://dx.doi.org/10.4314/star.v3i4.1 ...

Some links on this page may take you to non-federal websites. Their policies may differ from this site.