International Nuclear Information System (INIS)
Cozzi, A.
2009-01-01
The Saltstone Production Facility (SPF) receives waste from Tank 50H for treatment. In the fourth quarter of the 2008 calendar year (4QCY08), Tank 50 accepted transfers of approximately 15 kgal from the Effluent Treatment Project (ETP) waste, approximately 12 kgal from Tank 710-the H-Canyon General Purpose Evaporator, approximately 5 kgal from the H-Canyon Super Kukla campaign, and approximately 34 kgal from the Modular Caustic Side Solvent Extraction Unit (MCU) Decontaminated Salt Solution Hold Tank (DSS-HT). The Saltstone Grout Sampling plan provides the South Carolina Department of Health and Environmental Control (SCDHEC) with the chemical and physical characterization strategy for the salt solution which is to be disposed of in the Z-Area Solid Waste Landfill (ISWLF).1 During operation, samples were collected from Tank 50H and grout samples prepared to determine the non-hazardous nature of the grout to meet the requirements of the South Carolina Hazardous Waste Management Regulations (SCHWMR) R.61-79.261.24(b) and R.61-79.268.48(a). SRNL was asked to prepare saltstone from a sample of Tank 50H obtained October 29, 2008 during 4QCY08 to determine the non-hazardous nature of the grout. The samples were cured and shipped to Babcock and Wilcox Technical Services Group-Radioisotope and Analytical Chemistry Laboratory (B and WTSG-RACL) to perform the Toxic Characteristic Leaching Procedure (TCLP)2 and subsequent extract analysis on saltstone samples for the analytes required for the quarterly analysis saltstone sample. In addition to the eight toxic metals-arsenic, barium, cadmium, chromium, mercury, lead, selenium and silver-analytes included the underlying hazardous constituents (UHC) antimony, beryllium, nickel, and thallium which could not be eliminated from analysis by process knowledge.3 B and WTSG-RACL provided subsamples to GEL Laboratories, LLC for analysis for the UHCs benzene, phenols and total and amenable cyanide. A Saltstone waste form was prepared in
Energy Technology Data Exchange (ETDEWEB)
Eibling, R. E.
2012-12-19
A Saltstone waste form was prepared in the Savannah River National Laboratory (SRNL) from a Tank 50H sample and Z-Area premix material for the third quarter of calendar year 2012 (3QCY12). After a 34 day cure, samples of the saltstone were collected, and the waste form was shown to meet the South Carolina Hazardous Waste Management Regulations (SCHWMR) R.61-79.261.24 and R.61-79.268.48(a) requirements for a nonhazardous waste form with respect to RCRA metals and underlying hazardous constituents. These analyses met all quality assurance specifications of USEPA SW-846.
1QCY17 Saltstone waste characterization analysis
Energy Technology Data Exchange (ETDEWEB)
Johnson, F. C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2017-07-25
In the first quarter of calendar year 2017, a salt solution sample was collected from Tank 50 on January 16, 2017 in order to meet South Carolina (SC) Regulation 61-107.19 Part I C, “Solid Waste Management: Solid Waste Landfills and Structural Fill – General Requirements” and the Saltstone Disposal Facility Class 3 Landfill Permit. The Savannah River National Laboratory (SRNL) was requested to prepare and ship saltstone samples to a United States Environmental Protection Agency (EPA) certified laboratory to perform the Toxicity Characteristic Leaching Procedure (TCLP) and subsequent characterization.
Energy Technology Data Exchange (ETDEWEB)
Eibling, R.
2011-09-28
Savannah River National Laboratory (SRNL) was asked to prepare saltstone from samples of Tank 50H obtained by SRNL on April 5, 2011 (Tank 50H sampling occurred on April 4, 2011) during 2QCY11 to determine the non-hazardous nature of the grout and for additional vault classification analyses. The samples were cured and shipped to Babcock & Wilcox Technical Services Group-Radioisotope and Analytical Chemistry Laboratory (B&W TSG-RACL) to perform the Toxic Characteristic Leaching Procedure (TCLP) and subsequent extract analysis on saltstone samples for the analytes required for the quarterly analysis saltstone sample. In addition to the eight toxic metals - arsenic, barium, cadmium, chromium, mercury, lead, selenium and silver - analytes included the underlying hazardous constituents (UHC) antimony, beryllium, nickel, and thallium which could not be eliminated from analysis by process knowledge. Additional inorganic species determined by B&W TSG-RACL include aluminum, boron, chloride, cobalt, copper, fluoride, iron, lithium, manganese, molybdenum, nitrate/nitrite as Nitrogen, strontium, sulfate, uranium, and zinc and the following radionuclides: gross alpha, gross beta/gamma, 3H, 60Co, 90Sr, 99Tc, 106Ru, 106Rh, 125Sb, 137Cs, 137mBa, 154Eu, 238Pu, 239/240Pu, 241Pu, 241Am, 242Cm, and 243/244Cm. B&W TSG-RACL provided subsamples to GEL Laboratories, LLC for analysis for the VOCs benzene, toluene, and 1-butanol. GEL also determines phenol (total) and the following radionuclides: 147Pm, 226Ra and 228Ra. Preparation of the 2QCY11 saltstone samples for the quarterly analysis and for vault classification purposes and the subsequent TCLP analyses of these samples showed that: (1) The saltstone waste form disposed of in the Saltstone Disposal Facility in 2QCY11 was not characteristically hazardous for toxicity. (2) The concentrations of the eight RCRA metals and UHCs identified as possible in the saltstone waste form were present at levels below the UTS. (3) Most of the
Characterization Of Core Sample Collected From The Saltstone Disposal Facility
International Nuclear Information System (INIS)
Cozzi, A.; Duncan, A.
2010-01-01
During the month of September 2008, grout core samples were collected from the Saltstone Disposal Facility, Vault 4, cell E. This grout was placed during processing campaigns in December 2007 from Deliquification, Dissolution and Adjustment Batch 2 salt solution. The 4QCY07 Waste Acceptance Criteria sample collected on 11/16/07 represents the salt solution in the core samples. Core samples were retrieved to initiate the historical database of properties of emplaced Saltstone and to demonstrate the correlation between field collected and laboratory prepared samples. Three samples were collected from three different locations. Samples were collected using a two-inch diameter concrete coring bit. In April 2009, the core samples were removed from the evacuated sample container, inspected, transferred to PVC containers, and backfilled with nitrogen. Samples furthest from the wall were the most intact cylindrically shaped cored samples. The shade of the core samples darkened as the depth of coring increased. Based on the visual inspection, sample 3-3 was selected for all subsequent analysis. The density and porosity of the Vault 4 core sample, 1.90 g/cm 3 and 59.90% respectively, were comparable to values achieved for laboratory prepared samples. X-ray diffraction analysis identified phases consistent with the expectations for hydrated Saltstone. Microscopic analysis revealed morphology features characteristic of cementitious materials with fly ash and calcium silicate hydrate gel. When taken together, the results of the density, porosity, x-ray diffraction analysis and microscopic analysis support the conclusion that the Vault 4, Cell E core sample is representative of the expected waste form.
International Nuclear Information System (INIS)
HAY, MICHAEL
2004-01-01
As part of the program to disposition the tetraphenylborate (TPB) in Tank 48H and return the tank to service, Salt Processing Development requested a review of the literature to assess the state of knowledge pertaining to incorporation of tetraphenylborate slurries in saltstone grout with respect to benzene generation rates and leaching performance. Examination of past studies conducted at Savannah River Site (SRS) on the incorporation of TPB slurries in saltstone provides a basis for developing a more focused scope of experimental studies. Tank 48H currently contains potassium and cesium tetraphenylborate salts as a result of a demonstration of the In Tank Precipitation (ITP) process in 1983 and subsequent ITPradioactive start-up operations in 1995. The tank currently contains approximately 240,000 gallons of salt solution with approximately 19,000 kg of potassium and cesium tetraphenylborate salts. The presence of the TPB salts makes the waste incompatible with existing High Level Waste treatment facilities. The TPB salts in Tank 48H must be treated or removed to meet the scheduled return to service date of 2007. The two preferred options for disposition of the TBP slurries in Tank 48H include: (1) Aggregation of the material with the Defense Waste Processing Facility (DWPF) recycle stream and disposal in the Saltstone Processing Facility (SPF), and (2) In-Situ Thermal Decomposition using heat in combination with pH reduction and catalyst addition. The current literature review along with the current experimental studies provide a basis for determining the feasibility of the option to incorporate the TPB slurries into saltstone grout
International Nuclear Information System (INIS)
Almond, P.; Kaplan, D.
2011-01-01
Core samples originating from Vault 4, Cell E of the Saltstone Disposal Facility (SDF) were collected in September of 2008 (Hansen and Crawford 2009, Smith 2008) and sent to SRNL to measure chemical and physical properties of the material including visual uniformity, mineralogy, microstructure, density, porosity, distribution coefficients (K d ), and chemical composition. Some data from these experiments have been reported (Cozzi and Duncan 2010). In this study, leaching experiments were conducted with a single core sample under conditions that are representative of saltstone performance. In separate experiments, reducing and oxidizing environments were targeted to obtain solubility and Kd values from the measurable species identified in the solid and aqueous leachate. This study was designed to provide insight into how readily species immobilized in saltstone will leach from the saltstone under oxidizing conditions simulating the edge of a saltstone monolith and under reducing conditions, targeting conditions within the saltstone monolith. Core samples were taken from saltstone poured in December of 2007 giving a cure time of nine months in the cell and a total of thirty months before leaching experiments began in June 2010. The saltstone from Vault 4, Cell E is comprised of blast furnace slag, class F fly ash, portland cement, and Deliquification, Dissolution, and Adjustment (DDA) Batch 2 salt solution. The salt solution was previously analyzed from a sample of Tank 50 salt solution and characterized in the 4QCY07 Waste Acceptance Criteria (WAC) report (Zeigler and Bibler 2009). Subsequent to Tank 50 analysis, additional solution was added to the tank solution from the Effluent Treatment Project as well as from inleakage from Tank 50 pump bearings (Cozzi and Duncan 2010). Core samples were taken from three locations and at three depths at each location using a two-inch diameter concrete coring bit (1-1, 1-2, 1-3; 2-1, 2-2, 2-3; 3-1, 3-2, 3-3) (Hansen and Crawford
Energy Technology Data Exchange (ETDEWEB)
Almond, P.; Kaplan, D.
2011-04-25
Core samples originating from Vault 4, Cell E of the Saltstone Disposal Facility (SDF) were collected in September of 2008 (Hansen and Crawford 2009, Smith 2008) and sent to SRNL to measure chemical and physical properties of the material including visual uniformity, mineralogy, microstructure, density, porosity, distribution coefficients (K{sub d}), and chemical composition. Some data from these experiments have been reported (Cozzi and Duncan 2010). In this study, leaching experiments were conducted with a single core sample under conditions that are representative of saltstone performance. In separate experiments, reducing and oxidizing environments were targeted to obtain solubility and Kd values from the measurable species identified in the solid and aqueous leachate. This study was designed to provide insight into how readily species immobilized in saltstone will leach from the saltstone under oxidizing conditions simulating the edge of a saltstone monolith and under reducing conditions, targeting conditions within the saltstone monolith. Core samples were taken from saltstone poured in December of 2007 giving a cure time of nine months in the cell and a total of thirty months before leaching experiments began in June 2010. The saltstone from Vault 4, Cell E is comprised of blast furnace slag, class F fly ash, portland cement, and Deliquification, Dissolution, and Adjustment (DDA) Batch 2 salt solution. The salt solution was previously analyzed from a sample of Tank 50 salt solution and characterized in the 4QCY07 Waste Acceptance Criteria (WAC) report (Zeigler and Bibler 2009). Subsequent to Tank 50 analysis, additional solution was added to the tank solution from the Effluent Treatment Project as well as from inleakage from Tank 50 pump bearings (Cozzi and Duncan 2010). Core samples were taken from three locations and at three depths at each location using a two-inch diameter concrete coring bit (1-1, 1-2, 1-3; 2-1, 2-2, 2-3; 3-1, 3-2, 3-3) (Hansen and
REDUCTION CAPACITY OF SALTSTONE AND SALTSTONE COMPONENTS
Energy Technology Data Exchange (ETDEWEB)
Roberts, K.; Kaplan, D.
2009-11-30
The duration that saltstone retains its ability to immobilize some key radionuclides, such as technetium (Tc), plutonium (Pu), and neptunium (Np), depends on its capacity to maintain a low redox status (or low oxidation state). The reduction capacity is a measure of the mass of reductants present in the saltstone; the reductants are the active ingredients that immobilize Tc, Pu, and Np. Once reductants are exhausted, the saltstone loses its ability to immobilize these radionuclides. The reduction capacity values reported here are based on the Ce(IV)/Fe(II) system. The Portland cement (198 {micro}eq/g) and especially the fly ash (299 {micro}eq/g) had a measurable amount of reduction capacity, but the blast furnace slag (820 {micro}eq/g) not surprisingly accounted for most of the reduction capacity. The blast furnace slag contains ferrous iron and sulfides which are strong reducing and precipitating species for a large number of solids. Three saltstone samples containing 45% slag or one sample containing 90% slag had essentially the same reduction capacity as pure slag. There appears to be some critical concentration between 10% and 45% slag in the Saltstone formulation that is needed to create the maximum reduction capacity. Values from this work supported those previously reported, namely that the reduction capacity of SRS saltstone is about 820 {micro}eq/g; this value is recommended for estimating the longevity that the Saltstone Disposal Facility will retain its ability to immobilize radionuclides.
International Nuclear Information System (INIS)
Nichols, Ralph L.; Dixon, Kenneth L.
2013-01-01
Recent research into the moisture retention properties of saltstone suggest that osmotic pressure may play a potentially significant role in contaminant transport (Dixon et al., 2009 and Dixon, 2011). The Savannah River Remediation Closure and Disposal Assessments Group requested the Savannah River National Laboratory (SRNL) to conduct a literature search on osmotic potential as it relates to contaminant transport and to develop a conceptual model of saltstone that incorporates osmotic potential. This report presents the findings of the literature review and presents a conceptual model for saltstone that incorporates osmotic potential. The task was requested through Task Technical Request HLW-SSF-TTR-2013-0004. Simulated saltstone typically has very low permeability (Dixon et al. 2008) and pore water that contains a large concentration of dissolved salts (Flach and Smith 2013). Pore water in simulated saltstone has a high salt concentration relative to pore water in concrete and groundwater. This contrast in salt concentration can generate high osmotic pressures if simulated saltstone has the properties of a semipermeable membrane. Estimates of osmotic pressure using results from the analysis of pore water collected from simulated saltstone show that an osmotic pressure up to 2790 psig could be generated within the saltstone. Most semi-permeable materials are non-ideal and have an osmotic efficiency 3 , KNO 3 , Na 3 PO 4 x12H 2 O, and K 3 PO 4 when exposed to a dilute solution. Typically hydraulic head is considered the only driving force for groundwater in groundwater models. If a low permeability material containing a concentrated salt solution is present in the hydrogeologic sequence large osmotic pressures may develop and lead to misinterpretation of groundwater flow and solute transport. The osmotic pressure in the semi-permeable material can significantly impact groundwater flow in the vicinity of the semi-permeable material. One possible outcome is that
Energy Technology Data Exchange (ETDEWEB)
Kaplan, D; Kimberly Roberts, K; Steven Serkiz, S; Matthew Siegfried, M
2008-10-30
gram ({micro}eq/g). This value was approximately the same value as the one measured for 100% blast furnace slag. The cause for this approximately four-fold greater reduction capacity than anticipated is not known, but may be the result of the higher pH of Saltstone (pH {approx}11) compared to blast furnace slag (pH {approx}8), the presence of reducing minerals in the fly ash used to make the Saltstone, or to the Saltstone possibly having semi-conductor properties. These reduction capacity values will result in a near four-fold increase in the estimated duration that the Saltstone facility will remain in a reduced chemical state. The implication of this result is that oxidation-state-sensitive contaminants, such as Pu, Np, and Tc, will remain for a longer duration in a much less mobile form than previously believed. The reduction capacity of vault concrete, which consisted of 10 wt-% blast furnace slag, was 240 {micro}eq/g. Essentially all Am, Cd, Ce, Co, Cs, Hg, Sr, and Y was (ad)sorbed within four hours, whereas <3% of the adsorbed metals desorbed from these solids after 90 hours of continuous leaching. In particular, desorption of Tc (under oxidizing conditions) was >10{sup 3} fold slower than (ad)sorption (under reducing conditions). An important implication of this finding is that if groundwater by-passes or short-circuits the reduction capacity of the Saltstone by flowing along a crack, the ability of the oxygenated water to promote Tc desorption is appreciably less than that predicted based on the K{sub d} value. Relatively low Tc K{sub d} values, 6 to 91 mL/g, were measured in these studies indicating that little if any of the Tc(VII) introduced into the Saltstone or Vault 2 concrete suspensions was reduced to Tc(IV). Such a reduction results in apparent K{sub d} values on the order of 10{sup 4} mL/g. As such, these Tc sorption/desorption experiments need additional investigation to fully represent Saltstone environmental conditions. It is important to
Slag-based saltstone formulations
International Nuclear Information System (INIS)
Langton, C.A.
1987-08-01
Approximately 400 x 10 6 L of low-level alkaline salt solution will be treated at the Savannah River Plant (SRP) Defense Waste Processing Facility (DWPF) prior to disposal in concrete vaults at SRP. Treatment involves removal of Cs + and Sr +2 , followed by solidification and stabilization of potential contaminants in saltstone, a hydrated ceramic wasteform. Chromium, technetium, and nitrate releases from saltstone can be significantly reduced by substituting hydraulic blast furnace slag for portland cement in the formulation designs. Slag-based mixes are also compatible with the Class F flyash used in saltstone as a functional extender to control heat of hydration and reduce permeability. (Class F flyash is also locally available at SRP.) A monolithic wasteform is produced by the hydration of the slag and flyash. Soluble ion release (NO 3- ) is controlled by the saltstone microstructure. Chromium and technetium are less leachable from slag mixes because these species are chemically reduced to a lower valence state by ferrous iron in the slag and are precipitated as relatively insoluble phases, such as Cr(OH) 3 and TcO 2 . 3 refs., 3 figs., 2 tabs
International Nuclear Information System (INIS)
Kaplan, D; Roberts, Kimberly; Serkiz, Steven; Siegfried, Matthew
2008-01-01
the same value as the one measured for 100% blast furnace slag. The cause for this approximately four-fold greater reduction capacity than anticipated is not known, but may be the result of the higher pH of Saltstone (pH ∼11) compared to blast furnace slag (pH ∼8), the presence of reducing minerals in the fly ash used to make the Saltstone, or to the Saltstone possibly having semi-conductor properties. These reduction capacity values will result in a near four-fold increase in the estimated duration that the Saltstone facility will remain in a reduced chemical state. The implication of this result is that oxidation-state-sensitive contaminants, such as Pu, Np, and Tc, will remain for a longer duration in a much less mobile form than previously believed. The reduction capacity of vault concrete, which consisted of 10 wt-% blast furnace slag, was 240 (micro)eq/g. Essentially all Am, Cd, Ce, Co, Cs, Hg, Sr, and Y was (ad)sorbed within four hours, whereas 10 3 fold slower than (ad)sorption (under reducing conditions). An important implication of this finding is that if groundwater by-passes or short-circuits the reduction capacity of the Saltstone by flowing along a crack, the ability of the oxygenated water to promote Tc desorption is appreciably less than that predicted based on the K d value. Relatively low Tc K d values, 6 to 91 mL/g, were measured in these studies indicating that little if any of the Tc(VII) introduced into the Saltstone or Vault 2 concrete suspensions was reduced to Tc(IV). Such a reduction results in apparent K d values on the order of 10 4 mL/g. As such, these Tc sorption/desorption experiments need additional investigation to fully represent Saltstone environmental conditions. It is important to understand the limits of these data. They do not provide insight into how radionuclides cured and immobilized in Saltstone will leach from the Saltstone. However they do provide insight into how radionuclides once released into porewater will interact
Results and analysis of saltstone cores taken from saltstone disposal unit cell 2A
Energy Technology Data Exchange (ETDEWEB)
Reigel, M. M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hill, K. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-03-01
As part of an ongoing Performance Assessment (PA) Maintenance Plan, Savannah River Remediation (SRR) has developed a sampling and analyses strategy to facilitate the comparison of field-emplaced samples (i.e., saltstone placed and cured in a Saltstone Disposal Unit (SDU)) with samples prepared and cured in the laboratory. The primary objectives of the Sampling and Analyses Plan (SAP) are; (1) to demonstrate a correlation between the measured properties of laboratory-prepared, simulant samples (termed Sample Set 3), and the field-emplaced saltstone samples (termed Sample Set 9), and (2) to validate property values assumed for the Saltstone Disposal Facility (SDF) PA modeling. The analysis and property data for Sample Set 9 (i.e. six core samples extracted from SDU Cell 2A (SDU2A)) are documented in this report, and where applicable, the results are compared to the results for Sample Set 3. Relevant properties to demonstrate the aforementioned objectives include bulk density, porosity, saturated hydraulic conductivity (SHC), and radionuclide leaching behavior.
Slag-based saltstone formulations
International Nuclear Information System (INIS)
Langton, C.A.
1987-01-01
Approximately 400 x 10 6 liters of low-level alkaline salt solution will be treated at the Savannah River Plant (SRP) Defense Waste Processing Facility (DWPF) prior to disposal in concrete vaults at SRP. Treatment involves removal of CS + and Sr +2 followed by solidification and stabilization of potential contaminants in saltstone, a hydrated ceramic waste form. Chromium, technetium, and nitrate releases from saltstone can be significantly reduced by substituting hydraulic blast furnace slag for portland cement in the formulation designs. Slag-based mixes are also compatible with Class F fly ash used in saltstone as a functional extender to control heat of hydration and reduce permeability. A monolithic waste form is produced by the hydration of the slag and fly ash. Soluble ion release (NO 3 - ) is controlled by the saltstone microstructure. Chromium and technetium are less leachable from slag mixes compared to cement-based waste forms because these species are chemically reduced to a lower valence state by ferrous iron in the slag and precipitated as relatively insoluble phases, such as CR(OH) 3 and TcO 2 . 5 refs., 4 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Nichols, Ralph L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Dixon, Kenneth L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRN
2013-09-23
Recent research into the moisture retention properties of saltstone suggest that osmotic pressure may play a potentially significant role in contaminant transport (Dixon et al., 2009 and Dixon, 2011). The Savannah River Remediation Closure and Disposal Assessments Group requested the Savannah River National Laboratory (SRNL) to conduct a literature search on osmotic potential as it relates to contaminant transport and to develop a conceptual model of saltstone that incorporates osmotic potential. This report presents the findings of the literature review and presents a conceptual model for saltstone that incorporates osmotic potential. The task was requested through Task Technical Request HLW-SSF-TTR- 2013-0004.
HYDRAULIC AND PHYSICAL PROPERTIES OF MCU SALTSTONE
International Nuclear Information System (INIS)
Dixon, K; Mark Phifer, M
2008-01-01
The Saltstone Disposal Facility (SDF), located in the Z-Area of the Savannah River Site (SRS), is used for the disposal of low-level radioactive salt solution. The SDF currently contains two vaults: Vault 1 (6 cells) and Vault 4 (12 cells). Additional disposal cells are currently in the design phase. The individual cells of the saltstone facility are filled with saltstone., Saltstone is produced by mixing the low-level radioactive salt solution, with blast furnace slag, fly ash, and cement or lime to form a dense, micro-porous, monolithic, low-level radioactive waste form. The saltstone is pumped into the disposal cells where it subsequently solidifies. Significant effort has been undertaken to accurately model the movement of water and contaminants through the facility. Key to this effort is an accurate understanding of the hydraulic and physical properties of the solidified saltstone. To date, limited testing has been conducted to characterize the saltstone. The primary focus of this task was to estimate the hydraulic and physical properties of MCU (Modular Caustic Side Solvent Extraction Unit) saltstone relative to two permeating fluids. These fluids included simulated groundwater equilibrated with vault concrete and simulated saltstone pore fluid. Samples of the MCU saltstone were prepared by the Savannah River National Laboratory (SRNL) and allowed to cure for twenty eight days prior to testing. These samples included two three-inch diameter by six inch long mold samples and three one-inch diameter by twelve inch long mold samples
HYDRAULIC AND PHYSICAL PROPERTIES OF MCU SALTSTONE
Energy Technology Data Exchange (ETDEWEB)
Dixon, K; Mark Phifer, M
2008-03-19
The Saltstone Disposal Facility (SDF), located in the Z-Area of the Savannah River Site (SRS), is used for the disposal of low-level radioactive salt solution. The SDF currently contains two vaults: Vault 1 (6 cells) and Vault 4 (12 cells). Additional disposal cells are currently in the design phase. The individual cells of the saltstone facility are filled with saltstone., Saltstone is produced by mixing the low-level radioactive salt solution, with blast furnace slag, fly ash, and cement or lime to form a dense, micro-porous, monolithic, low-level radioactive waste form. The saltstone is pumped into the disposal cells where it subsequently solidifies. Significant effort has been undertaken to accurately model the movement of water and contaminants through the facility. Key to this effort is an accurate understanding of the hydraulic and physical properties of the solidified saltstone. To date, limited testing has been conducted to characterize the saltstone. The primary focus of this task was to estimate the hydraulic and physical properties of MCU (Modular Caustic Side Solvent Extraction Unit) saltstone relative to two permeating fluids. These fluids included simulated groundwater equilibrated with vault concrete and simulated saltstone pore fluid. Samples of the MCU saltstone were prepared by the Savannah River National Laboratory (SRNL) and allowed to cure for twenty eight days prior to testing. These samples included two three-inch diameter by six inch long mold samples and three one-inch diameter by twelve inch long mold samples.
Saltstone Matrix Characterization And Stadium Simulation Results
International Nuclear Information System (INIS)
Langton, C.
2009-01-01
SIMCO Technologies, Inc. was contracted to evaluate the durability of the saltstone matrix material and to measure saltstone transport properties. This information will be used to: (1) Parameterize the STADIUM(reg s ign) service life code, (2) Predict the leach rate (degradation rate) for the saltstone matrix over 10,000 years using the STADIUM(reg s ign) concrete service life code, and (3) Validate the modeled results by conducting leaching (water immersion) tests. Saltstone durability for this evaluation is limited to changes in the matrix itself and does not include changes in the chemical speciation of the contaminants in the saltstone. This report summarized results obtained to date which include: characterization data for saltstone cured up to 365 days and characterization of saltstone cured for 137 days and immersed in water for 31 days. Chemicals for preparing simulated non-radioactive salt solution were obtained from chemical suppliers. The saltstone slurry was mixed according to directions provided by SRNL. However SIMCO Technologies Inc. personnel made a mistake in the premix proportions. The formulation SIMCO personnel used to prepare saltstone premix was not the reference mix proportions: 45 wt% slag, 45 wt% fly ash, and 10 wt% cement. SIMCO Technologies Inc. personnel used the following proportions: 21 wt% slag, 65 wt% fly ash, and 14 wt% cement. The mistake was acknowledged and new mixes have been prepared and are curing. The results presented in this report are assumed to be conservative since the excessive fly ash was used in the SIMCO saltstone. The SIMCO mixes are low in slag which is very reactive in the caustic salt solution. The impact is that the results presented in this report are expected to be conservative since the samples prepared were deficient in slag and contained excess fly ash. The hydraulic reactivity of slag is about four times that of fly ash so the amount of hydrated binder formed per unit volume in the SIMCO saltstone samples
HYDRAULIC AND PHYSICAL PROPERTIES OF SALTSTONE GROUTS AND VAULT CONCRETES
International Nuclear Information System (INIS)
Dixon, K.; Harbour, J.; Phifer, M.
2008-01-01
The Saltstone Disposal Facility (SDF), located in the Z-Area of the Savannah River Site (SRS), is used for the disposal of low-level radioactive salt solution. The SDF currently contains two vaults: Vault 1 (6 cells) and Vault 4 (12 cells). Additional disposal cells are currently in the design phase. The individual cells of the saltstone facility are filled with saltstone. Saltstone is produced by mixing the low-level radioactive salt solution, with blast furnace slag, fly ash, and cement (dry premix) to form a dense, micro-porous, monolithic, low-level radioactive waste form. The saltstone is pumped into the disposal cells where it subsequently solidifies. Significant effort has been undertaken to accurately model the movement of water and contaminants through the facility. Key to this effort is an accurate understanding of the hydraulic and physical properties of the solidified saltstone. To date, limited testing has been conducted to characterize the saltstone. The primary focus of this task was to estimate the hydraulic and physical properties of three types of saltstone and two vault concretes. The saltstone formulations included saltstone premix batched with (1) Deliquification, Dissolution, and Adjustment (DDA) salt simulant (w/pm 0.60), (2) Actinide Removal Process (ARP)/Modular Caustic Side Solvent Extraction Unit (MCU) salt simulant (w/pm 0.60), and (3) Salt Waste Processing Facility (SWPF) salt simulant (w/pm 0.60). The vault concrete formulations tested included the Vault 1/4 concrete and two variations of the Vault 2 concrete (Mix 1 and Mix 2). Wet properties measured for the saltstone formulations included yield stress, plastic viscosity, wet unit weight, bleed water volume, gel time, set time, and heat of hydration. Hydraulic and physical properties measured on the cured saltstone and concrete samples included saturated hydraulic conductivity, moisture retention, compressive strength, porosity, particle density, and dry bulk density. These properties
MEASUREMENT OF SPECIFIC HEAT CAPACITY OF SALTSTONE
International Nuclear Information System (INIS)
Harbour, J.; Williams, V.
2008-01-01
One of the goals of the Saltstone variability study is to identify (and quantify the impact of) the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. The heat capacity of the Saltstone waste form is one of the important properties of Saltstone mixes that was last measured at SRNL in 1997. It is therefore important to develop a core competency for rapid and accurate analysis of the specific heat capacity of the Saltstone mixes in order to quantify the impact of compositional and operational variations on this property as part of the variability study. The heat capacity, coupled with the heat of hydration data obtained from isothermal calorimetry for a given Saltstone mix, can be used to predict the maximum temperature increase in the cells within the vaults of the Saltstone Disposal Facility (SDF). The temperature increase controls the processing rate and the pour schedule. The maximum temperature is also important to the performance properties of the Saltstone. For example, in mass pours of concrete or grout of which Saltstone is an example, the maximum temperature increase and the maximum temperature difference (between the surface and the hottest location) are controlled to ensure durability of the product and prevent or limit the cracking caused by the thermal gradients produced during curing. This report details the development and implementation of a method for the measurement of the heat capacities of Saltstone mixes as well as the heat capacities of the cementitious materials of the premix and the simulated salt solutions used to batch the mixes. The developed method utilizes the TAM Air isothermal calorimeter and takes advantage of the sophisticated heat flow measurement capabilities of the instrument. Standards and reference materials were identified and used to validate the procedure and ensure accuracy of testing. Heat capacities of Saltstone mixes were
MEASUREMENT OF SPECIFIC HEAT CAPACITY OF SALTSTONE
Energy Technology Data Exchange (ETDEWEB)
Harbour, J; Vickie Williams, V
2008-09-29
One of the goals of the Saltstone variability study is to identify (and quantify the impact of) the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. The heat capacity of the Saltstone waste form is one of the important properties of Saltstone mixes that was last measured at SRNL in 1997. It is therefore important to develop a core competency for rapid and accurate analysis of the specific heat capacity of the Saltstone mixes in order to quantify the impact of compositional and operational variations on this property as part of the variability study. The heat capacity, coupled with the heat of hydration data obtained from isothermal calorimetry for a given Saltstone mix, can be used to predict the maximum temperature increase in the cells within the vaults of the Saltstone Disposal Facility (SDF). The temperature increase controls the processing rate and the pour schedule. The maximum temperature is also important to the performance properties of the Saltstone. For example, in mass pours of concrete or grout of which Saltstone is an example, the maximum temperature increase and the maximum temperature difference (between the surface and the hottest location) are controlled to ensure durability of the product and prevent or limit the cracking caused by the thermal gradients produced during curing. This report details the development and implementation of a method for the measurement of the heat capacities of Saltstone mixes as well as the heat capacities of the cementitious materials of the premix and the simulated salt solutions used to batch the mixes. The developed method utilizes the TAM Air isothermal calorimeter and takes advantage of the sophisticated heat flow measurement capabilities of the instrument. Standards and reference materials were identified and used to validate the procedure and ensure accuracy of testing. Heat capacities of Saltstone mixes were
Large-scale demonstration of waste solidification in saltstone
International Nuclear Information System (INIS)
McIntyre, P.F.; Oblath, S.B.; Wilhite, E.L.
1988-05-01
The saltstone lysimeters are a large scale demonstration of a disposal concept for decontaminated salt solution resulting from in-tank processing of defense waste. The lysimeter experiment has provided data on the leaching behavior of large saltstone monoliths under realistic field conditions. The results also will be used to compare the effect of capping the wasteform on contaminant release. Biweekly monitoring of sump leachate from three lysimeters has continued on a routine basis for approximately 3 years. An uncapped lysimeter has shown the highest levels of nitrate and 99 Tc release. Gravel and clay capped lysimeters have shown levels equivalent to or slightly higher than background rainwater levels. Mathematical model predictions have been compared to lysimeter results. The models will be applied to predict the impact of saltstone disposal on groundwater quality. 9 refs., 5 figs., 3 tabs
MEASUREMENT OF WASTE LOADING IN SALTSTONE
International Nuclear Information System (INIS)
Harbour, J; Vickie Williams, V
2008-01-01
One of the goals of the Saltstone variability study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. One of those properties of importance is the Waste Loading (WL) of the decontaminated salt solution (DSS) in the Saltstone waste form. Waste loading is a measure of the amount of waste that can be incorporated within a waste form. The value of the Saltstone waste loading ultimately determines the number of vaults that will be required to disposition all of the DSS. In this report, the waste loading is defined as the volume in milliliters of DSS per liter of Saltstone waste form. The two most important parameters that determine waste loading for Saltstone are water to cementitious material (w/cm) ratio and the cured grout density. Data are provided that show the dependence of waste loading on the w/cm ratio for a fixed DSS composition using the current premix material (45% Blast Furnace Slag (BFS), 45% Fly Ash (FA) and 10% Ordinary Portland Cement (OPC)). The impact of cured grout density on waste loading was also demonstrated. Mixes (at 0.60 w/cm) made with a Modular Caustic side extraction Unit (MCU) simulant and either OPC or BFS have higher cured grout densities than mixes made with premix and increase the WL to 709 mL/L for the OPC mix and 689 mL/L for the BFS mix versus the value of 653 mL/L for MCU in premix at 0.60 w/cm ratio. Bleed liquid reduces the waste loading and lowers the effective w/cm ratio of Saltstone. A method is presented (and will be used in future tasks) for correcting the waste loading and the w/cm ratio of the as-batched mixes in those cases where bleed liquid is present. For example, the Deliquification, Dissolution and Adjustment (DDA) mix at an as-batched 0.60 w/cm ratio, when corrected for % bleed, gives a mix with a 0.55 w/cm ratio and a WL that has been reduced from 662 to 625 mL/L. An example is provided that
Lysimeter study of vegetative uptake from saltstone
Energy Technology Data Exchange (ETDEWEB)
Murphy, C.E. Jr.
1990-06-08
At the Savannah River Site, liquid, low-level nuclear waste will be disposed of by incorporating the waste in concrete, a wasteform called saltstone. Saltstone monoliths will then be buried in the earth. To study the potential uptake of radionuclides by trees and other plants growing in the soil in the area containing buried saltstone, a lysimeter study has been in progress since 1984. Thirty two lysimeters were designed, constructed, and filled with soil. Saltstone samples, containing the liquid, low-level supernate from the tank 50 in-tank precipitation demonstration, were buried in some of the lysimeters. Other lysimeters, not containing saltstone, were used as controls. Crops, grass, and trees were planted in the lysimeters and sampled periodically to determine radionuclide concentrations. Water samples were also collected from the lysimeter sumps and analyzed for radionuclide content. This report documents the results of vegetative and lysimeter sump water measurements from the beginning of the project in November of 1984 through September of 1989. 6 refs., 22 figs., 6 tabs.
Key Factors That Influence The Performance Properties Of ARP/MCU Saltstone Mixes
International Nuclear Information System (INIS)
Harbour, J.; Edwards, T.; Williams, V.
2009-01-01
At the Saltstone Production Facility (SPF), decontaminated salt solution (DSS) is combined with premix (a cementitious mixture of portland cement (PC), blast furnace slag (BFS) and Class F fly ash (FA)) in a Readco mixer to produce fresh (uncured) Saltstone. After transfer to the Saltstone Disposal Facility (SDF) the hydration reactions initiated during the contact of the premix and salt solution continue during the curing period to produce the hardened waste form product. The amount of heat generated from hydration and the resultant temperature increase in the vaults depend on the composition of the decontaminated salt solution being dispositioned as well as the grout formulation (mix design). This report details the results from Task 3 of the Saltstone Variability Study for FY09 which was performed to identify, and quantify when possible, those factors that drive the performance properties of the projected ARP/MCU Batches. A baseline ARP/MCU mix (at 0.60 water to cementitious materials (w/cm) ratio) was established and consisted of the normal premix composition and a salt solution that was an average of the projected compositions of the last three ARP/MCU batches developed by T. A. Le. This task introduced significant variation in (1) wt % slag, w/cm ratio, and wt % portland cement about the baseline mix and (2) the temperature of curing in order to better assess the dependence of the performance properties on these factors. Two separate campaigns, designated Phase 10 and Phase 11, were carried out under Task 3. Experimental designs and statistical analyses were used to search for correlation among properties and to develop linear models to predict property values based on factors such as w/cm ratio, slag concentration, and portland cement concentration. It turns out that the projected salt compositions contained relatively high amounts of aluminate (0.22 M) even though no aluminate was introduced due to caustic aluminate removal from High Level Waste. Previous
Leaching of saltstone: Laboratory and field testing and mathematical modeling
International Nuclear Information System (INIS)
Grant, M.W.; Langton, C.A.; Oblath, S.B.; Pepper, D.W.; Wallace, R.M.; Wilhite, E.L.; Yau, W.W.F.
1987-01-01
A low-level alkaline salt solution will be a byproduct in the processing of high-level waste at the Savannah River Plant (SRP). This solution will be incorporated into a wasteform, saltstone, and disposed of in surface vaults. Laboratory and field leach testing and mathematical modeling have demonstrated the predictability of contaminant release from cement wasteforms. Saltstone disposal in surface vaults will meet the design objective, which is to meet drinking water standards in shallow groundwater at the disposal area boundary. Diffusion is the predominant mechanism for release of contaminants to the environment. Leach testing in unsaturated soil, at soil moisture levels above 1 wt %, has shown no difference in leach rate compared to leaching in distilled water. Field leach testing of three thirty-ton blocks of saltstone in lysimeters has been underway since January 1984. Mathematical models were applied to assess design features for saltstone disposal. One dimensional infinite-composite and semi-infinite analytical models were developed for assessing diffusion of nitrate from saltstone through a cement barrier. Numerical models, both finite element and finite difference, were validated by comparison of model predictions with the saltstone lysimeter results. Validated models were used to assess the long-term performance of the saltstone stored in surface vaults. The maximum concentrations of all contaminants released from saltstone to shallow groundwater are predicted to be below drinking water standards at the disposal area boundary. 5 refs., 11 figs., 5 tabs
GLASS COMPOSITION-TCLP RESPONSE MODEL FOR WASTE GLASSES
International Nuclear Information System (INIS)
Kim, Dong-Sang; Vienna, John D.
2004-01-01
A first-order property model for normalized Toxicity Characteristic Leaching Procedure (TCLP) release as a function of glass composition was developed using data collected from various studies. The normalized boron release is used to estimate the release of toxic elements based on the observation that the boron release represents the conservative release for those constituents of interest. The current TCLP model has two targeted application areas: (1) delisting of waste-glass product as radioactive (not mixed) waste and (2) designating the glass wastes generated from waste-glass research activities as hazardous or non-hazardous. This paper describes the data collection and model development for TCLP releases and discusses the issues related to the application of the model
Groundwater Monitoring Plan for the Z-Area Saltstone Disposal Facility, Revision 3
International Nuclear Information System (INIS)
WELLS, DANIEL
2005-01-01
Groundwater monitoring has been conducted at the Z-Area Saltstone Disposal Facility since 1987. At that time, groundwater monitoring was not required by the industrial landfill regulations, but a modest monitoring program was required by the operating permit. At the time of the 1996 permit renewal, it was determined that a more robust monitoring program was needed. The draft permit required new monitoring wells within 25 feet of each active disposal cell. As an alternative, SRS proposed a program based on direct push sampling. This program called for biennial direct push sampling within 25 feet of each waste-containing cell with additional samples being taken in areas where excessive cracking had been observed. The direct push proposal was accepted by The South Carolina Department of Health and Environmental Control (SCDHEC), and was incorporated by reference into the Z-Area Saltstone Industrial Solid Waste Permit, No.025500-1603. The Industrial Solid Waste Landfill Regulations were revised in 1998 and now include specific requirements for groundwater monitoring. SRS's plan for complying with those regulations is discussed below. The plan calls for a return to traditional monitoring with permanent wells. It also proposes a more technically sound monitoring list based on the actual composition of saltstone
Process Formulations And Curing Conditions That Affect Saltstone Properties
Energy Technology Data Exchange (ETDEWEB)
Reigel, M. M.; Pickenheim, B. R.; Daniel, W. E.
2012-09-28
The first objective of this study was to analyze saltstone fresh properties to determine the feasibility of reducing the formulation water to premix (w/p) ratio while varying the amount of extra water and admixtures used during processing at the Saltstone Production Facility (SPF). The second part of this study was to provide information for understanding the impact of curing conditions (cure temperature, relative humidity (RH)) and processing formulation on the performance properties of cured saltstone.
Huang, Minrui; Feng, Huajun; Shen, Dongsheng; Li, Na; Chen, Yingqiang; Shentu, Jiali
2016-03-01
As the standard toxicity characteristic leaching procedure (TCLP) can not exhaust the acid neutralizing capacity of the cement rotary kiln co-processing solid wastes products which is particularly important for the assessment of the leaching concentrations of heavy metals. A modified TCLP was proposed. The extent of leaching of heavy metals is low using the TCLP and the leaching performance of the different metals can not be differentiated. Using the modified TCLP, however, Zn leaching was negligible during the first 180 h and then sharply increased (2.86 ± 0.18 to 3.54 ± 0.26 mg/L) as the acidity increased (pH leaching is enhanced using the modified TCLP. While Pb leached readily during the first 126 h and then leachate concentrations decreased to below the analytical detection limit. To conclude, this modified TCLP is a more suitable method for these cement rotary kiln co-processing products.
Concept development for saltstone and low level waste disposal
International Nuclear Information System (INIS)
Wilhite, E.L.
1987-03-01
A low-level alkaline salt solution will be a byproduct in the processing of high-level waste at the Savannah River Plant (SRP). This solution will be incorporated into a cement wasteform, saltstone, and placed in surface vaults. Laboratory and field testing and mathematical modeling have demonstrated the predictability of contaminant release from cement wasteforms. Saltstone disposal in surface vaults will meet drinking water standards in shallow groundwater at the disposal area boundary. Planning for new Low-Level Waste (LLW) disposal could incorporate concepts developed for saltstone disposal
Saltstone studies using the scaled continuous processing facility
Energy Technology Data Exchange (ETDEWEB)
Fowley, M. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Cozzi, A. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hansen, E. K. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2015-08-01
The Savannah River National Laboratory (SRNL) has supported the Saltstone Facility since its conception with bench-scale laboratory experiments, mid-scale testing at vendor facilities, and consultations and testing at the Saltstone Facility. There have been minimal opportunities for the measurement of rheological properties of the grout slurry at the Saltstone Production Facility (SPF); thus, the Scaled Continuous Processing Facility (SCPF), constructed to provide processing data related to mixing, transfer, and other operations conducted in the SPF, is the most representative process data for determining the expected rheological properties in the SPF. These results can be used to verify the laboratory scale experiments that support the SPF using conventional mixing processes that appropriately represent the shear imparted to the slurry in the SPF.
Leaching of saltstones containing fly ash
International Nuclear Information System (INIS)
Barnes, M.W.; Roy, D.M.; Langton, C.A.
1985-01-01
Two types of fly ash were incorporated in saltstones designed for potential encapsulation of Savannah River Plant low level defense waste. These fly ashes have some cementitious properties while at the same time their presence in substitution for cement slows early hydration. Class C fly ash has a high calcium content and is considered cementitious; Class F fly ash has a low calcium content and is not classified as cementitious. Leach tests were performed and physical properties were measured for saltstones containing each class, to see the differences in the effect of the fly ashes. The four waste ions nitrate, nitrite, sodium and sulfate were shown to leach by diffusion. Effective diffusivities were determined for these ions. Data for nitrate, the most important species from the environmental point of view, are shown in Table A. Saltstones made with Class C fly ash have substantially lower leach rates than those made with Class F fly ash. The leach rates, and therefore the square roots of the effective diffusivities, have been found to be proportional to the pore surface area per unit volume (or the ratio of pore volume to pore radius), to the fraction of waste containing solution, and to the inverse of the fraction of calcium in the saltstone. Rates and diffusivities are not proportional to the water to cement ratio, because this number depends on whether the fly ash is counted as cementitious, as in Class C cement, or not cementitious, as in Class F cement. In fact the relatively small amount of calcium in Class F cement contributes to the cementitious properties overall, though not so much as Class C cement. 4 refs., 2 figs., 6 tabs
International Nuclear Information System (INIS)
Poirier, M.R.
2000-01-01
The Saltstone Facility provides the final treatment and disposal of low level liquid wastes streams. At the Saltstone Facility, the waste is mixed with cement, flyash, and slag to form a grout, which is pumped into large concrete vaults where it cures. The facility started radioactive operations in June 1990. High Level Waste Engineering requested Savannah River Technology Center to determine the effect of TPB and its decomposition products (i.e., 3PB, 2PB, and 1PB) on the saltstone process. Previous testing performed by SRTC determined saltstone benzene evolution rates a function of ITP filtrate composition. Testing by the Thermal Fluids Laboratory has shown at design operation, the temperature in the Z-area vaults could reach 85 degrees Celsius. Saltstone asked SRTC to perform additional testing to determine whether curing at 85 degrees Celsius could change saltstone benzene evolution rates. This document describes the test performed to determine the effect of curing temperature on the benzene evolution rates
Technical Insights for Saltstone PA Maintenance
International Nuclear Information System (INIS)
Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.
2011-01-01
The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure and Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and
Technical Insights for Saltstone PA Maintenance
Energy Technology Data Exchange (ETDEWEB)
Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.
2011-07-20
The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure & Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and
Investigations of metal leaching from mobile phone parts using TCLP and WET methods.
Yadav, Satyamanyu; Yadav, Sudesh
2014-11-01
Metal leaching from landfills containing end-of-life or otherwise discarded mobile phones poses a threat to the environment as well as public health. In the present study, the metal toxicity of printed wire boards (PWBs), plastics, liquid crystal displays (LCDs) and batteries of mobile phones was assessed using the Toxicity Characteristics Leaching Procedures (TCLP) and the Waste Extraction Test (WET). The PWBs failed TCLP for Pb and Se, and WET for Pb and Zn. In WET, the two PWB samples for Pb and Zn and the battery samples for Co and Cu failed the test. Furthermore, the PWBS for Ni and the battery samples for Ni and Co failed the WET in their TCLP leachates. Both, Ni and Co are the regulatory metals in only WET and not covered under TCLP. These observations indicate that the TCLP seems to be a more aggressive test than the WET for the metal leaching from the mobile phone parts. The compositional variations, nature of leaching solution (acetate in TCLP and citrate in WET) and the redox conditions in the leaching solution of the PWBs resulted in different order of metals with respect to their amounts of leaching from PWBs in TCLP (Fe > Pb > Zn > Ni > Co > Cu) and WET (Zn > Fe > Ni > Pb > Cu). The metal leaching also varied with the make, manufacturing year and part of the mobile phone tested. PWBs, plastics and batteries should be treated as hazardous waste. Metal leaching, particularly of Se and Pb, from mobile phones can be harmful to the environment and human health. Therefore, a scientifically sound and environmentally safe handling and disposal management system needs to be evolved for the mobile phone disposal. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Reigel, Marissa M.; Fowley, Mark D.; Hansen, Erich K.; Hera, Kevin R.; Marzolf, Athneal D.; Cozzi, Alex D.
2013-01-01
The Savannah River National Laboratory (SRNL) has supported the Saltstone Production Facility (SPF) since its conception. However, bench scaled tests have not always provided process or performance data related to the mixing, transfer, and other operations utilized in the SPF. A need was identified to better understand the SPF processes and to have the capabilities at SRNL to simulate the SPF unit operations to support an active low-level radioactive waste (LLW) processing facility. At the SPF, the dry premix is weighed, mixed and transferred to the Readco '10-inch' continuous mixer where it is mixed with the LLW salt solution from the Salt Feed Tank (SFT) to produce fresh Saltstone slurry. The slurry is discharged from the mixer into a hopper. The hopper feeds the grout pump that transfers the slurry through at least 457.2 meters of piping and discharges it into the Saltstone Disposal Units (SDU) for permanent disposal. In conjunction with testing individual SPF processes over several years, SRNL has designed and fabricated a scaled Saltstone Facility. Scaling of the system is primarily based on the volume capacity of the mixer and maintaining the same shear rate and total shear at the wall of the transfer line. At present, SRNL is utilizing the modular capabilities of the scaled Saltstone Facility to investigate the erosion issues related to the augers and paddles inside the SPF mixer. Full implementation of the scaled Saltstone Facility is still ongoing, but it is proving to be a valuable resource for testing alternate Saltstone formulations, cleaning sequences, the effect of pumping Saltstone to farther SDU's, optimization of the SPF mixer, and other operational variables before they are implemented in the SPF. (authors)
Degradation Of Cementitious Materials Associated With Saltstone Disposal Units
International Nuclear Information System (INIS)
Flach, G. P; Smith, F. G. III
2013-01-01
The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed ''saltstone''. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of an SDF disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions. The nominal value (NV) is an intermediate result that is more probable than the conservative estimate
Savannah River Site - Salt-stone Disposal Facility Performance Assessment Update
International Nuclear Information System (INIS)
Newman, J.L.
2009-01-01
The Savannah River Site (SRS) Salt-stone Facility is currently in the midst of a Performance Assessment revision to estimate the effect on human health and the environment of adding new disposal units to the current Salt-stone Disposal Facility (SDF). These disposal units continue the ability to safely process the salt component of the radioactive liquid waste stored in the underground storage tanks at SRS, and is a crucial prerequisite for completion of the overall SRS waste disposition plan. Removal and disposal of low activity salt waste from the SRS liquid waste system is required in order to empty tanks for future tank waste processing and closure operations. The Salt-stone Production Facility (SPF) solidifies a low-activity salt stream into a grout matrix, known as salt-stone, suitable for disposal at the SDF. The ability to dispose of the low-activity salt stream in the SDF required a waste determination pursuant to Section 3116 of the Ronald Reagan National Defense Authorization Act of 2005 and was approved in January 2006. One of the requirements of Section 3116 of the NDAA is to demonstrate compliance with the performance objectives set out in Subpart C of Part 61 of Title 10, Code of Federal Regulations. The PA is the document that is used to ensure ongoing compliance. (authors)
Modified TCLP test for evaluating the leachability of site-specific wastes
International Nuclear Information System (INIS)
Pier, J.
1996-01-01
The Weldon Spring Site Remedial Action Project (WSSRAP) has developed a site-specific test to assess the leachability of wastes that will be placed in its on-site disposal cell. This test is modelled after the TCLP, but examines an expanded list of parameters and uses an extraction solution that is representative of conditions that are expected to exist in the disposal facility. Following the same logic that guided development of TCLP protocols, the WSSRAP developed concentration guidelines for non-TCLP parameters that were contaminants of concern in its wastes. Response actions, specific to the WSSRAP cell and wastes, were also developed to address constituents that failed to meet these guides. From 1955 to 1966, the US Atomic Energy Commission operated a uranium feed materials plant on this site. Nitroaromatic, and later, radiological wastes were disposed of in the quarry from 1945 until 1970. This paper describes testing to determine whether contaminant concentrations in leachates derived from the major waste-types that will be placed in its on-site disposal cell conform with the Department of Energy's (DOE) as low as reasonably achievable (ALARA) policy. Although the WSSRAP will continue to use the TCLP test to determine if any waste is classified RCRA-hazardous, the site-specific test described in this paper will be used to further assess whether leachate from any waste-type has the potential to adversely impact groundwater
TCLP Preparation and Analysis of K East Basin Composite Sludge Samples
International Nuclear Information System (INIS)
Silvers, K.L.; Wagner, J.J.; Steele, R.T.
2000-01-01
Sludge samples from the Hanford K East Basin were analyzed by the Toxicity Characterization Leaching Procedure (TCLP) to assist in the appropriate Resource Conservation and Recovery Act (RCIL4) designation of this material. Sludge samples were collected by Fluor Hanford, Inc. using the consolidated sludge sampling system (system that allows collection of a single sample from multiple sample locations). These samples were shipped to the Postirradiation Testing Laboratory (PTL, 327 Building) and then transferred to the Pacific Northwest National Laboratory (PNNL) Radiochemical Processing Laboratory (RPL, 325 Building) for recovery and testing. Two sludge composites were prepared, using the consolidated sludge samples, to represent K East canister sludge (sample KC Can Comp) and K East floor sludge (sample KC Floor Comp). Each composite was extracted in duplicate and analyzed in duplicate following pre-approved(a) TCLP extraction and analyses procedures. In addition, these samples and duplicates were analyzed for total RCRA metals (via acid digestion preparation). The work was conducted in accordance with the requirements of the Hanford Analytical Quality Assurance Requirements Document (HASQARD). A PNNL Quality Assurance Program compliant with J HASQARD was implemented for this effort. The results from the TCLP analyses showed that all RCRA metal concentrations were less than the TCLP limits for both the canister and floor composite samples and their respective duplicates
Energy Technology Data Exchange (ETDEWEB)
Almond, P. M. [Savannah River Site (SRS), Aiken, SC (United States); Kaplan, D. I. [Savannah River Site (SRS), Aiken, SC (United States); Langton, C. A. [Savannah River Site (SRS), Aiken, SC (United States); Stefanko, D. B. [Savannah River Site (SRS), Aiken, SC (United States); Spencer, W. A. [Savannah River Site (SRS), Aiken, SC (United States); Hatfield, A. [Clemson University, Clemson, SC (United States); Arai, Y. [Clemson University, Clemson, SC (United States)
2012-08-23
The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.
Degradation Of Cementitious Materials Associated With Saltstone Disposal Units
Energy Technology Data Exchange (ETDEWEB)
Flach, G. P; Smith, F. G. III
2013-03-19
The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed “saltstone”. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of an SDF disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions. The nominal value (NV) is an intermediate result that is more probable than the conservative
Verification of Sulfate Attack Penetration Rates for Saltstone Disposal Unit Modeling
Energy Technology Data Exchange (ETDEWEB)
Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2015-05-12
Recent Special Analysis modeling of Saltstone Disposal Units consider sulfate attack on concrete and utilize degradation rates estimated from Cementitious Barriers Partnership software simulations. This study provides an independent verification of those simulation results using an alternative analysis method and an independent characterization data source. The sulfate penetration depths estimated herein are similar to the best-estimate values in SRNL-STI-2013-00118 Rev. 2 and well below the nominal values subsequently used to define Saltstone Special Analysis base cases.
International Nuclear Information System (INIS)
Cook, J.R.
2006-01-01
The Savannah River National Laboratory is actively working on a total revision of the Saltstone Performance Assessment. 'Lessons Learned' from the review are being applied to this effort. Examples of the areas in which significant new work is being done are development of a methodology to do probabilistic uncertainty analyses, employing quantitative analytical tools to represent long-term chemical degradation of both concrete and the Saltstone wasteform, and then using those tools to come to a better understanding of how changes in the vault and Saltstone will affect the performance of the overall disposal system over long periods of time. (authors)
Saltstone processing startup at the Savannah River Plant
International Nuclear Information System (INIS)
Wilhite, E.L.; Langton, C.A.; Sturm, H.F.; Hooker, R.L.; Occhipinti, E.S.
1988-01-01
High-level nuclear wastes are stored in large underground tanks at the Savannah River Plant. Processing of this waste in preparation for ultimate disposal will begin in 1988. The waste will be processed to separate the high-level radioactive fraction from the low-level radioactive fraction. The separation will be made in existing waste tanks by a process combining precipitation, adsorption, and filtration. The high-level fraction will be vitrified into borosilicate glass in the Defense Waste Processing Facility (DWPF) for permanent disposal in a federal repository. The low-level fraction (decontaminated salt solution) will be mixed with a cementitious slag-flyash blend. The resulting wasteform, saltstone, will be disposed of onsite by emplacement in an engineered facility. Waste properties, disposal facility details, and wasteform characteristics are discussed. In particular, details of saltstone processing, focusing on experience obtained from facility startup, are presented
International Nuclear Information System (INIS)
Langton, C.
2008-01-01
This report summarizes the preliminary results of a durability analysis performed by SIMCO Technologies Inc. to assess the effects of contacting saltstone Vaults 1/4 and Disposal Unit 2 concretes with highly alkaline solutions containing high concentrations of dissolved sulfate. The STADIUM(reg s ign) code and data from two surrogate concretes which are similar to the Vaults 1/4 and Disposal Unit 2 concretes were used in the preliminary durability analysis. Simulation results for these surrogate concrete mixes are provided in this report. The STADIUM(reg s ign) code will be re-run using transport properties measured for the SRS Vaults 1/4 and Disposal Unit 2 concrete samples after SIMCO personnel complete characterization testing on samples of these materials. Simulation results which utilize properties measured for samples of Vaults 1/4 and Disposal Unit 2 concretes will be provided in Revision 1 of this report after property data become available. The modeling performed to date provided the following information on two concrete mixes that will be used to support the Saltstone PA: (1) Relationship between the rate of advancement of the sulfate front (depth of sulfate ion penetration into the concrete) and the rate of change of the concrete permeability and diffusivity. (2) Relationship between the sulfate ion concentration in the corrosive leachate and the rate of the sulfate front progression. (3) Equation describing the change in hydraulic properties (hydraulic conductivity and diffusivity) as a function of sulfate ion concentration in the corrosive leachate. These results have been incorporated into the current Saltstone PA analysis by G. Flach (Flach, 2008). In addition, samples of the Saltstone Vaults 1/4 and Disposal Unit 2 concretes have been prepared by SIMCO Technologies, Inc. Transport and physical properties for these materials are currently being measured and sulfate exposure testing to three high alkaline, high sulfate leachates provided by SRNL is
PHYSICAL PROPERTY MEASUREMENTS OF LABORATORY PREPARED SALTSTONE GROUT
Energy Technology Data Exchange (ETDEWEB)
Hansen, E.; Cozzi, A.; Edwards, T.
2014-05-05
The Saltstone Production Facility (SPF) built two new Saltstone Disposal Units (SDU), SDU 3 and SDU 5, in 2013. The variable frequency drive (VFD) for the grout transfer hose pump tripped due to high current demand by the motor during the initial radioactive saltstone transfer to SDU 5B on 12/5/2013. This was not observed during clean cap processing on July 5, 2013 to SDU 3A, which is a slightly longer distance from the SPF than is SDU 5B. Saltstone Design Authority (SDA) is evaluating the grout pump performance and capabilities to transfer the grout processed in SPF to SDU 3/5. To assist in this evaluation, grout physical properties are required. At this time, there are no rheological data from the actual SPF so the properties of laboratory prepared samples using simulated salt solution or Tank 50 salt solution will be measured. The physical properties of grout prepared in the laboratory with de-ionized water (DI) and salt solutions were obtained at 0.60 and 0.59 water to premix (W/P) ratios, respectively. The yield stress of the DI grout was greater than any salt grout. The plastic viscosity of the DI grout was lower than all of the salt grouts (including salt grout with admixture). When these physical data were used to determine the pressure drop and fluid horsepower for steady state conditions, the salt grouts without admixture addition required a higher pressure drop and higher fluid horsepower to transport. When 0.00076 g Daratard 17/g premix was added, both the pressure drop and fluid horsepower were below that of the DI grout. Higher concentrations of Daratard 17 further reduced the pressure drop and fluid horsepower. The uncertainty in the single point Bingham Plastic parameters is + 4% of the reported values and is the bounding uncertainty. Two different mechanical agitator mixing protocols were followed for the simulant salt grout, one having a total mixing time of three minutes and the other having a time of 10 minutes. The Bingham Plastic parameters
International Nuclear Information System (INIS)
Cook, J.R.
2003-01-01
The Aqueous PUREX waste stream from Tanks 33 and 35, which have been blended in Tank 34, has been identified for possible processing through the Saltstone Processing Facility for disposal in the Saltstone Disposal Facility
International Nuclear Information System (INIS)
Wilhite, E.L.
1985-01-01
The effect of capping the entire saltstone landfill is dependent on the effectiveness of the clay cap in preventing infiltration. A cap that is 99% effective will reduce releases from the saltstone landfill by a factor of 7.7. Several combinations of landfill design alterations will result in meeting ground water standards
Special Analysis: Revision of Saltstone Vault 4 Disposal Limits (U)
Energy Technology Data Exchange (ETDEWEB)
Cook, J
2005-05-26
New disposal limits have been computed for Vault 4 of the Saltstone Disposal Facility based on several revisions to the models in the existing Performance Assessment and the Special Analysis issued in 2002. The most important changes are the use of a more rigorous groundwater flow and transport model, and consideration of radon emanation. Other revisions include refinement of the aquifer mesh to more accurately model the footprint of the vault, a new plutonium chemistry model accounting for the different transport properties of oxidation states III/IV and V/VI, use of variable infiltration rates to simulate degradation of the closure system, explicit calculation of gaseous releases and consideration of the effects of settlement and seismic activity on the vault structure. The disposal limits have been compared with the projected total inventory expected to be disposed in Vault 4. The resulting sum-of-fractions of the 1000-year disposal limits is 0.2, which indicates that the performance objectives and requirements of DOE 435.1 will not be exceeded. This SA has not altered the conceptual model (i.e., migration of radionuclides from the Saltstone waste form and Vault 4 to the environment via the processes of diffusion and advection) of the Saltstone PA (MMES 1992) nor has it altered the conclusions of the PA (i.e., disposal of the proposed waste in the SDF will meet DOE performance measures). Thus a PA revision is not required and this SA serves to update the disposal limits for Vault 4. In addition, projected doses have been calculated for comparison with the performance objectives laid out in 10 CFR 61. These doses are 0.05 mrem/year to a member of the public and 21.5 mrem/year to an inadvertent intruder in the resident scenario over a 10,000-year time-frame, which demonstrates that the 10 CFR 61 performance objectives will not be exceeded. This SA supplements the Saltstone PA and supersedes the two previous SAs (Cook et al. 2002; Cook and Kaplan 2003).
Composite analysis E-area vaults and saltstone disposal facilities
Energy Technology Data Exchange (ETDEWEB)
Cook, J.R.
1997-09-01
This report documents the Composite Analysis (CA) performed on the two active Savannah River Site (SRS) low-level radioactive waste (LLW) disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults (EAV) Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of SRS and contains all of the waste disposal facilities, chemical separations facilities and associated high-level waste storage facilities as well as numerous other sources of radioactive material. The analysis considered 114 potential sources of radioactive material containing 115 radionuclides. The results of the CA clearly indicate that continued disposal of low-level waste in the saltstone and EAV facilities, consistent with their respective radiological performance assessments, will have no adverse impact on future members of the public.
Composite analysis E-area vaults and saltstone disposal facilities
International Nuclear Information System (INIS)
Cook, J.R.
1997-09-01
This report documents the Composite Analysis (CA) performed on the two active Savannah River Site (SRS) low-level radioactive waste (LLW) disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults (EAV) Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of SRS and contains all of the waste disposal facilities, chemical separations facilities and associated high-level waste storage facilities as well as numerous other sources of radioactive material. The analysis considered 114 potential sources of radioactive material containing 115 radionuclides. The results of the CA clearly indicate that continued disposal of low-level waste in the saltstone and EAV facilities, consistent with their respective radiological performance assessments, will have no adverse impact on future members of the public
FOAM FORMATION IN THE SALTSTONE PRODUCTION FACILITY: EVALUATION OF SOURCES AND MITIGATION
Energy Technology Data Exchange (ETDEWEB)
Cozzi, A.
2011-01-18
The Saltstone Production Facility receives waste from Tank 50H for treatment. Influents into Tank 50H include the Effluent Treatment Project waste concentrate, H-Canyon low activity waste and General Purpose Evaporator bottoms, Modular Caustic Side Solvent Extraction Unit decontaminated salt solution, and salt solution from the Deliquification, Dissolution and Adjust campaign. Using the Waste Characterization System (WCS), this study tracks the relative amounts of each influent into Tank 50H, as well as the total content of Tank 50H, in an attempt to identify the source of foaming observed in the Saltstone Production Facility hopper. Saltstone has been using antifoam as part of routine processing with the restart of the facility in December 2006. It was determined that the maximum admix usage in the Saltstone Production Facility, both antifoam and set retarder, corresponded with the maximum concentration of H-Canyon low activity waste in Tank 50H. This paper also evaluates archived salt solutions from Waste Acceptance Criteria analysis for propensity to foam and the antifoam dosage required to mitigate foaming. It was determined that Effluent Treatment Project contributed to the expansion factor (foam formation) and General Purpose Evaporator contributed to foaminess (persistence). It was also determined that undissolved solids contribute to foam persistence. It was shown that additions of Dow Corning Q2-1383a antifoam reduced both the expansion factor and foaminess of salt solutions. The evaluation of foaming in the grout hopper during the transition from water to salt solution indicated that higher water-to-premix ratios tended to produce increased foaming. It was also shown that additions of Dow Corning Q2-1383a antifoam reduced foam formation and persistence.
SALTSTONE VARIABILITY STUDY - MEASUREMENT OF POROSITY
International Nuclear Information System (INIS)
Harbour, J; Vickie Williams, V; Tommy Edwards, T; Russell Eibling, R; Ray Schumacher, R
2007-01-01
One of the goals of the Saltstone Variability Study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone mixes. One of the key performance properties is porosity which is a measure of the volume percent of a cured grout that is occupied by salt solution (for the saturated case). This report presents (1) the results of efforts to develop a method for the measurement of porosity of grout samples and (2) initial results of porosity values for samples that have been previously produced as part of the Saltstone Variability Study. A cost effective measurement method for porosity was developed that provides reproducible results, is relatively fast (30 to 60 minutes per sample) and uses a Mettler Toledo HR83 Moisture Analyzer that is already operational and routinely calibrated at Aiken County Technology Laboratory. The method involves the heating of the sample at 105 C until no further mass loss is observed. This mass loss value, which is due to water evaporation, is then used to calculate the volume percent porosity of the mix. The results of mass loss for mixes at 105 C were equivalent to the results obtained using thermal gravimetric analysis. The method was validated by comparing measurements of mass loss at 105 C for cured portland cement in water mixes to values presented in the literature for this system. A stereopycnometer from Quantachrome Instruments was selected to measure the cured grout bulk densities. Density is a property that is required to calculate the porosities. A stereopycnometer was already operational at Aiken County Technology Laboratory, has been calibrated using a solid stainless steel sphere of known volume, is cost effective and fast (∼15 minutes per sample). Cured grout densities are important in their own right because they can be used to project the volume of waste form produced from a given amount of salt feed of known composition. For mixes
GAS MIXING ANALYSIS IN A LARGE-SCALED SALTSTONE FACILITY
Energy Technology Data Exchange (ETDEWEB)
Lee, S
2008-05-28
Computational fluid dynamics (CFD) methods have been used to estimate the flow patterns mainly driven by temperature gradients inside vapor space in a large-scaled Saltstone vault facility at Savannah River site (SRS). The purpose of this work is to examine the gas motions inside the vapor space under the current vault configurations by taking a three-dimensional transient momentum-energy coupled approach for the vapor space domain of the vault. The modeling calculations were based on prototypic vault geometry and expected normal operating conditions as defined by Waste Solidification Engineering. The modeling analysis was focused on the air flow patterns near the ventilated corner zones of the vapor space inside the Saltstone vault. The turbulence behavior and natural convection mechanism used in the present model were benchmarked against the literature information and theoretical results. The verified model was applied to the Saltstone vault geometry for the transient assessment of the air flow patterns inside the vapor space of the vault region using the potential operating conditions. The baseline model considered two cases for the estimations of the flow patterns within the vapor space. One is the reference nominal case. The other is for the negative temperature gradient between the roof inner and top grout surface temperatures intended for the potential bounding condition. The flow patterns of the vapor space calculated by the CFD model demonstrate that the ambient air comes into the vapor space of the vault through the lower-end ventilation hole, and it gets heated up by the Benard-cell type circulation before leaving the vault via the higher-end ventilation hole. The calculated results are consistent with the literature information. Detailed results and the cases considered in the calculations will be discussed here.
International Nuclear Information System (INIS)
Aiyar, G.S.; Hsiu, F.J.
1987-01-01
Radioactive waste from processed spent nuclear fuel at the Savannah River Plant, South Carolina, are stored in underground tanks. The wastes consist of sludge and supernate. Most of the radionuclides and some nonradioactive constituents are removed from the supernate. These along with the sludge are converted into a glass-crystallite matrix and cast into stainless steel cansisters for future disposal in a geological repository. The decontaminated salt solution is mixed with cement, fly ash, and a set-retarding agent, and the resulting grout is transferred to reinforced concrete vaults where it sets into a monolith termed saltstone. The vault is then capped with concrete. A total of 21 vaults measuring 600 x 100 x 27 ft are planned for disposal of the existing supernate plus any additional supernate generated up to the year 2000
Atmospheric Pathway Screening Analysis for Saltstone Disposal Facility Vault 4
International Nuclear Information System (INIS)
COOK, JAMES
2004-01-01
A sequential screening process using a methodology developed by the National Council on Radiation Protection and Measurements, professional judgment and process knowledge has been used to produce a list of radionuclides requiring detailed analysis to derive disposal limits for the Saltstone Disposal Facility based on the atmospheric pathway
Computational Fluid Dynamics Model for Saltstone Vault 4 Vapor Space
International Nuclear Information System (INIS)
Lee, Si Young
2005-01-01
Computational fluid dynamics (CFD) methods have been used to estimate the flow patterns for vapor space inside the Saltstone Vault No.4 under different operating scenarios. The purpose of this work is to examine the gas motions inside the vapor space under the current vault configurations. A CFD model took three-dimensional transient momentum-energy coupled approach for the vapor space domain of the vault. The modeling calculations were based on prototypic vault geometry and expected normal operating conditions as defined by Waste Solidification Engineering. The modeling analysis was focused on the air flow patterns near the ventilated corner zones of the vapor space inside the Saltstone vault. The turbulence behavior and natural convection mechanism used in the present model were benchmarked against the literature information and theoretical results. The verified model was applied to the Saltstone vault geometry for the transient assessment of the air flow patterns inside the vapor space of the vault region using the boundary conditions as provided by the customer. The present model considered two cases for the estimations of the flow patterns within the vapor space. One is the reference baseline case. The other is for the negative temperature gradient between the roof inner and top grout surface temperatures intended for the potential bounding condition. The flow patterns of the vapor space calculated by the CFD model demonstrate that the ambient air comes into the vapor space of the vault through the lower-end ventilation hole, and it gets heated up by the Benard-cell type circulation before leaving the vault via the higher-end ventilation hole. The calculated results are consistent with the literature information
International Nuclear Information System (INIS)
Johnson, T.L.
1986-02-01
A field test facility has been designed and installed to obtain data on the vegetative uptake of radionuclides from buried low-level radioactive waste. The waste is a cement-like, solidified salt solution known as saltstone. The facility consists of 32 lysimeters (containers 6 feet in diameter and 6 to 10 feet in depth) holding buried saltstone at varying depths, and with varying types of vegetation grown at the surface. Vegetation, soil, and groundwater samples will be analyzed for Tc-99, Sr-90, I-129, Cs-137, and other radionuclides. Groundwater will also be analyzed for other water quality parameters, including nitrates
Chen, Jian-Jun; Yu, Tian-Ming; Wang, Bi-Ling; Xie, Zheng-Miao
2010-01-01
A pot experiment was conducted to evaluate the effects of phosphate-containing (P) amendments on the toxicity and bioavailability of Pb and Zn in a soil contaminated by mining tailings using toxicity characteristic leaching procedure (TCLP) and water soluble, exchangeable leaching procedures in order to find out the appropriate P application rates to reduce the soil TCLP extractable Pb to below the USA EPA's regulatory limit levels. The results showed that TCLP extractable Pb concentrations were significantly decreased by up to 93.3% for MPP treatments and up to 68.5% for SSP treatments after P application. The dose required to reduce leachable Pb below the EPA's regulatory limit level was found to be around the molar ratio of v(P/Pb) = 0.6 for MPP and 1.8 for SSP. It was also found both MPP and SSP could reduce the exchangeable Pb and Zn concentrations that all bio-available Zn forms including water soluble, exchangeable, and TCLP extractable forms in soil were significantly and negatively correlated to soil pH values, indicating that the content of Zn in the soil was mostly controlled by soil pH value even after P application. These results suggest that P as MPP and SSP could successfully decrease the toxicity and bioavailability of Pb and Zn in the contaminated soil.
International Nuclear Information System (INIS)
ROBERT, HIERGESELL
2005-01-01
To assist the Saltstone Vault 2 Design Team, an investigation was conducted to evaluate the effectiveness of alternative concrete wall thicknesses in limiting nitrate diffusion away from the planned facility. While the current design calls for 18-inch concrete walls, alternative thicknesses of 12-in, 8-in, and 6-in were evaluated using a simplified 1-D numerical model. To serve as a guide for Saltstone Vault 2 conceptual design, the results of this investigation were applied to Saltstone Vault 4 to determine what the hypothetical limits would be for concrete wall thicknesses thinner than the planned 18-inches. This was accomplished by adjusting the Vault 4 Limits, based on the increased nitrate diffusion rates through the thinner concrete walls, such that the 100-m well limit of 44 mg/L of nitrate as nitrate was not exceeded. The implication of these preliminary results is that as thinner vault walls are implemented there is a larger release of nitrate, thus necessitating optimal vault placement to minimize the number of vaults placed along a single groundwater flow path leading to the discharge zone
Adaptation of the TCLP and SW-846 methods to radioactive mixed waste
International Nuclear Information System (INIS)
Griest, W.H.; Schenley, R.L.; Caton, J.E.; Wolfe, P.F.
1994-01-01
Modifications of conventional sample preparation and analytical methods are necessary to provide radiation protection and to meet sensitivity requirements for regulated constituents when working with radioactive samples. Adaptations of regulatory methods for determining ''total'' Toxicity Characteristic Leaching Procedure (TCLP) volatile and semivolatile organics and pesticides, and for conducting aqueous leaching are presented
International Nuclear Information System (INIS)
Langton, C.A.
1984-01-01
Defense waste processing at the Savannah River Plant will include decontamination and disposal of approximately 400 million liters of waste containing NaNO 3 , NaOH, Na 2 SO 4 , and NaNO 2 . After decontamination, the salt solution is classified as low-level waste. A cement-based waste form, saltstone, has been designed for disposal of Savannah River Plant low-level radioactive salt waste. Bulk properties of this material have been tailored with respect to salt leach rate, permeability, and compressive strength. Microstructure and mineralogy of leached and unleached specimens were characterized by SEM and x-ray diffraction analyses. The disposal system for the DWPF salt waste includes reconstitution of the crystallized salt as a solution containing 32 wt % solids. This solution will be decontaminated to remove 137 Cs and 90 Sr and then stabilized in a cement-based waste form. Laboratory and field tests indicate that this stabilization process greatly reduces the mobility of all of the waste constitutents in the surface and near-surface environment. Engineered trenches for subsurface burial of the saltstone have been designed to ensure compatibility between the waste form and the environment. The total disposal sytem, saltstone-trench-surrounding soil, has been designed to contain radionuclides, Cr, and Hg by both physical encapsulation and chemical fixation mechanisms. Physical encapsulation of the salts is the mechanism employed for controlling N and OH releases. In this way, final disposal of the SRP low-level waste can be achieved and the quality of the groundwater at the perimeter of the disposal site meets EPA drinking water standards
Performance Properties Of Saltstone Produced Using SWPF Simulants
International Nuclear Information System (INIS)
Harbour, J.; Edwards, T.
2010-01-01
The overwhelming majority of waste to be immobilized at the Saltstone Production Facility will come from the waste stream exiting the Salt Waste Processing Facility (SWPF). These SWPF batches are salt solutions that result from pretreatment of the High Level Waste (HLW) supernate by an Actinide Removal Process followed by Caustic Side Solvent Extraction. The concentration of aluminate within these streams will vary and be determined by (1) the concentration in the incoming salt waste stream, (2) the degree of aluminum leaching from the HLW, (3) the method for introducing the aluminate into the waste stream (continuous or batch) and (4) and any operational or regulatory limitations. The overall Performance Assessment outcome for the Saltstone Disposal Facility will depend significantly on the performance properties of the SWPF Saltstone grouts. This report identifies and quantifies, when possible, those factors that drive the performance properties of the projected SWPF grouts. Previous work has identified aluminate concentration in the salt waste stream as a key factor in determining performance. Consequently, significant variation in the aluminate concentration to a maximum level of 0.65 M was investigated in this report. The SWPF baseline grout is a mix with a 0.60 water to cementitious ratio and a premix composition of 45 wt % slag, 45 wt % fly ash and 10 wt % portland cement. The key factors that drive performance of the SWPF mixes were determined to be (1) the time/temperature profile for curing, (2) water to cementitious materials ratio, (3) aluminate concentration in the waste stream, and (4) wt % slag in the premix. An increase in the curing temperature for mixes with 45 wt % slag resulted in a 2.5 times decrease in Young's modulus. The reduction of Young's modulus measured at 60 C versus 22 C was mitigated by an increase in the aluminate concentration but was still significant. For mixes containing 60 wt % slag, the reduction in Young's modulus between
UK-Nuclear decommissioning authority and US Salt-stone waste management issues
International Nuclear Information System (INIS)
Lawless, William; Whitton, John
2007-01-01
Available in abstract form only. Full text of publication follows: We update two case studies of stakeholder issues in the UK and US. Earlier versions were reported at Waste Management 2006 and 2007 and at ICEM 2005. UK: The UK nuclear industry has begun to consult stakeholders more widely in recent years. Historically, methods of engagement within the industry have varied, however, recent discussions have generally been carried out with the explicit understanding that engagement with stakeholders will be 'dialogue based' and will 'inform' the final decision made by the decision maker. Engagement is currently being carried out at several levels within the industry; at the national level (via the Nuclear Decommissioning Authority's (NDA) National Stakeholder Group (NSG)); at a local site level (via Site Stakeholder Groups) and at a project level (usually via the Best Practicable Environmental Option process (BPEO)). This paper updates earlier results by the co-author with findings from a second questionnaire issued to the NSG in Phase 2 of the engagement process. An assessment is made regarding the development of stakeholder perceptions since Phase 1 towards the NDA process. US: The US case study reviews the resolution of issues on salt-stone by Department of Energy's (DOE) Savannah River Site (SRS) Citizens Advisory Board (CAB), in Aiken, SC. Recently, SRS-CAB encouraged DOE and South Carolina's regulatory Department of Health and Environmental Control (SC-DHEC) to resolve a conflict preventing SC-DHEC from releasing a draft permit to allow SRS to restart salt-stone operations. It arose with a letter sent from DOE blaming the Governor of South Carolina for delay in restarting salt processing. In reply, the Governor blamed DOE for failing to assure that Salt Waste Processing Facility (SWPF) would be built. SWPF is designed to remove most of the radioactivity from HLW prior to vitrification, the remaining fraction destined for salt-stone. (authors)
Waste Incidental to Reprocessing Evaluation for Disposing Saltcake to Saltstone
International Nuclear Information System (INIS)
Jones, R.T.
2002-01-01
This Waste Incidental to Reprocessing Evaluation is performed in accordance with Department of Energy Order 435.1, Radioactive Waste Management. This evaluation is performed in order to determine whether saltcake currently stored in the Tank Farms, when separated from supernate, meets WIR requirements and can therefore be managed as Low Level Waste and disposed in the Saltstone Production and Disposal Facility in Z-Area
Addendum to the composite analysis for the E-Area Vaults and Saltstone Disposal Facilities
Energy Technology Data Exchange (ETDEWEB)
Cook, J.R.
2000-03-13
This report documents the composite analysis performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility.
Addendum to the composite analysis for the E-Area Vaults and Saltstone Disposal Facilities
International Nuclear Information System (INIS)
Cook, J.R.
2000-01-01
This report documents the composite analysis performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility
IMPACT OF INCREASED ALUMINATE CONCENTRATIONS ON PROPERTIES OF SALTSTONE MIXES
International Nuclear Information System (INIS)
Harbour, J; Tommy Edwards, T; Erich Hansen, E; Vickie Williams, V
2007-01-01
One of the goals of the Saltstone variability study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone mixes. The protocols developed in this variability study are ideally suited as a tool to assess the impact of proposed changes to the processing flow sheet for Liquid Waste Operations (LWO). One such proposal that is currently under consideration is to introduce a leaching step in the treatment of the High Level Waste (HLW) sludge to remove aluminum prior to vitrification at the Defense Waste Processing Facility (DWPF). This leachate would significantly increase the soluble aluminate concentrations as well as the free hydroxide ion concentration in the salt feed that will be processed at the Saltstone Processing Facility (SPF). Consequently, an initial study of the impact of increased aluminate concentration on the Saltstone grout properties was performed. The projected compositions and ranges of the aluminate rich salt stream (which includes the blending strategy) are not yet available and consequently, in this initial report, two separate salt stream compositions were investigated. The first stream starts with the previously projected baseline composition of the salt solution that will be fed to SPF from the Salt Waste Processing Facility (SWPF). The second stream is the solution that results from washing of the current Tank 51 sludge and subsequent transfer of the salt solution to Tank 11. The SWPF simulant has higher nitrate and lower free hydroxide than the Tank 11 simulant. In both of these cases, the aluminate was varied up to a maximum of 0.40 to 0.45M aluminate in order to evaluate the impact of increasing aluminate ion concentration on the grout properties. In general, the fresh grout properties of mixes made with SWPF and Tank 11 simulants were relatively insensitive to an increase in aluminate concentration in the salt solutions. However, the overall
Special Analysis: Revised 14C Disposal Limits for the Saltstone Disposal Facility
International Nuclear Information System (INIS)
Kaplan, D.I.
2004-01-01
The Saltstone Special Analysis calculated a limit for 14C based on the atmospheric pathway of 52 pCi/mL using some very conservative assumptions. This was compared to the estimated Low Curie Salt concentration of 0.45 pCi/mL and since the limit was two orders of magnitude greater than the estimated concentration, the decision was made that no further analysis was needed. The 14C concentration in Tank 41 has been found to be much greater than the estimated concentration and to exceed the limit derived in the Special Analysis. A rigorous analysis of the release of 14C via the air pathway that considers the chemical effects of the Saltstone system has shown that the flux of 14C is significantly less than that assumed in the Special Analysis. The net result is an inventory limit for 14C that is significantly higher than that derived in the Special Analysis that will also meet the performance objectives of DOE Order 435.1
PORFLOW Simulations Supporting Saltstone Disposal Unit Design Optimization
Energy Technology Data Exchange (ETDEWEB)
Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hang, T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Taylor, G. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2015-12-10
SRNL was requested by SRR to perform PORFLOW simulations to support potential cost-saving design modifications to future Saltstone Disposal Units in Z-Area (SRR-CWDA-2015-00120). The design sensitivity cases are defined in a modeling input specification document SRR-CWDA-2015-00133 Rev. 1. A high-level description of PORFLOW modeling and interpretation of results are provided in SRR-CWDA-2015-00169. The present report focuses on underlying technical issues and details of PORFLOW modeling not addressed by the input specification and results interpretation documents. Design checking of PORFLOW modeling is documented in SRNL-L3200-2015-00146.
SENSITIVITY ANALYSIS FOR SALTSTONE DISPOSAL UNIT COLUMN DEGRADATION ANALYSES
Energy Technology Data Exchange (ETDEWEB)
Flach, G.
2014-10-28
PORFLOW related analyses supporting a Sensitivity Analysis for Saltstone Disposal Unit (SDU) column degradation were performed. Previous analyses, Flach and Taylor 2014, used a model in which the SDU columns degraded in a piecewise manner from the top and bottom simultaneously. The current analyses employs a model in which all pieces of the column degrade at the same time. Information was extracted from the analyses which may be useful in determining the distribution of Tc-99 in the various SDUs throughout time and in determining flow balances for the SDUs.
International Nuclear Information System (INIS)
Lee, B.K.; Hwang, H.W.
2010-01-01
Leaching characteristics of industrial sludge and fly ash using Korean Standard Leaching Procedure (KSLP) and Toxicity Characteristics Leaching Procedure (TCLP) were studied. Possibilities of re-adsorption of heavy metal ions on the surface of sludge and ash during the course of leaching were also investigated. KSLP looked relatively more aggressive than the TCLP in leaching heavy metal ions. Concentrations of metal ions leached in both the methods, however, were found very low in comparison to the concentration of ions present in the original samples. In case of sludge, heavy metal ions showed relatively high rate of leaching at fourth and fifth stages of sequential extraction while ash showed high rate of leaching at the first three stages of extraction. Some of the concentrations of heavy metal ions leached out in the tests also found to be adsorbed on the surface of sludge and ash. Heavy metal ions present in high concentrations in the sample showed lower rate of adsorption than their leaching rate. No distinct difference in the results of KSLP and TCLP was observed. However, variations in the leaching results could be due to the different nature of hazardous waste and leaching conditions. More information like kinetics of leaching, mineralogical characteristics of waste and site characteristics of landfill were required to predict more accurate leaching behavior of ions in natural conditions. (author)
Z-Area Saltstone Disposal Facility Groundwater Monitoring Report. 1997 Annual Report
International Nuclear Information System (INIS)
Roach, J.L. Jr.
1997-12-01
Samples from the ZBG wells at the Z-Area Saltstone Disposal Facility are analyzed for constituents required by South Carolina Department of Health and Environmental Control (SCDHEC) Industrial Solid Waste Permit number-sign 025500-1603 (formerly IWP-217). No constituents were reported above SCDHEC-proposed groundwater monitoring standards or final Primary Drinking Water Standards during first or third quareters 1997. No constituents were detected above SRS flagging criteria during first or third quarters 1997
Energy Technology Data Exchange (ETDEWEB)
Bowers, J.S.; Anson, J.R.; Painter, S.M. [Lawrence Livermore National Lab., CA (United States)] [and others
1995-12-31
Stabilization is a best demonstrated available technology, or BDAT. This technology traps toxic contaminants in a matrix so that they do not leach into the environment. The stabilization process routinely uses pozzolanic materials. Portland cement, fly ash-lime mixes, gypsum cements, and clays are some of the most common materials. In many instances, materials that can pass the Toxicity Characteristic Leaching Procedure (TCLP the federal leach test) or the Soluble Threshold Leachate Concentration (STLC the California leach test) must have high concentrations of lime or other caustic material because of the low pH of the leaching media. Both leaching media, California`s and EPA`s, have a pH of 5.0. California uses citric acid and sodium citrate while EPA uses acetic acid and sodium acetate. The concentration in the leachate is approximately ten times higher for the STLC procedure than the TCLP. These media can form ligands that provide excellent metal leaching. Because of the aggressive nature of the leaching medium, stabilized wastes in many cases will not pass the leaching tests. At the Lawrence Livermore National Laboratory (LLNL), additives such as dithiocarbamates and thiocarbonates, which are pH-insensitive and provide resistance to ligand formation, are used in the waste stabilization process. Attapulgite, montmorillonite, and sepiolite clays are used because they are forgiving (recipe can be adjusted before the matrix hardens) when formulating a stabilization matrix, and they have a neutral pH. By using these clays and additives, LLNL`s highly concentrated wastewater treatment sludges have passed the TCLP and STLC tests. The most frequently used stabilization process consists of a customized recipe involving waste sludge, clay and dithiocarbamate salt, mixed with a double planetary mixer into a pasty consistency. TCLP and STLC data on this waste matrix have shown that the process matrix meets land disposal requirements.
Radiological performance assessment for the Z-Area Saltstone Disposal Facility
Energy Technology Data Exchange (ETDEWEB)
Cook, J.R.; Fowler, J.R. [Westinghouse Savannah River Co., Aiken, SC (United States)
1992-12-18
This radiological performance assessment (RPA) for the Savannah River Site (SRS) Saltstone Disposal Facility (SDF) was prepared in accordance with the requirements of Chapter III of the US Department of Energy Order 5820.2A. The Order specifies that an RPA should provide reasonable assurance that a low-level waste (LLW) disposal facility will comply with the performance objectives of the Order. The performance objectives require that: (1) exposures of the general public to radioactivity in the waste or released from the waste will not result in an effective dose equivalent of 25 mrem per year; (2) releases to the atmosphere will meet the requirements of 40 CFR 61; (3) inadvertent intruders will not be committed to an excess of an effective dose equivalent of 100 mrem per year from chronic exposure, or 500 mrem from a single acute exposure; and (4) groundwater resources will be protected in accordance with Federal, State and local requirements.
Radiological performance assessment for the Z-Area Saltstone Disposal Facility
International Nuclear Information System (INIS)
Cook, J.R.; Fowler, J.R.
1992-01-01
This radiological performance assessment (RPA) for the Savannah River Site (SRS) Saltstone Disposal Facility (SDF) was prepared in accordance with the requirements of Chapter III of the US Department of Energy Order 5820.2A. The Order specifies that an RPA should provide reasonable assurance that a low-level waste (LLW) disposal facility will comply with the performance objectives of the Order. The performance objectives require that: (1) exposures of the general public to radioactivity in the waste or released from the waste will not result in an effective dose equivalent of 25 mrem per year; (2) releases to the atmosphere will meet the requirements of 40 CFR 61; (3) inadvertent intruders will not be committed to an excess of an effective dose equivalent of 100 mrem per year from chronic exposure, or 500 mrem from a single acute exposure; and (4) groundwater resources will be protected in accordance with Federal, State and local requirements
Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds
International Nuclear Information System (INIS)
Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.
2007-01-01
The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound
Data Package for Secondary Waste Form Down-Selection-Cast Stone
International Nuclear Information System (INIS)
Serne, R. Jeffrey; Westsik, Joseph H.
2011-01-01
Available literature on Cast Stone and Saltstone was reviewed with an emphasis on determining how Cast Stone and related grout waste forms performed in relationship to various criteria that will be used to decide whether a specific type of waste form meets acceptance criteria for disposal in the Integrated Disposal Facility (IDF) at Hanford. After the critical review of the Cast Stone/Saltstone literature, we conclude that Cast Stone is a good candidate waste form for further consideration. Cast stone meets the target IDF acceptance criteria for compressive strength, no free liquids, TCLP leachate are below the UTS permissible concentrations and leach rates for Na and Tc-99 are suiteably low. The cost of starting ingredients and equipment necessary to generate Cast Stone waste forms with secondary waste streams are low and the Cast Stone dry blend formulation can be tailored to accommodate variations in liquid waste stream compositions. The database for Cast Stone short-term performance is quite extensive compared to the other three candidate waste solidification processes. The solidification of liquid wastes in Cast Stone is a mature process in comparison to the other three candidates. Successful production of Cast Stone or Saltstone has been demonstrated from lab-scale monoliths with volumes of cm3 through m3 sized blocks to 210-liter sized drums all the way to the large pours into vaults at Savannah River. To date over 9 million gallons of low activity liquid waste has been solidified and disposed in concrete vaults at Savannah River.
Data Package for Secondary Waste Form Down-Selection—Cast Stone
Energy Technology Data Exchange (ETDEWEB)
Serne, R. Jeffrey; Westsik, Joseph H.
2011-09-05
Available literature on Cast Stone and Saltstone was reviewed with an emphasis on determining how Cast Stone and related grout waste forms performed in relationship to various criteria that will be used to decide whether a specific type of waste form meets acceptance criteria for disposal in the Integrated Disposal Facility (IDF) at Hanford. After the critical review of the Cast Stone/Saltstone literature, we conclude that Cast Stone is a good candidate waste form for further consideration. Cast stone meets the target IDF acceptance criteria for compressive strength, no free liquids, TCLP leachate are below the UTS permissible concentrations and leach rates for Na and Tc-99 are suiteably low. The cost of starting ingredients and equipment necessary to generate Cast Stone waste forms with secondary waste streams are low and the Cast Stone dry blend formulation can be tailored to accommodate variations in liquid waste stream compositions. The database for Cast Stone short-term performance is quite extensive compared to the other three candidate waste solidification processes. The solidification of liquid wastes in Cast Stone is a mature process in comparison to the other three candidates. Successful production of Cast Stone or Saltstone has been demonstrated from lab-scale monoliths with volumes of cm3 through m3 sized blocks to 210-liter sized drums all the way to the large pours into vaults at Savannah River. To date over 9 million gallons of low activity liquid waste has been solidified and disposed in concrete vaults at Savannah River.
Lifescience Database Archive (English)
Full Text Available e uncharacterized protein OS=Oryza... 35 0.050 tr|Q68LQ2|Q68LQ2_9ROSI Maturase (Fragment) OS=Sapria himalaya...na ... 37 0.50 tr|Q5QCI0|Q5QCI0_9ROSI Maturase (Fragment) OS=Sapria himalayana ... 37 0.50 tr|Q6FQH7|Q6FQH7_...C Sbjct: 115 LSRTCGDVDFLLVMGDESDATRELC 139 >tr|Q68LQ2|Q68LQ2_9ROSI Maturase (Fragment) OS=Sapria himalayana ...ase (Fragment) OS=Sapria himalayana GN=matR PE=4 SV=1 Length = 584 Score = 37.4 b
Energy Technology Data Exchange (ETDEWEB)
1989-04-04
This petition seeks exclusion for stabilized and solidified sludge material generated by treatment of wastewater from the 300-M aluminum forming and metal finishing processes. The waste contains both hazardous and radioactive components and is classified as a mixed waste. The objective of this petition is to demonstrate that the stabilized sludge material (saltstone), when properly disposed, will not exceed the health-based standards for the hazardous constituents. This petition contains sampling and analytical data which justify the request for exclusion. The results show that when the data are applied to the EPA Vertical and Horizontal Spread (VHS) Model, health-based standards for all hazardous waste constituents will not be exceeded during worst case operating and environmental conditions. Disposal of the stabilized sludge material in concrete vaults will meet the requirements pertaining to Waste Management Activities for Groundwater Protection at the Savannah River Site in Aiken, S.C. Documents set forth performance objectives and disposal options for low-level radioactive waste disposal. Concrete vaults specified for disposal of 300-M saltstone (treated F006 sludge) assure that these performance objectives will be met.
Energy Technology Data Exchange (ETDEWEB)
Fondeur, F. F.
2013-04-17
The Office of Waste Processing, within the Office of Technology Innovation and Development, funded the development of an enhanced Caustic-Side Solvent Extraction (CSSX) solvent for deployment at the Savannah River Site for removal of cesium from High Level Waste. This effort lead to the development of the Next Generation Solvent (NGS) with Tris (3,7-dimethyl octyl) guanidine (TiDG). The first deployment target for the NGS solvent is within the Modular CSSX Unit (MCU). Deployment of a new chemical within an existing facility requires verification that the new chemical components are compatible with the installed equipment. In the instance of a new organic solvent, the primary focus is on compatibility of the solvent with organic polymers used in the affected facility. This report provides the calculated data from exposing these polymers to the Next Generation Solvent. An assessment of the dimensional stability of polymers known to be used or present in the MCU, Defense Waste Processing Facility (DWPF), and Saltstone facilities that will be exposed to the NGS showed that TiDG could selectively affect the elastomers and some thermoplastics to varying extents, but the typical use of these polymers in a confined geometry will likely prevent the NGS from impacting component performance. The polymers identified as of primary concern include Grafoil® (flexible graphite), Tefzel®, Isolast®, ethylene-propylene-diene monomer (EPDM) rubber, nitrile-butadiene rubber (NBR), styrene-butadiene rubber (SBR), ultra high molecular weight polyethylene (UHMWPE), and fluorocarbon rubber (FKM). Certain polymers like NBR and EPDM were found to interact mildly with NGS but their calculated swelling and the confined geometry will impede interaction with NGS. In addition, it was found that Vellumoid (cellulose fibers-reinforced glycerin and protein) may leach protein and Polyvinyl Chloride (PVC) may leach plasticizer (such as Bis-Ethylhexyl-Phthalates) into the NGS solvent. Either case
Groundwater Monitoring Plan for the Z-Area Saltstone Facility
International Nuclear Information System (INIS)
Wells, D.
2002-01-01
Groundwater monitoring has been conducted at the Z-Area Saltstone Disposal Facility since 1987. At that time, groundwater monitoring was not required by the industrial landfill regulations, but a modest monitoring program was required by the operating permit. In 1996 SRS proposed a program based on direct push sampling. This program called for biennial direct push sampling within 25 feet of each waste-containing cell with additional samples being taken in areas where excessive cracking had been observed. The direct push proposal was accepted by The South Carolina Department of Health and Environmental Control (SCDHEC). The Industrial Solid Waste Landfill Regulations were revised in 1998 and now include requirements for groundwater monitoring. The major elements of those regulations and their application at Z-Area are discussed. These are a point of compliance, groundwater protection standards, the groundwater monitoring system, sampling and analysis, and data evaluation and reporting
Benzene TCLP results from saltstone prepared with 2X ITP flowsheet concentrations of phenylborates
International Nuclear Information System (INIS)
Poirier, M.R.
2000-01-01
The Savannah River Site (SRS) teamed with the Pacific Northwest National Laboratory (PNNL), Oak Ridge National Laboratory (ORNL), and ITT Flygt Corporation to conduct a test program evaluating shrouded axial propeller mixers (Flygt mixers) for heel removal in SRS Tank 19. SRS is identifying and investigating techniques to remove sludge heels from waste tanks such as Tank 19
Energy Technology Data Exchange (ETDEWEB)
Shafer, A.
2010-05-05
The purpose of this report is to document the acceptability of the second macrobatch (Salt Batch 2) of Tank 49H waste to H Tank Farm, DWPF, and Saltstone for operation of the Interim Salt Disposition Project (ISDP). Tank 49 feed meets the Waste Acceptance Criteria (WAC) requirements specified by References 11, 12, and 13. Salt Batch 2 material is qualified and ready to be processed through ARP/MCU to the final disposal facilities.
International Nuclear Information System (INIS)
Wolf, H.C.
1984-06-01
The installation phase of a large-scale demonstration of the disposal concept for decontaminated, low-level radioactive salt waste at the Savannah River Plant was completed in December 1983 and January 1984. The installation entailed immobilizing 7500 gallons of decontaminated salt solution with a blended cement formulation and pouring the resulting grout, saltstone, into three specially designed lysimeters for extended in-field leaching tests under natural conditions. 4 references, 35 figures, 4 tables
International Nuclear Information System (INIS)
Bowers, J.S.; Anson, J.R.; Painter, S.M.; Maitino, R.E.
1995-03-01
Stabilization traps toxic contaminants (usually both chemically and physically) in a matrix so that they do not leach into the environment. Typical contaminants are metals (mostly transition metals) that exhibit the characteristic of toxicity. The stabilization process routinely uses pozzolanic materials. Portland cement, fly ash-lime mixes, gypsum cements, and clays are some of the most common materials. In many instances, materials that can pass the Toxicity Characteristic Leaching Procedure (TCLP-the federal leach test) or the Soluble Threshold Leachate Concentration (STLC-the California leach test) must have high concentrations of lime or other caustic material because of the low pH of the leaching media. Both leaching media, California's and EPA's, have a pH of 5.0. California uses citric acid and sodium citrate while EPA uses acetic acid and sodium acetate. These media can form ligands that provide excellent metal leaching. Because of the aggressive nature of the leaching medium, stabilized wastes in many cases will not pass the leaching tests. At the Lawrence Livermore National Laboratory, additives such as dithiocarbamates and thiocarbonates, which are pH-insensitive and provide resistance to ligand formation, are used in the waste stabilization process. Attapulgite, montmorillonite, and sepiolite clays are used because they are forgiving (recipe can be adjusted before the matrix hardens). The most frequently used stabilization process consists of a customized recipe involving waste sludge, clay and dithiocarbamate salt, mixed with a double planetary mixer into a pasty consistency. TCLP and STLC data on this waste matrix have shown that the process matrix meets land disposal requirements
NUMERICAL FLOW AND TRANSPORT SIMULATIONS SUPPORTING THE SALTSTONE FACILITY PERFORMANCE ASSESSMENT
Energy Technology Data Exchange (ETDEWEB)
Flach, G.
2009-02-28
The Saltstone Disposal Facility Performance Assessment (PA) is being revised to incorporate requirements of Section 3116 of the Ronald W. Reagan National Defense Authorization Act for Fiscal Year 2005 (NDAA), and updated data and understanding of vault performance since the 1992 PA (Cook and Fowler 1992) and related Special Analyses. A hybrid approach was chosen for modeling contaminant transport from vaults and future disposal cells to exposure points. A higher resolution, largely deterministic, analysis is performed on a best-estimate Base Case scenario using the PORFLOW numerical analysis code. a few additional sensitivity cases are simulated to examine alternative scenarios and parameter settings. Stochastic analysis is performed on a simpler representation of the SDF system using the GoldSim code to estimate uncertainty and sensitivity about the Base Case. This report describes development of PORFLOW models supporting the SDF PA, and presents sample results to illustrate model behaviors and define impacts relative to key facility performance objectives. The SDF PA document, when issued, should be consulted for a comprehensive presentation of results.
Addendum to the Composite Analysis for the E-Area Vaults and Saltstone Disposal Facilities
International Nuclear Information System (INIS)
Cook, J.R.
2002-01-01
Revision 1 of the Composite Analysis (CA) Addendum has been prepared to respond to the U.S. Department of Energy (DOE) Low-Level Waste Disposal Facilities Federal Review Group review of the CA. This addendum to the composite analysis responds to the conditions of approval. The composite analysis was performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of the Savannah River Site and contains all of the waste disposal facilities, the chemical separation facilities and associated high-level waste storage facilities, as well as numerous other sources of radioactive material
Kede, Maria Luiza F. M.; Correia, Fabio V.; Conceição, Paulo F.; Salles Junior, Sidney F.; Marques, Marcia; Moreira, Josino C.; Pérez, Daniel V.
2014-01-01
The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb) and cadmium (Cd) from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed) followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.)). The treatments applied (in triplicates) were: T1—potassium dihydrogen phosphate (KH2PO4); T2—reactive natural phosphate fertilizer (NRP) and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP); sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF) for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1) plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments. PMID:25386955
Directory of Open Access Journals (Sweden)
Maria Luiza F. M. Kede
2014-11-01
Full Text Available The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb and cadmium (Cd from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.. The treatments applied (in triplicates were: T1—potassium dihydrogen phosphate (KH2PO4; T2—reactive natural phosphate fertilizer (NRP and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP; sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1 plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments.
Perovskite-based heterostructures integrating ferromagnetic-insulating La0.1Bi0.9MnO3
Gajek, M.; Bibes, M.; Barthélémy, A.; Varela, M.; Fontcuberta, J.
2005-05-01
We report on the growth of thin films and heterostructures of the ferromagnetic-insulating perovskite La0.1Bi0.9MnO3. We show that the La0.1Bi0.9MnO3 perovskite grows single phased, epitaxially, and with a single out-of-plane orientation either on SrTiO3 substrates or onto strained La2/3Sr1/3MnO3 and SrRuO3 ferromagnetic-metallic buffer layers. We discuss the magnetic properties of the La0.1Bi0.9MnO3 films and heterostructures in view of their possible potential as magnetoelectric or spin-dependent tunneling devices.
Energy Auditor and Quality Control Inspector Competency Model
Energy Technology Data Exchange (ETDEWEB)
Head, Heather R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Kurnik, Charles W [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Schroeder, Derek [U.S. Department of Energy; Cutchin, Kelly [Simonson Management Services
2018-05-02
The Energy Auditor (EA) and Quality Control Inspector (QCI) Competency model was developed to identify the soft skills, foundational competencies and define the levels of Knowledge, Skills, and Abilities (KSAs) required to successfully perform the tasks defined in the EA and QCI Job Task Analysis (JTAs), the U.S. Department of Energy (DOE) used the U.S. Department of Labor's (DOL) Competency Model Clearinghouse resources to develop a QCI and EA Competency Model. To keep the QCI and EA competency model consistent with other construction and energy management competency models, DOE and the National Renewable Energy Laboratory used the existing 'Residential Construction Competency Model' and the 'Advanced Commercial Building Competency Model' where appropriate.
A non-toxic fluorogenic dye for mitochondria labeling.
Han, Junyan; Han, Myung Shin; Tung, Ching-Hsuan
2013-11-01
Mitochondria, powerhouses of cells, are responsible for many critical cellular functions, such as cell energy metabolism, reactive oxygen species production, and apoptosis regulation. Monitoring mitochondria morphology in live cells temporally and spatially could help with the understanding of the mechanisms of mitochondrial functional regulation and the pathogenesis of mitochondria-related diseases. A novel non-cytotoxic fluorogenic compound, AcQCy7, was developed as a mitochondria-specific dye. AcQCy7 emitted no fluorescent signal outside of cells, but it became fluorescent after intracellular hydrolysis of the acetyl group. The hydrolyzed fluorescent product was well retained in mitochondria, enabling long-lasting fluorescence imaging of mitochondria without cell washing. A 2-day culture study using AcQCy7 showed no sign of cytotoxicity, whereas a commonly used mitochondria-staining probe, Mitochondria Tracker Green, caused significant cell death even at a much lower concentration. Apoptosis-causing mitochondria fission was monitored clearly in real time by AcQCy7. A simple add-and-read mitochondria specific dye AcQCy7 has been validated in various cell models. Bright mitochondria specific fluorescent signal in treated cells lasted several days without noticeable toxicity. The probe AcQCy7 has been proofed to be a non-toxic agent for long-term mitochondria imaging. © 2013.
Energy Technology Data Exchange (ETDEWEB)
2016-11-18
There are many common software patterns and utilities for the ORNL Quantum Computing Institute that can and should be shared across projects. Otherwise we find duplication of code which adds unwanted complexity. This is a software product seeks to alleviate this by providing common utilities such as object factories, graph data structures, parameter input mechanisms, etc., for other software products within the ORNL Quantum Computing Institute. This work enables pure basic research, has no export controlled utilities, and has no real commercial value.
DEFF Research Database (Denmark)
Basith, M. A.; Khan, F. A.; Ahmmad, Bashir
2015-01-01
that the strength of the exchange bias effect is tunable by the field cooling. The HEB values are also found to be dependent on the temperature. This magnetically tunable exchange bias obtained at temperatures up to 250K in Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles may be worthwhile for potential applications.......The exchange bias (EB) effect has been observed in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles.The influence of magnetic field cooling on the exchange bias effect has also been investigated. The magnitude of the exchange bias field (HEB) increases with the cooling magnetic field, showing...
Kaasaaitamine. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-97-09 / Jaan Sootak
Sootak, Jaan, 1948-
2009-01-01
Riigikohtu lahendist 3-1-1-97-09: I. V. kaitsja vandeadvokaat Aivar Ennoki kassatsioon Tallinna Ringkonnakohtu 15. juuni 2009. a kohtuotsuse peale kriminaalasjas I. V. süüdistuses KarS § 200 lg 2 p 7 - § 22 lg 3; § 215 lg 2 p 3 - § 22 lg 3 järgi
A review on economic emission dispatch problems using quantum computational intelligence
Mahdi, Fahad Parvez; Vasant, Pandian; Kallimani, Vish; Abdullah-Al-Wadud, M.
2016-11-01
Economic emission dispatch (EED) problems are one of the most crucial problems in power systems. Growing energy demand, limitation of natural resources and global warming make this topic into the center of discussion and research. This paper reviews the use of Quantum Computational Intelligence (QCI) in solving Economic Emission Dispatch problems. QCI techniques like Quantum Genetic Algorithm (QGA) and Quantum Particle Swarm Optimization (QPSO) algorithm are discussed here. This paper will encourage the researcher to use more QCI based algorithm to get better optimal result for solving EED problems.
BENCH SCALE SALTSTONE PROCESS DEVELOPMENT MIXING STUDY
Energy Technology Data Exchange (ETDEWEB)
Cozzi, A.; Hansen, E.
2011-08-03
The Savannah River National Laboratory (SRNL) was requested to develop a bench scale test facility, using a mixer, transfer pump, and transfer line to determine the impact of conveying the grout through the transfer lines to the vault on grout properties. Bench scale testing focused on the effect the transfer line has on the rheological property of the grout as it was processed through the transfer line. Rheological and other physical properties of grout samples were obtained prior to and after pumping through a transfer line. The Bench Scale Mixing Rig (BSMR) consisted of two mixing tanks, grout feed tank, transfer pump and transfer hose. The mixing tanks were used to batch the grout which was then transferred into the grout feed tank. The contents of the feed tank were then pumped through the transfer line (hose) using a progressive cavity pump. The grout flow rate and pump discharge pressure were monitored. Four sampling stations were located along the length of the transfer line at the 5, 105 and 205 feet past the transfer pump and at 305 feet, the discharge of the hose. Scaling between the full scale piping at Saltstone to bench scale testing at SRNL was performed by maintaining the same shear rate and total shear at the wall of the transfer line. The results of scaling down resulted in a shorter transfer line, a lower average velocity, the same transfer time and similar pressure drops. The condition of flow in the bench scale transfer line is laminar. The flow in the full scale pipe is in the transition region, but is more laminar than turbulent. The resulting plug in laminar flow in the bench scale results in a region of no-mixing. Hence mixing, or shearing, at the bench scale should be less than that observed in the full scale, where this plug is non existent due to the turbulent flow. The bench scale tests should be considered to be conservative due to the highly laminar condition of flow that exists. Two BSMR runs were performed. In both cases, wall
Synthesis, Magnetization, and Electrical Transport Properties of Mn3Zn0.9Cu0.1N
Directory of Open Access Journals (Sweden)
Y. Yin
2013-01-01
Full Text Available We synthesized Mn3Zn0.9Cu0.1N by solid state reaction, and magnetic as well as electrical transport properties were investigated. It is found that Mn3Zn0.9Cu0.1N exhibits a first-order antiferromagnetism (AFM to paramagnetic (PM transition with the Néel temperature TN ~163 K, and substitution of Cu for Zn would favor ferromagnetism (FM state and weaken AFM ground state, leading to a convex curvature character of M(T curve. With high external fields 10 kOe–50 kOe, magnetic transition remains a robust AFM-PM feature while FM phase is completely suppressed. Thermal hysteresis of M(T under 500 Oe is also suppressed when the magnetic field exceeds 10 kOe. Mn3Zn0.9Cu0.1N exhibits a good metallic behavior except for a slope change around TN, which is closely related to AFM-PM magnetic transition. Compared with the first differential of resistivity with respect to temperature for (dρ/dTMn3ZnN in transition temperature range, the absolute value of (dρ/dTMn3Zn0.9Cu0.1N is much lower which is close to zero.
Mechanisms of contaminant migration from grouted waste
International Nuclear Information System (INIS)
Magnuson, S.O.; Yu, A.D.
1992-01-01
Low-level radioactive decontaminated salt solution is generated at the Savannah River Site (SRS) from the In-Tank Precipitation process. The solution is mixed with cement, slag, and fly ash, to form a grout, termed ''Saltstone'', that will be disposed in concrete vaults at the Saltstone Disposal Facility (SDF) [1]. Of the contaminants in the Saltstone, the greatest concern to SRS is the potential release of nitrate to the groundwater because of the high initial nitrate concentration (0.25 g/cm 3 ) in the Saltstone and the low Safe Drinking Water Act (SDWA) maximum contaminant level (MCL) of 44 mg/L. The SDF is designed to allow a slow, controlled release over thousands of years. This paper addresses a modeling study of nitrate migration from intact non-degraded concrete vaults in the unsaturated zone for the Radiological Performance Assessment (PA) of the SRS Saltstone Disposal Facility [3]. The PA addresses the performance requirements mandated by DOE Order 5820.2A [4
Synthesis and electrical characterization of BaZr0.9Ho0.1O3-δ electrolyte ceramic for IT - SOFCs
Saini, Deepash S.; Singh, Lalit K.; Bhattacharya, D.
2018-04-01
A cost-effective modified combustion method using citric acid and glycine has recently been developed to synthesize high quality, and nanosized BaZr0.9Ho0.1O3 ceramic powder. BaZr0.9Ho0.1O3-δ ceramic powder was characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and field emission scanning electron microscopy (FESEM). XRD pattern of BaZr0.9Ho0.1O3-δ ceramic sintered at 1600 °C has shown that pure phase of BaZr0.9Ho0.1O3-δ with cubic Pm3¯m space group symmetry. The transmission electron microscopic investigation has shown that the particle size of the powder calcined at 1100 °C was in the range 30-80 nm. The FESEM image of sintered pellet at 1600 °C for 4 h reveals porous nature of BaZr0.9Ho0.1O3-δ with 83.7 relative density. Impedance analysis reveal three type relaxations in the temperature range 250 °C to 500 °C as studied at different frequencies over 100 Hz to 1 MHz in air. The grain boundary conductivity of BaZr0.9Ho0.1O3-δ ceramic is found lower then grain (bulk) conductivity due to core-space charge layer behavior in grain boundary.
Doping effects on the relaxation of frustration and magnetic properties of YMn0.9Cu0.1O3
Xiao, L. X.; Xia, Z. C.; Wang, X.; Ni, Y.; Yu, W.; Shi, L. R.; Jin, Z.; Xiao, G. L.
2017-12-01
The crystal structure and magnetic properties of hexagonal YMn0.9Cu0.1O3 single crystal are systematically investigated. The refinement results of XRD show the lattice constant decreases, which is unusually due to the doped Cu2+ ion has a larger ionic radius than the Mn3+ ions. The XPS results show that the coexistence of Mn2+, Mn3+ and Mn4+ ions in YMn0.9Cu0.1O3 single crystal. Magnetization measurements show that Cu doped YMn0.9Cu0.1O3 and parent YMnO3 have almost the same antiferromagnetic transition temperature TN, which indicates the AFM interaction is robust in the geometry frustrated system. Because doping directly destroy some of the Mn3+ ions nets, the relaxation of frustration of Mn in-plane 2D triangular geometry network leads to the significantly decrease of Mn3+ ions AFM interaction. In addition, the coexistence and competition between the ferromagnetic and antiferromagnetic interactions among the Mn2+, Mn3+ and Mn4+ ions lead to a complicated and irreversible magnetization behavior in YMn0.9Cu0.1O3 single crystal.
International Nuclear Information System (INIS)
Lee, Si Y.; Hyun, Sinjae
2013-01-01
A new disposal unit, designated as Saltstone Disposal Unit 6 (SDU6), is being designed for support of site accelerated closure goals and salt waste projections identified in the new Liquid Waste System Plan. The unit is a cylindrical disposal cell of 375 ft in diameter and 43 ft in height, and it has a minimum 30 million gallons of capacity. SRNL was requested to evaluate the impact of an increased grout placement height on the flow patterns radially spread on the floor and to determine whether grout quality is impacted by the height. The primary goals of the work are to develop the baseline Computational Fluid Dynamics (CFD) model and to perform the evaluations for the flow patterns of grout material in SDU6 as a function of elevation of grout discharge port and grout rheology. Two transient grout models have been developed by taking a three-dimensional multiphase CFD approach to estimate the domain size of the grout materials radially spread on the facility floor and to perform the sensitivity analysis with respect to the baseline design and operating conditions such as elevation height of the discharge port and fresh grout properties. For the CFD modeling calculations, air-grout Volume of Fluid (VOF) method combined with Bingham plastic and time-dependent grout models were used for examining the impact of fluid spread performance for the initial baseline configurations and to evaluate the impact of grout pouring height on grout quality. The grout quality was estimated in terms of the air volume fraction for the grout layer formed on the SDU6 floor, resulting in the change of grout density. The study results should be considered as preliminary scoping analyses since benchmarking analysis is not included in this task scope. Transient analyses with the Bingham plastic model were performed with the FLUENTTM code on the high performance parallel computing platform in SRNL. The analysis coupled with a transient grout aging model was performed by using ANSYS-CFX code
33 CFR 151.09 - Applicability.
2010-07-01
....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...
Advanced Power Batteries for Renewable Energy Applications 3.09
Energy Technology Data Exchange (ETDEWEB)
Shane, Rodney [East Penn Manufacturing Company, Inc., Lyon Station, PA (United States)
2011-12-01
This report describes the research that was completed under project title Advanced Power Batteries for Renewable Energy Applications 3.09, Award Number DE-EE0001112. The report details all tasks described in the Statement of Project Objectives (SOPO). The SOPO includes purchasing of test equipment, designing tooling, building cells and batteries, testing all variables and final evaluation of results. The SOPO is included. There were various types of tests performed during the project, such as; gas collection, float current monitoring, initial capacity, high rate partial state of charge (HRPSoC), hybrid pulse power characterization (HPPC), high rate capacity, corrosion, software modeling and solar life cycle tests. The grant covered a period of two years starting October 1, 2009 and ending September 30, 2011.
International Nuclear Information System (INIS)
Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui
2014-01-01
Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS
Magnetic-entropy change in Mn1.1Fe0.9P0.7As0.3-xGe x
International Nuclear Information System (INIS)
Tegus, O.; Fuquan, B.; Dagula, W.; Zhang, L.; Brueck, E.; Si, P.Z.; Boer, F.R. de; Buschow, K.H.J.
2005-01-01
We have studied the magnetic properties and magnetic-entropy changes of Mn 1.1 Fe 0.9 P 0.7 As 0.3-x Ge x compounds with x = 0, 0.05, 0.1, 0.15 and 0.3. X-ray diffraction (XRD) study shows all the compounds crystallize in the Fe 2 P-type structure. Magnetic measurements show that the Curie temperature increases from 150 K for Mn 1.1 Fe 0.9 P 0.7 As 0.3 to 380 K for Mn 1.1 Fe 0.9 P 0.7 Ge 0.3 . A field-induced first-order magnetic phase transition is observed above the Curie temperature for the compounds with x up to 0.15. There exists an optimal composition in which the first-order phase transition is the sharpest. The optimal composition for this system is x = 0.1. The maximal magnetic-entropy change derived from the magnetization data is about 40 J/(kg K) for a field change from 0 to 3 T
La2/3Sr1/3MnO3-La0.1Bi0.9MnO3 heterostructures for spin filtering
Gajek, M.; Bibes, M.; Varela, M.; Fontcuberta, J.; Herranz, G.; Fusil, S.; Bouzehouane, K.; Barthélémy, A.; Fert, A.
2006-04-01
We have grown heterostructures associating half-metallic La2/3Sr1/3MnO3 (LSMO) bottom electrodes and ferromagnetic La0.1Bi0.9MnO3 (LBMO) tunnel barriers. The layers in the heterostructures have good structural properties and top LBMO films (4 nm thick) have a very low roughness when deposited onto LSMO/SrTiO3(1.6 nm) templates. The LBMO films show an insulating behavior and a ferromagnetic character that are both preserved down to very low thicknesses. They are thus suitable for being used as tunnel barriers. Spin-dependent transport measurements performed on tunnel junctions defined from LSMO/SrTiO3/LBMO/Au samples show a magnetoresistance of up to ~90% at low temperature and bias. This evidences a spin-filtering effect by the LBMO layer, with a spin-filtering efficiency of ~35%.
Zouari, I.; Sassi, Z.; Seveyrat, L.; Perrin, V.; Zghal, S.; Abdelmoula, N.; Lebrun, L.; Khemakhem, H.
2017-07-01
BaTi0.9Zr0.1O3 (BZT), Ba1- x Ln2 x/3□ x/3Ti0.9Zr0.1O3 (with x = 0.5% mol and Ln = Er3+) (BZT-Er) and Ba1- x Ln2 x/3□ x/3Ti0.9Zr0.1O3 (with x = 0.5% mol and Ln = Pr3+) (BZT-Pr) were prepared via the conventional solid-state reaction method. X-ray diffraction showed that all these ceramics were in the single perovskite phase at room temperature (RT). The temperature dependence of dielectric behavior was investigated in the temperature range 25-225°C and exhibited a classical ferroelectric behavior. A slight decrease of the Curie temperature ( T C) with Pr3+ and Er3+ substitution was observed in addition to an increase in the maximum dielectric permittivity ( \\varepsilon_{r {max} }^' }} ) of about 40% for the BZT-Er. At RT, the ferroelectric and piezoelectric coefficients were decreased for BZT-Pr, but were maintained for BZT-Er with a piezoelectric coefficient ( d 33) of 185 pC/N, a planar electromechanical coupling factor of 30%, and a remanent polarization of 11.6 μC/cm2. The Raman bands as a function of temperature confirmed the paraelectric-ferroelectric phase transition of all those ceramics. The photoluminescence spectra showed that strong red (615 nm and 645 nm) and bright green (523 nm and 545 nm) emission bands were obtained, under excitation by laser at 488 nm at RT, for BZT-Pr and BZT-Er, respectively. These multifunctional materials showed a significant technological promise in coupling device applications.
A theoretical study of the complexes of N2O with H+, Li+, and HF using various correlation methods
International Nuclear Information System (INIS)
Del Bene, J.E.; Stahlberg, E.A.; Shavitt, I.
1990-01-01
Binding energies for complexes of N 2 O with the acids H + , Li + , and HF have been computed using the following correlation methods: many-body (Moller-Plesset) perturbation theory at second (MP2), third (MP3), and fourth (MP4) order; the quadratic CI method with single and double excitations (QCISD) and with noniterative inclusion of triple excitations (QCISD(T)); the linearized coupled-cluster method (LCCM); the averaged coupled-pair functional (ACPF); configuration interaction with all single and double excitations (CISD); and CISD with the Davidson and Pople corrections. The convergence of the Moller-Plesset expansion is erratic, predicting that the terminal nitrogen is the preferred binding site for the complexes at the MP2 and MP4 levels, in disagreement with Hartree-Fock and MP3 and all other models (including the infinite-order QCI). The effect of triple excitations at MP4 and QCI is to destabilize complexes bound at O and stabilize those bound at N, but this effect is greatly overestimated at MP4 relative to QCI. Except for the LCCM result for N-protonated N 2 O, ACPF and LCCM binding energies are similar to the QCISD values. The size-consistency error in the ACPF binding energies of the complexes of N 2 O with HF is about 0.5 kcal/mol. The CISD size-consistency error for these complexes is 23 kcal/mol, leading to negative binding energies when computed relative to isolated N 2 O and HF
International Nuclear Information System (INIS)
Charkin, O.P.; Klimenko, N.M.; MakKi, M.L.
2000-01-01
Ab initio calculations of potential energy surfaces in neighborhood of key structures of non rigid dimer molecules of lithium salts of (LiMgX 3 ) 2 and binuclear anions Mg 2 X 5 - , dianions MgX 6 2- and molecules Mg 2 X 4 (X=H, F) are done in the framework of QCI-SD(T)/6-31(+)G**//MP2/6-31G* + ZPE(MP2/6-31G*) and MP2/6-31G*//HF/6-31G* + ZPE(HF/6-31G*) approximations. Equilibrium geometric parameters, relative energy and energy of decomposition of isomers, frequencies and IR-intensities of normal vibrations are determined. Data obtained are compared with results of analogous calculations for beryllium related compounds [ru
International Nuclear Information System (INIS)
Ross, S.B.; Oegren, S.-O.; Renyi, A.L.
1976-01-01
The inhibition of the uptake of 3 H-(-)-noradrenaline (NA), 3 H-dopamine and 14 C-5-hydroxytryptamine (5-HT) in mouse brain slices by (Z)-3-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl)propene(H 102/09), desipramine and chlorimipramine and their releasing effect on the 3 H-amines previously accumulated in the slices were examined. The interactions with reserpine produced hypothermia and sedation and the 5-hydroxytryptophan (5-HTP) syndrome in mice were also studied. Due to the poor inhibitory activity on the NA uptake H 102/09 was a more selective inhii.or of the 5-HT uptake than was chlorimipramine, particularly after administration in vivo, where it was as potent as chlorimipramine (ED50=19μmol/kg intraperitoneally). In vitro chlorimipramine was 6 to 12 times more active than H 102/09. Desipramine was a very selective inhibitor of the NA uptake in vitro and in vivo. The compounds were generally more potent in inhibiting the uptake than in releasing the amines. However, in striatal slices the inhibition of DA uptake could be due to the releasing effect since the difference in potencies were small. The effect of desipramine on 5-HT uptake and that of H102/09 on NA uptake could also involve a release component. The 5-HTP syndrome was potentiated by H 102/09 and chlorimipramine but not by desipramine. The reserpine hypothermia but not the sedation was potently antagonized and reversed by desipramine and by chlorimipramine at high doses but not by H 102/09, suggested that NA but not 5-HT is involved in the hypothermic action of reserpine. (author)
“Pesting”-like oxidation phenomenon of p-type filled skutterudite Ce{sub 0.9}Fe{sub 3}CoSb{sub 12}
Energy Technology Data Exchange (ETDEWEB)
Qiu, Pengfei [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Xia, Xugui; Huang, Xiangyang; Gu, Ming [CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Qiu, Yuting [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Chen, Lidong, E-mail: chenlidong@mail.sic.ac.cn [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China)
2014-11-05
Highlights: • Ce{sub 0.9}Fe{sub 3}Co{sub 1}Sb{sub 12} exhibits “pesting”-like oxidation phenomenon at high temperature. • The highest oxidation rate of Ce{sub 0.9}Fe{sub 3}Co{sub 1}Sb{sub 12} appears around 800 K. • Severe periodically oxide layer peeling-off behavior is observed around 800 K. • The co-existence of Fe and Co is responsible for the poor oxidation resistance. - Abstract: Oxidation behavior of p-type filled skutterudite Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} in air was investigated and the oxidation mechanism was discussed in this study. Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} exhibits interesting “pesting”-like oxidation phenomenon around 800 K. The bulk sample completely disintegrates into a crowd of plate-like particles under this temperature range after only 24 h exposure in air. However, this abnormal oxidation phenomenon is not observed at temperature below 750 K or above 850 K. This result is consistent with the thermogravimetry and derivative thermogravimetry measurements which show that the oxidation rate for Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} around 800 K is the highest among 650–900 K. Microstructure observations suggest that this “pesting”-like oxidation is related with the severe periodically oxide layer peeling-off behavior around 800 K, which makes the Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} samples are easy to be oxidized because the fresh substrate surface is always exposed to high concentration oxygen atmosphere. X-ray diffraction and X-ray photoelectron spectroscopy measurements indicated that in the oxide scale the direct contact of Fe{sup 3+}-oxide and CoSb{sub 2}O{sub 4} which possess different formation/growth rate and volume expansion coefficient should be responsible for this peculiar oxide layer peeling-off behavior around 800 K. This work can serve as an important reference for the designation of M{sub y}Fe{sub 4−x}Co{sub x}Sb{sub 12}-based skutterudite thermoelectric device.
Alternate paddle configuration for improved wear resistance in the saltstone mixer
Energy Technology Data Exchange (ETDEWEB)
Reigel, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Fowley, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2013-09-23
The Saltstone Production Facility has a 10-inch Readco-Kurimoto continuous mixer that mixes the premix dry feeds and low-level waste salt solution to make fresh (uncured) saltstone. Inspection of the mixer in January 2013 showed significant wear on the third, fourth and fifth paddle pairs after the conveying augers. A 2-inch Readco-Kurimoto continuous mixer was used to test alternate paddle configurations for use in the 10-inch mixer to decrease the wear rate on the paddles. Two wear tests were conducted to investigate a method of reducing wear on the mixer paddles. The first test (wear test 2a) had a paddle configuration similar to the currently installed 10-inch mixer in the SPF. This test established baseline wear. The second test (wear test 2b) had a reconfigured paddle arrangement that replaced the flat paddles with helical paddles for paddle pairs 2 - 6 and aligned paddle pair 1 with the augers. The intent of the reconfiguration was to more effectively convey the partially wetted dry feeds through the transition region and into the liquid feed where paddle wear is reduced due to dry feeds and salt solution being mixed at the intended water to premix ratio. The design of the helical paddles provides conveyance through the transition region to the liquid feed inlet. The alignment with the auger is aimed to provide a smoother transition (minimizing the discontinuity between the auger and paddle pair 1) into the downstream paddles. A soft metal with low wear resistance (6000 series aluminum) was used for the wear testing paddles to determine wear patterns while minimizing run time and maximizing wear rate. For the two paddle configurations tested using the scaled 2-inch Readco-Kurimoto continuous mixer, with the first six paddles after the augers replaced by the wear paddles and the remaining paddles were stainless steel. Since the 10-inch SPF mixer is designed with the liquid inlet centered over paddle pairs 5 and 6, the scaled 2-inch mixer was configured the
International Nuclear Information System (INIS)
Charkin, O.P.; Klimenko, N.M.; MakKi, M.L.
2000-01-01
In the framework of correlated approximation method QCI-SD(T)/6-31(+)G** + ZPE(MP2/6-31G*) and MP2/6-31(+)G* + ZPE(HF/6-31G*) ab initio calculations of surfaces and potential energy in the surroundings of key structures of not rigid dimer molecules of beryllate and fluoroberyllate complex salts (LiBeX 3 ) 2 , binuclear anions Be 2 X 5 - , dianions Be 2 X 6 2- and molecules Be 2 X 4 (X=H, F) are done. Equilibrium geometrical parameters of isomers, frequencies and relative IR intensities of normal vibrations, their relative energies and decomposition energies are determined. Similarity and differences of hydrides and fluorides, deformation and polarization of anions under cation effect in the case of their different mutual orientation are analyzed [ru
Rith, Sareth; Chin, Savuth; Sar, Borann; Y, Phalla; Horm, Srey Viseth; Ly, Sovann; Buchy, Philippe; Dussart, Philippe; Horwood, Paul F
2015-12-01
Despite annual co-circulation of different subtypes of seasonal influenza, co-infections between different viruses are rarely detected. These co-infections can result in the emergence of reassortant progeny. We document the detection of an influenza co-infection, between influenza A/H3N2 with A/H1N1pdm09 viruses, which occurred in a 3 year old male in Cambodia during April 2014. Both viruses were detected in the patient at relatively high viral loads (as determined by real-time RT-PCR CT values), which is unusual for influenza co-infections. As reassortment can occur between co-infected influenza A strains we isolated plaque purified clonal viral populations from the clinical material of the patient infected with A/H3N2 and A/H1N1pdm09. Complete genome sequences were completed for 7 clonal viruses to determine if any reassorted viruses were generated during the influenza virus co-infection. Although most of the viral sequences were consistent with wild-type A/H3N2 or A/H1N1pdm09, one reassortant A/H3N2 virus was isolated which contained an A/H1N1pdm09 NS1 gene fragment. The reassortant virus was viable and able to infect cells, as judged by successful passage in MDCK cells, achieving a TCID50 of 10(4)/ml at passage number two. There is no evidence that the reassortant virus was transmitted further. The co-infection occurred during a period when co-circulation of A/H3N2 and A/H1N1pdm09 was detected in Cambodia. It is unclear how often influenza co-infections occur, but laboratories should consider influenza co-infections during routine surveillance activities. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Herrera-Pérez, G., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Morales, D., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx; Paraguay-Delgado, F.; Reyes-Rojas, A.; Fuentes-Cobas, L. E. [Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Borja-Urby, R. [Centro de Nanociencias Micro y Nanotecnologías, Instituto Politécnico Nacional, 07300 México City (Mexico)
2016-09-07
This work presents the identification of inter-band transitions in the imaginary part of the dielectric function (ε{sub 2}) derived from the Kramers–Kronig analysis for [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} (BCZT) nanocrystals synthesized by the modified Pechini method. The analysis started with the chemical identification of the atoms that conform BCZT in the valence loss energy region of a high energy-resolution of electron energy loss spectroscopy. The indirect band energy (E{sub g}) was determined in the dielectric response function. This result is in agreement with the UV-Vis technique, and it obtained an optical band gap of 3.16 eV. The surface and volume plasmon peaks were observed at 13.1 eV and 26.2 eV, respectively. The X-ray diffraction pattern and the Rietveld refinement data of powders heat treated at 700 °C for 1 h suggest a tetragonal structure with a space group (P4 mm) with the average crystal size of 35 nm. The average particle size was determined by transmission electron microscopy.
Directory of Open Access Journals (Sweden)
Dudek Magdalena
2016-03-01
Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.
Energy Technology Data Exchange (ETDEWEB)
Parjansri, P. [Rajamangala University of Technology Krungthep, Physics Division, Faculty of Science and Technology, Bangkok (Thailand); Intatha, U. [Mae Fah Luang University, School of Science, Chiang Rai (Thailand); Guo, R.; Bhalla, A.S. [University of Texas at San Antonio, Department of Electrical and Computer Engineering, Faculty of Engineering, San Antonio, TX (United States); Eitssayeam, S. [Chiang Mai University, Department of Physics and Materials Science, Faculty of Science, Chiang Mai (Thailand); Chiang Mai University, Materials Science Research Center, Faculty of Science, Chiang Mai (Thailand)
2016-09-15
This work was to investigate the effects of antimony oxide (Sb{sub 2}O{sub 3}) on the electrical properties of Ba{sub 0.9}Ca{sub 0.1}Zr{sub 0.1}Ti{sub 0.9}O{sub 3} (BCZT) ceramics and was prepared by adding 1 mol% of BCZT nanocrystals. The seed is nanocrystals of BCZT which was synthesized by the molten salt method. The ceramics powders were prepared by the mixed oxide method using BaCO{sub 3}, CaCO{sub 3}, ZrO{sub 2}, TiO{sub 2} as starting materials, and the BCZT seed was added as nanocrystal for induce phase transition. They were doped with x mol% Sb{sub 2}O{sub 3} (x = 0.0-0.5). Results indicated that all samples show pure perovskite phase. The Sb{sub 2}O{sub 3} enhanced the electrical properties of the ceramic systems. Excellent values of a dielectric constant (ε {sub r}) at room temperature (T{sub r}) were 4086 with sample of x = 0.5, and at Curie temperature (T{sub c}) was 15,485 for samples with x = 0.1. The highest remnant polarization (P{sub r}), piezoelectric charge coefficient (d{sub 33}), piezoelectric voltage coefficient (g{sub 33}), electromechanical coefficient for planar mode (k{sub p}) and thickness mode (k{sub t}) values were 6.3 μC/cm{sup 2}, 346 pC/N, 15.6 x 10{sup -3} Vm/N, 42 and 41 %, respectively, which were obtained for the sample of x = 0.2 mol% Sb. (orig.)
HIV-1 and its gp120 inhibits the influenza A(H1N1)pdm09 life cycle in an IFITM3-dependent fashion.
Mesquita, Milene; Fintelman-Rodrigues, Natalia; Sacramento, Carolina Q; Abrantes, Juliana L; Costa, Eduardo; Temerozo, Jairo R; Siqueira, Marilda M; Bou-Habib, Dumith Chequer; Souza, Thiago Moreno L
2014-01-01
HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle in vitro. We show here that exposure of A(H1N1)pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1)pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs) to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1)pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA) gene from in vitro experiments and from samples of HIV-1/A(H1N1)pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1)pdm09 co-infected patients during the recent influenza form 2009/2010.
HIV-1 and its gp120 inhibits the influenza A(H1N1pdm09 life cycle in an IFITM3-dependent fashion.
Directory of Open Access Journals (Sweden)
Milene Mesquita
Full Text Available HIV-1-infected patients co-infected with A(H1N1pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1pdm09 life cycle in vitro. We show here that exposure of A(H1N1pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA gene from in vitro experiments and from samples of HIV-1/A(H1N1pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1pdm09 co-infected patients during the recent influenza form 2009/2010.
Thermoelectric properties of Ca1-xYxMnO3 and Ca0.9Y0.1-yFeyMnO3 perovskite compounds
DEFF Research Database (Denmark)
Thuy, Nguyen Thi; Minh, Dang Le; Van Nong, Ngo
2012-01-01
Polycrystalline Ca1-xYxMnO3 (x = 0.0; 0.1; 0.3; 0.5; 0.7) and Ca0.9Y0.1-yFeyMnO3 (y = 0.00; 0.01; 0.03; 0.05) compounds were prepared by solid-state reaction. X-ray diffraction (XRD) analysis revealed all XRD peaks of all the samples as identical to the orthorhombic structure. The thermoelectric ...
International Nuclear Information System (INIS)
Pan Fusheng; Yang Mingbo; Shen Jia; Wu Lu
2011-01-01
Research highlights: → Minor Zr and/or Sr additions can effectively refine the grains of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the tensile properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. - Abstract: The effects of minor Zr and Sr on the as-cast microstructure and mechanical properties of the Mg-3Ce-1.2Mn-0.9Sc (wt.%) alloy were investigated by using optical and electron microscopies, differential scanning calorimetry (DSC) analysis, and tensile and creep tests. The results indicate that adding minor Zr and/or Sr to the Mg-3Ce-1.2Mn-0.9Sc alloy does not cause an obvious change in the morphology and distribution of the Mg 12 Ce phase. However, the grains of the Zr and/or Sr-containing alloys are effectively refined. Among the Zr and/or Sr-containing alloys, the grains of the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr are the finest, followed by the alloys with the additions of 0.5 wt.%Zr and 0.1 wt.%Sr, respectively. In addition, small additions of Zr and/or Sr can improve the tensile and creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. Among the Zr and/or Sr-containing alloys, the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr obtains the optimum tensile and creep properties.
The magnetic transition temperature tuned by strain in YMn0.9Ru0.1O3 thin films
Directory of Open Access Journals (Sweden)
L. P. Yang
2018-05-01
Full Text Available Epitaxial orthorhombic YMn0.9Ru0.1O3 films with different thickness have been grown on (001-SrTiO3 substrates by pulsed laser deposition (PLD. The crystal structure is well investigated by X-ray Diffraction. It is found that the out-of-plane parameter c slowly increases with decreasing thickness of samples because of the tensile strain between the films and substrates along c axis. The lengths of in-plane Mn-O bonds expand with the enhancement of strains, which is proved by Raman scatting. The magnetic measurements reveal that there exist two magnetic transition temperatures TN1 and TN2. The TN1 is close to that of orthorhombic YMnO3 bulk. With decreasing thickness of the films, TN1 keeps almost constant because of the small stain along c-axis. TN2, however, obviously increases from 117 K to 134 K, which could be related to the expansion of in-plane Mn-O bonds. Results show that the magnetic transition temperature of YMn0.9Ru0.1O3 films can be sensitively manipulated by the strain of the films.
Passive mode locking of 2.09 microm Cr,Tm,Ho:Y3Sc2Al3O12 laser using PbS quantum-dot-doped glass.
Denisov, Igor A; Skoptsov, Nikolai A; Gaponenko, Maxim S; Malyarevich, Alexander M; Yumashev, Konstantin V; Lipovskii, Andrei A
2009-11-01
Passive Q-switched mode locking of a 2.09 microm flashlamp-pumped Cr(3+),Tm(3+),Ho(3+):Y(3)Sc(2)Al(3)O(12) laser by use of a phosphate glass doped with PbS quantum dots of 5 nm in radius was demonstrated. Mode-locked pulses of 290 ps in duration and up to 0.5 mJ in energy were registered.
National Research Council Canada - National Science Library
Vittori, Jay
1999-01-01
This study is an Air Force doctrinaire's account of the development of Joint Publication 3-09, Doctrine for Joint Fire Support, the most controversial joint military doctrine publication ever produced...
Hirsnik, Erkki, 1982-
2010-01-01
Riigikohtu lahendist 3-1-1-104-09: Edelaraudtee Infrastruktuuri AS kaitsja vandeadvokaat Leonid Tolstovi kassatsioon Pärnu Maakohtu 4. juuni 2009. a kohtuotsuse peale Edelaraudtee Infrastruktuuri AS väärteoasjas looduskaitseseaduse § 71 lg 2 järgi
Moon, Deok Hyun; Wazne, Mahmoud; Yoon, In-Ho; Grubb, Dennis G
2008-11-30
A stabilization/solidification (S/S) process for arsenic (As) contaminated soils was evaluated using cement kiln dust (CKD). Laboratory-prepared slurries, made of either kaolinite or montmorillonite, and field soils spiked with either As(3+) or As(5+) were prepared and treated with CKD ranging from 10 to 25 wt%. Sodium arsenite and sodium arsenate at 0.1 wt% were used to simulate arsenite (As(3+)) and arsenate (As(5+)) source contamination in soils, respectively. The effectiveness of treatment was evaluated at curing periods of 1- and 7-days based on the toxicity characteristic leaching procedure (TCLP). As-CKD and As-clay-CKD slurries were also spiked at 10 wt% to evaluate As immobilization mechanism using X-ray powder diffraction (XRPD) analyses. Overall, the TCLP results showed that only the As(5+) concentrations in kaolinite amended with 25 wt% CKD after 1 day of curing were less than the TCLP regulatory limit of 5mg/L. Moreover, at 7 days of curing, all As(3+) and As(5+) concentrations obtained from kaolinite soils were less than the TCLP criteria. However, none of the CKD-amended montmorillonite samples satisfied the TCLP-As criteria at 7 days. Only field soil samples amended with 20 wt% CKD complied with the TCLP criteria within 1 day of curing, where the source contamination was As(5+). XRPD and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX) results showed that Ca-As-O and NaCaAsO(4).7.5H(2)O were the primary phases responsible for As(3+) and As(5+) immobilization in the soils, respectively.
International Nuclear Information System (INIS)
Moon, Deok Hyun; Wazne, Mahmoud; Yoon, In-Ho; Grubb, Dennis G.
2008-01-01
A stabilization/solidification (S/S) process for arsenic (As) contaminated soils was evaluated using cement kiln dust (CKD). Laboratory-prepared slurries, made of either kaolinite or montmorillonite, and field soils spiked with either As 3+ or As 5+ were prepared and treated with CKD ranging from 10 to 25 wt%. Sodium arsenite and sodium arsenate at 0.1 wt% were used to simulate arsenite (As 3+ ) and arsenate (As 5+ ) source contamination in soils, respectively. The effectiveness of treatment was evaluated at curing periods of 1- and 7-days based on the toxicity characteristic leaching procedure (TCLP). As-CKD and As-clay-CKD slurries were also spiked at 10 wt% to evaluate As immobilization mechanism using X-ray powder diffraction (XRPD) analyses. Overall, the TCLP results showed that only the As 5+ concentrations in kaolinite amended with 25 wt% CKD after 1 day of curing were less than the TCLP regulatory limit of 5 mg/L. Moreover, at 7 days of curing, all As 3+ and As 5+ concentrations obtained from kaolinite soils were less than the TCLP criteria. However, none of the CKD-amended montmorillonite samples satisfied the TCLP-As criteria at 7 days. Only field soil samples amended with 20 wt% CKD complied with the TCLP criteria within 1 day of curing, where the source contamination was As 5+ . XRPD and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX) results showed that Ca-As-O and NaCaAsO 4 .7.5H 2 O were the primary phases responsible for As 3+ and As 5+ immobilization in the soils, respectively
Defense waste salt disposal at the Savannah River Plant
International Nuclear Information System (INIS)
Langton, C.A.; Dukes, M.D.
1984-01-01
A cement-based waste form, saltstone, has been designed for disposal of Savannah River Plant low-level radioactive salt waste. The disposal process includes emplacing the saltstone in engineered trenches above the water table but below grade at SRP. Design of the waste form and disposal system limits the concentration of salts and radionuclides in the groundwater so that EPA drinking water standards will not be exceeded at the perimeter of the disposal site. 10 references, 4 figures, 3 tables
Effect of Chlorine Substitution on Sulfide Reactivity with OH Radicals
2008-09-01
Single point energy: MP2/6-311+G(3df,2p) (LRG) • Zero Point Energy from a vibrational frequency analysis: MP2/6-31++G** ( ZPE ) • Extrapolated energy...E(QCI) + E(LARG) – E(SML) + ZPE • Characterize the TS • Use a three-point fit methodology – fit a harmonic potential to three CCSD single point
Riigikohtu kriminaalkolleegiumi 24. aprilli 2009. a otsus kriminaalasjas 3-1-1-10-09 / Margus Mõttus
Mõttus, Margus
2009-01-01
Riigikohtu otsusest 3-1-1-10-09: Livio Karro kaitsjate A. Pilve ja R. Otsa, Margus Nei kaitsja T. Pilve, Vladimir Kudrjavtsevi kaitsja A. Lubergi, M. Loorpuu kaitsja T. Ploomipuu, R. Väinoja kaitsja H. Tombergi ja K. Kaunispaiga kaitsja A. Gorkini kassatsioonid kriminaalasjas L. Karro süüdistuses KarS § 294 lg 2 p-de 1 ja 3; § 294 lg 2 p-de 1 ja 3 ja § 22 lg 2 ning § 296 lg 2 p-de 1 ja 2 järgi, M. Nei ja V. Kudrjavtsevi süüdistuses KarS § 294 lg 2 p 3 järgi, R. Väinoja süüdistuses KarS § 298 lg 1 järgi ja K. Kaunispaiga süüdistuses KarS § 298 lg 1 ja § 22 lg 2 järgi
3D network single-phase Ni0.9Zn0.1O as anode materials for lithium-ion batteries
DEFF Research Database (Denmark)
Huang, Guoyong; Guo, Xueyi; Cao, Xiao
2016-01-01
A novel 3D network single-phase Ni0.9Zn0.1O has been designed and synthesized by calcining a special metal-organic precursor (MOP) (MeO2C3H6, Me=Ni and Zn, the molar ratio of Ni: Zn=9:1) as the self-sacrificing template for the first time. Comparing with NiO or the mixture of NiO and ZnO, the new...
Directory of Open Access Journals (Sweden)
David La
Full Text Available BACKGROUND: Infection by the pandemic influenza A (H1N1/09 virus resulted in significant pathology among specific ethnic groups worldwide. Natural Killer (NK cells are important in early innate immune responses to viral infections. Activation of NK cells, in part, depend on killer-cell immunoglobulin-like receptors (KIR and HLA class I ligand interactions. To study factors involved in NK cell dysfunction in overactive immune responses to H1N1 infection, KIR3DL1/S1 and KIR2DL2/L3 allotypes and cognate HLA ligands of H1N1/09 intensive-care unit (ICU patients were determined. METHODOLOGY AND FINDINGS: KIR3DL1/S1, KIR2DL2/L3, and HLA -B and -C of 51 H1N1/09 ICU patients and 105 H1N1-negative subjects (St. Theresa Point, Manitoba were characterized. We detected an increase of 3DL1 ligand-negative pairs (3DL1/S1(+ Bw6(+ Bw4(-, and a lack of 2DL1 HLA-C2 ligands, among ICU patients. They were also significantly enriched for 2DL2/L3 ligand-positive pairs (PVA, P=0.024, Pc=0.047; Odds Ratio:2.563, CI95%:1.109-5.923, 3DL1*00101 (Ab>VA, PSTh, P=0.034, Pc=0.268, and 3DL1*029 (Ab>STh, P=0.039, Pc=0.301. Aboriginal patients ligand-positive for 3DL1/S1 and 2DL1 had the lowest probabilities of death (R(d (R(d=28%, compared to patients that were 3DL1/S1 ligand-negative (R(d=52% or carried 3DL1*029 (R(d=52%. Relative to Caucasoids (CA, two allotypes were enriched among non-aboriginal ICU patients (NAb: 3DL1*00401 (NAb>CA, P<0.001, Pc<0.001 and 3DL1*01502 (CA
16 CFR 0.9 - Organization structure.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...
Energy Technology Data Exchange (ETDEWEB)
Langton, C. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-06-30
The objective of this study was to identify potential chemical degradation mechanisms for the Saltstone Disposal Unit (SDU) concretes, which over the performance life of the structures may be exposed to highly alkaline sodium salt solutions containing sulfate, hydroxide, and other potentially corrosive chemicals in salt solution and saltstone flush water, drain water, leachate and / or pore solution. The samples analyzed in this study were cement pastes prepared in the SIMCO Technologies, Inc. concrete laboratory. They were based on the paste fractions of the concretes used to construct the Saltstone Disposal Units (SDUs). SDU 1 and 4 concrete pastes were represented by the PV1 test specimens. The paste in the SDU 2, 3, 5, and 6 concrete was represented by the PV2 test specimens. SIMCO Technologies, Inc. selected the chemicals and proportions in the aggressive solutions to approximate proportions in the saltstone pore solution [2, 3, 5, and 6]. These test specimens were cured for 56 days in curing chamber before being immersed in aggressive solutions. After exposure, the samples were frozen to prevent additional chemical transport and reaction. Selected archived (retrieved from the freezer) samples were sent to the Savannah River National Laboratory (SRNL) for additional characterization using x-ray diffraction (XRD), scanning electron microscopy (SEM), and energy dispersive x-ray (EDX) spectroscopy. Characterization results are summarized in this report. In addition, a correlation between the oxide composition of the pastes and their chemical durability in the alkaline salt solutions is provided.
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0033 ref|ZP_01901905.1| hypothetical protein RAZWK3B_08726 [Roseobacte...r sp. AzwK-3b] gb|EDM72321.1| hypothetical protein RAZWK3B_08726 [Roseobacter sp. AzwK-3b] ZP_01901905.1 0.13 31% ...
International Nuclear Information System (INIS)
Nash, Charles A.; McCabe, Daniel J.
2017-01-01
This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO 4 - ) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.
Neptunium sorption and co-precipitation of strontium in simulated DWPF salt solution
International Nuclear Information System (INIS)
McIntyre, P.F.; Orebaugh, E.G.; King, C.M.
1988-01-01
Batch experiments performed using crushed slag saltstone (∼40 mesh) removed >80% of 237 Np from simulated Defense Waste Processing Facility (DWPF) salt solution. The concentration of 237 Np (110 pCi/ml) used was 1000x greater than levels in actual DWPF solutions. Neptunium-239 was used as a tracer and was formed by neutron activation of uranyl nitrate. Results showed that small amounts of crushed saltstone (as little as 0.05 grams), removed >80% of neptunium from 15 ml of simulated DWPF solution after several hours equilibration. The neptunium is sorbed on insoluble carbonates formed in and on the saltstone matrix. Further testing showed that addition of 0.01 and 0.10 ml of 1 molar Ca +2 (ie. Ca (NO 3 ) 2 , CaCl 2 ) into 15 ml of simulated DWPF solution yielded a white carbonate precipitate which also removed >80% of the neptunium after 1 hour equilibration. Further experiments were performed to determine the effectiveness of this procedure to co-precipitate strontium
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik
Energy Technology Data Exchange (ETDEWEB)
Nash, Charles A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); McCabe, Daniel J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2017-10-09
This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO4 -) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0017 ref|NP_001025549.1| potassium voltage-gated channel, shaker-relat...ed subfamily, member 3 [Gallus gallus] gb|AAP94028.1| shaker subfamily potassium channel Kv1.3 [Gallus gallus] NP_001025549.1 0.0 83% ...
Energy Technology Data Exchange (ETDEWEB)
Liu, Jun; Chen, Zonghai; Busking, Sara; Belharouak, Ilias; Amine, Khalil [Chemical Engineering Division, Argonne National Laboratory, 9700 S. Cass Avenue, IL 60439 (United States)
2007-12-06
Lithium-rich layered metal oxide Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} was investigated as a potential positive electrode material for high-power batteries for hybrid electric vehicle (HEV) applications. In order to evaluate the power and life characteristics of the graphite/Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} cell chemistry, hybrid pulse power characterization (HPPC) and accelerated calendar life tests were conducted on several pouch cells containing electrolytes with and without additives. The data show that the cells containing 0.5 wt% lithium bis(oxalate)borate (LiBOB) or vinyl ethyl carbonate (VEC) additives, or the novel lithium difluoro(oxalato)borate (LiDFOB) additive, have much improved cycle and calendar life performance. (author)
Magnetocaloric response of La 0.70 Ca 0.1 Sr 0.2 Fe 0.1 Mn 0.9 O 3 ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 38; Issue 1. Magnetocaloric response of La0.70Ca0.1Sr0.2Fe0.1Mn0.9O3 pervoskite for magnetic refrigeration. M S Anwar Faheem Ahmed Bon Heun Koo. Volume 38 Issue 1 February 2015 pp 101-104 ...
Electrochemical Activity of a La0.9Ca0.1Co1−xFexO3 Catalyst for a Zinc Air Battery Electrode
Directory of Open Access Journals (Sweden)
Seungwook Eom
2015-01-01
Full Text Available The optimum composition of cathode catalyst has been studied for rechargeable zinc air battery application. La0.9Ca0.1Co1−xFexO3 (x=0–0.4 perovskite powders were prepared using the citrate method. The substitution ratio of Co2+ with Fe3+ cations was controlled in the range of 0–0.4. The optimum substitution ratio of Fe3+ cations was determined by electrochemical measurement of the air cathode composed of the catalyst, polytetrafluoroethylene (PTFE binder, and Vulcan XC-72 carbon. The substitution by Fe enhanced the electrochemical performances of the catalysts. Considering oxygen reduction/evolution reactions and cyclability, we achieved optimum substitution level of x=0.1 in La0.9Ca0.1Co1−xFexO3.
Synthesis dependent characteristics of Sr1−xMnxTiO3 (x=0.03, 0.05, 0.07 and 0.09)
International Nuclear Information System (INIS)
Preethi Meher, K.R.S.; Bogicevic, Christine; Janolin, Pierre-Eymeric; Varma, K.B.R.
2012-01-01
Sr 1−x Mn x TiO 3 (where x=0.03, 0.05, 0.07 and 0.09) was synthesized via different routes that include solid-state, oxalate precipitation and freeze drying. In oxalate precipitation technique, compositions corresponding to 3 and 5 mol% doping of Mn were monophasic whereas the higher compositions revealed the presence of the secondary phases such as MnO, Mn 3 O 4 etc., as confirmed by high resolution X-ray diffraction (XRD) studies. The decomposition behavior of the precursors prepared using oxalate precipitation method corresponding to the above mentioned compositions was studied. Nanopowders of compositions pertaining to 5 to 9 mol% of Mn doping were obtained using freeze–drying technique. The average crystallite size of these nanopowders was found to be in the 35 to 65 nm range. The microstructural studies carried out on the sintered ceramics, fabricated using powders synthesized by different routes established the fine grained nature ( 1−x Mn x TiO 3 (x=0.03 and 0.05) obtained by oxalate precipitation technique along with that of the nanopowders for x=0.05, 0.07 and 0.09 obtained by freeze drying method, microstructural characterization and synthesis dependent dielectric behavior. Highlights: ► Monophasic samples obtained for compositions Sr 1−x Mn x TiO 3 with x=0.03 and 0.05. ► Nanopowders of Sr 1−x Mn x TiO 3 with x=0.05, 0.07 and 0.09 were synthesized by freeze–drying method. ► Phase purity of samples synthesized using freeze drying method were studied at different sintering temperatures. ► Analysis of Raman spectra for samples prepared by both oxalate precipitation and freeze–drying. ► Microstructure dependent dielectric characteristics have been illustrated.
Synthesis, Sintering, and Electrical Properties of BaCe0.9−xZrxY0.1O3−δ
DEFF Research Database (Denmark)
Ricote, S.; Caboche, G.; Estournes, C.
2008-01-01
BaCe0.9-xZrxY0.1O3-delta powders were synthesized by a solid-state reaction. Different contents of cerium and zirconium were studied. Pellets were sintered using either conventional sintering in air at 1700 degrees C or the Spark Plasma Sintering (SPS) technique. The density of the samples sintered...
Nason, Martin L.; Brown, Clarence A., Jr.; Rock, Rupert S.
1955-01-01
A linear stability analysis and flight-test investigation has been performed on a rolleron-type roll-rate stabilization system for a canard-type missile configuration through a Mach number range from 0.9 to 2.3. This type damper provides roll damping by the action of gyro-actuated uncoupled wing-tip ailerons. A dynamic roll instability predicted by the analysis was confirmed by flight testing and was subsequently eliminated by the introduction of control-surface damping about the rolleron hinge line. The control-surface damping was provided by an orifice-type damper contained within the control surface. Steady-state rolling velocities were at all times less than 1 radian per second between the Mach numbers of 0.9 to 2.3 on the configurations tested. No adverse longitudinal effects were experienced in flight because of the tendency of the free-floating rollerons to couple into the pitching motion at the low angles of attack and disturbance levels investigated herein after the introduction of control-surface damping.
Results for the second quarter 2014 tank 50 WAC slurry sample chemical and radionuclide contaminants
International Nuclear Information System (INIS)
Bannochie, C.
2014-01-01
This report details the chemical and radionuclide contaminant results for the characterization of the 2014 Second Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System
Results for the Third Quarter 2014 Tank 50 WAC slurry sample: Chemical and radionuclide contaminants
Energy Technology Data Exchange (ETDEWEB)
Crawford, Charles L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2015-01-08
This report details the chemical and radionuclide contaminant results for the characterization of the 2014 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time.1 Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
Energy Technology Data Exchange (ETDEWEB)
Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2015-09-30
This report details the chemical and radionuclide contaminant results for the characterization of the Calendar Year (CY) 2014 Fourth Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
Results For The Third Quarter 2013 Tank 50 WAC Slurry Sample
Energy Technology Data Exchange (ETDEWEB)
Bannochie, Christopher J.
2013-11-26
This report details the chemical and radionuclide contaminant results for the characterization of the 2013 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
Energy Technology Data Exchange (ETDEWEB)
Bannochie, Christopher J.
2013-07-31
This report details the chemical and radionuclide contaminant results for the characterization of the 2013 Second Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by Saltstone Facility Engineering (SFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0017 ref|NP_001079227.1| shaker-like potassium channel subunit Kv1.3B ...[Xenopus laevis] gb|AAK83378.1|AF395810_1 shaker-like potassium channel subunit Kv1.3B [Xenopus laevis] NP_001079227.1 0.0 86% ...
Magnetic properties of zigzag (0,9 GaAs nanotube doped with 3d transition metals
Directory of Open Access Journals (Sweden)
R Fathi
2016-06-01
Full Text Available of 3d transition metals (Sc, Ti, Cr, Mn , Fe, Co, Ni in both far and close situations were studied based on spin polarised density functional theory using the generalized gradient approximation (LDA with SIESTA code. The electronic structures show that zigzag (0,9 GaAs nanotubes are non-magnetic semiconductors with direct band gap. It was revealed that doping of 11.11 % Fe and Mn concentrations substituted in Ga sites in ferromagnetic phase in far situation and Cr sites in ferromagnetic phase in near situation introduces half metallic behavior with %100 spin polarization. The unique structure of spin polarised energy levels is primarily attributed to strong hybridization of 3d transition metal and its nearest-neighbor As-4p orbitals. The results of this study can be useful for empirical studies on diluted magnetic semiconductors (DMSs and systemic investigation in 3d transitional metals. We suggest that GaAs nanotubes doped by transition metals would have a potential application as a spin polarised electron source for spintronic devices in the future.
Electroresistance and magnetoresistance in La0.9Ba0.1MnO3 thin films
International Nuclear Information System (INIS)
Hu, F.X.; Gao, J.; Wang, Z.H.
2006-01-01
The electroresistance and magnetoresistance effects have been investigated in La 0.9 Ba 0.1 MnO 3 epitaxial thin films. Tensile strain caused by substrate mismatch makes the Curie temperature T C of the film at ∼300 K. The influence of an applied dc-current on the resistance in the absence of a magnetic field was studied. Significant change of the peak resistance at different currents was found. The reduction of the peak resistance reaches ∼27% with an electric current density up to 1.3 x 10 5 A cm -2 . We also studied colossal magnetoresistance (CMR) effect in the films. Applying a magnetic field of 2 T could lead to a magnetoresistance as large as 42%. The reduction of resistance caused by a current density ∼1.3 x 10 5 A cm -2 was found to be equivalent to the CMR effect caused by 1.5 T near T C . The phenomenon that the resistance in CMR manganites could be easily controlled by the electric current should be of high interest for both fundamental research and practical applications
Evaluasi Fungsi Insinerator Dalam Memusnahkan Limbah B3 Di Rumah Sakit NI Dr.Ramelan Surabaya
Directory of Open Access Journals (Sweden)
Jahn Leonard Saragih
2013-09-01
Full Text Available Pengelolaan limbah padat B3 di Rumah Sakit TNI Angkatan Laut Dr. Ramelan sangat penting diperhatikan karena dapat berdampak buruk apabila tidak dikelola dengan baik. Oleh sebab itu diperlukan adanya penelitian untuk mengidentifikasi jumlah timbulan dan penanganan limbah padat B3, mengevaluasi manajemen, penyimpanan sementara serta mengevaluasi proses insinerasi. Evaluasi fungsi incinerator di Rumah Sakit TNI Angkatan Laut Dr. Ramelan dilakukan dengan meneliti jumlah timbulan limbah B3, kapasitas pembakaran insinerator, suhu pembakaran insinerator, densitas limbah dan abu pembakaran, dan tes TCLP residu pembakaran incinerator Rumah Sakit TNI Angkatan Laut Dr. Ramelan. Dalam penelitian ini, Rumkital Dr. Ramelan memusnahkan limbah dengan incinerator. Limbah B3 yang dihasilkan Rumkital Dr. Ramelan dimusnakan dengan satu incinerator dengan type KAMINE TYPE BDR-INC 10. Limbah yang dimusnahkan di Rumkital Dr. Ramelan berasal dari Rumkital Dr. Ramelan dan Lantamal Perak. Setelah dilakukan penelitian langsung selama 14 hari berturut-turut, didapatkan bahwa rata-rata timbulan limbah B3 di Rumkital Dr. Ramelan adalah 89.98 Kg/hari dan dengan densitas rata-rata limbah ialah 166,67 kg/m3. Tinggat removal dari pembakaran limbah dengan incinerator di Rumah Sakit TNI Angkatan Laut Dr. Ramelan ialah 82,63%. Pengelolaan abu sisa incinerator Rumkital Dr. Ramelan belum sesuai dengan peraturan yang berlaku dan dari penelitian yang dilakukan yaitu pengujian kandungan abu incinerator, solidifikasi abu incinerator dengan perbandingan semen:abu adalah 1:3 dan uji TCLP, didapatkan bahwa limbah abu sisa insinerator Rumah Sakit TNI Angkatan Laut Dr. Ramelan Surabaya, dapat ditimbun pada landfill kategori I sesuai dengan Keputusan Kepala Bapedal No.4 Tahun 1995.
Ac conductivity and relaxation mechanism in Ba0.9Sr0.1TiO3
International Nuclear Information System (INIS)
Singh, A.K.; Barik, Subrat K.; Choudhary, R.N.P.; Mahapatra, P.K.
2009-01-01
The ac conductivity and relaxation mechanism in Ba 0.9 Sr 0.1 TiO 3 ceramics have been investigated systematically. A high-temperature solid-state reaction technique was used to synthesize the compound. The formation of the compound was checked by an X-ray diffraction (XRD) technique. The dielectric permittivity and the loss tangent of the sample were measured in a frequency range from 1 kHz to 1 MHz at different temperatures (30-500 deg. C). A study on dielectric properties reveals the electrical relaxation phenomenon occurs in the material. The activation energy was calculated from the temperature variation of dc conductivity. Studies of frequency and temperature dependence of ac conductivity of the compound suggest that conduction process in the material is thermally activated.
Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy
International Nuclear Information System (INIS)
Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.
2006-01-01
X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions
Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling
International Nuclear Information System (INIS)
Bhaskar, U.K.; Bid, S.; Pradhan, S.K.
2011-01-01
Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N
Guillemot, Fabien; Mironov, Vladimir; Nakamura, Makoto
2010-03-01
The International Conference on Bioprinting and Biofabrication in Bordeaux (3B'09) demonstrated that the field of bioprinting and biofabrication continues to evolve. The increasing number and broadening geography of participants, the emergence of new exciting bioprinting technologies, and the attraction of young investigators indicates the strong growth potential of this emerging field. Bioprinting can be defined as the use of computer-aided transfer processes for patterning and assembling living and non-living materials with a prescribed 2D or 3D organization in order to produce bio-engineered structures serving in regenerative medicine, pharmacokinetic and basic cell biology studies. The use of bioprinting technology for biofabrication of in vitro assay has been shown to be a realistic short-term application. At the same time, the principal feasibility of bioprinting vascularized human organs as well as in vivo bioprinting has been demonstrated. The bioprinting of complex 3D human tissues and constructs in vitro and especially in vivo are exciting, but long-term, applications. It was decided that the 5th International Conference on Bioprinting and Biofabrication would be held in Philadelphia, USA in October 2010. The specially appointed 'Eploratory Committee' will consider the possibility of turning the growing bioprinting community into a more organized entity by creating a new bioprinting and biofabrication society. The new journal Biofabrication was also presented at 3B'09. This is an important milestone per se which provides additional objective evidence that the bioprinting and biofabrication field is consolidating and maturing. Thus, it is safe to state that bioprinting technology is coming of age.
Power Systems Development Facility Gasification Test Run TC09
Energy Technology Data Exchange (ETDEWEB)
Southern Company Services
2002-09-30
This report discusses Test Campaign TC09 of the Kellogg Brown & Root, Inc. (KBR) Transport Gasifier train with a Siemens Westinghouse Power Corporation (Siemens Westinghouse) particle filter system at the Power Systems Development Facility (PSDF) located in Wilsonville, Alabama. The Transport Gasifier is an advanced circulating fluidized-bed gasifier designed to operate as either a combustor or a gasifier in air- or oxygen-blown mode of operation using a particulate control device (PCD). The Transport Gasifier was operated as a pressurized gasifier during TC09 in air- and oxygen-blown modes. Test Run TC09 was started on September 3, 2002, and completed on September 26, 2002. Both gasifier and PCD operations were stable during the test run, with a stable baseline pressure drop. The oxygen feed supply system worked well and the transition from air to oxygen was smooth. The gasifier temperature varied between 1,725 and 1,825 F at pressures from 125 to 270 psig. The gasifier operates at lower pressure during oxygen-blown mode due to the supply pressure of the oxygen system. In TC09, 414 hours of solid circulation and over 300 hours of coal feed were attained with almost 80 hours of pure oxygen feed.
Results for the Fourth Quarter Calendar Year 2015 Tank 50H Salt Solution Sample
Energy Technology Data Exchange (ETDEWEB)
Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-01-11
In this memorandum, the chemical and radionuclide contaminant results from the Fourth Quarter Calendar Year 2015 (CY15) sample of Tank 50H salt solution are presented in tabulated form. The Fourth Quarter CY15 Tank 50H samples were obtained on October 29, 2015 and received at Savannah River National Laboratory (SRNL) on October 30, 2015. The information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering for the transfer of aqueous waste from Tank 50H to the Salt Feed Tank in the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the Task Technical and Quality Assurance Plan (TTQAP) for the Tank 50H saltstone task. The chemical and radionuclide contaminant results from the characterization of the Fourth Quarter Calendar Year 2015 (CY15) sampling of Tank 50H were requested by SRR personnel and details of the testing are presented in the SRNL Task Technical and Quality Assurance Plan.
First International Diagnosis Competition - DXC'09
Kurtoglu, tolga; Narasimhan, Sriram; Poll, Scott; Garcia, David; Kuhn, Lukas; deKleer, Johan; vanGemund, Arjan; Feldman, Alexander
2009-01-01
A framework to compare and evaluate diagnosis algorithms (DAs) has been created jointly by NASA Ames Research Center and PARC. In this paper, we present the first concrete implementation of this framework as a competition called DXC 09. The goal of this competition was to evaluate and compare DAs in a common platform and to determine a winner based on diagnosis results. 12 DAs (model-based and otherwise) competed in this first year of the competition in 3 tracks that included industrial and synthetic systems. Specifically, the participants provided algorithms that communicated with the run-time architecture to receive scenario data and return diagnostic results. These algorithms were run on extended scenario data sets (different from sample set) to compute a set of pre-defined metrics. A ranking scheme based on weighted metrics was used to declare winners. This paper presents the systems used in DXC 09, description of faults and data sets, a listing of participating DAs, the metrics and results computed from running the DAs, and a superficial analysis of the results.
Hydrostatic pressure effect on Tsub(c) of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O3
International Nuclear Information System (INIS)
Chu, C.W.; Huang, S.; Sleight, A.W.
1976-01-01
The superconducting transition temperature of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O 3 has been found to be suppressed smoothly by the application of hydrostatic pressure at a rate of -(2.9 +- 0.2) x 10 -5 kbar -1 up to 15 kbar. The implications of these results are discussed. (author)
Stabilization/solidification of selenium-impacted soils using Portland cement and cement kiln dust
International Nuclear Information System (INIS)
Moon, Deok Hyun; Grubb, Dennis G.; Reilly, Trevor L.
2009-01-01
Stabilization/solidification (S/S) processes were utilized to immobilize selenium (Se) as selenite (SeO 3 2- ) and selenate (SeO 4 2- ). Artificially contaminated soils were prepared by individually spiking kaolinite, montmorillonite and dredged material (DM; an organic silt) with 1000 mg/kg of each selenium compound. After mellowing for 7 days, the Se-impacted soils were each stabilized with 5, 10 and 15% Type I/II Portland cement (P) and cement kiln dust (C) and then were cured for 7 and 28 days. The toxicity characteristic leaching procedure (TCLP) was used to evaluate the effectiveness of the S/S treatments. At 28 days curing, P doses of 10 and 15% produced five out of six TCLP-Se(IV) concentrations below 10 mg/L, whereas only the 15% C in DM had a TCLP-Se(IV) concentration 3 .H 2 O) and selenate substituted ettringite (Ca 6 Al 2 (SeO 4 ) 3 (OH) 12 .26H 2 O), respectively.
Directory of Open Access Journals (Sweden)
Nindya Rossavina Dewi
2016-03-01
Full Text Available Fly ash is widely used as concrete’s builder because it contains quite high silica (SiO2 approximately 58,20%. Fly ash can increase concrete power pressure and contains characteristic like cement. Fly ash contains low CaO approximately 3,30% so it needs other material to increase CaO on concrete. CaO found on karbit waste it contained CaO approximately 56,5%. Method of concrete making and technical feasibility test on this research use SNI standar (SNI 03-2834-2000. Environmental feasibility test use Toxicity Characteristic Leaching Procedur (TCLP according PP No. 101 tahun 2014. The results of this research show that the use of karbit waste and fly ash can increase concrete power pressure at age of immersion 28 days. Concrete power pressure with 25% fly ash addition and carbide waste 2,5%;5%;10%; and 15% are 22,05 MPa, 19,43 MPa, 18,59 MPa, 16.09 MPa. Concrete power pressure increase 34,2%; 18,25%; dan 13,14%. Heavy metal concentration at concrete with fly ash 25% and carbide waste 2,5% ; 5% ; 10% are below standard. The best composition is the mixing between 25% fly ash dan10% carbide waste which has Concrete power pressure 18,59 MPa.
Registration of 'CP 09-2392' Sugarcane
CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...
Soo, Anneli, 1984-
2010-01-01
Riigikohtu otsusest asjas 3-1-1-57-09: N. Kohtovi kaitsja vandeadvokaat Tarmo Pilve kassatsioon Tartu Ringkonnakohtu 18. veebruari 2009. a kohtuotsuse peale kriminaalasi N. Kohtovi süüdistuses KarS § 256 lg 1, § 120 ja § 121 järgi
Leachability of Arsenic and Heavy Metals from Mine Tailings of Abandoned Metal Mines
Lim, Mihee; Han, Gi-Chun; Ahn, Ji-Whan; You, Kwang-Suk; Kim, Hyung-Seok
2009-01-01
Mine tailings from an abandoned metal mine in Korea contained high concentrations of arsenic (As) and heavy metals [e.g., As: 67,336, Fe: 137,180, Cu: 764, Pb: 3,572, and Zn: 12,420 (mg/kg)]. US EPA method 6010 was an effective method for analyzing total arsenic and heavy metals concentrations. Arsenic in the mine tailings showed a high residual fraction of 89% by a sequential extraction. In Toxicity Characteristic Leaching Procedure (TCLP) and Korean Standard Leaching Test (KSLT), leaching concentrations of arsenic and heavy metals were very low [e.g., As (mg/L): 0.4 for TCLP and 0.2 for KSLT; cf. As criteria (mg/L): 5.0 for TCLP and 1.5 for KSLT]. PMID:20049231
Directory of Open Access Journals (Sweden)
Radheshyam Rai
2014-04-01
Full Text Available The multiferroic Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3, (where M = Ba (DB, La (DL and Pb (DP has been synthesized by using solid-state reaction technique. Effects of Ba, La and Pb substitution on the structure, electrical and ferroelectric properties of Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 samples have been studied by performing X-ray diffraction, dielectric and magnetic measurements. The crystal structures of the ceramic samples have a tetragonal phase. The vibrating sample magnetometer (VSM measurement shows a significant change in the magnetic properties of Ba-doped Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 as compared to La- and Pb-doped ceramics. It is seen that coercive field (HC and remanent magnetization (MR increases with Ba-doped ceramics but decreases for La- and Pb-doped ceramics.
Energy Technology Data Exchange (ETDEWEB)
Gao, Rongli, E-mail: gaorongli2008@163.com [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing, 401331 (China); Chongqing Key Laboratory of Nano/Micro Composite Materials and Devices, Chongqing, 401331 (China); Fu, Chunlin; Cai, Wei; Chen, Gang; Deng, Xiaoling; Cao, Xianlong [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing, 401331 (China); Chongqing Key Laboratory of Nano/Micro Composite Materials and Devices, Chongqing, 401331 (China)
2016-09-15
Bi{sub 0.9}La{sub 0.1}FeO{sub 3} (BLFO) films were fabricated on La{sub 0.7}Sr{sub 0.3}MnO{sub 3} (LSMO)/SrTiO{sub 3}(STO)(001) substrates by pulsed laser deposition. The ferroelectric photovoltaic characteristics of Au/BLFO/LSMO heterostructures were studied under green light illumination. The open circuit voltage and short circuit current were observed to be positive and negative values under weak light illumination in the as-grown self-poled downward BLFO thin films, while they changed the signs when the light intensity is strong. On the contrary, this photovoltaic properties can be switched when the BLFO films were in poled up state. The photovoltaic effect was also strongly dependent on the polarization direction, incident light intensity and the distribution of oxygen vacancies. As a result, the sign of open circuit voltage and short circuit current could be independent of the direction of polarization. We believe that the switchable diode and photovoltaic effects can be explained well using the concepts of Schottky barrier modulation by polarization flipping and of oxygen vacancies and the distribution of oxygen vacancies at Au/BLFO or BLFO/LSMO interface. Our work provides deep insights into the nature of diode and photovoltaic effects in ferroelectric films, implying an effective approach to improve photovoltaic effect by tuning oxygen vacancies in ferroelectric materials. - Highlights: • Pure phase Bi{sub 0.9}La{sub 0.1}FeO{sub 3} thin films were grown using pulsed laser deposition. • The as grown films were self poled and the polarization direction is downward. • The switchable photovoltaic effect depend on ferroelectric polarization directions. • Photovoltaic effect can be switched by changing the intensity of incident radiation. • Depolarization field and oxygen vacancies together induce the photovoltaic effect.
Directory of Open Access Journals (Sweden)
Ling Qin
2018-05-01
Full Text Available Background: The C allele of the interferon-induced transmembrane protein-3 (IFITM3 SNP rs12252, a common allele in South East Asia and China, is strongly associated with severe influenza infection. However, despite the high occurrence of rs12252-CC genotype in Chinese population (~25%, severe influenza infection is rare. The aim of study is to determine whether rs12252-CC individuals have pre-existing antibody responses to previous seasonal influenza infections.Cohort and Method: A total 99 young healthy volunteers (18–20 years were recruited and received an influenza seasonal Vaccination [A/Switzerland/9715293/2013(H3N2, A/California/7/2009 (pdm09H1N1 and B/Jeep/3073/2013-like virus (Flu-B]. Plasma and gDNA was isolated from each volunteer before, and 14, 28, 180, 360, and 540 days after vaccination. Additionally, 68 elderlies (>65 years were also recruited as a control group to compare the levels of antibodies at baseline between the young adults and the elderly. For each sample IFITM3 rs12252 genotype was determined and antibody levels in response to pdmH1N1, H3N2 and Influenza B infection were measured for each time point.Results: We found a significantly higher level of pre-existing antibodies to pandemic influenza H1N1/09 virus (pdm09H1N1 but not to H3N2 or FluB in CC donors in comparison with CT/TT donors prior to vaccination. No impact of IFITM3 genotype in boosting influenza specific antibodies in young adults within 1 year after receiving seasonal influenza vaccination was observed. In addition, there was no difference in pdm09H1N1 specific antibody levels observed in the elderly cohort between volunteers carrying different IFITM3 genotypes. Higher levels of antibodies to pdmH1N1 were observed in elderly CC carriers when compared to the young CC carriers, but this trend was not replicated in TT carriers.Conclusion:IFITM3-rs12252 CC carriers exhibit a high level of pre-existing immunity to pdm09H1N1 compared to TT carriers in the
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...
Correlation between thermal vibration and conductivity in La0.9Sr0.1B0.9Mg0.1O3-δ, B=Al, Ga and Sc
DEFF Research Database (Denmark)
Lybye, Dorthe; Nielsen, K.
2004-01-01
In order to obtain abetter understanding of the oxide ion conductivity in perovskites, the structure of La(0.9)Sr(0.1)Bo(9)Mg(0.1)O(3 - delta), B=Al, Ga and Sc, have been investigated by time-of-flight powder neutron diffraction at room temperature, 270, 470, 750, 850 and 950 degreesC. For all...... compounds, at all temperatures, structural and anisotropic thermal parameters were refined by full profile Rietveld methods to weighted profile R values less than 0.063. The changes in difference nuclear densities, Deltarho, due to changes in temperature are illustrated by difference density maps around...... the atoms. The observed difference densities are described mainly by zeroth- and second-order spherical harmonics (quadrupolar functions), the nature of which vary with atomic site. The difference density maps provide a direct picture of the average in space and time of changes in atomic thermal vibrations...
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 gb|EAW85442.1| progestin and adipoQ receptor family member IV, is...oform CRA_b [Homo sapiens] gb|EAW85444.1| progestin and adipoQ receptor family member IV, isoform CRA_b [Homo sapiens] EAW85442.1 3e-94 65% ...
Comparison of leach results from field and laboratory prepared samples
International Nuclear Information System (INIS)
Oblath, S.B.; Langton, C.A.
1985-01-01
The leach behavior of saltstone prepared in the laboratory agrees well with that from samples mixed in the field using the Littleford mixer. Leach rates of nitrates and cesium from the current reference formulation saltstone were compared. The laboratory samples were prepared using simulated salt solution; those in the field used Tank 50 decontaminated supernate. For both nitrate and cesium, the field and laboratory samples showed nearly identical leach rates for the first 30 to 50 days. For the remaining period of the test, the field samples showed higher leach rates with the maximum difference being less than a factor of three. Ruthenium and antimony were present in the Tank 50 supernate in known amounts. Antimony-125 was observed in the leachate and a fractional leach rate was calculated to be at least a factor of ten less than that of 137 Cs. No 106 Ru was observed in the leachate, and the release rate was not calculated. However, based on the detection limits for the analysis, the ruthenium leach rate must also be at least a factor of ten less than cesium. These data are the first measurements of the leach rates of Ru and Sb from saltstone. The nitrate leach rates for these samples were 5 x 10 -5 grams of nitrate per square cm per day after 100 days for the laboratory samples and after 200 days for the field samples. These values are consistent with the previously measured leach rates for reference formulation saltstone. The relative standard deviation in the leach rate is about 15% for the field samples, which all were produced from one batch of saltstone, and about 35% for the laboratory samples, which came from different batches. These are the first recorded estimates of the error in leach rates for saltstone
Degradation of cementitious materials associated with salstone disposal units
Energy Technology Data Exchange (ETDEWEB)
Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Smith, F. G. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2014-09-01
The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed “saltstone”. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of a saltstone disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions.
Rectifying characteristics and magnetoresistance in La0.9Sr0.1MnO3/Nb-doped SrTiO3 heterojunctions
International Nuclear Information System (INIS)
Luo, Z.; Gao, J.
2007-01-01
Manganite-based heterojunctions have attracted lots of attention as one of the most promising practical applications of colossal magnetoresistance materials. In this work, heterojunctions were fabricated by depositing La 0.9 Sr 0.1 MnO 3 (LSMO) films on substrates of 0.7 wt.% Nb-doped SrTiO 3 using pulsed laser deposition technique. X-ray diffraction spectra confirmed that the grown films are of single phase and have an orientation with the c-axis perpendicular to the substrate surface. As temperature decreases, the resistivity of LSMO films first increases gradually and then increases abruptly at temperature lower than 150 K. These junctions showed clear rectifying characteristics and strong temperature dependent current-voltage relation. Diffusion voltage decreases as temperature increases. Under forward bias, current is proportion to exp(eV/nkT). Ideal factor increases quickly and tunneling current plays more and more important role as temperature decreases. At 50 K, tunneling current becomes nearly dominant. Large magnetoresistance was observed. The sign and value of such magnetoresistance depends on the direction and value of current
Energy Technology Data Exchange (ETDEWEB)
Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-02-18
This report details the chemical and radionuclide contaminant results for the characterization of the Calendar Year (CY) 2015 First, Second, and Third Quarter sampling of Tank 50H for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering (D&S-FE) to support the transfer of low-level aqueous waste from Tank 50H to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50H Waste Characterization System. Previous memoranda documenting the WAC analyses results have been issued for these three samples.
International Nuclear Information System (INIS)
Dinamarca, Robinson; Garcia, Ximena; Jimenez, Romel; Fierro, J.L.G.; Pecchi, Gina
2016-01-01
Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La_1_-_xAg_xMn_0_._9Co_0_._1O_3) and A-site deficient (La_1_-_xMn_0_._9Co_0_._1O_3_-_δ) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O_2-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag_2O segregated phases and the redox pair Mn"4"+/Mn"3"+. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn"4"+/Mn"3"+, which is attributed to the cubic crystalline structure.
Lim, Jung Eun; Sung, Jwa Kyung; Sarkar, Binoy; Wang, Hailong; Hashimoto, Yohey; Tsang, Daniel C W; Ok, Yong Sik
2017-04-01
Metal stabilization using soil amendments is an extensively applied, economically viable and environmentally friendly remediation technique. The stabilization of Pb, Zn and As in contaminated soils was evaluated using natural starfish (NSF) and calcined starfish (CSF) wastes at different application rates (0, 2.5, 5.0 and 10.0 wt%). An incubation study was conducted over 14 months, and the efficiency of stabilization for Pb, Zn and As in soil was evaluated by the toxicity characteristic leaching procedure (TCLP) test. The TCLP-extractable Pb was reduced by 76.3-100 and 91.2-100 % in soil treated with NSF and CSF, respectively. The TCLP-extractable Zn was also reduced by 89.8-100 and 93.2-100 % in soil treated with NSF and CSF, respectively. These reductions could be associated with the increased metal adsorption and the formation of insoluble metal precipitates due to increased soil pH following application of the amendments. However, the TCLP-extractable As was increased in the soil treated with NSF, possibly due to the competitive adsorption of phosphorous. In contrast, the TCLP-extractable As in the 10 % CSF treatment was not detectable because insoluble Ca-As compounds might be formed at high pH values. Thermodynamic modeling by visual MINTEQ predicted the formation of ettringite (Ca 6 Al 2 (SO 4 ) 3 (OH) 12 ·26H 2 O) and portlandite (Ca(OH) 2 ) in the 10 % CSF-treated soil, while SEM-EDS analysis confirmed the needle-like structure of ettringite in which Pb was incorporated and stabilized in the 10 % CSF treatment.
Viswanath, Pamarti; Prashanth, Sadhu Sai Pavan; Molli, Muralikrishna; Wicram, Jaschin Prem; Sai Muthukumar, V.
2018-04-01
Glass ceramics are excellent replacement for single crystalline materials which are expensive and difficult to fabricate. In this context, we have attempted to fabricate glass nanocomposites comprising of Lithium Borate glass matrix embedded with lead free ferroelectric Ba0.85Ca0.15Zr0.1Ti0.9O3 (BCZT). Both of these functional materials are known to exhibit excellent ferroelectric behavior and are currently explored for various device applications. We have prepared these novel glass nanocomposite using melt-quenching techniquein various chemical composition involving different molar ratio. x(Ba0.85Ca0.15Zr0.1Ti0.9O3)-(1-x)(Li2O.2B2O3) where (x=0.1,0.2,0.3,0.4). The as-quenched samples exhibited amorphous nature as revealed by X-ray Diffraction studies. With the increase in BCZT content we have observed significant alteration in optical bandgap and Urbach energy. The tailoring of optical properties by tuning the structure was probed by Raman vibrational spectroscopy which confirmed the dominant role played by BCZT as a network modifier in these borate glasses. Concomitantly, these glass nanocomposites were found to be excellent UV absorbers.
A 0.9-V 12-bit 40-MSPS Pipeline ADC for Wireless Receivers
Ito, Tomohiko; Itakura, Tetsuro
A 0.9-V 12-bit 40-MSPS pipeline ADC with I/Q amplifier sharing technique is presented for wireless receivers. To achieve high linearity even at 0.9-V supply, the clock signals to sampling switches are boosted over 0.9V in conversion stages. The clock-boosting circuit for lifting these clocks is shared between I-ch ADC and Q-ch ADC, reducing the area penalty. Low supply voltage narrows the available output range of the operational amplifier. A pseudo-differential (PD) amplifier with two-gain-stage common-mode feedback (CMFB) is proposed in views of its wide output range and power efficiency. This ADC is fabricated in 90-nm CMOS technology. At 40MS/s, the measured SNDR is 59.3dB and the corresponding effective number of bits (ENOB) is 9.6. Until Nyquist frequency, the ENOB is kept over 9.3. The ADC dissipates 17.3mW/ch, whose performances are suitable for ADCs for mobile wireless systems such as WLAN/WiMAX.
International Nuclear Information System (INIS)
Dickens, P.G.; Flynn, G.J.; Patat, S.; Stuttart, G.P.
1997-01-01
Complete crystal structures of the related phases UTi x Nb 3-x O 10 (x=0,1/3,1) and of the intercalation compound Li 0.9 UTiNb 2 O 10 have been determined by Rietveld analysis of room-temperature powder neutron diffraction data. The new structural data combined with magnetic susceptibility measurements made in the range 5 y 1 U V 1+y-x U VI x-y Ti IV x Nb V 3-x O 10 (y≤ x ≤1) with U V (f 1 ) being the only paramagnetic species present. (Author)
Corrosion of Dental Au-Ag-Cu-Pd Alloys in 0.9 % Sodium Chloride Solution
International Nuclear Information System (INIS)
Chiba, Atsushi; Kusayanagi, Yukiharu
2005-01-01
Two Au-Ag-Cu-Pd dental casting alloys (Au:12% and 20%) used. The test solutions used 0.9 % NaCl solution (isotonic sodium chloride solution), 0.9 % NaCl solution containing 1 % lactic acid, and 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The surface of two samples in three sample solutions was not natural discoloration during one year. The alloy containing 12 % gold was easily alloyed and the composition was uniform comparing with the alloy containing 20 % gold. The rest potentials have not a little effect after three months. The kinds of metals could not definitely from the oxidation and reduction waves of metal on the cyclic voltammograms. The dissolutions of gold and palladium were 12 % Au sample in the 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The pH of solution had an affect on dissolution of copper, and sulfur ion had an affect on dissolution of silver. The copper dissolved amount from 20 % gold sample was about 26 times comparing with that of 12 % gold sample in the 0.9 % solution containing 1 % lactic acid. Corrosion products were silver chloride and copper chloride in NaCl solution, and silver sulfide and copper sulfide in NaCl solution containing Na 2 S
40 CFR 61.09 - Notification of startup.
2010-07-01
... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...
Magnetic Properties of La0.9Ag0.1(Mn1-xCoxO3 under Pressure
Directory of Open Access Journals (Sweden)
Mihalik M.
2013-01-01
Full Text Available In our paper we report on magnetic properties of La0.90Ag0.10(CoxMn1-xO3 ferromagnetic ceramics (x = 0.00 and0.03 which were studied in pressures up to 0.9 GPa. Magnetic transition at the Curie temperature TC is accompanied with metal insulator transition with a maximum at T* which is shifted to lower temperature with applied magnetic field. The Curie temperature is decreasing with substitution of Co for Mn and is ranging from 178 K to 126.5 K. Hydrostatic pressure increases TC for sample with x = 0.03 nearly linearly with the pressure coefficient dTc/dp = 5.7 K/GPa. Hysteresis loop is affected marginally; µs increases and Hc decreases with pressure.
Effects of the fabrication process on the grain-boundary resistance in BaZr0.9Y0.1O3-δ
DEFF Research Database (Denmark)
Ricote, Sandrine; Bonanos, Nikolaos; Manerbino, A.
2014-01-01
This paper reports on the effect of the fabrication process on the conductivity of BZY10 (BaZr0.9Y0.1O3-δ). The dense specimens were prepared by four methods: (1) solid-state reactive sintering (SSRS), (2) conventional sintering using powder prepared by solid-state reaction and NiO as sintering a...
The n-Cu0.9Ag0.1In3Se5 chalcopyrite, electronic as well as ionic conductor
International Nuclear Information System (INIS)
Diaz, R
2008-01-01
A resistance increase with time of the n-Cu 0.9 Ag 0.1 In 3 Se 5 chalcopyrite has been observed. This new effect is analysed in terms of a hypothesis of ion migration and Schottky barrier formation. These results might explain why different solar cell efficiencies are obtained for the chalcopyrites, CuInSe 2 and CuIn x Ga 1-x Se 2 , when an In-rich film is deposited on top of the chalcopyrite. In these solar cells, ion migration can exist and a new effect appears similar to the one observed in our compound. The ions, probably the cations, are moved by the electrical field towards the cathode. A gradient of mobile ions appears across the sample and the positive charge is accumulated near this electrode such that it varies the metal-semiconductor interface. This interface is a Schottky barrier where the contact potential is a function of time due to the arrival of ions. The electrical measurements have been carried out on a solid state device, graphite/n-Cu 0.9 Ag 0.1 In 3 Se 5 /graphite. The current intensity and the potential drop across the sample have been measured with time when a constant electrical potential is applied for 600 s at dark or under ultraviolet illumination and at room temperature. A comparative study in similar electrical conditions is done; the current intensity difference and the potential drop across the difference (under ultraviolet illumination minus at dark) are not constant and both measurements increase with time
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...
Exon: CBRC-MMUS-09-0206 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...
Crystal growth and piezoelectric properties of Ca3Ta(Ga0.9Sc0.1)3Si2O14 bulk single crystal
Igarashi, Yu; Yokota, Yuui; Ohashi, Yuji; Inoue, Kenji; Yamaji, Akihiro; Shoji, Yasuhiro; Kamada, Kei; Kurosawa, Shunsuke; Yoshikawa, Akira
2018-03-01
Ca3Ta(Ga0.9Sc0.1)3Si2O14 langasite-type single crystal with a diameter of 1 in. was grown by Czochralski (Cz) method. Obtained crystal had good crystallinity and its lattice constants exceeded those of Ca3TaGa3Si2O14 (CTGS) according to the X-ray analysis. A crack-free specimen cut from the grown crystal was used for the measurements of dielectric constant ε11T/ε0, electromechanical coupling factor k12, and piezoelectric constant d11. The accuracies of these measurements were better than those for the crystal grown by micro-pulling-down (μ-PD) method. Substitution of Ga with Sc resulted modification of these constants in the directions opposite to those observed after partial substitution of Ga (of CTGS) with Al. This suggests that increase of |d14| was most probably associated with enlargement of average size of the Ga sites. The crystal reported here had greater dimensions as compared to analogous crystals grown by the μ-PD method. As a result, accuracy of determination of acoustic constants of this material may be improved.
Rolin, C; Hecq, J-D; Tulkens, P; Vanbeckbergen, D; Jamart, J; Galanti, L
2011-11-01
The aim of this study was to investigate the stability of a mixture of temocillin 20mg/ml in 5% dextrose and in 0.9% sodium chloride polyolefin bags after freezing, microwave thawing and long-term storage at 5±3°C. The stability of ten polyolefin bags containing 20mg/ml of temocillin, five bags in 5% dextrose and five bags in 0.9% sodium chloride, prepared under aseptic conditions was studied after freezing for 1 month at -20°C, thawing in a microwave oven with a validated cycle, and stored at 5±3°C. Over 30 days, temocillin concentrations were measured by high-pressure liquid chromatography. Visual inspections, microscope observation, spectrophotometric measurements and pH measurements were also performed. No precipitation occurred in the preparations but minor colour change was observed. No microaggregate was observed with optical microscopy or revealed by a change of absorbance. Based on a shelf life of 95% residual potency, temocillin infusions were stable at least 11 days in 5% dextrose and 14 days in 0.9% sodium chloride after freezing and microwave thawing (corresponding at the period where 95% lower confidence limit of the concentration-time profile remained superior to 95% of the initial concentration). During this period, the pH values of drug solutions have been observed to decrease without affecting chromatographic parameters. Within these limits, temocillin in 5% dextrose and in 0.9% sodium chloride infusions may be prepared and frozen in advance by a centralized intravenous admixture service then thawed before use in clinical units. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Photoresponse in La0.9Hf0.1MnO3/0.05wt%Nb-doped SrTiO3 heteroepitaxial junctions
Qi, Yaping; Ni, Hao; Zheng, Ming; Zeng, Jiali; Jiang, Yucheng; Gao, Ju
2018-05-01
Excellent photo detectors need to have the rapid response and good repeatability from the requirement of industrial applications. In this paper, transport behavior and opto-response of heterostructures made with La0.9Hf0.1MnO3 and 0.05wt%Nb-doped SrTiO3 were investigated. The heterojunctions exhibited an excellent rectifying feature with very low leakage in a broad temperature region (from 40 to 300 K). These thin films presented persistent and stable photovoltages upon light illumination. Rapid shift between small and large voltages corresponding to "light OFF" and "light ON" states, respectively, was observed, demonstrating reliable photo detection behavior. A semiconductor laser with a wavelength of 650 nm was used as the light source. It is also noted that the observed photovoltages are strongly determined by light intensity. The injection of photoexcited charge carriers (electrons) could be responsible for the appearance of the observed opto-response. Such manipulative features by light irradiation exhibit great potential for light detectors for visible light.
Photoresponse in La0.9Hf0.1MnO3/0.05wt%Nb-doped SrTiO3 heteroepitaxial junctions
Directory of Open Access Journals (Sweden)
Yaping Qi
2018-05-01
Full Text Available Excellent photo detectors need to have the rapid response and good repeatability from the requirement of industrial applications. In this paper, transport behavior and opto-response of heterostructures made with La0.9Hf0.1MnO3 and 0.05wt%Nb-doped SrTiO3 were investigated. The heterojunctions exhibited an excellent rectifying feature with very low leakage in a broad temperature region (from 40 to 300 K. These thin films presented persistent and stable photovoltages upon light illumination. Rapid shift between small and large voltages corresponding to “light OFF” and “light ON” states, respectively, was observed, demonstrating reliable photo detection behavior. A semiconductor laser with a wavelength of 650 nm was used as the light source. It is also noted that the observed photovoltages are strongly determined by light intensity. The injection of photoexcited charge carriers (electrons could be responsible for the appearance of the observed opto-response. Such manipulative features by light irradiation exhibit great potential for light detectors for visible light.
2011-09-30
...-Toner''); Alpha Image Tech of South El Monte, California (``Alpha Image''); ACM Technologies, Inc. of Corona, California (``ACM''); Virtual Imaging Products Inc. of North York, Ontario; Acecom Inc.--San... Image, Copy Tech, LTT, C&R, ACM, Ink Master, Direct Billing, Ink Tech, QCI, IJSS, Acecom, Ninestar Tech...
Altered response to A(H1N1)pnd09 vaccination in pregnant women
DEFF Research Database (Denmark)
Bischoff, Anne Louise; Følsgaard, Nilofar Vahman; Carson, Charlotte Giwercman
2013-01-01
BACKGROUND: Pregnant women were suspected to be at particular risk when H1N1pnd09 influenza became pandemic in 2009. Our primary objective was to compare the immune responses conferred by MF59®-adjuvanted vaccine (Focetria®) in H1N1pnd09-naïve pregnant and non-pregnant women. The secondary aims...... were to compare influences of dose and adjuvant on the immune response. METHODS: The study was nested in the Copenhagen Prospective Studies on Asthma in Childhood (COPSAC2010) pregnancy cohort in 2009-2010 and conducted as a single-blinded block-randomised [1∶1∶1] controlled clinical trial in pregnant...... women after gestational week 20: (1) 7.5 µg H1N1pnd09 antigen with MF59-adjuvant (Pa7.5 µg); (2) 3.75 µg antigen half MF59-adjuvanted (Pa3.75 µg); (3) 15 µg antigen unadjuvanted (P15 µg); and in non-pregnant women receiving (4) 7.5 µg antigen full adjuvanted (NPa7.5 µg). Blood samples were collected...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...
Results For The Third Quarter Calendar Year 2016 Tank 50H Salt Solution Sample
Energy Technology Data Exchange (ETDEWEB)
Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-10-13
In this memorandum, the chemical and radionuclide contaminant results from the Third Quarter Calendar Year 2016 (CY16) sample of Tank 50H salt solution are presented in tabulated form. The Third Quarter CY16 Tank 50H samples (a 200 mL sample obtained 6” below the surface (HTF-5-16-63) and a 1 L sample obtained 66” from the tank bottom (HTF-50-16-64)) were obtained on July 14, 2016 and received at Savannah River National Laboratory (SRNL) on the same day. Prior to obtaining the samples from Tank 50H, a single pump was run at least 4.4 hours, and the samples were pulled immediately after pump shut down. The information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering for the transfer of aqueous waste from Tank 50H to the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the Task Technical and Quality Assurance Plan (TTQAP) for the Tank 50H saltstone task. The chemical and radionuclide contaminant results from the characterization of the Third Quarter CY16 sampling of Tank 50H were requested by Savannah River Remediation (SRR) personnel and details of the testing are presented in the SRNL TTQAP.
Energy Technology Data Exchange (ETDEWEB)
Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan, 713103, West Bengal (India); Kar, T. [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700032, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India)
2016-02-01
This article reports the synthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C powder obtained by mechanical milling the mixture of Si, Al and graphite powders at room temperature under inert atmosphere. XRD patterns of ball-milled powders clearly reveal the nucleation of Si{sub 0.9}Al{sub 0.1}C phase after 5 h of milling and the stoichiometric cubic Si{sub 0.9}Al{sub 0.1}C is formed after 10 h of milling with crystallite size of ∼3 nm. Microstructure of ball-milled powders in terms of different lattice imperfections is characterized by employing both Rietveld's method of structure refinement using XRD data and high resolution transmission electron microscope (HRTEM). HRTEM micrographs of 10 h milled powder substantiate the formation of nanocrystalline Si{sub 0.9}Al{sub 0.1}C compound without any contamination and confirm the findings of Rietveld analysis using XRD data. - Highlights: • Cubic Si{sub 0.9}Al{sub 0.1}C is formed after 5 h of milling of Si, Al and graphite powders. • Nanocrystalline Si{sub 0.9}Al{sub 0.1}C with particle size ∼3 nm is obtained after 10 h milling. • Average particle size of Si{sub 0.9}Al{sub 0.1}C from XRD analysis and HRTEM is very close.
International Nuclear Information System (INIS)
Zheng, R.K.; Dong, S.N.; Wu, Y.Q.; Zhu, Q.X.; Wang, Y.; Chan, H.L.W.; Li, X.M.; Luo, H.S.; Li, X.G.
2012-01-01
The authors constructed multiferroic structures by growing La 0.9 Ce 0.1 MnO 3 (LCEMO) thin films on piezoelectric 0.68Pb(Mg 1/3 Nb 2/3 )O 3 –0.32PbTiO 3 (PMN-PT) single-crystal substrates. Due to the efficient elastic coupling at the interface, the electric-field-induced piezoelectric strain in PMN-PT substrates is effectively transferred to LCEMO films and thus, leads to a decrease in the resistance and an increase in the magnetoresistance of the films. Particularly, it was found that the resistance-strain coefficient [(ΔR/R) film /(Δε zz ) film ] of the LCEMO film was considerably enhanced by the application of magnetic fields, demonstrating strong coupling between the lattice and the spin degrees of freedom. (ΔR/R) film /(Δε zz ) film at 122 K was enhanced by ∼ 28.8% by a magnetic field of 1.2 T. An analysis of the overall results demonstrates that the phase separation is crucial to understand strain-mediated modulation of electronic transport properties of manganite film/PMN-PT multiferroic structures. - Highlights: ► La 0.9 Ce 0.1 Mn O3 films were epitaxially grown on piezoelectric single crystals. ► Piezoelectric strain influences the electronic transport properties of films. ► Magnetic field enhances the piezoelectric strain effect. ► Phase separation is crucial to understand the piezoelectric strain effect.
Energy Technology Data Exchange (ETDEWEB)
NONE
2009-07-01
Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6{sup th} Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found.
Nunes, Vinícius Rodrigues Taranto; Barbuto, Rafael Calvão; Vidigal, Paula Vieira Teixeira; Pena, Guilherme Nogueira; Rocha, Silvia Lunardi; de Siqueira, Lucas Tourinho; Caliari, Marcelo Vidigal; de Araujo, Ivana Duval
2014-04-01
Peritoneal cavity lavage is used widely in the treatment of peritonitis. Nonetheless, some studies question its rationale and prove it to be deleterious to the mesothelium. The present study aims to determine whether 0.9% and 3.0% saline lavage of the peritoneal cavity have an effect on the early systemic inflammatory response, namely, in the lung injury and splenic cellularity of gerbils with induced peritonitis. Thirty-four male gerbils were divided into four groups: Control (n=9), submitted to laparotomy at time zero, re-laparotomy after 2 h, and sacrificed after a total of 6 h from start; untreated (n=8), submitted to peritonitis induction through cecal ligation and puncture (CLP) at time zero, re-laparotomy intended for drying of abdominal cavity and resection of the ischemic cecum after 2 h, and sacrifice after a total of 6 h from start; saline (n=8), submitted to peritonitis induction through CLP at time zero, re-laparotomy intended for warm 0.9% saline lavage of the abdominal cavity and resection of the ischemic cecum after 2 h, and sacrificed after a total of 6 h from start; and hypertonic (n=9), submitted to peritonitis induction through CLP at time zero, re-laparotomy intended for warm hypertonic saline (3.0%) lavage of the abdominal cavity and resection of the ischemic cecum after 2 h, and sacrificed after a total of 6 h from start. After sacrifice, we collected the left lung and the spleen for morphometric analysis. In the both the saline and hypertonic groups, there was significant decrease in the mean nuclei count in the lungs, compared with the untreated group (p0.05). The present study demonstrated that the peritoneal lavage with large volumes of warm 0.9% and 3.0% saline has a beneficial effect on the early systemic inflammatory response in infected animals, modulating and reducing the lung injury but having no effect on splenic cell count.
Quantum control for initiation and detection of explosives
International Nuclear Information System (INIS)
Greenfield, Margo T.; McGrane, Shawn D.; Scharff, R. Jason; Moore, David S.
2010-01-01
We employ quantum control methods towards detection and quantum controlled initiation (QCI) of energetic materials. Ultrafast pulse shaping of broadband Infrared (∼750 nm to 850 run) and ultraviolet (266 nm, 400 nm) light is utilized for control. The underlying principals behind optimal control can be utilized to both detect and initiate explosives. In each case, time dependent phase shaped electric fields drive the chemical systems towards a desired state. For optimal dynamic detection of explosives (ODD-Ex) a phase specific broadband infrared pulse is created which increases not only the sensitivity of detection but also the selectivity of an explosive's spectral signatures in a background of interferents. QCI on the other hand, seeks to initiate explosives by employing shaped ultraviolet light. QCI is ideal for use with explosive detonators as it removes the possibility of unintentional initiation from an electrical source while adding an additional safety feature, initiation only with the proper pulse shape. Quantum control experiments require: (1) the ability to phase and amplitude shape the laser pulse and (2) the ability to effectively search for the pulse shape which controls the reaction. In these adaptive experiments we utilize both global and local optimization search routines such as genetic algorithm, differential evolution, and downhill simplex. Pulse shaping the broadband IR light, produced by focusing 800 nm light through a pressurized tube of Argon, is straightforward as commercial pulse shapers are available at and around 800 nm. Pulse shaping in the UV requires a home built shaper. Our system is an acoustic optical modulator (AOM) pulse shaper in which consists of a fused silica AOM crystal placed in the Fourier plane of a 4-f zero dispersion compressor.
Zhu, Zhi; Tang, Xingui; Jiang, Yanping; Liu, Qiuxiang; Zhang, Tianfu; Li, Wenhua
2017-03-28
This work evaluated the resistance switching characteristics in the (100)-oriented Pb(Zn 1/3 Nb 2/3 ) 0.91 Ti 0.09 O₃ (PZNT) single crystal. The current hysteresis can be closely related to the ferroelectric polarization and we provided a possible explanation using a model about oxygen vacancies to analyze the mechanism of switching. The obvious frequency dispersion of the relative permittivity signified the relaxer-type behavior of the sample. The value of the relaxation parameter γ = 1.48 was estimated from the linear fit of the modified Curie-Weiss law, indicating the relaxer nature. High-temperature dielectric relaxation behaviors were revealed in the temperature region of 400-650 °C. In addition, under the measuring frequency of 10 kHz, ε r was tunable by changing the electric field and the largest tunability of ε r reached 14.78%. At room temperature, the high pyroelectric coefficient and detectivity figure of merit were reported.
2009-01-01
Kohtulahendi 3-4-1-2-09 (Tallinna Linnavolikogu taotlus tunnistada kehtetuks kohaliku omavalitsuse volikogu valimise seaduse § 7 lg 2 p 5 ja § 8 lg 4 ; või § 7 lg 2 p 5 ja § 9 lg 4 ; või § 7 lg 2 p 5, § 8 lg 4 ja § 9 lg 2.) tekst inglise keeles
Water vapour solubility and conductivity study of the proton conductor BaCe(0.9 − x)ZrxY0.1O(3 − δ)
DEFF Research Database (Denmark)
Ricote, Sandrine; Bonanos, Nikolaos; Caboche, G:
2009-01-01
The perovskite BaCe(0.9 − x)ZrxY0.1O(3 − δ) has been prepared by solid state reaction at 1400 °C and conventional sintering at 1700 °C. Water uptake experiments performed between 400 and 600 °C, at a water vapour pressure of 0.02 atm, provide data on the concentration of protons incorporated in t...
Impedance spectroscopy studies on lead free (Ba0.85Ca0.15(Ti0.9Zr0.1O3 ceramics
Directory of Open Access Journals (Sweden)
Ahcène Chaouchi
2012-12-01
Full Text Available The AC complex impedance spectroscopy technique has been used to obtain the electrical parameters of polycrystalline sample of (Ba0.85Ca0.15(Ti0.9Zr0.1O3 in a wide frequency range at different temperatures. This sample was prepared by a high temperature solid-state reaction technique and single phase formation was confirmed by X-ray diffraction technique. This study was carried out by the means of simultaneous analysis of impedance, modulus, and electrical conductivity. The Cole-Cole (Nyquist plots suggest that the grains and grain boundaries are responsible in the conduction mechanism of the material at high temperature. The ColeCole (Nyquist plot studies revealed the presence of grain and grain boundary effect at 485 °C. On the other hand, it showed only the presence of grain boundary component of the resistivity at 535 °C. Complex impedance analysis indicated the presence of non-Debye type dielectric relaxation. The bulk resistance of the material decreases with rise in temperature similar to a semiconductor, and the Cole-Cole (Nyquist plot showed the negative temperature coefficient of resistance (NTCR character of (Ba0.85Ca0.15(Ti0.9Zr0.1O3. The value of activation energy is found to be 0.7433 eV, which suggests that the conduction may be the result of defect and charge carriers present in the materials.
Piezoresistance of Silicon and Strained Si0.9Ge0.1
DEFF Research Database (Denmark)
Richter, Jacob; Hansen, Ole; Larsen, A. Nylandsted
2005-01-01
We present experimentally obtained results of the piezoresistive effect in p-type silicon and strained Si0.9Ge0.1. Today, strained Si1-xGex is used for high speed electronic devices. This paper investigates if this area of use can be expanded to also cover piezoresistive micro electro mechanical...... systems (MEMS) devices. The measurements are performed on microfabricated test chips where resistors are defined in layers grown by molecular beam epitaxy on (0 0 1) silicon substrates. A uniaxial stress along the [1 1 0] direction is applied to the chip, with the use of a four point bending fixture....... The investigation covers materials with doping levels of N-A = 10(18) cm(-3) and NA = 1019 cm(-3), respectively. The results show that the pi(66) piezoresistive coefficient in strained Si0.9Ge0.1 is approximately 30% larger than the comparable pi(44) piezoresistive coefficient in silicon at a doping level of N...
Surface Spin Glass Ordering and Exchange Bias in Nanometric Sm0.09Ca0.91MnO3 Manganites
Giri, S. K.; Nath, T. K.
2011-07-01
We have thoroughly investigated the entire magnetic state of under doped ferromagnetic insulating manganite Sm0.09Ca0.91MnO3 through temperature dependent linear and non-linear ac magnetic susceptibility and magnetization measurements. This ferromagnetic insulating manganite is found to have frequency dependent ferromagnetic to paramagnetic transition temperature at around 108 K. Exchange- bias effect are observed in field -cooled magnetic hysteresis loops for this nanoparticle. We have attributed our observation to the formation of ferromagnetic cluster which are formed as a consequence of intrinsic phase separation below certain temperature in this under doped manganites. We have carried out electronic- and magneto-transport measurements to support these observed results.
Impedance spectroscopy studies on lead free Ba1-xMgx(Ti0.9Zr0.1)O3 ceramics
Ben Moumen, S.; Neqali, A.; Asbani, B.; Mezzane, D.; Amjoud, M.; Choukri, E.; Gagou, Y.; El Marssi, M.; Luk'yanchuk, Igor A.
2018-06-01
Ba1-xMgx(Ti0.9Zr0.1)O3 (x = 0.01 and 0.02) ceramics were prepared using the conventional solid state reaction. Rietveld refinement performed on X-ray diffraction patterns indicates that the samples are tetragonal crystal structure with P4mm space group. By increasing Mg content from 1 to 2% the unit cell volume decreased. Likewise, the grains size is greatly reduced from 10 μm to 4 μm. The temperature dependence of dielectric constants at different frequencies exhibited typical relaxor ferroelectric characteristic, with sensitive dependence in frequency and temperature for ac conductivity. The obtained activation energy values were correlated to the proposed conduction mechanisms.
Liu, Tonghua; Wang, Wei; Qiang, Wenjiang; Shu, Guogang
2018-04-01
To study the thermal aging embrittlement of Z3CN20.09M duplex stainless steel produced in China, accelerated thermal aging experiments were carried out at 380 °C up to 9000 h. Microhardness measurements, Charpy impact and eddy current tests were performed on aged samples to characterize their thermal aging embrittlement. The results showed that the signal amplitude of eddy current decreased with the increase in aging time. Two quantitative correlations of the eddy current signal amplitude with both the Charpy impact energy, and the Vickers microhardness of the ferrite phase are obtained. The study showed that eddy current testing could be used to non-destructively evaluate the thermal aging embrittlement of cast duplex stainless steels.
DEFF Research Database (Denmark)
Ricote, Sandrine; Bonanos, Nikolaos; Marco de Lucas, M.C.
2009-01-01
The perovskite BaCe(0.9−x)ZrxY0.1O(3−δ) is prepared by solid-state reaction at 1400 °C and sintering at 1700 °C. It is characterised using X-ray diffraction, Raman spectroscopy and electrical measurements. A distortion from the cubic structure at room temperature is noticeable in the Raman spectr...
Gilev, A. R.; Kiselev, E. A.; Zakharov, D. M.; Cherepanov, V. A.
2017-10-01
The total conductivity, Seebeck coefficient and oxygen non-stoichiometry for La1.2Sr0.8Ni0.9Fe0.1O4+δ have been measured vs temperature and oxygen partial pressure P(O2). The measurements were carried out at 800, 850, 900 and 950 °C within the P(O2) range of 10-5-0.21 atm. La1.2Sr0.8Ni0.9Fe0.1O4+δ was shown to be oxygen deficient in all temperature and P(O2) ranges studied. The calculated values of the partial molar enthalpy of oxygen depend very slightly on oxygen content (δ), indicating that La1.2Sr0.8Ni0.9Fe0.1O4+δ with the oxygen deficiency can be considered an ideal solution. The model of point defect equilibria in La1.2Sr0.8Ni0.9Fe0.1O4+δ has been proposed and fitted to experimental dependencies. Subsequent joint analysis of the defect structure and transport properties revealed that electron holes can coexist in both localized and quasi-delocalized states in the oxide: the former corresponded to high-spin state Ni3+ and the latter - to low-spin state Ni3+. The mobilities of localized electron holes were shown to be significantly lower in comparison to quasi-delocalized ones. The behavior of localized electron holes was explained in terms of a small polaron conduction mechanism; in contrast, quasi-delocalized electron holes were described in terms of a band conduction approach. The small polaron conduction mechanism was shown to be predominant in the Sr- and Fe-co-doped lanthanum nickelate.
Ac conductivity and relaxation mechanism in Ba{sub 0.9}Sr{sub 0.1}TiO{sub 3}
Energy Technology Data Exchange (ETDEWEB)
Singh, A K; Barik, Subrat K [Department of Physics and Meteorology, Indian Institute of Technology, Kharagpur 721 302 (India); Choudhary, R N.P. , [Department of Physics and Meteorology, Indian Institute of Technology, Kharagpur 721 302 (India); Mahapatra, P K [Department of Physics, Vidyasagar University, Midnapore 721 102 (India)
2009-06-24
The ac conductivity and relaxation mechanism in Ba{sub 0.9}Sr{sub 0.1}TiO{sub 3} ceramics have been investigated systematically. A high-temperature solid-state reaction technique was used to synthesize the compound. The formation of the compound was checked by an X-ray diffraction (XRD) technique. The dielectric permittivity and the loss tangent of the sample were measured in a frequency range from 1 kHz to 1 MHz at different temperatures (30-500 deg. C). A study on dielectric properties reveals the electrical relaxation phenomenon occurs in the material. The activation energy was calculated from the temperature variation of dc conductivity. Studies of frequency and temperature dependence of ac conductivity of the compound suggest that conduction process in the material is thermally activated.
46 CFR 42.09-5 - All vessels-division into types.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...
Variability Of KD Values In Cementitious Materials And Sediments
International Nuclear Information System (INIS)
Almond, P.; Kaplan, D.; Shine, E.
2012-01-01
Measured distribution coefficients (K d values) for environmental contaminants provide input data for performance assessments (PA) that evaluate physical and chemical phenomena for release of radionuclides from wasteforms, degradation of engineered components and subsequent transport of radionuclides through environmental media. Research efforts at SRNL to study the effects of formulation and curing variability on the physiochemical properties of the saltstone wasteform produced at the Saltstone Disposal Facility (SDF) are ongoing and provide information for the PA and Saltstone Operations. Furthermore, the range and distribution of plutonium K d values in soils is not known. Knowledge of these parameters is needed to provide guidance for stochastic modeling in the PA. Under the current SRS liquid waste processing system, supernate from F and H Tank Farm tanks is processed to remove actinides and fission products, resulting in a low-curie Decontaminated Salt Solution (DSS). At the Saltstone Production Facility (SPF), DSS is mixed with premix, comprised of blast furnace slag (BFS), Class F fly ash (FA), and portland cement (OPC) to form a grout mixture. The fresh grout is subsequently placed in SDF vaults where it cures through hydration reactions to produce saltstone, a hardened monolithic waste form. Variation in saltstone composition and cure conditions of grout can affect the saltstone's physiochemical properties. Variations in properties may originate from variables in DSS, premix, and water to premix ratio, grout mixing, placing, and curing conditions including time and temperature (Harbour et al. 2007; Harbour et al. 2009). There are no previous studies reported in the literature regarding the range and distribution of K d values in cementitious materials. Presently, the Savannah River Site (SRS) estimate ranges and distributions of K d values based on measurements of K d values made in sandy SRS sediments (Kaplan 2010). The actual cementitious material K d
International Nuclear Information System (INIS)
2009-01-01
The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).
Enhanced conductivity in pulsed laser deposited Ce0.9Gd0.1O2−δ/SrTiO3 heterostructures
DEFF Research Database (Denmark)
Kant, K. Mohan; Esposito, Vincenzo; Pryds, Nini
2010-01-01
Significant enhancement in the electrical conductivity of Ce0.9Gd0.1O2−δ (CGO) thin films (250 and 500 nm) deposited on MgO(001) substrate is observed by introducing ∼ 50 nm thin SrTiO3 buffer layer film. Introduction of the buffer layer is found to form epitaxial films, leading to minimal grain...... boundary network that results in a free conduction path with near-zero blocking effects perpendicular to current flow. The in-plane conductivity measurements confirm increase in conductivity with increase in compressive strain on CGO films. © 2010 American Institute of Physics...
iMovie '09 & iDVD pocket genius
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of iMovie '09 or iDVD, put this savvy Portable Genius to work. Want to quickly turn raw footage into a polished movie? Crop, rotate, or delete clips? Add background music or sound effects? Customize your iDVD themes? You'll find cool and useful Genius tips, insider secrets, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy iMovie '09 and iDVD to the max.
INTERNATIONAL PROGRAM: SUMMARY REPORT ON THE PROPERTIES OF CEMENTITIOUS WASTE FORMS
International Nuclear Information System (INIS)
Harbour, J
2007-01-01
This report provides a summary of the results on the properties of cementitious waste forms obtained as part of the International Program. In particular, this report focuses on the results of Task 4 of the Program that was initially entitled ''Improved Retention of Key Contaminants of Concern in Low Temperature Immobilized Waste Forms''. Task 4 was a joint program between Khlopin Radium Institute and the Savannah River National Laboratory. The task evolved during this period into a study of cementitious waste forms with an expanded scope that included heat of hydration and fate and transport modeling. This report provides the results for Task 4 of the International Program as of the end of FY06 at which time funding for Task 4 was discontinued due to the needs of higher priority tasks within the International Program. Consequently, some of the subtasks were only partially completed, but it was considered important to capture the results up to this point in time. Therefore, this report serves as the closeout report for Task 4. The degree of immobilization of Tc-99 within the Saltstone waste form was measured through monolithic and crushed grout leaching tests. An effective diffusion coefficient of 4.8 x 10 -12 (Leach Index of 11.4) was measured using the ANSI/ANS-16.1 protocol which is comparable with values obtained for tank closure grouts using a dilute salt solution. The leaching results show that, in the presence of concentrated salt solutions such as those that will be processed at the Saltstone Production Facility, blast furnace slag can effectively reduce pertechnetate to the immobile +4 oxidation state. Leaching tests were also initiated to determine the degree of immobilization of selenium in the Saltstone waste form. Results were obtained for the upper bound of projected selenium concentration (∼5 x 10 -3 M) in the salt solution that will be treated at Saltstone. The ANSI/ANS 16.1 leaching tests provided a value for the effective diffusivity of ∼5 x 10
DEFF Research Database (Denmark)
Kjellsson, Gøsta; Strandberg, Morten Tune
2012-01-01
"DMU har modtaget og vurderet de supplerende oplysninger (mail fra Skov- og Naturstyrelsen d. 07-09-2004) til ansøgningen om tilladelse til markedsføring af genetisk modificeret majs C/DE/02/09 (MON863 og MON863 x MON810). Vi har gennemgået oplysningerne i det tilsendte materiale for at se om de ...
17 CFR 210.12-09 - Valuation and qualifying accounts.
2010-04-01
... period Column C—Additions (1)—Charged to costs and expenses (2)—Charged to other accounts—describe Column... qualifying accounts and reserves by descriptive title. Group (a) those valuation and qualifying accounts... accounts. 210.12-09 Section 210.12-09 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...
Energy Technology Data Exchange (ETDEWEB)
Dinamarca, Robinson [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile); Garcia, Ximena; Jimenez, Romel [Department of Chemical Engineering, Faculty of Engineering, University of Concepción, Concepción (Chile); Fierro, J.L.G. [Instituto de Catálisis y Petroleoquímica, CSIC, Cantoblanco, 28049 Madrid (Spain); Pecchi, Gina, E-mail: gpecchi@udec.cl [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile)
2016-09-15
Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La{sub 1-x}Ag{sub x}Mn{sub 0.9}Co{sub 0.1}O{sub 3}) and A-site deficient (La{sub 1-x}Mn{sub 0.9}Co{sub 0.1}O{sub 3-δ}) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O{sub 2}-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag{sub 2}O segregated phases and the redox pair Mn{sup 4+}/Mn{sup 3+}. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn{sup 4+}/Mn{sup 3+}, which is attributed to the cubic crystalline structure.
Energy Technology Data Exchange (ETDEWEB)
Singh, B.K.; Kumar, B. [Crystal Lab., Dept. of Physics and Astrophysics, University of Delhi (India)
2010-10-15
The electrical properties of Pb(Zn{sub 1/3} Nb{sub 2/3}){sub 0.91}Ti{sub 0.09}O{sub 3} single crystals over a wide range of frequencies (20 Hz to 2 MHz) and temperature (30 to 490 C) were studied using impedance spectroscopic technique. A strongly frequency dependant Debye type relaxation process in crystals was observed. The activation energy for relaxation was found to be 1.72 eV. The nature of Cole-Cole plot reveals the contribution of only grain (bulk) effect in the sample. The temperature dependant conductivity was found to different in different temperature regions, which shows the presence of different carrier for conduction. The activation energy for conduction in the order of 1.69 eV suggested that the conduction process in higher temperature region is governed by the presence of lead vacancy defect in the sample. Further, the negative temperature thermistor behaviour of the system was explored and various associated parameters were calculated. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Sein, Karin, 1974-
2010-01-01
Riigikohtu lahendist 3-2-1-98-09: A & M Invest OÜ kassatsioonkaebus Tallinna Ringkonnakohtu 30.03.2009. a otsusele A & M Invest OÜ hagis K. Radiku ja M. Radiku vastu hüvitise 1 950 946,70 krooni väljamõistmiseks
Cephradine as corrosion inhibitor for copper in 0.9% NaCl solution
Tasić, Žaklina Z.; Petrović Mihajlović, Marija B.; Radovanović, Milan B.; Simonović, Ana T.; Antonijević, Milan M.
2018-05-01
The effect of (6R,7R)-7-[[(2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetyl]amino]-3-methyl-8-oxo-5-thia-1-azobicyclo[4.2.0]oct-2-ene-2-carboxylic acid (cephradine) on corrosion behavior of copper in 0.9% NaCl solution was investigated. The electrochemical methods including the open circuit potential measurements, potentiodynamic polarization and electrochemical impedance spectroscopy measurements, scanning electron microscopy with energy dispersive X-ray spectroscopy and quantum chemical calculations were used for this investigation. According to the results obtained by potentiodynamic polarization, cephradine acts as mixed type inhibitor. Also, the results obtained by electrochemical impedance spectroscopy indicate that cephradine provides good copper protection in 0.9% NaCl solution. The inhibition efficiency of cephradine increases with increasing its concentration. The scanning electron microscopy with energy dispersive X-ray spectroscopy confirms that a protective layer is formed on the copper surface due to the adsorption of cephradine on the active sites on the copper surface. Adsorption of cephradine in 0.9% NaCl solution follows the Langmuir adsorption isotherm. Quantum chemical calculations are in agreement with results obtained by electrochemical measurements.
THE SUBLUMINOUS AND PECULIAR TYPE Ia SUPERNOVA PTF 09dav
International Nuclear Information System (INIS)
Sullivan, M.; Ofek, E. O.; Blake, S.; Podsiadlowski, P.; Kasliwal, M. M.; Cooke, J.; Quimby, R.; Kulkarni, S. R.; Nugent, P. E.; Thomas, R. C.; Poznanski, D.; Howell, D. A.; Arcavi, I.; Gal-Yam, A.; Hook, I. M.; Mazzali, P.; Bildsten, L.; Bloom, J. S.; Cenko, S. B.; Law, N.
2011-01-01
PTF 09dav is a peculiar subluminous Type Ia supernova (SN) discovered by the Palomar Transient Factory (PTF). Spectroscopically, it appears superficially similar to the class of subluminous SN1991bg-like SNe, but it has several unusual features which make it stand out from this population. Its peak luminosity is fainter than any previously discovered SN1991bg-like SN Ia (M B ∼ -15.5), but without the unusually red optical colors expected if the faint luminosity were due to extinction. The photospheric optical spectra have very unusual strong lines of Sc II and Mg I, with possible Sr II, together with stronger than average Ti II and low velocities of ∼6000 km s -1 . The host galaxy of PTF09dav is ambiguous. The SN lies either on the extreme outskirts (∼41 kpc) of a spiral galaxy or in an very faint (M R ≥ -12.8) dwarf galaxy, unlike other 1991bg-like SNe which are invariably associated with massive, old stellar populations. PTF 09dav is also an outlier on the light-curve-width-luminosity and color-luminosity relations derived for other subluminous SNe Ia. The inferred 56 Ni mass is small (0.019 ± 0.003 M sun ), as is the estimated ejecta mass of 0.36 M sun . Taken together, these properties make PTF 09dav a remarkable event. We discuss various physical models that could explain PTF 09dav. Helium shell detonation or deflagration on the surface of a CO white dwarf can explain some of the features of PTF 09dav, including the presence of Sc and the low photospheric velocities, but the observed Si and Mg are not predicted to be very abundant in these models. We conclude that no single model is currently capable of explaining all of the observed signatures of PTF 09dav.
Multifold polar states in Zn-doped Sr0.9Ba0.1TiO3 ceramics
Guo, Yan-Yan; Guo, Yun-Jun; Wei, Tong; Liu, Jun-Ming
2015-12-01
We investigate the effect of Zn doping on the dielectricity and ferroelectricity of a series of polycrystalline Sr0.9-xZnxBa0.1TiO3 (0.0% ≤ x ≤ 5.0%) ceramics. It is surprisingly observed that the Zn doping will produce the multifold polar states, i.e., the Zn-doped ceramic will convert a reduced polar state into an enhanced polar state, and eventually into a stabilized polar state with increasing the doping level x. It is revealed that in the background of quantum fluctuations, the competition between the Zn-doping-induced lattice contraction and the Ba-doping-induced lattice expansion is responsible for both the reduced polar state and the enhanced polar state coming into being. Also, the addition of the antiferrodistortive effect, which is the antipolar interaction originating from the opposite tilted-TiO6 octahedra rotation, represents the core physics behind the stabilized polar state. Project supported by the National Natural Science Foundation of China (Grant Nos. 11304158, 51431006, 51102277, and 11104118), the Scientific Research Foundation of Nanjing University of Posts and Telecommunications, China (Grant No. NY213020), and the Qing Lan Project of Jiangsu Province, China.
Observation of magnetization reversal behavior in Sm0.9Gd0.1Cr0.85Mn0.15O3 orthochromites
Panwar, Neeraj; Joby, Jostin P.; Kumar, Surendra; Coondoo, Indrani; Vasundhara, M.; Kumar, Nitu; Palai, Ratnakar; Singhal, Rahul; Katiyar, Ram S.
2018-05-01
Impact of co-doping (Gd and Mn) on the magnetic properties has been systematically investigated in SmCrO3 compound. For the synthesized compound Sm0.9Gd0.1Cr0.85Mn0.15O3 (SGCMO), below the Neel transition temperature and under low applied magnetic field, temperature induced magnetization reversal at 105 K (crossover temperature) was noticed in the field cooled magnetization curve. Magnetization reversal attained maximum value of -1.03 emu/g at 17 K where spin reorientation occurred. The magnetization reversal disappeared under higher applied field. From the M-H plots an enhancement in the magnetization was observed due to Gd doping. Magnetocaloric effect at low temperatures measured through the magnetic entropy change was found sixteen times higher for this compound as compared to pristine SmCrO3 and twice to that of SmCr0.85Mn0.15O3 compound. The study reveals the importance of co-doping in tailoring the magnetic properties of rare-earth chromites.
Vasylkiv, Oleg; Borodianska, Hanna; Badica, Petre; Zhen, Yongda; Tok, Alfred
2009-01-01
Four-cation nanograined strontium and magnesium doped lanthanum gallate (La0.8Sr0.2) (Ga0.9Mg0.1)O(3-delta) (LSGM) and its composite with 2 wt% of ceria (LSGM-Ce) were prepared. Morphologically homogeneous nanoreactors, i.e., complex intermediate metastable aggregates of desired composition were assembled by spray atomization technique, and subsequently loaded with nanoparticles of highly energetic C3H6N6O6. Rapid nanoblast calcination technique was applied and the final composition was synthesized within the preliminary localized volumes of each single nanoreactor on the first step of spark plasma treatment. Subsequent SPS consolidations of nanostructured extremely active LSGM and LSGM-Ce powders were achieved by rapid treatment under pressures of 90-110 MPa. This technique provided the heredity of the final structure of nanosize multimetal oxide, allowed the prevention of the uncontrolled agglomeration during multicomponent aggregates assembling, subsequent nanoblast calcination, and final ultra-rapid low-temperature SPS consolidation of nanostructured ceramics. LaSrGaMgCeO(3-delta) nanocrystalline powder consisting of approximately 11 nm crystallites was consolidated to LSGM-Ce nanoceramic with average grain size of approximately 14 nm by low-temperature SPS at 1250 degrees C. Our preliminary results indicate that nanostructured samples of (La0.8Sr0.2)(Ga0.9Mg0.1)O(3-delta) with 2 wt% of ceria composed of approximataley 14 nm grains can exhibit giant magnetoresistive effect in contrast to the usual paramagnetic properties measured on the samples with larger grain size.
Energy Technology Data Exchange (ETDEWEB)
Ghoudi, Hanen; Khirouni, Kamel [Universite de Gabes, Laboratoire de Physique des Materiaux et des Nanomateriaux Appliquee a l' Environnement (La Phy MNE), Faculte des Sciences de Gabes, Gabes (Tunisia); Chkoundali, Souad [Universite de Sfax, Laboratoire des Materiaux Multifonctionnels et Applications (LaMMA), Faculte des Sciences de Sfax (FSS), Sfax (Tunisia); Aydi, Abdelhedi [Universite de Gabes, Laboratoire de Physique des Materiaux et des Nanomateriaux Appliquee a l' Environnement (La Phy MNE), Faculte des Sciences de Gabes, Gabes (Tunisia); Universite de Sfax, Laboratoire des Materiaux Multifonctionnels et Applications (LaMMA), Faculte des Sciences de Sfax (FSS), Sfax (Tunisia)
2017-11-15
(Ba{sub 0.7}Sr{sub 0.3}){sub 1-x}Na{sub x}(Ti{sub 0.9}Sn{sub 0.1}){sub 1-x}Nb{sub x}O{sub 3} ceramics with compositions x = 0.6, 0.7, 0.8 and 0.9 were synthesized using the solid-state reaction method. These ceramics were examined by X-ray diffraction and dielectric measurements over a broad temperature and frequency ranges. X-ray diffraction patterns revealed a single-perovskite phase crystallized in a cubic structure, for x < 0.8, and in tetragonal, for x ≥ 0.8, with Pm3m and P4mm spaces groups, respectively. Two types of behaviors, classical ferroelectric or relaxor, were observed depending on the x composition. It is noted that temperatures T{sub C} (the Curie temperature) or T{sub m} (the temperature of maximum permittivity) rise when x increases and the relaxor character grows more significantly when x composition decreases. To analyze the dielectric relaxation degree of relaxor, various models were considered. It was proven that an exponential function could well describe the temperature dependence of the static dielectric constant and relaxation time. (orig.)
Equilibrium leaching of toxic elements from cement stabilized soil.
Voglar, Grega E; Leštan, Domen
2013-02-15
The toxicity characteristics leaching procedure (TCLP) is commonly used to assess the efficiency of solidification/stabilization (S/S) of pollutants in wastes, despite recent objections to this method. In this study, formulations of 7, 10, 15 and 20% (w/w) of calcium aluminate cement (CAC) and sulfate resistant Portland cement (SRC) were used for S/S of soil from brownfield contaminated with 43,149, 10,115, 7631, 6130, 90, 82 mg kg(-1) of Zn, Pb, Cu, As, Cd and Ni, respectively. CAC produced S/S soil monoliths of higher mechanical strength (up to 7.65 N mm(-2)). Mass-transfer analysis indicated surface wash-off as a mechanism of toxic elements release, and equilibrium leaching as a crucial parameter of S/S efficiency assessment. In the expected range of field soil pH after S/S (pH 7-9), the TCLP gave markedly different results than the multi-point pH equilibrium leaching method (using nine targeted pH values): up to 2953-, 94-, 483-, 1.3-, 27- and 1.5-times more Zn, Pb, Cu, As, Cd and Ni, respectively, was determined in the TCLP leachate. S/S with CAC reduced leachability of toxic elements more effectively than SRC. Our results indicate that, under given field conditions, the TCLP significantly underrates the efficiency of S/S of contaminated soil with cementitious binders. Copyright © 2012 Elsevier B.V. All rights reserved.
ALMA DEEP FIELD IN SSA22: A CONCENTRATION OF DUSTY STARBURSTS IN A z = 3.09 PROTOCLUSTER CORE
Energy Technology Data Exchange (ETDEWEB)
Umehata, H.; Ivison, R. J. [European Southern Observatory, Karl-Schwarzschild-Str. 2, D-85748 Garching (Germany); Tamura, Y.; Kohno, K.; Izumi, T.; Makiya, R. [Institute of Astronomy, School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Alexander, D. M.; Smail, I. [Centre for Extragalactic Astronomy, Department of Physics, Durham University, South Road, Durham DH1 3LE (United Kingdom); Geach, J. E. [Centre for Astrophysics Research, Science and Technology Research Institute, University of Hertfordshire, Hatfield AL10 9AB (United Kingdom); Hatsukade, B.; Kato, Y.; Kawabe, R.; Lee, M.; Matsuda, Y.; Nakanishi, K.; Saito, T. [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Hughes, D. H. [Department of astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Ikarashi, S. [Kapteyn Astronomical Institute, University of Groningen, P.O. Box 800, 9700AV Groningen (Netherlands); Kubo, M. [Institute for Cosmic Ray Research, University of Tokyo, 5-1-5 Kashiwa-no-Ha, Kashiwa City, Chiba 277-8582 (Japan); Lehmer, B., E-mail: humehata@eso.org [Department of Physics, University of Arkansas, 226 Physics Building, 835 West Dickson Street, Fayetteville, AR 72701 (United States); and others
2015-12-10
We report the results of 1.′5 × 3′ mapping at 1.1 mm with the Atacama Large Millimeter/submillimeter Array toward the central region of the z = 3.09 SSA22 protocluster. By combining our source catalog with archival spectroscopic redshifts, we find that eight submillimeter galaxies (SMGs) with flux densities, S{sub 1.1} {sub mm} = 0.7–6.4 mJy (L{sub IR} ∼ 10{sup 12.1}–10{sup 13.1} L{sub ⊙}) are at z = 3.08–3.10. Not only are these SMGs members of the protocluster, but they in fact reside within the node at the junction of the 50 Mpc scale filamentary three-dimensional structure traced by Lyα emitters in this field. The eight SMGs account for a star formation rate density (SFRD) ∼10 M{sub ⊙} yr{sup −1} Mpc{sup −3} in the node, which is two orders of magnitudes higher than the global SFRD at this redshift. We find that four of the eight SMGs host an X-ray-luminous active galactic nucleus. Our results suggest that the vigorous star formation activity and the growth of supermassive black holes (SMBHs) occurred simultaneously in the densest regions at z ∼ 3, which may correspond to the most active historical phase of the massive galaxy population found in the core of the clusters in the present universe. Two SMGs are associated with Lyα blobs, implying that the two populations coexist in high-density environments for a few cases.
4U 1907+09: an HMXB running away from the Galactic plane
Gvaramadze, V. V.; Röser, S.; Scholz, R.-D.; Schilbach, E.
2011-05-01
We report the discovery of a bow shock around the high-mass X-ray binary (HMXB) 4U 1907+09 using the Spitzer Space Telescope 24 μm data (after Vela X-1 the second example of bow shocks associated with HMXBs). The detection of the bow shock implies that 4U 1907+09 is moving through space with a high (supersonic) peculiar velocity. To confirm the runaway nature of 4U 1907+09, we measured its proper motion, which for an adopted distance to the system of 4 kpc corresponds to a peculiar transverse velocity of ≃ 160 ± 115 km s-1, meaning that 4U 1907+09 is indeed a runaway system. This also supports the general belief that most HMXBs possess high space velocities. The direction of motion of 4U 1907+09 inferred from the proper motion measurement is consistent with the orientation of the symmetry axis of the bow shock, and shows that the HMXB is running away from the Galactic plane. We also present the Spitzer images of the bow shock around Vela X-1 (a system similar to 4U 1907+09) and compare it with the bow shock generated by 4U 1907+09.
46 CFR 42.09-35 - Additional survey requirements for wood-hull vessels.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Additional survey requirements for wood-hull vessels. 42.09-35 Section 42.09-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES... Additional survey requirements for wood-hull vessels. (a) In addition to the requirements in § 42.09-25, the...
Stabilization/solidification of selenium-impacted soils using Portland cement and cement kiln dust.
Moon, Deok Hyun; Grubb, Dennis G; Reilly, Trevor L
2009-09-15
Stabilization/solidification (S/S) processes were utilized to immobilize selenium (Se) as selenite (SeO(3)(2-)) and selenate (SeO(4)(2-)). Artificially contaminated soils were prepared by individually spiking kaolinite, montmorillonite and dredged material (DM; an organic silt) with 1000 mg/kg of each selenium compound. After mellowing for 7 days, the Se-impacted soils were each stabilized with 5, 10 and 15% Type I/II Portland cement (P) and cement kiln dust (C) and then were cured for 7 and 28 days. The toxicity characteristic leaching procedure (TCLP) was used to evaluate the effectiveness of the S/S treatments. At 28 days curing, P doses of 10 and 15% produced five out of six TCLP-Se(IV) concentrations below 10mg/L, whereas only the 15% C in DM had a TCLP-Se(IV) concentration soil-cement slurries aged for 30 days enabled the identification of Se precipitates by X-ray powder diffraction (XRD) and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX). XRD and SEM-EDX analyses of the Se(IV)- and Se(VI)-soil-cement slurries revealed that the key selenium bearing phases for all three soil-cement slurries were calcium selenite hydrate (CaSeO(3).H(2)O) and selenate substituted ettringite (Ca(6)Al(2)(SeO(4))(3)(OH)(12).26H(2)O), respectively.
Profile of yttrium segregation in BaCe0,9Y0,1O3-δ as function of sintering temperature
International Nuclear Information System (INIS)
Hosken, C.M.; Souza, D.P.F. de
2010-01-01
Researches on solid oxide fuel cells indicate barium cerate perovskite as a very attractive material for using as electrolyte due to its high protonic conductivity. The objective of this work is investigate the yttrium segregation during sintering of BaCe 0,9 Y 0,1 O 3-δ doped with Zn O as a sintering aid. The powders were prepared by citrate process. Powders were isostatic pressed into pellets and sintered in air at 1200, 1275, 1325 and 1400 deg C. The samples were characterized by scanning electron microscopy, X-ray diffraction and impedance spectroscopy. Secondary phase containing Yttrium and Cerium was detected as sintering temperature increased. Increase of the lattice parameter and activation energy for electrical conductivity were also detected on samples sintered at 1400 deg C. (author)
Hong Kong domestic health spending: financial years 1989/90 to 2008/09.
Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V
2012-08-01
This report presents the latest estimates of Hong Kong domestic health spending for financial years 1989/90 to 2008/09, cross-stratified and categorised by financing source, provider and function. Total expenditure on health (TEH) was HK$84,391 million in financial year 2008/09, which represents an increase of HK$5030 million or 6.3% over the preceding year. Amid the financial tsunami in late 2008, TEH grew faster relative to gross domestic product (GDP) leading to a marked increase as a percentage of GDP from 4.8% in 2007/08 to 5.1% in 2008/09. During the period 1989/90 to 2008/09, TEH per capita (at constant 2009 prices) grew at an average annual rate of 4.9%, which was faster than that of per capita GDP by 2.0 percentage points. 6.4% when compared with 2007/08, reaching HK$41 257 million and HK$43 134 million, respectively. Consequently, public and private shares of total health expenditure remained the same in the 2 years at 48.9% and 51.1%, respectively. Regarding private spending, the most important source of health financing was out-of-pocket payments by households (35.4% of TEH), followed by employer-provided group medical benefits (7.5%) and private insurance (6.4%). During the period, a growing number of households (mostly in middle to high-income groups) subscribed to pre-payment plans for financing health care. As such, private insurance has taken on an increasingly important role for financing private spending. Of the HK$84 391 million total health expenditure in 2008/09, current expenditure comprised HK$81 186 million (96.2%), whereas HK$3206 million (3.8%) was for capital expenses (ie investment in medical facilities). Analysed by health care function, services for curative care accounted for the largest share of total health spending (66.1%), which was made up of ambulatory services (32.8%), in-patient curative care (28.8%), day patient hospital services (3.9%) and home care (0.5%). Notwithstanding the small share of total spending for day patient
Facilities Performance Indicators Report, 2008-09
Hills, Christina, Ed.
2010-01-01
This paper features another expanded Web-based Facilities Performance Indicators Report (FPI). The purpose of APPA's Facilities Performance Indicators is to provide a representative set of statistics about facilities in educational institutions. The 2008-09 iteration of the Web-based Facilities Performance Indicators Survey was posted and…
International Nuclear Information System (INIS)
Gao, Ning; Quan, Chuye; Ma, Yuhui; Han, Yumin; Wu, Zhenli; Mao, Weiwei
2016-01-01
We propose first-principles methods to study the structure, electronic, optical and magnetic properties of BiFeO 3 (BFO) and Bi 0.9 Ca 0.1 FeO 3 (BCFO). The morphology, optical band gap as well as magnetic hysteresis also have been investigated using experimental methods. X-ray diffraction data shows that Bi-site doping with Ca could result in a transition of crystal structure (from single phase rhombohedral (R3c) to two phase coexistence). Changing of Fermi level and decreasing of band gap indicating that the Ca-doped BFO exhibit a typical half-metallic nature. The optical absorption properties are related to the electronic structure and play the key role in determining their band gaps, also we have analyzed the inter-band contribution to the theory of optical properties such as absorption spectra, dielectric constant, energy-loss spectrum, absorption coefficient, optical reflectivity, and refractive index of BCFO. Enhancement of magnetic properties after doping is proved by both experimental and calculated result, which can be explained by size effect and structural distortion.
Effect of thermal aging on the low cycle fatigue behavior of Z3CN20.09M cast duplex stainless steel
Energy Technology Data Exchange (ETDEWEB)
Chen, Weifeng [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Xue, Fei [Suzhou Nuclear Power Research Institute, Suzhou 215004 (China); Tian, Yang [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Yu, Dunji, E-mail: djyu@tju.edu.cn [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Yu, Weiwei [Suzhou Nuclear Power Research Institute, Suzhou 215004 (China); Chen, Xu [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China)
2015-10-14
Nuclear grade Z3CN20.09M cast duplex stainless steel exhibits enhanced cyclic stress response and prolonged low cycle fatigue life at room temperature after thermal aging at 400 °C for up to 6000 h. The threshold strain amplitude for the onset of secondary hardening is shifted to a lower value after thermal aging. Microstructural observations reveal that fatigue cracks tend to initiate from phase boundaries in virgin specimens, but to initiate in the ferrite phase in aged ones. Denser fatigue striations are found on the fracture surface of fatigued specimen subjected to longer thermal aging duration. These observations are explained in the context of thermal aging induced embrittlement of the ferrite phase and deformation induced martensitic phase transformation in the austenite phase.
Radon measurements at IC-09 well of Chingshui geothermal field (Taiwan): A case study
International Nuclear Information System (INIS)
Chen, Y.; Kuo, T.; Fan, K.; Liang, H.; Tsai, C.; Chiang, C.; Su, C.
2011-01-01
Radon concentration was monitored during the flow tests of well IC-09 at the Chingshui geothermal field. The radon concentration was found to increase from 54 ± 29 to 983 ± 65 Bq/m 3 as a step function of production time, or cumulative production. The observed radon behavior can be explained by a radial composite model with the carbonate scales deposited in the skin zone near the well. The radius of skin zone near well IC-09 can be estimated with radon data at about 20 m using a plug flow model. Monitoring natural radon during the well flow tests is a helpful tracer to diagnose the formation damage near the well.
Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09.
Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming
2014-11-01
Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.
Zhu, Liang; Liu, Yu; Su, Chao; Zhou, Wei; Liu, Meilin; Shao, Zongping
2016-08-08
We have synthesized and characterized perovskite-type SrCo0.9 Nb0.1 O3-δ (SCN) as a novel anion-intercalated electrode material for supercapacitors in an aqueous KOH electrolyte, demonstrating a very high volumetric capacitance of about 2034.6 F cm(-3) (and gravimetric capacitance of ca. 773.6 F g(-1) ) at a current density of 0.5 A g(-1) while maintaining excellent cycling stability with a capacity retention of 95.7 % after 3000 cycles. When coupled with an activated carbon (AC) electrode, the SCN/AC asymmetric supercapacitor delivered a specific energy density as high as 37.6 Wh kg(-1) with robust long-term stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Barcelona - Talent Latent 09 / Ahto Sooaru
Sooaru, Ahto
2010-01-01
Fotonäitusest "Talent Latent 09" Barcelonas Arts Santa Monica kunstikeskuses. Loetletud näitusel eksponeeritud fotode autorid. Pikemalt Rafael Milach'i (sünd. 1978), Lucia Ganieva, Javier Marquerie Thomas'i (sünd. 1986), Amaury da Cunha (sünd. 1976) töödest. Lühidalt ka teistest näitustest Arts Santa Monica kunstikeskuses
Statistical experimental design for saltstone mixtures
International Nuclear Information System (INIS)
Harris, S.P.; Postles, R.L.
1991-01-01
We used a mixture experimental design for determining a window of operability for a process at the Savannah River Site Defense Waste Processing Facility (DWPF). The high-level radioactive waste at the Savannah River Site is stored in large underground carbon steel tanks. The waste consists of a supernate layer and a sludge layer. 137 Cs will be removed from the supernate by precipitation and filtration. After further processing, the supernate layer will be fixed as a grout for disposal in concrete vaults. The remaining precipitate will be processed at the DWPF with treated waste tank sludge and glass-making chemicals into borosilicate glass. The leach rate properties of the supernate grout, formed from various mixes of solidified salt waste, needed to be determined. The effective diffusion coefficients for NO 3 and Cr were used as a measure of leach rate. Various mixes of cement, Ca(OH) 2 , salt, slag and flyash were used. These constituents comprise the whole mix. Thus, a mixture experimental design was used
Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A
2006-03-01
Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.
Disposal of decontaminated salts at the Savannah River Plant by solidification and burial
International Nuclear Information System (INIS)
Dukes, M.D.; Wolf, H.C.; Langton, C.A.
1983-01-01
The current plan for disposal of waste salt at the Savannah River Plant (SRP) is to immobilize the decontaminated salt solution by mixing with cement and SRP soil, and bury the resulting grout (saltstone) in a landfill. The grout which contains 37.8 wt % salt solution, 22.8 wt % Portland I-P cement, and 39.2 wt % SRP soil, was specially formulated to have a low permeability ( -10 cm/sec). This material will be mixed and placed in trenches. After setting, the saltstone will be covered with a clay cap, and an overburden of compacted native soil will be replaced. 6 references
Residual mercury content and leaching of mercury and silver from used amalgam capsules.
Stone, M E; Pederson, E D; Cohen, M E; Ragain, J C; Karaway, R S; Auxer, R A; Saluta, A R
2002-06-01
The objective of this investigation was to carry out residual mercury (Hg) determinations and toxicity characteristic leaching procedure (TCLP) analysis of used amalgam capsules. For residual Hg analysis, 25 capsules (20 capsules for one brand) from each of 10 different brands of amalgam were analyzed. Total residual Hg levels per capsule were determined using United States Environmental Protection Agency (USEPA) Method 7471. For TCLP analysis, 25 amalgam capsules for each of 10 brands were extracted using a modification of USEPA Method 1311. Hg analysis of the TCLP extracts was done with USEPA Method 7470A. Analysis of silver (Ag) concentrations in the TCLP extract was done with USEPA Method 6010B. Analysis of the residual Hg data resulted in the segregation of brands into three groups: Dispersalloy capsules, Group A, retained the most Hg (1.225 mg/capsule). These capsules were the only ones to include a pestle. Group B capsules, Valliant PhD, Optaloy II, Megalloy and Valliant Snap Set, retained the next highest amount of Hg (0.534-0.770 mg/capsule), and were characterized by a groove in the inside of the capsule. Group C, Tytin regular set double-spill, Tytin FC, Contour, Sybraloy regular set, and Tytin regular set single-spill retained the least amount of Hg (0.125-0.266 mg/capsule). TCLP analysis of the triturated capsules showed Sybraloy and Contour leached Hg at greater than the 0.2 mg/l Resource Conservation and Recovery Act (RCRA) limit. This study demonstrated that residual mercury may be related to capsule design features and that TCLP extracts from these capsules could, in some brands, exceed RCRA Hg limits, making their disposal problematic. At current RCRA limits, the leaching of Ag is not a problem.
Elkind, Elina, 1982-
2009-01-01
Riigikohtu lahendist 3-1-1-36-09: Nikolai Galkovski kaitsja vandeadvokaat Anatoli Jaroslavski, Andrei Grišini kaitsja vandeadvokaat Leonid Olovjanišnikovi, Aleksandr Semjonovi kaitsja vandeadvokaat Oleg Nišajevi ja Dmitri Štšerbakovi kaitsja vandeadvokaat Toomas Alpi kassatsioonid Tallinna Ringkonnakohtu 24. novembri 2008. a kohtuotsuse peale kriminaalasjas Andrei Grišini süüdistuses KarS § 114 p-de 2, 3 ja 5 ja § 22 lg-te 2 ja 3, Dmitri Štšerbakovi süüdistuses KarS § 114 p-de 2, 3 ja 5, Aleksandr Semjonovi süüdistuses KarS § 114 p-de 2, 3 ja 5 ning Nikolai Galkovski süüdistuses KarS § 257, § 114 p-de 2, 3 ja 5 ja § 22 lg 3 järgi
Akdogan, E. K.; Hall, A.; Simon, W. K.; Safari, A.
2007-01-01
We investigate the nonlinear dielectric properties of 0.9Pb(Mg1/3,Nb2/3)O3•0.1PbTiO3 (PMN-PT) and Ba[Ti0.85,Sn0.15]O3 (BTS) paraelectrics experimentally and theoretically. We measure the nonlinear dielectric response in the parallel plate capacitor configuration, whereby we obtain the low frequency linear permittivity (ε33), and the higher order permittivities (ε3333,ε333333) at 298K as ε33PMN-PT=2.1×10-7 and ε33BTS=4.1×10-8F /m, ε3333PMN-PT=-4.9×10-20 and ε3333BTS=-7.3×10-21F3m /C2, and ε333333PMN-PT=7.6×10-33 and ε333333BTS=9.85×10-34F5m3/C4. By using a self-consistent thermodynamic theory in conjunction with the experimental data, we compute the E3 dependence of electrostatic free energy ΔG, the field-induced polarization P3, and the thermodynamic tunability ∂2P3/∂E32, and prove that electrostatic free energy has to be expanded at least up to the sixth order in the electric field to define the critical field ∣E3*∣ at which maximum tunability is attained. We also show that ∣E3*∣ is a function on ∣ε3333∣/ε333333 only. Consequently, we find ∣E3*∣PMN-PT=8.0×105V /m and ∣E3*∣BTS=8.6×105V/m. We compute the engineering tunabilities as ΓPMN-PT=65% and ΓBTS=55%, and then define a normalized tunability ξ to take into account the ∣E3*∣ parameter. Thereof, we determine ∣ξ ∣PMT-PT=8.1×10-5%/Vm-1 and ∣ξ∣BTS=6.4×10-5%/Vm-1. Our results reveal that ∣E3*∣BTS>∣E3*∣PMN-PT although ΓBTS<ΓPMN-PT, unequivocally showing the need for defining a critical field parameter in evaluating the nonlinear dielectric response and tunability, in particular, and in nonlinear dielectrics in general. The results also indicate that the nonlinear dielectric properties of PMN-PT are an order of magnitude higher than that of BTS, which we discuss in the context of structure-property relations of relaxors.
Energy Technology Data Exchange (ETDEWEB)
Hosken, C.M.; Souza, D.P.F. de, E-mail: camila.hosken@gmail.co [Universidade Federal de Sao Carlos (LAPCEC/UFSCar), SP (Brazil). Programa de Pos-Graduacao em Ciencia e Engenharia de Materiais. Lab. de Preparacao e Caracterizacao Eletrica em Ceramicas
2010-07-01
Researches on solid oxide fuel cells indicate barium cerate perovskite as a very attractive material for using as electrolyte due to its high protonic conductivity. The objective of this work is investigate the yttrium segregation during sintering of BaCe{sub 0,9}Y{sub 0,1}O{sub 3-{delta}} doped with Zn O as a sintering aid. The powders were prepared by citrate process. Powders were isostatic pressed into pellets and sintered in air at 1200, 1275, 1325 and 1400 deg C. The samples were characterized by scanning electron microscopy, X-ray diffraction and impedance spectroscopy. Secondary phase containing Yttrium and Cerium was detected as sintering temperature increased. Increase of the lattice parameter and activation energy for electrical conductivity were also detected on samples sintered at 1400 deg C. (author)
W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell
2007-01-01
textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we
Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.
Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that
Unigene BLAST: CBRC-GGAL-09-0012 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GGAL-09-0012 gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken liver cDNA library Gallus gallus cDNA clone pnl...1s.pk003.f8 5' similar to histidine-rich glycoprotein - bovine (fragments), mRNA sequence /clone=pnl
Energy Technology Data Exchange (ETDEWEB)
Giubileo, F. [CNR-INFM Laboratorio Regionale SUPERMAT e Dipartimento di Fisica ' E.R. Caianiello' , Universita degli Studi di Salerno, via Salvador Allende, 84081 Baronissi (Italy)], E-mail: giubileo@sa.infn.it; Bobba, F.; Scarfato, A. [CNR-INFM Laboratorio Regionale SUPERMAT e Dipartimento di Fisica ' E.R. Caianiello' , Universita degli Studi di Salerno, via Salvador Allende, 84081 Baronissi (Italy); Roditchev, D. [Institut des Nanosciences de Paris, INSP, Universite P. et M.Curie Paris 6, CNRS, UMR 75-88, Paris (France); Zhigadlo, N.; Karpinski, J. [Solid State Physics Laboratory, ETH Zurich, CH-8093 Zurich (Switzerland); Cucolo, A.M. [CNR-INFM Laboratorio Regionale SUPERMAT e Dipartimento di Fisica ' E.R. Caianiello' , Universita degli Studi di Salerno, via Salvador Allende, 84081 Baronissi (Italy)
2007-09-01
We have performed I(V) and dI/dV(V) measurements on high quality Mg{sub 0.9}Al{sub 0.1}B{sub 2} single crystals by means of a variable temperature scanning tunneling spectroscopy (STS) working in magnetic field up to 7 T. c-axis tunneling showed a single gap, probing the three-dimensional Dp that appeared highly non-homogeneous in its spatial distribution on nanometer scale, with an amplitude between 1.5 meV and 2.3 meV. Temperature and magnetic field dependence of the conductance spectra were studied in S-I-N configuration as well as in S-I-S configuration, after pushing the Pt/Ir tip in the sample to capture a superconducting grain at the very apex of the tip. For the largest energy gap (2.3 meV), we found H{sub c2} {approx} 3 T, i.e., a 25% raising with respect to what observed in the pure crystal.
ChemSession'09 - 6. Warsaw Seminar of the PhD Students in Chemistry - Abstracts
International Nuclear Information System (INIS)
2009-01-01
Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6 th Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found
Emergence of influenza A (H1N1) PDM09 in the remote Islands of India--a molecular approach.
Muruganandam, N; Bhattacharya, D; Chaaithanya, I K; Bhattacharya, H; Reesu, R; Maile, A; Bharathi, G S J; Sugunan, A P; Vijayachari, P
2015-01-01
A disease outbreak of A (H1N1) PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1) PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1) PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1) PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1) PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. A (H1N1) PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
DEFF Research Database (Denmark)
Yap, Emily W.; Glaum, Julia; Oddershede, Jette
2018-01-01
The ferroelectric and piezoelectric properties of (Ba0.85Ca0.15)(Zr0.1Ti0.9)O3 (BCZT) ceramics were measured as a function of porosity. Porous BCZT ceramics were fabricated using the sacrificial fugitive technique. Two different pore morphologies were induced by adding polymeric microspheres...... and fibres as the pore-forming agents. Increasing porosity led to decreasing ferroelectric and piezoelectric properties due to a reduction of polarisable BCZT ceramic available. With the benefit of being a lead-free piezoelectric material, porous BCZT ceramics may be considered for acoustic impedance...
Energy Technology Data Exchange (ETDEWEB)
Wei, Maocai; Liu, Meifeng; Wang, Xiuzhang [Hubei Normal University, Institute for Advanced Materials, and School of Physics and Electronic Science, Huangshi (China); Li, Meiya; Zhu, Yongdan; Zhao, Meng; Zhang, Feng; Xie, Shuai [Wuhan University, School of Physics and Technology, and Key Laboratory of Artificial Micro/Nano Structures of the Ministry of Education, Wuhan (China); Hu, Zhongqiang [Northeastern University, Department of Electrical and Computer Engineering, Boston, MA (United States); Liu, Jun-Ming [Nanjing University, Laboratory of Solid State Microstructures, Nanjing (China)
2017-03-15
Epitaxial Bi{sub 0.9}Eu{sub 0.1}FeO{sub 3} (BEFO) thin films are deposited on Nb-doped SrTiO{sub 3} (NSTO) substrates by pulsed laser deposition to fabricate the Pt/BEFO/NSTO (001) heterostructures. These heterostructures possess bipolar resistive switching, where the resistances versus writing voltage exhibits a distinct hysteresis loop and a memristive behavior with good retention and anti-fatigue characteristics. The local resistive switching is confirmed by the conductive atomic force microscopy (C-AFM), suggesting the possibility to scale down the memory cell size. The observed memristive behavior could be attributed to the ferroelectric polarization effect, which modulates the height of potential barrier and width of depletion region at the BEFO/NSTO interface. The continuously tunable resistive switching behavior could be useful to achieve non-volatile, high-density, multilevel random access memory with low energy consumption. (orig.)
Statistical experimental design for saltstone mixtures
International Nuclear Information System (INIS)
Harris, S.P.; Postles, R.L.
1992-01-01
The authors used a mixture experimental design for determining a window of operability for a process at the U.S. Department of Energy, Savannah River Site, Defense Waste Processing Facility (DWPF). The high-level radioactive waste at the Savannah River Site is stored in large underground carbon steel tanks. The waste consists of a supernate layer and a sludge layer. Cesium-137 will be removed from the supernate by precipitation and filtration. After further processing, the supernate layer will be fixed as a grout for disposal in concrete vaults. The remaining precipitate will be processed at the DWPF with treated waste tank sludge and glass-making chemicals into borosilicate glass. The leach-rate properties of the supernate grout formed from various mixes of solidified coefficients for NO 3 and chromium were used as a measure of leach rate. Various mixes of cement, Ca(OH) 2 , salt, slag, and fly ash were used. These constituents comprise the whole mix. Thus, a mixture experimental design was used. The regression procedure (PROC REG) in SAS was used to produce analysis of variance (ANOVA) statistics. In addition, detailed model diagnostics are readily available for identifying suspicious observations. For convenience, trillinear contour (TLC) plots, a standard graphics tool for examining mixture response surfaces, of the fitted model were produced using ECHIP
Bacillus velezensis CC09: A Potential 'Vaccine' for Controlling Wheat Diseases.
Kang, Xingxing; Zhang, Wanling; Cai, Xunchao; Zhu, Tong; Xue, Yarong; Liu, Changhong
2018-04-11
Biocontrol bacteria that can act like a "vaccine", stimulating plant resistance to pathogenic diseases, are still not fully elucidated. In this study, an endophytic bacterium, Bacillus velezensis CC09, labeled with green fluorescent protein, was tested for its colonization, migration, and expression of genes encoding iturin A synthetase within wheat tissues and organs as well as for protective effects against wheat take-all and spot blotch diseases. The results showed that strain CC09 not only formed biofilm on the root surface but was also widely distributed in almost every tissue, including the epidermis, cortex, and xylem vessels, and even migrated to stems and leaves, resulting in 66.67% disease-control efficacy (DCE) of take-all and 21.64% DCE of spot blotch. Moreover, the gene cluster encoding iturin A synthase under the control of the p itu promoter is expressed in B. velezensis CC09 in wheat tissues, which indicates that iturin A might contribute to the in-vivo antifungal activity and leads to the disease control. All these data suggested that strain CC09 can act like a 'vaccine' in the control of wheat diseases, with a single treatment inoculated on roots through multiple mechanisms.
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09
Energy Technology Data Exchange (ETDEWEB)
Gustafsson, Jaana; Gustafsson, Christer (Malaa Geoscience AB (Sweden))
2010-01-15
This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09
International Nuclear Information System (INIS)
Gustafsson, Jaana; Gustafsson, Christer
2010-01-01
This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
Directory of Open Access Journals (Sweden)
Pool Marcos
Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.
Annual North Dakota Elevator Marketing Report, 2008-09
2009-12-01
The Annual North Dakota Elevator Marketing Report for 2008-09 was prepared by Kimberly Vachal and Laurel Benson, : Upper Great Plains Transportation Institute. The authors gratefully acknowledge the assistance of the North Dakota : Grain Dealers Asso...
Clark, Josh
2009-01-01
With iWork '09: The Missing Manual, you'll quickly learn everything you need to know about Apple's incredible productivity programs, including the Pages word-processor, the Numbers spreadsheet, and the Keynote presentation program that Al Gore and Steve Jobs made famous. This book gives you crystal-clear and jargon-free explanations of iWork's capabilities, advantages, and limitations to help you produce stunning documents and cinema-quality digital presentations in no time.
Directory of Open Access Journals (Sweden)
H. H. Yu
2016-10-01
Full Text Available Hollow spheres structures of La0.7Sr0.2Ca0.1Co0.9Fe0.1O3–δ (LSCCT have been synthesized via hydrothermal method using carbon spheres as template. The structure and electrical conductivity of obtained samples are characterized by X-ray diffraction (XRD, scanning electron microscope (SEM, transmission electron microscope (TEM and direct current (DC four-probe method respectively. The results show that hollow spheres structures of LSCCT with the mean particle size of 0,9 - 1,2 μm is single perovskite. The electrical conductivity of the samples is higher than 100 S/cm from 600 to 800 ℃ and can meet the demand of the electrical properties for the cathode materials.
Emergence of influenza A (H1N1 PDM09 in the remote Islands of India - A molecular approach
Directory of Open Access Journals (Sweden)
N Muruganandam
2015-01-01
Full Text Available Background: A disease outbreak of A (H1N1 PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1 PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. Materials and Methods: During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1 PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Result: Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1 PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1 PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. Conclusion: A (H1N1 PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
Sharma, Sarita; Sharma, Hakikat; Negi, N. S.
2018-05-01
Lead free Ba0.85Ca0.15Zr0.1Ti0.9O3(BCTZ) ceramic has been synthesized by sol-gel method. Properties of material are studied at different sintering temperatures for 5 hours. Structural and microstructural properties are analyzed by using X-ray diffractrometer (XRD) and scanning electron microscopy (SEM) at annealing temperature of 850°C and 1050°C XRD pattern confirm the perovskite structure of the material without any unwanted phases crystalinity increased with increase of sintering temperature so as roughness and porosity is decreased as shown by SEM micrographs. There is large improvement in density with rise of sintering temperature which also leads to drastic change in ferroelectric and dielectric properties.
Yingmin Zhu; Haijun Chen; Stephen Boulton; Fang Mei; Na Ye; Giuseppe Melacini; Jia Zhou; Xiaodong Cheng
2015-01-01
The cAMP signaling cascade is one of the most frequently targeted pathways for the development of pharmaceutics. A plethora of recent genetic and pharmacological studies suggest that exchange proteins directly activated by cAMP (EPACs) are implicated in multiple pathologies. Selective EPAC inhibitors have been recently developed. One specific inhibitor, ESI-09, has been shown to block EPAC activity and functions, as well as to recapitulate genetic phenotypes of EPAC knockout mice when applied...
17 CFR 8.09 - Review of investigation report.
2010-04-01
... PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.09 Review of investigation report. The disciplinary committee shall promptly review each investigation report. In the event the disciplinary committee determines that additional investigation or evidence is needed, it shall...
Cai, Xun-Chao; Liu, Chang-Hong; Wang, Bao-Tong; Xue, Ya-Rong
2017-03-01
Bacillus velezensis CC09, which was isolated from healthy leaves of Cinnamomum camphora and previously identified as Bacillus amyloliquefaciens CC09, shows great potential as a new biocontrol agent, in control of many phytopathogenic diseases. To extend our understanding of the potential antifungal capacities, we did a whole genome analysis of strain CC09. Result shows that strain CC09 has a relatively large genome size (4.17Mb) with an average GC content of 46.1%, and 4021 predicted genes. Thirteen secondary metabolites encoding clusters have been identified within the genome of B. velezensis CC09 using genome mining technique. Data of comparative genomic analysis indicated that 3 of the clusters are conserved by all strains of B. velezensis, B. amyloliquefaciens and B. subtilis 168, 9 by B. velezensis and B. amyloliquefaciens, and 2 by all strains of B. velezensis. Another 2 clusters encoding NRPS (Non-Ribosomal Peptide Synthetases) and NRPS-TransATPKS (NRPS and trans-Acyl Transferase Polyketide Synthetases) respectively are observed only in 15 B. velezensis strains, which might lead to the synthesis of novel bioactive compounds and could be explored as antimicrobial agents in the future. These clusters endow B. velezensis CC09 with strong and broad antimicrobial activities, for example, in control of wheat powdery mildew disease. Moreover, our data further confirmed the taxonomy of strain CC09 is a member of B. velezensis rather than a strain of B. amyloliquefaciens based on core genome sequence analysis using phylogenomic approach. Copyright © 2016 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Ze-Qing Guo
2017-02-01
Full Text Available TiO2-Na0.9Mg0.45Ti3.55O8 (TiO2-NMTO nanocomposites were synthesized via a simple hydrothermal method. TiO2 nanoparticles were loaded on NMTO nanosheets with well matched lattices. The TiO2-NMTO nanoheterojunctions enjoyed high photodegradative ability for a RhB pollutant. The photoinduced electron-hole pairs were separated effectively by the TiO2-NMTO nanoheterojunctions, which were directly observed by surface potential measurements with a scanning Kelvin probe microscopy. The photogenerated electrons accumulate at interface due to the high density of interface states, and holes remain TiO2 and NMTO particles, other than they migrate from one part to another in heterojunctions by comparing the surface potentials under illumination with different wavelengths.
Acharya, S.; Adam, J.; Adamová, D.; Adolfsson, J.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmad, N.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Al-Turany, M.; Alam, S. N.; Alba, J. L. B.; Albuquerque, D. S. D.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altenkamper, L.; Altsybeev, I.; Alves Garcia Prado, C.; Andrei, C.; Andreou, D.; Andrews, H. A.; Andronic, A.; Anguelov, V.; Anson, C.; Antičić, T.; Antinori, F.; Antonioli, P.; Anwar, R.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalá, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Ball, M.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barioglio, L.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Batigne, G.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Beltran, L. G. E.; Belyaev, V.; Bencedi, G.; Beole, S.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, A.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biro, G.; Biswas, R.; Biswas, S.; Blair, J. T.; Blau, D.; Blume, C.; Boca, G.; Bock, F.; Bogdanov, A.; Boldizsár, L.; Bombara, M.; Bonomi, G.; Bonora, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Botta, E.; Bourjau, C.; Bratrud, L.; Braun-Munzinger, P.; Bregant, M.; Broker, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buhler, P.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Cabala, J.; Caffarri, D.; Caines, H.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Capon, A. A.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Ceballos Sanchez, C.; Cerello, P.; Chandra, S.; Chang, B.; Chapeland, S.; Chartier, M.; Chattopadhyay, S.; Chattopadhyay, S.; Chauvin, A.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, S.; Chochula, P.; Chojnacki, M.; Choudhury, S.; Chowdhury, T.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Concas, M.; Conesa Balbastre, G.; Conesa Del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Costanza, S.; Crkovská, J.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danisch, M. C.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; de, S.; de Caro, A.; de Cataldo, G.; de Conti, C.; de Cuveland, J.; de Falco, A.; de Gruttola, D.; De Marco, N.; de Pasquale, S.; de Souza, R. D.; Degenhardt, H. F.; Deisting, A.; Deloff, A.; Deplano, C.; Dhankher, P.; di Bari, D.; di Mauro, A.; di Nezza, P.; di Ruzza, B.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Doremalen, L. V. R.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Duggal, A. K.; Dukhishyam, M.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Endress, E.; Engel, H.; Epple, E.; Erazmus, B.; Erhardt, F.; Espagnon, B.; Esumi, S.; Eulisse, G.; Eum, J.; Evans, D.; Evdokimov, S.; Fabbietti, L.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Fernández Téllez, A.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Francisco, A.; Frankenfeld, U.; Fronze, G. G.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gajdosova, K.; Gallio, M.; Galvan, C. D.; Ganoti, P.; Garabatos, C.; Garcia-Solis, E.; Garg, K.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Gay Ducati, M. B.; Germain, M.; Ghosh, J.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Gomëz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, A. S.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Greiner, L.; Grelli, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Gronefeld, J. M.; Grosa, F.; Grosse-Oetringhaus, J. F.; Grosso, R.; Gruber, L.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Guzman, I. B.; Haake, R.; Hadjidakis, C.; Hamagaki, H.; Hamar, G.; Hamon, J. C.; Haque, M. R.; Harris, J. W.; Harton, A.; Hassan, H.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Hellbär, E.; Helstrup, H.; Herghelegiu, A.; Hernandez, E. G.; Herrera Corral, G.; Herrmann, F.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hills, C.; Hippolyte, B.; Hladky, J.; Hohlweger, B.; Horak, D.; Hornung, S.; Hosokawa, R.; Hristov, P.; Hughes, C.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Iga Buitron, S. A.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Islam, M. S.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacak, B.; Jacazio, N.; Jacobs, P. M.; Jadhav, M. B.; Jadlovsky, J.; Jaelani, S.; Jahnke, C.; Jakubowska, M. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jercic, M.; Jimenez Bustamante, R. T.; Jones, P. G.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karczmarczyk, P.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Ketzer, B.; Khabanova, Z.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Khatun, A.; Khuntia, A.; Kielbowicz, M. M.; Kileng, B.; Kim, B.; Kim, D.; Kim, D. J.; Kim, H.; Kim, J. S.; Kim, J.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobdaj, C.; Kofarago, M.; Köhler, M. K.; Kollegger, T.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Konyushikhin, M.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Kreis, L.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kundu, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lai, Y. S.; Lakomov, I.; Langoy, R.; Lapidus, K.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lavicka, R.; Lea, R.; Leardini, L.; Lee, S.; Lehas, F.; Lehner, S.; Lehrbach, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Lévai, P.; Li, X.; Lien, J.; Lietava, R.; Lim, B.; Lindal, S.; Lindenstruth, V.; Lindsay, S. W.; Lippmann, C.; Lisa, M. A.; Litichevskyi, V.; Llope, W. J.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Loncar, P.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Luhder, J. R.; Lunardon, M.; Luparello, G.; Lupi, M.; Lutz, T. H.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martinengo, P.; Martinez, J. A. L.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Masciocchi, S.; Masera, M.; Masoni, A.; Masson, E.; Mastroserio, A.; Mathis, A. M.; Matuoka, P. F. T.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzilli, M.; Mazzoni, M. A.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Mhlanga, S.; Miake, Y.; Mieskolainen, M. M.; Mihaylov, D. L.; Mikhaylov, K.; Milosevic, J.; Mischke, A.; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Khan, M. Mohisin; Moreira de Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Münning, K.; Munzer, R. H.; Murakami, H.; Murray, S.; Musa, L.; Musinsky, J.; Myers, C. J.; Myrcha, J. W.; Nag, D.; Naik, B.; Nair, R.; Nandi, B. K.; Nania, R.; Nappi, E.; Narayan, A.; Naru, M. U.; Natal da Luz, H.; Nattrass, C.; Navarro, S. R.; Nayak, K.; Nayak, R.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Negrao de Oliveira, R. A.; Nellen, L.; Nesbo, S. V.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Ohlson, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Oravec, M.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Pachmayer, Y.; Pacik, V.; Pagano, D.; Pagano, P.; Paić, G.; Palni, P.; Pan, J.; Pandey, A. K.; Panebianco, S.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.; Parmar, S.; Passfeld, A.; Pathak, S. P.; Patra, R. N.; Paul, B.; Pei, H.; Peitzmann, T.; Peng, X.; Pereira, L. G.; Pereira da Costa, H.; Peresunko, D.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Pezzi, R. P.; Piano, S.; Pikna, M.; Pillot, P.; Pimentel, L. O. D. L.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pliquett, F.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Poppenborg, H.; Porteboeuf-Houssais, S.; Pozdniakov, V.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Rana, D. B.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Ratza, V.; Ravasenga, I.; Read, K. F.; Redlich, K.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rodríguez Cahuantzi, M.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Rokita, P. S.; Ronchetti, F.; Rosas, E. D.; Rosnet, P.; Rossi, A.; Rotondi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rueda, O. V.; Rui, R.; Rumyantsev, B.; Rustamov, A.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Saarinen, S.; Sadhu, S.; Sadovsky, S.; Šafařík, K.; Saha, S. K.; Sahlmuller, B.; Sahoo, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sandoval, A.; Sarkar, D.; Sarkar, N.; Sarma, P.; Sas, M. H. P.; Scapparone, E.; Scarlassara, F.; Schaefer, B.; Scharenberg, R. P.; Scheid, H. S.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schmidt, M. O.; Schmidt, M.; Schmidt, N. V.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sett, P.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shahoyan, R.; Shaikh, W.; Shangaraev, A.; Sharma, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Sheikh, A. I.; Shigaki, K.; Shou, Q.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silaeva, S.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Song, J.; Song, M.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spiriti, E.; Sputowska, I.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stankus, P.; Stenlund, E.; Stocco, D.; Storetvedt, M. M.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Sumowidagdo, S.; Suzuki, K.; Swain, S.; Szabo, A.; Szarka, I.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thakur, D.; Thakur, S.; Thomas, D.; Thoresen, F.; Tieulent, R.; Tikhonov, A.; Timmins, A. R.; Toia, A.; Torres, S. R.; Tripathy, S.; Trogolo, S.; Trombetta, G.; Tropp, L.; Trubnikov, V.; Trzaska, W. H.; Trzeciak, B. A.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Umaka, E. N.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vala, M.; van der Maarel, J.; van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vázquez Doce, O.; Vechernin, V.; Veen, A. M.; Velure, A.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Vértesi, R.; Vickovic, L.; Vigolo, S.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Virgili, T.; Vislavicius, V.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Voscek, D.; Vranic, D.; Vrláková, J.; Wagner, B.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wenzel, S. C.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilk, G.; Wilkinson, J.; Willems, G. A.; Williams, M. C. S.; Willsher, E.; Windelband, B.; Witt, W. E.; Yalcin, S.; Yamakawa, K.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yoon, J. H.; Yurchenko, V.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zmeskal, J.; Zou, S.; Alice Collaboration
2018-02-01
Invariant differential yields of deuterons and antideuterons in p p collisions at √{s } = 0.9, 2.76 and 7 TeV and the yields of tritons, 3He nuclei, and their antinuclei at √{s } = 7 TeV have been measured with the ALICE detector at the CERN Large Hadron Collider. The measurements cover a wide transverse momentum (pT) range in the rapidity interval |y |<0.5 , extending both the energy and the pT reach of previous measurements up to 3 GeV/c for A =2 and 6 GeV/c for A =3 . The coalescence parameters of (anti)deuterons and 3He¯ nuclei exhibit an increasing trend with pT and are found to be compatible with measurements in p A collisions at low pT and lower energies. The integrated yields decrease by a factor of about 1000 for each increase of the mass number with one (anti)nucleon. Furthermore, the deuteron-to-proton ratio is reported as a function of the average charged particle multiplicity at different center-of-mass energies.
Results for the first quarter calendar year 2017 tank 50H salt solution sample
Energy Technology Data Exchange (ETDEWEB)
Crawford, C. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2017-04-12
In this memorandum, the chemical and radionuclide contaminant results from the First Quarter Calendar Year 2017 (CY17) sample of Tank 50H salt solution are presented in tabulated form. The First Quarter CY17 Tank 50H samples [a 200 mL sample obtained 6” below the surface (HTF-50-17-7) and a 1 L sample obtained 66” from the tank bottom (HTF-50-17-8)] were obtained on January 15, 2017 and received at Savannah River National Laboratory (SRNL) on January 16, 2017. Prior to obtaining the samples from Tank 50H, a single pump was run at least 4.4 hours and the samples were pulled immediately after pump shut down. All volatile organic analysis (VOA) and semi-volatile organic analysis (SVOA) were performed on the surface sample and all other analyses were performed on the variable depth sample. The information from this characterization will be used by Savannah River Remediation (SRR) for the transfer of aqueous waste from Tank 50H to the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. The chemical and radionuclide contaminant results from the characterization of the First Quarter CY17 sampling of Tank 50H were requested by SRR personnel and details of the testing are presented in the SRNL Task Technical and Quality Assurance Plan (TTQAP). This memorandum is part of Deliverable 2 from SRR request. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the TTQAP for the Tank 50H saltstone task.
International Nuclear Information System (INIS)
Quan, Chuye; Ma, Yuhui; Han, Yumin; Tang, Xingxing; Lu, Mengjia; Mao, Weiwei; Zhang, Jian; Yang, Jianping; Li, Xing’ao
2015-01-01
Highlights: • Crystal structure of doped samples transform to two phase coexistence. • The crystal size decreased to ∼50 nm after doping. • Ultraviolet absorption peak demonstrates apparent blue shift for doped sample. • The ratio of Fe 2+ increased by merging Nd. • Ca, Nd co-doped can promote the ferromagnetism obviously. - Abstract: Pure and co-doped BiFeO 3 (Ca, Nd) nanoparticles with diameter in the range of 50–250 nm were synthesized through a sol–gel method. X-ray diffraction (XRD) and Raman results show that Bi-site co-doped with Ca, Nd could result in a transition of crystal structure (from single phase rhombohedral (R3c) to two phase coexistence). An apparent blue shift can be observed in the co-doped samples along with a decrease of the direct optical band gap. Moreover, the leakage current was decreased due to the introduction of nonvolatile Ca and Nd at Bi 3+ site. Analysis of MPMS-VSM magnetic hysteresis data reveals a further enhancement in magnetism in the Nd doped Bi 0.9 Ca 0.1 FeO 3, which is further explained by XPS characterization
NCBI nr-aa BLAST: CBRC-HSAP-09-0006 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0006 ref|ZP_00960995.1| pyruvate carboxylase [Roseovarius nubinhibens ...ISM] gb|EAP76566.1| pyruvate carboxylase [Roseovarius nubinhibens ISM] ZP_00960995.1 1.2 28% ...
Energy Technology Data Exchange (ETDEWEB)
Gao, Ning; Quan, Chuye [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); Ma, Yuhui [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); School of Science, Nanjing University of Posts and Telecommunications (NUPT), Nanjing 210023 (China); Key Laboratory of Flexible Electronics (KLOFE) & Institute of Advanced Materials (IAM), National Synergistic Innovation Center for Advanced Materials - SICAM, Nanjing Tech University - Nanjing Tech, 30 South Puzhu Road, Nanjing 211816 (China); Han, Yumin; Wu, Zhenli [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); Mao, Weiwei [Key Laboratory for Organic Electronics & Information Displays - KLOEID, Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials (IAM), School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); School of Science, Nanjing University of Posts and Telecommunications (NUPT), Nanjing 210023 (China); and others
2016-01-15
We propose first-principles methods to study the structure, electronic, optical and magnetic properties of BiFeO{sub 3} (BFO) and Bi{sub 0.9}Ca{sub 0.1}FeO{sub 3} (BCFO). The morphology, optical band gap as well as magnetic hysteresis also have been investigated using experimental methods. X-ray diffraction data shows that Bi-site doping with Ca could result in a transition of crystal structure (from single phase rhombohedral (R3c) to two phase coexistence). Changing of Fermi level and decreasing of band gap indicating that the Ca-doped BFO exhibit a typical half-metallic nature. The optical absorption properties are related to the electronic structure and play the key role in determining their band gaps, also we have analyzed the inter-band contribution to the theory of optical properties such as absorption spectra, dielectric constant, energy-loss spectrum, absorption coefficient, optical reflectivity, and refractive index of BCFO. Enhancement of magnetic properties after doping is proved by both experimental and calculated result, which can be explained by size effect and structural distortion.
NCBI nr-aa BLAST: CBRC-GACU-09-0002 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0002 ref|YP_594114.1| amidohydrolase [Deinococcus geothermalis DSM 113...00] gb|ABF44040.1| amidohydrolase [Deinococcus geothermalis DSM 11300] YP_594114.1 5.5 28% ...
Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes II. experimental determination
DEFF Research Database (Denmark)
Chatzichristodoulou, Christodoulos; Søgaard, Martin; Glasscock, Julie
2011-01-01
Thin (∼30 m), dense Ce0.9Gd0.1O1.95- (CGO10) membranes (5 5 cm2+) supported on a porous NiO/YSZ substrate were fabricated by tape casting, wet powder spraying and lamination. A La 0.58Sr0.4Co0.2Fe0.8O 3-δ/Ce0.9Gd0.1O1.95- (LSCF/CGO10) composite cathode was applied by screen printing. Oxygen...... compartment. The performance of the membrane was also investigated under varying CH 4 and H2O gas mixtures at 1106 K. The oxygen flux increased with decreasing steam to carbon ratio and was found to exceed 10 N mL min-1 cm-2 of O2 for steam to carbon ratios below 4:3. Post-test analysis of the tested membrane...
NCBI nr-aa BLAST: CBRC-GGAL-09-0008 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GGAL-09-0008 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 5e-61 23% ...
Fast helicity switching of x-ray circular polarization at beamline P09 at PETRA III
Energy Technology Data Exchange (ETDEWEB)
Strempfer, J., E-mail: Joerg.Strempfer@desy.de; Mardegan, J. R. L.; Francoual, S.; Veiga, L. S. I.; Spitzbart, T.; Zink, H. [Deutsches Elektronen Synchrotron (DESY), Notkestrasse 85, 22603 Hamburg (Germany); Bouchenoire, L. [XMaS, ESRF, 6 rue Jules Horowitz, BP220, Grenoble 38043 (France); Department of Physics, University of Liverpool, Liverpool, L69 7ZE (United Kingdom)
2016-07-27
At the resonant scattering and diffraction beamline P09 at PETRA III/DESY, polarization manipulation in the X-ray energy range 3-13 keV is possible using wave-plates. Recently, fast flipping of circular polarization helicity using the Raspberry Pi controlled FPGA (PiLC) device developed at DESY and dedicated piezo-electric flippers has been commissioned. Functionality of the PiLC for XMCD and first XMCD measurements at the Fe K-and Dy-L{sub 3} absorption edges are presented.
Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathon; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John
2014-01-01
The 3M(™) Molecular Detection Assay (MDA) Salmonella utilizes isothermal amplification of nucleic acid sequences with high specificity, efficiency, rapidity and bioluminescence to detect amplification of Salmonella spp. in food, food-related, and environmental samples after enrichment. A method modification and matrix extension study of the previously approved AOAC Official Method(SM) 2013.09 was conducted, and approval of the modification was received on March 20, 2014. Using an unpaired study design in a multilaboratory collaborative study, the 3M MDA Salmonella method was compared to the U.S. Department of Agriculture/Food Safety and Inspection Service (USDA/FSIS) Microbiology Laboratory Guidebook (MLG) 4.05 (2011), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg, and Catfish Products for raw ground beef and the U.S. Food and Drug Administration (FDA)/Bacteriological Analytical Manual (BAM) Chapter 5, Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the LPODs of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0186 ref|XP_001213909.1| predicted protein [Aspergillus terreus NIH262...4] gb|EAU35178.1| predicted protein [Aspergillus terreus NIH2624] XP_001213909.1 0.076 27% ...
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0074 ref|XP_001564659.1| dynein heavy chain, putative [Leishmania brazil...iensis] emb|CAM38725.1| dynein heavy chain, putative [Leishmania braziliensis] XP_001564659.1 7.8 31% ...
Braun, Dorothee; Schmidbauer, Martin; Hanke, Michael; Schwarzkopf, Jutta
2018-01-01
The formation process of a ferroelectric multi-rank domain pattern in the thickness range of 7-52 nm is investigated for monoclinic K0.9Na0.1NbO3 strained epitaxial films on (110) NdScO3 substrates. Although the elastic strain energy density is degenerated for two pseudocubic orientations, a distinctive hierarchy of domain evolution is observed with exclusive in-plane a1a2 domains for very thin films and the retarded onset of a ferroelectric MC phase at larger film thickness. This is accompanied by a thickness dependent transformation from stripe domains to a herringbone pattern and, eventually, for the thickest film, to a checkerboard-like structure. These transformations in the domain arrangement and width are correlated to energetic aspects as depolarization field and anisotropic strain relaxation in the film. While for the MC domains plastic strain relaxation is throughout observed, the a1a2 domains show a two-step strain relaxation mechanism starting with an in-plane elastic shearing, which is followed by plastic lattice relaxation. Our results highlight a pathway for engineering and patterning of periodic ferroelectric domain structures.
Registration of ‘CP 09-1822’ Sugarcane
‘CP 09-1822’ (Reg. No. __; PI 686942 sugarcane (a complex hybrid of Saccharum spp.) was released in June 2016 for commercial cultivation on sand (mineral) soils in Florida. This cultivar was developed through a collaborative sugarcane cultivar development program of the USDA-ARS, the University of F...
NCBI nr-aa BLAST: CBRC-RMAC-09-0022 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-RMAC-09-0022 ref|YP_026083.1| NADH dehydrogenase subunit 2 [Steinernema carpoc...apsae] gb|AAT00526.1| NADH dehydrogenase subunit 2 [Steinernema carpocapsae] YP_026083.1 1e-05 30% ...
Lin, Shengxuan; Zhou, Xuedong; Ge, Liya; Ng, Sum Huan; Zhou, Xiaodong; Chang, Victor Wei-Chung
2016-10-01
Heavy metals and some metalloids are the most significant inorganic contaminants specified in toxicity characteristic leaching procedure (TCLP) in determining the safety of landfills or further utilization. As a consequence, a great deal of efforts had been made on the development of miniaturized analytical devices, such as Microchip Electrophoresis (ME) and μTAS for on-site testing of heavy metals and metalloids to prevent spreading of those pollutants or decrease the reutilization period of waste materials such as incineration bottom ash. However, the bottleneck lied in the long and tedious conventional TCLP that requires 18 h of leaching. Without accelerating the TCLP process, the on-site testing of the waste material leachates was impossible. In this study, therefore, a new accelerated leaching method (ALM) combining ultrasonic assisted leaching with tumbling was developed to reduce the total leaching time from 18 h to 30 min. After leaching, the concentrations of heavy metals and metalloids were determined with ICP-MS or ICP-optical emission spectroscopy. No statistical significance between ALM and TCLP was observed for most heavy metals (i.e., cobalt, manganese, mercury, molybdenum, nickel, silver, strontium, and tin) and metalloids (i.e., arsenic and selenium). For the heavy metals with statistical significance, correlation factors derived between ALM and TCLP were 0.56, 0.20, 0.037, and 0.019 for barium, cadmium, chromium, and lead, respectively. Combined with appropriate analytical techniques (e.g., ME), the ALM can be applied to rapidly prepare the incineration bottom ash samples as well as other environmental samples for on-site determination of heavy metals and metalloids. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Registration of ‘CP 09-1430’ Sugarcane
‘CP 09-1430’ (Reg. No. ; PI 686940 sugarcane (a complex hybrid of Saccharum spp.) was developed and released (6 Jun. 2016) through cooperative research conducted by the USDA-ARS Sugarcane Field Station , Canal Point, the University of Florida, and the Florida Sugar Cane League, Inc. for use on ...
International Nuclear Information System (INIS)
Xu Lin; Luo Mingfang; Li Wangliang; Wei Xuetuan; Xie Keng; Liu Lijun; Jiang Chengying; Liu Huizhou
2011-01-01
Research highlights: → Growing cells have high Cr (VI) resistant and reducing ability aerobically. → Resting cells show strong anaerobic-reduction potential. → Acetate can highly stimulate both aerobic and anaerobic reduction process. - Abstract: A novel Cr (VI) resistant bacterial strain LSSE-09, identified as Pannonibacter phragmitetus, was isolated from industrial sludge. It has strong aerobic and anaerobic Cr (VI)-reduction potential under alkaline conditions. At 37 o C and pH 9.0, growing cells of strain LSSE-09 could completely reduce 100 and 1000 mg L -1 Cr (VI)-Cr (III) within 9 and 24 h, respectively under aerobic condition. Resting cells showed higher anaerobic reduction potential with the rate of 1.46 mg g -1 (dryweight) min -1 , comparing with their aerobic reduction rate, 0.21 mg g -1 min -1 . External electron donors, such as lactate, acetate, formate, pyruvate, citrate and glucose could highly increase the reduction rate, especially for aerobic reduction. The presence of 3000 mg L -1 acetate enhanced anaerobic and aerobic Cr (VI)-reduction rates up to 9.47 mg g -1 min -1 and 4.42 mg g -1 min -1 , respectively, which were 5 and 20 times faster than those without it. Strain LSSE-09 retained high activities over six batch cycles and NO 3 - and SO 4 2- had slightly negative effects on Cr (VI)-reduction rates. The results suggest that strain LSSE-09 has potential application for Cr (VI) detoxification in alkaline wastewater.
Kusznierz, Gabriela; Carolina, Cudós; Manuel, Rudi Juan; Sergio, Lejona; Lucila, Ortellao; Julio, Befani; Mirta, Villani; Pedro, Morana; Graciana, Morera; Andrea, Uboldi; Elsa, Zerbini
2017-07-01
It is important to characterize the clinical and epidemiological pattern of the influenza A (H1N1) pdm09 virus and compare it with influenza A (H3N2) virus, as surveyed in just a few studies, in order to contribute to the implementation and strengthening of influenza control and prevention strategies. The aims in this study were to describe influenza clinical and epidemiological characteristics in hospitalized patients, caused by influenza A (H1N1)pdm09 and influenza A (H3N2) viruses during 2013, in Santa Fe, Argentina. A retrospective study was conducted over 2013 among hospitalized patients with laboratory-confirmed influenza diagnosis. In contrast to patients with influenza A (H3N2) (20.5%), a higher proportion of hospitalizations associated with influenza H1N1pdm were reported among adults aged 35-65 years (42.8%). Of all patients, 73.6% had an underlying medical condition. Hospitalized patients with H1N1pdm were subject to 2.6 (95%CI, 1.0-6.8) times higher risk of severity, than those hospitalized with influenza A (H3N2). This results demonstrate the impact in the post-pandemic era of H1N1pdm virus, with increased risk of severe disease, in relation to H3N2 virus, both viruses co-circulating during 2013. © 2017 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Ding, Hanping; Lin, Bin; Wang, Songlin; Fang, Daru; Dong, Yingchao; Peng, Ranran; Liu, Xingqiu; Meng, Guangyao [Department of Materials Science and Engineering, University of Science and Technology of China (USTC), Hefei 230026 (China); Jiang, Yinzhu; Tao, Shanwen [Department of Chemistry, School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom)
2008-12-01
The SrCo{sub 0.9}Sb{sub 0.1}O{sub 3-{delta}} (SCS) composite oxide with cubic perovskite structure was synthesized by a modified Pechini method and examined as a novel cathode for protonic ceramic membrane fuel cells (PCMFCs). At 700 C and under open-circuit condition, symmetrical SCS cathode on BaZr{sub 0.1}Ce{sub 0.7}Y{sub 0.2}O{sub 3-{delta}} (BZCY7) electrolyte showed low polarization resistances (R{sub p}) of 0.22 {omega}cm{sup 2} in air. A laboratory-sized tri-layer cell of NiO-BZCY7/BZCY7/SCS was operated from 500 to 700 C with humidified hydrogen ({proportional_to}3% H{sub 2}O) as fuel and the static air as oxidant. A high open-circuit potential of 1.004 V, a maximum power density of 259 mW cm{sup -2}, and a low polarization resistance of the electrodes of 0.14 {omega}cm{sup 2} was achieved at 700 C. (author)
Structural and biophysical characterization of the PI4KB:14-3-3 protein complex
Czech Academy of Sciences Publication Activity Database
Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen
2017-01-01
Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 proteins Subject RIV: CE - Biochemistry
International Nuclear Information System (INIS)
Gustafson, D.E.; Hofmeister, W.H.; Bayuzick, R.J.; Nagashio, K.; Kuribayashi, K.
2003-01-01
This paper presents the results of rapid solidification experiments performed on the copper oxide superconductors Y x Nd 1-x Ba 2 Cu 3 O 7-δ (0≤x≤0.9). Spherical rare earth (RE) 123 specimens were levitated in O 2 using aero-acoustic levitation (AAL), melted with a laser, undercooled, and solidified. The peritectic transformation temperature for the reaction RE 2 BaCuO 5 +liquid→REBa 2 Cu 3 O 7-δ corresponding to the maximum recalescence temperature during solidification was determined. RE123 was formed directly from the melt for Y-Nd binary alloy compositions with Nd concentration greater than 20% (Y concentration less than 80%). A minimum in the peritectic transformation temperature for the Nd/Y123 system corresponding to a composition Y 0.3 Nd 0.7 123 was determined at 66 deg. C below the peritectic of pure Nd123
Influenza A (H1N1pdm09)-Related Critical Illness and Mortality in Mexico and Canada, 2014.
Dominguez-Cherit, Guillermo; De la Torre, Alethse; Rishu, Asgar; Pinto, Ruxandra; Ñamendys-Silva, Silvio A; Camacho-Ortiz, Adrián; Silva-Medina, Marco Antonio; Hernández-Cárdenas, Carmen; Martínez-Franco, Michel; Quesada-Sánchez, Alejandro; López-Gallegos, Guadalupe Celia; Mosqueda-Gómez, Juan L; Rivera-Martinez, Norma E; Campos-Calderón, Fernando; Rivero-Sigarroa, Eduardo; Hernández-Gilsoul, Thierry; Espinosa-Pérez, Lourdes; Macías, Alejandro E; Lue-Martínez, Dolores M; Buelna-Cano, Christian; Ramírez-García Luna, Ana-Sofía; Cruz-Ruiz, Nestor G; Poblano-Morales, Manuel; Molinar-Ramos, Fernando; Hernandez-Torre, Martin; León-Gutiérrez, Marco Antonio; Rosaldo-Abundis, Oscar; Baltazar-Torres, José Ángel; Stelfox, Henry T; Light, Bruce; Jouvet, Philippe; Reynolds, Steve; Hall, Richard; Shindo, Nikki; Daneman, Nick; Fowler, Robert A
2016-10-01
The 2009-2010 influenza A (H1N1pdm09) pandemic caused substantial morbidity and mortality among young patients; however, mortality estimates have been confounded by regional differences in eligibility criteria and inclusion of selected populations. In 2013-2014, H1N1pdm09 became North America's dominant seasonal influenza strain. Our objective was to compare the baseline characteristics, resources, and treatments with outcomes among critically ill patients with influenza A (H1N1pdm09) in Mexican and Canadian hospitals in 2014 using consistent eligibility criteria. Observational study and a survey of available healthcare setting resources. Twenty-one hospitals, 13 in Mexico and eight in Canada. Critically ill patients with confirmed H1N1pdm09 during 2013-2014 influenza season. None. The main outcome measures were 90-day mortality and independent predictors of mortality. Among 165 adult patients with H1N1pdm09-related critical illness between September 2013 and March 2014, mean age was 48.3 years, 64% were males, and nearly all influenza was community acquired. Patients were severely hypoxic (median PaO2-to-FIO2 ratio, 83 mm Hg), 97% received mechanical ventilation, with mean positive end-expiratory pressure of 14 cm H2O at the onset of critical illness and 26.7% received rescue oxygenation therapy with prone ventilation, extracorporeal life support, high-frequency oscillatory ventilation, or inhaled nitric oxide. At 90 days, mortality was 34.6% (13.9% in Canada vs 50.5% in Mexico, p Mexico (odds ratio, 7.76 [95% CI, 2.02-27.35]). ICUs in Canada generally had more beds, ventilators, healthcare personnel, and rescue oxygenation therapies. Influenza A (H1N1pdm09)-related critical illness still predominantly affects relatively young to middle-aged patients and is associated with severe hypoxemic respiratory failure. The local critical care system and available resources may be influential determinants of patient outcome.
Res Sep 2014 Cover Tp 08.09.14.cdr
Indian Academy of Sciences (India)
Admin
2010). ISSN 0971-8044. Regn No.KRNAVBGE-340/2012-2014. Licenced to Post without prepayment No.6. Posted at MBC, GPO, Bangalore 560 001, 12.09.14. Registered with Registrar of Newspapers in India vide Regn. No. 66273/96.
NCBI nr-aa BLAST: CBRC-PTRO-09-0001 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-09-0001 ref|ZP_01444684.1| hypothetical protein R2601_22801 [Roseovarius ...sp. HTCC2601] gb|EAU45065.1| hypothetical protein R2601_22801 [Roseovarius sp. HTCC2601] ZP_01444684.1 0.32 34% ...
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 ref|NP_001017377.1| progestin and adipoQ receptor family member I...V [Rattus norvegicus] gb|AAH92635.1| Progestin and adipoQ receptor family member IV [Rattus norvegicus] gb|EDM03772.1| progesti
Directory of Open Access Journals (Sweden)
I. K. Tastra
2012-05-01
Full Text Available High moisture of fresh cassava root (65-75 % wet basis need appropriate post harvest handling that can reduce lossesdue to delayed drying process. To accelerate drying process, a cassava chipper (MPB-09 was modified and evaluated for chipping fresh cassava root. This machine included hopper, horizontal chipping cylinder, 5.5 hp gasoline engine, belt, pulley, frame and cover. The performance evaluation of the cassava chipper was done using the combination of four type chipping cylinder (3, 4, 5 and 6 knife and three level chipping cylinder speed (400, 500, 600 Rpm. Regression analysis and homogeneity test of the regression coefficient was used to evaluate the the performance of the cassava chipper. Based on the optimum combination of the type of chipping cylinder and its speed, financial analysis was conducted to evaluate its feasibility. The optimum effective capacity of MPB-09 chipper was at horizontal chipping cylinder with 6 knife and rotation speed 600 rpm. At effective capacity 2.5 t/hour, investment cost Rp 7,500,000 /unit, effective working hours 160 hours/years, two operator cost Rp 200,000 /day and chipping cost Rp 50 /kg chip ; the unit cost (BP was Rp 22 /kg chip; the break-even point (BEP was 90.3 t chip/year; the pay back periodl (PBP was0.7 years; the net present value (NPV was Rp 24,473,739; the benefit cost ratio (B/C was 1.8 and the internal rate of return (IRR was 149.8 %. Based on the results of the financial analysis. it was concluded that MPB-09 chipper was feasible to be applied at farm level. ABSTRAK Kadar air umbi ubikayu yang tinggi (65-70 % bb saat panen memerlukan penanganan yang cepat guna mengurangisusut mutu akibat keterlambatan proses pengeringan. Untuk mempercepat proses pengeringan telah dilakukan modifikasi mesin penyawut (MPB-09 dengan komponen pisau sawut masing-masing sebanyak 3, 4, 5 dan 6 buah per piringan dan dievaluasi kinerjanya pada putaran 400, 500 dan 600 Rpm. Evaluasi kinerja mesin MPB
A study of analysis PB1-F2 protein of Influenza Viruses A/H1N1pdm09, A/ H3N2, and A/H5N1
Directory of Open Access Journals (Sweden)
Hana Apsari Pawestri
2016-07-01
Full Text Available Abstrak Tujuan. Protein PB1-F2 (polymerase basic 1-frame 2 adalah protein terbaru yang ditemukan pada virus Influenza dan telah terbukti berperan dalam induksi kematian sel dan patogenitas. Tujuan dari tulisan ini adalah untuk menganalisis protein PB1-F2 pada virus Influenza A/H5N1 dan A/H1N1pdm09. Metode. Kami melakukan pencarian data yang relevan yaitu sekuens gen virus Influenza A/H5N1 dan A/H1N1pdm09 dari Gen Bank National Center for Biotechnology Information (NCBI selama tahun 1997-2015. Data yang digunakan adalah data sekuens nukleotida gen PB1 (polymerase basic1 virus influenza A/H5N1 dan A/H1N1pdm09. Kemudian dilakukan analisis alignment untuk mengetahui variasi protein dan mutasi yang berhubungan dengan patogenitas dan virulensi. Hasil. Kami melakukan penelitian terhadap sekuens PB1-F2 sebanyak 3262 influenza A/H5N1 dan 2472 Influenza A/H1N1pdm09. Hasil analisis menunjukkan bahwa semua sekuens A/H5N1 memiliki panjang yang penuh sebanyak 90 asam amino, kecuali influenza pandemi 2009 hanya memiliki panjang 87 asam amino. Kemudian, ditemukan mutasi yang berhubungan dengan virulensi yang ditunjukan dengan perubahan asam amino Asparagin (N menjadi Serin (S. Mutasi tersebut terjadi pada Influenza A/H5N1 sebanyak 8.5% dan Influenza A/H1N1pdm09 sebanyak 0.5%. Kesimpulan. Ditemukan beberapa variasi panjang asam amino dan mutasi penting pada sekuens PB1-F2 dari subtipe yang berbeda yaitu influenza A/H5N1 dan A/H1N1pdm09 yang mengindikasikan seleksi spesifik karena introduksi dan adaptasi terhadap inang yang berbeda. Diperlukan penelitian lanjutan untuk lebih memahami variasi dan kontribusi protein PB1-F2 tersebut terhadap virulensi dan patogenitas virus Influenza. Kata kunci : Patogenesis, Virus Influenza, Protein PB1-F2 Abstract Aim. Influenza virus PB1-F2 (polymerase basic 1-frame 2 protein is a novel protein previously shown to be involved in cell death induction and pathogenesis. Here we analysis the PB1-F2 protein of Influenza virus A
A study of analysis PB1-F2 protein of Influenza Viruses A/H1N1pdm09, A/ H3N2, and A/H5N1
Directory of Open Access Journals (Sweden)
Hana Apsari Pawestri
2016-07-01
Full Text Available Abstrak Tujuan. Protein PB1-F2 (polymerase basic 1-frame 2 adalah protein terbaru yang ditemukan pada virus Influenza dan telah terbukti berperan dalam induksi kematian sel dan patogenitas. Tujuan dari tulisan ini adalah untuk menganalisis protein PB1-F2 pada virus Influenza A/H5N1 dan A/H1N1pdm09. Metode. Kami melakukan pencarian data yang relevan yaitu sekuens gen virus Influenza A/H5N1 dan A/H1N1pdm09 dari Gen Bank National Center for Biotechnology Information (NCBI selama tahun 1997-2015. Data yang digunakan adalah data sekuens nukleotida gen PB1 (polymerase basic1 virus influenza A/H5N1 dan A/H1N1pdm09. Kemudian dilakukan analisis alignment untuk mengetahui variasi protein dan mutasi yang berhubungan dengan patogenitas dan virulensi. Hasil. Kami melakukan penelitian terhadap sekuens PB1-F2 sebanyak 3262 influenza A/H5N1 dan 2472 Influenza A/H1N1pdm09. Hasil analisis menunjukkan bahwa semua sekuens A/H5N1 memiliki panjang yang penuh sebanyak 90 asam amino, kecuali influenza pandemi 2009 hanya memiliki panjang 87 asam amino. Kemudian, ditemukan mutasi yang berhubungan dengan virulensi yang ditunjukan dengan perubahan asam amino Asparagin (N menjadi Serin (S. Mutasi tersebut terjadi pada Influenza A/H5N1 sebanyak 8.5% dan Influenza A/H1N1pdm09 sebanyak 0.5%. Kesimpulan. Ditemukan beberapa variasi panjang asam amino dan mutasi penting pada sekuens PB1-F2 dari subtipe yang berbeda yaitu influenza A/H5N1 dan A/H1N1pdm09 yang mengindikasikan seleksi spesifik karena introduksi dan adaptasi terhadap inang yang berbeda. Diperlukan penelitian lanjutan untuk lebih memahami variasi dan kontribusi protein PB1-F2 tersebut terhadap virulensi dan patogenitas virus Influenza. Kata kunci : Patogenesis, Virus Influenza, Protein PB1-F2 Abstract Aim. Influenza virus PB1-F2 (polymerase basic 1-frame 2 protein is a novel protein previously shown to be involved in cell death induction and pathogenesis. Here we analysis the PB1-F2 protein of Influenza virus A
Isomers of (Ca0.1La0.9)(Ba1.65La0.35)Cu3Oy Superconductor Having Different Tc
International Nuclear Information System (INIS)
Knizhnik, A.; Reisner, G.M.; Men, A.; Eckstein, Y.
1998-01-01
(Ca 0.1 La 0.9 )(Ba 1.65 La 0.35 )Cu 3 O y is a YBCO like superconductor but tetragonal for any y, i.e. without ordered chains. Its T c vs y plot has no intermediate plateau and is a nearly straight line in the under doped region. Different oxygen contents were obtained by oxygenation at various temperatures under 1 atm O 2 followed by quench in liquid nitrogen. This type of oxygenation leads to samples where the oxygen content corresponds to the thermodynamic equilibrium with the gas phase because the form of attaining the oxygenation temperature (Tom higher or lower temperature) and time (over 10h) of oxygenation do not change y and Tc. Changing of the firing temperature (we used the usual carbonate-oxide preparation which included 3 firings in powder, pelletization, sintering and oxygenation) changes Tc at the same y. The increase of the firing temperature by 40 deg C increases T c by 7-10K while y remains unchanged. Increases of the temperature of sintering virtually do not change T c which shows that low and high Tc compounds are formed during the first stages of preparation and that there is no thermodynamic equilibrium between them. The low Tc compounds cannot be transformed into high Tc ones by raising the temperature
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0033 ref|YP_001510423.1| hypothetical protein Franean1_6173 [Frankia s...p. EAN1pec] gb|ABW15517.1| hypothetical protein Franean1_6173 [Frankia sp. EAN1pec] YP_001510423.1 0.097 29% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0004 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0004 ref|XP_747491.1| K+ homeostasis protein Kha1, putative [Aspergill...us fumigatus Af293] gb|EAL85453.1| K+ homeostasis protein Kha1, putative [Aspergillus fumigatus Af293] XP_747491.1 0.53 28% ...
NCBI nr-aa BLAST: CBRC-RMAC-09-0031 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-RMAC-09-0031 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 0.0 97% ...
NCBI nr-aa BLAST: CBRC-TGUT-09-0014 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TGUT-09-0014 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 1e-144 67% ...
NCBI nr-aa BLAST: CBRC-PABE-09-0037 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PABE-09-0037 ref|YP_890142.1| hypothetical protein MSMEG_5916 [Mycobacterium sme...gmatis str. MC2 155] gb|ABK71889.1| hypothetical protein MSMEG_5916 [Mycobacterium smegmatis str. MC2 155] YP_890142.1 0.033 36% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...
Undergraduate Education with the WIYN 0.9-m Telescope
Pilachowski, Catherine A.
2017-01-01
Several models have been explored at Indiana University Bloomington for undergraduate student engagement in astronomy using the WIYN 0.9-m telescope at Kitt Peak. These models include individual student research projects using the telescope, student observations as part of an observational techniques course for majors, and enrichment activities for non-science majors in general education courses. Where possible, we arrange for students to travel to the telescope. More often, we are able to use simple online tools such as Skype and VNC viewers to give students an authentic observing experience. Experiences with the telescope motivate students to learn basic content in astronomy, including the celestial sphere, the electromagnetic spectrum, telescopes and detectors, the variety of astronomical objects, date reduction processes, image analysis, and color image creation and appreciation. The WIYN 0.9-m telescope is an essential tool for our program at all levels of undergraduate education
International Nuclear Information System (INIS)
Zhang Hongdi; An Yukai; Mai Zhenhong; Lu Huibin; Zhao Kun; Pan Guoqiang; Li Ruipeng; Fan Rong
2008-01-01
The thickness dependence of microstructures of La 0.9 Sr 0.1 MnO 3 (LSMO) thin films grown on exact-cut and miscut SrTiO 3 (STO) substrates, respectively, was investigated by high-angle X-ray diffraction (HXRD), X-ray small-angle reflection (XSAR), X-ray reciprocal space mapping and atomic force microscopy (AFM). Results show that the LSMO films are in pseudocubic structure and are highly epitaxial [0 0 1]-oriented growth on the (0 0 1) STO substrates. The crystalline quality of the LSMO film is improved with thickness. The epitaxial relationship between the LSMO films and the STO substrates is [0 0 1] LSMO -parallel [0 0 1] EXACT-STO , and the LSMO films have a slight mosaic structure along the q x direction for the samples grown on the exact-cut STO substrates. However, an oriented angle of about 0.24 deg. exists between [0 0 1] LSMO and [0 0 1] MISCUT-STO , and the LSMO films have a mosaic structure along the q z direction for that grown on the miscut STO substrates. The mosaic structure of both groups of the samples tends to reduce with thickness. The diffraction intensity of the (0 0 4) peaks increases with thickness of the LSMO film. The XSAR and AFM observations show that for both groups, the interface is sharp and the surface is rather smooth. The mechanism was discussed briefly
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0186 ref|ZP_01510169.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirm...ans PsJN] gb|EAV05032.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirmans PsJN] ZP_01510169.1 1.4 31% ...
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...
DEFF Research Database (Denmark)
Ovtar, Simona; Gurauskis, Jonas; Bjørnetun Haugen, Astri
2017-01-01
The oxygen permeation through dense Ce0.9Gd0.1O1.95-La0.6Sr0.4FeO3−d dual-phase composite asymmetric membranes supported on a porous MgO tube was studied. The membranes were prepared by thermoplastic extrusion, dip coating, co-sintering and infiltration of a catalyst. Oxygen permeation measureme...
Energy Technology Data Exchange (ETDEWEB)
Zhou, Qingjun [State Key Laboratory of Superhard Materials and College of Physics, Jilin University, Changchun 130012 (China); College of Science, Civil Aviation University of China, Tianjin 300300 (China); Zhang, Leilei; He, Tianmin [State Key Laboratory of Superhard Materials and College of Physics, Jilin University, Changchun 130012 (China)
2010-02-15
A cobalt-free cubic perovskite oxide, SrFe{sub 0.9}Nb{sub 0.1}O{sub 3-{delta}} (SFN) was investigated as a cathode for intermediate-temperature solid oxide fuel cells (IT-SOFCs). XRD results showed that SFN cathode was chemically compatible with the electrolyte Sm{sub 0.2}Ce{sub 0.8}O{sub 1.9} (SDC) for temperatures up to 1050 C. The electrical conductivity of SFN sample reached 34-70 S cm{sup -1} in the commonly operated temperatures of IT-SOFCs (600-800 C). The area specific resistance was 0.138 {omega} cm{sup 2} for SFN cathode on SDC electrolyte at 750 C. A maximum power density of 407 mW cm{sup -2} was obtained at 800 C for single-cell with 300 {mu}m thick SDC electrolyte and SFN cathode. (author)
Properties of slag concrete for low-level waste containment
International Nuclear Information System (INIS)
Langton, C.A.; Wong, P.B.
1991-01-01
Ground granulated blast furnace slag was incorporated in the concrete mix used for construction of low-level radioactive waste disposal vaults. The vaults were constructed as six 100 x 100 x 25 ft cells with each cell sharing internal walls with the two adjacent cells. The vaults were designed to contain a low-level radioactive wasteform called saltstone and to isolate the saltstone from the environment until the landfill is closed. Closure involves backfilling with native soil, installation of clay cap, and run-off control. The design criteria for the slag-substituted concrete included compressive strength, 4000 psi after 28 days; slump, 6 inch; permeability, less than 10 -7 cm/sec; and effective nitrate, chromium and technetium diffusivities of 10 -8 , 10 -12 and 10 -12 cm 2 /sec, respectively. The reducing capacity of the slag resulted in chemically reducing Cr +6 to Cr +3 and Tc +7 to Tc +4 and subsequent precipitation of the respective hydroxides in the alkaline pore solution. Consequently, the concrete vault enhances containment of otherwise mobile waste ions and contributes to the overall protection of the groundwater at the disposal site
DEFF Research Database (Denmark)
Gil Cuesta, Julita; Aavitsland, Preben; Englund, Hélène
2016-01-01
During the 2009/10 influenza A(H1N1)pdm09 pandemic, the five Nordic countries adopted different approaches to pandemic vaccination. We compared pandemic vaccination strategies and severe influenza outcomes, in seasons 2009/10 and 2010/11 in these countries with similar influenza surveillance...... systems. We calculated the cumulative pandemic vaccination coverage in 2009/10 and cumulative incidence rates of laboratory confirmed A(H1N1)pdm09 infections, intensive care unit (ICU) admissions and deaths in 2009/10 and 2010/11. We estimated incidence risk ratios (IRR) in a Poisson regression model...... with the other countries. In 2010/11 Denmark had a significantly higher cumulative incidence of A(H1N1)pdm09 ICU admissions (IRR: 2.4; 95% confidence interval (CI): 1.9-3.0) and deaths (IRR: 8.3; 95% CI: 5.1-13.5). Compared with Denmark, the other countries had higher pandemic vaccination coverage...
Baggett, Henry C.; Chittaganpitch, Malinee; Thamthitiwat, Somsak; Prapasiri, Prabda; Naorat, Sathapana; Sawatwong, Pongpun; Ditsungnoen, Darunee; Olsen, Sonja J.; Simmerman, James M.; Srisaengchai, Prasong; Chantra, Somrak; Peruski, Leonard F.; Sawanpanyalert, Pathom; Maloney, Susan A.; Akarasewi, Pasakorn
2012-01-01
Background Data on the burden of the 2009 influenza pandemic in Asia are limited. Influenza A(H1N1)pdm09 was first reported in Thailand in May 2009. We assessed incidence and epidemiology of influenza-associated hospitalizations during 2009–2010. Methods We conducted active, population-based surveillance for hospitalized cases of acute lower respiratory infection (ALRI) in all 20 hospitals in two rural provinces. ALRI patients were sampled 1∶2 for participation in an etiology study in which nasopharyngeal swabs were collected for influenza virus testing by PCR. Results Of 7,207 patients tested, 902 (12.5%) were influenza-positive, including 190 (7.8%) of 2,436 children aged incidence of hospitalized influenza cases was 136 per 100,000, highest in ages 75 years (407 per 100,000). The incidence of influenza A(H1N1)pdm09 was 62 per 100,000 (214 per 100,000 in children <5 years). Eleven influenza-infected patients required mechanical ventilation, and four patients died, all adults with influenza A(H1N1)pdm09 (1) or H3N2 (3). Conclusions Influenza-associated hospitalization rates in Thailand during 2009–10 were substantial and exceeded rates described in western countries. Influenza A(H1N1)pdm09 predominated, but H3N2 also caused notable morbidity. Expanded influenza vaccination coverage could have considerable public health impact, especially in young children. PMID:23139802
Mirzadeh Vaghefi, P.; Baghizadeh, A.; Willinger, M.; Lourenço, A. A. C. S.; Amaral, V. S.
2017-12-01
Oxide multiferroic thin films and heterostructures offer a wide range of properties originated from intrinsic coupling between lattice strain and nanoscale magnetic/electronic ordering. La0.9Ba0.1MnO3 (LBM) thin-films and LBM/BaTiO3/LBM (LBMBT) heterostructures were grown on single crystalline [100] silicon and [0001] Al2O3 using RF magnetron sputtering to study the effect of crystallinity and induced lattice mismatch in the film on magnetic properties of deposited films and heterostructures. The thicknesses of the films on Al2O3 and Si are 70 and 145 nm, respectively, and for heterostructures are 40/30/40 nm on both substrates. The microstructure of the films, state of strain and growth orientations was studied by XRD and microscopy techniques. Interplay of microstructure, strain and magnetic properties is further investigated. It is known that the crystal structure of substrates and imposed tensile strain affect the physical properties; i.e. magnetic behavior of the film. The thin layer grown on Al2O3 substrate shows out-of-plane compressive strain, while Si substrate induces tensile strain on the deposited film. The magnetic transition temperatures (Tc) of the LBM film on the Si and Al2O3 substrates are found to be 195 K and 203 K, respectively, slightly higher than the bulk form, 185 K. The LBMBT heterostructure on Si substrate shows drastic decrease in magnetization due to produced defects created by diffusion of Ti ions into magnetic layer. Meanwhile, the Tc in LBMBTs increases in respect to other studied single layers and heterostructure, because of higher tensile strain induced at the interfaces.
He, Jie; Figueroa, Deborah A; Lim, Tze-Peng; Chow, Diana S; Tam, Vincent H
2010-07-15
The stability of polymyxin B sulfate in infusion bags containing 0.9% sodium chloride injection stored at 4 and 25 degrees C was studied. Seven manufacturing batches of polymyxin B from different sources were tested. The products were reconstituted in sterile water for injection, diluted in infusion bags containing 0.9% sodium chloride injection, and stored at room temperature (25 degrees C) or under refrigeration (4 degrees C). Samples were withdrawn at the same time on days 0, 1, 2, 3, 5, and 7. A modified microbiological assay was used to determine the concentrations, as indicated by zones of inhibition, of polymyxin B. Bordetella bronchiseptica served as the reference organism. Stability was defined as retention of >90% of the initial concentration. The decomposition kinetics of polymyxin B in 0.9% sodium chloride injection were evaluated by plotting the polymyxin B concentration remaining versus time. On average, the samples retained over 90% of their initial concentration for up to two days at both storage temperatures. All samples retained over 90% of their initial concentration at 24 hours. The decomposition kinetics of polymyxin B in infusion bags containing 0.9% sodium chloride injection exhibited pseudo-first-order kinetics, with rate constants of 0.024-0.075 day(-1) at 25 degrees C and 0.022-0.043 day(-1) at 4 degrees C (p > 0.05). Polymyxin B was stable for at least one day when stored at 4 or 25 degrees C in infusion bags containing 0.9% sodium chloride injection. Stability did not differ significantly between the two storage temperatures.
Salt-stone Oxidation Study: Leaching Method - 13092
International Nuclear Information System (INIS)
Langton, C.A.; Stefanko, D.B.; Burns, H.H.
2013-01-01
Cementitious waste forms can be designed to chemically stabilize selected contaminants, such as Tc +7 and Cr +6 , by chemically reduction to lower valance states, Tc +4 and Cr +3 , respectively, and precipitation of these species in alkaline media as low solubility solid phases. Data for oxidation of this type of cementitious waste form cured under field conditions as a function of time is required for predicting the performance of the waste form and disposal facility. The rate of oxidation (oxidation front advancement) is an important parameter for predicting performance because the solubilities of some radionuclide contaminants, e.g., technetium, are a function of the oxidation state. A non-radioactive experiment was designed for quantifying the oxidation front advancement using chromium, as an approximate redox-sensitive surrogate (Cr +6 / Cr +3 ) for technetium (Tc +7 / Tc +4 ). Nonradioactive cementitious waste forms were prepared in the laboratory and cured under both laboratory and 'field conditions'. Laboratory conditions were ambient temperature and sealed sample containers. Field conditions were approximated by curing samples in open containers which were placed inside a plastic container stored outdoors at SRS. The container had a lid and was instrumented with temperature and humidity probes. Sub-samples as thin as 0.2 mm were taken as a function of distance from the exposed surface of the as-cast sample. The sub-samples were leached and the leachates were analyzed for chromium, nitrate, nitrite and sodium. Nitrate, nitrite, and sodium concentrations were used to provide baseline data because these species are not chemically retained in the waste form matrix to any significant extent and are not redox sensitive. 'Effective' oxidation fronts for Cr were measured for samples containing 1000, 500 and 20 mg/kg Cr added as soluble sodium chromate, Na 2 CrO 4 . For a sample cured for 129 days under field conditions, leachable Cr (assumed to be the oxidized
22 CFR 231.09 - No acceleration of Eligible Notes.
2010-04-01
... Section 231.09 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11... have the right to pay any amounts in respect of the Eligible Notes other than in accordance with the...
XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet
Energy Technology Data Exchange (ETDEWEB)
Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)
2013-12-25
Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.
33 CFR 88.09 - Temporary exemption from light and shape requirements when operating under bridges.
2010-07-01
... and shape requirements when operating under bridges. 88.09 Section 88.09 Navigation and Navigable... Temporary exemption from light and shape requirements when operating under bridges. A vessel's navigation lights and shapes may be lowered if necessary to pass under a bridge. ...
Directory of Open Access Journals (Sweden)
Hsin-Ying Lee
2014-01-01
Full Text Available The Mg0.1Zn0.9O films were grown using atomic layer deposition (ALD system and applied to metal-semiconductor-metal ultraviolet photodetectors (MSM-UPDs as an active layer. To suppress the dangling bonds on the Mg0.1Zn0.9O surface, the photoelectrochemical (PEC treatment was used to passivate the Mg0.1Zn0.9O surface, which could reduce the dark current of the MSM-UPDs about one order. Beside, to increase more incident light into the Mg0.1Zn0.9O active layer of the MSM-UPDs, the 500-nm-diameter silica nanospheres were spin-coated on the Mg0.1Zn0.9O active layer to improve the antireflection capability at the wavelength of 340 nm. The reflectivity of the Mg0.1Zn0.9O films with silica nanospheres antireflection layer decreased about 7.0% in comparison with the Mg0.1Zn0.9O films without silica nanospheres. The photocurrent and UV-visible ratio of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were enhanced to 5.85 μA and 1.44×104, respectively, at the bias voltage of 5 V. Moreover, the noise equivalent power and the specific detectivity of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were decreased to 2.60×10-13 W and increased to 1.21×1012 cmHz1/2W−1, respectively, at the bias voltage of 5 V. According to the above mentions, the PEC treatment and silica nanospheres antireflection layer could effectively enhance the performance of Mg0.1Zn0.9O MSM-UPDs.
ATLAS Monte Carlo tunes for MC09
The ATLAS collaboration
2010-01-01
This note describes the ATLAS tunes of underlying event and minimum bias description for the main Monte Carlo generators used in the MC09 production. For the main shower generators, pythia and herwig (with jimmy), the MRST LO* parton distribution functions (PDFs) were used for the first time in ATLAS. Special studies on the performance of these, conceptually new, PDFs for high pt physics processes at LHC energies are presented. In addition, a tune of jimmy for CTEQ6.6 is presented, for use with MC@NLO.
Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.
2012-01-01
Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699
Forward-backward multiplicity correlations in pp collisions at root s=0.9, 2.76 and 7 TeV
Adam, J.; Adamova, D.; Aggarwal, M. M.; Rinella, G. Aglieri; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmed, I.; Ahn, S. U.; Aimo, I.; Aiola, S.; Ajaz, M.; Akindinov, A.; Alam, S. N.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Alves Garcia Prado, C.; Andrei, C.; Andronic, A.; Anguelov, V.; Anielski, J.; Anticic, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshaeuser, H.; Arcelli, S.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I. C.; Arslandok, M.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Bach, M.; Badala, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Ball, M.; Pedrosa, F. Baltasar Dos Santos; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnafoeldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Camejo, A. Batista; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Martinez, H. Bello; Bellwied, R.; Belmont, R.; Belmont-Moreno, E.; Belyaev, V.; Bencedi, G.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Biswas, S.; Bjelogrlic, S.; Blanco, F.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Boggild, H.; Boldizsar, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Bossu, F.; Botje, M.; Botta, E.; Boettger, S.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buncic, P.; Busch, O.; Buthelezi, Z.; Buxton, J. T.; Caffarri, D.; Cai, X.; Caines, H.; Diaz, L. Calero; Caliva, A.; Calvo Villar, E.; Camerini, P.; Carena, F.; Carena, W.; Castellanos, J. Castillo; Castro, A. J.; Casula, E. A. R.; Cavicchioli, C.; Ceballos Sanchez, C.; Cepila, J.; Cerello, P.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Barroso, V. Chibante; Chinellato, D. D.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Balbastre, G. Conesa; del Valle, Z. Conesa; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Morales, Y. Corrales; Cortes Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Crochet, P.; Cruz Albino, R.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; De, S.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; Deloff, A.; Denes, E.; D'Erasmo, G.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Corchero, M. A. Diaz; Dietel, T.; Dillenseger, P.; Divia, R.; Djuvsland, O.; Dobrin, A.; Dobrowolski, T.; Domenicis Gimenez, D.; Doenigus, B.; Dordic, O.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Engel, H.; Erazmus, B.; Erdal, H. A.; Eschweiler, D.; Espagnon, B.; Esposito, M.; Estienne, M.; Esumi, S.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Felea, D.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernandez Tellez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Fleck, M. G.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Furs, A.; Girard, M. Fusco; Gaardhoje, J. J.; Gagliardi, M.; Gago, A. M.; Gallio, M.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Gargiulo, C.; Gasik, P.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glaessel, P.; Ramirez, A. Gomez; Gonzalez-Zamora, P.; Gorbunov, S.; Goerlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Grosse-Oetringhaus, J. F.; Grossiord, J. -Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Haake, R.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hanratty, L. D.; Hansen, A.; Harris, J. W.; Hartmann, H.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Hess, B. A.; Hetland, K. F.; Hilden, T. E.; Hillemanns, H.; Hippolyte, B.; Hristov, P.; Huang, M.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Ionita, C.; Ippolitov, M.; Irfan, M.; Ivanov, M.; Ivanov, V.; Jacholkowski, A.; Jacobs, P. M.; Jahnke, C.; Jang, H. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jimenez Bustamante, R. T.; Jones, P. G.; Jung, H.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kamin, J.; Kang, J. H.; Kaplin, V.; Kar, S.; Uysal, A. Karasu; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Khan, K. H.; Khan, M. M.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, B.; Kim, D. W.; Kim, D. J.; Kim, H.; Kim, J. S.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Boesing, C.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobayashi, T.; Kobdaj, C.; Kofarago, M.; Koehler, M. K.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kovalenko, V.; Kowalski, M.; Kox, S.; Meethaleveedu, G. Koyithatta; Kral, J.; Kralik, I.; Kravcakova, A.; Krelina, M.; Kretz, M.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kucera, V.; Kucheriaev, Y.; Kugathasan, T.; Kuhn, C.; Kuijer, P. G.; Kulakov, I.; Kumar, J.; Kumar, L.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lea, R.; Leardini, L.; Lee, G. R.; Legrand, I.; Lehnert, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; Leon Monzon, I.; Leoncino, M.; Levai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Lodato, D. F.; Loenne, P. I.; Loggins, V. R.; Loginov, V.; Loizides, C.; Lopez, X.; Lopez Torres, E.; Lowe, A.; Lu, X. -G.; Luettig, P.; Lunardon, M.; Luparello, G.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manceau, L.; Manko, V.; Manso, F.; Manzari, V.; Marchisone, M.; Mares, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marin, A.; Markert, C.; Marquard, M.; Martashvili, I.; Martin, N. A.; Blanco, J. Martin; Martinengo, P.; Martinez, M. I.; Garcia, G. Martinez; Martynov, Y.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastroserio, A.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzoni, M. A.; Mcdonald, D.; Meddi, F.; Menchaca-Rocha, A.; Meninno, E.; Perez, J. Mercado; Meres, M.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Minervini, L. M.; Mischke, A.; Mishra, A. N.; Miskowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Montano Zetina, L.; Montes, E.; Morando, M.; De Godoy, D. A. Moreira; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Muehlheim, D.; Muhuri, S.; Mukherjee, M.; Mueller, H.; Mulligan, J. D.; Munhoz, M. G.; Murray, S.; Musa, L.; Musinsky, J.; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Nattrass, C.; Nayak, K.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Nilsen, B. S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Oh, S. K.; Ohlson, A.; Okatan, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira Da Silva, A. C.; Onderwaater, J.; Oppedisano, C.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pagano, P.; Paic, G.; Pajares, C.; Pal, S. K.; Pan, J.; Pandey, A. K.; Pant, D.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, W. J.; Parmar, S.; Passfeld, A.; Patalakha, D. I.; Paticchio, V.; Paul, B.; Pawlak, T.; Peitzmann, T.; Da Costa, H. Pereira; De Oliveira Filho, E. Pereira; Peresunko, D.; Lara, C. E. Perez; Peskov, V.; Pestov, Y.; Petracek, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Ploskon, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Raniwala, R.; Raniwala, S.; Rasanen, S. S.; Rascanu, B. T.; Rathee, D.; Rauf, A. W.; Razazi, V.; Read, K. F.; Real, J. S.; Redlich, K.; Reed, R. J.; Rehman, A.; Reichelt, P.; Reicher, M.; Reidt, F.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Rettig, F.; Revol, J. -P.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rivetti, A.; Rocco, E.; Rodriguez Cahuantzi, M.; Manso, A. Rodriguez; Roed, K.; Rogochaya, E.; Rohr, D.; Rohrich, D.; Romita, R.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Sadovsky, S.; Safarik, K. .; Sahlmuller, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salgado, C. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Castro, X. Sanchez; Sandor, L.; Sandoval, A.; Sano, M.; Santagati, G.; Sarkar, D.; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schuchmann, S.; Schukraft, J.; Schulc, M.; Schuster, T.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Seeder, K. S.; Segato, G.; Seger, J. E.; Sekiguchi, Y.; Selyuzhenkov, I.; Senosi, K.; Seo, J.; Serradilla, E.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, N.; Shigaki, K.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Singaraju, R.; Singh, R.; Singha, S.; Singhal, V.; Sinha, B. C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Skjerdal, K.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Sogaard, C.; Soltz, R.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Spacek, M.; Spiriti, E.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stefanek, G.; Steinpreis, M.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Sultanov, R.; Sumbera, M.; Symons, T. J. M.; Szabo, A.; de Toledo, A. Szanto; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Takahashi, J.; Tanaka, N.; Tangaro, M. A.; Takaki, J. D. Tapia; Peloni, A. Tarantola; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Munoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thaeder, J.; Thomas, D.; Tieulent, R.; Timmins, A. R.; Toia, A.; Trogolo, S.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vajzer, M.; Vala, M.; Palomo, L. Valencia; Vallero, S.; Van der Maarel, J.; Van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vyvre, P. Vande; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vechernin, V.; Veen, A. M.; Veldhoen, M.; Velure, A.; Venaruzzo, M.; Vercellin, E.; Vergara Limon, S.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Viinikainen, J.; Vilakazi, Z.; Baillie, O. Villalobos; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Vislavicius, V.; Viyogi, Y. P.; Vodopyanov, A.; Voelkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Vranic, D.; Vrlakova, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Wang, Y.; Watanabe, D.; Weber, M.; Weber, S. G.; Wessels, J. P.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilkinson, J.; Williams, M. C. S.; Windelband, B.; Winn, M.; Yaldo, C. G.; Yamaguchi, Y.; Yang, H.; Yang, P.; Yano, S.; Yasnopolskiy, S.; Yin, Z.; Yokoyama, H.; Yoo, I. -K.; Yurchenko, V.; Yushmanov, I.; Zaborowska, A.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zgura, I. S.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zyzak, M.
2015-01-01
The strength of forward-backward (FB) multiplicity correlations is measured by the ALICE detector in proton-proton (pp) collisions at = 0.9, 2.76 and 7 TeV. The measurement is performed in the central pseudorapidity region (|eta| <0.8) for the transverse momentum p (T) > 0.3 GeV/c. Two separate
THE FERMI-GBM X-RAY BURST MONITOR: THERMONUCLEAR BURSTS FROM 4U 0614+09
International Nuclear Information System (INIS)
Linares, M.; Chakrabarty, D.; Connaughton, V.; Bhat, P. N.; Briggs, M. S.; Preece, R.; Jenke, P.; Kouveliotou, C.; Wilson-Hodge, C. A.; Van der Horst, A. J.; Camero-Arranz, A.; Finger, M.; Paciesas, W. S.; Beklen, E.; Von Kienlin, A.
2012-01-01
Thermonuclear bursts from slowly accreting neutron stars (NSs) have proven difficult to detect, yet they are potential probes of the thermal properties of the NS interior. During the first year of a systematic all-sky search for X-ray bursts using the Gamma-ray Burst Monitor aboard the Fermi Gamma-ray Space Telescope we have detected 15 thermonuclear bursts from the NS low-mass X-ray binary 4U 0614+09 when it was accreting at nearly 1% of the Eddington limit. We measured an average burst recurrence time of 12 ± 3 days (68% confidence interval) between 2010 March and 2011 March, classified all bursts as normal duration bursts and placed a lower limit on the recurrence time of long/intermediate bursts of 62 days (95% confidence level). We discuss how observations of thermonuclear bursts in the hard X-ray band compare to pointed soft X-ray observations and quantify such bandpass effects on measurements of burst radiated energy and duration. We put our results for 4U 0614+09 in the context of other bursters and briefly discuss the constraints on ignition models. Interestingly, we find that the burst energies in 4U 0614+09 are on average between those of normal duration bursts and those measured in long/intermediate bursts. Such a continuous distribution in burst energy provides a new observational link between normal and long/intermediate bursts. We suggest that the apparent bimodal distribution that defined normal and long/intermediate duration bursts during the last decade could be due to an observational bias toward detecting only the longest and most energetic bursts from slowly accreting NSs.
The leaching of lead from lead-based paint in landfill environments.
Wadanambi, Lakmini; Dubey, Brajesh; Townsend, Timothy
2008-08-30
Lead leaching from lead-based paint (LBP) was examined using standardized laboratory protocols and tests with leachate from actual and simulated landfill environments. Two different LBP samples were tested; leaching solutions included leachates from three municipal solid waste (MSW) landfills and three construction and demolition (C&D) debris landfills. The toxicity characteristic leaching procedure (TCLP) and the synthetic precipitation leaching procedure (SPLP) were also performed. Lead concentrations were many times higher using the TCLP compared to the SPLP and the landfill leachates. No significant difference (alpha=0.05) was observed in leached lead concentrations from the MSW landfill and C&D debris landfill leachates. The impact of other building materials present in LBP debris on lead leaching was examined by testing mixtures of LBP (2%) and different building materials (98%; steel, wood, drywall, concrete). The type of substrate present impacted lead leaching results, with concrete demonstrating the most dramatic impact; the lowest lead concentrations were measured in the presence of concrete under both TCLP and SPLP extractions.
DEFF Research Database (Denmark)
Nissen, Klaus; Bogedal Jorgensen, Lene; Lindegaard Berg, Dorthe
2017-01-01
Purpose. Results of an evaluation of the stability of methotrexate in 0.9% sodium chloride injection and 5% dextrose injection are presented. Methods. Methotrexate concentrated solution (100 mg/mL) was diluted to nominal concentrations of 0.2 and 20 mg/mL in infusion bags containing 0.9% sodium...... chloride injection or 5% dextrose injection. The filled bags were stored for 28 days at 25 °C and 60% relative humidity and protected from light. Samples were withdrawn for analysis on the day of preparation and after 3, 7, 14, 21, and 28 days. The test program included visual inspections, measurements...... in amounts of known and unknown degradation products were detected. In 5% dextrose injection, methotrexate at the higher concentration was stable for 28 days, with minor formation of degradation products; in the 0.2-mg/mL solution, however, methotrexate was stable for only 3 days. At later time points...
Salt-stone Oxidation Study: Leaching Method - 13092
Energy Technology Data Exchange (ETDEWEB)
Langton, C.A.; Stefanko, D.B.; Burns, H.H. [Savannah River National Laboratory, Savannah River Remediation, LLC, Savannah River Site, Aiken, SC 29808 (United States)
2013-07-01
Cementitious waste forms can be designed to chemically stabilize selected contaminants, such as Tc{sup +7} and Cr{sup +6}, by chemically reduction to lower valance states, Tc{sup +4} and Cr{sup +3}, respectively, and precipitation of these species in alkaline media as low solubility solid phases. Data for oxidation of this type of cementitious waste form cured under field conditions as a function of time is required for predicting the performance of the waste form and disposal facility. The rate of oxidation (oxidation front advancement) is an important parameter for predicting performance because the solubilities of some radionuclide contaminants, e.g., technetium, are a function of the oxidation state. A non-radioactive experiment was designed for quantifying the oxidation front advancement using chromium, as an approximate redox-sensitive surrogate (Cr{sup +6} / Cr{sup +3}) for technetium (Tc{sup +7} / Tc{sup +4}). Nonradioactive cementitious waste forms were prepared in the laboratory and cured under both laboratory and 'field conditions'. Laboratory conditions were ambient temperature and sealed sample containers. Field conditions were approximated by curing samples in open containers which were placed inside a plastic container stored outdoors at SRS. The container had a lid and was instrumented with temperature and humidity probes. Sub-samples as thin as 0.2 mm were taken as a function of distance from the exposed surface of the as-cast sample. The sub-samples were leached and the leachates were analyzed for chromium, nitrate, nitrite and sodium. Nitrate, nitrite, and sodium concentrations were used to provide baseline data because these species are not chemically retained in the waste form matrix to any significant extent and are not redox sensitive. 'Effective' oxidation fronts for Cr were measured for samples containing 1000, 500 and 20 mg/kg Cr added as soluble sodium chromate, Na{sub 2}CrO{sub 4}. For a sample cured for 129 days
DEFF Research Database (Denmark)
Fast, Søren; Nielsen, Viveque Egsgaard; Bonnema, Steen Joop
2009-01-01
Context: Recombinant human TSH (rhTSH) is used to augment the effect of radioiodine therapy for nontoxic multinodular goitre. Reports of acute thyroid swelling and hyperthyroidism warrant safety studies evaluating whether these side-effects are dose-dependent. Objective: To determine the effects...... on thyroid size and function of various doses of rhTSH. Design: In nine healthy male volunteers the effect of placebo, 0.1, 0.3 and 0.9 mg of rhTSH was examined in a paired design including four consecutive study rounds. Main outcome measures: Were evaluated at baseline, 24h, 48h, 96h, 7 days and 28 days...... after rhTSH and included: Thyroid volume (TV) estimation by planimetric ultrasound, and thyroid function by serum TSH, freeT3, freeT4 and Tg levels. Results: Following placebo or 0.1 mg rhTSH the TV did not change significantly from baseline at any time. At 24 and 48 hours after administration of 0.3 mg...
Comparative Effects of Biochar, Slag and Ferrous-Mn Ore on Lead and Cadmium Immobilization in Soil.
Mehmood, Sajid; Rizwan, Muhammad; Bashir, Saqib; Ditta, Allah; Aziz, Omar; Yong, Li Zhe; Dai, Zhihua; Akmal, Muhammad; Ahmed, Waqas; Adeel, Muhammad; Imtiaz, Muhammad; Tu, Shuxin
2018-02-01
A variety of remediation approaches have been applied to the heavy metals-contaminated soils, however, the immobilization of metals in co-contaminated soils still not cleared. Therefore, an incubation study was conducted to evaluate the instantaneous effects of different concentrations of biochar (BC), slag (SL) and Fe-Mn ore (FMO) on immobilization of Pb and Cd through the Toxicity Characteristic Leaching Procedure (TCLP) by following the the European Community Bureau of Reference (BCR), CaCl 2 and NH 4 NO 3 . The sequential extraction of BCR showed decrease in acid soluble fractions, while the residual proportions of Pb and Cd were enhanced with increasing concentrations of SL and BC. Addition of BC significantly lowered the extractable fractions of both metals by TCLP, NH 4 NO 3 and CaCl 2 as compared to SL and FMO. Among all amendments, BC incorporation into co-contaminated soil offered promising results for Pb and Cd immobilization. Overall, all amendments showed positive and long-term impact on the reclamation of co-contaminated soil with heavy metals and could deserve advance monitoring studies on a field scale.
Carbon bed mercury emissions control for mixed waste treatment.
Soelberg, Nick; Enneking, Joe
2010-11-01
Mercury has various uses in nuclear fuel reprocessing and other nuclear processes, and so it is often present in radioactive and mixed (radioactive and hazardous) wastes. Compliance with air emission regulations such as the Hazardous Waste Combustor (HWC) Maximum Achievable Control Technology (MACT) standards can require off-gas mercury removal efficiencies up to 99.999% for thermally treating some mixed waste streams. Test programs have demonstrated this level of off-gas mercury control using fixed beds of granular sulfur-impregnated activated carbon. Other results of these tests include (1) the depth of the mercury control mass transfer zone was less than 15-30 cm for the operating conditions of these tests; (2) MERSORB carbon can sorb mercury up to 19 wt % of the carbon mass; and (3) the spent carbon retained almost all (98.3-99.99%) of the mercury during Toxicity Characteristic Leachability Procedure (TCLP) tests, but when even a small fraction of the total mercury dissolves, the spent carbon can fail the TCLP test when the spent carbon contains high mercury concentrations.
NCBI nr-aa BLAST: CBRC-OLAT-09-0016 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-OLAT-09-0016 sp|P43141|ADB4C_MELGA Beta-4C adrenergic receptor (Beta-4C adreno...ceptor) (Beta-4C adrenoreceptor) gb|AAA62151.1| beta-4C-adrenergic receptor gb|AAA62150.1| adrenergic beta-4c receptor P43141 1e-107 51% ...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the...
Establishment of new disposal capacity for the Savannah River Plant
International Nuclear Information System (INIS)
Albenesius, E.L.; Wilhite, E.L.
1987-01-01
Two new low-level waste (LLW) disposal sites for decontaminated salt solidified with cement and fly ash (saltstone) and for conventional solid LLW are planned for SRP in the next several years. An above-ground vault disposal system for saltstone was designed to minimize impact on the environment by controlling permeability and diffusivity of the waste form and concrete liner. The experimental program leading to the engineered disposal system included formulation studies, multiple approaches to measurement of permeability and diffusivity, extensive mathematical modeling, and large-scale lysimeter tests to validate model projections. The overall study is an example of the systems approach to disposal site design to achieve a predetermined performance objective. The same systems approach is being used to develop alternative designs for disposal of conventional LLW at the Savannah River Plant. 14 figures
DEFF Research Database (Denmark)
Basith, M. A.; Ngo, Duc-The; Quader, A.
2014-01-01
We present a simple technique to synthesize ultrafine nanoparticles directly from bulk multiferroic perovskitepowder. The starting materials, which were ceramic pellets of the nominal compositions Bi0.9Gd0.1-Fe1−xTixO3 (x = 0.00–0.20), were prepared initially by a solid state reaction technique, ...
Yang, Wen-Tao; Wang, Ying-Jie; Zhou, Hang; Yi, Kai-Xin; Zeng, Min; Peng, Pei-Qin; Liao, Bo-Han
2015-02-01
Speciation and bioavailability of arsenic in the rhizosphere and non-rhizosphere soils at different growth stages (tillering stage, jointing stage, booting stage, filling stage and maturing stage) of rice (Oryza sativa L.) were studied using toxicity characteristic leaching procedure (TCLP) and arsenic speciation analysis. Pot experiments were conducted and the soil samples were taken from a certain paddy soil in Hunan Province contaminated by mining industry. The results showed that: (1) With the extension of rice growth period, pH values and TCLP extractable arsenic levels in the rhizosphere and non-rhizosphere soils increased gradually. Soil pH and TCLP extractable arsenic levels in non-rhizosphere soils were higher than those in the rhizosphere soils at the same growth stage. (2) At the different growth stages of rice, contents of exchangeable arsenic (AE-As) in rhizosphere and non-rhizosphere soils were lower than those before the rice planting, and increased gradually with the extension of the rice growing period. Contents of Al-bound arsenic (Al-As), Fe-bound arsenic (Fe-As) and Ca-bound arsenic (Ca-As) increased gradually after rice planting, but not significantly. Residual arsenic (O-As) and total arsenic (T-As) decreased gradually after rice planting, by 37.30% and 14.69% in the rhizosphere soils and by 31.38% and 8.67% in the non-rhizosphere soils, respectively. (3) At the different growth stages of rice, contents of various forms of arsenic in the soils were in the following order: residual arsenic (O-As) > Fe-bound arsenic ( Fe-As) > Al-bound arsenic (Al-As) > Ca-bound arsenic (Ca-As) > exchangeable arsenic (AE-As). In the pH range of 5.0- 5.8, significant positive linear correlations were found between most forms of arsenic or TCLP extractable arsenic levels and pH values, while the Ca-bound arsenic was poorly correlated with pH values in the rhizosphere soils.
National Oceanic and Atmospheric Administration, Department of Commerce — Physical and profile oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater...
Hecq, J-D; Godet, M; Gillet, P; Jamart, J; Galanti, L
2014-01-01
The aim of this study was to investigate the long-term stability of morphine hydrochloride in 0.9% NaCI infusion polyolefin bags and polypropylene syringes after storage at 5 degrees C + 3 degrees C and to evaluate the influence of initial freezing and microwave thawing on this stability. Ten polyolefin bags and five polypropylene syringes containing 100 mL of 1 mg/mL of morphine hydrochloride solution in 0.9% NaCI were prepared under aseptic conditions. Five polyolefin bags were frozen at -20 degrees C for 90 days before storage. Immediately after the preparation and after thawing, 2 mL of each bag were withdrawn for the initial concentration measurements. All polyolefin bags and polypropylene syringes were then refrigerated at 5 degrees C + 3 degrees C for 58 days during which the morphine concentrations were measured periodically by high-performance liquid chromatography using a reversed-phase column, naloxone as internal standard, a mobile phase consisting of 5% acetonitrile and 95% of KH2PO4 buffer (pH 3.50), and detection with diode array detector at 254 nm. Visual and microscopic observations and spectrophotometric and pH measurements were also performed. Solutions were considered stable if the concentration remained superior to 90% of the initial concentration. The degradation products peaks were not quantitatively significant and were resolved from the native drug. Polyolefin bag and polypropylene syringe solutions were stable when stored at 5 degrees C + 3 degrees C during these 58 days. No color change or precipitation in the solutions was observed. The physical stability was confirmed by visual, microscopic, and spectrophotometric inspection. There was no significant change in pH during storage. Freezing and microwave thawing didn't influence the infusion stability. Morphine hydrochloride infusions may be prepared in advance by centralized intravenous additive service, frozen in polyolefin bags, and microwave thawed before storage under refrigeration
Energy Technology Data Exchange (ETDEWEB)
Lim, Ae Ran, E-mail: aeranlim@hanmail.net [Department of Science Education, Jeonju University, Jeonju 560-759 (Korea, Republic of); Department of Carbon Fusion Engineering, Jeonju University, Jeonju 560-759 (Korea, Republic of)
2016-03-01
Temperature dependences of the chemical shift and spin-lattice relaxation time in the rotating frame T{sub 1ρ} were measured for {sup 1}H and {sup 13}C nuclei in mixed crystals of the form [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 1-x} Co{sub x}Cl{sub 4} (x = 0, 0.5, 0.7, 0.9, and 1). The mixed crystals varied in color according to the amount of Co{sup 2+} ions, whereas the phase transition temperatures remained nearly unchanged. [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4} and [N(CH{sub 3}){sub 4}]{sub 2}CoCl{sub 4} crystals contain two nonequivalent types of a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4}. The two crystallographically different ions a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4} were distinguished using {sup 13}C CP/MAS NMR spectroscopy. The NMR spectrum and T{sub 1ρ} for {sup 1}H and {sup 13}C in case of x = 0.5 and x = 0.7 were similar to those for [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4}, whereas those for x = 0.9 were absolutely different. Additionally, [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 0.1}Co{sub 0.9}Cl{sub 4} exhibited the structural properties of both [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4} and [N(CH{sub 3}){sub 4}]{sub 2}CoCl{sub 4}. - Highlights: • Chemical shift and spin-lattice relaxation time in rotating frame. • Two crystallographically different ions a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4}. • Structural properties of mixed crystals.
Preliminary characterization of abandoned septic tank systems. Volume 2: Appendix D
International Nuclear Information System (INIS)
1995-12-01
In an effort to support remedial investigations of abandoned septic tanks by US DOE, this report contains the results of chemical analyses of the contents of these abandoned tanks. Analytical data are presented for the following: volatile/TCLP volatile organics; semivolatile/TCLP semivolatile organics; PCB organics; total petroleum hydrocarbons; and total metals. The abandoned systems potentially received wastes or effluent from buildings which could have discharged non-domestic, petroleum hydrocarbons, hazardous, radioactive and/or mixed wastes. The 20 sites investigated are located on the Nevada Test Site
Abelev, Betty Bezverkhny; Adamova, Dagmar; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agostinelli, Andrea; Agrawal, Neelima; Ahammed, Zubayer; Ahmad, Nazeer; Ahmed, Ijaz; Ahn, Sang Un; Ahn, Sul-Ah; Aimo, Ilaria; Aiola, Salvatore; Ajaz, Muhammad; Akindinov, Alexander; Alam, Sk Noor; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alici, Andrea; Alkin, Anton; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Armesto Perez, Nestor; Arnaldi, Roberta; Aronsson, Tomas; Arsene, Ionut Cristian; Arslandok, Mesut; Augustinus, Andre; Averbeck, Ralf Peter; Awes, Terry; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Baltasar Dos Santos Pedrosa, Fernando; Baral, Rama Chandra; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartke, Jerzy Gustaw; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Baumann, Christoph Heinrich; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bellwied, Rene; Belmont Moreno, Ernesto; Belmont Iii, Ronald John; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Berger, Martin Emanuel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Bjelogrlic, Sandro; Blanco, Fernando; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Bogolyubskiy, Mikhail; Boehmer, Felix Valentin; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botje, Michiel; Botta, Elena; Boettger, Stefan; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Catanescu, Vasile Ioan; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Chang, Beomsu; Chapeland, Sylvain; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Chochula, Peter; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortese, Pietro; Cortes Maldonado, Ismael; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dainese, Andrea; Dang, Ruina; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Kushal; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; Delagrange, Hugues; Deloff, Andrzej; Denes, Ervin Sandor; D'Erasmo, Ginevra; De Caro, Annalisa; De Cataldo, Giacinto; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; De Rooij, Raoul Stefan; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Di Bari, Domenico; Di Liberto, Sergio; Di Mauro, Antonio; Di Nezza, Pasquale; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Dobrowolski, Tadeusz Antoni; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Dorheim, Sverre; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent; Dupieux, Pascal; Dutt Mazumder, Abhee Kanti; Hilden, Timo Eero; Ehlers Iii, Raymond James; Elia, Domenico; Engel, Heiko; Erazmus, Barbara Ewa; Erdal, Hege Austrheim; Eschweiler, Dominic; Espagnon, Bruno; Esposito, Marco; Estienne, Magali Danielle; Esumi, Shinichi; Evans, David; Evdokimov, Sergey; Fabris, Daniela; Faivre, Julien; Falchieri, Davide; Fantoni, Alessandra; Fasel, Markus; Fehlker, Dominik; Feldkamp, Linus; Felea, Daniel; Feliciello, Alessandro; Feofilov, Grigory; Ferencei, Jozef; Fernandez Tellez, Arturo; Gonzalez Ferreiro, Elena; Ferretti, Alessandro; Festanti, Andrea; Figiel, Jan; Araujo Silva Figueredo, Marcel; Filchagin, Sergey; Finogeev, Dmitry; Fionda, Fiorella; Fiore, Enrichetta Maria; Floratos, Emmanouil; Floris, Michele; Foertsch, Siegfried Valentin; Foka, Panagiota; Fokin, Sergey; Fragiacomo, Enrico; Francescon, Andrea; Frankenfeld, Ulrich Michael; Fuchs, Ulrich; Furget, Christophe; Furs, Artur; Fusco Girard, Mario; Gaardhoeje, Jens Joergen; Gagliardi, Martino; Gago Medina, Alberto Martin; Gallio, Mauro; Gangadharan, Dhevan Raja; Ganoti, Paraskevi; Gao, Chaosong; Garabatos Cuadrado, Jose; Garcia-Solis, Edmundo Javier; Gargiulo, Corrado; Garishvili, Irakli; Gerhard, Jochen; Germain, Marie; Gheata, Andrei George; Gheata, Mihaela; Ghidini, Bruno; Ghosh, Premomoy; Ghosh, Sanjay Kumar; Gianotti, Paola; Giubellino, Paolo; Gladysz-Dziadus, Ewa; Glassel, Peter; Gomez Ramirez, Andres; Gonzalez Zamora, Pedro; Gorbunov, Sergey; Gorlich, Lidia Maria; Gotovac, Sven; Graczykowski, Lukasz Kamil; Grelli, Alessandro; Grigoras, Alina Gabriela; Grigoras, Costin; Grigoryev, Vladislav; Grigoryan, Ara; Grigoryan, Smbat; Grynyov, Borys; Grion, Nevio; Grosse-Oetringhaus, Jan Fiete; Grossiord, Jean-Yves; Grosso, Raffaele; Guber, Fedor; Guernane, Rachid; Guerzoni, Barbara; Guilbaud, Maxime Rene Joseph; Gulbrandsen, Kristjan Herlache; Gulkanyan, Hrant; Gumbo, Mervyn; Gunji, Taku; Gupta, Anik; Gupta, Ramni; Khan, Kamal; Haake, Rudiger; Haaland, Oystein Senneset; Hadjidakis, Cynthia Marie; Haiduc, Maria; Hamagaki, Hideki; Hamar, Gergoe; Hanratty, Luke David; Hansen, Alexander; Harris, John William; Hartmann, Helvi; Harton, Austin Vincent; Hatzifotiadou, Despina; Hayashi, Shinichi; Heckel, Stefan Thomas; Heide, Markus Ansgar; Helstrup, Haavard; Herghelegiu, Andrei Ionut; Herrera Corral, Gerardo Antonio; Hess, Benjamin Andreas; Hetland, Kristin Fanebust; Hippolyte, Boris; Hladky, Jan; Hristov, Peter Zahariev; Huang, Meidana; Humanic, Thomas; Hussain, Nur; Hussain, Tahir; Hutter, Dirk; Hwang, Dae Sung; Ilkaev, Radiy; Ilkiv, Iryna; Inaba, Motoi; Innocenti, Gian Michele; Ionita, Costin; Ippolitov, Mikhail; Irfan, Muhammad; Ivanov, Marian; Ivanov, Vladimir; Jacholkowski, Adam Wlodzimierz; Jacobs, Peter Martin; Jahnke, Cristiane; Jang, Haeng Jin; Janik, Malgorzata Anna; Pahula Hewage, Sandun; Jena, Chitrasen; Jena, Satyajit; Jimenez Bustamante, Raul Tonatiuh; Jones, Peter Graham; Jung, Hyungtaik; Jusko, Anton; Kadyshevskiy, Vladimir; Kalinak, Peter; Kalweit, Alexander Philipp; Kamin, Jason Adrian; Kang, Ju Hwan; Kaplin, Vladimir; Kar, Somnath; Karasu Uysal, Ayben; Karavichev, Oleg; Karavicheva, Tatiana; Karpechev, Evgeny; Kebschull, Udo Wolfgang; Keidel, Ralf; Keijdener, Darius Laurens; Keil, Markus; Khan, Mohammed Mohisin; Khan, Palash; Khan, Shuaib Ahmad; Khanzadeev, Alexei; Kharlov, Yury; Kileng, Bjarte; Kim, Beomkyu; Kim, Do Won; Kim, Dong Jo; Kim, Jinsook; Kim, Mimae; Kim, Minwoo; Kim, Se Yong; Kim, Taesoo; Kirsch, Stefan; Kisel, Ivan; Kiselev, Sergey; Kisiel, Adam Ryszard; Kiss, Gabor; Klay, Jennifer Lynn; Klein, Jochen; Klein-Boesing, Christian; Kluge, Alexander; Knichel, Michael Linus; Knospe, Anders Garritt; Kobdaj, Chinorat; Kofarago, Monika; Kohler, Markus Konrad; Kollegger, Thorsten; Kolozhvari, Anatoly; Kondratev, Valerii; Kondratyeva, Natalia; Konevskikh, Artem; Kovalenko, Vladimir; Kowalski, Marek; Kox, Serge; Koyithatta Meethaleveedu, Greeshma; Kral, Jiri; Kralik, Ivan; Kravcakova, Adela; Krelina, Michal; Kretz, Matthias; Krivda, Marian; Krizek, Filip; Kryshen, Evgeny; Krzewicki, Mikolaj; Kucera, Vit; Kucheryaev, Yury; Kugathasan, Thanushan; Kuhn, Christian Claude; Kuijer, Paulus Gerardus; Kulakov, Igor; Kumar, Jitendra; Kurashvili, Podist; Kurepin, Alexander; Kurepin, Alexey; Kuryakin, Alexey; Kushpil, Svetlana; Kweon, Min Jung; Kwon, Youngil; Ladron De Guevara, Pedro; Lagana Fernandes, Caio; Lakomov, Igor; Langoy, Rune; Lara Martinez, Camilo Ernesto; Lardeux, Antoine Xavier; Lattuca, Alessandra; La Pointe, Sarah Louise; La Rocca, Paola; Lea, Ramona; Leardini, Lucia; Lee, Graham Richard; Legrand, Iosif; Lehnert, Joerg Walter; Lemmon, Roy Crawford; Lenti, Vito; Leogrande, Emilia; Leoncino, Marco; Leon Monzon, Ildefonso; Levai, Peter; Li, Shuang; Lien, Jorgen Andre; Lietava, Roman; Lindal, Svein; Lindenstruth, Volker; Lippmann, Christian; Lisa, Michael Annan; Ljunggren, Hans Martin; Lodato, Davide Francesco; Lonne, Per-Ivar; Loggins, Vera Renee; Loginov, Vitaly; Lohner, Daniel; Loizides, Constantinos; Lopez, Xavier Bernard; Lopez Torres, Ernesto; Lu, Xianguo; Luettig, Philipp Johannes; Lunardon, Marcello; Luparello, Grazia; Ma, Rongrong; Maevskaya, Alla; Mager, Magnus; Mahapatra, Durga Prasad; Mahmood, Sohail Musa; Maire, Antonin; Majka, Richard Daniel; Malaev, Mikhail; Maldonado Cervantes, Ivonne Alicia; Malinina, Liudmila; Mal'Kevich, Dmitry; Malzacher, Peter; Mamonov, Alexander; Manceau, Loic Henri Antoine; Manko, Vladislav; Manso, Franck; Manzari, Vito; Marchisone, Massimiliano; Mares, Jiri; Margagliotti, Giacomo Vito; Margotti, Anselmo; Marin, Ana Maria; Markert, Christina; Marquard, Marco; Martashvili, Irakli; Martin, Nicole Alice; Martinengo, Paolo; Martinez Hernandez, Mario Ivan; Martinez-Garcia, Gines; Martin Blanco, Javier; Martynov, Yevgen; Mas, Alexis Jean-Michel; Masciocchi, Silvia; Masera, Massimo; Masoni, Alberto; Massacrier, Laure Marie; Mastroserio, Annalisa; Matyja, Adam Tomasz; Mayer, Christoph; Mazer, Joel Anthony; Mazzoni, Alessandra Maria; Mcdonald, Daniel; Meddi, Franco; Menchaca-Rocha, Arturo Alejandro; Meninno, Elisa; Mercado-Perez, Jorge; Meres, Michal; Miake, Yasuo; Mikhaylov, Konstantin; Milano, Leonardo; Milosevic, Jovan; Mischke, Andre; Mishra, Aditya Nath; Miskowiec, Dariusz Czeslaw; Mitra, Jubin; Mitu, Ciprian Mihai; Mlynarz, Jocelyn; Mohammadi, Naghmeh; Mohanty, Bedangadas; Molnar, Levente; Montano Zetina, Luis Manuel; Montes Prado, Esther; Morando, Maurizio; Moreira De Godoy, Denise Aparecida; Moretto, Sandra; Morreale, Astrid; Morsch, Andreas; Muccifora, Valeria; Mudnic, Eugen; Muhlheim, Daniel Michael; Muhuri, Sanjib; Mukherjee, Maitreyee; Muller, Hans; Gameiro Munhoz, Marcelo; Murray, Sean; Musa, Luciano; Musinsky, Jan; Nandi, Basanta Kumar; Nania, Rosario; Nappi, Eugenio; Nattrass, Christine; Nayak, Kishora; Nayak, Tapan Kumar; Nazarenko, Sergey; Nedosekin, Alexander; Nicassio, Maria; Niculescu, Mihai; Niedziela, Jeremi; Nielsen, Borge Svane; Nikolaev, Sergey; Nikulin, Sergey; Nikulin, Vladimir; Nilsen, Bjorn Steven; Noferini, Francesco; Nomokonov, Petr; Nooren, Gerardus; Norman, Jaime; Nyanin, Alexander; Nystrand, Joakim Ingemar; Oeschler, Helmut Oskar; Oh, Saehanseul; Oh, Sun Kun; Okatan, Ali; Okubo, Tsubasa; Olah, Laszlo; Oleniacz, Janusz; Oliveira Da Silva, Antonio Carlos; Onderwaater, Jacobus; Oppedisano, Chiara; Ortiz Velasquez, Antonio; Oskarsson, Anders Nils Erik; Otwinowski, Jacek Tomasz; Oyama, Ken; Ozdemir, Mahmut; Pachmayer, Yvonne Chiara; Pachr, Milos; Pagano, Paola; Paic, Guy; Pajares Vales, Carlos; Pal, Susanta Kumar; Palmeri, Armando; Pant, Divyash; Papikyan, Vardanush; Pappalardo, Giuseppe; Pareek, Pooja; Park, Woojin; Parmar, Sonia; Passfeld, Annika; Patalakha, Dmitry; Paticchio, Vincenzo; Paul, Biswarup; Pawlak, Tomasz Jan; Peitzmann, Thomas; Pereira Da Costa, Hugo Denis Antonio; Pereira De Oliveira Filho, Elienos; Peresunko, Dmitry Yurevich; Perez Lara, Carlos Eugenio; Pesci, Alessandro; Peskov, Vladimir; Pestov, Yury; Petracek, Vojtech; Petran, Michal; Petris, Mariana; Petrovici, Mihai; Petta, Catia; Piano, Stefano; Pikna, Miroslav; Pillot, Philippe; Pinazza, Ombretta; Pinsky, Lawrence; Piyarathna, Danthasinghe; Ploskon, Mateusz Andrzej; Planinic, Mirko; Pluta, Jan Marian; Pochybova, Sona; Podesta Lerma, Pedro Luis Manuel; Poghosyan, Martin; Pohjoisaho, Esko Heikki Oskari; Polishchuk, Boris; Poljak, Nikola; Pop, Amalia; Porteboeuf, Sarah Julie; Porter, R Jefferson; Potukuchi, Baba; Prasad, Sidharth Kumar; Preghenella, Roberto; Prino, Francesco; Pruneau, Claude Andre; Pshenichnov, Igor; Puccio, Maximiliano; Puddu, Giovanna; Pujahari, Prabhat Ranjan; Punin, Valery; Putschke, Jorn Henning; Qvigstad, Henrik; Rachevski, Alexandre; Raha, Sibaji; Rajput, Sonia; Rak, Jan; Rakotozafindrabe, Andry Malala; Ramello, Luciano; Raniwala, Rashmi; Raniwala, Sudhir; Rasanen, Sami Sakari; Rascanu, Bogdan Theodor; Rathee, Deepika; Rauf, Aamer Wali; Razazi, Vahedeh; Read, Kenneth Francis; Real, Jean-Sebastien; Redlich, Krzysztof; Reed, Rosi Jan; Rehman, Attiq Ur; Reichelt, Patrick Simon; Reicher, Martijn; Reidt, Felix; Renfordt, Rainer Arno Ernst; Reolon, Anna Rita; Reshetin, Andrey; Rettig, Felix Vincenz; Revol, Jean-Pierre; Reygers, Klaus Johannes; Riabov, Viktor; Ricci, Renato Angelo; Richert, Tuva Ora Herenui; Richter, Matthias Rudolph; Riedler, Petra; Riegler, Werner; Riggi, Francesco; Rivetti, Angelo; Rocco, Elena; Rodriguez Cahuantzi, Mario; Rodriguez Manso, Alis; Roeed, Ketil; Rogochaya, Elena; Sharma, Rohni; Rohr, David Michael; Roehrich, Dieter; Romita, Rosa; Ronchetti, Federico; Ronflette, Lucile; Rosnet, Philippe; Rossi, Andrea; Roukoutakis, Filimon; Roy, Ankhi; Roy, Christelle Sophie; Roy, Pradip Kumar; Rubio Montero, Antonio Juan; Rui, Rinaldo; Russo, Riccardo; Ryabinkin, Evgeny; Ryabov, Yury; Rybicki, Andrzej; Sadovskiy, Sergey; Safarik, Karel; Sahlmuller, Baldo; Sahoo, Pragati; Sahoo, Raghunath; Sahoo, Sarita; Sahu, Pradip Kumar; Saini, Jogender; Sakai, Shingo; Salgado Lopez, Carlos Alberto; Salzwedel, Jai Samuel Nielsen; Sambyal, Sanjeev Singh; Samsonov, Vladimir; Sanchez Castro, Xitzel; Sanchez Rodriguez, Fernando Javier; Sandor, Ladislav; Sandoval, Andres; Sano, Masato; Santagati, Gianluca; Sarkar, Debojit; Scapparone, Eugenio; Scarlassara, Fernando; Scharenberg, Rolf Paul; Schiaua, Claudiu Cornel; Schicker, Rainer Martin; Schmidt, Christian Joachim; Schmidt, Hans Rudolf; Schuchmann, Simone; Schukraft, Jurgen; Schulc, Martin; Schuster, Tim Robin; Schutz, Yves Roland; Schwarz, Kilian Eberhard; Schweda, Kai Oliver; Scioli, Gilda; Scomparin, Enrico; Scott, Rebecca Michelle; Segato, Gianfranco; Seger, Janet Elizabeth; Sekiguchi, Yuko; Selyuzhenkov, Ilya; Senosi, Kgotlaesele; Seo, Jeewon; Serradilla Rodriguez, Eulogio; Sevcenco, Adrian; Shabetai, Alexandre; Shabratova, Galina; Shahoyan, Ruben; Shangaraev, Artem; Sharma, Ankita; Sharma, Natasha; Sharma, Satish; Shigaki, Kenta; Shtejer Diaz, Katherin; Sibiryak, Yury; Siddhanta, Sabyasachi; Siemiarczuk, Teodor; Silvermyr, David Olle Rickard; Silvestre, Catherine Micaela; Simatovic, Goran; Singaraju, Rama Narayana; Singh, Ranbir; Singha, Subhash; Singhal, Vikas; Sinha, Bikash; Sarkar - Sinha, Tinku; Sitar, Branislav; Sitta, Mario; Skaali, Bernhard; Skjerdal, Kyrre; Slupecki, Maciej; Smirnov, Nikolai; Snellings, Raimond; Soegaard, Carsten; Soltz, Ron Ariel; Song, Jihye; Song, Myunggeun; Soramel, Francesca; Sorensen, Soren Pontoppidan; Spacek, Michal; Spiriti, Eleuterio; Sputowska, Iwona Anna; Spyropoulou-Stassinaki, Martha; Srivastava, Brijesh Kumar; Stachel, Johanna; Stan, Ionel; Stefanek, Grzegorz; Steinpreis, Matthew Donald; Stenlund, Evert Anders; Steyn, Gideon Francois; Stiller, Johannes Hendrik; Stocco, Diego; Stolpovskiy, Mikhail; Strmen, Peter; Alarcon Do Passo Suaide, Alexandre; Sugitate, Toru; Suire, Christophe Pierre; Suleymanov, Mais Kazim Oglu; Sultanov, Rishat; Sumbera, Michal; Symons, Timothy; Szabo, Alexander; Szanto De Toledo, Alejandro; Szarka, Imrich; Szczepankiewicz, Adam; Szymanski, Maciej Pawel; Takahashi, Jun; Tangaro, Marco-Antonio; Tapia Takaki, Daniel Jesus; Tarantola Peloni, Attilio; Tarazona Martinez, Alfonso; Tariq, Mohammad; Tarzila, Madalina-Gabriela; Tauro, Arturo; Tejeda Munoz, Guillermo; Telesca, Adriana; Terasaki, Kohei; Terrevoli, Cristina; Thaeder, Jochen Mathias; Thomas, Deepa; Tieulent, Raphael Noel; Timmins, Anthony Robert; Toia, Alberica; Trubnikov, Victor; Trzaska, Wladyslaw Henryk; Tsuji, Tomoya; Tumkin, Alexandr; Turrisi, Rosario; Tveter, Trine Spedstad; Ullaland, Kjetil; Uras, Antonio; Usai, Gianluca; Vajzer, Michal; Vala, Martin; Valencia Palomo, Lizardo; Vallero, Sara; Vande Vyvre, Pierre; Van Der Maarel, Jasper; Van Hoorne, Jacobus Willem; Van Leeuwen, Marco; Diozcora Vargas Trevino, Aurora; Vargyas, Marton; Varma, Raghava; Vasileiou, Maria; Vasiliev, Andrey; Vechernin, Vladimir; Veldhoen, Misha; Velure, Arild; Venaruzzo, Massimo; Vercellin, Ermanno; Vergara Limon, Sergio; Vernet, Renaud; Verweij, Marta; Vickovic, Linda; Viesti, Giuseppe; Viinikainen, Jussi Samuli; Vilakazi, Zabulon; Villalobos Baillie, Orlando; Vinogradov, Alexander; Vinogradov, Leonid; Vinogradov, Yury; Virgili, Tiziano; Vislavicius, Vytautas; Viyogi, Yogendra; Vodopyanov, Alexander; Volkl, Martin Andreas; Voloshin, Kirill; Voloshin, Sergey; Volpe, Giacomo; Von Haller, Barthelemy; Vorobyev, Ivan; Vranic, Danilo; Vrlakova, Janka; Vulpescu, Bogdan; Vyushin, Alexey; Wagner, Boris; Wagner, Jan; Wagner, Vladimir; Wang, Mengliang; Wang, Yifei; Watanabe, Daisuke; Weber, Michael; Weber, Steffen Georg; Wessels, Johannes Peter; Westerhoff, Uwe; Wiechula, Jens; Wikne, Jon; Wilde, Martin Rudolf; Wilk, Grzegorz Andrzej; Wilkinson, Jeremy John; Williams, Crispin; Windelband, Bernd Stefan; Winn, Michael Andreas; Yaldo, Chris G; Yamaguchi, Yorito; Yang, Hongyan; Yang, Ping; Yang, Shiming; Yano, Satoshi; Yasnopolskiy, Stanislav; Yi, Jungyu; Yin, Zhongbao; Yoo, In-Kwon; Yushmanov, Igor; Zaborowska, Anna; Zaccolo, Valentina; Zaman, Ali; Zampolli, Chiara; Zaporozhets, Sergey; Zarochentsev, Andrey; Zavada, Petr; Zavyalov, Nikolay; Zbroszczyk, Hanna Paulina; Zgura, Sorin Ion; Zhalov, Mikhail; Zhang, Haitao; Zhang, Xiaoming; Zhang, Yonghong; Zhao, Chengxin; Zhigareva, Natalia; Zhou, Daicui; Zhou, Fengchu; Zhou, You; Zhou, Zhuo; Zhu, Hongsheng; Zhu, Jianhui; Zhu, Xiangrong; Zichichi, Antonino; Zimmermann, Alice; Zimmermann, Markus Bernhard; Zinovjev, Gennady; Zoccarato, Yannick Denis; Zyzak, Maksym
2015-04-09
The multiplicity and pseudorapidity distributions of inclusive photons have been measured at forward rapidities ($2.3 < \\eta < 3.9$) in proton-proton collisions at three center-of-mass energies, $\\sqrt{s}=0.9$, 2.76 and 7 TeV using the ALICE detector. It is observed that the increase in the average photon multiplicity as a function of beam energy is compatible with both a logarithmic and a power-law dependence. The relative increase in average photon multiplicity produced in inelastic pp collisions at 2.76 and 7 TeV center-of-mass energies with respect to 0.9 TeV are 37.2% $\\pm$ 0.3% (stat) $\\pm$ 8.8% (sys) and 61.2% $\\pm$ 0.3% (stat) $\\pm$ 7.6% (sys), respectively. The photon multiplicity distributions for all center-of-mass energies are well described by negative binomial distributions. The multiplicity distributions are also presented in terms of KNO variables. The results are compared to model predictions, which are found in general to underestimate the data at large photon multiplicities, in partic...
Influence of Cobalt Doping on the Physical Properties of Zn0.9Cd0.1S Nanoparticles
Directory of Open Access Journals (Sweden)
Gupta Hari Om
2009-01-01
Full Text Available Abstract Zn0.9Cd0.1S nanoparticles doped with 0.005–0.24 M cobalt have been prepared by co-precipitation technique in ice bath at 280 K. For the cobalt concentration >0.18 M, XRD pattern shows unidentified phases along with Zn0.9Cd0.1S sphalerite phase. For low cobalt concentration (≤0.05 M particle size, d XRDis ~3.5 nm, while for high cobalt concentration (>0.05 M particle size decreases abruptly (~2 nm as detected by XRD. However, TEM analysis shows the similar particle size (~3.5 nm irrespective of the cobalt concentration. Local strain in the alloyed nanoparticles with cobalt concentration of 0.18 M increases ~46% in comparison to that of 0.05 M. Direct to indirect energy band-gap transition is obtained when cobalt concentration goes beyond 0.05 M. A red shift in energy band gap is also observed for both the cases. Nanoparticles with low cobalt concentrations were found to have paramagnetic nature with no antiferromagnetic coupling. A negative Curie–Weiss temperature of −75 K with antiferromagnetic coupling was obtained for the high cobalt concentration.
DEFF Research Database (Denmark)
Kubat, Irnis; Petersen, Christian Rosenberg; Møller, Uffe Visbech
2014-01-01
of ZBLAN spanning the 0.9–4.1μm SC at the −30dB level. The ZBLAN fiber SC is then coupled into 10cm of As2Se3 chalcogenide Microstructured Optical Fiber (MOF) designed to have a zero-dispersion wavelength (λZDW) significantly below the 4.1μm InfraRed (IR) edge of the ZBLAN fiber SC, here 3.55μm...
Oxygen Exchange and Transport in (La0.6Sr0.4)0.98FeO3-d – Ce0.9Gd0.1O1.95 Dual-Phase Composites
DEFF Research Database (Denmark)
Ovtar, Simona; Søgaard, Martin; Norrman, Kion
2018-01-01
The chemical diffusion coefficient and the effective surface exchange coefficient (kex) of dual-phase (La0.6Sr0.4)0.98FeO3-d (LSF) − Ce0.9Gd0.1O1.95 (CGO) composites containing between 30 and 70 vol.% of CGO were determined by electrical conductivity relaxation (ECR) at high oxygen partial...... pressures (10−3 .../s for a 70 vol.% of CGO in the composite at 750°C for a pO2 change from 0.2 to 1.0 atm. The experiments demonstrate that the kex is enhanced due to a synergistic effect between the two phases, and suggest a direct involvement of CGO phase in the oxygen surface exchange reaction. Possible mechanisms...
Energy Technology Data Exchange (ETDEWEB)
Andries, Jan P.M. [University of Professional Education, Department of Life Sciences, P.O. Box 90116, 4800 RA Breda (Netherlands); Claessens, Henk A. [University of Professional Education, Department of Life Sciences, P.O. Box 90116, 4800 RA Breda (Netherlands); Eindhoven University of Technology, Department of Chemical Engineering and Chemistry, Laboratory of Polymer Chemistry, P.O. Box 513 (Helix, STW 1.35), 5600 MB Eindhoven (Netherlands); Heyden, Yvan Vander [Department of Analytical Chemistry and Pharmaceutical Technology, Vrije Universiteit Brussel-VUB, Laarbeeklaan 103, B-1090 Brussels (Belgium); Buydens, Lutgarde M.C., E-mail: L.Buydens@science.ru.nl [Institute for Molecules and Materials, Radboud University Nijmegen, Toernooiveld 1, 6525 ED Nijmegen (Netherlands)
2009-10-12
In high-performance liquid chromatography, quantitative structure-retention relationships (QSRRs) are applied to model the relation between chromatographic retention and quantities derived from molecular structure of analytes. Classically a substantial number of test analytes is used to build QSRR models. This makes their application laborious and time consuming. In this work a strategy is presented to build QSRR models based on selected reduced calibration sets. The analytes in the reduced calibration sets are selected from larger sets of analytes by applying the algorithm of Kennard and Stone on the molecular descriptors used in the QSRR concerned. The strategy was applied on three QSRR models of different complexity, relating logk{sub w} or log k with either: (i) log P, the n-octanol-water partition coefficient, (ii) calculated quantum chemical indices (QCI), or (iii) descriptors from the linear solvation energy relationship (LSER). Models were developed and validated for 76 reversed-phase high-performance liquid chromatography systems. From the results we can conclude that it is possible to develop log P models suitable for the future prediction of retentions with as few as seven analytes. For the QCI and LSER models we derived the rule that three selected analytes per descriptor are sufficient. Both the dependent variable space, formed by the retention values, and the independent variable space, formed by the descriptors, are covered well by the reduced calibration sets. Finally guidelines to construct small calibration sets are formulated.
Ueda, Yu; Odunayo, Adesola; Mann, F A
2013-01-01
To determine whether heparinized saline would be more effective in maintaining the patency of peripheral IV catheters in dogs compared to 0.9% sodium chloride. Prospective blinded randomized study. University Veterinary Teaching Hospital. Thirty healthy purpose bred dogs, intended for use in the junior surgery laboratory, were utilized. The dogs were randomized into 1 of 3 groups, 2 treatment groups and a control group. An 18-Ga cephalic catheter was placed in the cephalic vein of each dog. Each dog in the treatment group had their catheter flushed with either 10 IU/mL heparinized saline or 0.9% sodium chloride every 6 hours for 42 hours. The dogs in the control group did not have their catheters flushed until the end of the study period. Immediately prior to flushing catheters, each catheter was evaluated for patency by aspiration of blood and the catheter site was evaluated for phlebitis. All dogs in the heparinized saline and 0.9% sodium chloride group had catheters that flushed easily at each evaluation point. More dogs in the saline group had catheters from which blood could not be aspirated, but there was no significant difference between these groups. All dogs in the control group had catheters that flushed easily at the end of the assigned 6 hour interval except in 1 dog. Phlebitis was not detected in any dog. Flushes of 0.9% sodium chloride were found to be as effective as 10 IU/mL heparinized saline flushes in maintaining patency of 18-Ga peripheral venous catheters in dogs for up to 42 hours. For peripheral catheters placed with the intention of performing serial blood draws, heparinized flushes may be warranted. © Veterinary Emergency and Critical Care Society 2013.
NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...
National Oceanic and Atmospheric Administration, Department of Commerce — Imagery, laboratory analysis and sediment analysis oceanographic data were collected aboard the GYRE in the Gulf of Mexico from 2010-09-13 to 2010-09-16 in response...
Energy Technology Data Exchange (ETDEWEB)
Quan, Chuye; Ma, Yuhui; Han, Yumin; Tang, Xingxing; Lu, Mengjia [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); Mao, Weiwei [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); School of Science, Nanjing University of Posts and Telecommunications (NUPT), Nanjing 210023 (China); Zhang, Jian [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); Yang, Jianping [School of Science, Nanjing University of Posts and Telecommunications (NUPT), Nanjing 210023 (China); Li, Xing’ao, E-mail: lxahbmy@126.com [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); and others
2015-06-25
Highlights: • Crystal structure of doped samples transform to two phase coexistence. • The crystal size decreased to ∼50 nm after doping. • Ultraviolet absorption peak demonstrates apparent blue shift for doped sample. • The ratio of Fe{sup 2+} increased by merging Nd. • Ca, Nd co-doped can promote the ferromagnetism obviously. - Abstract: Pure and co-doped BiFeO{sub 3} (Ca, Nd) nanoparticles with diameter in the range of 50–250 nm were synthesized through a sol–gel method. X-ray diffraction (XRD) and Raman results show that Bi-site co-doped with Ca, Nd could result in a transition of crystal structure (from single phase rhombohedral (R3c) to two phase coexistence). An apparent blue shift can be observed in the co-doped samples along with a decrease of the direct optical band gap. Moreover, the leakage current was decreased due to the introduction of nonvolatile Ca and Nd at Bi{sup 3+} site. Analysis of MPMS-VSM magnetic hysteresis data reveals a further enhancement in magnetism in the Nd doped Bi{sub 0.9}Ca{sub 0.1}FeO{sub 3,} which is further explained by XPS characterization.
Energy Technology Data Exchange (ETDEWEB)
Choi, Hye-Min [Department of Engineering in Energy and Applied Chemistry, Silla University, Busan 617-736 (Korea, Republic of); Park, Sangmoon, E-mail: spark@silla.ac.kr [Department of Engineering in Energy and Applied Chemistry, Silla University, Busan 617-736 (Korea, Republic of)
2012-09-15
Luminescent materials composed of Sr{sub 3-x-3y/2}M{sub x}Ce{sub y}AlO{sub 4}F (M=Ca, Ba, 0{<=}x{<=}0.9, 0.001{<=}y{<=}0.05) were prepared by the solid-state reaction method. X-ray diffraction (XRD) patterns of the obtained oxyfluorides are exhibited for indexing peak positions. Dynamic excitation and emission spectra of the Ce{sup 3+}-activated oxyfluoride phosphors are clearly monitored. The critical emission quenching as a function of Ce{sup 3+} contents in Sr{sub 2.5-3y/2}M{sub 0.5}Ce{sub y}AlO{sub 4}F phosphors is revealed at quite low concentrations of the activator. CIE coordinates of blue and green Sr{sub 2.5-3y/2}M{sub 0.5}Ce{sub y}AlO{sub 4}F phosphors are clearly measured. The relative quantum efficiency of Sr{sub 2.4985}Ca{sub 0.5}Ce{sub 0.005}AlO{sub 4}F based on the integrated emission is determined. The Sr{sub 3-x-3y/2}M{sub x}Ce{sub y}AlO{sub 4}F phosphors excited near 410 nm light could be prominent phosphors in applications of NUV-LED. - Highlights: Black-Right-Pointing-Pointer Blue and green emitting oxyfluoride phosphors are excitated near 410 nm Black-Right-Pointing-Pointer Ce{sup 3+}-activated oxyfluoride phosphors are quite effective to prepare white light for near-UV LED applications. Black-Right-Pointing-Pointer Gradual substitution of Ce{sup 3+} content in the oxyfluoride hosts changes CIE values.
Energy Technology Data Exchange (ETDEWEB)
Thenmozhi, N. [NMSSVN College, Madurai (India). PG and Research Dept. of Physics; Saravanan, R. [The Madura College, Madurai (India). Research Centre and Post Graduate Dept. of Physics; Fu, Yen-Pei [National Dong-Hwa Univ., Hualien, Taiwan (China). Dept. of Materials Science and Engineering
2017-07-01
In this article, structural properties and bonding behaviours of codoped lanthanum chromites (La{sub 0.8}Ca{sub 0.2})(Cr{sub 0.9-x}Co{sub 0.1}Cu{sub x})O{sub 3} (x=0.00, 0.03, and 0.12) were investigated in detail. Polycrystalline chromite samples (La{sub 0.8}Ca{sub 0.2})(Cr{sub 0.9-x}Co{sub 0.1}Cu{sub x})O{sub 3} (x=0.00, 0.03, and 0.12) were prepared by a standard solid-state reaction process. The synthesised samples were characterised for their structural, morphological, optical, and magnetic properties using powder XRD, SEM/EDS, UV-Vis, and VSM. XRD data showed that the samples were crystallised into a single phase with orthorhombic structure. Powder profile refinement analysis suggested the reduction in lattice parameters and cell volume with the addition of Cu. The electron density distributions and the bonding features of the prepared samples have been investigated using maximum entropy method (MEM). The mid bond electron density values revealed the enhancement of ionic nature between lanthanum and oxygen ions and a reduction in covalent nature between chromium and oxygen ions. Heterogeneous distribution of particles with different sizes was observed through SEM micrographs. EDS spectra confirms the presence of constituent elements in the prepared samples. Optical band gap values are decreasing with the addition of Cu. Antiferromagnetic ordering was observed from M-H curves obtained at room temperature. The structural and the magnetic properties are correlated.
Energy Technology Data Exchange (ETDEWEB)
Arranz Gonzalez, J. C.; Cala Rivero, V.
2011-07-01
Metallurgic mine wastes often contain high concentrations of potentially toxic elements, the mobility of which may pose an environmental hazard for water and surrounding ecosystems. We have examined the mobility of Ag, As, Cu, Pb and Zn from composite surface samples (0-20 cm) of different pyritic tailings impoundments in the province of Huelva (Spain). These samples were also subject to physical chemical and mineralogical (XRD) characterization. The total metal content of the tailings ranged between 1.89-11.2 ppm for Ag, 72-610 ppm for As, 245-1194 ppm for Cu, 220-11933 for Pb and 41-706 for Zn, all proving to be highly acidic. The mobility of these elements was assessed by using a seven-step sequential extraction procedure and applying the toxicity characteristic leaching procedure (TCLP). We investigated the applicability of TCLP to the tailings by comparing the results with those of the first steps of the sequential extraction procedure. It was found that the pH values remained buffered (close to 4.97) upon adding the TCLP extraction reagent and that the pH values differed significantly from those of the aqueous extracts. This could result in an underestimation of mobile forms compared with those dissolved in water. We may also conclude that due to the presence of specific minerals or to the preference of some elements for acetate ions the results of any assessment of metal mobility in pyritic tailings using the TCLP test may be questionable. (Author) 42 refs.
Park, Byung Hyun; Choi, Gyeong Man
2015-10-01
Perovskite oxides have potential for use as alternative anode materials in solid oxide fuel cells (SOFCs) due to stability in anode atmosphere; donor-doped SrTiO3 (e.g., La0.2Sr0.8TiO3-δ) is a good candidate for this purpose. Electro-catalytic nanoparticles can be produced in oxide anodes by the ex-solution method, e.g., by incorporating Ni into a perovskite oxide in air, then reducing the oxide in H2 atmosphere. In this study, we varied the temperature (1100, 1250 °C) and atmosphere (air, H2) of La0.2Sr0.8Ti0.9Ni0.1O3-δ (LSTN) anode firing to control the degree of Ni ex-solution and microstructure. LSTN fired at 1250 °C in H2 showed the best anodic performance for scandia-stabilized zirconia (ScSZ) electrolyte-supported cells in H2 and CH4 fuels due to the favorable microstructure and Ni ex-solution.
Performance evaluation of Mn and Fe doped SrCo0.9Nb0.1O3-δ cathode for IT-SOFC application
Bele, Lokesh; Lenka, R. K.; Patro, P. K.; Muhmood, L.; Mahata, T.; Sinha, P. K.
2018-02-01
Cathode materials of Mn and Fe doped SrCo0.9Nb0.1O3-δ, are synthesized by solid state route for intermediate temperature fuel cell applications. Phase pure material is obtained after calcining the precursors at 1100 °C. Phase compatibility is observed between this novel cathode material with gadolinia doped ceria (GDC) electrolyte material as reflected in the diffraction pattern. The state of art YSZ electrolyte is not compatible with this cathode material. Average thermal expansion coefficient of the material varies between 17 to 22 X 10-6 K-1 on doping, from room temperature to 800 °C. Increase in thermal expansion coefficient is observed with Mn and Fe doping associated with the loss of oxygen from the crystal. The electrical conductivity of the cathode material decreases with Fe and Mn doping. Mn doped samples show lowest conductivity. From the symmetric cell measurement lower area specific resistance (0.16 Ω-cm2) is obtained for un-doped samples, at 850 °C. From the initial results it can be inferred that Mn/Fe doping improves neither the thermal expansion co-efficient nor the electrochemical activity.
Shi, Jing; Zhu, Rongfeng; Liu, Xing; Yuan, Ningyi; Ding, Jianning; Luo, Haosu
2017-01-01
The 1 wt % Li-doped (Ba0.85Ca0.15)(Zr0.1Ti0.9)O3 (BCZT-Li) ceramics prepared by the citrate method exhibit improved phase purity, densification and electrical properties, which provide prospective possibility to develop high-performance electrocaloric materials. The electrocaloric effect was evaluated by phenomenological method, and the BCZT-Li ceramics present large electrocaloric temperature change ∆T, especially large electrocaloric responsibility ξ = ∆Tmax/∆Emax, which can be comparable to the largest values reported in the lead-free piezoelectric ceramics. The excellent electrocaloric effect is considered as correlating with the coexistence of polymorphic ferroelectric phases, which are detected by the Raman spectroscopy. The large ξ value accompanied by decreased Curie temperature (around 73 °C) of the BCZT-Li ceramics prepared by the citrate method presents potential applications as the next-generation solid-state cooling devices. PMID:28927004
Directory of Open Access Journals (Sweden)
Jing Shi
2017-09-01
Full Text Available The 1 wt % Li-doped (Ba0.85Ca0.15(Zr0.1Ti0.9O3 (BCZT-Li ceramics prepared by the citrate method exhibit improved phase purity, densification and electrical properties, which provide prospective possibility to develop high-performance electrocaloric materials. The electrocaloric effect was evaluated by phenomenological method, and the BCZT-Li ceramics present large electrocaloric temperature change ∆T, especially large electrocaloric responsibility ξ = ∆Tmax/∆Emax, which can be comparable to the largest values reported in the lead-free piezoelectric ceramics. The excellent electrocaloric effect is considered as correlating with the coexistence of polymorphic ferroelectric phases, which are detected by the Raman spectroscopy. The large ξ value accompanied by decreased Curie temperature (around 73 °C of the BCZT-Li ceramics prepared by the citrate method presents potential applications as the next-generation solid-state cooling devices.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-03 to 2010-09-07 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-15 to 2010-09-22 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-23 to 2010-09-28 in...
Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Ero, Janos; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hoch, Michael; Hormann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schofbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; De Wolf, Eddi A.; Hashemi, Majid; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; D'Hondt, Jorgen; Devroede, Olivier; Kalogeropoulos, Alexis; Maes, Joris; Mozer, Matthias Ulrich; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Villella, Ilaria; Chabert, Eric Christian; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Marage, Pierre Edouard; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; Cortina Gil, Eduardo; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Gregoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Militaru, Otilia; Ovyn, Severine; Piotrzkowski, Krzysztof; Quertenmont, Loic; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Herquet, Philippe; Alves, Gilvan; Pol, Maria Elena; Henrique Gomes e Souza, Moacyr; Carvalho, Wagner; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Oguri, Vitor; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; Torres Da Silva De Araujo, Felipe; De Almeida Dias, Flavia; Dias, Marco Andre Ferreira; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Damgov, Jordan; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Stoykova, Stefka; Sultanov, Georgi; Trayanov, Rumen; Vankov, Ivan; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leandar; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Jian; Wang, Xianyou; Wang, Zheng; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Hu, Zhen; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhu, Bo; Andres Carrillo Montoya, Camilo; Gomez Moreno, Bernardo; Andres Ocampo Rios, Alberto; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Fereos, Reginos; Galanti, Mario; Mousa, Jehad; Papadakis, Antonakis; Ptochos, Fotios; Razis, Panos A.; Tsiakkouri, Demetra; Zinonos, Zinonas; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Muntel, Mait; Raidal, Martti; Rebane, Liis; Eerola, Paula; Czellar, Sandor; Harkonen, Jaakko; Heikkinen, Mika Aatos; Karimaki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampen, Tapio; Lassila-Perini, Kati; Lehti, Sami; Linden, Tomas; Luukka, Panja-Riina; Maenpaa, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Dejardin, Marc; Denegri, Daniel; Descamps, Julien; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, Francois-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, Andre; Rousseau, Delphine; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Bianchini, Lorenzo; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dobrzynski, Ludwik; Elgammal, Sherif; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Mine, Philippe; Paganini, Pascal; Sirois, Yves; Thiebaux, Christophe; Zabi, Alexandre; Agram, Jean-Laurent; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Conte, Eric; Drouhin, Frederic; Ferro, Cristina; Fontaine, Jean-Charles; Gele, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Ripp-Baudot, Isabelle; Speck, Joaquim; Van Hove, Pierre; Baty, Clement; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fassi, Farida; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Roinishvili, Vladimir; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Pandoulas, Demetrios; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Actis, Oxana; Bender, Walter; Biallass, Philipp; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Kirsch, Matthias; Klimkovich, Tatsiana; Kreuzer, Peter; Lanske, Dankfried; Merschmeyer, Markus; Meyer, Arnd; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sowa, Michael; Steggemann, Jan; Teyssier, Daniel; Zeidler, Clemens; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flugge, Gunter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrens, Ulf; Borras, Kerstin; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Meyer, Andreas Bernhard; Mnich, Joachim; Olzem, Jan; Parenti, Andrea; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Volyanskyy, Dmytro; Wissing, Christoph; Autermann, Christian; Draeger, Jula; Eckstein, Doris; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Sander, Christian; Schleper, Peter; Schroder, Matthias; Schum, Torben; Stadie, Hartmut; Steinbruck, Georg; Thomsen, Jan; Wolf, Roger; Bauer, Julia; Blum, Peter; Buege, Volker; Cakir, Altan; Chwalek, Thorsten; Daeuwel, Daniel; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Frey, Martin; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heinrich, Michael; Hoffmann, Karl-heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Muller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Renz, Manuel; Sabellek, Andreas; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jurgen; Stober, Fred-Markus; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Karafasoulis, Konstantinos; Kyriakis, Aristoteles; Loukas, Demitrios; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Petrakou, Eleni; Zachariadou, Aikaterini; Agapitos, Antonis; Gouskos, Loukas; Katsas, Panagiotis; Panagiotou, Apostolos; Saganis, Konstantinos; Xaxiris, Evangelos; Evangelou, Ioannis; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Sharma, Richa; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Chauhan, Sushil; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Ranjan, Kirti; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Suggisetti, Praveenkumar; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Nayak, Aruna; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Fahim, Ali; Jafari, Abideh; Mohammadi Najafabadi, Mojtaba; Moshaii, Ahmad; Paktinat Mehdiabadi, Saeid; Zeinali, Maryam; Felcini, Marta; Abbrescia, Marcello; Barbone, Lucia; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fedele, Francesca; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pierro, Giuseppe Antonio; Polese, Giovanni; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Capiluppi, Paolo; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Chiorboli, Massimiliano; Costa, Salvatore; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Broccolo, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Landi, Gregorio; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; Cerati, Giuseppe Benedetto; De Guio, Federico; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Menasce, Dario; Miccio, Vincenzo; Moroni, Luigi; Negri, Pietro; Paganoni, Marco; Pedrini, Daniele; Pullia, Antonino; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Salerno, Roberto; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Taroni, Silvia; Cimmino, Anna; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Biasotto, Massimo; Carlin, Roberto; Checchia, Paolo; De Mattia, Marco; Dorigo, Tommaso; Fanzago, Federica; Gasparini, Fabrizio; Giubilato, Piero; Gonella, Franco; Gresele, Ambra; Gulmini, Michele; Lacaprara, Stefano; Lazzizzera, Ignazio; Maron, Gaetano; Mattiazzo, Serena; Meneguzzo, Anna Teresa; Passaseo, Marina; Pegoraro, Matteo; Pozzobon, Nicola; Ronchese, Paolo; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Baesso, Paolo; Berzano, Umberto; Pagano, Davide; Ratti, Sergio P.; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fano, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Bocci, Andrea; Castaldi, Rino; Dell'Orso, Roberto; Dutta, Suchandra; Fiori, Francesco; Foa, Lorenzo; Gennai, Simone; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Borgia, Maria Assunta; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Dellacasa, Giulio; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Penzo, Aldo; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kong, Dae Jung; Park, Hyangkyu; Son, Dong-Chul; Kim, Jaeho; Song, Sanghyeon; Jung, Seung Yong; Hong, Byung-Sik; Kim, Hyunchul; Kim, Ji Hyun; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Sim, Kwang Souk; Kim, Jangho; Choi, Minkyoo; Park, In Kyu; Choi, Suyong; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Jo, Youngkwon; Kwon, Jeongteak; Lee, Jongseok; Lee, Sungeun; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla Valdez, Heriberto; Sanchez Hernandez, Alberto; Carrillo Moreno, Salvador; Ibarguen, Humberto Antonio Salazar; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Allfrey, Philip; Krofcheck, David; Aumeyr, Thomas; Butler, Philip H.; Signal, Tony; Williams, Jennifer C.; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Gorski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; Bargassa, Pedrame; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Musella, Pasquale; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wohri, Hermine Katharina; Altsybeev, Igor; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger, Michael, Jr.; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Vishnevskiy, Alexander; Volodko, Anton; Zarubin, Anatoli; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Obrant, Gennady; Shcheglov, Yury; Shchetkovskiy, Alexander; Smirnov, Igor; Sulimov, Valentin; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Ilina, Natalia; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Kuleshov, Sergey; Oulianov, Alexei; Safronov, Grigory; Semenov, Sergey; Shreyber, Irina; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Vardanyan, Irina; Dremin, Igor; Kirakosyan, Martin; Konovalova, Nina; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Datsko, Kirill; Kachanov, Vassili; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Sytine, Alexandre; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Maletic, Dimitrije; Puzovic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Fernandez Bedoya, Cristina; Fernandez Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Pelayo, Jesus Puerta; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; de Troconiz, Jorge F.; Cuevas, Javier; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; Iglesias, Lara Lloret; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Diaz Merino, Irma; Diez Gonzalez, Carlos; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Gonzalez Suarez, Rebeca; Jorda, Clara; Pardo, Patricia Lobelle; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Martinez Ruiz del Arbol, Pablo; Matorras, Francisco; Rodrigo, Teresa; Jimeno, Alberto Ruiz; Scodellaro, Luca; Sanudo, Mar Sobron; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Baillon, Paul; Ball, Austin; Barney, David; Beaudette, Florian; Beccati, Barbara; Bell, Alan James; Bellan, Riccardo; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bolognesi, Sara; Bona, Marcella; Breuker, Horst; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cattai, Ariella; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Covarelli, Roberto; Cure, Benoit; Dahms, Torsten; De Roeck, Albert; Elliott-Peisert, Anna; Funk, Wolfgang; Gaddi, Andrea; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gowdy, Stephen; Guiducci, Luigi; Gutleber, Johannes; Hartl, Christian; Harvey, John; Hegner, Benedikt; Henderson, Conor; Hoffmann, Hans Falk; Honma, Alan; Huhtinen, Mika; Innocente, Vincenzo; Janot, Patrick; Lecoq, Paul; Leonidopoulos, Christos; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Meridiani, Paolo; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mulders, Martijn; Noy, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimia, Martti; Racz, Attila; Rolandi, Gigi; Rovere, Marco; Ryjov, Vladimir; Sakulin, Hannes; Schafer, Christoph; Schlatter, Wolf-Dieter; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stockli, Fabian; Traczyk, Piotr; Tropea, Paola; Tsirou, Andromachi; Istvan Veres, Gabor; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Konig, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Caminada, Lea; Casella, Maria Chiara; Chen, Zhiling; Cittolin, Sergio; Dambach, Sarah; Dissertori, Gunther; Dittmar, Michael; Eggel, Christina; Eugster, Jurg; Freudenreich, Klaus; Grab, Christoph; Herve, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Milenovic, Predrag; Moortgat, Filip; Nardulli, Alessandro; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Sala, Leonardo; Sanchez, Ann-Karin; Sawley, Marie-Christine; Schinzel, Dietrich; Sordini, Viola; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Trub, Peter; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Rikova, Mirena Ivova; Regenfus, Christian; Robmann, Peter; Rommerskirchen, Tanja; Schmidt, Alexander; Snoek, Hella; Tsirigkas, Dimitrios; Wilke, Lotte; Chang, Yuan-Hann; Chen, E.Augustine; Chen, Wan-Ting; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Wu, Jing-Han; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Lei, Yeong-Jyi; Lin, Sheng-wen; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-ming; Ueno, Koji; Wang, Chin-chi; Wang, Minzu; Adiguzel, Aytul; Ayhan, Aydin; Bakirci, Mustafa Numan; Cerci, Salim; Demir, Zahide; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gurpinar, Emine; Karaman, Turker; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sahin, Ozge; Sengul, Ozden; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gulmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Cussans, David; Frazier, Robert; Goldstein, Joel; Hansen, Maria; Heath, Greg P.; Heath, Helen F.; Hill, Christopher; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Mackay, Catherine Kirsty; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Davies, Gavin; Della Negra, Michel; Foudas, Costas; Fulcher, Jonathan; Futyan, David; Hall, Geoffrey; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; MacEvoy, Barry C.; Magnan, Anne-Marie; Marrouche, Jad; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Stoye, Markus; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Reid, Ivan; Teodorescu, Liliana; Bose, Tulika; Clough, Andrew; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sulak, Lawrence; Andrea, Jeremy; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Esen, Selda; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Speer, Thomas; Tsang, Ka Vang; Breedon, Richard; Calderon de la Barca Sanchez, Manuel; Cebra, Daniel; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Wallny, Rainer; Babb, John; Chandra, Avdhesh; Clare, Robert; Ellison, John Anthony; Gary, J.William; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, Andre; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Norman, Matthew; Padhi, Sanjay; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Vartak, Adish; Wurthwein, Frank; Yagil, Avraham; Barge, Derek; Blume, Michael; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Garberson, Jeffrey; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lamb, James; Lowette, Steven; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Witherell, Michael; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Gataullin, Marat; Litvine, Vladimir; Ma, Yousi; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Jang, Dong Wook; Jun, Soon Yung; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Blekman, Freya; Cassel, David; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Patterson, Juliet Ritchie; Puigh, Darren; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Vaughan, Jennifer; Weng, Yao; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Albrow, Michael; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Binkley, Morris; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Green, Dan; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Limon, Peter; Lueking, Lee; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Prokofyev, Oleg; Sexton-Kennedy, Elizabeth; Sharma, Seema; Smith, Richard P.; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Piero Di Giovanni, Gian; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kotov, Khristian; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Pakhotin, Yuriy; Piedra Gomez, Jonatan; Prescott, Craig; Rapsevicius, Valdas; Remington, Ronald; Schmitt, Michael; Scurlock, Bobby; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Luis Rodriguez, Jorge; Adams, Todd; Askew, Andrew; Chen, Jie; Dharmaratna, Welathantri G.D.; Diamond, Brendan; Gleyzer, Sergei V.; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Sekmen, Sezen; Baarmand, Marc M.; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Mermerkaya, Hamit; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatian, Samvel; Mironov, Camelia; Shabalina, Elizaveta; Smoron, Agata; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Chung, Kwangzoo; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bandurin, Dmitry; Barfuss, Anne-fleur; Bolton, Tim; Chakaberia, Irakli; Kaadze, Ketino; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; D'Enterria, David; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristian Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Wyslouch, Bolek; Xie, Si; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Petyt, David; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A.; Sonnek, Peter; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Smith, Kenneth; Strang, Michael; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Reucroft, Steve; Swain, John; Wood, Darien; Anastassov, Anton; Kubik, Andrew; Ofierzynski, Radoslaw Adrian; Pozdnyakov, Andrey; Schmitt, Michael; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Ruchti, Randy; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Killewald, Phillip; Ling, Ta-Yung; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroue, Pierre; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatzerklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Potamianos, K.; Sedov, Alexey; Shipsey, Ian; Silvers, David; Yoo, Hwi Dong; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Matveev, Mikhail; Morales, Jafet; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel; Demina, Regina; Flacher, Henning; Garcia-Bellido, Aran; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Korjenevski, Sergey; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Demortier, Luc; Goulianos, Konstantin; Hatakeyama, Kenichi; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Gershtein, Yuri; Halkiadakis, Eva; Hits, Dmitry; Lath, Amitabh; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Nguyen, Chi Nhan; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Toback, David; Weinberger, Michael; Akchurin, Nural; Jeong, Chiyoung; Lee, Sung Won; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Brownson, Eric; Engh, Daniel; Florez, Carlos; Johns, Willard; Kurt, Pelin; Sheldon, Paul; Arenton, Michael Wayne; Balazs, Michael; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Hirosky, Robert; Ledovskoy, Alexander; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Gunthoti, Kranti; Harr, Robert; Karchin, Paul Edmund; Mattson, Mark; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Flood, Kevin; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Lomidze, David; Loveless, Richard; Mohapatra, Ajit; Reeder, Don; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc
2010-01-01
Measurements of inclusive charged-hadron transverse-momentum and pseudorapidity distributions are presented for proton-proton collisions at sqrt(s) = 0.9 and 2.36 TeV. The data were collected with the CMS detector during the LHC commissioning in December 2009. For non-single-diffractive interactions, the average charged-hadron transverse momentum is measured to be 0.46 +/- 0.01 (stat.) +/- 0.01 (syst.) GeV/c at 0.9 TeV and 0.50 +/- 0.01 (stat.) +/- 0.01 (syst.) GeV/c at 2.36 TeV, for pseudorapidities between -2.4 and +2.4. At these energies, the measured pseudorapidity densities in the central region, dN(charged)/d(eta) for |eta| < 0.5, are 3.48 +/- 0.02 (stat.) +/- 0.13 (syst.) and 4.47 +/- 0.04 (stat.) +/- 0.16 (syst.), respectively. The results at 0.9 TeV are in agreement with previous measurements and confirm the expectation of near equal hadron production in p-pbar and pp collisions. The results at 2.36 TeV represent the highest-energy measurements at a particle collider to date.
76 FR 41501 - Notice of Intent To Award Affordable Care Act (ACA) Funding, EH09-907
2011-07-14
... network expansion and enhancement. Funding is appropriated under the Affordable Care Act (Pub. L. 111-148... Intent To Award Affordable Care Act (ACA) Funding, EH09-907 AGENCY: Centers for Disease Control and... in their FY 2011 applications submitted under funding opportunity EH09-907, ``National Environmental...
Energy Technology Data Exchange (ETDEWEB)
Saravanan, R. [Research Centre and Post Graduate Department of physics, The Madura College, Madurai 625011 (India); Thenmozhi, N., E-mail: thenmozhi.n6@gmail.com [PG and Research Department of Physics, NMSSVN College, Nagamalai, Madurai 625019 (India); Fu, Yen-Pei [Department of materials Science and Engineering, National Dong-Hwa University, Shou-Feng, Hualien 974, Taiwan (China)
2016-07-15
The doped lanthanum chromite (La{sub 0.8}Ca{sub 0.2})(Cr{sub 0.9−x}Co{sub 0.1}Mn{sub x})O{sub 3} (x=0.03, 0.06, 0.09 and 0.12) were synthesized by solid state reaction technique. The samples have been characterized by X-ray diffraction for structural and charge density analysis. XRD data show that the grown samples are orthorhombic in structure with single phase. The spatial charge density distribution in the unit cell for the synthesized samples has been studied using maximum entropy method. Further, the samples were analyzed by UV–visible spectrometry for optical properties and scanning electron microscopy for surface morphology. From the optical data, it was found that the direct band gap of the samples range from 2.27 to 2.46 eV. The samples were also investigated by vibrating sample magnetometry for magnetic properties. From VSM data, it is inferred that all the samples in this series are found to be predominantly antiferromagnetic in nature. Since the doped lanthanum chromites have good mechanical properties and electrical conductivity at high temperature, these materials are used in solid oxide fuel cells (SOFC).
Ferroelectric and dielectric properties of BaTi0.9Zr0.1O3 doped with Li0.5Fe2.5O4 ceramics
Gajula, Ganapathi Rao; Buddiga, Lakshmi Rekha; Chidambara Kumar, K. N.; Ch, Arun Kumar; Samatha, K.; Kokkiragadda, Sreeramachandra Murthy; Dasari, Madhava Prasad
2018-06-01
We have prepared a composite BaTi0.9Zr0.1O3 (BTZr) doped with Li0.5Fe2.5O4 (LF) having chemical formulae (1- x) BTZr + (x) LF (x=0, 0.05, 0.1 and 0.15) conventional solid state reaction technique. We have sintered the grown composites at 1150 °C for 3 h. We have characterized the grown composites using XRD, FESEM, P-E loop tracer and LCR meter. The XRD measurements reveal the tetragonal nature of the composites. The morphological studies reveal that the composite exhibits dense microstructure with small pores. The P-E loops confirm that the composites exhibit remnant polarization and the coercive field increases with increasing concentration of Lithium Ferrite (LF). We have studied dielectric property of the composites by varying the temperature of the sample from 30 °C to 500 °C at 1 kHz, 10 kHz and also by varying the frequency from 1 Hz to 10 MHz at 30 °C. The dielectric property of BTZr has increased after doping LF in BTZr which reveals the enhancement of electrical properties of the grown composite.
Energy Technology Data Exchange (ETDEWEB)
Miah, M.J. [Department of Physics, Bangladesh University of Engineering and Technology (Bangladesh); Department of Physics, Comilla University, Comilla (Bangladesh); Khan, M.N.I. [Materials Science Division, Atomic Energy Center, Dhaka (Bangladesh); Hossain, A.K.M. Akther, E-mail: akmhossain@phy.buet.ac.bd [Department of Physics, Bangladesh University of Engineering and Technology (Bangladesh)
2016-03-01
Multiferroic xBa{sub 0.95}Sr{sub 0.05}TiO{sub 3}–(1−x)BiFe{sub 0.9}Gd{sub 0.1}O{sub 3} [xBST–(1−x)BFGO], where x=0.00−0.40, have been synthesized by the conventional solid-state reaction method. The crystalline phase, microstructure, relaxor behavior, ac conductivity, impedance spectroscopy, dc magnetic properties, complex initial permeability and magnetoelectric coefficient of these solid solutions have been investigated. The crystal structure is found to change from rhombohedral in BFGO rich compositions to cubic when x≥0.30. Room temperature dielectric properties are investigated within the frequency range from 1 kHz to 1 MHz and found to increase with BST content. The frequency dependence of high temperature dielectric measurements indicated that the composites with x≥0.20, exhibit relaxor ferroelectric behavior. The ac conductivity obeys the Jonscher’s universal power law and BST helps to enhance the electrical conductivity of the composites. Studies of impedance spectroscopy suggest that only grains have the contribution to the conductivity mechanism in this material. Magnetizations as a function of applied magnetic field measurements show weak ferromagnetism for 0.10≤x≤0.30 composites. The maximum value of remnant magnetization is found to be 0.565×10{sup 3} A/m (=0.08 emu/g) for x=0.25 which is better than previously reported BaTiO{sub 3}–BiFeO{sub 3} systems. The complex initial permeability is found to improve with the increase in BST concentration due to the reduction of oxygen vacancies. In addition, an enhanced magnetoelectric (ME) coupling is also observed and determined by the ME coefficient. The maximum value of ME coefficient is found to be 21.71×10{sup −4} V/A (=1.67 mV/cm Oe) for the x=0.25 composition. The BST–BFGO solid solutions show high-performance multiferroic properties and can be selected for further investigation. - Highlights: • Phase pure multiferroic xBa{sub 0.95}Sr{sub 0.05}TiO{sub 3}–(1−x)BiFe{sub 0.9
ANALYSIS OF TANK 28F SALTCAKE CORE SAMPLES FTF-456 - 467
Energy Technology Data Exchange (ETDEWEB)
Martino, C; Daniel McCabe, D; Tommy Edwards, T; Ralph Nichols, R
2007-02-28
Twelve LM-75 core samplers from Tank 28F sampling were received by SRNL for saltcake characterization. Of these, nine samplers contained mixtures of free liquid and saltcake, two contained only liquid, and one was empty. The saltcake contents generally appeared wet. A summary of the major tasks performed in this work are as follows: (1) Individual saltcake segments were extruded from the samplers and separated into saltcake and free liquid portions. (2) Free liquids were analyzed to estimate the amount of traced drill-string fluid contained in the samples. (3) The saltcake from each individual segment was homogenized, followed by analysis in duplicate. The analysis used more cost-effective and bounding radiochemical analyses rather than using the full Saltstone WAC suite. (4) A composite was created using an approximately equal percentage of each segment's saltcake contents. Supernatant liquid formed upon creation of the composite was decanted prior to use of the composite, but the composite was not drained. (5) A dissolution test was performed on the sample by contacting the composite with water at a 4:1 mass ratio of water to salt. The resulting soluble and insoluble fractions were analyzed. Analysis focused on a large subset of the Saltstone WAC constituents.
2008-09 National Rivers and Streams Assessment Fish Tissue Data Dictionary
The Office of Science and Technology (OST) is providing the fish tissue results from the 2008-09 National Rivers and Streams Assessment (NRSA). This document includes the “data dictionary” for Mercury, Selenium, PBDEs, PCBs, Pesticides and PFCs.
Secular changes in intakes of foods among New Zealand adults from 1997 to 2008/09.
Smith, Claire; Gray, Andrew R; Mainvil, Louise A; Fleming, Elizabeth A; Parnell, Winsome R
2015-12-01
To examine changes in the food choices of New Zealand (NZ) adults, between the 1997 National Nutrition Survey (NNS97) and the 2008/09 NZ Adult Nutrition Survey (2008/09 NZANS). The 2008/09 NZANS and the NNS97 were cross-sectional surveys of NZ adults (aged 15 years and over). Dietary intake data were collected using a computer-based 24 h diet recall. Logistic regression models were used to examine changes over time in the percentage reporting each food group, with survey year, sex and age group (19-30 years, 31-50 years, 51-70 years, ≥71 years) as the variables. NZ households. Adults aged 19 years and over (NNS97, n 4339; 2008/09 NZANS, n 3995). In the 2008/09 NZANS compared with NNS97, males and females were less likely to report consuming bread, potatoes, beef, vegetables, breakfast cereal, milk, cheese, butter, pies, biscuits, cakes and puddings, and sugar/confectionery (all Psnacks and snack bars (e.g., crisps, extruded snacks, muesli bars; P=0.007) and pasta and pasta dishes (P=0.017). Although food choices were associated with sex and age group, there were few differential changes between the surveys by sex or age group. For all age groups there was a shift in the percentage who reported consuming the traditional NZ foods, namely bread, beef, potatoes and vegetables, towards more rice and rice dishes. Declines in the consumption of butter, pies, biscuits, cakes and puddings are congruent with current dietary guidelines.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Wes Bordelon in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the BUNNY BORDELON in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Rachel Bordelon in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...
International Nuclear Information System (INIS)
Celegato, F.; Coiesson, M.; Magni, A.; Tiberto, P.; Vinai, F.; Kane, S. N.; Modak, S. S.; Gupta, A.; Sharma, P.
2007-01-01
Amorphous Fe 73.9 Nb 3.1 Cu 0.9 Si 13.2 B 8.9 thin films have been produced by ion beam sputtering with two different beam energies (500 and 1000 eV). Magnetic measurements indicate that the samples display a uniaxial magnetic anisotropy, especially for samples prepared with the lower beam energy. Magnetization relaxation has been measured on both films with an alternating gradient force magnetometer and magneto-optical Kerr effect. Magnetization relaxation occurs on time scales of tens of seconds and can be described with a single stretched exponential function. Relaxation intensity turns out to be higher when measured along the easy magnetization axis
Energy Technology Data Exchange (ETDEWEB)
Kossi, S. EL., E-mail: safwene666@hotmail.com [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Rhouma, F.I.H. [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Laboratoire de Photovoltaique, Centre de Recherches et des Tehnologies de l' Energie, BP Hammam-Lif 2050 (Tunisia); Dhahri, J. [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Khirouni, K. [Laboratoire de Physique des Matériaux et des Nanomatériaux Appliquée à L’environnement, Faculté des Sciences de Gabes Cité Erriadh, 6079 Gabes (Tunisia)
2014-05-01
This work studies structural and various electrical properties of polycrystalline La{sub 0.7}Sr{sub 0.25} Na{sub 0.05} Mn{sub 0.9}Ti{sub 0.1}O{sub 3} (LSNMTi), which were prepared by standard solid state reaction technique. The formation of a single phase rhombohedral structure of the composition was confirmed by the X-ray diffraction study. The electrical behavior of sintered pellets investigated by impedance spectra has shown frequency dependent behavior. Both conductivity and electric modulus formalisms have been used to study the relaxation dynamics of charge carriers. The variation of ac conductivity with frequency at different temperatures obeys the universal Jonscher's power law (σ{sub ac}αw).
Dinga, J N; Gamua, S D; Titanji, V P K
2017-08-01
It has been shown that covalently linking two antigens could enhance the immunogenicity of the chimeric construct. To prioritize such a chimera for malaria vaccine development, it is necessary to demonstrate that naturally acquired antibodies against the chimera are associated with protection from malaria. Here, we probe the ability of a chimeric construct of UB05 and UB09 antigens (UB05-09) to better differentiate between acquired immune protection and susceptibility to malaria. In a cross-sectional study, recombinant UB05-09 chimera and the constituent antigens were used to probe for specific antibodies in the plasma from children and adults resident in a malaria-endemic zone, using the enzyme-linked immunosorbent assay (ELISA). Anti-UB05-09 antibody levels doubled that of its constituent antigens, UB09 and UB05, and this correlated with protection against malaria. The presence of enhanced UB05-09-specific antibody correlated with the absence of fever and parasitaemia, which are the main symptoms of malaria infection. The chimera is more effective in detecting and distinguishing acquired protective immunity against malaria than any of its constituents taken alone. Online B-cell epitope prediction tools confirmed the presence of B-cell epitopes in the study antigens. UB05-09 chimera is a marker of protective immunity against malaria that needs to be studied further. © 2017 John Wiley & Sons Ltd.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the JACK FITZ in the Gulf of Mexico from 2010-09-04 to 2010-09-12 in response to the Deepwater...
An evaluation of trace element release associated with acid mine drainage
International Nuclear Information System (INIS)
Sullivan, P.J.; Yelton, J.L.
1988-01-01
The determination of trace element release from geologic materials, such as oil shale and coal overburden, is important for proper solid waste management planning. The objective of this study was to determine a correlation between release using the following methods: (1) sequential selective dissolution for determining trace element residencies, (2) toxicity characteristic leaching procedure (TCLP), and (3) humidity cell weathering study simulating maximum trace element release. Two eastern oil shales were used, a New Albany shale that contains 4.6 percent pyrite, and a Chattanooga shale that contains 1.5 percent pyrite. Each shale was analyzed for elemental concentrations by soluble, adsorbed, organic, carbonate, and sulfide phases. The results of the results of the selective dissolution studies show that each trace element has a unique distribution between the various phases. Thus, it is possible to predict trace element release based on trace element residency. The TCLP results show that this method is suitable for assessing soluble trace element release but does not realistically assess potential hazards. The results of the humidity cell studies do demonstrate a more reasonable method for predicting trace element release and potential water quality hazards. The humidity cell methods, however, require months to obtain the required data with a large number of analytical measurements. When the selective dissolution data are compared to the trace element concentrations in the TCLP and humidity cell leachates, it is shown that leachate concentrations are predicted by the selective dissolution data. Therefore, selective dissolution may represent a rapid method to assess trace element release associated with acid mine drainage
Directory of Open Access Journals (Sweden)
Taylor Brandão Schnaider
2002-04-01
Full Text Available JUSTIFICATIVA E OBJETIVOS: Em estudo com células endoteliais de veias umbilicais humanas expostas à indometacina, foi observado aumento da atividade pró-coagulante. Estudo em coelhos comprovou a presença de trombose nas veias auriculares após administração de tenoxicam com seu diluente ou de seu diluente isolado. Não foram encontrados estudos na literatura consultada que tenham avaliado o endotélio venoso após a administração do tenoxicam, em seres humanos. O objetivo desta pesquisa foi avaliar se o tenoxicam com cloreto de sódio a 0,9% (NaCl a 0,9% provoca alterações no endotélio venoso de coelhos, como as observadas quando associado ao seu diluente (água bidestilada. MÉTODO: Noventa coelhos (2.000 - 3.500 g foram distribuídos aleatoriamente em dois grupos: Controle, com administração de NaCl a 0,9%; Experimento, com tenoxicam (20 mg associado à água bidestilada ou ao NaCl a 0,9%. O volume injetado nos dois grupos foi constante de 2 ml. A anestesia foi induzida com maleato de acepromazina, cloridrato de cetamina e cloridrato de xilazina, sendo a punção das veias auriculares caudais direita e esquerda realizada com agulha tipo borboleta 27G. Os animais foram mantidos no biotério por 6 h, 12 h e 24 h, novamente anestesiados e submetidos à eutanásia, sendo então realizada exérese das aurículas em sua base e posterior avaliação microscópica das veias. RESULTADOS: Observou-se trombose no grupo Experimento, numa porcentagem de 19,4% após administração do tenoxicam com água bidestilada e 22,2% após administração do tenoxicam com NaCl a 0,9%. No grupo Controle, em que foi injetado somente NaCl a 0,9%, nenhuma das veias apresentou trombose. CONCLUSÕES: Os resultados encontrados permitem concluir que o tenoxicam, com água bidestilada ou com solução de cloreto de sódio a 0,9%, produziu trombose nas veias em que foi injetado.JUSTIFICATIVA Y OBJETIVOS: En estudio con células endoteliales de venas umbilicales
Baumüller, E; Schaller, S J; Chiquito Lama, Y; Frick, C G; Bauhofer, T; Eikermann, M; Fink, H; Blobner, M
2015-05-01
A train-of-four ratio (TOFR) ≥0.9 measured by quantitative neuromuscular monitoring is accepted as an indication of sufficient neuromuscular recovery for extubation, even though many postsynaptic acetylcholine receptors may still be inhibited. We investigated whether antagonism with sugammadex after spontaneous recovery to TOFR≥0.9 further improves muscle function or subjective well-being. Following recovery to TOFR≥0.9 and emergence from anaesthesia, 300 patients randomly received either sugammadex 1.0 mg kg(-1) or placebo. Fine motor function (Purdue Pegboard Test) and maximal voluntary grip strength were measured before and after surgery (before and after test drug administration). At discharge from the postanaesthesia care unit, well-being was assessed with numerical analogue scales and the Quality-of-Recovery Score 40 (QoR-40). Patients' fine motor function [6 (sd 4) vs 15 (3) pegs (30 s)(-1), Psugammadex or placebo, motor function was significantly improved in both groups but did not reach the preoperative level. There was no difference between groups at any time. Global well-being was unaffected (QoR-40: placebo, 174 vs 185; sugammadex, 175 vs 186, P>0.05). Antagonizing rocuronium at TOF≥0.9 with sugammadex 1.0 mg kg(-) (1) did not improve patients' motor function or well-being when compared with placebo. Our data support the view that TOFR≥0.9 measured by electromyography signifies sufficient recovery of neuromuscular function. The trial is registered at ClinicalTrials.gov (NCT01101139). © The Author 2014. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M
2013-05-01
During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5-14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15-24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates.
High School Longitudinal Study of 2009 (HSLS:09): Base-Year Data File Documentation. NCES 2011-328
Ingels, Steven J.; Pratt, Daniel J.; Herget, Deborah R.; Burns, Laura J.; Dever, Jill A.; Ottem, Randolph; Rogers, James E.; Jin, Ying; Leinwand, Steve
2011-01-01
The High School Longitudinal Study of 2009 (HSLS:09) is the fifth in a series of National Center for Education Statistics (NCES) secondary longitudinal studies. The core research questions for HSLS:09 explore secondary to postsecondary transition plans and the evolution of those plans; the paths into and out of science, technology, engineering,…
National Collegiate Athletic Association (NJ1), 2009
2009-01-01
This report marks the completion of the 2008-09 reporting cycle and the fourth year of the Division III Financial Aid Reporting Program. The report examines findings for all reporting institutions from each of the four reporting cycles, and details the outcomes of the Division III Financial Aid Committee's 2008-09 review process. Four calculations…
International Nuclear Information System (INIS)
Taylor, P.A.; Kent, T.E.
1994-02-01
This project was undertaken to demonstrate that new liquid waste streams, generated as a consequence of closure activities at Waste Area Grouping (WAG) 6 and other sites, can be treated at the existing wastewater treatment facilities at Oak Ridge National Laboratory (ORNL) to meet discharge requirements without producing hazardous secondary solid wastes. Previous bench and pilot-scale treatability studies have shown that ORNL treatment operations will adequately remove the contaminants and that the secondary solid wastes produced were not hazardous when treating water from two trenches in WAG 6. This study used WAG 6 trench water spiked with the minimum concentration of Toxicity Characteristics Leaching Procedure (TCLP) constituents (chemicals that can make a waste hazardous) found in any groundwater samples at ORNL. The Wastewater Treatment Test Facility (WTTF), a 0.5 L/min pilot plant that simulates the treatment capabilities of the Process Waste Treatment Plant (PWPT) and Nonradiological Wastewater Treatment Plant (NRWTP), was used for this test. This test system, which is able to produce secondary wastes in the quantities necessary for TCLP testing, was operated for a 59-d test period with a minimum of problems and downtime. The pilot plant operating data verified that WAG 6 trench waters, spiked with the minimum concentration of TCLP contaminants measured to date, can be treated at the PWTP and NRWTP to meet current discharge limits. The results of the TCLP analysis indicated that none of the secondary solid wastes produced during the treatment of these wastewaters will be considered hazardous as defined by the Resource Conservation and Recovery Act
Karthikeyan, N.; Kumar, R. Ramesh; Jaiganesh, G.; Sivakumar, K.
2018-01-01
The search for thermoelectric materials has been incredibly increased due to the increase in global energy demand. Hence the present work focus on preparation and characterization of thermal transport phenomena of pure and Ba/Ca substituted perovskite LaFeO3 orthoferrite system. The conventional solid state reaction technique is utilized for the preparation of LaFeO3 and La0.9M0.1FeO3 (M = Ca and Ba) compounds. Crystal structure analyses of the prepared samples are analyses using Rietveld refinement process which confirms the orthoferrite crystal structure of all the prepared compounds with induced distortion in position of atoms by the incorporation of substituent atoms. The electronic structure calculations are performed by VASP. As the LaFeO3 compound is a strongly energy correlated system, the Density Functional Theory (DFT) calculations are performed by DFT + U (Hubbard function) method. The computed band gap values are compared with the energy gap values calculated from UV-Vis spectral analysis. Electrical conductivity measurement and Arrhenius behavior for the temperature range of room temperature to 650 K are analyzed and the drift increase in conductivity with respect to temperature is due to the thermally activated mobility of charge carriers. Temperature dependent thermopower analysis is also examined using homemade seebeck coefficient measurement system. The calculation of thermoelectric power factor reveals that the Ba substituted LaFeO3 compound show highest power factor value of 3.73 μW/K2 cm at higher temperature and the superior power factor values observed in the Ba substituted compound determine the material's capability in power generating devices based on thermoelectric effect.
National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113914 includes chemical, discrete sample, physical and profile data collected from METEOR in the North Atlantic Ocean from 1997-08-15 to 1997-09-09...
National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0115700 includes chemical, discrete sample, physical and profile data collected from KNORR in the South Pacific Ocean from 1992-09-01 to 1992-09-15...
Energy Technology Data Exchange (ETDEWEB)
Bartlett, Jennifer L.; Finch, Charlie T. [U.S. Naval Observatory, Washington, DC 20392 (United States); Lurie, John C. [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Riedel, Adric [California Institute of Technology, Pasadena, CA 91125 (United States); Ianna, Philip A.; Henry, Todd J. [RECONS Institute, Chambersburg, PA 17201 (United States); Jao, Wei-Chun [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30302 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Subasavage, John P., E-mail: jennifer.bartlett@navy.mil, E-mail: charlie.finch@usno.navy.mil, E-mail: lurie@uw.edu, E-mail: adric.riedel@gmail.com, E-mail: philianna3@gmail.com, E-mail: thenry@chara.gsu.edu, E-mail: jao@chara.gsu.edu, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: jsubasavage@nofs.usno.navy.mil [U.S. Naval Observatory, Flagstaff, AZ 86001 (United States)
2017-10-01
As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr{sup −1}, including 2MASS J02511490-0352459, which exceeds 2.″0 yr{sup −1}. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11–22 mag and spectral types M3.0V–L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na i and K i gravity indicators, H α measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ∼120 Myr.
Bartlett, Jennifer L.; Lurie, John C.; Riedel, Adric; Ianna, Philip A.; Jao, Wei-Chun; Henry, Todd J.; Winters, Jennifer G.; Finch, Charlie T.; Subasavage, John P.
2017-10-01
As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr-1, including 2MASS J02511490-0352459, which exceeds 2.″0 yr-1. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11-22 mag and spectral types M3.0V-L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na I and K I gravity indicators, Hα measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ˜120 Myr.
Saravana Kumar, P.; Balachandran, C.; Duraipandiyan, V.; Ramasamy, D.; Ignacimuthu, S.; Al-Dhabi, Naif Abdullah
2015-02-01
The application of microorganisms for the synthesis of nanoparticles as an eco-friendly and promising approach is welcome due to its non-toxicity and simplicity. The aim of this study was to synthesize silver nanoparticle using Streptomyces sp. (09 PBT 005). 09 PBT 005 was isolated from the soil sample of the agriculture field in Vengodu, Thiruvannamalai district, Tamil Nadu, India. 09 PBT 005 was subjected to molecular characterization by 16S rRNA sequence analysis. It was found that 09 PBT 005 belonged to Streptomyces sp. The isolate Streptomyces sp. 09 PBT 005 was inoculated in fermentation medium and incubated at 30 ºC for 12 days in different pH conditions. The 0.02 molar concentration showed good antibacterial activity against Gram-positive and Gram-negative bacteria at pH-7. The synthesis of silver nanoparticles was investigated by UV-Vis spectroscopy, scanning electron microscopy and Fourier Transform Infrared analysis. The synthesized AgNPs sizes were found to be in the dimensions ranging between 198 and 595 nm. The cytotoxicity of the synthesized nanoparticles was studied against A549 adenocarcinoma lung cancer cell line. It showed 83.23 % activity at 100 μl with IC 50 value of 50 μl. This method will be useful in the biosynthesis of nanoparticles.
First-principles study of electronic properties of Si doped FeSe{sub 0.9} alloys
Energy Technology Data Exchange (ETDEWEB)
Kumar, Sandeep, E-mail: sandeep@phy.iitb.ac.in; Singh, Prabhakar P. [Department of Physics, Indian Institute of Technology Bombay, Powai, Mumbai 400076 (India)
2016-05-23
We have performed first-principles study of electronic and superconducting properties of FeSe{sub 0.9-x}Si{sub x} (x = 0.0, 0.05) alloys using Korringa-Kohn-Rostoker Atomic Sphere Approximation within the coherent potential approximation (KKR-ASA-CPA). In our calculations, we used the local density approximation (LDA) for the exchange correlation potential. Our calculations show that these alloys are nonmagnetic in nature. We found that the substitution of Si at Se site into FeSe{sub 0.9} made subtle affects in the electronic structure with respect to the parent FeSe. The results have been analyzed in terms of changes in the density of states (DOS), band structures, Fermi surfaces and the superconducting transition temperature of FeSe{sub 0.9} and FeSe{sub 0.85}Si{sub 0.05} alloys.
H2-assisted CO2 thermochemical reduction on La0.9Ca0.1FeO3-δ membranes: a kinetics study
Wu, Xiao-Yu; Ghoniem, Ahmed F.
2017-01-01
Kinetics data for CO2 thermochemical reduction in an isothermal membrane reactor is required to identify the rate-limiting steps. Here, we report a detailed reaction kinetics study on this process supported by an La0.9Ca0.1FeO3-δ (LCF-91) membrane. The dependence of CO2 reduction rate on various operating conditions is examined such as CO2 concentration on the feed side, fuel concentrations on the sweep side and temperatures. CO2 reduction rate is proportional to the oxygen flux across the membrane, and the measured maximum fluxes are 0.191 and 0.164 μmol cm-2 s-1 with 9.5% H2 and 11.6% CO on the sweep side at 990oC, respectively. Fuel is used to maintain the chemical potential gradient across the membrane and CO is used by construction to derive the surface reaction kinetics. This membrane also exhibits stable performances for 106 hours. A resistance-network model is developed to describe the oxygen transport process and the kinetics data are parameterized using the experimental values. The model shows a transition of the rate limiting step between the surface reactions on the feed side and the sweep side depending on the operating conditions.
H2-assisted CO2 thermochemical reduction on La0.9Ca0.1FeO3-δ membranes: a kinetics study
Wu, Xiao-Yu
2017-11-04
Kinetics data for CO2 thermochemical reduction in an isothermal membrane reactor is required to identify the rate-limiting steps. Here, we report a detailed reaction kinetics study on this process supported by an La0.9Ca0.1FeO3-δ (LCF-91) membrane. The dependence of CO2 reduction rate on various operating conditions is examined such as CO2 concentration on the feed side, fuel concentrations on the sweep side and temperatures. CO2 reduction rate is proportional to the oxygen flux across the membrane, and the measured maximum fluxes are 0.191 and 0.164 μmol cm-2 s-1 with 9.5% H2 and 11.6% CO on the sweep side at 990oC, respectively. Fuel is used to maintain the chemical potential gradient across the membrane and CO is used by construction to derive the surface reaction kinetics. This membrane also exhibits stable performances for 106 hours. A resistance-network model is developed to describe the oxygen transport process and the kinetics data are parameterized using the experimental values. The model shows a transition of the rate limiting step between the surface reactions on the feed side and the sweep side depending on the operating conditions.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Specialty Diver I in the Gulf of Mexico from 2010-09-10 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Meg L. Skansi in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...
Czech Academy of Sciences Publication Activity Database
Dubánková, Anna; Humpolíčková, Jana; Šilhán, Jan; Bäumlová, Adriana; Chalupská, Dominika; Klíma, Martin; Bouřa, Evžen
2017-01-01
Roč. 284, Suppl 1 (2017), s. 190 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : RdRp * ACBD3 Subject RIV: CE - Biochemistry
Energy Technology Data Exchange (ETDEWEB)
Yu, Limin [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou (China); University of Chinese Academy of Sciences, Beijing (China); Jia, Junhong; Yi, Gewen [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou (China)
2017-02-15
An electrode with [KNbO{sub 3}]{sub 0.9}[BaCo{sub 1/2}Nb{sub 1/2}O{sub 3-δ}]{sub 0.1} (KBCNO) perovskite oxide as sensitizer and well-aligned TiO{sub 2} nanorod arrays is prepared via conventional standard solid-state synthesis method, followed by pulsed laser deposition technique for the first time. Enhanced absorption in visible light region is observed for KBCNO rate at TiO{sub 2} NRs photoelectrode, which is mainly because the inserted Co 3d electronic states can hybridize with O 2p states in the gap of KBCNO, reducing the band gap to 1.90 eV. Additionally, the oxygen vacancies existing in KBCNO can not only serve as photoinduced charge traps and adsorption sites but also prevent recombination of photoinduced electron-hole, giving rise to enhanced separation of photogenerated electron-hole pair and leading to an improved performance in solar energy conversion. The KBCNO rate at TiO{sub 2} NRs photoelectrode exhibits an energy conversion efficiency of 0.183% under one sun illumination. This work provide further insight for improving the efficiency of utilization of solar energy by using a new composite perovskite oxides material, which may be promising rational categories of material for solar conversion and storage devices. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
LENUS (Irish Health Repository)
Valenciano, Marta
2015-06-04
In the first five I-MOVE (Influenza Monitoring Vaccine Effectiveness in Europe) influenza seasons vaccine effectiveness (VE) results were relatively homogenous among participating study sites. In 2013-2014, we undertook a multicentre case-control study based on sentinel practitioner surveillance networks in six European Union (EU) countries to measure 2013-2014 influenza VE against medically-attended influenza-like illness (ILI) laboratory-confirmed as influenza. Influenza A(H3N2) and A(H1N1)pdm09 viruses co-circulated during the season.
Darton, Thomas C; Jones, Claire; Blohmke, Christoph J; Waddington, Claire S; Zhou, Liqing; Peters, Anna; Haworth, Kathryn; Sie, Rebecca; Green, Christopher A; Jeppesen, Catherine A; Moore, Maria; Thompson, Ben A V; John, Tessa; Kingsley, Robert A; Yu, Ly-Mee; Voysey, Merryn; Hindle, Zoe; Lockhart, Stephen; Sztein, Marcelo B; Dougan, Gordon; Angus, Brian; Levine, Myron M; Pollard, Andrew J
2016-08-01
Typhoid persists as a major cause of global morbidity. While several licensed vaccines to prevent typhoid are available, they are of only moderate efficacy and unsuitable for use in children less than two years of age. Development of new efficacious vaccines is complicated by the human host-restriction of Salmonella enterica serovar Typhi (S. Typhi) and lack of clear correlates of protection. In this study, we aimed to evaluate the protective efficacy of a single dose of the oral vaccine candidate, M01ZH09, in susceptible volunteers by direct typhoid challenge. We performed a randomised, double-blind, placebo-controlled trial in healthy adult participants at a single centre in Oxford (UK). Participants were allocated to receive one dose of double-blinded M01ZH09 or placebo or 3-doses of open-label Ty21a. Twenty-eight days after vaccination, participants were challenged with 104CFU S. Typhi Quailes strain. The efficacy of M01ZH09 compared with placebo (primary outcome) was assessed as the percentage of participants reaching pre-defined endpoints constituting typhoid diagnosis (fever and/or bacteraemia) during the 14 days after challenge. Ninety-nine participants were randomised to receive M01ZH09 (n = 33), placebo (n = 33) or 3-doses of Ty21a (n = 33). After challenge, typhoid was diagnosed in 18/31 (58.1% [95% CI 39.1 to 75.5]) M01ZH09, 20/30 (66.7% [47.2 to 87.2]) placebo, and 13/30 (43.3% [25.5 to 62.6]) Ty21a vaccine recipients. Vaccine efficacy (VE) for one dose of M01ZH09 was 13% [95% CI -29 to 41] and 35% [-5 to 60] for 3-doses of Ty21a. Retrospective multivariable analyses demonstrated that pre-existing anti-Vi antibody significantly reduced susceptibility to infection after challenge; a 1 log increase in anti-Vi IgG resulting in a 71% decrease in the hazard ratio of typhoid diagnosis ([95% CI 30 to 88%], p = 0.006) during the 14 day challenge period. Limitations to the study included the requirement to limit the challenge period prior to treatment to 2
Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M.
2013-01-01
During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5–14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15–24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates. PMID:23509122
DEFF Research Database (Denmark)
Huang, Hua; Cheng, Shiyang; Gao, Jianfeng
2014-01-01
The dual-phase Ce0.9Gd0.1O1.95–La0.6Sr0.4Co0.2Fe0.8O3−δ asymmetric membrane was prepared via a phase-inversion tape-casting method. The membrane consisted of a thicker porous support layer and a thinner dense layer. When the dense side of the membrane was coated with a La0.6Sr0.4CoO3−δ catalytic...
1994-10-01
Division Chief Dr George Lee ................................ Executive Manager MSgt Mike Wantland .. . . . . . . . . . . . . . .Division...prevents cross contamination of samples. The plastic bag may be Labelled with either a Sharple or an adhesive-backed label. Finally, the bagged tube...cost of the TCLP Metals Screen is aruund $400.00. 3. Who do I call ff I have Further questions? In the Analytical Division, MSgt Mike Wantland (DSN240
NCBI nr-aa BLAST: CBRC-PTRO-09-0020 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-09-0020 ref|NP_000671.2| alpha-1A-adrenergic receptor isoform 1 [Homo sap...iens] sp|P35348|ADA1A_HUMAN Alpha-1A adrenergic receptor (Alpha 1A-adrenoceptor) (Alpha 1A-adrenoreceptor) (Alpha-1C adrenergic... receptor) (Alpha adrenergic receptor 1c) gb|AAB60353.1| adrenergic alpha-1c receptor pro...tein dbj|BAC05926.1| seven transmembrane helix receptor [Homo sapiens] gb|AAQ91331.1| adrenergic
Magnetic transitions in double perovskite Sr2FeRe1-xSbxO6 (0≤x≤0.9)
International Nuclear Information System (INIS)
Jung, Alexandra; Ksenofontov, Vadim; Reiman, Sergey; Therese, Helen Annal; Felser, Claudia; Tremel, Wolfgang; Kolb, Ute
2006-01-01
The double perovskites Sr 2 FeMO 6 (M=Re,Mo) belong to the important class of half-metallic magnetic materials. In this study we explore the effect of replacing the electronic 5d buffer element Re with variable valency by the main group element Sb with fixed valency. X-ray diffraction reveals Sr 2 FeRe 1-x Sb x O 6 (0 2 FeReO 6 changes to antiferromagnetic upon Sb substitution as was determined by magnetic susceptibility measurements. Samples up to a doping level of 0.3 are ferrimagnetic, while Sb contents higher than 0.6 result in an overall antiferromagnetic behavior. 57 Fe and 121 Sb Moessbauer spectroscopy specifies the valence state of Sb to be +5 within the whole range of substitution whereas the Fe valence state changes from +2.7 for the parent compound to +2.9 for Sr 2 FeRe 0.1 Sb 0.9 O 6 . Accordingly, Fe adopts the role of an electronic buffer element from Re upon heavy Sb doping. Additionally, 57 Fe Moessbauer results show a coexistence of ferri- and antiferromagnetic clusters within the same perovskite-type crystal structure in the Sb substitution range 0.3 2 FeReO 6 and Sr 2 FeRe 0.9 Sb 0.1 O 6 are ''purely'' ferrimagnetic and Sr 2 FeRe 0.1 Sb 0.9 O 6 contains antiferromagnetically ordered Fe sites only. Consequently, a replacement of the Re atoms by a nonmagnetic main group element such as Sb blocks the superexchange pathways -Fe-O-Re(Sb)-O-Fe- along the crystallographic axis of the perovskite unit cell and destroys the itinerant magnetism of the parent compound
3D Microstructure Modeling of Porous Metal Filters
Czech Academy of Sciences Publication Activity Database
Hejtmánek, Vladimír; Čapek, M.
2012-01-01
Roč. 2, č. 3 (2012), s. 344-352 ISSN 2075-4701. [International Conference on Porous Metals and Metallic Foams /7./. Busan, 18.09.2011-21.09.2011] R&D Projects: GA ČR(CZ) GAP204/11/1206; GA ČR GA203/09/1353 Institutional support: RVO:67985858 Keywords : porous metal filter * stochastic reconstruction * microstructural descriptors Subject RIV: CF - Physical ; Theoretical Chemistry
Energy Technology Data Exchange (ETDEWEB)
Morris, M.I.
2002-02-06
The Resource Conservation and Recovery Act (RCRA) defines several categories of mercury wastes, each of which has a defined technology or concentration-based treatment standard, or universal treatment standard (UTS). RCRA defines mercury hazardous wastes as any waste that has a TCLP value for mercury of 0.2 mg/L or greater. Three of these categories, all nonwastewaters, fall within the scope of this report on new technologies to treat mercury-contaminated wastes: wastes as elemental mercury; hazardous wastes with less than 260 mg/kg [parts per million (ppm)] mercury; and hazardous wastes with 260 ppm or more of mercury. While this report deals specifically with the last category--hazardous wastes with 260 ppm or more of mercury--the other two categories will be discussed briefly so that the full range of mercury treatment challenges can be understood. The treatment methods for these three categories are as follows: Waste as elemental mercury--RCRA identifies amalgamation (AMLGM) as the treatment standard for radioactive elemental mercury. However, radioactive mercury condensates from retorting (RMERC) processes also require amalgamation. In addition, incineration (IMERC) and RMERC processes that produce residues with >260 ppm of radioactive mercury contamination and that fail the RCRA toxicity characteristic leaching procedure (TCLP) limit for mercury (0.20 mg/L) require RMERC, followed by AMLGM of the condensate. Waste with <260 ppm mercury--No specific treatment method is specified for hazardous wastes containing <260 ppm. However, RCRA regulations require that such wastes (other than RMERC residues) that exceed a TCLP mercury concentration of 0.20 mg/L be treated by a suitable method to meet the TCLP limit for mercury of 0.025 mg/L. RMERC residues must meet the TCLP value of {ge}0.20 mg/L, or be stabilized and meet the {ge}0.025 mg/L limit. Waste with {ge}260 ppm mercury--For hazardous wastes with mercury contaminant concentrations {ge}260 ppm and RCRA
Frequency upconversion fluorescence studies of Er{sup 3+}/Yb{sup 3+}-codoped KNbO{sub 3} phosphors
Energy Technology Data Exchange (ETDEWEB)
Balakrishnaiah, R. [Department of Electronic Materials Engineering, Silla University, Busan 617-736 (Korea, Republic of); Department of Physics, Changwon National University, Changwon 641-773 (Korea, Republic of); Kim, Dong Woo [Department of Electronic Materials Engineering, Silla University, Busan 617-736 (Korea, Republic of); Yi, Soung Soo, E-mail: ssyi@silla.ac.k [Department of Electronic Materials Engineering, Silla University, Busan 617-736 (Korea, Republic of); Kim, Kwang Duk; Kim, Sung Hoon [Department of Engineering in Energy and Applied Chemistry, Silla University, Busan 617-736 (Korea, Republic of); Jang, Kiwan; Lee, Ho Sueb [Department of Physics, Changwon National University, Changwon 641-773 (Korea, Republic of); Jeong, Jung Hyun [Department of Physics, Pukyong National University, Busan 608-737 (Korea, Republic of)
2009-05-29
Different concentrations of Er{sup 3+} and Yb{sup 3+} ions-doped potassium niobate (K{sub 0.9}NbO{sub 3}:Yb{sub (x)}Er{sub (0.1-x)} for x = 0, 0.01, 0.05, 0.09 and 0.1) polycrystalline powder phosphors were prepared by the conventional solid state reaction method and were characterized by X-ray diffraction (XRD) and scanning electron microscopy (SEM) techniques. Energy transfer and upconversion fluorescence properties of the Yb{sup 3+} and Er{sup 3+}-codoped phosphors have been discussed. The XRD data has shown mono-phase for pure KNbO{sub 3} while the doped samples represented additional phase formation. The SEM micrographs represented the rectangular crystal growth habit for the KNbO{sub 3} phosphors when doped with 0.1 mol of Er{sup 3+} ions. An intense green emission at 557 nm along with a red emission at 674 nm was observed when the doped samples were excited with 975 nm IR radiation. The upconversion mechanism has been discussed based on the excited state absorption and energy transfer mechanisms.
Ling, Yihan; Xie, Huixin; Liu, Zijing; Du, Xiaoni; Chen, Hui; Ou, Xuemei; Zhao, Ling; Budiman, Riyan Achmad
2018-03-01
For the sake of improving the electrochemical activity and chromium tolerance of the K2NiF4-type oxide, La2NiO4+δ (LNO), with nonnucleation agents like Mn and Sr elements, the electrochemical performance and degradation were comparatively studied at two cathodes La2Ni0.9Fe0.1O4+δ (LNF) and LNF-40wt%Gd0.1Ce0.9O1.95 (LNF-GDC) on the GDC electrolyte, where 5wt%Cr2O3 incorporation provides Cr-containing atmosphere. Compared with non-doped LNO, LNF shows a higher interstitial oxygen concentration (δ = 0.298) and a lower electrical conductivity, where bivalent Ni ion, {Ni}_{Ni}^{ × } , and trivalent Ni ion, {Ni}_{Ni}^{ \\cdot } , and trivalent Fe ion on Ni-site, {Fe}_{Ni}^{ \\cdot } , were observed from the XPS measurements. LNF-GDC shows greatly reduced interfacial polarization resistances (Rp), which are only half of those of LNF, indicating a better electrochemical performance. More importantly, no significant degradation of LNF-GDC in performance has been observed under exposure of Cr-containing atmosphere at 700 °C for 350 h, while Rp of LNF increased by nearly 20%, suggesting LNF by GDC incorporation can enhance the electrochemical performance as well as chromium tolerance for intermediate temperature solid oxide fuel cells (IT-SOFCs).
Hazardous waste status of discarded electronic cigarettes
Energy Technology Data Exchange (ETDEWEB)
Krause, Max J.; Townsend, Timothy G., E-mail: ttown@ufl.edu
2015-05-15
Highlights: • Electronic cigarettes were tested using TCLP and WET. • Several electronic cigarette products leached lead at hazardous waste levels. • Lead was the only element that exceeded hazardous waste concentration thresholds. • Nicotine solution may cause hazardous waste classification when discarded unused. - Abstract: The potential for disposable electronic cigarettes (e-cigarettes) to be classified as hazardous waste was investigated. The Toxicity Characteristic Leaching Procedure (TCLP) was performed on 23 disposable e-cigarettes in a preliminary survey of metal leaching. Based on these results, four e-cigarette products were selected for replicate analysis by TCLP and the California Waste Extraction Test (WET). Lead was measured in leachate as high as 50 mg/L by WET and 40 mg/L by TCLP. Regulatory thresholds were exceeded by two of 15 products tested in total. Therefore, some e-cigarettes would be toxicity characteristic (TC) hazardous waste but a majority would not. When disposed in the unused form, e-cigarettes containing nicotine juice would be commercial chemical products (CCP) and would, in the United States (US), be considered a listed hazardous waste (P075). While household waste is exempt from hazardous waste regulation, there are many instances in which such waste would be subject to regulation. Manufactures and retailers with unused or expired e-cigarettes or nicotine juice solution would be required to manage these as hazardous waste upon disposal. Current regulations and policies regarding the availability of nicotine-containing e-cigarettes worldwide were reviewed. Despite their small size, disposable e-cigarettes are consumed and discarded much more quickly than typical electronics, which may become a growing concern for waste managers.
Hazardous waste status of discarded electronic cigarettes
International Nuclear Information System (INIS)
Krause, Max J.; Townsend, Timothy G.
2015-01-01
Highlights: • Electronic cigarettes were tested using TCLP and WET. • Several electronic cigarette products leached lead at hazardous waste levels. • Lead was the only element that exceeded hazardous waste concentration thresholds. • Nicotine solution may cause hazardous waste classification when discarded unused. - Abstract: The potential for disposable electronic cigarettes (e-cigarettes) to be classified as hazardous waste was investigated. The Toxicity Characteristic Leaching Procedure (TCLP) was performed on 23 disposable e-cigarettes in a preliminary survey of metal leaching. Based on these results, four e-cigarette products were selected for replicate analysis by TCLP and the California Waste Extraction Test (WET). Lead was measured in leachate as high as 50 mg/L by WET and 40 mg/L by TCLP. Regulatory thresholds were exceeded by two of 15 products tested in total. Therefore, some e-cigarettes would be toxicity characteristic (TC) hazardous waste but a majority would not. When disposed in the unused form, e-cigarettes containing nicotine juice would be commercial chemical products (CCP) and would, in the United States (US), be considered a listed hazardous waste (P075). While household waste is exempt from hazardous waste regulation, there are many instances in which such waste would be subject to regulation. Manufactures and retailers with unused or expired e-cigarettes or nicotine juice solution would be required to manage these as hazardous waste upon disposal. Current regulations and policies regarding the availability of nicotine-containing e-cigarettes worldwide were reviewed. Despite their small size, disposable e-cigarettes are consumed and discarded much more quickly than typical electronics, which may become a growing concern for waste managers
Incorporation and conduction of proton in Sr-doped LaMO3 (M=Al, Sc, In, Yb, Y)
International Nuclear Information System (INIS)
Okuyama, Yuji; Kozai, Takeshi; Ikeda, Shohei; Matsuka, Maki; Sakai, Takaaki; Matsumoto, Hiroshige
2014-01-01
In order to clarify the effect of the B site species in ABO 3 perovskite oxides on the proton transport properties, the proton incorporation into a series of La 0.9 Sr 0.1 MO 3-δ , (M = Al, Sc, In, Yb, Y) was studied by measuring the electrical conductivity and electromotive forces of the gas concentration cells, and by a thermogravimetric analysis. The proton concentration and electrical conductivity increased in the order of the B site species, Al 0.9 Sr 0.1 AlO 3-δ showed an oxide ion conductivity, while La 0.9 Sr 0.1 YbO 3-δ and La 0.9 Sr 0.1 YO 3-δ exhibited a protonic conductivity in the temperature range of 573–1173 K. La 0.9 Sr 0.1 ScO 3-δ and La 0.9 Sr 0.1 InO 3-δ showed a protonic conductivity under 873 K, and a mixed proton and oxide ion conductivity at 1073 K
3D Discrete Dislocation Dynamics Applied to Interactions between Dislocation Walls and Particles
Czech Academy of Sciences Publication Activity Database
Záležák, Tomáš; Dlouhý, Antonín
2012-01-01
Roč. 122, č. 3 (2012), s. 450-452 ISSN 0587-4246. [International Symposium on Physics of Materials /12./ - ISPMA 12. Prague, 04.09.2011-08.09.2011] R&D Projects: GA ČR GD106/09/H035; GA ČR GA202/09/2073; GA MŠk OC 162 Institutional research plan: CEZ:AV0Z20410507 Keywords : 3D discrete dislocation dynamics * tilt boundary * migration * diffusion * pecipitation hardening Subject RIV: JG - Metallurgy Impact factor: 0.531, year: 2012
In-situ stabilization of the Geiger (C and M Oil) Superfund Site
International Nuclear Information System (INIS)
Andromalos, K.B.; Ameel, M.E.
1994-01-01
The Geiger (C and M Oil) Superfund Site is the first US Army Corps of Engineers managed soil remediation project which utilized the in-situ stabilization/solidification technique to remediate the soil. This project involved the remediation of approximately 23,000 cubic yards of contaminated soil. Contaminants of concern included chromium, lead, PCB'S, toluene, benzene, and other organic compounds. Clean-up criteria for the stabilized material was equal to the National Primary Drinking Water Regulations, when tested using the TCLP leachate extraction method. Chromium, lead, and toluene were the main contaminants of concern, with TCLP clean-up goals of 150, 15 and 1,000 parts per billion (ppb), respectively. This National Priorities List (NPL) site is located near Charleston, SC and was an abandoned old waste oil facility that utilized unlined shallow trenches for the storage of waste oil. This paper summarizes the initial testing programs and the final production work at the site. Extensive testing was performed throughout all phases of the project. This testing was performed for the purpose of mix optimization, quality assurance, and verification testing. Specific parameters tested included: TCLP testing of organics, metals and PCBs, permeability testing, and unconfirmed compression strength
Directory of Open Access Journals (Sweden)
Leny Yuliati
2014-05-01
Full Text Available Background: The hydrothermal method was used as a new approach to prepare a series of Ag-doped Cd0.1Zn0.9S photocatalysts. The effect of Ag doping on the properties and photocatalytic activity of Cd0.1Zn0.9S was studied for the hydrogen production from water reduction under visible light irradiation.Results: Compared to the series prepared by the co-precipitation method, samples prepared by the hydrothermal method performed with a better photocatalytic activity. The sample with the optimum amount of Ag doping showed the highest hydrogen production rate of 3.91 mmol/h, which was 1.7 times higher than that of undoped Cd0.1Zn0.9S. With the Ag doping, a red shift in the optical response was observed, leading to a larger portion of the visible light absorption than that of without doping. In addition to the larger absorption in the visible-light region, the increase in photocatalytic activity of samples with Ag doping may also come from the Ag species facilitating electron–hole separation.Conclusion: This study demonstrated that Ag doping is a promising way to enhance the activity of Cd0.1Zn0.9S photocatalyst.
Aamodt, K.; Abeysekara, U.; Abrahantes Quintana, A.; Abramyan, A.; Adamova, D.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, A.; Ahmad, N.; Ahn, S.U.; Akimoto, R.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Avina, E.Almaraz; Alme, J.; Alt, T.; Altini, V.; Altinpinar, S.; Andrei, C.; Andronic, A.; Anelli, G.; Angelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antinori, S.; Antipin, K.; Antonczyk, D.; Antonioli, P.; Anzo, A.; Aphecetche, L.; Appelshauser, H.; Arcelli, S.; Arceo, R.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bablok, S.; Bach, M.; Badala, A.; Baek, Y.W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baldit, A.; Ban, J.; Barbera, R.; Barnafoldi, G.G.; Barnby, L.; Barret, V.; Bartke, J.; Barile, F.; Basile, M.; Basmanov, V.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Becker, B.; Belikov, I.; Bellwied, R.; Belmont-Moreno, E.; Belogianni, A.; Benhabib, L.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdermann, E.; Berdnikov, Y.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Bimbot, L.; Biolcati, E.; Blanc, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Bohm, J.; Boldizsar, L.; Bombara, M.; Bombonati, C.; Bondila, M.; Borel, H.; Borshchov, V.; Borisov, A.; Bortolin, C.; Bose, S.; Bosisio, L.; Bossu, F.; Botje, M.; Bottger, S.; Bourdaud, G.; Boyer, B.; Braun, M.; Braun-Munzinger, P.; Bravina, L.; Bregant, M.; Breitner, T.; Bruckner, G.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Buncic, P.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Camacho, E.; Camerini, P.; Campbell, M.; Canoa Roman, V.; Capitani, G.P.; Cara Romeo, G.; Carena, F.; Carena, W.; Carminati, F.; Casanova Diaz, A.; Caselle, M.; Castellanos, J.Castillo; Castillo Hernandez, J.F.; Catanescu, V.; Cattaruzza, E.; Cavicchioli, C.; Cerello, P.; Chambert, V.; Chang, B.; Chapeland, S.; Charpy, A.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Choi, K.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chuman, F.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Cobanoglu, O.; Coffin, J.P.; Coli, S.; Colla, A.; Conesa Balbastre, G.; Conesa del Valle, Z.; Conner, E.S.; Constantin, P.; Contin, G.; Contreras, J.G.; Corrales Morales, Y.; Cormier, T.M.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Cussonneau, J.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, S.; Dash, A.; Dash, S.; de Barros, G.O.V.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gaspari, M.; de Groot, J.; De Gruttola, D.; de Haas, A.P.; De Marco, N.; De Pasquale, S.; De Remigis, R.; de Rooij, R.; de Vaux, G.; Delagrange, H.; Dellacasa, G.; Deloff, A.; Demanov, V.; Denes, E.; Deppman, A.; D'Erasmo, G.; Derkach, D.; Devaux, A.; Di Bari, D.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Dialinas, M.; Diaz, L.; Diaz, R.; Dietel, T.; Divia, R.; Djuvsland, O.; Dobretsov, V.; Dobrin, A.; Dobrowolski, T.; Donigus, B.; Dominguez, I.; Dordic, O.; Dubey, A.K.; Dubuisson, J.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, A.K.; Dutta Majumdar, M.R.; Elia, D.; Emschermann, D.; Enokizono, A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Evrard, S.; Eyyubova, G.; Fabjan, C.W.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fateev, O.; Fearick, R.; Fedunov, A.; Fehlker, D.; Fekete, V.; Felea, D.; Fenton-Olsen, B.; Feofilov, G.; Fernandez Tellez, A.; Ferreiro, E.G.; Ferretti, A.; Ferretti, R.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Fodor, Z.; Foertsch, S.; Foka, P.; Fokin, S.; Formenti, F.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Frolov, A.; Fuchs, U.; Furano, F.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gadrat, S.; Gagliardi, M.; Gago, A.; Gallio, M.; Ganoti, P.; Ganti, M.S.; Garabatos, C.; Garcia Trapaga, C.; Gebelein, J.; Gemme, R.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Giraudo, G.; Giubellino, P.; Gladysz-Dziadus, E.; Glasow, R.; Glassel, P.; Glenn, A.; Gomez Jimenez, R.; Gonzalez Santos, H.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Gorbunov, Y.; Gotovac, S.; Gottschlag, H.; Grabski, V.; Grajcarek, R.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Gustafsson, H.A.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hamblen, J.; Han, B.H.; Harris, J.W.; Hartig, M.; Harutyunyan, A.; Hasch, D.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heide, M.; Heinz, M.; Helstrup, H.; Herghelegiu, A.; Hernandez, C.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hiei, A.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Hu, S.; Huang, M.; Huber, S.; Humanic, T.J.; Hutter, D.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Innocenti, P.G.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, A.; Ivanov, M.; Ivanov, V.; Iwasaki, T.; Jacholkowski, A.; Jacobs, P.; Jancurova, L.; Jangal, S.; Janik, R.; Jena, C.; Jena, S.; Jirden, L.; Jones, G.T.; Jones, P.G.; Jovanovic, P.; Jung, H.; Jung, W.; Jusko, A.; Kaidalov, A.B.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kamal, A.; Kamermans, R.; Kanaki, K.; Kang, E.; Kang, J.H.; Kapitan, J.; Kaplin, V.; Kapusta, S.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kikola, D.; Kileng, B.; Kim, D.J.; Kim, D.S.; Kim, D.W.; Kim, H.N.; Kim, J.; Kim, J.H.; Kim, J.S.; Kim, M.; Kim, M.; Kim, S.H.; Kim, S.; Kim, Y.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Klovning, A.; Kluge, A.; Kniege, S.; Koch, K.; Kolevatov, R.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskih, A.; Kornas, E.; Kour, R.; Kowalski, M.; Kox, S.; Kozlov, K.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Kravcakova, A.; Krawutschke, T.; Krivda, M.; Krumbhorn, D.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kumar, L.; Kumar, N.; Kupczak, R.; Kurashvili, P.; Kurepin, A.; Kurepin, A.N.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kutouski, M.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; La Rocca, P.; Lackner, F.; Ladron de Guevara, P.; Lafage, V.; Lal, C.; Lara, C.; Larsen, D.T.; Laurenti, G.; Lazzeroni, C.; Le Bornec, Y.; Le Bris, N.; Lee, H.; Lee, K.S.; Lee, S.C.; Lefevre, F.; Lenhardt, M.; Leistam, L.; Lehnert, J.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Li, Y.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Listratenko, O.; Liu, L.; Loginov, V.; Lohn, S.; Lopez, X.; Lopez Noriega, M.; Lopez-Ramirez, R.; Lopez Torres, E.; Lovhoiden, G.; Lozea Feijo Soares, A.; Lu, S.; Lunardon, M.; Luparello, G.; Luquin, L.; Lutz, J.R.; Ma, K.; Ma, R.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Makhlyueva, I.; Mal'Kevich, D.; Malaev, M.; Malagalage, K.J.; Maldonado Cervantes, I.; Malek, M.; Malkiewicz, T.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Martashvili, I.; Martinengo, P.; Martinez Hernandez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Maruyama, Y.; Marzari Chiesa, A.; Masciocchi, S.; Masera, M.; Masetti, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mazza, G.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mendez Lorenzo, P.; Meoni, M.; Mercado Perez, J.; Mereu, P.; Miake, Y.; Michalon, A.; Miftakhov, N.; Milosevic, J.; Minafra, F.; Mischke, A.; Miskowiec, D.; Mitu, C.; Mizoguchi, K.; Mlynarz, J.; Mohanty, B.; Molnar, L.; Mondal, M.M.; Montano Zetina, L.; Monteno, M.; Montes, E.; Morando, M.; Moretto, S.; Morsch, A.; Moukhanova, T.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Munoz, J.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Navach, F.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nendaz, F.; Newby, J.; Nianine, A.; Nicassio, M.; Nielsen, B.S.; Nikolaev, S.; Nikolic, V.; Nikulin, S.; Nikulin, V.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyatha, A.; Nygaard, C.; Nyiri, A.; Nystrand, J.; Ochirov, A.; Odyniec, G.; Oeschler, H.; Oinonen, M.; Okada, K.; Okada, Y.; Oldenburg, M.; Oleniacz, J.; Oppedisano, C.; Orsini, F.; Ortiz Velasquez, A.; Ortona, G.; Oskamp, C.J.; Oskarsson, A.; Osmic, F.; Osterman, L.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Ovrebekk, G.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Panse, R.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Pastircak, B.; Pastore, C.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Pepato, A.; Pereira, H.; Peressounko, D.; Perez, C.; Perini, D.; Perrino, D.; Peryt, W.; Peschek, J.; Pesci, A.; Peskov, V.; Pestov, Y.; Peters, A.J.; Petracek, V.; Petridis, A.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Peyre, J.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Platt, R.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta Lerma, P.L.M.; Poggio, F.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Polozov, P.; Polyakov, V.; Pommeresch, B.; Pop, A.; Posa, F.; Pospisil, V.; Potukuchi, B.; Pouthas, J.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puddu, G.; Pujahari, P.; Pulvirenti, A.; Punin, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Rammler, M.; Raniwala, R.; Raniwala, S.; Rasanen, S.S.; Rashevskaya, I.; Rath, S.; Read, K.F.; Real, J.S.; Redlich, K.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Ricaud, H.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rivetti, A.; Rodriguez Cahuantzi, M.; Roed, K.; Rohrich, D.; Roman Lopez, S.; Romita, R.; Ronchetti, F.; Rosinsky, P.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Rousseau, S.; Roy, C.; Roy, P.; Rubio-Montero, A.J.; Rui, R.; Rusanov, I.; Russo, G.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahoo, R.; Saini, J.; Saiz, P.; Sakata, D.; Salgado, C.A.; Salgueiro Domingues da Silva, R.; Salur, S.; Samanta, T.; Sambyal, S.; Samsonov, V.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Saturnini, P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schindler, H.; Schmidt, C.; Schmidt, H.R.; Schossmaier, K.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Segato, G.; Semenov, D.; Senyukov, S.; Seo, J.; Serci, S.; Serkin, L.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabratova, G.; Shahoyan, R.; Sharkov, G.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddi, E.; Siemiarczuk, T.; Silenzi, A.; Silvermyr, D.; Simili, E.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Snow, H.; Sogaard, C.; Soloviev, A.; Soltveit, H.K.; Soltz, R.; Sommer, W.; Son, C.W.; Son, H.; Song, M.; Soos, C.; Soramel, F.; Soyk, D.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Staley, F.; Stan, E.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Stenlund, E.; Steyn, G.; Stocco, D.; Stock, R.; Stolpovsky, P.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sumbera, M.; Susa, T.; Swoboda, D.; Symons, J.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Szuba, M.; Tadel, M.; Tagridis, C.; Takahara, A.; Takahashi, J.; Tanabe, R.; Takaki, D.J.Tapia; Taureg, H.; Tauro, A.; Tavlet, M.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Tieulent, R.; Tlusty, D.; Toia, A.; Tolyhy, T.; Torcato de Matos, C.; Torii, H.; Torralba, G.; Toscano, L.; Tosello, F.; Tournaire, A.; Traczyk, T.; Tribedy, P.; Troger, G.; Truesdale, D.; Trzaska, W.H.; Tsiledakis, G.; Tsilis, E.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Turvey, A.; Tveter, T.S.; Tydesjo, H.; Tywoniuk, K.; Ulery, J.; Ullaland, K.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vacchi, A.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van den Brink, A.; van der Kolk, N.; Vyvre, P.Vande; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasiliev, A.; Vassiliev, I.; Vasileiou, M.; Vechernin, V.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernet, R.; Verweij, M.; Vetlitskiy, I.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Viyogi, Y.P.; Vodopianov, A.; Voloshin, K.; Voloshin, S.; Volpe, G.; von Haller, B.; Vranic, D.; Vrlakova, J.; Vulpescu, B.; Wagner, B.; Wagner, V.; Wallet, L.; Wan, R.; Wang, D.; Wang, Y.; Watanabe, K.; Wen, Q.; Wessels, J.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilk, A.; Wilk, G.; Williams, M.C.S.; Willis, N.; Windelband, B.; Xu, C.; Yang, C.; Yang, H.; Yasnopolskiy, S.; Yermia, F.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I-K.; Yuan, X.; Yurevich, V.; Yushmanov, I.; Zabrodin, E.; Zagreev, B.; Zalite, A.; Zampolli, C.; Zanevsky, Yu.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zbroszczyk, H.; Zelnicek, P.; Zenin, A.; Zepeda, A.; Zgura, I.; Zhalov, M.; Zhang, X.; Zhou, D.; Zhou, S.; Zhu, J.; Zichichi, A.; Zinchenko, A.; Zinovjev, G.; Zoccarato, Y.; Zychacek, V.; Zynovyev, M.
2010-01-01
Charged-particle production was studied in proton-proton collisions collected at the LHC with the ALICE detector at centre-of-mass energies 0.9 TeV and 2.36 TeV in the pseudorapidity range |eta| < 1.4. In the central region (|eta| < 0.5), at 0.9 TeV, we measure charged-particle pseudorapidity density dNch/deta = 3.02 +- 0.01 (stat.) +0.08 -0.05 (syst.) for inelastic interactions, and dNch/deta = 3.58 +- 0.01 (stat.) +0.12 -0.12 (syst.) for non-single-diffractive interactions. At 2.36 TeV, we find dNch/deta = 3.77 +- 0.01 (stat.) +0.25 -0.12 (syst.) for inelastic, and dNch/deta = 4.43 +- 0.01 (stat.) +0.17 -0.12 (syst.) for non-single-diffractive collisions. The relative increase in charged-particle multiplicity from the lower to higher energy is 24.7% +- 0.5% (stat.) +5.7% -2.8% (syst.) for inelastic and 23.7% +- 0.5% (stat.) +4.6% -1.1% (syst.) for non-single-diffractive interactions. This increase is consistent with that reported by the CMS collaboration for non-single-diffractive events and larger th...
New genetic variants of influenza A(H1N1)pdm09 detected in Cuba during 2011-2013.
Arencibia, Amely; Acosta, Belsy; Muné, Mayra; Valdés, Odalys; Fernandez, Leandro; Medina, Isel; Savón, Clara; Oropesa, Suset; Gonzalez, Grehete; Roque, Rosmery; Gonzalez, Guelsys; Hernández, Bárbara; Goyenechea, Angel; Piñón, Alexander
2015-06-01
Influenza A(H1N1)pdm09 virus has evolved continually since its emergence in 2009. For influenza virus strains, genetic changes occurring in HA1 domain of the hemagglutinin cause the emergence of new variants. The aim of our study is to establish genetic associations between 35 A(H1N1)pdm09 viruses circulating in Cuba in 2011-2012 and 2012-2013 seasons, and A/California/07/2009 strain recommended by WHO as the H1N1 component of the influenza vaccine. The phylogenetic analysis revealed the circulation of clades 3, 6A, 6B, 6C and 7. Mutations were detected in the antigenic site or in the receptor-binding domains of HA1 segment, including S174P, S179N, K180Q, S202T, S220T and R222K. Substitutions S174P, S179N, K180Q and R222K were detected in Cuban strains for the first time. Copyright © 2015 Elsevier B.V. All rights reserved.
Study on uranium leaching behavior from coal fly ash samples
International Nuclear Information System (INIS)
Police, S.; Maity, S.; Chaudhary, D.K.; Sahu, S.K.; Pandit, G.G.
2017-01-01
Leachability of trace and toxic metals from coal fly ash (FA) poses significant environmental problems especially ground and surface water contamination. In the present study, leachability of U using batch leaching tests (i.e., at various leachate pH values) and using TCLP was studied. Results of pH variation study indicate that, U has higher leachability in acidic medium as compared to slightly alkaline medium. The leachable U concentrations observed in pH variation study are well below the WHO safety limits. In TCLP leachates, the leachable U concentrations are found to be higher than that observed in pH variation study. (author)
Energy Technology Data Exchange (ETDEWEB)
Wu, Huan Chun; Yang, Bin [State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Beijing (China); Chen, Yue Feng; Chen, Xu Dong [Collaborative Innovation Center of Steel Technology, Beijing (China)
2017-06-15
The fatigue crack propagation behaviors of Z3CN20.09M duplex stainless steel (DSS) were investigated by studying oxide films of specimens tested in 290°C water and air. The results indicate that a full oxide film that consisted of oxides and hydroxides was formed in 290°C water. By contrast, only a half-baked oxide film consisting of oxides was formed in 290°C air. Both environments are able to deteriorate the elastic modulus and hardness of the oxide films, especially the 290°C water. The fatigue lives of the specimens tested in 290°C air were about twice of those tested in 290°C water at all strain amplitudes. Moreover, the crack propagation rates of the specimen tested in 290°C water were confirmed to be faster than those tested in 290°C air, which was thought to be due to the deteriorative strength of the oxide films induced by the mutual promotion of oxidation and crack propagation at the crack tip. It is noteworthy that the crack propagation can be postponed by the ferrite phase in the DSS, especially when the specimens were tested in 290°C water.
Directory of Open Access Journals (Sweden)
Heidi G. Rodriguez-Ramirez
2014-01-01
Full Text Available In 2009, a new influenza A (H1N1 virus affected many persons around the world. There is an urgent need for finding biomarkers to distinguish between influenza A (H1N1pdm09 and seasonal influenza virus. We investigated these possible biomarkers in the lung of fatal cases of confirmed influenza A (H1N1pdm09. Cytokines (inflammatory and anti-inflammatory and cellular markers (macrophages and lymphocytes subpopulation markers were analyzed in lung tissue from both influenza A (H1N1pdm09 and seasonal influenza virus. High levels of IL-17, IFN-γ, and TNF-α positive cells were identical in lung tissue from the influenza A (H1N1pdm09 and seasonal cases when compared with healthy lung tissue (P<0.05. Increased IL-4+ cells, and CD4+ and CD14+ cells were also found in high levels in both influenza A (H1N1pdm09 and seasonal influenza virus (P<0.05. Low levels of CD206+ cells (marker of alternatively activated macrophages marker in lung were found in influenza A (H1N1pdm09 when compared with seasonal influenza virus (P<0.05, and the ratio of CD206/CD14+ cells was 2.5-fold higher in seasonal and noninfluenza group compared with influenza A (H1N1pdm09 (P<0.05. In conclusion, CD206+ cells differentiate between influenza A (H1N1pdm09 and seasonal influenza virus in lung tissue of fatal cases.
Energy Technology Data Exchange (ETDEWEB)
Gustafson, D.E.; Hofmeister, W.H.; Bayuzick, R.J.; Nagashio, K.; Kuribayashi, K
2003-01-20
This paper presents the results of rapid solidification experiments performed on the copper oxide superconductors Y{sub x}Nd{sub 1-x}Ba{sub 2}Cu{sub 3}O{sub 7-{delta}} (0{<=}x{<=}0.9). Spherical rare earth (RE) 123 specimens were levitated in O{sub 2} using aero-acoustic levitation (AAL), melted with a laser, undercooled, and solidified. The peritectic transformation temperature for the reaction RE{sub 2}BaCuO{sub 5}+liquid{yields}REBa{sub 2}Cu{sub 3}O{sub 7-{delta}} corresponding to the maximum recalescence temperature during solidification was determined. RE123 was formed directly from the melt for Y-Nd binary alloy compositions with Nd concentration greater than 20% (Y concentration less than 80%). A minimum in the peritectic transformation temperature for the Nd/Y123 system corresponding to a composition Y{sub 0.3}Nd{sub 0.7}123 was determined at 66 deg. C below the peritectic of pure Nd123.
Peru : Country Program Evaluation for the World Bank Group, 2003-09
Independent Evaluation Group
2011-01-01
Since 2003, Peru has emerged as an open, rapidly growing economy. Over the review period of 2003-09, successive governments adopted policy platforms aimed at maintaining macroeconomic stability, furthering the private sector supply response, broadening participation in growth, improving social service delivery, and strengthening public institutions. The World Bank Group (WBG) supported each of ...
Energy Technology Data Exchange (ETDEWEB)
Cantrell, Kirk J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Westsik, Joseph H. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Serne, R Jeffrey [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Um, Wooyong [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Cozzi, Alex D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2016-05-16
A review of the most up-to-date and relevant data currently available was conducted to develop a set of recommended values for use in the Integrated Disposal Facility (IDF) performance assessment (PA) to model contaminant release from a cementitious waste form for aqueous wastes treated at the Hanford Effluent Treatment Facility (ETF). This data package relies primarily upon recent data collected on Cast Stone formulations fabricated with simulants of low-activity waste (LAW) and liquid secondary wastes expected to be produced at Hanford. These data were supplemented, when necessary, with data developed for saltstone (a similar grout waste form used at the Savannah River Site). Work is currently underway to collect data on cementitious waste forms that are similar to Cast Stone and saltstone but are tailored to the characteristics of ETF-treated liquid secondary wastes. Recommended values for key parameters to conduct PA modeling of contaminant release from ETF-treated liquid waste are provided.
Directory of Open Access Journals (Sweden)
Thomas C Darton
2016-08-01
Full Text Available Typhoid persists as a major cause of global morbidity. While several licensed vaccines to prevent typhoid are available, they are of only moderate efficacy and unsuitable for use in children less than two years of age. Development of new efficacious vaccines is complicated by the human host-restriction of Salmonella enterica serovar Typhi (S. Typhi and lack of clear correlates of protection. In this study, we aimed to evaluate the protective efficacy of a single dose of the oral vaccine candidate, M01ZH09, in susceptible volunteers by direct typhoid challenge.We performed a randomised, double-blind, placebo-controlled trial in healthy adult participants at a single centre in Oxford (UK. Participants were allocated to receive one dose of double-blinded M01ZH09 or placebo or 3-doses of open-label Ty21a. Twenty-eight days after vaccination, participants were challenged with 104CFU S. Typhi Quailes strain. The efficacy of M01ZH09 compared with placebo (primary outcome was assessed as the percentage of participants reaching pre-defined endpoints constituting typhoid diagnosis (fever and/or bacteraemia during the 14 days after challenge. Ninety-nine participants were randomised to receive M01ZH09 (n = 33, placebo (n = 33 or 3-doses of Ty21a (n = 33. After challenge, typhoid was diagnosed in 18/31 (58.1% [95% CI 39.1 to 75.5] M01ZH09, 20/30 (66.7% [47.2 to 87.2] placebo, and 13/30 (43.3% [25.5 to 62.6] Ty21a vaccine recipients. Vaccine efficacy (VE for one dose of M01ZH09 was 13% [95% CI -29 to 41] and 35% [-5 to 60] for 3-doses of Ty21a. Retrospective multivariable analyses demonstrated that pre-existing anti-Vi antibody significantly reduced susceptibility to infection after challenge; a 1 log increase in anti-Vi IgG resulting in a 71% decrease in the hazard ratio of typhoid diagnosis ([95% CI 30 to 88%], p = 0.006 during the 14 day challenge period. Limitations to the study included the requirement to limit the challenge period prior to treatment to
Zöll, Klaus; Kahlenberg, Volker; Krüger, Hannes; Tropper, Peter
2018-02-01
In the course of a systematic study of a part of the quaternary system Fe2O3-CaO-Al2O3-MgO (FCAM) the previously unknown compound Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36 (FCAM-III) has been synthesized. By analogy with the so-called SFCA series [1-5], our investigation in the system of FCAM shows the existence of a stoichiometric homologous series M14+6nO20+8n, where M = Fe, Ca, Al, Mg and n = 1 or 2. In air, we can prove the formation of coexisting FCAM-III and FCAM-I solid solutions at 1400 °C. By increasing the temperature up to 1425 °C FCAM-I disappears completely and FCAM-III co-exists with magnesiumferrite and a variety of calcium iron oxides. At 1450 °C FCAM-III breaks down to a mixture of FCAM-I again as well as magnesioferrite and melt. Small single-crystals of FCAM-III up to 35 μm in size could be retrieved from the 1425 °C experiment and were subsequently characterized using electron microprobe analysis and synchroton X-ray single-crystal diffraction. Finally the Fe2+/Fetot ratio was calculated from the total iron content based on the crystal-chemical formula obtained from EMPA measurements and charge balance considerations. FCAM-III or Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36 has a triclinic crystal structure (space group P 1 ̅). The basic crystallographic data are: a = 10.223(22) Å, b = 10.316(21) Å, c = 14.203(15) Å, α = 93.473(50)°, β = 107.418(67)°, γ = 109.646(60)°, V = 1323.85(2) ų, Z = 1. Using Schreinemaker's technique to analyze the phase relations in the system Fe2O3-CaO-Al2O3-MgO it was possible to obtain the semi-quantitative stability relations between the participating phases and construct a topologically correct phase sequence as a function of T and fO2. The analysis shows that Ca2Al0.5Fe1.5O5 (C2A0.25F0.75) and CaAl1.5Fe2.5O7 (CA0.75F1.25) with higher calculated Fe2+ contents are preferably formed at lower oxygen fugacity and react to CaAl0.5Fe1.5O4 (CA0.25F0.75) by increasing fO2. Spinel-type magnesium
Energy Technology Data Exchange (ETDEWEB)
Li, C. Q.; Peng, L.; Jiang, K.; Hu, Z. G., E-mail: zghu@ee.ecnu.edu.cn; Chu, J. H. [Key Laboratory of Polar Materials and Devices, Ministry of Education, Department of Electronic Engineering, East China Normal University, Shanghai 200241 (China); Wang, P.; Liu, A. Y. [Department of Physics, Shanghai Normal University, Shanghai 200234 (China)
2015-06-15
The phase transitions of Pb{sub 1−x}Sr{sub x}(Al{sub 1/3}Nb{sub 2/3}){sub 0.1}(Zr{sub 0.52}Ti{sub 0.48}){sub 0.9}O{sub 3} (Sr-modified PAN-PZT) ceramics with Sr compositions of x = 2%, 5%, 10% and 15% have been investigated using X-ray diffraction (XRD), temperature dependent dielectric permittivity and Raman scattering. The XRD analysis show that the phase transition occurs between Sr composition of 5% and 10%. Based on the broad dielectric peaks at 100 Hz, the diffused phase transition from tetragonal (T) to cubic (C) structure shifts to lower temperature with increasing Sr composition. The dramatic changes of wavenumber and full width at half-maximum (FWHM) for E(TO{sub 4})′ softing mode can be observed at morphotropic phase boundary (MPB). Moreover, the MPB characteristic shows a wider and lower trend of temperature region with increasing Sr composition. It could be ascribed to the diminishment of the energy barrier and increment of A-cation entropy. Therefore, the Sr-modified PAN-PZT ceramics unambiguously undergo two successive structural transitions (rhombohedral-tetragonal-cubic phase) with temperature from 80 to 750 K. Correspondingly, the phase diagram of Sr-modified PAN-PZT ceramics can be well depicted.
Preparation of Mo/Al2O3 Sulfide Catalysts Modified by Ir Nanoparticles
Czech Academy of Sciences Publication Activity Database
Cinibulk, Josef; Vít, Zdeněk
2002-01-01
Roč. 143, - (2002), s. 443-451 ISSN 0167-2991. [International Symposium Scientific Bases for the Preparation of Heterogeneous Catalysts /8./. Louvain-la-Neuve, 09.09.2002-12.09.2002] R&D Projects: GA AV ČR IAA4072103 Keywords : catalysts modified * sulfide catalysts * Mo/Al2O3 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.468, year: 2002
2014-05-01
Appendix C, including volumes, flow rates, operating times and routine O&M information. No well rehabilitation was required. Appendix C includes...leaching procedure (TCLP; EPA Method 1311). Soil IDW (12.65 tons) was transported to the Omni Waste of Osceola County Landfill by Florida Environmental...pump for repair. No rehabilitation or re- development of the wells was required. O&M forms are included in Attachment C-3 of this Appendix. C
Coinfection with influenza A(H1N1)pdm09 and dengue virus in fatal cases.
Perdigão, Anne Carolinne Bezerra; Ramalho, Izabel Letícia Cavalcante; Guedes, Maria Izabel Florindo; Braga, Deborah Nunes Melo; Cavalcanti, Luciano Pamplona Góes; Melo, Maria Elisabeth Lisboa de; Araújo, Rafael Montenegro de Carvalho; Lima, Elza Gadelha; Silva, Luciene Alexandre Bié da; Araújo, Lia de Carvalho; Araújo, Fernanda Montenegro de Carvalho
2016-09-01
We report on four patients with fatal influenza A(H1N1)pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses' epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4). Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998). As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015). In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm), caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010). In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013). The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1)pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013). The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1)pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Coinfection with influenza A(H1N1pdm09 and dengue virus in fatal cases
Directory of Open Access Journals (Sweden)
Anne Carolinne Bezerra Perdigão
2016-01-01
Full Text Available Abstract We report on four patients with fatal influenza A(H1N1pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses’ epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4. Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998. As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015. In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm, caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010. In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013. The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013. The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Gefenaite, G.; Tacken, M.; Bos, J.; Stirbu-Wagner, I.; Korevaar, J.C.; Stolk, R.P.; Wolters, B.; Bijl, M.; Postma, M.J.; Wilschut, J.; Nichol, K.L.; Hak, E.
2013-01-01
Introduction: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we conducted a study in the adults belonging to the risk groups to assess the A(H1N1)pdm09 MF59-adjuvanted influenza vaccine effectiveness. Methods: VE against influenza and/or pneumonia was
Denson, D D; Crews, J C; Grummich, K W; Stirm, E J; Sue, C A
1991-03-01
The stability of methadone hydrochloride in 0.9% sodium chloride injection in flexible polyvinyl chloride containers was studied. Commercially available methadone hydrochloride 20 mg/mL and 25-mL single-dose bags of 0.9% sodium chloride injection were used. Six samples each were prepared at methadone hydrochloride concentrations of 1, 2, and 5 mg/mL. The solutions were stored at room temperature and were not protected from light. Immediately after preparation and after two, three, and four weeks of storage, each of the 18 samples was divided into three aliquots, each of which was analyzed in duplicate for methadone hydrochloride concentration by gas chromatography. There was less than 10% change in methadone hydrochloride concentration in any sample throughout the four-week study period. Methadone hydrochloride at concentrations of 1, 2, and 5 mg/mL prepared in commercially available flexible polyvinyl chloride containers of 0.9% sodium chloride injection and stored at room temperature without deliberate protection from light is stable for at least four weeks.
Measures for Assessing Student Attitudes toward Older People
Lin, Xiaoping; Bryant, Christina; Boldero, Jennifer
2011-01-01
Measuring medical and allied health students' attitudes towards older people has been identified as an important research area. The present study compared the use of implicit and explicit attitude measures. Sixty-five undergraduates completed one explicit measure, the Fraboni Scale of Ageism (FSA), (Fraboni, Saltstone, & Hughes, 1990) and one…
Dewulf, J; Galanti, L; Godet, M; Gillet, P; Jamart, J; Hecq, J-D
2015-03-01
The aim of the study was to investigate the long-term stability of acyclovir 5 mg/mL (a generic product versus the brand name) in NaCl 0.9% after storage at 5±3°C and to evaluate the influence of initial freezing and microwave thawing on this stability. Five bags of Acyclovir® Hospira 5 mg/mL (A) and five bags of Zovirax® GSK 5 mg/mL (B) were prepared under aseptic conditions and stored 3 months at -20°C, then thawed and stored 30 days at 4°C. Five bags of Acyclovir® 5 mg/mL (C) and five bags of Zovirax® 5 mg/mL (D) were also prepared under aseptic conditions and stored 30 days at 5±3°C. Optic density measurement at different wavelengths, pH measurement and optic microscope observations were performed periodically during the storage. A forced degradation test with HCl 12 M and NaOH 5 M before and after heating at 100°C was also performed. The concentrations were measured by HPLC-PDA. The only one forced degradation test that yielded chromatograms with degradation products peak was the test with the acid solution heated at 100°C without interference with the native product. No significant change in pH values or optic densities were seen during the study for both products. No crystals were seen with the optic microscope during the study. Acyclovir® and Zovirax® solutions were stable for at least 21 days according to the FDA recommendations. Moreover, there was no statistical difference between regression lines of those two products and two storage conditions. Under the conditions of this study, Acyclovir® 5 mg/mL in 100 mL of NaCl 0.9% infusion remains stable at least for 21 days at 5±3°C with or without freezing at -20°C during the three previous months. There is no statistical difference between the brand name and a generic product. Acyclovir may be prepared in advanced by a centralized intravenous additive service, frozen in polyolefin bags and microwave thawed before storage under refrigeration until 21 days. Copyright © 2014 Elsevier Masson
Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09
Directory of Open Access Journals (Sweden)
P.B. Lintongan
2004-06-01
Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.
Outcomes of influenza A(H1N1)pdm09 virus infection
DEFF Research Database (Denmark)
Lynfield, Ruth; Davey, Richard; Dwyer, Dominic E
2014-01-01
BACKGROUND: Data from prospectively planned cohort studies on risk of major clinical outcomes and prognostic factors for patients with influenza A(H1N1)pdm09 virus are limited. In 2009, in order to assess outcomes and evaluate risk factors for progression of illness, two cohort studies were...
International Nuclear Information System (INIS)
ADAMS, J.W.; KALB, P.D.
2001-01-01
Brookhaven National Laboratory's Sulfur Polymer Stabilization/Solidification (SPSS) process was used to treat approximately 90kg of elemental mercury mixed waste from Los Alamos National Laboratory. Treatment was carried out in a series of eight batches using a 1 ft(sup 3) pilot-scale mixer, where mercury loading in each batch was 33.3 weight percent. Although leach performance is currently not regulated for amalgamated elemental mercury (Hg) mixed waste, Toxicity Characteristic Leach Procedure (TCLP) testing of SPSS treated elemental mercury waste indicates that leachability is readily reduced to below the TCLP limit of 200 ppb (regulatory requirement following treatment by retort for wastes containingandgt; 260 ppb Hg), and with process optimization, to levels less than the stringent Universal Treatment Standard (UTS) limit of 25 ppb that is applied to waste containingandlt; 260 ppm Hg. In addition, mercury-contaminated debris, consisting of primary glass and plastic containers, as well as assorted mercury thermometers, switches, and labware, was first reacted with SPSS components to stabilize the mercury contamination, then macroencapsulated in the molten SPSS product. This treatment was done by vigorous agitation of the sulfur polymer powder and the comminuted debris. Larger plastic and metal containers were reacted to stabilize internal mercury contamination, and then filled with molten sulfur polymer to encapsulate the treated product
Directory of Open Access Journals (Sweden)
Minh D. Nguyen
2016-08-01
Full Text Available Pb0.9La0.1(Zr0.52Ti0.48O3 (PLZT relaxor-ferroelectric thin films were grown on SrRuO3/SrTiO3/Si substrates by pulsed laser deposition. A large recoverable storage density (Ureco of 13.7 J/cm3 together with a high energy efficiency (η of 88.2% under an applied electric field of 1000 kV/cm and at 1 kHz frequency was obtained in 300-nm-thick epitaxial PLZT thin films. These high values are due to the slim and asymmetric hysteresis loop when compared to the values in the reference undoped epitaxial lead zirconate titanate Pb(Zr0.52Ti0.48O3 ferroelectric thin films (Ureco = 9.2 J/cm3 and η = 56.4% which have a high remanent polarization and a small shift in the hysteresis loop, under the same electric field.
The Nuclear Energy Advanced Modeling and Simulation Enabling Computational Technologies FY09 Report
Energy Technology Data Exchange (ETDEWEB)
Diachin, L F; Garaizar, F X; Henson, V E; Pope, G
2009-10-12
In this document we report on the status of the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Enabling Computational Technologies (ECT) effort. In particular, we provide the context for ECT In the broader NEAMS program and describe the three pillars of the ECT effort, namely, (1) tools and libraries, (2) software quality assurance, and (3) computational facility (computers, storage, etc) needs. We report on our FY09 deliverables to determine the needs of the integrated performance and safety codes (IPSCs) in these three areas and lay out the general plan for software quality assurance to meet the requirements of DOE and the DOE Advanced Fuel Cycle Initiative (AFCI). We conclude with a brief description of our interactions with the Idaho National Laboratory computer center to determine what is needed to expand their role as a NEAMS user facility.
Galindo, Danielle; Villanueva, Linda; Nguyen, Cathy; Patel, Milan; Borbridge, Lisa; Attar, Mayssa; Schiffman, Rhett M.; Hollander, David A.
2011-01-01
Abstract Purpose Anti-inflammatory activity of topical nonsteroidal anti-inflammatory drugs is mediated by suppression of cyclooxygenase (COX) isoenzymes. This study compared ocular penetration and inflammation suppression of topical ketorolac 0.45% and bromfenac 0.09% ophthalmic solutions in a rabbit model. Methods At hour 0, 36 rabbits received ketorolac 0.45%, bromfenac 0.09%, or an artificial tear 3 times once every 20 min. Half of the rabbits in each group then received intravenous injections of lipopolysaccharide (LPS) and fluorescein isothiocyanate (FITC)–dextran at hour 1, and the other half at hour 10. Aqueous and iris-ciliary body (ICB) samples were collected in the former group at hour 2 (peak) and in the latter group at hour 11 (trough) An additional group of 6 animals received only FITC-dextran, and samples were collected 1 h later. Peak and trough nonsteroidal anti-inflammatory drug concentrations were compared with previously determined half-maximal inhibitory concentrations (IC50) for COX isoenzymes. Results Peak and trough aqueous and ICB concentrations of ketorolac were at least 7-fold or greater than those of bromfenac. At peak levels, both ketorolac 0.45% and bromfenac 0.09% significantly inhibited LPS-induced aqueous prostaglandin E2 and FITC-dextran elevation (P < 0.01). At trough, both study drugs significantly inhibited LPS-induced aqueous prostaglandin E2 elevation (P < 0.05), but only ketorolac 0.45% significantly reduced LPS-induced aqueous FITC-dextran elevation (P < 0.01). Aqueous and ICB ketorolac concentrations exceeded its IC50 for COX-1 and COX-2 at peak and trough. Aqueous and ICB bromfenac levels exceeded its IC50 for COX-2 at peak and trough, but not for COX-1 at trough aqueous levels and peak and trough ICB levels. Conclusions Both ketorolac 0.45% and bromfenac 0.09% effectively suppressed inflammation at peak. At trough, only ketorolac 0.45% effectively suppressed inflammation as measured by FITC
Prehistory effect on dielectric properties of NaNbO3-Gd1/3NbO3
International Nuclear Information System (INIS)
Burkhanov, A.I.; Bondarenko, P.V.; Shil'nikov, A.V.; Raevskaya, S.I.; Raevskij, I.P.
2006-01-01
One studied the low- and the infralow-frequency dielectric response of 0.9NaNbO 3 -0.1Gd 1/3 NbO 3 (NNG10) composition ceramics and single crystal at the material different prehistory. One revealed the differences in the nature of dielectric aging in NaNbO 3 antiferroelectric base material with a diffused phase transition in contrast to manifestation of similar phenomena in ferroelectrics-relaxors [ru
Electrochemical characterization and redox behavior of Nb-doped SrTiO3
DEFF Research Database (Denmark)
Blennow Tullmar, Peter; Kammer Hansen, Kent; Wallenberg, L. Reine
2009-01-01
Sr-vacancy compensated Nb-doped SrTiO3 with the nominal composition Sr0.94Ti0.9Nb0.1O3 has been evaluated as a solid oxide fuel cell (SOFC) anode material in terms of redox stability and electrochemical properties. Sr0.94Ti0.9Nb0.1O3 has been synthesized with a recently developed modified glycine......-nitrate process. The phase purity and redox behavior have been analyzed with XRD and TGA. The electrochemical properties of Sr0.94Ti0.9Nb0.1O3 and a composite electrode of Sr0.94Ti0.9Nb0.1O3/YSZ have been investigated by electrochemical impedance spectroscopy (EIS) on cone shaped electrodes and on electrodes...... in a symmetrical cell configuration. The experiments indicated that the Nb-doped SrTiO3 electrodes were redox stable and showed a potential ability to be used as a part of a SOFC anode. The electrochemical activity appeared to be governed by the concentration of defect species (especially Ti3+ and V-0...
NCBI nr-aa BLAST: CBRC-MMUS-09-0191 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0191 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r
NCBI nr-aa BLAST: CBRC-GACU-09-0018 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0018 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenergic... receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AAB59487.1| alpha 1a/d adre...nergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenergic
NCBI nr-aa BLAST: CBRC-MMUS-09-0013 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0013 ref|NP_005950.1| melatonin receptor 1B [Homo sapiens] sp|P49286|M...TR1B_HUMAN Melatonin receptor type 1B (Mel-1B-R) (Mel1b melatonin receptor) gb|AAC50612.1| Mel1b-melatonin r...eceptor dbj|BAA92315.1| melatonin 1b receptor [Homo sapiens] gb|AAS00461.1| melatonin receptor 1B [Homo sapi...ens] gb|AAH69163.1| Melatonin receptor 1B [Homo sapiens] gb|EAW66891.1| melatonin receptor 1B [Homo sapiens] NP_005950.1 1e-164 80% ...
Directory of Open Access Journals (Sweden)
Adriano B. Carregaro
2015-01-01
Full Text Available The study aimed to compare the effects of intraosseous infusion of lactated Ringer's and 0.9% sodium chloride solutions on the electrolytes and acid-base balance in pigeons submitted to humerus osteosynthesis. Eighteen pigeons were undergoing to isoflurane anesthesia by an avalvular circuit system. They were randomly assigned into two groups (n=9 receiving lactated Ringer's solution (LR or 0.9% sodium chloride (SC, in a continuous infusion rate of 20mL/kg/h, by using an intraosseous catheter into the tibiotarsus during 60-minute anesthetic procedure. Heart rate (HR, and respiratory rate (RR were measured every 10 min. Venous blood samples were collected at 0, 30 and 60 minutes to analyze blood pH, PvCO2, HCO3 -, Na+ and K+. Blood gases and electrolytes showed respiratory acidosis in both groups during induction, under physical restraint. This acidosis was evidenced by a decrease of pH since 0 min, associated with a compensatory response, observed by increasing of HCO3 - concentration, at 30 and 60 min. It was not observed any changes on Na+ and K+ serum concentrations. According to the results, there is no reason for choosing one of the two solutions, and it could be concluded that both fluid therapy solutions do not promote any impact on acid-base balance and electrolyte concentrations in pigeons submitted to humerus osteosynthesis.
Electronic structure of Rh-based CuRh0.9Mg0.1O2 oxide thermoelectrics
Vilmercati, P.; Martin, E.; Cheney, C. Parks; Bondino, F.; Magnano, E.; Parmigiani, F.; Sasagawa, T.; Mannella, N.
2013-03-01
The electronic structure of the Rh-based CuRh0.9Mg0.1O2 oxide thermoelectric compound has been studied with a multitechnique approach consisting of photoemission, x-ray absorption, and x-ray emission spectroscopies. The data indicate that the region of the valence band in the proximity of the Fermi level is dominated by Rh-derived states. These findings outline the importance of the electronic structure of the Rh ions for the large thermoelectric power in CuRh0.9Mg0.1O2 at high temperature.
International Nuclear Information System (INIS)
Xu, Yang; Yu, Jingang; Peng, Sui; Liu, Suqin; Wei, Zhongqiang; Li, Xianhong; Li, Yajuan
2012-01-01
Homogeneous carbon-coated LiFe 0.9 Mn 0.1 PO 4 cathode material was synthesized by one-step solid-state reaction using glucose as carbon source. Powder X-ray diffractometry (XRD), transmission electron microscopy (TEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and galvanostatic measurements were employed to characterize the samples. Mn-doping and carbon co-modification did not affect the olivine structure of LiFePO 4 , but improved its kinetics in terms of capacity delivery, polarization and rate capability. When compared with the undoped LiFePO 4 /C, the LiFe 0.9 Mn 0.1 PO 4 /C sample presented good size distribution - around 100-200 nm - and better electrochemical performance. At current rates of 0.1, 1.0, 3.0 and 10.0 C (C = 170 mA g -1 ), the LiFe 0.9 Mn 0.1 PO 4 /C electrode delivered discharge capacities of 154.1, 138.8, 120.0 and 94.0 mA h g -1 , respectively. Results obtained by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) indicated that the polarization and charge transfer resistance of the sample were greatly decreased by Mn-doping. (author)
Directory of Open Access Journals (Sweden)
Gayle P Dolan
Full Text Available The Influenza Clinical Information Network (FLU-CIN was established to gather detailed clinical and epidemiological information about patients with laboratory confirmed A(H1N1pdm09 infection in UK hospitals. This report focuses on the clinical course and outcomes of infection in pregnancy.A standardised data extraction form was used to obtain detailed clinical information from hospital case notes and electronic records, for patients with PCR-confirmed A(H1N1pdm09 infection admitted to 13 sentinel hospitals in five clinical 'hubs' and a further 62 non-sentinel hospitals, between 11th May 2009 and 31st January 2010.Outcomes were compared for pregnant and non-pregnant women aged 15-44 years, using univariate and multivariable techniques.Of the 395 women aged 15-44 years, 82 (21% were pregnant; 73 (89% in the second or third trimester. Pregnant women were significantly less likely to exhibit severe respiratory distress at initial assessment (OR = 0.49 (95% CI: 0.30-0.82, require supplemental oxygen on admission (OR = 0.40 (95% CI: 0.20-0.80, or have underlying co-morbidities (p-trend <0.001. However, they were equally likely to be admitted to high dependency (Level 2 or intensive care (Level 3 and/or to die, after adjustment for potential confounders (adj. OR = 0.93 (95% CI: 0.46-1.92. Of 11 pregnant women needing Level 2/3 care, 10 required mechanical ventilation and three died.Since the expected prevalence of pregnancy in the source population was 6%, our data suggest that pregnancy greatly increased the likelihood of hospital admission with A(H1N1pdm09. Pregnant women were less likely than non-pregnant women to have respiratory distress on admission, but severe outcomes were equally likely in both groups.
Source removal strategy development for manufactured gas plant sites
International Nuclear Information System (INIS)
Golchin, J.; Nelson, S.
1994-01-01
A source removal action plan was developed by Midwest Gas and the Iowa Department of Natural Resources to address the source coal tar contamination within the underground gas holder basin at former Manufactured Gas Plant (MGP) sites. The procedure utilizes a mixture of coal, contaminated soil and coal rat sludge to provide a material that had suitable material handling characteristics for shipment and burning in high efficiency utility boilers. Screening of the mixture was required to remove oversized debris and ferrous metal. The resulting mixture did not exhibit toxic characteristics when tested under the Toxicity Characteristics Leaching Procedure (TCLP). Test results on the coal tar sludges have indicated that the more pure coal tar materials may fail the TCLP test and be classified as a RCRA hazardous waste. The processing procedure was designed to stabilize the coal tar sludges and render those sludges less hazardous and, as a result, able to pass the TCLP test. This procedure was adopted by the Edison Electric Institute to develop a national guidance document for remediation of MGP sites. The EPA Office of Solid Waste and Emergency Response recommended this strategy to the Regional Waste Management Directors as a practical tool for handling wastes that may exhibit the RCRA characteristics
Takemae, Nobuhiro; Harada, Michiyo; Nguyen, Phuong Thanh; Nguyen, Tung; Nguyen, Tien Ngoc; To, Thanh Long; Nguyen, Tho Dang; Pham, Vu Phong; Le, Vu Tri; Do, Hoa Thi; Vo, Hung Van; Le, Quang Vinh Tin; Tran, Tan Minh; Nguyen, Thanh Duy; Thai, Phuong Duy; Nguyen, Dang Hoang; Le, Anh Quynh Thi; Nguyen, Diep Thi; Uchida, Yuko; Saito, Takehiko
2017-01-01
Active surveillance of influenza A viruses of swine (IAV-S) involving 262 farms and 10 slaughterhouses in seven provinces in northern and southern Vietnam from 2010 to 2015 yielded 388 isolates from 32 farms; these viruses were classified into H1N1, H1N2, and H3N2 subtypes. Whole-genome sequencing followed by phylogenetic analysis revealed that the isolates represented 15 genotypes, according to the genetic constellation of the eight segments. All of the H1N1 viruses were entirely A(H1N1)pdm09 viruses, whereas all of the H1N2 and H3N2 viruses were reassortants among 5 distinct ancestral viruses: H1 and H3 triple-reassortant (TR) IAV-S that originated from North American pre-2009 human seasonal H1, human seasonal H3N2, and A(H1N1)pdm09 viruses. Notably, 93% of the reassortant IAV-S retained M genes that were derived from A(H1N1)pdm09, suggesting some advantage in terms of their host adaptation. Bayesian Markov chain Monte Carlo analysis revealed that multiple introductions of A(H1N1)pdm09 and TR IAV-S into the Vietnamese pig population have driven the genetic diversity of currently circulating Vietnamese IAV-S. In addition, our results indicate that a reassortant IAV-S with human-like H3 and N2 genes and an A(H1N1)pdm09 origin M gene likely caused a human case in Ho Chi Minh City in 2010. Our current findings indicate that human-to-pig transmission as well as cocirculation of different IAV-S have contributed to diversifying the gene constellations of IAV-S in Vietnam. This comprehensive genetic characterization of 388 influenza A viruses of swine (IAV-S) isolated through active surveillance of Vietnamese pig farms from 2010 through 2015 provides molecular epidemiological insight into the genetic diversification of IAV-S in Vietnam after the emergence of A(H1N1)pdm09 viruses. Multiple reassortments among A(H1N1)pdm09 viruses and enzootic IAV-S yielded 14 genotypes, 9 of which carried novel gene combinations. The reassortants that carried M genes derived from A(H1N1
Extended stability of intravenous 0.9% sodium chloride solution after prolonged heating or cooling.
Puertos, Enrique
2014-03-01
The primary objective of this study was to evaluate the stability and sterility of an intravenous 0.9% sodium chloride solution that had been cooled or heated for an extended period of time. Fifteen sterile 1 L bags of 0.9% sodium chloride solution were randomly selected for this experiment. Five bags were refrigerated at an average temperature of 5.2°C, 5 bags were heated at an average temperature of 39.2°C, and 5 bags were stored at an average room temperature of 21.8°C to serve as controls. All samples were protected from light and stored for a period of 199 days prior to being assayed and analyzed for microbial and fungal growth. There was no clinically significant difference in the mean sodium values between the refrigerated samples, the heated samples, and the control group. There were no signs of microbial or fungal growth for the duration of the study. A sterile intravenous solution of 0.9% sodium chloride that was heated or cooled remained stable and showed no signs of microbial or fungal growth for a period of 199 days. This finding will allow hospitals and emergency medical technicians to significantly extend the expiration date assigned to these fluids and therefore obviate the need to change out these fluids every 28 days as recommended by the manufacturer.
Kim, Chanho; Park, Hyunjung; Jang, Inyoung; Kim, Sungmin; Kim, Kijung; Yoon, Heesung; Paik, Ungyu
2018-02-01
Controlling triple phase boundary (TPB), an intersection of the ionic conductor, electronic conductor and gas phase as a major reaction site, is a key to improve cell performances for low-temperature solid oxide fuel cells. We report a synthesis of morphologically well-defined Gd0.1Ce0.9O1.95 (GDC) embedded Ba0.5Sr0.5Co0.8Fe0.2O3-δ (BSCF) nanofibers and their electrochemical performances as a cathode. Electrospun fibers prepared with a polymeric solution that contains crystalline Ba0.5Sr0.5Co0.8Fe0.2O3-δ particles in ∼200 nm size and Gd(NO3)3/Ce(NO3)3 precursors in an optimized weight ratio of 3 to 2 result in one dimensional structure without severe agglomeration and morphological collapse even after a high calcination at 1000 °C. As-prepared nanofibers have fast electron pathways along the axial direction of fibers, a higher surface area of 7.5 m2 g-1, and more oxygen reaction sites at TPBs than those of GDC/BSCF composite particles and core-shell nanofibers. As a result, the Gd0.1Ce0.9O1.95 embedded Ba0.5Sr0.5Co0.8Fe0.2O3-δ nanofiber cell shows excellent performances of the maximum power density of 0.65 W cm-2 at 550 °C and 1.02 W cm-2 at 600 °C, respectively.
The development of new phosphors of Tb3+/Eu3+ co-doped Gd3Al5O12 with tunable emission
Teng, Xin; Wang, Wenzhi; Cao, Zhentao; Li, Jinkai; Duan, Guangbin; Liu, Zongming
2017-07-01
The gadolinium aluminum garnets Gd3Al5O12 (GdAG) activated with Tb3+/Eu3+ were successfully prepared via co-precipitation method at 1500 °C in this work. The crystal structure stabilization, elements analysis, microphotograph, PL/PLE spectra, decay behavior and quantum efficiency were discussed in detail. The metastable GdAG compounds been effectively stabilized by doping with smaller 10 at.% Tb3+, which then allows the development of new phosphors of (Gd0.9-xTb0.1Eux)3Al5O12 (GdAG:Tb3+/Eu3+, x = 0-0.03) for opto-functionality explorations. The PLE/PL spectra displays that the strongest PLE peak was located at ∼276 nm, which overlaps the 8S7/2 → 6IJ transition of Gd3+. Under 276 nm excitation, the phosphors exhibited both Tb3+ and Eu3+ emissions at 548 nm (green, 5D4 → 7F5 transition of Tb3+) and 592 nm (orange-red, 5D0 → 7F1 transition of Eu3+), respectively. The emission intensities of Tb3+ and Eu3+ remarkably varied with the Eu3+ incorporation. As a consequence, the emission color can be readily tuned from approximately green to orange-red. Fluorescence decay analysis found that the lifetime for the Tb3+ emission rapidly decreased conforming to the Tb3+ → Eu3+ energy transfer, and the energy transfer efficiency was calculated. Owing to the Gd3+ → Eu3+ and Gd3+ → Tb3+ energy transfer, the emission intensities of Tb3+ and Eu3+ in (Gd0.9-xTb0.1Eux)AG phosphor were higher than (Y0.87Tb0.1Eu0.03)AG and (Lu0.87Tb0.1Eu0.03)AG system. The (Gd0.9-xTb0.1Eux)AG garnet phosphors developed in this work may serve as a new type of phosphor which hopefully meets the requirements of various lighting and optical display applications.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Safety Zone and Regulated Navigation Area, Chicago Sanitary and Ship Canal, Romeoville, IL. 165.T09-1080 Section 165.T09-1080 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY REGULATED NAVIGATION AREAS AND LIMITED...
Gefenaite, Giedre; Tacken, Margot; Bos, Jens; Stirbu-Wagner, Irina; Korevaar, Joke C.; Stolk, Ronald P.; Wolters, Bert; Bijl, Marc; Postma, Maarten J.; Wilschut, Jan; Nichol, Kristin L.; Hak, Eelko
Background: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we aimed to assess the effectiveness of MF59-adjuvanted A(H1N1)pdm09 vaccine in a matched case-control study. Objectives: We aimed to assess the effectiveness of MF59- adjuvanted A(H1N1)pdm09
International Nuclear Information System (INIS)
BOWERMAN, B.S.; ADAMS, J.W.; HEISER, J.; KALB, P.D.; LOCKWOOD, A.
2003-01-01
As of October 2001, approximately 7,000 yd 3 of stockpiled soil remained at Brookhaven National Laboratory (BNL) after the remediation of the BNL Chemical/Animal/Glass Pits disposal area. The soils were originally contaminated with radioactive materials and heavy metals, depending on what materials had been interred in the pits, and how the pits were excavated. During the 1997 removal action, the more hazardous/radioactive materials were segregated, along with, chemical liquids and solids, animal carcasses, intact gas cylinders, and a large quantity of metal and glass debris. Nearly all of these materials have been disposed of. In order to ensure that all debris was removed and to characterize the large quantity of heterogeneous soil, BNL initiated an extended sorting, segregation, and characterization project directed at the remaining soil stockpiles. The project was co-funded by the Department of Energy Environmental Management Office (DOE EM) through the BNL Environmental Restoration program and through the DOE EM Office of Science and Technology Accelerated Site Technology Deployment (ASTD) program. The focus was to remove any non-conforming items, and to assure that mercury and radioactive contaminant levels were within acceptable limits for disposal as low-level radioactive waste. Soils with mercury concentrations above allowable levels would be separated for disposal as mixed waste. Sorting and segregation were conducted simultaneously. Large stockpiles (ranging from 150 to 1,200 yd 3 ) were subdivided into manageable 20 yd 3 units after powered vibratory screening. The 1/2-inch screen removed almost all non-conforming items (plus some gravel). Non-conforming items were separated for further characterization. Soil that passed through the screen was also visually inspected before being moved to a 20 yd 3 ''subpile.'' Eight samples from each subpile were collected after establishing a grid of four quadrants: north, east, south and west, and two layers: top and
Analysis of failed ramps during the RHIC FY09 run
Energy Technology Data Exchange (ETDEWEB)
Minty, M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.
2014-08-15
The Relativistic Heavy Ion Collider (RHIC) is a versatile accelerator that supports operation with polarized protons of up to 250 GeV and ions with up to 100 GeV/nucleon. During any running period, various operating scenarios with different particle species, beam energies or accelerator optics are commissioned. In this report the beam commissioning periods for establishing full energy beams (ramp development periods) from the FY09 run are summarized and, for the purpose of motivating further developments, we analyze the reasons for all failed ramps.
Analysis of failed ramps during the RHIC FY09 run
International Nuclear Information System (INIS)
Minty, M.
2014-01-01
The Relativistic Heavy Ion Collider (RHIC) is a versatile accelerator that supports operation with polarized protons of up to 250 GeV and ions with up to 100 GeV/nucleon. During any running period, various operating scenarios with different particle species, beam energies or accelerator optics are commissioned. In this report the beam commissioning periods for establishing full energy beams (ramp development periods) from the FY09 run are summarized and, for the purpose of motivating further developments, we analyze the reasons for all failed ramps.
Abelev, B.; Adamova, D.; Adare, A.M.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Agostinelli, A.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, N.; Masoodi, A.Ahmad; Ahn, S.U.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Molina, R.Alfaro; Alici, A.; Alkin, A.; Almaraz Avina, E.; Alt, T.; Altini, V.; Altinpinar, S.; Altsybeev, I.; Andrei, C.; Andronic, A.; Anguelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshauser, H.; Arbor, N.; Arcelli, S.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Arslandok, M.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bach, M.; Badala, A.; Baek, Y.W.; Bailhache, R.; Bala, R.; Ferroli, R.Baldini; Baldisseri, A.; Baldit, A.; Baltasar Dos Santos Pedrosa, F.; Ban, J.; Baral, R.C.; Barbera, R.; Barile, F.; Barnafoldi, G.G.; Barnby, L.S.; Barret, V.; Bartke, J.; Basile, M.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Beck, H.; Belikov, I.; Bellini, F.; Bellwied, R.; Belmont-Moreno, E.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bergmann, C.; Berzano, D.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, N.; Bianchi, L.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, F.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Boldizsar, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Bortolin, C.; Bose, S.; Bossu, F.; Botje, M.; Bottger, S.; Boyer, B.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broz, M.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Bugaiev, K.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Calvo Villar, E.; Camerini, P.; Canoa Roman, V.; Cara Romeo, G.; Carena, F.; Carena, W.; Carlin Filho, N.; Carminati, F.; Carrillo Montoya, C.A.; Casanova Diaz, A.; Caselle, M.; Castillo Castellanos, J.; Castillo Hernandez, J.F.; Casula, E.A.R.; Catanescu, V.; Cavicchioli, C.; Cepila, J.; Cerello, P.; Chang, B.; Chapeland, S.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chung, S.U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Coccetti, F.; Coffin, J.P.; Colamaria, F.; Colella, D.; Conesa Balbastre, G.; Conesa del Valle, Z.; Constantin, P.; Contin, G.; Contreras, J.G.; Cormier, T.M.; Corrales Morales, Y.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Alaniz, E.Cruz; Cuautle, E.; Cunqueiro, L.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, K.; Das, D.; Dash, A.; Dash, S.; De, S.; De Azevedo Moregula, A.; de Barros, G.O.V.; De Caro, A.; De Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; Delagrange, H.; Del Castillo Sanchez, E.; Deloff, A.; Demanov, V.; De Marco, N.; Denes, E.; De Pasquale, S.; Deppman, A.; Erasmo, G.D.; de Rooij, R.; Di Bari, D.; Dietel, T.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Divia, R.; Djuvsland, O.; Dobrin, A.; Dobrowolski, T.; Dominguez, I.; Donigus, B.; Dordic, O.; Driga, O.; Dubey, A.K.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, M.R.; Dutta Majumdar, A.K.; Elia, D.; Emschermann, D.; Engel, H.; Erdal, H.A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Eyyubova, G.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fearick, R.; Fedunov, A.; Fehlker, D.; Feldkamp, L.; Felea, D.; Feofilov, G.; Fernandez Tellez, A.; Ferretti, A.; Ferretti, R.; Figiel, J.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Finogeev, D.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gagliardi, M.; Gago, A.; Gallio, M.; Gangadharan, D.R.; Ganoti, P.; Garabatos, C.; Garcia-Solis, E.; Garishvili, I.; Gerhard, J.; Germain, M.; Geuna, C.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Gianotti, P.; Girard, M.R.; Giubellino, P.; Gladysz-Dziadus, E.; Glassel, P.; Gomez, R.; Ferreiro, E.G.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Goswami, A.; Gotovac, S.; Grabski, V.; Graczykowski, L.K.; Grajcarek, R.; Grelli, A.; Grigoras, C.; Grigoras, A.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerra Gutierrez, C.; Guerzoni, B.; Guilbaud, M.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Han, B.H.; Hanratty, L.D.; Hansen, A.; Harmanova, Z.; Harris, J.W.; Hartig, M.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heckel, S.T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Huang, M.; Huber, S.; Humanic, T.J.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Incani, E.; Innocenti, P.G.; Innocenti, G.M.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, M.; Ivanov, V.; Ivanov, A.; Ivanytskyi, O.; Jacholkowski, A.; Jacobs, P.M.; Jancurova, L.; Jang, H.J.; Jangal, S.; Janik, R.; Janik, M.A.; Jayarathna, P.H.S.Y.; Jena, S.; Jimenez Bustamante, R.T.; Jirden, L.; Jones, P.G.; Jung, W.; Jung, H.; Jusko, A.; Kaidalov, A.B.; Kakoyan, V.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kanaki, K.; Kang, J.H.; Kaplin, V.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, P.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, J.H.; Kim, D.J.; Kim, D.W.; Kim, J.S.; Kim, M.; Kim, S.H.; Kim, S.; Kim, B.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Kluge, A.; Knichel, M.L.; Koch, K.; Kohler, M.K.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskikh, A.; Korneev, A.; Kottachchi Kankanamge Don, C.; Kour, R.; Kowalski, M.; Kox, S.; Koyithatta Meethaleveedu, G.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Krawutschke, T.; Kretz, M.; Krivda, M.; Krizek, F.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kurashvili, P.; Kurepin, A.B.; Kurepin, A.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; Ladron de Guevara, P.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; La Rocca, P.; Lazzeroni, C.; Lea, R.; Le Bornec, Y.; Lee, S.C.; Lee, K.S.; Lefevre, F.; Lehnert, J.; Leistam, L.; Lenhardt, M.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Liu, L.; Loenne, P.I.; Loggins, V.R.; Loginov, V.; Lohn, S.; Lohner, D.; Loizides, C.; Loo, K.K.; Lopez, X.; Lopez Torres, E.; Lovhoiden, G.; Lu, X.G.; Luettig, P.; Lunardon, M.; Luo, J.; Luparello, G.; Luquin, L.; Luzzi, C.; Ma, R.; Ma, K.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Markert, C.; Martashvili, I.; Martinengo, P.; Martinez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Martynov, Y.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mayer, C.; Mazer, J.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mercado Perez, J.; Meres, M.; Miake, Y.; Michalon, A.; Midori, J.; Milano, L.; Milosevic, J.; Mischke, A.; Mishra, A.N.; Miskowiec, D.; Mitu, C.; Mlynarz, J.; Mohanty, A.K.; Mohanty, B.; Molnar, L.; Montano Zetina, L.; Monteno, M.; Montes, E.; Moon, T.; Morando, M.; Moreira De Godoy, D.A.; Moretto, S.; Morsch, A.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Nattrass, C.; Naumov, N.P.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nicassio, M.; Nielsen, B.S.; Niida, T.; Nikolaev, S.; Nikolic, V.; Nikulin, V.; Nikulin, S.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyanin, A.; Nyatha, A.; Nygaard, C.; Nystrand, J.; Obayashi, H.; Ochirov, A.; Oeschler, H.; Oh, S.K.; Oh, S.; Oleniacz, J.; Oppedisano, C.; Ortiz Velasquez, A.; Ortona, G.; Oskarsson, A.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Passfeld, A.; Pastircak, B.; Patalakha, D.I.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Perales, M.; Pereira De Oliveira Filho, E.; Peresunko, D.; Perez Lara, C.E.; Perez Lezama, E.; Perini, D.; Perrino, D.; Peryt, W.; Pesci, A.; Peskov, V.; Pestov, Y.; Petracek, V.; Petran, M.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Piyarathna, D.B.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta-Lerma, P.L.M.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Pop, A.; Porteboeuf-Houssais, S.; Pospisil, V.; Potukuchi, B.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puchagin, S.; Puddu, G.; Pulvirenti, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Qvigstad, H.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Raniwala, S.; Raniwala, R.; Rasanen, S.S.; Rascanu, B.T.; Rathee, D.; Read, K.F.; Real, J.S.; Redlich, K.; Reichelt, P.; Reicher, M.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rodriguez Cahuantzi, M.; Rohr, D.; Rohrich, D.; Romita, R.; Ronchetti, F.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Roy, P.; Roy, C.; Rubio Montero, A.J.; Rui, R.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahu, P.K.; Saini, J.; Sakaguchi, H.; Sakai, S.; Sakata, D.; Salgado, C.A.; Sambyal, S.; Samsonov, V.; Sanchez Castro, X.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H.R.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Scott, P.A.; Segato, G.; Selyuzhenkov, I.; Senyukov, S.; Seo, J.; Serci, S.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabetai, A.; Shabratova, G.; Shahoyan, R.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddhanta, S.; Siemiarczuk, T.; Silvermyr, D.; Simonetti, G.; Singaraju, R.; Singh, R.; Singha, S.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Sogaard, C.; Soltz, R.; Son, H.; Song, J.; Song, M.; Soos, C.; Soramel, F.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Stan, I.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Steinpreis, M.; Stenlund, E.; Steyn, G.; Stocco, D.; Stolpovskiy, M.; Strabykin, K.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sukhorukov, M.; Sultanov, R.; Sumbera, M.; Susa, T.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Tagridis, C.; Takahashi, J.; J.Tapia Takaki, D.; Tauro, A.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Thomas, J.H.; Thomas, D.; Tieulent, R.; Timmins, A.R.; Tlusty, D.; Toia, A.; Torii, H.; Toscano, L.; Tosello, F.; Traczyk, T.; Truesdale, D.; Trzaska, W.H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T.S.; Ulery, J.; Ullaland, K.; Ulrich, J.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vajzer, M.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van der Kolk, N.; Vande Vyvre, P.; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vechernin, V.; Veldhoen, M.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernekohl, D.C.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, L.; Vinogradov, Y.; Vinogradov, A.; Virgili, T.; Viyogi, Y.P.; Vodopyanov, A.; Voloshin, S.; Voloshin, K.; Volpe, G.; von Haller, B.; Vranic, D.; Ovrebekk, G.; Vrlakova, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, V.; Wan, R.; Wang, Y.; Wang, M.; Wang, D.; Wang, Y.; Watanabe, K.; Wessels, J.P.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilk, A.; Williams, M.C.S.; Windelband, B.; Karampatsos, L.Xaplanteris; Yang, H.; Yang, S.; Yano, S.; Yasnopolskiy, S.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I.K.; Yoon, J.; Yu, W.; Yuan, X.; Yushmanov, I.; Zach, C.; Zampolli, C.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zelnicek, P.; Zgura, I.S.; Zhalov, M.; Zhang, X.; Zhou, F.; Zhou, Y.; Zhou, D.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zinovjev, G.; Zoccarato, Y.; Zynovyev, M.
2013-07-16
The first measurements of the invariant differential cross sections of inclusive $\\pi^0$ and $\\eta$ meson production at mid-rapidity in proton-proton collisions at $\\sqrt{s}=0.9$ TeV and $\\sqrt{s}=7$ TeV are reported. The $\\pi^0$ measurement covers the ranges $0.4
Energy Technology Data Exchange (ETDEWEB)
Mondal, Tanusree [Functional Ceramics Laboratory, Department of Applied Physics, Indian Institute of Technology (ISM), Dhanbad 826004 (India); Das, Sayantani [Department of Physics, University of Calcutta, 92, Acharya Prafulla Chandra Road, Kolkata 700009 (India); Badapanda, T. [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha 7520544 (India); Sinha, T.P. [Department of Physics, Bose Institute, 93/1, Acharya Prafulla Chandra Road, Kolkata 700009 (India); Sarun, P.M., E-mail: sarun.res@gmail.com [Functional Ceramics Laboratory, Department of Applied Physics, Indian Institute of Technology (ISM), Dhanbad 826004 (India)
2017-03-01
The Ca modified Ba{sub 1−x}Ca{sub x}Zr{sub 0.1}Ti{sub 0.9}O{sub 3} (BCZT) system for x=0.00–0.20 is synthesized by the high-temperature conventional solid state reaction method. The morphotropic phase boundary (MPB) between the tetragonal and cubic structure is obtained at room temperature for the composition x=0.15. The doping of Ca facilitates the enhancement of the homogeneity of microstructure and growth of the grain size. The phase transition is also confirmed by Raman spectroscopy. In order to explore the effect of Ca concentration variation on the conduction mechanism of BaZr{sub 0.1}Ti{sub 0.9}O{sub 3} (BZT) ceramic, the frequency dependent ac impedance spectroscopy technique is used at various temperatures. The effect of Ca doping on the electrical properties of BZT is clearly noticeable. The resistance of the grain (bulk) and the grain boundary is increased as a consequence of the increase in the activation energy of Ca substituted BZT samples. The enhanced resistivity of the Ca substituted BZT ceramics is explained in terms of the decrease in the mobility of the charge carriers associated with the lattice distortion. The electric modulus analysis reveals the enhanced capacitance of BCZT ceramics which is in good agreement with the results obtained from complex impedance analysis.
Glinz, Martin; Heymans, Patrick; Persson, Anne; Sindre, Guttorm; Aurum, Aybüke; Madhavji, Nazim; Madhavji, N.; Paech, Barbara; Regev, Gil; Wieringa, Roelf J.
This report summarizes the presentations and discussions at REFSQ’09, the 15th International Working Conference on Requirements Engineering: Foundation for Software Quality which was held on June 8-9, 2009 in Amsterdam, The Netherlands.
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 ref|NP_689554.2| progestin and adipoQ receptor family member IV [...Homo sapiens] sp|Q8N4S7|PAQR4_HUMAN RecName: Full=Progestin and adipoQ receptor family member 4; AltName: Full=Progesti...n and adipoQ receptor family member IV gb|AAH33703.1| Progestin and adipoQ receptor family member... IV [Homo sapiens] gb|AAR08370.1| progestin and adipoQ receptor family member IV ...[Homo sapiens] gb|EAW85441.1| progestin and adipoQ receptor family member IV, isoform CRA_a [Homo sapiens] gb|EAW85443.1| progesti
Energy Technology Data Exchange (ETDEWEB)
Thakur, Shweta; Rai, Radheshyam, E-mail: rshyam1273@gmail.com [School of Physics, Shoolini University, Himachal Pradesh (India); Bdikin, Igor [Centre for Mechanical Technology and Automation (TEMA), University of Aveiro (Portugal); Valente, Manuel Almeida [Departamento de Fisica, Universidade de Aveiro (Portugal)
2016-01-15
In this paper we present the impedance spectroscopy of ternary solid solutions of BiFeO{sub 3} , TbFeO{sub 3} and PbTiO{sub 3} , prepared by solid-state reaction method. The preliminary structural studies were carried out by X-ray diffraction technique, showing the formation of polycrystalline sample with ABO{sub 3} type of perovskite structure with hexagonal symmetry for Bi{sub 0.8}Tb{sub 0.1}Pb{sub 0.1}Fe{sub 0.9}Ti{sub 0.1}O{sub 3} system at room temperature. Dielectric and impedance study of this ceramic has been characterized in the temperature range 175 - 325 deg C and frequency range 100 Hz - 1 MHz. The maximum ferroelectric transition temperature (T{sub c} ) of this system was in the range 210 - 225 deg C with the dielectric constant having maximum value ∼ 2480 at 1 kHz. The complex impedance graph exhibited one impedance semicircle arc at all reported temperatures, which indicates that the impedance response is a Cole-Cole type relaxation. Single semicircle indicate that the grain effect of the bulk in ceramic. The bulk resistance of the material decreases with increasing temperature showing negative temperature showing a typical semiconducting property, i.e. negative temperature coefficient of resistance (NTCR) behavior. (author)
Cao, Xinde; Dermatas, Dimitris; Xu, Xuanfeng; Shen, Gang
2008-03-01
Lead (Pb) contamination at shooting range sites is increasingly under environmental concern. Controlling Pb leachability from shooting range soil media is an important step to minimize Pb exposure to the surrounding environment. This study investigated stabilization of Pb in shooting range soils treated with cement, quicklime, and phosphate. Two soils were used and collected from two shooting ranges, referred to as SR1 and SR2. The treatment additives were applied to the soils at rates from 2.5% to 10% (w/w). The effectiveness of each treatment was evaluated by Pb (w/w). The effectiveness of each treatment was evaluated by Pb leachability, measured by the Toxicity Characteristic Leaching Procedure (TCLP). The possible mechanisms for Pb immobilization were elucidated using X-ray powder diffraction (XRPD). Cement and quicklime treatments were effective in immobilizing Pb in SR1 soil, with reduction of Pb concentration in TCLP leachate (TCLP-Pb) to be below the U.S. EPA non-hazardous regulatory limit of 5 mg L(-1) at application rates of > or =5% and 28-d incubation. By contrast, cement and quicklime amendments were less effective for Pb stabilization in SR2 soil because the TCLP-Pb levels in the treated soil were still higher than the limit of 5 mg L(-1) at all application rates, although they were significantly reduced in comparison with the untreated soil. Phosphate application was most effective in reducing Pb leach ing in both soils. Even at an application rate as low as 5% and 1-d incubation, phosphate could reduce TCLP-Pb to be below the limit of 5 mg L(-1) in both soils. Immobilization of Pb in the SR1 soil amended with cement and quicklime was attributed to the formation of pozzolanic minerals (e.g., calcium silicate hydrate C-S-H and ettringite) that could encapsulate soil Pb. The pozzolanic reaction was limited in the SR2 soil upon the application of cement and quicklime. Reduction of the TCLP-Pb might result from complexation of Pb on the surface of the
Polymer systems testing: Final report
International Nuclear Information System (INIS)
1993-01-01
Los Alamos National Laboratory (LANL) is in the process of decontaminating lead shielding material. The procedure involves abrasive surface etching of the shielding to remove the outer layer of lead that contains the majority of the radioactive contaminants. This procedure generates a small volume of mixed waste in the form of a wet residue containing lead, abrasive grit (Al 2 O 3 ), uranium and water. IC Technologies, Inc. (ICT) has developed several processes for the treatment of mixed wastes involving stabilizing/encapsulating the waste in a polymer monolith. The objective of the test program was to verify the applicability of ICT's technology to this specific waste stream and provide LANL baseline data on the performance of polymer encapsulation techniques. Polymer microencapsulation of lead shielding/blasting grit (surrogate) mixed waste was evaluated. Two polymers, melamine formaldehyde and polyester xylene, were used to examine the effect of waste loading on Toxicity Characteristic Leaching Procedure (TCLP) extract Pb concentration. Six levels of waste loading were evaluated by eleven tests. Significant reduction in Pb solubility during TCLP was achieved. Additional optimization to the single-stage microencapsulation technique utilized will be necessary to mitigate the toxic (RCRA) characteristic of the waste
GTS-LCS, in-situ experiment 2. Modeling of tracer test 09-03
International Nuclear Information System (INIS)
Manette, M.; Saaltink, M.W.; Soler, J.M.
2015-02-01
Within the framework of the GTS-LCS project (Grimsel Test Site - Long-Term Cement Studies), an in-situ experiment lasting about 5 years was started in 2009 to study water-cement-rock interactions in a fractured granite. Prior to the experiment, a tracer test was performed to characterize the initial flow and transport properties of the rock around the experimental boreholes. This study reports on the model interpretation of tracer test 09-03. The calculations were performed by means of a two-dimensional model (homogeneous fracture plane including 3 boreholes) using the Retraso-CodeBright software package. In the tracer test, Grimsel groundwater containing the tracer (uranine) was circulated in the emplacement borehole during 43 days (zero injection flow rate). Circulation continued without tracer afterwards. Water was extracted at the observation and extraction boreholes. Results from a model sensitivity analysis comparing model results with measured tracer concentrations showed 3 cases where the evolution of tracer concentrations in the 3 different boreholes was satisfactory. In these cases a low-permeability skin affected the emplacement and observation boreholes. No skin appeared to affect the extraction borehole. The background hydraulic gradient seems to have no effect on the results of the tracer test. These results will be applied in the calculation of the initial flow field for the reactive transport phase of in-situ experiment 2 (interaction between pre-hardened cement and fractured granite at Grimsel). (orig.)
THE STELLAR INITIAL MASS FUNCTION AT 0.9 < z < 1.5
Energy Technology Data Exchange (ETDEWEB)
Martín-Navarro, Ignacio; Trujillo, Ignacio; Vazdekis, Alexandre [Instituto de Astrofísica de Canarias, c/Vía Láctea s/n, E38205 - La Laguna, Tenerife (Spain); Pérez-González, Pablo G.; Esquej, Pilar; Sánchez, Helena Domínguez; Espino, Néstor [Departamento de Astrofísica, Facultad de CC. Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Barro, Guillermo [UCO/Lick Observatory, Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Bruzual, Gustavo [Centro de Radioastronomía y Astrofísica, UNAM, Campus Morelia, México (Mexico); Charlot, Stéphane [UPMC-CNRS, UMR7095, Institut d' Astrophysique de Paris, F-75014 Paris (France); Cava, Antonio [Observatoire de Genève, Université de Genève, 51 Ch. des Maillettes, 1290 Versoix (Switzerland); Ferreras, Ignacio [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Barbera, Francesco La [INAF-Osservatorio Astronomico di Capodimonte, Napoli (Italy); Koekemoer, Anton M. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Cenarro, A. Javier, E-mail: imartin@iac [Centro de Estudios de Física del Cosmos de Aragǿn, Plaza San Juan 1, E-44001 Teruel (Spain)
2015-01-01
We explore the stellar initial mass function (IMF) of a sample of 49 massive quiescent galaxies (MQGs) at 0.9 < z < 1.5. We base our analysis on intermediate resolution spectro-photometric data in the GOODS-N field taken in the near-infrared and optical with the Hubble Space Telescope Wide Field Camera 3 G141 grism and the Survey for High-z Absorption Red and Dead Sources. To constrain the slope of the IMF, we have measured the TiO{sub 2} spectral feature, whose strength depends strongly on the content of low-mass stars, as well as on stellar age. Using ultraviolet to near-infrared individual and stacked spectral energy distributions, we have independently estimated the stellar ages of our galaxies. Knowing the age of the stellar population, we interpret the strong differences in the TiO{sub 2} feature as an IMF variation. In particular, for the heaviest z ∼ 1 MQGs (M > 10{sup 11} M {sub ☉}), we find an average age of 1.7 ± 0.3 Gyr and a bottom-heavy IMF (Γ {sub b} = 3.2 ± 0.2). Lighter MQGs (2 × 10{sup 10} < M < 10{sup 11} M {sub ☉}) at the same redshift are younger on average (1.0 ± 0.2 Gyr) and present a shallower IMF slope (Γ{sub b}=2.7{sub −0.4}{sup +0.3}). Our results are in good agreement with the findings about the IMF slope in early-type galaxies of similar mass in the present-day universe. This suggests that the IMF, a key characteristic of the stellar populations in galaxies, is bottom-heavier for more massive galaxies and has remained unchanged in the last ∼8 Gyr.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Ji; Li, Yuan; Xu, Nansheng [Department of Inorganic Nonmetallic Materials, University of Science and Technology Beijing, Beijing 100083 (China); Zhao, Hailei; Li, Fushen [Department of Inorganic Nonmetallic Materials, University of Science and Technology Beijing, Beijing 100083 (China); Beijing Key Lab. of New Energy Material and Technology, Beijing 100083 (China); Ding, Weizhong; Lu, Xionggang [School of Materials Science and Engineering, Shanghai University, Shanghai 200072 (China)
2010-01-15
Cubic perovskite oxygen permeation materials BaCo{sub 0.9-x}Fe{sub x}Nb{sub 0.1}O{sub 3-{delta}} (BCFN, x = 0.1-0.7) are prepared by the conventional solid state reaction process. The crystal structure development, structural stability, electrical conductivity and oxygen permeation flux are investigated. The introduction of iron makes the formation of cubic perovskite structure for BCFN materials much easier. BCFN exhibits a p-type semiconductor and obeys the thermally activated small polarons hopping mechanism. The electrical conductivity of BCFN increases with increasing temperature and decreases with the Fe-doping concentration. The incorporation of Fe decreases slightly the oxygen permeability of BCFN membranes, but enhances significantly the structure stability of the oxygen permeation membrane in reducing atmosphere. A high oxygen permeation flux of 1.7 ml cm{sup -2} min{sup -1} at 900 C through 1 mm densified membrane under air/helium condition is obtained for the composition of BaCo{sub 0.6}Fe{sub 0.3}Nb{sub 0.1}O{sub 3-{delta}}. (author)
Autogenous shrinkage of Ducorit S5R ASTM C 1698-09 test method
DEFF Research Database (Denmark)
Damkilde, Lars
The report deals with experimental measurement of autogenous shrinkage of Ducorit S5R according to the test method ASTM C 1698-09. This test method measures the bulk strain of a sealed cementitious specimen, at constant temperature and not subjected to external forces, from the time of final...
Pretreatment of Tc-Containing Waste and Its Effect on Tc-99 Leaching From Grouts
International Nuclear Information System (INIS)
Aloy, Albert; Kovarskaya, Elena N.; Harbour, John R.; Langton, Christine A.; Holtzscheiter, E. William
2007-01-01
A salt solution (doped with Tc-99), that simulates the salt waste stream to be processed at the Saltstone Production Facility, was immobilized in grout waste forms with and without (1) ground granulated blast furnace slag and (2) pretreatment with iron salts. The degree of immobilization of Tc-99 was measured through monolithic and crushed grout leaching tests. Although Fe (+2) was shown to be effective in reducing Tc-99 to the +4 state, the strong reducing nature of the blast furnace slag present in the grout formulation dominated the reduction of Tc-99 in the cured grouts. An effective diffusion coefficient of 4.75 x 10 -12 (Leach Index of 11.4) was measured using the ANSI/ANS-16.1 protocol. The leaching results show that, even in the presence of a concentrated salt solution, blast furnace slag can effectively reduce pertechnetate to the immobile +4 oxidation state. The measured diffusivity was introduced into a flow and transport model (PORFLOW) to calculate the release of Tc-99 from a Saltstone Vault as a function of hydraulic conductivity of the matrix. (authors)
Gachara, George; Symekher, Samuel; Otieno, Michael; Magana, Japheth; Opot, Benjamin; Bulimo, Wallace
2016-06-01
An influenza pandemic caused by a novel influenza virus A(H1N1)pdm09 spread worldwide in 2009 and is estimated to have caused between 151,700 and 575,400 deaths globally. While whole genome data on new virus enables a deeper insight in the pathogenesis, epidemiology, and drug sensitivities of the circulating viruses, there are relatively limited complete genetic sequences available for this virus from African countries. We describe herein the full genome analysis of influenza A(H1N1)pdm09 viruses isolated in Kenya between June 2009 and August 2010. A total of 40 influenza A(H1N1)pdm09 viruses isolated during the pandemic were selected. The segments from each isolate were amplified and directly sequenced. The resulting sequences of individual gene segments were concatenated and used for subsequent analysis. These were used to infer phylogenetic relationships and also to reconstruct the time of most recent ancestor, time of introduction into the country, rates of substitution and to estimate a time-resolved phylogeny. The Kenyan complete genome sequences clustered with globally distributed clade 2 and clade 7 sequences but local clade 2 viruses did not circulate beyond the introductory foci while clade 7 viruses disseminated country wide. The time of the most recent common ancestor was estimated between April and June 2009, and distinct clusters circulated during the pandemic. The complete genome had an estimated rate of nucleotide substitution of 4.9×10(-3) substitutions/site/year and greater diversity in surface expressed proteins was observed. We show that two clades of influenza A(H1N1)pdm09 virus were introduced into Kenya from the UK and the pandemic was sustained as a result of importations. Several closely related but distinct clusters co-circulated locally during the peak pandemic phase but only one cluster dominated in the late phase of the pandemic suggesting that it possessed greater adaptability. Copyright © 2016 Elsevier B.V. All rights reserved.
Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09
Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong
2016-01-01
Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B.?velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and vo...
Energy Technology Data Exchange (ETDEWEB)
Elder, H.H.
2001-07-11
The HLW salt waste (salt cake and supernate) now stored at the SRS must be treated to remove insoluble sludge solids and reduce the soluble concentration of radioactive cesium radioactive strontium and transuranic contaminants (principally Pu and Np). These treatments will enable the salt solution to be processed for disposal as saltstone, a solid low-level waste.
Compatibility of butorphanol and droperidol in 0.9% sodium chloride injection.
Chen, Fu-Chao; Fang, Bao-Xia; Li, Peng; Yang, Jin-Guo; Zhou, Ben-Hong
2013-03-15
The compatibility and stability of butorphanol tartrate and droperidol in polyvinyl chloride (PVC) bags and glass bottles stored at 4°C and 25°C for up to 15 days were studied. Admixtures were assessed initially and for 15 days after preparation in PVC bags and glass bottles using 0.9% sodium chloride injection as a diluent and stored at 4°C and 25°C. The initial drug concentrations were 0.08 mg/mL for butorphanol tartrate and 0.05 mg/mL for droperidol. Samples were withdrawn from each container immediately after preparation and at predetermined intervals (2, 4, 8, 24, 48, 72, 120, 168, 240, and 360 hours after preparation). The solutions were visually inspected for precipitation, cloudiness, and discoloration at each sampling interval. Drug concentrations were determined using a validated high-pressure liquid chromatography method. After 15 days of storage, all formulations tested retained >98% of the initial concentrations of both drugs. The drug mixtures were clear in appearance, and no color change or precipitation was observed. Throughout this period, pH values remained stable. Admixtures of butorphanol tartrate 0.08 mg/mL and droperidol 0.05 mg/mL in 0.9% sodium chloride injection were stable for at least 360 hours when stored in PVC bags or glass bottles at 4°C and 25°C and protected from light.
International Nuclear Information System (INIS)
Reigel, M.; Bibler, N.
2010-01-01
This report details the chemical and radionuclide contaminant results for the characterization of the 2010 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC). Information from this characterization will be used by Liquid Waste Operations (LWO) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System. The following conclusions are drawn from the analytical results provided in this report: (i) The concentrations of the reported chemical and radioactive contaminants were less than their respective WAC targets or limits unless noted in this section. (ii) The reported detection limits for 94 Nb, 247 Cm and 249 Cf are above the requested limits from Reference 4. However, they are below the limits established in Reference 3. (iii) The reported detection limit for 242m Am is greater than the requested limit from Attachment 8.4 of the WAC. (iv) The reported detection limit for Isopar L is greater than the limit from Table 3 of the WAC. (v) The reported concentration of Isopropanol is greater than the limit from Table 4 of the WAC. (vi) Isopar L and Norpar 13 have limited solubility in aqueous solutions making it difficult to obtain consistent and reliable sub-samples. The values reported in this memo are the concentrations in the sub-sample as detected by the GC/MS; however, the results may not accurately represent the concentrations of the analytes in Tank 50.
Idaho National Laboratory’s FY09 & FY10 Greenhouse Gas Report
Energy Technology Data Exchange (ETDEWEB)
Jennifer D. Morton
2011-06-01
A greenhouse gas (GHG) inventory is a systematic approach to account for the production and release of certain gases generated by an institution from various emission sources. The gases of interest are those that climate science has identified as related to anthropogenic global climate change. This document presents an inventory of GHGs generated during fiscal year (FY) 2009 and 2010 by Idaho National Laboratory (INL), a Department of Energy (DOE)-sponsored entity, located in southeastern Idaho. In recent years, concern has grown about the environmental impact of GHGs. This, together with a desire to decrease harmful environmental impacts, would be enough to encourage the calculation of an inventory of the total GHGs generated at INL. Additionally, INL has a desire to see how its emissions compare with similar institutions, including other DOE national laboratories. Executive Order 13514 requires that federal agencies and institutions document reductions in GHG emissions. INL's GHG inventory was calculated according to methodologies identified in federal GHG guidance documents using operational control boundaries. It measures emissions generated in three scopes: (1) INL emissions produced directly by stationary or mobile combustion and by fugitive emissions, (2) the share of emissions generated by entities from which INL purchased electrical power, and (3) indirect or shared emissions generated by outsourced activities that benefit INL (occur outside INL's organizational boundaries, but are a consequence of INL's activities). This inventory found that INL generated 103,590 and 102,413 MT of CO2-equivalent emissions during FY09 and FY10, respectively. The following conclusions were made from looking at the results of the individual contributors to INL's FY09 and FY10 GHG inventories: (1) Electricity (including the associated transmission and distribution losses) is the largest contributor to INL's GHG inventory, with over 50% of the CO2e
Shah, Hiral D.; Bhalodia, J. A.
2018-05-01
The structural, magnetic and magnetotransport properties of (1-x)La0.7Sr0.3Mn0.9Co0.1O3(LSMCO)/x% Ag (x=0%, 2%, 4%) nanocomposites were investigated to explore the role of second introduced phase. (1-x) LSMCO/x% Ag (x=0%, 2%, 4%) nanocomposites are prepared via solid-state reaction method. X-ray diffraction (XRD) and SEM analysis indicated that x% of Ag are not substituted into the main LSMCO phase and remains an additive to the second phase at grain boundaries [1]. The structural parameters and the reliability factors for all the samples were successfully determined by the Rietveld refinement. Magnetization and transport properties of (1-x)LSMCO/x% Ag nanocomposites have been reported. Resistivity of the composite samples increases with Ag content in comparison with the pure LSMCO, and suppressed with applied magnetic field in all the composite samples [2]. The metal-insulator transition (TMI) and accompanied paramagnetic-ferromagnetic transition (TC) temperatures decrease with increase in Ag content. The electrical resistivity of the experimental results is explored by theoretical model below TMI. The maximum MR was observed to be 55% in the x=4% sample at 5 K temperature under 7 T magnetic field, this value is larger than that of pure LSMCO (19% at 5 K and 7 T), which is encouraging for practical application. Summarily, the addition of Ag in LSMCO improves MR% values significantly due to the more grain boundary contribution and result in better physical properties of the parent manganite system.
Energy Technology Data Exchange (ETDEWEB)
ADAMS,J.W.; KALB,P.D.
2001-11-01
Brookhaven National Laboratory's Sulfur Polymer Stabilization/Solidification (SPSS) process was used to treat approximately 90kg of elemental mercury mixed waste from Los Alamos National Laboratory. Treatment was carried out in a series of eight batches using a 1 ft{sup 3} pilot-scale mixer, where mercury loading in each batch was 33.3 weight percent. Although leach performance is currently not regulated for amalgamated elemental mercury (Hg) mixed waste, Toxicity Characteristic Leach Procedure (TCLP) testing of SPSS treated elemental mercury waste indicates that leachability is readily reduced to below the TCLP limit of 200 ppb (regulatory requirement following treatment by retort for wastes containing > 260 ppb Hg), and with process optimization, to levels less than the stringent Universal Treatment Standard (UTS) limit of 25 ppb that is applied to waste containing < 260 ppm Hg. In addition, mercury-contaminated debris, consisting of primary glass and plastic containers, as well as assorted mercury thermometers, switches, and labware, was first reacted with SPSS components to stabilize the mercury contamination, then macroencapsulated in the molten SPSS product. This treatment was done by vigorous agitation of the sulfur polymer powder and the comminuted debris. Larger plastic and metal containers were reacted to stabilize internal mercury contamination, and then filled with molten sulfur polymer to encapsulate the treated product.
CSIR Research Space (South Africa)
Dhlamini, MS
2012-05-01
Full Text Available .physb.2011.09.091 Concentration effect of Tm3+ on cathodoluminescence properties of SiO2: Tm 3+ and SiO2:Ho 3+, Tm3+ systems M.S. Dhlamini, G.H. Mhlongo, H.C. Swart, O.M. Ntwaeaborwa, K.T. Hillie ABSTRACT: Cathodoluminescence (CL) properties of Si...O2 powders activated with thulium (Tm3+) and holmium (Ho3+) ions prepared by a sol–gel process were investigated. Different molar concentrations of Tm3+ co-doped with Ho3+ were studied. The 460 nm peak was monitored and the influence of the beam...
International Nuclear Information System (INIS)
Lee, D.D.
2000-01-01
The goal of the Savannah River Salt Waste Processing Program (SPP) is to evaluate and select the most effective technology for the treatment of the high-level waste salt solutions currently being stored in underground storage tanks at the U.S. Department of Energy Savannah River Site (SRS) in Aiken, South Carolina. One of the three technologies currently being developed for this application is the Small-Tank Tetraphenylborate Process (STTP). This process uses sodium tetraphenylborate (NaTPB) to precipitate and remove radioactive cesium from the waste and monosodium titanate (MST) to sorb and remove radioactive strontium and actinides. Oak Ridge National Laboratory is demonstrating this process at the 1:4000 scale using a 20-L capacity continuous-flow stirred-tank reactor (CSTR) system. Since March 1999, three operating campaigns of the 20-L CSTR have been conducted. The ultimate goal is to verify that this process, under certain extremes of operating conditions, can meet the minimum treatment criteria necessary for processing and disposal at the Savannah River Saltstone Facility. The waste acceptance criteria (WAC) for 137 Cs, 90 Sr, and total actinides are 137 Cs and 90 Sr are to obtain decontamination factors (DFs) of 40,000 (99.998% removal) and 26 (96.15% removal), respectively. The DF is defined as the concentration of contaminant in the waste divided by the concentration of contaminant in the effluent stream
Directory of Open Access Journals (Sweden)
YUPING MA
2016-01-01
Full Text Available ABSTRACT A soil isolate, Penicillium janthinellum sw09 has been found to produce significant amounts of an extracellular pectinase subsequently characterized as exo-polygalacturonase (exo-PG. By optimizing growth conditions, P. janthinellum sw09 produced high amount of exo-PG (16.54 units/mL. The crude enzyme was purified by gel filtration chromatography and two exo-PG activity peaks (designated as PGI and PGII were revealed. On SDS-PAGE analysis, purified PGII using DEAE-Sepharose FF column, was found to be a single band with a molecular mass of 66.2 kDa. The purified PGII exhibited maximal activity at the temperature of 45 oC and pH 5.0. The stability profiles show that PGII is more stable in the pH range of 4.0-8.0 and below 60 oC. The Km and Vmax for the enzyme was 1.74 mg/mL and 18.08 μmol/ (mL•min, respectively. Due to this enzymatic characterization, this pectinase is an attractive candidate for applications in degradation of pectin.
Gong, Yanyan; Liu, Yuanyuan; Xiong, Zhong; Kaback, Dawn; Zhao, Dongye
2012-07-01
Mercury (Hg) is one of the most pervasive and bio-accumulative metals in the environment. Yet, effective in situ remediation technologies have been lacking. This study investigated the effectiveness of a class of soil-deliverable FeS nanoparticles for in situ immobilization of Hg in two field-contaminated soils from a New Jersey site and one sediment from an Alabama site. The nanoparticles were prepared using sodium carboxymethyl cellulose (CMC) as a stabilizer. Transmission electron microscopy measurements revealed a particle size of 34.3 ± 8.3 nm (standard deviation), whereas dynamic light scattering gave a hydrodynamic diameter of 222.5 ± 3.2 nm. Batch tests showed that at an FeS-to-Hg molar ratio of 28:1-118:1, the nanoparticles reduced water-leachable Hg by 79%-96% and the TCLP (toxicity characteristic leaching procedure) based leachability by 26%-96%. Column breakthrough tests indicated that the nanoparticles were deliverable in the sediment/soil columns under moderate injection pressure. However, once the external pressure was removed, the delivered nanoparticles remained virtually mobile under typical groundwater flow conditions. When the Hg-contaminated soil and sediment were treated with 52-95 pore volumes of a 500 mg l-1 FeS nanoparticle suspension, water-leachable Hg was reduced by 90%-93% and TCLP-leachable Hg was reduced by 65%-91%. The results warrant further field demonstration of this promising in situ remediation technology.
RESEARCH OF SYNERGETIC RELIABILITY OF PEARLITE-REDUCED STRUCTURAL STEEL 09G2FB
Directory of Open Access Journals (Sweden)
Gustov Yuriy Ivanovich
2012-10-01
Full Text Available The primary objective of the research is the synergetic reliability of perlite-reduced structural steel 09G2FB exposed to various thermal and mechanical treatments. In the aftermath of the above exposure, the steel in question has proved to assume a set of strength-related and plastic mechanical properties (σσδ and ψ.
EDZ09 project and related EDZ studies in ONKALO 2008-2010
Energy Technology Data Exchange (ETDEWEB)
Mellanen, S. [Genpro Solutions Oy, Helsinki (Finland); Lehtimaeki, T. [Svensk Kaernbraenslehantering AB, Stockholm (Sweden); Heikkinen, E. [Poeyry Finland Oy, Espoo (Finland) Water and Environment; Mustonen, S.; Norokallio, J.
2010-12-15
The EDZ (Excavation Damaged Zone) is one of the issues in the evaluation of the long term safety concerning the underground rock surfaces of the final disposal facility. There have been various research and development tasks relating to the EDZ (among other items the EDZ300 Project) completed both before starting the excavation of the ONKALO underground facility and during the construction work. The EDZ09 Project was established to improve the drill and blast excavation method to control the EDZ and to verify the feasibility of Ground Penetrating Radar as a characterisation tool for the EDZ. The project was divided into two parts: Work Package (WP1), which managed the control of the excavation; and Work Package 2 (WP2), which concentrated on the geophysical tests. Long term safety issues were not included into EDZ09 Project. The project work was undertaken in a specific EDZ niche (Tutkimustila 3, ONK-TKU- 3620) with Work Package 1 being concerned with the research niche excavation and Work Package 2 with activities conducted in the niche. In Work Package 2 (WP2), a series of investigations under controlled conditions for EDZ assessment was conducted before and after the excavation. These measurements were performed in drillholes and on the tunnel surface. The investigations carried out before excavation of the EDZ-tunnel define the undisturbed, baseline conditions in the surrounding rock (behind the planned tunnel wall); and the investigations carried out after excavation of EDZ-tunnel define the conditions when the EDZ already exists. The induced change in the conditions before and after excavation indicate the EDZ. The results of measurements from tunnel surfaces and from drillholes were reviewed with petrophysical sample data taken and analysed from the same location. Baseline investigations included: (1) a reflection seismic single-hole survey in a drillhole parallel to the planned tunnel outside the tunnel contour; (2) seismic tomography between two drillholes
EDZ09 project and related EDZ studies in ONKALO 2008-2010
International Nuclear Information System (INIS)
Mellanen, S.; Lehtimaeki, T.; Heikkinen, E.; Mustonen, S.; Norokallio, J.
2010-12-01
The EDZ (Excavation Damaged Zone) is one of the issues in the evaluation of the long term safety concerning the underground rock surfaces of the final disposal facility. There have been various research and development tasks relating to the EDZ (among other items the EDZ300 Project) completed both before starting the excavation of the ONKALO underground facility and during the construction work. The EDZ09 Project was established to improve the drill and blast excavation method to control the EDZ and to verify the feasibility of Ground Penetrating Radar as a characterisation tool for the EDZ. The project was divided into two parts: Work Package (WP1), which managed the control of the excavation; and Work Package 2 (WP2), which concentrated on the geophysical tests. Long term safety issues were not included into EDZ09 Project. The project work was undertaken in a specific EDZ niche (Tutkimustila 3, ONK-TKU- 3620) with Work Package 1 being concerned with the research niche excavation and Work Package 2 with activities conducted in the niche. In Work Package 2 (WP2), a series of investigations under controlled conditions for EDZ assessment was conducted before and after the excavation. These measurements were performed in drillholes and on the tunnel surface. The investigations carried out before excavation of the EDZ-tunnel define the undisturbed, baseline conditions in the surrounding rock (behind the planned tunnel wall); and the investigations carried out after excavation of EDZ-tunnel define the conditions when the EDZ already exists. The induced change in the conditions before and after excavation indicate the EDZ. The results of measurements from tunnel surfaces and from drillholes were reviewed with petrophysical sample data taken and analysed from the same location. Baseline investigations included: (1) a reflection seismic single-hole survey in a drillhole parallel to the planned tunnel outside the tunnel contour; (2) seismic tomography between two drillholes