Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong
2018-04-05
Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome
Directory of Open Access Journals (Sweden)
Walid Mottawea
2018-05-01
Full Text Available Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella. In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S. Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.
Evaluation of whole genome sequencing for outbreak detection of Salmonella enterica
DEFF Research Database (Denmark)
Leekitcharoenphon, Pimlapas; Nielsen, Eva M.; Kaas, Rolf Sommer
2014-01-01
Salmonella enterica is a common cause of minor and large food borne outbreaks. To achieve successful and nearly ‘real-time’ monitoring and identification of outbreaks, reliable sub-typing is essential. Whole genome sequencing (WGS) shows great promises for using as a routine epidemiological typing....... Enteritidis and 5 S. Derby were also sequenced and used for comparison. A number of different bioinformatics approaches were applied on the data; including pan-genome tree, k-mer tree, nucleotide difference tree and SNP tree. The outcome of each approach was evaluated in relation to the association...... of the isolates to specific outbreaks. The pan-genome tree clustered 65% of the S. Typhimurium isolates according to the pre-defined epidemiology, the k-mer tree 88%, the nucleotide difference tree 100% and the SNP tree 100% of the strains within S. Typhimurium. The resulting outcome of the four phylogenetic...
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Directory of Open Access Journals (Sweden)
Reza Ranjbar
2017-09-01
Full Text Available Background: Salmonella enterica serovar Typhimurium is one of the most important serovars of Salmonella enterica and is associated with human salmonellosis worldwide. Many epidemiological studies have focused on the characteristics of Salmonella Typhimurium in many countries as well as in Asia. This study was conducted to investigate the genetic characteristics of Salmonella Typhimurium using multilocus sequence typing (MLST. Methods: Clinical samples (urine, blood, and stool were collected from patients, who were admitted to 2 hospitals in Tehran between April and September, 2015. Salmonella Typhimurium strains were identified by conventional standard biochemical and serological testing. The antibiotic susceptibility patterns of the Salmonella Typhimurium isolates against 16 antibiotics was determined using the disk diffusion assay. The clonal relationship between the strains of Salmonella Typhimurium was analyzed using MLST. Results: Among the 68 Salmonella isolates, 31% (n=21 were Salmonella Typhimurium. Of the total 21 Salmonella Typhimurium isolates, 76% (n=16 were multidrug-resistant and showed resistance to 3 or more antibiotic families. The Salmonella Typhimurium isolates were assigned to 2 sequence types: ST19 and ST328. ST19 was more common (86%. Both sequence types were further assigned to 1 eBURST group. Conclusion: This is the first study of its kind in Iran to determine the sequence types of the clinical isolates of Salmonella Typhimurium in Tehran hospitals using MLST. ST19 was detected as the major sequence type of Salmonella Typhimurium.
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
International Nuclear Information System (INIS)
Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.
1988-01-01
The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems
Directory of Open Access Journals (Sweden)
Joshua M Thornbrough
Full Text Available CD18 expressing phagocytes associated with the gastro-intestinal (GI epithelium can shuttle Salmonella directly into the bloodstream within a few minutes following microbial ingestion. We have previously demonstrated that Salmonella controls the CD18 pathway to deeper tissue, manipulating the migratory properties of infected cells as an unappreciated component of its pathogenesis. We have observed that one type III effector, SrfH (also called SseI that Salmonella secretes into infected phagocytes manipulates the host protein TRIP6 to stimulate their migration. Paradoxically, SrfH was shown in another study to subvert a different host protein, IQGAP1, in a manner that inhibits the productive motility of such cells, perhaps to avoid interactions with T cells. Here, we resolve the discrepancy. We report that one naturally occurring allele of srfH promotes the migration of infected phagocytes into the bloodstream, while another naturally occurring allele that differs by only a single nucleotide polymorphism (SNP does not. This SNP determines if the protein contains an aspartic acid or a glycine residue at position 103 and may determine if SrfH binds TRIP6. SrfH Gly103 is a rare allele, but is present in the highly invasive strain Salmonella enterica serovar Typhimurium UK-1 (stands for universal killer. It is also present in the genome of the only sequenced strain belonging to the emerging pandemic Salmonella enterica serovar 4, [5],12,i:-, which is frequently associated with septicemia. Finally, we present evidence that suggests that Gifsy-2, the bacteriophage upon which srfH resides, is present in a clinical isolate of the human-specific pathogen, Salmonella enterica serovar Typhi. These observations may have interesting implications for our understanding of Salmonella pathogenesis.
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Desai, Prerak; Porwollik, Steffen; Canals, Rocio; Perez, Daniel R.; Chu, Weiping; McClelland, Michael; Teplitski, Max
2016-01-01
ABSTRACT Human enteric pathogens, such as Salmonella spp. and verotoxigenic Escherichia coli, are increasingly recognized as causes of gastroenteritis outbreaks associated with the consumption of fruits and vegetables. Persistence in plants represents an important part of the life cycle of these pathogens. The identification of the full complement of Salmonella genes involved in the colonization of the model plant (tomato) was carried out using transposon insertion sequencing analysis. With this approach, 230,000 transposon insertions were screened in tomato pericarps to identify loci with reduction in fitness, followed by validation of the screen results using competition assays of the isogenic mutants against the wild type. A comparison with studies in animals revealed a distinct plant-associated set of genes, which only partially overlaps with the genes required to elicit disease in animals. De novo biosynthesis of amino acids was critical to persistence within tomatoes, while amino acid scavenging was prevalent in animal infections. Fitness reduction of the Salmonella amino acid synthesis mutants was generally more severe in the tomato rin mutant, which hyperaccumulates certain amino acids, suggesting that these nutrients remain unavailable to Salmonella spp. within plants. Salmonella lipopolysaccharide (LPS) was required for persistence in both animals and plants, exemplifying some shared pathogenesis-related mechanisms in animal and plant hosts. Similarly to phytopathogens, Salmonella spp. required biosynthesis of amino acids, LPS, and nucleotides to colonize tomatoes. Overall, however, it appears that while Salmonella shares some strategies with phytopathogens and taps into its animal virulence-related functions, colonization of tomatoes represents a distinct strategy, highlighting this pathogen's flexible metabolism. IMPORTANCE Outbreaks of gastroenteritis caused by human pathogens have been increasingly associated with foods of plant origin, with tomatoes
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...
Directory of Open Access Journals (Sweden)
Mark R Wilson
Full Text Available Establishing an association between possible food sources and clinical isolates requires discriminating the suspected pathogen from an environmental background, and distinguishing it from other closely-related foodborne pathogens. We used whole genome sequencing (WGS to Salmonella subspecies enterica serotype Tennessee (S. Tennessee to describe genomic diversity across the serovar as well as among and within outbreak clades of strains associated with contaminated peanut butter. We analyzed 71 isolates of S. Tennessee from disparate food, environmental, and clinical sources and 2 other closely-related Salmonella serovars as outgroups (S. Kentucky and S. Cubana, which were also shot-gun sequenced. A whole genome single nucleotide polymorphism (SNP analysis was performed using a maximum likelihood approach to infer phylogenetic relationships. Several monophyletic lineages of S. Tennessee with limited SNP variability were identified that recapitulated several food contamination events. S. Tennessee clades were separated from outgroup salmonellae by more than sixteen thousand SNPs. Intra-serovar diversity of S. Tennessee was small compared to the chosen outgroups (1,153 SNPs, suggesting recent divergence of some S. Tennessee clades. Analysis of all 1,153 SNPs structuring an S. Tennessee peanut butter outbreak cluster revealed that isolates from several food, plant, and clinical isolates were very closely related, as they had only a few SNP differences between them. SNP-based cluster analyses linked specific food sources to several clinical S. Tennessee strains isolated in separate contamination events. Environmental and clinical isolates had very similar whole genome sequences; no markers were found that could be used to discriminate between these sources. Finally, we identified SNPs within variable S. Tennessee genes that may be useful markers for the development of rapid surveillance and typing methods, potentially aiding in traceback efforts
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Saeidabadi, Mohammad Sadegh; Nili, Hassan; Dadras, Habibollah; Sharifiyazdi, Hassan; Connolly, Joanne; Valcanis, Mary; Raidal, Shane; Ghorashi, Seyed Ali
2017-06-01
Consumption of poultry products contaminated with Salmonella is one of the major causes of foodborne diseases worldwide and therefore detection and differentiation of Salmonella spp. in poultry is important. In this study, oligonucleotide primers were designed from hemD gene and a PCR followed by high-resolution melt (HRM) curve analysis was developed for rapid differentiation of Salmonella isolates. Amplicons of 228 bp were generated from 16 different Salmonella reference strains and from 65 clinical field isolates mainly from poultry farms. HRM curve analysis of the amplicons differentiated Salmonella isolates and analysis of the nucleotide sequence of the amplicons from selected isolates revealed that each melting curve profile was related to a unique DNA sequence. The relationship between reference strains and tested specimens was also evaluated using a mathematical model without visual interpretation of HRM curves. In addition, the potential of the PCR-HRM curve analysis was evaluated for genotyping of additional Salmonella isolates from different avian species. The findings indicate that PCR followed by HRM curve analysis provides a rapid and robust technique for genotyping of Salmonella isolates to determine the serovar/serotype.
Directory of Open Access Journals (Sweden)
Rizwana Tasmin
Full Text Available Salmonella Typhimurium is the leading cause of human non-typhoidal gastroenteritis in the US. S. Kentucky is one the most commonly recovered serovars from commercially processed poultry carcasses. This study compared the genotypic and phenotypic properties of two Salmonella enterica strains Typhimurium (ST221_31B and Kentucky (SK222_32B recovered from commercially processed chicken carcasses using whole genome sequencing, phenotype characterizations and an intracellular killing assay. Illumina MiSeq platform was used for sequencing of two Salmonella genomes. Phylogenetic analysis employing homologous alignment of a 1,185 non-duplicated protein-coding gene in the Salmonella core genome demonstrated fully resolved bifurcating patterns with varying levels of diversity that separated ST221_31B and SK222_32B genomes into distinct monophyletic serovar clades. Single nucleotide polymorphism (SNP analysis identified 2,432 (ST19 SNPs within 13 Typhimurium genomes including ST221_31B representing Sequence Type ST19 and 650 (ST152 SNPs were detected within 13 Kentucky genomes including SK222_32B representing Sequence Type ST152. In addition to serovar-specific conserved coding sequences, the genomes of ST221_31B and SK222_32B harbor several genomic regions with significant genetic differences. These included phage and phage-like elements, carbon utilization or transport operons, fimbriae operons, putative membrane associated protein-encoding genes, antibiotic resistance genes, siderophore operons, and numerous hypothetical protein-encoding genes. Phenotype microarray results demonstrated that ST221_31B is capable of utilizing certain carbon compounds more efficiently as compared to SK222_3B; namely, 1,2-propanediol, M-inositol, L-threonine, α-D-lactose, D-tagatose, adonitol, formic acid, acetoacetic acid, and L-tartaric acid. ST221_31B survived for 48 h in macrophages, while SK222_32B was mostly eliminated. Further, a 3-fold growth of ST221_31B was
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Using next generation sequencing to tackle non-typhoidal Salmonella infections
DEFF Research Database (Denmark)
Wain, John; Keddy, Karen H.; Hendriksen, Rene S.
2013-01-01
The publication of studies using next generation sequencing to analyse large numbers of bacterial isolates from global epidemics is transforming microbiology, epidemiology and public health. The emergence of multidrug resistant Salmonella Typhimurium ST313 is one example. While the epidemiology...... in Africa appears to be human-to-human spread and the association with invasive disease almost absolute, more needs to be done to exclude the possibility of animal reservoirs and to transfer the ability to track all Salmonella infections to the laboratories in the front line. In this mini-review we...
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Complete Whole-Genome Sequence of Salmonella enterica subsp. enterica Serovar Java NCTC5706.
Fazal, Mohammed-Abbas; Alexander, Sarah; Burnett, Edward; Deheer-Graham, Ana; Oliver, Karen; Holroyd, Nancy; Parkhill, Julian; Russell, Julie E
2016-11-03
Salmonellae are a significant cause of morbidity and mortality globally. Here, we report the first complete genome sequence for Salmonella enterica subsp. enterica serovar Java strain NCTC5706. This strain is of historical significance, having been isolated in the pre-antibiotic era and was deposited into the National Collection of Type Cultures in 1939. © Crown copyright 2016.
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.
Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R
2017-01-01
Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in
Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica
Directory of Open Access Journals (Sweden)
Maria Hoffmann
2017-08-01
Full Text Available Determinants of multidrug resistance (MDR are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI, and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about
Waldram, Alison; Dolan, Gayle; Ashton, Philip M; Jenkins, Claire; Dallman, Timothy J
2018-05-01
The unprecedented level of bacterial strain discrimination provided by whole genome sequencing (WGS) presents new challenges with respect to the utility and interpretation of the data. Whole genome sequences from 1445 isolates of Salmonella belonging to the most commonly identified serotypes in England and Wales isolated between April and August 2014 were analysed. Single linkage single nucleotide polymorphism thresholds at the 10, 5 and 0 level were explored for evidence of epidemiological links between clustered cases. Analysis of the WGS data organised 566 of the 1445 isolates into 32 clusters of five or more. A statistically significant epidemiological link was identified for 17 clusters. The clusters were associated with foreign travel (n = 8), consumption of Chinese takeaways (n = 4), chicken eaten at home (n = 2), and one each of the following; eating out, contact with another case in the home and contact with reptiles. In the same time frame, one cluster was detected using traditional outbreak detection methods. WGS can be used for the highly specific and highly sensitive detection of biologically related isolates when epidemiological links are obscured. Improvements in the collection of detailed, standardised exposure information would enhance cluster investigations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
Kuo, Chun Wei; Hao Huang, Kuan; Hsu, Bing Mu; Tsai, Hsien Lung; Tseng, Shao Feng; Kao, Po Min; Shen, Shu Min; Chou Chiu, Yi; Chen, Jung Sheng
2013-04-01
Salmonella is one of the most important pathogens of waterborne diseases with outbreaks from contaminated water reported worldwide. In addition, Salmonella spp. can survive for long periods in aquatic environments. To realize genotypes and serovars of Salmonella in aquatic environments, we isolated the Salmonella strains by selective culture plates to identify the serovars of Salmonella by serological assay, and identify the genotypes by Multilocus sequence typing (MLST) based on the sequence data from University College Cork (UCC), respectively. The results show that 36 stream water samples (30.1%) and 18 drinking water samples (23.3%) were confirmed the existence of Salmonella using culture method combined PCR specific invA gene amplification. In this study, 24 cultured isolates of Salmonella from water samples were classified to fifteen Salmonella enterica serovars. In addition, we construct phylogenetic analysis using phylogenetic tree and Minimum spanning tree (MST) method to analyze the relationship of clinical, environmental, and geographical data. Phylogenetic tree showed that four main clusters and our strains can be distributed in all. The genotypes of isolates from stream water are more biodiversity while comparing the Salmonella strains genotypes from drinking water sources. According to MST data, we can found the positive correlation between serovars and genotypes of Salmonella. Previous studies revealed that the result of Pulsed field gel electrophoresis (PFGE) method can predict the serovars of Salmonella strain. Hence, we used the MLST data combined phylogenetic analysis to identify the serovars of Salmonella strain and achieved effectiveness. While using the geographical data combined phylogenetic analysis, the result showed that the dominant strains were existed in whole stream area in rainy season. Keywords: Salmonella spp., MLST, phylogenetic analysis, PFGE
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Towards the development of a DNA-sequence based approach to serotyping of Salmonella enterica
Directory of Open Access Journals (Sweden)
Logan Julie MJ
2004-08-01
Full Text Available Abstract Background The fliC and fljB genes in Salmonella code for the phase 1 (H1 and phase 2 (H2 flagellin respectively, the rfb cluster encodes the majority of enzymes for polysaccharide (O antigen biosynthesis, together they determine the antigenic profile by which Salmonella are identified. Sequencing and characterisation of fliC was performed in the development of a molecular serotyping technique. Results FliC sequencing of 106 strains revealed two groups; the g-complex included those exhibiting "g" or "m,t" antigenic factors, and the non-g strains which formed a second more diverse group. Variation in fliC was characterised and sero-specific motifs identified. Furthermore, it was possible to identify differences in certain H antigens that are not detected by traditional serotyping. A rapid short sequencing assay was developed to target serotype-specific sequence motifs in fliC. The assay was evaluated for identification of H1 antigens with a panel of 55 strains. Conclusion FliC sequences were obtained for more than 100 strains comprising 29 different H1 alleles. Unique pyrosequencing profiles corresponding to the H1 component of the serotype were generated reproducibly for the 23 alleles represented in the evaluation panel. Short read sequence assays can now be used to identify fliC alleles in approximately 97% of the 50 medically most important Salmonella in England and Wales. Capability for high throughput testing and automation give these assays considerable advantages over traditional methods.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
LENUS (Irish Health Repository)
Song, Yajun
2010-08-01
OBJECTIVES: Decreased susceptibility to fluoroquinolones has become a major problem for the successful therapy of human infections caused by Salmonella enterica, especially the life-threatening typhoid and paratyphoid fevers. METHODS: By using Luminex xTAG beads, we developed a rapid, reliable and cost-effective multiplexed genotyping assay for simultaneously detecting 11 mutations in gyrA, gyrB and parE of S. enterica serovars Typhi and Paratyphi A that result in nalidixic acid resistance (Nal(R)) and\\/or decreased susceptibility to fluoroquinolones. RESULTS: This assay yielded unambiguous single nucleotide polymorphism calls on extracted DNA from 292 isolates of Salmonella Typhi (Nal(R) = 223 and Nal(S) = 69) and 106 isolates of Salmonella Paratyphi A (Nal(R) = 24 and Nal(S) = 82). All of the 247 Nal(R) Salmonella Typhi and Salmonella Paratyphi A isolates were found to harbour at least one of the target mutations, with GyrA Phe-83 as the most common one (143\\/223 for Salmonella Typhi and 18\\/24 for Salmonella Paratyphi A). We also identified three GyrB mutations in eight Nal(S) Salmonella Typhi isolates (six for GyrB Phe-464, one for GyrB Leu-465 and one for GyrB Asp-466), and mutations GyrB Phe-464 and GyrB Asp-466 seem to be related to the decreased ciprofloxacin susceptibility phenotype in Salmonella Typhi. This assay can also be used directly on boiled single colonies. CONCLUSIONS: The assay presented here would be useful for clinical and reference laboratories to rapidly screen quinolone-resistant isolates of Salmonella Typhi and Salmonella Paratyphi A, and decipher the underlying genetic changes for epidemiological purposes.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
Genomics of Salmonella Species
Canals, Rocio; McClelland, Michael; Santiviago, Carlos A.; Andrews-Polymenis, Helene
Progress in the study of Salmonella survival, colonization, and virulence has increased rapidly with the advent of complete genome sequencing and higher capacity assays for transcriptomic and proteomic analysis. Although many of these techniques have yet to be used to directly assay Salmonella growth on foods, these assays are currently in use to determine Salmonella factors necessary for growth in animal models including livestock animals and in in vitro conditions that mimic many different environments. As sequencing of the Salmonella genome and microarray analysis have revolutionized genomics and transcriptomics of salmonellae over the last decade, so are new high-throughput sequencing technologies currently accelerating the pace of our studies and allowing us to approach complex problems that were not previously experimentally tractable.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
DEFF Research Database (Denmark)
Karczmarczyk, M.; Martins, M.; McCusker, M.
2010-01-01
Ninety-three Salmonella isolates recovered from commercial foods and exotic animals in Colombia were studied. The serotypes, resistance profiles and where applicable the quinolone resistance genes were determined. Salmonella Anatum (n=14), Uganda (19), Braenderup (10) and Newport (10) were the most...... plasmids, two of which were completely sequenced. These exhibited 97% (serovar 6,7:d:- isolate) and 100% (serovar Infantis isolate) nucleotide sequence identity with previously identified ColE-like plasmids. This study demonstrates the occurrence of the qnrB19 gene associated with small ColE plasmids...
Crowe, Samuel J; Green, Alice; Hernandez, Kimberly; Peralta, Vi; Bottichio, Lyndsay; Defibaugh-Chavez, Stephanie; Douris, Aphrodite; Gieraltowski, Laura; Hise, Kelley; La-Pham, Karen; Neil, Karen P; Simmons, Mustafa; Tillman, Glenn; Tolar, Beth; Wagner, Darlene; Wasilenko, Jamie; Holt, Kristin; Trees, Eija; Wise, Matthew E
2017-04-01
High consumption rates and a multitude of brands make multistate foodborne outbreaks of Salmonella infections associated with chicken challenging to investigate, but whole genome sequencing is a powerful tool that can be used to assist investigators. Whole genome sequencing of pathogens isolated from clinical, environmental, and food samples is increasingly being used in multistate foodborne outbreak investigations to determine with unprecedented resolution how closely related these isolates are to one another genetically. In 2014, federal and state health officials investigated an outbreak of 146 Salmonella Heidelberg infections in 24 states. A follow-up analysis was conducted after the conclusion of the investigation in which 27 clinical and 24 food isolates from the outbreak underwent whole genome sequencing. These isolates formed seven clades, the largest of which contained clinical isolates from a subcluster of case patients who attended a catered party. One isolate from a chicken processed by a large producer was closely related genetically (zero to three single-nucleotide polymorphism differences) to the clinical isolates from these subcluster case patients. Chicken from this large producer was also present in the kitchen of the caterer on the day before the event, thus providing additional evidence that the chicken from this producer was the outbreak source. This investigation highlights how whole genome sequencing can be used with epidemiologic and traceback evidence to identify chicken sources of foodborne outbreaks.
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
George, Andrée S; Cox, Clayton E; Desai, Prerak; Porwollik, Steffen; Chu, Weiping; de Moraes, Marcos H; McClelland, Michael; Brandl, Maria T; Teplitski, Max
2018-03-01
Salmonella spp. are remarkably adaptable pathogens, and this adaptability allows these bacteria to thrive in a variety of environments and hosts. The mechanisms with which these pathogens establish within a niche amid the native microbiota remain poorly understood. Here, we aimed to uncover the mechanisms that enable Salmonella enterica serovar Typhimurium strain ATCC 14028 to benefit from the degradation of plant tissue by a soft rot plant pathogen, Pectobacterium carotovorum The hypothesis that in the soft rot, the liberation of starch (not utilized by P. carotovorum ) makes this polymer available to Salmonella spp., thus allowing it to colonize soft rots, was tested first and proven null. To identify the functions involved in Salmonella soft rot colonization, we carried out transposon insertion sequencing coupled with the phenotypic characterization of the mutants. The data indicate that Salmonella spp. experience a metabolic shift in response to the changes in the environment brought on by Pectobacterium spp. and likely coordinated by the csrBC small regulatory RNA. While csrBC and flhD appear to be of importance in the soft rot, the global two-component system encoded by barA sirA (which controls csrBC and flhDC under laboratory conditions) does not appear to be necessary for the observed phenotype. Motility and the synthesis of nucleotides and amino acids play critical roles in the growth of Salmonella spp. in the soft rot. IMPORTANCE Outbreaks of produce-associated illness continue to be a food safety concern. Earlier studies demonstrated that the presence of phytopathogens on produce was a significant risk factor associated with increased Salmonella carriage on fruits and vegetables. Here, we genetically characterize some of the requirements for interactions between Salmonella and phytobacteria that allow Salmonella spp. to establish a niche within an alternate host (tomato). Pathways necessary for nucleotide synthesis, amino acid synthesis, and motility
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. Comparison of hupA of E. coli and S. typhimurium revealed that the HU-2 proteins were identical and that there was high conservation of nucleotide sequences outside the coding frames of the genes. A 300-member genomic library of S. typhimurium was constructed by using random transposition of MudP, a specialized chimeric P22-Mu phage that packages chromosomal DNA unidirectionally from its insertion point. Oligonucleotide hybridization against the library identified one MudP insertion that lies within 28 kilobases of hupA; the MudP was 12% linked to purH at 90.5 min on the standard map. Plasmids expressing HU-2 had a surprising phenotype; they caused growth arrest when they were introduced into E. coli strains bearing a himA or hip mutation. These results suggest that IHF and HU have interactive roles in bacteria. Images PMID:3056912
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
Directory of Open Access Journals (Sweden)
Jing Han
Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Boonkhot, Phacharaporn; Tadee, Pakpoom; Yamsakul, Panuwat; Pocharoen, Chairoj; Chokesajjawatee, Nipa; Patchanee, Prapas
2015-05-01
Pigs and pork products are well known as an important source of Salmonella, one of the major zoonotic foodborne pathogens. The emergence and spread of antimicrobial resistance is becoming a major public health concern worldwide. Integrons are genetic elements known to have a role in the acquisition and expression of genes conferring antibiotic resistance. This study focuses on the prevalence of class 1 integrons-carrying Salmonella, the genetic diversity of strains of those organisms obtained from swine production chains in Chiang Mai and Lamphun provinces, Thailand, using multilocus sequence typing (MLST) and comparison of genetic diversity of sequence types of Salmonella from this study with pulsotypes identified in previous study. In 175 Salmonella strains, the overall prevalence of class 1 integrons-carrying-Salmonella was 14%. The gene cassettes array pattern "dfrA12-orfF-aadA2" was the most frequently observed. Most of the antimicrobial resistance identified was not associated with related gene cassettes harbored by Salmonella. Six sequence types were generated from 30 randomly selected strains detected by MLST. Salmonella at the human-animal-environment interface was confirmed. Linkages both in the farm to slaughterhouse contamination route and the horizontal transmission of resistance genes were demonstrated. To reduce this problem, the use of antimicrobials in livestock should be controlled by veterinarians. Education and training of food handlers as well as promotion of safe methods of food consumption are important avenues for helping prevent foodborne illness.
DEFF Research Database (Denmark)
Qin, Yanan; Hasman, Henrik; Aarestrup, Frank Møller
2014-01-01
Salmonella typhimurium is the causative agent of typhoid fever, which causes nearly 21.7 million illnesses and 217,000 deaths around the world each year. Here, we describe the draft genome sequences of the Salmonella typhimurium strains S7, S15, and S23, isolated from copper-fed pigs in Denmark...
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Salmonella Typhimurium gastroenteritis leading to chronic prosthetic vascular graft infection.
Cullinan, Milo; Clarke, Michael; Dallman, Tim; Peart, Steven; Wilson, Deborah; Weiand, Daniel
2017-08-01
Introduction. It is estimated up to 6 % of prosthetic vascular grafts become infected. Staphylococcus aureus is predominant in early infection and coagulase-negative staphylococci are predominant in late infections. Enterobacteriaceae cause 14-40 % of prosthetic vascular graft infections. This is, to our knowledge the first reported case of Salmonella gastroenteritis causing chronic prosthetic vascular graft infection (PVGI). Case presentation. A 57 years old lady presented with signs and symptoms of prosthetic vascular graft infection. Three years earlier, she had undergone a prosthetic axillo-femoral bypass graft for critical limb ischaemia. The infected prosthetic vascular graft was removed and Salmonella Typhimurium was isolated on culture. In the intervening period, Salmonella Typhimurium was isolated from a faecal specimen, collected during an episode of acute gastroenteritis. Whole-genome sequencing (WGS) showed that the respective Salmonella Typhimurium isolates differed by only a single nucleotide polymorphism (SNP). Salmonella Typhimurium was not isolated on culture of a faecal specimen collected five days following cessation of antimicrobial therapy. Six months after removal of the prosthetic graft, the patient remains under follow-up for her peripheral vascular disease, which currently requires no further surgical intervention. Conclusion. This case has clear implications for the management of chronic PVGI. It is vital to collect high-quality surgical specimens for microbiological analysis and empirical choices of antibiotics are unlikely to cover all potential pathogens. It may also be prudent to enquire about a history of acute gastroenteritis when assessing patients presenting with chronic PVGI.
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Gogoi, Purnima; Borah, Probodh; Hussain, Iftikar; Das, Leena; Hazarika, Girin; Tamuly, Shantanu; Barkalita, Luit Moni
2018-05-01
A total of 12 Salmonella isolates belonging to different serovars, viz , Salmonella enterica serovar Enteritidis ( n = 4), Salmonella enterica serovar Weltevreden ( n = 4), Salmonella enterica serovar Newport ( n = 1), Salmonella enterica serovar Litchifield ( n = 1), and untypeable strains ( n = 2) were isolated from 332 diarrheic fecal samples collected from animals, birds, and humans. Of the two molecular typing methods applied, viz , repetitive element sequence-based PCR (REP-PCR) and pulsed-field gel electrophoresis (PFGE), PFGE could clearly differentiate the strains belonging to different serovars as well as differentiate between strains of the same serovar with respect to their source of isolation, whereas REP-PCR could not differentiate between strains of the same serovar. Thus, it can be suggested that PFGE is more useful and appropriate for molecular typing of Salmonella isolates during epidemiological investigations than REP-PCR. Copyright © 2018 American Society for Microbiology.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Lauri, Andrea; Castiglioni, Bianca; Mariani, Paola
2011-07-01
Salmonella is a major cause of food-borne disease, and Salmonella enterica subspecies I includes the most clinically relevant serotypes. Salmonella serotype determination is important for the disease etiology assessment and contamination source tracking. This task will be facilitated by the disclosure of Salmonella serotype sequence polymorphisms, here annotated in seven genes (sefA, safA, safC, bigA, invA, fimA, and phsB) from 139 S. enterica strains, of which 109 belonging to 44 serotypes of subsp. I. One hundred nineteen polymorphic sites were scored and associated to single serotypes or to serotype groups belonging to S. enterica subsp. I. A diagnostic tool was constructed based on the Ligation Detection Reaction-Universal Array (LDR-UA) for the detection of polymorphic sites uniquely associated to serotypes of primary interest (Salmonella Hadar, Salmonella Infantis, Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Gallinarum, Salmonella Virchow, and Salmonella Paratyphi B). The implementation of promiscuous probes allowed the diagnosis of ten further serotypes that could be associated to a unique hybridization pattern. Finally, the sensitivity and applicability of the tool was tested on target DNA dilutions and with controlled meat contamination, allowing the detection of one Salmonella CFU in 25 g of meat.
Phylogenetics and differentiation of Salmonella Newport lineages by whole genome sequencing.
Directory of Open Access Journals (Sweden)
Guojie Cao
Full Text Available Salmonella Newport has ranked in the top three Salmonella serotypes associated with foodborne outbreaks from 1995 to 2011 in the United States. In the current study, we selected 26 S. Newport strains isolated from diverse sources and geographic locations and then conducted 454 shotgun pyrosequencing procedures to obtain 16-24 × coverage of high quality draft genomes for each strain. Comparative genomic analysis of 28 S. Newport strains (including 2 reference genomes and 15 outgroup genomes identified more than 140,000 informative SNPs. A resulting phylogenetic tree consisted of four sublineages and indicated that S. Newport had a clear geographic structure. Strains from Asia were divergent from those from the Americas. Our findings demonstrated that analysis using whole genome sequencing data resulted in a more accurate picture of phylogeny compared to that using single genes or small sets of genes. We selected loci around the mutS gene of S. Newport to differentiate distinct lineages, including those between invH and mutS genes at the 3' end of Salmonella Pathogenicity Island 1 (SPI-1, ste fimbrial operon, and Clustered, Regularly Interspaced, Short Palindromic Repeats (CRISPR associated-proteins (cas. These genes in the outgroup genomes held high similarity with either S. Newport Lineage II or III at the same loci. S. Newport Lineages II and III have different evolutionary histories in this region and our data demonstrated genetic flow and homologous recombination events around mutS. The findings suggested that S. Newport Lineages II and III diverged early in the serotype evolution and have evolved largely independently. Moreover, we identified genes that could delineate sublineages within the phylogenetic tree and that could be used as potential biomarkers for trace-back investigations during outbreaks. Thus, whole genome sequencing data enabled us to better understand the genetic background of pathogenicity and evolutionary history of S
A genomic overview of the population structure of Salmonella.
Alikhan, Nabil-Fareed; Zhou, Zhemin; Sergeant, Martin J; Achtman, Mark
2018-04-01
For many decades, Salmonella enterica has been subdivided by serological properties into serovars or further subdivided for epidemiological tracing by a variety of diagnostic tests with higher resolution. Recently, it has been proposed that so-called eBurst groups (eBGs) based on the alleles of seven housekeeping genes (legacy multilocus sequence typing [MLST]) corresponded to natural populations and could replace serotyping. However, this approach lacks the resolution needed for epidemiological tracing and the existence of natural populations had not been independently validated by independent criteria. Here, we describe EnteroBase, a web-based platform that assembles draft genomes from Illumina short reads in the public domain or that are uploaded by users. EnteroBase implements legacy MLST as well as ribosomal gene MLST (rMLST), core genome MLST (cgMLST), and whole genome MLST (wgMLST) and currently contains over 100,000 assembled genomes from Salmonella. It also provides graphical tools for visual interrogation of these genotypes and those based on core single nucleotide polymorphisms (SNPs). eBGs based on legacy MLST are largely consistent with eBGs based on rMLST, thus demonstrating that these correspond to natural populations. rMLST also facilitated the selection of representative genotypes for SNP analyses of the entire breadth of diversity within Salmonella. In contrast, cgMLST provides the resolution needed for epidemiological investigations. These observations show that genomic genotyping, with the assistance of EnteroBase, can be applied at all levels of diversity within the Salmonella genus.
Pettengill, James B; Pightling, Arthur W; Baugher, Joseph D; Rand, Hugh; Strain, Errol
2016-01-01
The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis). In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging due to both biological (evolutionary diverse samples) and computational (petabytes of sequence data) issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances) or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST) scheme). When analyzing empirical data (whole-genome sequence data from 18,997 Salmonella isolates) there are features (e.g., genomic, assembly, and contamination) that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.
Directory of Open Access Journals (Sweden)
James B Pettengill
Full Text Available The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis. In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging due to both biological (evolutionary diverse samples and computational (petabytes of sequence data issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST scheme. When analyzing empirical data (whole-genome sequence data from 18,997 Salmonella isolates there are features (e.g., genomic, assembly, and contamination that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
A ciprofloxacin resistant (CipR) Salmonella enterica subsp. enterica serovar Kentucky ST198 has rapidly and extensively disseminated globally to become a major food-safety and public health concern. Here, we report a complete genome sequence of a CipR S. Kentucky ST198 strain PU131 isolated from a ...
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Salmonella enteric subsp. enterica strains RM11060, serotype 6,8:d:-, and RM11065, serotype 6,8:-:e,n,z15, were isolated from environmental sampling in Central California in 2009. We report the complete genome sequences and annotation of these two strains. These genomic sequences are distinct and wi...
Directory of Open Access Journals (Sweden)
Penido, A. F. B.
2013-12-01
Full Text Available Aims: Characterization of cryptic plasmid pVCM01 (accession number JX133088 isolated from Salmonella enterica Enteritidis. Methodology and results: The complete sequence of pVCM01 was obtained. This plasmid possesses 1981 bp, with G+C content of 57% in agreement of the range of Salmonella genomic DNA. pVCM01 has a high degree of similarity to pB and pJ plasmids. It possesses six main open reading frames, only one have a very high degree of amino acid identity with protein involved in the rolling-circle-like replication (RCR. Based on the sequence similarities, pVCM01 plasmid belonged to the pC194/pUB110 rolling-circle replicating plasmid family. The Rep pVCM01 possesses the motifs: FLTLTVRN, HPHFHTL, SGDGYVKHERW, which were present in all Rep proteins. Conclusion, significance and impact of study: The small size of pVCM01 plasmid and its stability in E. coli cells, make it an attractive candidate to develop new vectors, such as cloning and/or expression vector.
Directory of Open Access Journals (Sweden)
Anne-Catherine Portmann
2018-03-01
Full Text Available Whole genome sequencing (WGS, using high throughput sequencing technology, reveals the complete sequence of the bacterial genome in a few days. WGS is increasingly being used for source tracking, pathogen surveillance and outbreak investigation due to its high discriminatory power. In the food industry, WGS used for source tracking is beneficial to support contamination investigations. Despite its increased use, no standards or guidelines are available today for the use of WGS in outbreak and/or trace-back investigations. Here we present a validation of our complete (end-to-end WGS workflow for Listeria monocytogenes and Salmonella enterica including: subculture of isolates, DNA extraction, sequencing and bioinformatics analysis. This end-to-end WGS workflow was evaluated according to the following performance criteria: stability, repeatability, reproducibility, discriminatory power, and epidemiological concordance. The current study showed that few single nucleotide polymorphism (SNPs were observed for L. monocytogenes and S. enterica when comparing genome sequences from five independent colonies from the first subculture and five independent colonies after the tenth subculture. Consequently, the stability of the WGS workflow for L. monocytogenes and S. enterica was demonstrated despite the few genomic variations that can occur during subculturing steps. Repeatability and reproducibility were also demonstrated. The WGS workflow was shown to have a high discriminatory power and has the ability to show genetic relatedness. Additionally, the WGS workflow was able to reproduce published outbreak investigation results, illustrating its capability of showing epidemiological concordance. The current study proposes a validation approach comprising all steps of a WGS workflow and demonstrates that the workflow can be applied to L. monocytogenes or S. enterica.
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
A genomic overview of the population structure of Salmonella.
Directory of Open Access Journals (Sweden)
Nabil-Fareed Alikhan
2018-04-01
Full Text Available For many decades, Salmonella enterica has been subdivided by serological properties into serovars or further subdivided for epidemiological tracing by a variety of diagnostic tests with higher resolution. Recently, it has been proposed that so-called eBurst groups (eBGs based on the alleles of seven housekeeping genes (legacy multilocus sequence typing [MLST] corresponded to natural populations and could replace serotyping. However, this approach lacks the resolution needed for epidemiological tracing and the existence of natural populations had not been independently validated by independent criteria. Here, we describe EnteroBase, a web-based platform that assembles draft genomes from Illumina short reads in the public domain or that are uploaded by users. EnteroBase implements legacy MLST as well as ribosomal gene MLST (rMLST, core genome MLST (cgMLST, and whole genome MLST (wgMLST and currently contains over 100,000 assembled genomes from Salmonella. It also provides graphical tools for visual interrogation of these genotypes and those based on core single nucleotide polymorphisms (SNPs. eBGs based on legacy MLST are largely consistent with eBGs based on rMLST, thus demonstrating that these correspond to natural populations. rMLST also facilitated the selection of representative genotypes for SNP analyses of the entire breadth of diversity within Salmonella. In contrast, cgMLST provides the resolution needed for epidemiological investigations. These observations show that genomic genotyping, with the assistance of EnteroBase, can be applied at all levels of diversity within the Salmonella genus.
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
DISSEMINATION OF SALMONELLA ENTERICA SEQUENCE TYPES AMONG ASEAN ECONOMIC COMMUNITY COUNTRIES.
Patchanee, Prapas; Boonkhot, Phacharaporn; Kittiwan, Nattinee; Tadee, Pakpoom; Chotinun, Suwit
2015-07-01
Food-borne illness caused by Salmonella enterica remains a public health problem and results in economic loss worldwide. With the up-coming establish- ment of the ASEAN Economic Community (AEC) allowing unrestricted move- ment of labor and goods, there is a higher risk of pathogen transmission among the AEC countries. This study characterized and investigated the spatial and temporal associations of S. enterica strains isolated in AEC countries during 1940- 2012 compared with those isolated in northern-Thailand during 2011-2013. Of the 173 S. enterica strains examined, 68 sequence types (STs) and 32 clonal complexes (CCs) were identified by multi loci sequence typing. Twenty-one strains belonged to four sequence types new to AEC countries, and they constituted only two CCs. A number of strains originated from various countries with multiple hosts, were highlighted. There was evidence of strains circulating in the AEC region well over a decade. Such information will be important in formulating biosecurity measures, as well as in educating regarding the risk of disease transmission in AEC.
Base Sequence Context Effects on Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
Yuqin Cai
2010-01-01
Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Panzenhagen, P H N; Cabral, C C; Suffys, P N; Franco, R M; Rodrigues, D P; Conte-Junior, C A
2018-04-01
Salmonella pathogenicity relies on virulence factors many of which are clustered within the Salmonella pathogenicity islands. Salmonella also harbours mobile genetic elements such as virulence plasmids, prophage-like elements and antimicrobial resistance genes which can contribute to increase its pathogenicity. Here, we have genetically characterized a selected S. Typhimurium strain (CCRJ_26) from our previous study with Multiple Drugs Resistant profile and high-frequency PFGE clonal profile which apparently persists in the pork production centre of Rio de Janeiro State, Brazil. By whole-genome sequencing, we described the strain's genome virulent content and characterized the repertoire of bacterial plasmids, antibiotic resistance genes and prophage-like elements. Here, we have shown evidence that strain CCRJ_26 genome possible represent a virulence-associated phenotype which may be potentially virulent in human infection. Whole-genome sequencing technologies are still costly and remain underexplored for applied microbiology in Brazil. Hence, this genomic description of S. Typhimurium strain CCRJ_26 will provide help in future molecular epidemiological studies. The analysis described here reveals a quick and useful pipeline for bacterial virulence characterization using whole-genome sequencing approach. © 2018 The Society for Applied Microbiology.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Kagambèga, Assèta; Lienemann, Taru; Frye, Jonathan G; Barro, Nicolas; Haukka, Kaisa
2018-01-01
Multidrug-resistant Salmonella is an important cause of morbidity and mortality in developing countries. The aim of this study was to characterize and compare multidrug-resistant Salmonella enterica serovar Typhimurium isolates from patients and poultry feces. Salmonella strains were isolated from poultry and patients using standard bacteriological methods described in previous studies. The strains were serotype according to Kaufmann-White scheme and tested for antibiotic susceptibility to 12 different antimicrobial agents using the disk diffusion method. The whole genome of the S. Typhimurium isolates was analyzed using Illumina technology and compared with 20 isolates of S. Typhimurium for which the ST has been deposited in a global MLST database.The ResFinder Web server was used to find the antibiotic resistance genes from whole genome sequencing (WGS) data. For comparative genomics, publicly available complete and draft genomes of different S. Typhimurium laboratory-adapted strains were downloaded from GenBank. All the tested Salmonella serotype Typhimurium were multiresistant to five commonly used antibiotics (ampicillin, chloramphenicol, streptomycin, sulfonamide, and trimethoprim). The multilocus sequence type ST313 was detected from all the strains. Our sequences were very similar to S. Typhimurium ST313 strain D23580 isolated from a patient with invasive non-typhoid Salmonella (NTS) infection in Malawi, also located in sub-Saharan Africa. The use of ResFinder web server on the whole genome of the strains showed a resistance to aminoglycoside associated with carriage of the following resistances genes: strA , strB , and aadA1 ; resistance to β-lactams associated with carriage of a bla TEM-1B genes; resistance to phenicol associated with carriage of catA1 gene; resistance to sulfonamide associated with carriage of sul1 and sul2 genes; resistance to tetracycline associated with carriage of tet B gene; and resistance to trimethoprim associated to dfrA1 gene
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
Lei, Chang-Wei; Zhang, An-Yun; Liu, Bi-Hui; Wang, Hong-Ning; Guan, Zhong-Bin; Xu, Chang-Wen; Xia, Qing-Qing; Cheng, Han; Zhang, Dong-Dong
2014-12-01
Six out of the 64 studied Proteus mirabilis isolates from 11 poultry farms in China contained Salmonella genomic island 1 (SGI1). PCR mapping showed that the complete nucleotide sequences of SGI1s ranged from 33.2 to 42.5 kb. Three novel variants, SGI1-W, SGI1-X, and SGI1-Y, have been characterized. Resistance genes lnuF, dfrA25, and qnrB2 were identified in SGI1 for the first time. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Salmonella Kentucky is a polyphyletic member of S. enterica subclade A1 with multiple sequence types that often colonize the same hosts but in different frequencies on different continents. To evaluate the genomic features involved in S. Kentucky host specificity we sequenced the genomes of four iso...
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Multilocus sequence typing as a replacement for serotyping in Salmonella enterica.
Directory of Open Access Journals (Sweden)
Mark Achtman
Full Text Available Salmonella enterica subspecies enterica is traditionally subdivided into serovars by serological and nutritional characteristics. We used Multilocus Sequence Typing (MLST to assign 4,257 isolates from 554 serovars to 1092 sequence types (STs. The majority of the isolates and many STs were grouped into 138 genetically closely related clusters called eBurstGroups (eBGs. Many eBGs correspond to a serovar, for example most Typhimurium are in eBG1 and most Enteritidis are in eBG4, but many eBGs contained more than one serovar. Furthermore, most serovars were polyphyletic and are distributed across multiple unrelated eBGs. Thus, serovar designations confounded genetically unrelated isolates and failed to recognize natural evolutionary groupings. An inability of serotyping to correctly group isolates was most apparent for Paratyphi B and its variant Java. Most Paratyphi B were included within a sub-cluster of STs belonging to eBG5, which also encompasses a separate sub-cluster of Java STs. However, diphasic Java variants were also found in two other eBGs and monophasic Java variants were in four other eBGs or STs, one of which is in subspecies salamae and a second of which includes isolates assigned to Enteritidis, Dublin and monophasic Paratyphi B. Similarly, Choleraesuis was found in eBG6 and is closely related to Paratyphi C, which is in eBG20. However, Choleraesuis var. Decatur consists of isolates from seven other, unrelated eBGs or STs. The serological assignment of these Decatur isolates to Choleraesuis likely reflects lateral gene transfer of flagellar genes between unrelated bacteria plus purifying selection. By confounding multiple evolutionary groups, serotyping can be misleading about the disease potential of S. enterica. Unlike serotyping, MLST recognizes evolutionary groupings and we recommend that Salmonella classification by serotyping should be replaced by MLST or its equivalents.
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
Directory of Open Access Journals (Sweden)
An T T Vo
Full Text Available BACKGROUND: The objective was to investigate the phenotypic and genotypic resistance and the horizontal transfer of resistance determinants from Salmonella isolates from humans and animals in Vietnam. METHODOLOGY/PRINCIPAL FINDINGS: The susceptibility of 297 epidemiologically unrelated non-typhoid Salmonella isolates was investigated by disk diffusion assay. The isolates were screened for the presence of class 1 integrons and Salmonella genomic island 1 by PCR. The potential for the transfer of resistance determinants was investigated by conjugation experiments. Resistance to gentamicin, kanamycin, chloramphenicol, streptomycin, trimethoprim, ampicillin, nalidixic acid, sulphonamides, and tetracycline was found in 13 to 50% of the isolates. Nine distinct integron types were detected in 28% of the isolates belonging to 11 Salmonella serovars including S. Tallahassee. Gene cassettes identified were aadA1, aadA2, aadA5, bla(PSE-1, bla(OXA-30, dfrA1, dfrA12, dfrA17, and sat, as well as open reading frames with unknown functions. Most integrons were located on conjugative plasmids, which can transfer their antimicrobial resistance determinants to Escherichia coli or Salmonella Enteritidis, or with Salmonella Genomic Island 1 or its variants. The resistance gene cluster in serovar Emek identified by PCR mapping and nucleotide sequencing contained SGI1-J3 which is integrated in SGI1 at another position than the majority of SGI1. This is the second report on the insertion of SGI1 at this position. High-level resistance to fluoroquinolones was found in 3 multiresistant S. Typhimurium isolates and was associated with mutations in the gyrA gene leading to the amino acid changes Ser83Phe and Asp87Asn. CONCLUSIONS: Resistance was common among Vietnamese Salmonella isolates from different sources. Legislation to enforce a more prudent use of antibiotics in both human and veterinary medicine should be implemented by the authorities in Vietnam.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
Sévellec, Yann; Vignaud, Marie-Léone; Granier, Sophie A.; Lailler, Renaud; Feurer, Carole; Le Hello, Simon; Mistou, Michel-Yves; Cadel-Six, Sabrina
2018-01-01
In France, Salmonella Derby is one of the most prevalent serotypes in pork and poultry meat. Since 2006, it has ranked among the 10 most frequent Salmonella serotypes isolated in humans. In previous publications, Salmonella Derby isolates have been characterized by pulsed field gel electrophoresis (PFGE) and antimicrobial resistance (AMR) profiles revealing the existence of different pulsotypes and AMR phenotypic groups. However, these results suffer from the low discriminatory power of these typing methods. In the present study, we built a collection of 140 strains of S. Derby collected in France from 2014 to 2015 representative of the pork and poultry food sectors. The whole collection was characterized using whole genome sequencing (WGS), providing a significant contribution to the knowledge of this underrepresented serotype, with few genomes available in public databases. The genetic diversity of the S. Derby strains was analyzed by single-nucleotide polymorphism (SNP). We also investigated AMR by both genome and phenotype, the main Salmonella pathogenicity island (SPI) and the fimH gene sequences. Our results show that this S. Derby collection is spread across four different lineages genetically distant by an average of 15k SNPs. These lineages correspond to four multilocus sequence typing (MLST) types (ST39, ST40, ST71, and ST682), which were found to be associated with specific animal hosts: pork and poultry. While the ST71 and ST682 strains are pansusceptible, ST40 isolates are characterized by the multidrug resistant profile STR-SSS-TET. Considering virulence determinants, only ST39 and ST40 present the SPI-23, which has previously been associated with pork enterocyte invasion. Furthermore, the pork ST682 isolates were found to carry mutations in the fimH sequence that could participate in the host tropism of this group. Our phylogenetic analysis demonstrates the polyphyletic nature of the Salmonella serotype Derby and provides an opportunity to identify
Directory of Open Access Journals (Sweden)
Yann Sévellec
2018-05-01
Full Text Available In France, Salmonella Derby is one of the most prevalent serotypes in pork and poultry meat. Since 2006, it has ranked among the 10 most frequent Salmonella serotypes isolated in humans. In previous publications, Salmonella Derby isolates have been characterized by pulsed field gel electrophoresis (PFGE and antimicrobial resistance (AMR profiles revealing the existence of different pulsotypes and AMR phenotypic groups. However, these results suffer from the low discriminatory power of these typing methods. In the present study, we built a collection of 140 strains of S. Derby collected in France from 2014 to 2015 representative of the pork and poultry food sectors. The whole collection was characterized using whole genome sequencing (WGS, providing a significant contribution to the knowledge of this underrepresented serotype, with few genomes available in public databases. The genetic diversity of the S. Derby strains was analyzed by single-nucleotide polymorphism (SNP. We also investigated AMR by both genome and phenotype, the main Salmonella pathogenicity island (SPI and the fimH gene sequences. Our results show that this S. Derby collection is spread across four different lineages genetically distant by an average of 15k SNPs. These lineages correspond to four multilocus sequence typing (MLST types (ST39, ST40, ST71, and ST682, which were found to be associated with specific animal hosts: pork and poultry. While the ST71 and ST682 strains are pansusceptible, ST40 isolates are characterized by the multidrug resistant profile STR-SSS-TET. Considering virulence determinants, only ST39 and ST40 present the SPI-23, which has previously been associated with pork enterocyte invasion. Furthermore, the pork ST682 isolates were found to carry mutations in the fimH sequence that could participate in the host tropism of this group. Our phylogenetic analysis demonstrates the polyphyletic nature of the Salmonella serotype Derby and provides an opportunity
The nucleotide sequence of a Polish isolate of Tomato torrado virus.
Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk
2008-12-01
A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Fu, Songzhe; Octavia, Sophie; Tanaka, Mark M.; Sintchenko, Vitali
2015-01-01
Salmonella enterica serovar Typhimurium is the most common Salmonella serovar causing foodborne infections in Australia and many other countries. Twenty-one S. Typhimurium strains from Salmonella reference collection A (SARA) were analyzed using Illumina high-throughput genome sequencing. Single nucleotide polymorphisms (SNPs) in 21 SARA strains ranged from 46 to 11,916 SNPs, with an average of 1,577 SNPs per strain. Together with 47 strains selected from publicly available S. Typhimurium genomes, the S. Typhimurium core genes (STCG) were determined. The STCG consist of 3,846 genes, a set that is much larger than that of the 2,882 Salmonella core genes (SCG) found previously. The STCG together with 1,576 core intergenic regions (IGRs) were defined as the S. Typhimurium core genome. Using 93 S. Typhimurium genomes from 13 epidemiologically confirmed community outbreaks, we demonstrated that typing based on the S. Typhimurium core genome (STCG plus core IGRs) provides superior resolution and higher discriminatory power than that based on SCG for outbreak investigation and molecular epidemiology of S. Typhimurium. STCG and STCG plus core IGR typing achieved 100% separation of all outbreaks compared to that of SCG typing, which failed to separate isolates from two outbreaks from background isolates. Defining the S. Typhimurium core genome allows standardization of genes/regions to be used for high-resolution epidemiological typing and genomic surveillance of S. Typhimurium. PMID:26019201
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
DEFF Research Database (Denmark)
Leekitcharoenphon, Pimlapas; Raufu, Ibrahim; Thorup Nielsen, Mette
2016-01-01
Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely...
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Tentative Colistin Epidemiological Cut-Off Value for Salmonella spp
DEFF Research Database (Denmark)
Agersø, Yvonne; Torpdahl, Mia; Zachariasen, Camilla
2012-01-01
. Interestingly, Salmonella Dublin and Salmonella Enteritidis belong to the same O-group (O:1, 9,12), suggesting that surface lipopolysaccharides (LPS) of the cell (O-antigen) play a role in colistin susceptibility. The epidemiological cut-off value of >2 mg/L for colistin suggested by European Committee...... on Antimicrobial Susceptibility Testing (EUCAST) is placed inside the distribution for both Salmonella Dublin and Salmonella Enteritidis. All tested Salmonella Dublin isolates, regardless of MIC colistin value, had identical pmrA and pmrB sequences. Missense mutations were found only in pmrA in one Salmonella...
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.
Liljeström, P L; Liljeström, P
1987-01-01
Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...
Abd El Ghany, Moataz
2016-05-25
Human infections with Salmonella enterica subspecies enterica serovar Senftenberg are often associated with exposure to poultry flocks, farm environments, or contaminated food. The recent emergence of multidrug-resistant isolates has raised public health concerns. In this study, comparative genomics and phenotypic analysis were used to characterize 14 Salmonella Senftenberg clinical isolates recovered from multiple outbreaks in Shenzhen and Shanghai, China, between 2002 and 2011. Single-nucleotide polymorphism analyses identified two phylogenetically distinct clades of S. Senftenberg, designated SC1 and SC2, harboring variations in Salmonella pathogenicity island 1 (SPI-1) and SPI-2 and exhibiting distinct biochemical and phenotypic signatures. Although the two variants shared the same serotype, the SC2 isolates of sequence type 14 (ST14) harbored intact SPI-1 and -2 and hence were characterized by possessing efficient invasion capabilities. In contrast, the SC1 isolates had structural deletion patterns in both SPI-1 and -2 that correlated with an impaired capacity to invade cultured human cells and also the year of their isolation. These atypical SC1 isolates also lacked the capacity to produce hydrogen sulfide. These findings highlight the emergence of atypical Salmonella Senftenberg variants in China and provide genetic validation that variants lacking SPI-1 and regions of SPI-2, which leads to impaired invasion capacity, can still cause clinical disease. These data have identified an emerging public health concern and highlight the need to strengthen surveillance to detect the prevalence and transmission of nontyphoidal Salmonella species.
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Directory of Open Access Journals (Sweden)
Pimlapas Leekitcharoenphon
Full Text Available Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely source of the human infections.
Comparing human-Salmonella with plant-Salmonella protein-protein interaction predictions
Directory of Open Access Journals (Sweden)
Sylvia eSchleker
2015-01-01
Full Text Available Salmonellosis is the most frequent food-borne disease world-wide and can be transmitted to humans by a variety of routes, especially via animal and plant products. Salmonella bacteria are believed to use not only animal and human but also plant hosts despite their evolutionary distance. This raises the question if Salmonella employs similar mechanisms in infection of these diverse hosts. Given that most of our understanding comes from its interaction with human hosts, we investigate here to what degree knowledge of Salmonella-human interactions can be transferred to the Salmonella-plant system. Reviewed are recent publications on analysis and prediction of Salmonella-host interactomes. Putative protein-protein interactions (PPIs between Salmonella and its human and Arabidopsis hosts were retrieved utilizing purely interolog-based approaches in which predictions were inferred based on available sequence and domain information of known PPIs, and machine learning approaches that integrate a larger set of useful information from different sources. Transfer learning is an especially suitable machine learning technique to predict plant host targets from the knowledge of human host targets. A comparison of the prediction results with transcriptomic data shows a clear overlap between the host proteins predicted to be targeted by PPIs and their gene ontology enrichment in both host species and regulation of gene expression. In particular, the cellular processes Salmonella interferes with in plants and humans are catabolic processes. The details of how these processes are targeted, however, are quite different between the two organisms, as expected based on their evolutionary and habitat differences. Possible implications of this observation on evolution of host-pathogen communication are discussed.
Directory of Open Access Journals (Sweden)
Rebecca L. Bell
2015-05-01
Full Text Available Virginia is the third largest producer of fresh-market tomatoes in the United States. Tomatoes grown along the eastern shore of Virginia are implicated almost yearly in Salmonella illnesses. Traceback implicates contamination occurring in the pre-harvest environment. To get a better understanding of the ecological niches of Salmonella in the tomato agricultural environment, a two-year study was undertaken at a regional agricultural research farm in Virginia. Environmental samples, including tomato (fruit, blossoms and leaves, irrigation water, surface water and sediment, were collected over the growing season. These samples were analyzed for the presence of Salmonella using modified FDA-BAM methods. Molecular assays were used to screen the samples. Over 1500 samples were tested. Seventy-five samples tested positive for Salmonella yielding over 230 isolates. The most commonly isolated serovars were S. Newport and S. Javiana with pulsed-field gel electrophoresis yielding 39 different patterns. Genetic diversity was further underscored among many other serotypes, which showed multiple PFGE subtypes. Whole genome sequencing of several S. Newport isolates collected in 2010 compared to clinical isolates associated with tomato consumption showed very few single nucleotide differences between environmental isolates and clinical isolates suggesting a source link to Salmonella contaminated tomatoes. Nearly all isolates collected during two growing seasons of surveillance were obtained from surface water and sediment sources pointing to these sites as long-term reservoirs for persistent and endemic contamination of this environment.
Iriarte, Andrés; Giner-Lamia, Joaquín; Silva, Claudia; Betancor, Laura; Astocondor, Lizeth; Cestero, Juan J; Ochoa, Theresa; García, Coralith; Puente, José L; Chabalgoity, José A; García-Del Portillo, Francisco
2017-07-20
We report a 4.99-Mb draft genome sequence of Salmonella enterica subsp. enterica serovar Infantis strain SPE101, isolated from feces of a 5-month-old breast-fed female showing diarrhea associated with severe dehydration and malnutrition. The infection prolonged for 6 months despite antibiotic treatment. Copyright © 2017 Iriarte et al.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Structural characterization of the Salmonella typhimurium LT2 umu operon
International Nuclear Information System (INIS)
Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.
1990-01-01
The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity
The Salmonella enterica Pan-genome
DEFF Research Database (Denmark)
Jacobsen, Annika; Hendriksen, Rene S.; Aarestrup, Frank Møller
2011-01-01
Salmonella enterica is divided into four subspecies containing a large number of different serovars, several of which are important zoonotic pathogens and some show a high degree of host specificity or host preference. We compare 45 sequenced S. enterica genomes that are publicly available (22......, and the core and pan-genome of Salmonella were estimated to be around 2,800 and 10,000 gene families, respectively. The constructed pan-genomic dendrograms suggest that gene content is often, but not uniformly correlated to serotype. Any given Salmonella strain has a large stable core, whilst...... there is an abundance of accessory genes, including the Salmonella pathogenicity islands (SPIs), transposable elements, phages, and plasmid DNA. We visualize conservation in the genomes in relation to chromosomal location and DNA structural features and find that variation in gene content is localized in a selection...
Directory of Open Access Journals (Sweden)
Yuki Furuse
2015-11-01
Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.
Cao, Guojie; Allard, Marc W; Hoffmann, Maria; Monday, Steven R; Muruvanda, Tim; Luo, Yan; Payne, Justin; Rump, Lydia; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick F; Brown, Eric W; Meng, Jianghong
2015-02-26
Multidrug-resistant (MDR) Salmonella enterica subsp. enterica serotype Newport has been a long-standing public health concern in the United States. We present the complete sequences of six IncA/C plasmids from animal-derived MDR S. Newport ranging from 80.1 to 158.5 kb. They shared a genetic backbone with S. Newport IncA/C plasmids pSN254 and pAM04528. Copyright © 2015 Cao et al.
An, Ran; Lin, Pengpeng; Bougouffa, Salim; Essack, Magbubah; Boxrud, David; Bajic, Vladimir B.; Vidovic, Sinisa
2018-01-01
Salmonella enterica subsp. enterica serovar Enteritidis is a wide-host-range pathogen. Occasionally, it is involved in invasive infections, leading to a high mortality rate. Here, we present the draft genome sequences of four S Enteritidis strains obtained from human and avian hosts that had been involved in bacteremia, gastroenteritis, and primary infections.
An, Ran
2018-01-24
Salmonella enterica subsp. enterica serovar Enteritidis is a wide-host-range pathogen. Occasionally, it is involved in invasive infections, leading to a high mortality rate. Here, we present the draft genome sequences of four S Enteritidis strains obtained from human and avian hosts that had been involved in bacteremia, gastroenteritis, and primary infections.
Method for the detection of Salmonella enterica serovar Enteritidis
Agron, Peter G.; Andersen, Gary L.; Walker, Richard L.
2008-10-28
Described herein is the identification of a novel Salmonella enterica serovar Enteritidis locus that serves as a marker for DNA-based identification of this bacterium. In addition, three primer pairs derived from this locus that may be used in a nucleotide detection method to detect the presence of the bacterium are also disclosed herein.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Directory of Open Access Journals (Sweden)
Timothy J Johnson
Full Text Available Salmonella enterica continues to be a significant cause of foodborne gastrointestinal illness in humans. A wide variety of Salmonella serovars have been isolated from production birds and from retail poultry meat. Recently, though, S. enterica subsp. enterica serovar Kentucky has emerged as one of the prominent Salmonella serovars isolated from broiler chickens. Recent work suggests that its emergence apparently coincides with its acquisition of a ColV virulence plasmid. In the present study, we examined 902 Salmonella isolates belonging to 59 different serovars for the presence of this plasmid. Of the serovars examined, the ColV plasmid was found only among isolates belonging to the serovars Kentucky (72.9%, Typhimurium (15.0% and Heidelberg (1.7%. We demonstrated that a single PFGE clonal type of S. Kentucky harbors this plasmid, and acquisition of this plasmid by S. Kentucky significantly increased its ability to colonize the chicken cecum and cause extraintestinal disease. Comparison of the completed sequences of three ColV plasmids from S. Kentucky isolated from different geographical locales, timepoints and sources revealed a nearly identical genetic structure with few single nucleotide changes or insertions/deletions. Overall, it appears that the ColV plasmid was recently acquired by a single clonal type S. Kentucky and confers to its host enhanced colonization and fitness capabilities. Thus, the potential for horizontal gene transfer of virulence and fitness factors to Salmonella from other enteric bacteria exists in poultry, representing a potential human health hazard.
Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg
2009-01-01
The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Emergence of Ciprofloxacin-Resistant Salmonella enterica Serovar Typhi in Italy.
Directory of Open Access Journals (Sweden)
Aurora García-Fernández
Full Text Available In developed countries, typhoid fever is often associated with persons who travel to endemic areas or immigrate from them. Typhoid fever is a systemic infection caused by Salmonella enterica serovar Typhi. Because of the emergence of antimicrobial resistance to standard first-line drugs, fluoroquinolones are the drugs of choice. Resistance to ciprofloxacin by this Salmonella serovar represents an emerging public health issue. Two S. enterica ser. Typhi strains resistant to ciprofloxacin (CIP were reported to the Italian surveillance system for foodborne and waterborne diseases (EnterNet-Italia in 2013. The strains were isolated from two Italian tourists upon their arrival from India. A retrospective analysis of 17 other S. enterica ser. Typhi strains isolated in Italy during 2011-2013 was performed to determine their resistance to CIP. For this purpose, we assayed for susceptibility to antimicrobial agents and conducted PCR and nucleotide sequence analyses. Moreover, all strains were typed using pulsed-field gel electrophoresis to evaluate possible clonal relationships. Sixty-eight percent of the S. enterica ser. Typhi strains were resistant to CIP (MICs, 0.125-16 mg/L, and all isolates were negative for determinants of plasmid-mediated quinolone resistance. Analysis of sequences encoding DNA gyrase and topoisomerase IV subunits revealed mutations in gyrA, gyrB, and parC. Thirteen different clonal groups were detected, and the two CIP-resistant strains isolated from the individuals who visited India exhibited the same PFGE pattern. Because of these findings, the emergence of CIP-resistant S. enterica ser. Typhi isolates in Italy deserves attention, and monitoring antibiotic susceptibility is important for efficiently managing cases of typhoid fever.
Directory of Open Access Journals (Sweden)
Sukdeb Nandi
2010-03-01
Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Directory of Open Access Journals (Sweden)
Egle Kudirkiene
2018-05-01
Full Text Available In the current study, we identified plasmids carrying antimicrobial resistance genes in draft whole genome sequences of 16 selected Salmonella enterica isolates representing six different serovars from humans in Ghana. The plasmids and the location of resistance genes in the genomes were predicted using a combination of PlasmidFinder, ResFinder, plasmidSPAdes and BLAST genomic analysis tools. Subsequently, S1-PFGE was employed for analysis of plasmid profiles. Whole genome sequencing confirmed the presence of antimicrobial resistance genes in Salmonella isolates showing multidrug resistance phenotypically. ESBL, either blaTEM52−B or blaCTX−M15 were present in two cephalosporin resistant isolates of S. Virchow and S. Poona, respectively. The systematic genome analysis revealed the presence of different plasmids in different serovars, with or without insertion of antimicrobial resistance genes. In S. Enteritidis, resistance genes were carried predominantly on plasmids of IncN type, in S. Typhimurium on plasmids of IncFII(S/IncFIB(S/IncQ1 type. In S. Virchow and in S. Poona, resistance genes were detected on plasmids of IncX1 and TrfA/IncHI2/IncHI2A type, respectively. The latter two plasmids were described for the first time in these serovars. The combination of genomic analytical tools allowed nearly full mapping of the resistance plasmids in all Salmonella strains analyzed. The results suggest that the improved analytical approach used in the current study may be used to identify plasmids that are specifically associated with resistance phenotypes in whole genome sequences. Such knowledge would allow the development of rapid multidrug resistance tracking tools in Salmonella populations using WGS.
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Salmonella enterica subsp. enterica bacteria are important foodborne pathogens with major economic impact. Some isolates exhibit increased heat tolerance, a concern for food safety. Analysis of a finished-quality genome sequence of an isolate commonly used in heat resistance studies, S. enterica sub...
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Genome-wide methylation patterns in Salmonella enterica Subsp. enterica Serovars.
Directory of Open Access Journals (Sweden)
Cary Pirone-Davies
Full Text Available The methylation of DNA bases plays an important role in numerous biological processes including development, gene expression, and DNA replication. Salmonella is an important foodborne pathogen, and methylation in Salmonella is implicated in virulence. Using single molecule real-time (SMRT DNA-sequencing, we sequenced and assembled the complete genomes of eleven Salmonella enterica isolates from nine different serovars, and analysed the whole-genome methylation patterns of each genome. We describe 16 distinct N6-methyladenine (m6A methylated motifs, one N4-methylcytosine (m4C motif, and one combined m6A-m4C motif. Eight of these motifs are novel, i.e., they have not been previously described. We also identified the methyltransferases (MTases associated with 13 of the motifs. Some motifs are conserved across all Salmonella serovars tested, while others were found only in a subset of serovars. Eight of the nine serovars contained a unique methylated motif that was not found in any other serovar (most of these motifs were part of Type I restriction modification systems, indicating the high diversity of methylation patterns present in Salmonella.
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Structure of Salmonella typhimurium OMP Synthase in a Complete Substrate Complex
DEFF Research Database (Denmark)
Grubmeyer, Charles; Hansen, Michael Riis; Fedorov, Alexander A.
2012-01-01
Dimeric Salmonella typhimurium orotate phosphoribosyltransferase (OMP synthase, EC 2.4.2.10), a key enzyme in de novo pyrimidine nucleotide synthesis, has been cocrystallized in a complete substrate E·MgPRPP·orotate complex and the structure determined to 2.2 Å resolution. This structure resem...
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
... Compartir Find out about Salmonella infections linked to Kellogg’s Honey Smacks Cereal Find out about Salmonella infections ... Outbreaks Multistate Outbreak of Salmonella Infections Linked to Kellogg’s Honey Smacks Cereal Multistate Outbreak of Salmonella Adelaide ...
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
A multiplex ligation detection assay for the characterization of Salmonella enterica strains
Aarts, H.J.M.; Vos, P.; Larsson, J.T.; Hoek, van A.H.A.M.; Huehn, S.; Weijers, T.; Gronlund, H.A.; Malorny, B.
2011-01-01
A proof of principle of a multi-target assay for genotyping Salmonella has been developed targeting 62 genomic marker sequences of Salmonella related to pathogenicity. The assay is based on multiplex ligation detection reaction (LDR) followed by customized ArrayTube (R) microarray detection. The
Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P
2010-09-01
The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.
1985-01-01
The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy
Wheeler, Emily; Cann, Isaac K O; Mackie, Roderick I
2011-04-01
Salmonella carriage patterns in wild and captive reptiles suggest that both geographical proximity and host ecological differences may determine bacterial diversity among reptile populations. In this study, we explore the relative importance of these factors on Salmonella diversity in free-living Galápagos iguanas. We isolated Salmonella enterica from marine iguanas (Amblyrhynchus cristatus) and land iguanas (Conolophus subcristatus and C. pallidus) living on two islands (Plaza Sur and Santa Fe). We evaluated Salmonella population patterns using genomic fingerprints, sequence typing and serotyping. Rep-PCR fingerprinting revealed significant grouping of isolates by iguana population. Island residence had the strongest effect on isolate similarity, but a smaller divergence among Salmonella isolates from different iguana ecotypes (land versus marine) was detected within each island. In contrast, sequence typing detected a marginal difference in isolate genotypes between islands. Sequence types corresponded strongly to serotype identity, with both islands hosting a unique serovar pool. Our findings suggest that both geographical location and host ecotype differences (either from within host strain selection or from differences in habitat use) contribute to Salmonella population patterns in the Galápagos Islands. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.
Le Gall, O; Candresse, T; Dunez, J
1988-02-01
Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.
Mutagenicity of irradiated solutions of nuclei acid bases and nucleosides in Salmonella typhimurium
International Nuclear Information System (INIS)
Wilmer, J.; Schubert, J.
1981-01-01
Solutions of nucleic acid bases, nucleosides and a nucleotide, saturated with either N 2 , N 2 O or O 2 , were irradiated and tested for mutagenicity towards Salmonella typhimurium, with and without pre-incubation. Irradiated solutions of the nuclei acid bases were all non-mutagenic. Irradiated solutions of the nucleosides showed mutagenicity in S. typhimurium TA100 (pre-incubation assay). Generally, the mutagenicity followed the order: N 2 O > N 2 > O 2 . The results show that the formation of mutagenic radiolytic products is initiated by attack of mainly solutions of the nucleotide thymidine-5'-monophosphate, no mutagenicity could be detected. (orig.)
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
A multiplex ligation detection assay for the characterization of Salmonella enterica strains
DEFF Research Database (Denmark)
Aarts, Henk J.M.; Vos, Pieter; Larsson, Jonas T.
2011-01-01
A proof of principle of a multi-target assay for genotyping Salmonella has been developed targeting 62 genomic marker sequences of Salmonella related to pathogenicity. The assay is based on multiplex ligation detection reaction (LDR) followed by customized ArrayTube® microarray detection. The fea...... assessors that support bio-traceability models....
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Research and identification of pathogenic bacteria 'Salmonella and Listeria' in food
International Nuclear Information System (INIS)
Harizi Khalil
2009-01-01
The sums propose to evaluate the bacterial contamination of certain food taken randomly by two pathogenic bacteria (Salmonella and Listeria) considering the evolution of the diseases of food oignon. For that 78 food samples of different origins were analysed. 2 stocks of the Listeria kind and 3 stocks of the salmonella kind were insulated and identified by biochemical and molecular tests. The pathogenic isolates were identified by coloration gram, test catalase, insulation on specific culture media and Api (20 E for Salmonella and Api listeria. At the end, the PCR were realized to amplify the gene iap which codes for the protein p60 at listeria as well as a sequence clonee randomly specific of Salmonella.
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Silencing by H-NS potentiated the evolution of Salmonella.
Directory of Open Access Journals (Sweden)
Sabrina S Ali
2014-11-01
Full Text Available The bacterial H-NS protein silences expression from sequences with higher AT-content than the host genome and is believed to buffer the fitness consequences associated with foreign gene acquisition. Loss of H-NS results in severe growth defects in Salmonella, but the underlying reasons were unclear. An experimental evolution approach was employed to determine which secondary mutations could compensate for the loss of H-NS in Salmonella. Six independently derived S. Typhimurium hns mutant strains were serially passaged for 300 generations prior to whole genome sequencing. Growth rates of all lineages dramatically improved during the course of the experiment. Each of the hns mutant lineages acquired missense mutations in the gene encoding the H-NS paralog StpA encoding a poorly understood H-NS paralog, while 5 of the mutant lineages acquired deletions in the genes encoding the Salmonella Pathogenicity Island-1 (SPI-1 Type 3 secretion system critical to invoke inflammation. We further demonstrate that SPI-1 misregulation is a primary contributor to the decreased fitness in Salmonella hns mutants. Three of the lineages acquired additional loss of function mutations in the PhoPQ virulence regulatory system. Similarly passaged wild type Salmonella lineages did not acquire these mutations. The stpA missense mutations arose in the oligomerization domain and generated proteins that could compensate for the loss of H-NS to varying degrees. StpA variants most able to functionally substitute for H-NS displayed altered DNA binding and oligomerization properties that resembled those of H-NS. These findings indicate that H-NS was central to the evolution of the Salmonellae by buffering the negative fitness consequences caused by the secretion system that is the defining characteristic of the species.
Applications of microscopy in Salmonella research.
Malt, Layla M; Perrett, Charlotte A; Humphrey, Suzanne; Jepson, Mark A
2015-01-01
Salmonella enterica is a Gram-negative enteropathogen that can cause localized infections, typically resulting in gastroenteritis, or systemic infection, e.g., typhoid fever, in humans and many other animals. Understanding the mechanisms by which Salmonella induces disease has been the focus of intensive research. This has revealed that Salmonella invasion requires dynamic cross-talk between the microbe and host cells, in which bacterial adherence rapidly leads to a complex sequence of cellular responses initiated by proteins translocated into the host cell by a type 3 secretion system. Once these Salmonella-induced responses have resulted in bacterial invasion, proteins translocated by a second type 3 secretion system initiate further modulation of cellular activities to enable survival and replication of the invading pathogen. Elucidation of the complex and highly dynamic pathogen-host interactions ultimately requires analysis at the level of single cells and single infection events. To achieve this goal, researchers have applied a diverse range of microscopy techniques to analyze Salmonella infection in models ranging from whole animal to isolated cells and simple eukaryotic organisms. For example, electron microscopy and high-resolution light microscopy techniques such as confocal microscopy can reveal the precise location of Salmonella and its relationship to cellular components. Widefield light microscopy is a simpler approach with which to study the interaction of bacteria with host cells and often has advantages for live cell imaging, enabling detailed analysis of the dynamics of infection and cellular responses. Here we review the use of imaging techniques in Salmonella research and compare the capabilities of different classes of microscope to address specific types of research question. We also provide protocols and notes on some microscopy techniques used routinely in our own research.
Directory of Open Access Journals (Sweden)
Patricio Retamal
Full Text Available A bioinformatics comparison of Salmonella Pathogenicity Island 3 sequences from S. Typhi and S. Typhimurium serovars showed that ten genes are highly conserved. However three of them are pseudogenes in S. Typhi. Our aim was to understand what functions are lost in S. Typhi due to pseudogenes by constructing a S. Typhi genetic hybrid carrying the SPI-3 region of S. Typhimurium instead of its own SPI-3. We observed that under stressful conditions the hybrid strain showed a clear impairment in resistance to hydrogen peroxide and decreased survival within U937 culture monocytes. We hypothesized that the marT-fidL operon, encoded in SPI-3, was responsible for the new phenotypes because marT is a pseudogen in S. Typhi and has a demonstrated role as a transcriptional regulator in S. Typhimurium. Therefore we cloned and transferred the S. Typhimurium marT-fidL operon into S. Typhi and confirmed that invasion of monocytes was dramatically decreased. Finally, our findings suggest that the genomic and functional differences between SPI-3 sequences have implications in the host specificity of Typhi and Typhimurium serovars.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
2015-05-26
N. Shariat, R. E. Timme, J. B. Pettengill, R. Barrangou, E. G. Dudley. Characterization and evolution of Salmonella CRISPR - Cas systems...Barrangou, Edward G. Dudley. Characterization of CRISPR - Cas in Salmonella, 3rd European CRISPR meeting. 14-MAY-14, . : , Margaret K. Kirchner, Nikki... CRISPRs Beyond subtyping approaches, we were motivated to understand the biology of CRISPR - Cas systems in Salmonella. We performed in-depth sequence
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Genomics of three new bacteriophages useful in the biocontrol of Salmonella
Directory of Open Access Journals (Sweden)
Carlota eBardina
2016-04-01
Full Text Available Non-typhoid Salmonella is the principal pathogen related to food-borne diseases throughout the world. Widespread antibiotic resistance has adversely affected human health and has encouraged the search for alternative antimicrobial agents. The advances in bacteriophage therapy highlight their use in controlling a broad spectrum of food-borne pathogens. One requirement for the use of bacteriophages as antibacterials is the characterization of their genomes. In this work, complete genome sequencing and molecular analyses were carried out for three new virulent Salmonella-specific bacteriophages (UAB_Phi20, UAB_Phi78, and UAB_Phi87 able to infect a broad range of Salmonella strains. Sequence analysis of the genomes of UAB_Phi20, UAB_Phi78, and UAB_Phi87 bacteriophages did not evidence the presence of known virulence-associated and antibiotic resistance genes, and potential immunoreactive food allergens. The UAB_Phi20 genome comprised 41,809 base pairs with 80 open reading frames (ORFs; 24 of them with assigned function. Genome sequence showed a high homology of UAB_Phi20 with Salmonella bacteriophage P22 and other P22likeviruses genus of the Podoviridae family, including ST64T and ST104. The DNA of UAB_Phi78 contained 44,110 bp including direct terminal repeats of 179 bp and 58 putative ORFs were predicted and 20 were assigned function. This bacteriophage was assigned to the SP6likeviruses genus of the Podoviridae family based on its high similarity not only with SP6 but also with the K1-5, K1E, and K1F bacteriophages, all of which infect Escherichia coli. The UAB_Phi87 genome sequence consisted of 87,669 bp with terminal direct repeats of 608 bp; although 148 ORFs were identified, putative functions could be assigned to only 29 of them. Sequence comparisons revealed the mosaic structure of UAB_Phi87 and its high similarity with bacteriophages Felix O1 and wV8 of E. coli with respect to genetic content and functional organization. Phylogenetic
Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.
2005-01-01
The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that
Salmonella Typhi genomics: envisaging the future of typhoid eradication.
Yap, Kien-Pong; Thong, Kwai Lin
2017-08-01
Next-generation whole-genome sequencing has revolutionised the study of infectious diseases in recent years. The availability of genome sequences and its understanding have transformed the field of molecular microbiology, epidemiology, infection treatments and vaccine developments. We review the key findings of the publicly accessible genomes of Salmonella enterica serovar Typhi since the first complete genome to the most recent release of thousands of Salmonella Typhi genomes, which remarkably shape the genomic research of S. Typhi and other pathogens. Important new insights acquired from the genome sequencing of S. Typhi, pertaining to genomic variations, evolution, population structure, antibiotic resistance, virulence, pathogenesis, disease surveillance/investigation and disease control are discussed. As the numbers of sequenced genomes are increasing at an unprecedented rate, fine variations in the gene pool of S. Typhi are captured in high resolution, allowing deeper understanding of the pathogen's evolutionary trends and its pathogenesis, paving the way to bringing us closer to eradication of typhoid through effective vaccine/treatment development. © 2017 John Wiley & Sons Ltd.
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Chang, Yu C; Scaria, Joy; Ibraham, Mariamma; Doiphode, Sanjay; Chang, Yung-Fu; Sultan, Ali; Mohammed, Hussni O
2016-01-01
Salmonella enterica is one of the most commonly reported causes of bacterial foodborne illness around the world. Understanding the sources of this pathogen and the associated factors that exacerbate its risk to humans will help in developing risk mitigation strategies. The genetic relatedness among Salmonella isolates recovered from human gastroenteritis cases and food animals in Qatar were investigated in the hope of shedding light on these sources, their possible transmission routes, and any associated factors. A repeat cross-sectional study was conducted in which the samples and associated data were collected from both populations (gastroenteritis cases and animals). Salmonella isolates were initially analyzed using multi-locus sequence typing (MLST) to investigate the genetic diversity and clonality. The relatedness among the isolates was assessed using the minimum spanning tree (MST). Twenty-seven different sequence types (STs) were identified in this study; among them, seven were novel, including ST1695, ST1696, ST1697, ST1698, ST1699, ST1702, and ST1703. The pattern of overall ST distribution was diverse; in particular, it was revealed that ST11 and ST19 were the most common sequence types, presenting 29.5% and 11.5% within the whole population. In addition, 20 eBurst Groups (eBGs) were identified in our data, which indicates that ST11 and ST19 belonged to eBG4 and eBG1, respectively. In addition, the potential association between the putative risk factors and eBGs were evaluated. There was no significant clustering of these eBGs by season; however, a significant association was identified in terms of nationality in that Qataris were six times more likely to present with eBG1 compared to non-Qataris. In the MST analysis, four major clusters were presented, namely, ST11, ST19, ST16, and ST31. The linkages between the clusters alluded to a possible transmission route. The results of the study have provided insight into the ST distributions of S. enterica and
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Silva, Claudia; Calva, Edmundo; Calva, Juan J; Wiesner, Magdalena; Fernández-Mora, Marcos; Puente, José L; Vinuesa, Pablo
2015-11-12
Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 was isolated in Mexico City, Mexico, from a patient with a systemic infection, and its complete genome sequence was determined using PacBio single-molecule real-time technology. Strain 33676 harbors an IncF plasmid carrying the extended-spectrum cephalosporin gene blaCMY-2 and a multidrug resistance IncA/C plasmid. Copyright © 2015 Silva et al.
DEFF Research Database (Denmark)
Defoor, Els Marie Celine; Martinussen, Jan
A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
Paixão, Tatiane A; Coura, Fernanda M; Malta, Marcelo C C; Tinoco, Herlandes P; Pessanha, Angela T; Pereira, Felipe L; Leal, Carlos A G; Heinemann, Marcos B; Figueiredo, Henrique C P; Santos, Renato L
2016-01-21
The draft genome sequences of two Salmonella enterica serotype Infantis isolates are reported here. One of the strains was isolated from a western lowland gorilla (Gorilla gorilla gorilla) with colitis. The second strain was isolated from a reptile that inhabited the same premises. Whole-genome sequencing demonstrated that these isolates were not clonal. Copyright © 2016 Paixão et al.
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Somsri Wiwanitkit; Viroj Wiwanitkit
2016-01-01
Salmonella infection can cause four predominant clinical syndromes: enteric fever, acute gastroenteritis, bacteraemia with or without metastatic infection, and the asymptomatic carrier state. Salmonella as an aetiological agent in osteomyelitis is essentially rare and salmonella osteomyelitis in itself is predominantly seen in patients with haemoglobinopathies such as sickle cell disease or thalassemia. There are very few cases reported in the literature in which salmonella osteomyelitis is s...
The invasome of Salmonella Dublin as revealed by whole genome sequencing
DEFF Research Database (Denmark)
Mohammed, Manal; Le Hello, Simon; Leekitcharoenphon, Pimlapas
2017-01-01
Salmonella enterica serovar Dublin is a zoonotic infection that can be transmitted from cattle to humans through consumption of contaminated milk and milk products. Outbreaks of human infections by S. Dublin have been reported in several countries including high-income countries. A high proportio...
Whole Genome Sequence Analysis of Salmonella Enteritidis Isolated from Wild Mice
Salmonella Enteritidis is a foodborne pathogen of global concern because of the high frequency isolated from foods and patients. Draft genomes of 64 S. Enteritidis strains from intestines and spleens of mice were reported. The availability of these genomes provides useful information on genomic dive...
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Is the Evolution of Salmonella enterica subsp. enterica Linked to Restriction-Modification Systems?
DEFF Research Database (Denmark)
Roer, Louise; Hendriksen, Rene S.; Leekitcharoenphon, Pimlapas
2016-01-01
Salmonella enterica subsp. enterica bacteria are highly diverse foodborne pathogens that are subdivided into more than 1,500 serovars. The diversity is believed to result from mutational evolution, as well as intra- and interspecies recombination that potentially could be influenced by restriction...... to the conjugational mode of horizontal gene transfer in Salmonella. Thus, we conclude that other factors must be involved in shaping the evolution of bacteria.......-modification (RM) systems. The aim of this study was to investigate whether RM systems were linked to the evolution of Salmonella enterica subsp. enterica. The study included 221 Salmonella enterica genomes, of which 68 were de novo sequenced and 153 were public available genomes from ENA. The data set covered 97...
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
Psoralen photomutagenic specificity in Salmonella typhimurium
International Nuclear Information System (INIS)
Koch, W.H.
1986-01-01
The cytotoxic and mutagenic specificity of two therapeutically employed psoralens was examined in several Ames Salmonella typhimurium strains with near ultraviolet light activation. Photomutagenic activity of 8-methoxypsoralen (8MOP) and 4,5',8-trimethylpsoralen (TMP) was found to be sequence-specific, and additionally was dependent on the level of DNA-repair proficiency. Phototoxicity was essentially identical in hisC3076, hisD3052 and hisG46 strains; uvrB - excision-repair-deficient bacteria were considerably more susceptible to lethal effects than wild-type parental strains. Finally, the data show that psoralens are potent frameshift photomutagens in Salmonella hisC3076 strains and demonstrate the potential utility of these strains in evaluating photomutagenic and phototoxic activity of new furocoumarin derivatives. (Auth.)
Mukhopadhyaya, R; Sadaie, M R
1993-02-01
Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M; Branger, Christine G; Tinge, Steven A; Curtiss, Roy
2010-06-01
A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal DeltaasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain chi9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/P(cro)) (P(R)), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC P(BAD) c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of beta-lactamase, and cloned into pYA4534 under the control of the P(trc) promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain chi9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M.; Branger, Christine G.; Tinge, Steven A.; Curtiss, Roy
2010-01-01
A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal ΔasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain χ9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/Pcro) (PR), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC PBAD c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of β-lactamase, and cloned into pYA4534 under the control of the Ptrc promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain χ9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route. PMID:20308296
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
DEFF Research Database (Denmark)
Löfström, Charlotta; Hansen, Trine; Maurischat, Sven
2015-01-01
Salmonella remains one of the most important zoonotic pathogenic bacteria and is the causative agents of salmonellosis. The aim of this article is to give an overview of Salmonella and salmonellosis, starting by describing the characteristics of the microorganism Salmonella, including biochemical...
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Directory of Open Access Journals (Sweden)
Wilson Ray
2011-11-01
Full Text Available Abstract Background Whole genome sequencing of bacteriophages suitable for biocontrol of pathogens in food products is a pre-requisite to any phage-based intervention procedure. Trials involving the biosanitization of Salmonella Typhimurium in the pig production environment identified one such candidate, ΦSH19. Results This phage was sequenced and analysis of its 157,785 bp circular dsDNA genome revealed a number of interesting features. ΦSH19 constitutes another member of the recently-proposed Myoviridae Vi01-like family of phages, containing S. Typhi-specific Vi01 and Shigella-specific SboM-AG3. At the nucleotide level ΦSH19 is highly similar to phage Vi01 (80-98% pairwise identity over the length of the genome, with the major differences lying in the region associated with host-range determination. Analyses of the proteins encoded within this region by ΦSH19 revealed a cluster of three putative tail spikes. Of the three tail spikes, two have protein domains associated with the pectate lyase family of proteins (Tsp2 and P22 tail spike family (Tsp3 with the prospect that these enable Salmonella O antigen degradation. Tail spike proteins of Vi01 and SboM-AG3 are predicted to contain conserved right-handed parallel β-helical structures but the internal protein domains are varied allowing different host specificities. Conclusions The addition or exchange of tail spike protein modules is a major contributor to host range determination in the Vi01-like phage family.
US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
A Perspective on Invasive Salmonella Disease in Africa.
Crump, John A; Heyderman, Robert S
2015-11-01
Salmonella enterica is a leading cause of community-acquired bloodstream infection in Africa. The contribution of typhoidal and nontyphoidal Salmonella serovars to invasive disease varies considerably in place and time, even within the same country. Nonetheless, many African countries are now thought to experience typhoid fever incidence >100 per 100,000 per year with approximately 1% of patients dying. Invasive nontyphoidal Salmonella (iNTS) disease was estimated to cause 3.4 million illnesses and 681 316 deaths in 2010, with the most disease in Africa. Antimicrobial drug resistance is a growing problem in S. enterica that threatens to further compromise patient outcomes. Reservoirs for nontyphoidal Salmonella and the predominant routes of transmission for typhoidal and nontyphoidal Salmonella are not well understood in Africa, hampering the design of evidence-based, non-vaccine- and vaccine-based prevention measures. It is difficult to distinguish clinically invasive Salmonella disease from febrile illnesses caused by other pathogens. Blood cultures are the mainstay of laboratory diagnosis, but lack sensitivity due to the low magnitude of bacteremia, do not produce results at point of care, and are not widely available in Africa. Serologic approaches to diagnosis remain inaccurate, and nucleic acid amplification tests are also compromised by low concentrations of bacteria. High-throughput whole-genome sequencing, together with a range of novel analytic pipelines, has provided new insights into the complex pattern of epidemiology, pathogenesis, and host adaptation. Concerted efforts are therefore needed to apply these new tools in the context of high-quality field surveillance to improve diagnosis, patient management, control, and prevention of invasive Salmonella infections in Africa. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
DEFF Research Database (Denmark)
Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili
2013-01-01
In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...
High-Resolution Microbiome Profiling for Detection and Tracking of Salmonella enterica
Directory of Open Access Journals (Sweden)
Christopher J. Grim
2017-08-01
Full Text Available 16S rRNA community profiling continues to be a useful tool to study microbiome composition and dynamics, in part due to advances in next generation sequencing technology that translate into reductions in cost. Reliable taxonomic identification to the species-level, however, remains difficult, especially for short-read sequencing platforms, due to incomplete coverage of the 16S rRNA gene. This is especially true for Salmonella enterica, which is often found as a low abundant member of the microbial community, and is often found in combination with several other closely related enteric species. Here, we report on the evaluation and application of Resphera Insight, an ultra-high resolution taxonomic assignment algorithm for 16S rRNA sequences to the species level. The analytical pipeline achieved 99.7% sensitivity to correctly identify S. enterica from WGS datasets extracted from the FDA GenomeTrakr Bioproject, while demonstrating 99.9% specificity over other Enterobacteriaceae members. From low-diversity and low-complexity samples, namely ice cream, the algorithm achieved 100% specificity and sensitivity for Salmonella detection. As demonstrated using cilantro and chili powder, for highly complex and diverse samples, especially those that contain closely related species, the detection threshold will likely have to be adjusted higher to account for misidentifications. We also demonstrate the utility of this approach to detect Salmonella in the clinical setting, in this case, bloodborne infections.
Applications of High Throughput Nucleotide Sequencing
DEFF Research Database (Denmark)
Waage, Johannes Eichler
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Kostas Papanotas; Petros A. Kokkinos; Panos G. Ziros; Apostolos Vantarakis
2012-01-01
The objective of this study was the application and evaluation of a loop-mediated isothermal amplification (LAMP) method for the detection of Salmonella spp. strains isolated from food samples. Salmonella specific invA gene sequences (50 strains, 15 serotypes) were amplified at 65oC in 60 min. All of the strains of Salmonella subsp. Enterica were shown to be positive using the LAMP reaction assay, whereas, all other bacteria, virus and yeasts tested in this study were negative. LAMP products ...
Directory of Open Access Journals (Sweden)
S.F. Mazhar
2014-09-01
Full Text Available Plant essential oils are natural products extracted from plants and because of their antimicrobial properties can be used as natural additives in foods. They are also useful for decontamination of food-borne pathogens and can be a safe additive in foods. The antimicrobial activities of essential oils belonging to Saturiea hortensis, Thymus vulgaris, Mentha polegium, Cuminum cyminum, Lavandula officinalis and Mentha viridis L. (spearmint were investigated at different concentrations (0.1, 0.3, 0.5, 1, 2, 5 and 10%v/v against Salmonella typhimurium, Salmonella paratyphi A and Salmonella paratyphi B by using the agar well diffusion method. Essential oils showed inhibitory effect on Salmonella spp. in the agar well diffusion assay. In addition, the capability of essential oils for decontamination of minced row beef, ground beef, minced raw chicken and minced raw fish inoculated with Salmonella spp. at 0.1 and 0.5%v/v were assessed. Reduction of the Salmonella spp. population was observed following the inoculation of the cultures with 0.1 and 0.5%v/v essential oils.
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Influence of On-farm pig Salmonella status on Salmonella Shedding at Slaughter.
Casanova-Higes, A; Andrés-Barranco, S; Mainar-Jaime, R C
2017-08-01
The risk of Salmonella shedding among pigs at slaughter with regard to their previous on-farm Salmonella status was assessed in a group of pigs from a farm from NE of Spain. A total of 202 pigs that had been serologically monitored monthly during the fattening period and from which mesenteric lymph nodes (MLN) and faecal (SFEC) samples were collected at slaughter for Salmonella isolation were included. A repeated-measures anova was used to assess the relationship between mean OD% values during the fattening period and sampling time and bacteriology on MLN and SFEC. Pigs were also grouped into four groups, that is pigs seronegative during the fattening period and Salmonella negative in MLN (group A; n = 69); pigs seronegative during the fattening period but Salmonella positive in MLN (B; n = 36); pigs seropositive at least once and Salmonella positive in MLN (C; n = 50); and pigs seropositive at least once but Salmonella negative in (D; n = 47). Pigs shedding at slaughter seroconverted much earlier and showed much higher mean OD% values than non-shedders pigs. The proportion of Salmonella shedders in groups A and D was high and similar (26.1% and 29.8%, respectively), but significantly lower than that for groups B and C. The odds of shedding Salmonella for groups B and C were 4.8 (95% CI = 1.5-15.5) and 20.9 (3.7-118) times higher, respectively, when compared to A. It was concluded that a large proportion of Salmonella seronegative pigs may shed Salmonella at slaughter, which would be likely associated to previous exposure with contaminated environments (i.e. transport and lairage). For pigs already infected at farm, the likelihood of shedding Salmonella was much higher and may depend on whether the bacterium has colonized the MLN or not. The odds of shedding Salmonella spp. were always much higher for pigs in which Salmonella was isolated from MLN. © 2016 Blackwell Verlag GmbH.
FASH: A web application for nucleotides sequence search
Directory of Open Access Journals (Sweden)
Chew Paul
2008-05-01
Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Lim, Chee Han; Voedisch, Sabrina; Wahl, Benjamin; Rouf, Syed Fazle; Geffers, Robert; Rhen, Mikael; Pabst, Oliver
2014-07-01
Vaccination represents an important instrument to control typhoid fever in humans and protects mice from lethal infection with mouse pathogenic serovars of Salmonella species. Mixed infections with tagged Salmonella can be used in combination with probabilistic models to describe the dynamics of the infection process. Here we used mixed oral infections with tagged Salmonella strains to identify bottlenecks in the infection process in naïve and vaccinated mice. We established a next generation sequencing based method to characterize the composition of tagged Salmonella strains which offers a fast and reliable method to characterise the composition of genome-tagged Salmonella strains. We show that initial colonization of Salmonella was distinguished by a non-Darwinian selection of few bacteria setting up the infection independently in gut associated lymphoid tissue and systemic compartments. Colonization of Peyer's patches fuels the sustained spread of bacteria into mesenteric lymph nodes via dendritic cells. In contrast, infection of liver and spleen originated from an independent pool of bacteria. Vaccination only moderately reduced invasion of Peyer's patches but potently uncoupled bacterial populations present in different systemic compartments. Our data indicate that vaccination differentially skews the capacity of Salmonella to colonize systemic and gut immune compartments and provide a framework for the further dissection of infection dynamics.
Directory of Open Access Journals (Sweden)
Chee Han Lim
2014-07-01
Full Text Available Vaccination represents an important instrument to control typhoid fever in humans and protects mice from lethal infection with mouse pathogenic serovars of Salmonella species. Mixed infections with tagged Salmonella can be used in combination with probabilistic models to describe the dynamics of the infection process. Here we used mixed oral infections with tagged Salmonella strains to identify bottlenecks in the infection process in naïve and vaccinated mice. We established a next generation sequencing based method to characterize the composition of tagged Salmonella strains which offers a fast and reliable method to characterise the composition of genome-tagged Salmonella strains. We show that initial colonization of Salmonella was distinguished by a non-Darwinian selection of few bacteria setting up the infection independently in gut associated lymphoid tissue and systemic compartments. Colonization of Peyer's patches fuels the sustained spread of bacteria into mesenteric lymph nodes via dendritic cells. In contrast, infection of liver and spleen originated from an independent pool of bacteria. Vaccination only moderately reduced invasion of Peyer's patches but potently uncoupled bacterial populations present in different systemic compartments. Our data indicate that vaccination differentially skews the capacity of Salmonella to colonize systemic and gut immune compartments and provide a framework for the further dissection of infection dynamics.
Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea
Directory of Open Access Journals (Sweden)
Ji-Sun Park
2015-01-01
Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.
Eleventh CRL-Salmonella interlaboratory comparison study on typing of Salmonella spp.
Berk PA; Maas HME; de Pinna E; Mooijman KA; MGB
2006-01-01
Het elfde ringonderzoek voor de typering van Salmonella werd in maart 2006 georganiseerd door het Communautair Referentie Laboratorium voor Salmonella (CRL-Salmonella, Bilthoven, Nederland) in samenwerking met de Health Protection Agency (HPA, Londen, Verenigd Koninkrijk). 26 Nationale Referentie
Tenth CRL-Salmonella interlaboratory comparison study on typing of Salmonella spp.
Korver H; Maas HME; Ward LR; Mevius DJ; Mooijman KA; MGB
2006-01-01
Het tiende ringonderzoek voor de typering van Salmonella werd in maart 2005 georganiseerd door het Communautair Referentie Laboratorium voor Salmonella (CRL-Salmonella, Bilthoven, Nederland) in samenwerking met de Health Protection Agency (HPA, Londen, Verenigd Koninkrijk) en het Centraal Instituut
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Thompson, C K; Wang, Q; Bag, S K; Franklin, N; Shadbolt, C T; Howard, P; Fearnley, E J; Quinn, H E; Sintchenko, V; Hope, K G
2017-07-01
During May 2015, an increase in Salmonella Agona cases was reported from western Sydney, Australia. We examine the public health actions used to investigate and control this increase. A descriptive case-series investigation was conducted. Six outbreak cases were identified; all had consumed cooked tuna sushi rolls purchased within a western Sydney shopping complex. Onset of illness for outbreak cases occurred between 7 April and 24 May 2015. Salmonella was isolated from food samples collected from the implicated premise and a prohibition order issued. No further cases were identified following this action. Whole genome sequence (WGS) analysis was performed on isolates recovered during this investigation, with additional S. Agona isolates from sporadic-clinical cases and routine food sampling in New South Wales, January to July 2015. Clinical isolates of outbreak cases were indistinguishable from food isolates collected from the implicated sushi outlet. Five additional clinical isolates not originally considered to be linked to the outbreak were genomically similar to outbreak isolates, indicating the point-source contamination may have started before routine surveillance identified an increase. This investigation demonstrated the value of genomics-guided public health action, where near real-time WGS enhanced the resolution of the epidemiological investigation.
Directory of Open Access Journals (Sweden)
White Brian
2009-01-01
Full Text Available Abstract Background Of the > 2000 serovars of Salmonella enterica subspecies I, most cause self-limiting gastrointestinal disease in a wide range of mammalian hosts. However, S. enterica serovars Typhi and Paratyphi A are restricted to the human host and cause the similar systemic diseases typhoid and paratyphoid fever. Genome sequence similarity between Paratyphi A and Typhi has been attributed to convergent evolution via relatively recent recombination of a quarter of their genomes. The accumulation of pseudogenes is a key feature of these and other host-adapted pathogens, and overlapping pseudogene complements are evident in Paratyphi A and Typhi. Results We report the 4.5 Mbp genome of a clinical isolate of Paratyphi A, strain AKU_12601, completely sequenced using capillary techniques and subsequently checked using Illumina/Solexa resequencing. Comparison with the published genome of Paratyphi A ATCC9150 revealed the two are collinear and highly similar, with 188 single nucleotide polymorphisms and 39 insertions/deletions. A comparative analysis of pseudogene complements of these and two finished Typhi genomes (CT18, Ty2 identified several pseudogenes that had been overlooked in prior genome annotations of one or both serovars, and identified 66 pseudogenes shared between serovars. By determining whether each shared and serovar-specific pseudogene had been recombined between Paratyphi A and Typhi, we found evidence that most pseudogenes have accumulated after the recombination between serovars. We also divided pseudogenes into relative-time groups: ancestral pseudogenes inherited from a common ancestor, pseudogenes recombined between serovars which likely arose between initial divergence and later recombination, serovar-specific pseudogenes arising after recombination but prior to the last evolutionary bottlenecks in each population, and more recent strain-specific pseudogenes. Conclusion Recombination and pseudogene-formation have been
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
Park, J-H; Kim, H-S; Yim, J-H; Kim, Y-J; Kim, D-H; Chon, J-W; Kim, H; Om, A-S; Seo, K-H
2017-08-01
Salmonella contamination in chicken samples can cause major health problems in humans. However, not only the effects of antibiotic treatment during growth but also the impacts of the poultry slaughter line on the prevalence of Salmonellae in final chicken meat sold to consumers are unknown. In this study, we compared the isolation rates and antimicrobial resistance of Salmonellae among antibiotic-free, conventional, conventional Korean native retail chicken meat samples, and clonal divergence of Salmonella isolates by multilocus sequence typing. In addition, the distribution of extended-spectrum β-lactamase (ESBL) genes in ESBL-producing Salmonella isolates was analyzed. A total of 72 retail chicken meat samples (n = 24 antibiotic-free broiler [AFB] chickens, n = 24 conventional broiler [CB] chickens, and n = 24 conventional Korean native [CK] chickens) was collected from local retail markets in Seoul, South Korea. The isolation rates of Salmonellae were 66.6% in AFB chickens, 45.8% in CB chickens, and 25% in CK chickens. By analyzing the minimum inhibitory concentrations of β-lactam antibiotics with the disc-diffusion test, we found that 81.2% of Salmonella isolates from AFB chickens, 63.6% of isolates from CB chickens, and 50% of isolates from CK chickens were ESBL producers; all ESBL-positive isolates had the CTX-M-15 genotype. Interestingly, all ESBL-producing Salmonellae were revealed as ST16 by multilocus sequence typing and had the genetic platform of blaCTX-M gene (IS26-ISEcp1-blaCTX-M-15-IS903), which was first reported in Salmonellae around the world. The Salmonella ST33 strain (S. Hadar) isolated in this study has never been reported in South Korea. In conclusion, our findings showed that antibiotic-free retail chicken meat products were also largely contaminated with ESBL-producing Salmonellae and that their ESBL genes and genetic platforms were the same as those isolated from conventional retail chicken meat products. © 2017 Poultry Science
Directory of Open Access Journals (Sweden)
Jorge Hernández
2012-08-01
Full Text Available A novel Salmonella serovar was isolated from Peregrine falcon (Falco peregrinus nestlings in northern Sweden in 2006. Three isolates of the same clone was retrieved from three falcon siblings and characterized as Salmonella enterica sub-species enterica: O-phase 13, 23:-: e, n, z 15 and the H-phase was not present. We propose the geographical name Salmonella enterica, sub-species enterica serovar Pajala to this novel Salmonella.
Miao, Zengmin; Li, Song; Qin, Kun; Zhou, Yufa
2017-10-01
The current study was undertaken to evaluate Salmonella contamination in retail pork at major village markets of the Tai'an region, China. In total, 200 retail pork samples were collected from four village markets between June 2015 and February 2016, of which 69 samples (34.5%) were determined to be positive for Salmonella. Eleven serotypes were identified from the 69 Salmonella isolates, and Salmonella Derby was the most common (18 of 69, 26.1%), followed by Typhimurium (17 of 69, 24.6%) and Meleagridis (11 of 69, 15.9%). Antimicrobial susceptibility testing showed that antimicrobial resistance against tetracycline was the most prevalent (42 of 69, 60.9%), but antimicrobial resistance against both ceftriaxone and cefotaxime was 1.4% (1 of 69) and 2.9% (2 of 69), respectively. Multilocus sequence typing revealed that the 69 Salmonella isolates were divided into 11 sequence types (STs), among which ST40 (18 of 69, 26.1%) was the most common, followed by ST34 (15 of 69, 21.7%) and ST64 (13 of 69, 18.8%). Collectively, retail pork at village markets in the Tai'an region has a high Salmonella contamination rate, and these isolates exhibit broad-spectrum antimicrobial resistance. However, the absence of a dominant ST demonstrates that the Salmonella isolates from retail pork may be of diverse origins.
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
Jaschob, Daniel; Davis, Trisha N; Riffle, Michael
2015-03-07
Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sasías, Sebastián; Martínez-Sanguiné, Adriana; Betancor, Laura; Martínez, Arací; D'Alessandro, Bruno; Iriarte, Andrés; Chabalgoity, José A; Yim, Lucía
2018-01-01
Salmonella enterica serovar Dublin is adapted to cattle but is able to infect humans with high invasiveness. An acute inflammatory response at the intestine helps to prevent Salmonella dissemination to systemic sites. Flagella contribute to this response by providing motility and FliC-mediated signaling through pattern recognition receptors. In a previous work, we reported a high frequency (11 out of 25) of S Dublin isolates lacking flagella in a collection obtained from humans and cattle. The aflagellate strains were impaired in their proinflammatory properties in vitro and in vivo The aim of this work was to elucidate the underlying cause of the absence of flagella in S Dublin isolates. We report here that class 3 flagellar genes are repressed in the human aflagellate isolates, due to impaired secretion of FliA anti-sigma factor FlgM. This phenotype is due to an in-frame 42-nucleotide deletion in the fliE gene, which codes for a protein located in the flagellar basal body. The deletion is predicted to produce a protein lacking amino acids 18 to 31. The aflagellate phenotype was highly stable; revertants were obtained only when fliA was artificially overexpressed combined with several successive passages in motility agar. DNA sequence analysis revealed that motile revertants resulted from duplications of DNA sequences in fliE adjacent to the deleted region. These duplications produced a FliE protein of similar length to the wild type and demonstrate that amino acids 18 to 31 of FliE are not essential. The same deletion was detected in S Dublin isolates obtained from cattle, indicating that this mutation circulates in nature. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Li Xuehui
2012-10-01
Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
White, David G.; Zhao, Shaohua; McDermott, Patrick F.; Ayers, Sherry; Friedman, Sharon; Sherwood, Julie; Breider-Foley, Missy; Nolan, Lisa K.
2003-01-01
Forty-two Salmonella isolates obtained from diseased swine were genetically characterized for the presence of specific antimicrobial resistance mechanisms. Twenty of these isolates were characterized as S. Typhimurium DT104 strains. Pulsed-field gel electrophoresis was used to determine genetic relatedness and revealed 20 distinct genetic patterns among the 42 isolates. However, all DT104 isolates fell within 2 closely related genetic clusters. Other Salmonella isolates were genetically grouped together according to serotype. All DT104 isolates displayed the penta-resistance phenotype to ampicillin, chloramphenicol, streptomycin, sulfamethoxazole, and tetracycline. Resistance to sulfamethoxazole, tetracycline, streptomycin, kanamycin, and ampicillin was most common among the non-DT104 Salmonella isolates. All DT104 strains contained 2 chromosomal integrons of 1000 and 1200 base pairs. The DNA sequencing revealed that the 2 integrons contained genes encoding a resistance to streptomycin and ampicillin, respectively. None of the non-DT104 strains showed the same pattern, although several strains possessed integrons of 1000 base pairs or larger. However, the majority of non-DT104 Salmonella strains did not possess any integrons. Two Salmonella isolates displayed tolerance to the organic solvent cyclohexane, indicating the possibility that they are overexpressing chromosomal regulatory genes marA or soxS or the associated multidrug efflux pump, acrAB. This research suggests that integrons contribute to antimicrobial resistance among specific swine Salmonella serotypes; however, they are not as widely disseminated among non-Typhimurium swine Salmonella serotypes as previously thought. PMID:12528827
New paradigms for Salmonella source attribution based on microbial subtyping.
Mughini-Gras, Lapo; Franz, Eelco; van Pelt, Wilfrid
2018-05-01
Microbial subtyping is the most common approach for Salmonella source attribution. Typically, attributions are computed using frequency-matching models like the Dutch and Danish models based on phenotyping data (serotyping, phage-typing, and antimicrobial resistance profiling). Herewith, we critically review three major paradigms facing Salmonella source attribution today: (i) the use of genotyping data, particularly Multi-Locus Variable Number of Tandem Repeats Analysis (MLVA), which is replacing traditional Salmonella phenotyping beyond serotyping; (ii) the integration of case-control data into source attribution to improve risk factor identification/characterization; (iii) the investigation of non-food sources, as attributions tend to focus on foods of animal origin only. Population genetics models or simplified MLVA schemes may provide feasible options for source attribution, although there is a strong need to explore novel modelling options as we move towards whole-genome sequencing as the standard. Classical case-control studies are enhanced by incorporating source attribution results, as individuals acquiring salmonellosis from different sources have different associated risk factors. Thus, the more such analyses are performed the better Salmonella epidemiology will be understood. Reparametrizing current models allows for inclusion of sources like reptiles, the study of which improves our understanding of Salmonella epidemiology beyond food to tackle the pathogen in a more holistic way. Copyright © 2017 Elsevier Ltd. All rights reserved.
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Buhr, R J; Bourassa, D V; Hinton, A; Fairchild, B D; Ritz, C W
2017-12-01
Research was conducted to evaluate the impact of litter Salmonella status during feed withdrawal on Salmonella recovery from the crop and ceca following feed withdrawal. In 4 experiments, pens of broilers in separate rooms were challenged with marker strains of either Salmonella Montevideo or Salmonella Heidelberg. Three d post challenge, a 12-hour feed withdrawal was initiated, and one pen of broilers was switched between rooms for each Salmonella serotype. In experiments 3 and 4, non-challenged broilers also were added to the Salmonella challenge pens. The litter of each pen was sampled before and after the feed withdrawal period, the broilers euthanized, and the crop and ceca aseptically removed for Salmonella isolation. Results showed that only the challenge Salmonella serotype was recovered from the litter in challenge pens where broilers were not moved, while both Salmonella serotypes were recovered from the litter of the switched pens. Salmonella was recovered from 56/80 crops and from 66/80 ceca of challenged broilers that remained in the challenge pens. The challenge Salmonella serotype was recovered from 50/80 crops and from 60/80 ceca, and the switched pens' litter Salmonella serotype was recovered from 19/80 crops but not from the ceca in broilers challenged with Salmonella and then switched between pens. For experiments 3 and 4, Salmonella was recovered from 19/40 crops and from only 2/40 ceca from the non-challenged broilers placed into the Salmonella challenge pens. The results from broilers that were switched between Salmonella challenge pens indicate that the recovery of Salmonella from the crop of broilers following feed withdrawal (on Salmonella-contaminated litter) appears to depend mainly on the initial challenge Salmonella (62%) and less on the litter Salmonella (24%) status during the feed withdrawal period. In contrast, only the initial challenge Salmonella was recovered from the ceca (79%) from broilers that remained in challenge pens or
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Lack of the PGA exopolysaccharide in Salmonella as an adaptive trait for survival in the host.
Directory of Open Access Journals (Sweden)
Maite Echeverz
2017-05-01
Full Text Available Many bacteria build biofilm matrices using a conserved exopolysaccharide named PGA or PNAG (poly-β-1,6-N-acetyl-D-glucosamine. Interestingly, while E. coli and other members of the family Enterobacteriaceae encode the pgaABCD operon responsible for PGA synthesis, Salmonella lacks it. The evolutionary force driving this difference remains to be determined. Here, we report that Salmonella lost the pgaABCD operon after the divergence of Salmonella and Citrobacter clades, and previous to the diversification of the currently sequenced Salmonella strains. Reconstitution of the PGA machinery endows Salmonella with the capacity to produce PGA in a cyclic dimeric GMP (c-di-GMP dependent manner. Outside the host, the PGA polysaccharide does not seem to provide any significant benefit to Salmonella: resistance against chlorine treatment, ultraviolet light irradiation, heavy metal stress and phage infection remained the same as in a strain producing cellulose, the main biofilm exopolysaccharide naturally produced by Salmonella. In contrast, PGA production proved to be deleterious to Salmonella survival inside the host, since it increased susceptibility to bile salts and oxidative stress, and hindered the capacity of S. Enteritidis to survive inside macrophages and to colonize extraintestinal organs, including the gallbladder. Altogether, our observations indicate that PGA is an antivirulence factor whose loss may have been a necessary event during Salmonella speciation to permit survival inside the host.
Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J
1989-12-21
The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Directory of Open Access Journals (Sweden)
Marcos César Lima de Mendonça
2011-06-01
Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.
Directory of Open Access Journals (Sweden)
Alban eRamette
2014-11-01
Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.
Directory of Open Access Journals (Sweden)
Allard Marc W
2012-01-01
Full Text Available Abstract Background Next-Generation Sequencing (NGS is increasingly being used as a molecular epidemiologic tool for discerning ancestry and traceback of the most complicated, difficult to resolve bacterial pathogens. Making a linkage between possible food sources and clinical isolates requires distinguishing the suspected pathogen from an environmental background and placing the variation observed into the wider context of variation occurring within a serovar and among other closely related foodborne pathogens. Equally important is the need to validate these high resolution molecular tools for use in molecular epidemiologic traceback. Such efforts include the examination of strain cluster stability as well as the cumulative genetic effects of sub-culturing on these clusters. Numerous isolates of S. Montevideo were shot-gun sequenced including diverse lineage representatives as well as numerous replicate clones to determine how much variability is due to bias, sequencing error, and or the culturing of isolates. All new draft genomes were compared to 34 S. Montevideo isolates previously published during an NGS-based molecular epidemiological case study. Results Intraserovar lineages of S. Montevideo differ by thousands of SNPs, that are only slightly less than the number of SNPs observed between S. Montevideo and other distinct serovars. Much less variability was discovered within an individual S. Montevideo clade implicated in a recent foodborne outbreak as well as among individual NGS replicates. These findings were similar to previous reports documenting homopolymeric and deletion error rates with the Roche 454 GS Titanium technology. In no case, however, did variability associated with sequencing methods or sample preparations create inconsistencies with our current phylogenetic results or the subsequent molecular epidemiological evidence gleaned from these data. Conclusions Implementation of a validated pipeline for NGS data acquisition and
Muyyarikkandy, Muhammed Shafeekh; Amalaradjou, Mary Anne
2017-11-09
Salmonella Enteritidis (SE), Salmonella Typhimurium (ST), and Salmonella Heidelberg (SH) have been responsible for numerous outbreaks associated with the consumption of poultry meat and eggs. Salmonella colonization in chicken is characterized by initial attachment to the cecal epithelial cells (CEC) followed by dissemination to the liver, spleen, and oviduct. Since cecal colonization is critical to Salmonella transmission along the food chain continuum, reducing this intestinal association could potentially decrease poultry meat and egg contamination. Hence, this study investigated the efficacy of Lactobacillus delbreuckii sub species bulgaricus (NRRL B548; LD), Lactobacillus paracasei (DUP-13076; LP), and Lactobacillus rhamnosus (NRRL B442; LR) in reducing SE, ST, and SH colonization in CEC and survival in chicken macrophages. Additionally, their effect on expression of Salmonella virulence genes essential for cecal colonization and survival in macrophages was evaluated. All three probiotics significantly reduced Salmonella adhesion and invasion in CEC and survival in chicken macrophages ( p < 0.05). Further, the probiotic treatment led to a significant reduction in Salmonella virulence gene expression ( p < 0.05). Results of the study indicate that LD, LP, and LR could potentially be used to control SE, ST, and SH colonization in chicken. However, these observations warrant further in vivo validation.
Directory of Open Access Journals (Sweden)
Muhammed Shafeekh Muyyarikkandy
2017-11-01
Full Text Available Salmonella Enteritidis (SE, Salmonella Typhimurium (ST, and Salmonella Heidelberg (SH have been responsible for numerous outbreaks associated with the consumption of poultry meat and eggs. Salmonella colonization in chicken is characterized by initial attachment to the cecal epithelial cells (CEC followed by dissemination to the liver, spleen, and oviduct. Since cecal colonization is critical to Salmonella transmission along the food chain continuum, reducing this intestinal association could potentially decrease poultry meat and egg contamination. Hence, this study investigated the efficacy of Lactobacillus delbreuckii sub species bulgaricus (NRRL B548; LD, Lactobacillus paracasei (DUP-13076; LP, and Lactobacillus rhamnosus (NRRL B442; LR in reducing SE, ST, and SH colonization in CEC and survival in chicken macrophages. Additionally, their effect on expression of Salmonella virulence genes essential for cecal colonization and survival in macrophages was evaluated. All three probiotics significantly reduced Salmonella adhesion and invasion in CEC and survival in chicken macrophages (p < 0.05. Further, the probiotic treatment led to a significant reduction in Salmonella virulence gene expression (p < 0.05. Results of the study indicate that LD, LP, and LR could potentially be used to control SE, ST, and SH colonization in chicken. However, these observations warrant further in vivo validation.
Directory of Open Access Journals (Sweden)
Salem Mohamed
2009-11-01
Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In
Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E
2009-11-25
To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the
Vongerichten, K F; Klein, J R; Matern, H; Plapp, R
1994-10-01
Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.
Bayesian Modeling of MPSS Data: Gene Expression Analysis of Bovine Salmonella Infection
Dhavala, Soma S.
2010-09-01
Massively Parallel Signature Sequencing (MPSS) is a high-throughput, counting-based technology available for gene expression profiling. It produces output that is similar to Serial Analysis of Gene Expression and is ideal for building complex relational databases for gene expression. Our goal is to compare the in vivo global gene expression profiles of tissues infected with different strains of Salmonella obtained using the MPSS technology. In this article, we develop an exact ANOVA type model for this count data using a zero-inflatedPoisson distribution, different from existing methods that assume continuous densities. We adopt two Bayesian hierarchical models-one parametric and the other semiparametric with a Dirichlet process prior that has the ability to "borrow strength" across related signatures, where a signature is a specific arrangement of the nucleotides, usually 16-21 base pairs long. We utilize the discreteness of Dirichlet process prior to cluster signatures that exhibit similar differential expression profiles. Tests for differential expression are carried out using nonparametric approaches, while controlling the false discovery rate. We identify several differentially expressed genes that have important biological significance and conclude with a summary of the biological discoveries. This article has supplementary materials online. © 2010 American Statistical Association.
Bayesian Modeling of MPSS Data: Gene Expression Analysis of Bovine Salmonella Infection
Dhavala, Soma S.; Datta, Sujay; Mallick, Bani K.; Carroll, Raymond J.; Khare, Sangeeta; Lawhon, Sara D.; Adams, L. Garry
2010-01-01
Massively Parallel Signature Sequencing (MPSS) is a high-throughput, counting-based technology available for gene expression profiling. It produces output that is similar to Serial Analysis of Gene Expression and is ideal for building complex relational databases for gene expression. Our goal is to compare the in vivo global gene expression profiles of tissues infected with different strains of Salmonella obtained using the MPSS technology. In this article, we develop an exact ANOVA type model for this count data using a zero-inflatedPoisson distribution, different from existing methods that assume continuous densities. We adopt two Bayesian hierarchical models-one parametric and the other semiparametric with a Dirichlet process prior that has the ability to "borrow strength" across related signatures, where a signature is a specific arrangement of the nucleotides, usually 16-21 base pairs long. We utilize the discreteness of Dirichlet process prior to cluster signatures that exhibit similar differential expression profiles. Tests for differential expression are carried out using nonparametric approaches, while controlling the false discovery rate. We identify several differentially expressed genes that have important biological significance and conclude with a summary of the biological discoveries. This article has supplementary materials online. © 2010 American Statistical Association.
Ulcerative Colitis and Its Association with Salmonella Species
Directory of Open Access Journals (Sweden)
Manish Kumar Tripathi
2016-01-01
Full Text Available Ulcerative colitis (UC is characterized by presence of ulcer in colon and bloody diarrhea. The present study explores the possibility of association between Salmonella and ulcerative colitis. The present study comprised 59 cases of UC, 28 of colon cancer (CC, 127 of irritable bowel syndrome (IBS, and 190 of healthy control. The serological study was done by Widal and Indirect Haemagglutination Assay (IHA for ViAb. Nested PCR was performed targeting fliC, staA, and stkG gene for Typhi and Paratyphi A, respectively. A total of 15.3% patients were positive for Salmonella “O” antigen among them 18.6% UC, 35.5% CC, 12.6% IBS, and 15.3% healthy control. A total of 36.9% patients were positive for “H” antigen including 39.0%, 57.1%, and 67.7% UC, CC, and IBS, respectively. About 1.73% show positive agglutination for AH antigen including 3.4%, 3.6%, and 1.6%, UC, CC, and IBS. A total of 10.89% were positive for ViAb. While 6.8% of UC, 10.7% of CC, 11.0% of IBS, and 12.1% of healthy subjects were positive for the antibody, the PCR positivity rates for Salmonella specific sequences were 79.7% in UC, 53.6% in CC, 66.1% in IBS, and 16.3% in healthy controls. The present study suggested that higher prevalence of Salmonella might play important role in etiopathogenesis of UC, IBS, and CC.
Salmonella risk to consumers via pork is related to the Salmonella prevalence in pig feed.
Rönnqvist, M; Välttilä, V; Ranta, J; Tuominen, P
2018-05-01
Pigs are an important source of human infections with Salmonella, one of the most common causes of sporadic gastrointestinal infections and foodborne outbreaks in the European region. Feed has been estimated to be a significant source of Salmonella in piggeries in countries of a low Salmonella prevalence. To estimate Salmonella risk to consumers via the pork production chain, including feed production, a quantitative risk assessment model was constructed. The Salmonella prevalence in feeds and in animals was estimated to be generally low in Finland, but the relative importance of feed as a source of Salmonella in pigs was estimated as potentially high. Discontinuation of the present strict Salmonella control could increase the risk of Salmonella in slaughter pigs and consequent infections in consumers. The increased use of low risk and controlled feed ingredients could result in a consistently lower residual contamination in pigs and help the tracing and control of the sources of infections. Copyright © 2017 Elsevier Ltd. All rights reserved.
Reimschuessel, Renate; Grabenstein, Michael; Guag, Jake; Nemser, Sarah M; Song, Kyunghee; Qiu, Junshan; Clothier, Kristin A; Byrne, Barbara A; Marks, Stanley L; Cadmus, Kyran; Pabilonia, Kristy; Sanchez, Susan; Rajeev, Sreekumari; Ensley, Steve; Frana, Timothy S; Jergens, Albert E; Chappell, Kimberly H; Thakur, Siddhartha; Byrum, Beverly; Cui, Jing; Zhang, Yan; Erdman, Matthew M; Rankin, Shelley C; Daly, Russell; Das, Seema; Ruesch, Laura; Lawhon, Sara D; Zhang, Shuping; Baszler, Timothy; Diaz-Campos, Dubraska; Hartmann, Faye; Okwumabua, Ogi
2017-05-01
Eleven laboratories collaborated to determine the periodic prevalence of Salmonella in a population of dogs and cats in the United States visiting veterinary clinics. Fecal samples (2,965) solicited from 11 geographically dispersed veterinary testing laboratories were collected in 36 states between January 2012 and April 2014 and tested using a harmonized method. The overall study prevalence of Salmonella in cats (3 of 542) was Salmonella -positive dogs were significantly more likely to have consumed raw food ( P = 0.01), to have consumed probiotics ( P = 0.002), or to have been given antibiotics ( P = 0.01). Rural dogs were also more likely to be Salmonella positive than urban ( P = 0.002) or suburban ( P = 0.001) dogs. In the 67 isolates, 27 unique serovars were identified, with three dogs having two serovars present. Antimicrobial susceptibility testing of 66 isolates revealed that only four of the isolates were resistant to one or more antibiotics. Additional characterization of the 66 isolates was done using pulsed-field gel electrophoresis and whole-genome sequencing (WGS). Sequence data compared well to resistance phenotypic data and were submitted to the National Center for Biotechnology Information (NCBI). This study suggests an overall decline in prevalence of Salmonella -positive dogs and cats over the last decades and identifies consumption of raw food as a major risk factor for Salmonella infection. Of note is that almost half of the Salmonella -positive animals were clinically nondiarrheic. Copyright © 2017 Reimschuessel et al.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
2013-07-16
...] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... the withdrawal of the compliance policy guide (CPG) entitled ``Sec. 690.700 Salmonella Contamination... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Castelijn, G.A.A.
2013-01-01
Biofilm formation by Salmonellaspp. is a problem in the food industry, since biofilms may act as a persistent source of product contamination. Therefore the aim of this study was to obtain more insight in the processes involved and the factors contributing to Salmonellabiofilm
Sabag-Daigle, Anice; Blunk, Henry M.; Gonzalez, Juan F.; Steidley, Brandi L.; Boyaka, Prosper N.
2016-01-01
Salmonella enterica is among the most burdensome of foodborne disease agents. There are over 2,600 serovars that cause a range of disease manifestations ranging from enterocolitis to typhoid fever. While there are two vaccines in use in humans to protect against typhoid fever, there are none that prevent enterocolitis. If vaccines preventing enterocolitis were to be developed, they would likely protect against only one or a few serovars. In this report, we tested the hypothesis that probiotic organisms could compete for the preferred nutrient sources of Salmonella and thus prevent or treat infection. To this end, we added the fra locus, which encodes a utilization pathway for the Salmonella-specific nutrient source fructose-asparagine (F-Asn), to the probiotic bacterium Escherichia coli Nissle 1917 (Nissle) to increase its ability to compete with Salmonella in mouse models. We also tested a metabolically competent, but avirulent, Salmonella enterica serovar Typhimurium mutant for its ability to compete with wild-type Salmonella. The modified Nissle strain became more virulent and less able to protect against Salmonella in some instances. On the other hand, the modified Salmonella strain was safe and effective in preventing infection with wild-type Salmonella. While we tested for efficacy only against Salmonella Typhimurium, the modified Salmonella strain may be able to compete metabolically with most, if not all, Salmonella serovars, representing a novel approach to control of this pathogen. PMID:27185789
Davidson, Anthony C; Humphreys, Daniel; Brooks, Andrew B E; Hume, Peter J; Koronakis, Vassilis
2015-02-10
To establish intracellular infections, Salmonella bacteria trigger host cell membrane ruffling and invasion by subverting cellular Arf guanine nucleotide exchange factors (GEFs) that activate Arf1 and Arf6 GTPases by promoting GTP binding. A family of cellular Arf GTPase-activating proteins (GAPs) can downregulate Arf signaling by stimulating GTP hydrolysis, but whether they do this during infection is unknown. Here, we uncovered a remarkable role for distinct Arf GAP family members in Salmonella invasion. The Arf6 GAPs ACAP1 and ADAP1 and the Arf1 GAP ASAP1 localized at Salmonella-induced ruffles, which was not the case for the plasma membrane-localized Arf6 GAPs ARAP3 and GIT1 or the Golgi-associated Arf1 GAP1. Surprisingly, we found that loss of ACAP1, ADAP1, or ASAP1 impaired Salmonella invasion, revealing that GAPs cannot be considered mere terminators of cytoskeleton remodeling. Salmonella invasion was restored in Arf GAP-depleted cells by expressing fast-cycling Arf derivatives, demonstrating that Arf GTP/GDP cycles facilitate Salmonella invasion. Consistent with this view, both constitutively active and dominant-negative Arf derivatives that cannot undergo GTP/GDP cycles inhibited invasion. Furthermore, we demonstrated that Arf GEFs and GAPs colocalize at invading Salmonella and collaborate to drive Arf1-dependent pathogen invasion. This study revealed that Salmonella bacteria exploit a remarkable interplay between Arf GEFs and GAPs to direct cycles of Arf GTPase activation and inactivation. These cycles drive Salmonella cytoskeleton remodeling and enable intracellular infections. To initiate infections, the Salmonella bacterial pathogen remodels the mammalian actin cytoskeleton and invades host cells by subverting host Arf GEFs that activate Arf1 and Arf6 GTPases. Cellular Arf GAPs deactivate Arf GTPases and negatively regulate cell processes, but whether they target Arfs during infection is unknown. Here, we uncovered an important role for the Arf GAP
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18
DEFF Research Database (Denmark)
Parkhill, J.; Dougan, G.; James, K.D.
2001-01-01
Salmonella enterica serovar Typhi (S. typhi) is the aetiological agent of typhoid fever, a serious invasive bacterial disease of humans with an annual global burden of approximately 16 million cases, leading to 600,000 fatalities(1). Many S. enterica serovars actively invade the mucosal surface...
Global Genomic Epidemiology of Salmonella enterica Serovar Typhimurium DT104
DEFF Research Database (Denmark)
Leekitcharoenphon, Pimlapas; Hendriksen, Rene S.; Le Hello, Simon
2016-01-01
It has been 30 years since the initial emergence and subsequent rapid global spread of multidrug-resistant Salmonella enterica serovar Typhimurium DT104 (MDR DT104). Nonetheless, its origin and transmission route have never been revealed. We used whole-genome sequencing (WGS) and temporally struc...
Directory of Open Access Journals (Sweden)
Budzanivska I. G.
2014-03-01
Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.
Ricke, Steven C; Kim, Sun Ae; Shi, Zhaohao; Park, Si Hong
2018-04-19
Salmonella remains a prominent cause of foodborne illnesses and can originate from a wide range of food products. Given the continued presence of pathogenic Salmonella in food production systems, there is a consistent need to improve identification and detection methods that can identify this pathogen at all stages in food systems. Methods for subtyping have evolved over the years, and the introduction of whole genome sequencing and advancements in PCR technologies has greatly improved the resolution for differentiating strains within a particular serovar. This, in turn, has led to the continued improvement in Salmonella detection technologies for utilization in food production systems. In this review, the focus will be on recent advancements in these technologies, as well as potential issues associated with the application of these tools in food production. In addition, the recent and emerging research developments on Salmonella detection and identification methodologies and their potential application in food production systems will be discussed. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR
International Nuclear Information System (INIS)
Ben salem, Issam
2007-01-01
Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)
Prevalence of Salmonella in Australian reptiles.
Scheelings, T Franciscus; Lightfoot, Dianne; Holz, Peter
2011-01-01
From January 2007 until June 2008, 504 reptiles of four families and 57 species were examined for Salmonella by using cloacal or intestinal swabs. Salmonella was identified in 139 (28%) of the 504 animals tested. Of the 504 reptiles examined, 210 were captive and 294 were wild. Ninety-eight (47%) of the captive reptiles were shedding Salmonella at the time of sampling. In contrast, only 41 (14%) of the wild reptiles were shedding Salmonella. The higher prevalence of Salmonella in captive reptiles was statistically significant (Preptiles in Australia are not natural carriers of Salmonella and that diet and captivity may influence Salmonella excretion in other species.
Directory of Open Access Journals (Sweden)
Sandeepa M Eswarappa
Full Text Available The genus Salmonella includes many pathogens of great medical and veterinary importance. Bacteria belonging to this genus are very closely related to those belonging to the genus Escherichia. lacZYA operon and lacI are present in Escherichia coli, but not in Salmonella enterica. It has been proposed that Salmonella has lost lacZYA operon and lacI during evolution. In this study, we have investigated the physiological and evolutionary significance of the absence of lacI in Salmonella enterica. Using murine model of typhoid fever, we show that the expression of LacI causes a remarkable reduction in the virulence of Salmonella enterica. LacI also suppresses the ability of Salmonella enterica to proliferate inside murine macrophages. Microarray analysis revealed that LacI interferes with the expression of virulence genes of Salmonella pathogenicity island 2. This effect was confirmed by RT-PCR and Western blot analysis. Interestingly, we found that SBG0326 of Salmonella bongori is homologous to lacI of Escherichia coli. Salmonella bongori is the only other species of the genus Salmonella and it lacks the virulence genes of Salmonella pathogenicity island 2. Overall, our results demonstrate that LacI is an antivirulence factor of Salmonella enterica and suggest that absence of lacI has facilitated the acquisition of virulence genes of Salmonella pathogenicity island 2 in Salmonella enterica making it a successful systemic pathogen.
Gantois, Inne; Ducatelle, Richard; Timbermont, Leen; Boyen, Filip; Bohez, Lotte; Haesebrouck, Freddy; Pasmans, Frank; van Immerseel, Filip
2006-09-11
Eggs are a major source of human infections with Salmonella. Therefore controlling egg contamination in laying hen flocks is one of the main targets for control programmes. A study was carried out to assess the effect of oral vaccination with TAD Salmonella vac E, TAD Salmonella vac T and with both vaccines TAD Salmonella vac E and TAD Salmonella vac T, on colonization of the reproductive tract and internal egg contamination of laying hens with Salmonella Enteritidis. Three groups of 30 laying hens were vaccinated at 1 day, 6 weeks and 16 weeks of age with either one of the vaccine strains, or a combination of both vaccine strains, while a fourth group was left unvaccinated. At 24 weeks of age, the birds were intravenously challenged with 0.5 ml containing 5 x 10(7)cfu Salmonella Enteritidis PT4 S1400/94. The number of oviducts from which Salmonella was isolated, was significantly lower in the vaccinated than in the non-vaccinated hens at 3 weeks post-challenge. Significantly less egg contents were Salmonella positive in the birds vaccinated with TAD Salmonella vac E or TAD Salmonella vac T (12/105 batches of eggs in both groups) than in the unvaccinated birds (28/105 batches of eggs). Internal egg contamination in the hens vaccinated with both TAD Salmonella vac E and TAD Salmonella vac T was even more reduced, as over the whole experiment, only one batch of eggs was positive. In conclusion, these data indicate that vaccination of laying hens with these live vaccines could be considered as a valuable tool in controlling internal egg contamination.
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathon; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John
2014-01-01
The 3M(™) Molecular Detection Assay (MDA) Salmonella utilizes isothermal amplification of nucleic acid sequences with high specificity, efficiency, rapidity and bioluminescence to detect amplification of Salmonella spp. in food, food-related, and environmental samples after enrichment. A method modification and matrix extension study of the previously approved AOAC Official Method(SM) 2013.09 was conducted, and approval of the modification was received on March 20, 2014. Using an unpaired study design in a multilaboratory collaborative study, the 3M MDA Salmonella method was compared to the U.S. Department of Agriculture/Food Safety and Inspection Service (USDA/FSIS) Microbiology Laboratory Guidebook (MLG) 4.05 (2011), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg, and Catfish Products for raw ground beef and the U.S. Food and Drug Administration (FDA)/Bacteriological Analytical Manual (BAM) Chapter 5, Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the LPODs of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Directory of Open Access Journals (Sweden)
Santiviago Carlos A
2009-08-01
Full Text Available Abstract Background The recently described Type VI Secretion System (T6SS represents a new paradigm of protein secretion in bacteria. A number of bioinformatic studies have been conducted to identify T6SS gene clusters in the available bacterial genome sequences. According to these studies, Salmonella harbors a unique T6SS encoded in the Salmonella Pathogenicity Island 6 (SPI-6. Since these studies only considered few Salmonella genomes, the present work aimed to identify novel T6SS loci by in silico analysis of every genome sequence of Salmonella available. Results The analysis of sequencing data from 44 completed or in progress Salmonella genome projects allowed the identification of 3 novel T6SS loci. These clusters are located in differentially-distributed genomic islands we designated SPI-19, SPI-20 and SPI-21, respectively. SPI-19 was identified in a subset of S. enterica serotypes including Dublin, Weltevreden, Agona, Gallinarum and Enteritidis. In the later, an internal deletion eliminated most of the island. On the other hand, SPI-20 and SPI-21 were restricted to S. enterica subspecies arizonae (IIIa serotype 62:z4,z23:-. Remarkably, SPI-21 encodes a VgrG protein containing a C-terminal extension similar to S-type pyocins of Pseudomonas aeruginosa. This is not only the first evolved VgrG described in Salmonella, but also the first evolved VgrG including a pyocin domain described so far in the literature. In addition, the data indicate that SPI-6 T6SS is widely distributed in S. enterica and absent in serotypes Enteritidis, Gallinarum, Agona, Javiana, Paratyphi B, Virchow, IIIa 62:z4,z23:- and IIIb 61:1,v:1,5,(7. Interestingly, while some serotypes harbor multiple T6SS (Dublin, Weltvreden and IIIa 62:z4,z23:- others do not encode for any (Enteritidis, Paratyphi B, Javiana, Virchow and IIIb 61:1,v:1,5,(7. Comparative and phylogenetic analyses indicate that the 4 T6SS loci in Salmonella have a distinct evolutionary history. Finally, we
Cummings, K J; Rodriguez-Rivera, L D; Norman, K N; Ohta, N; Scott, H M
2017-06-01
A recent increase in plasmid-mediated quinolone resistance (PMQR) has been detected among Salmonella isolated from humans in the United States, and it is necessary to determine the sources of human infection. We had previously isolated Salmonella from dairy farm environmental samples collected in Texas, and isolates were tested for anti-microbial susceptibility. Two isolates, serotyped as Salmonella Muenster, showed the discordant pattern of nalidixic acid susceptibility and intermediate susceptibility to ciprofloxacin. For this project, whole-genome sequencing of both isolates was performed to detect genes associated with quinolone resistance. The plasmid-mediated qnrB19 gene and IncR plasmid type were identified in both isolates. To our knowledge, this is the first report of PMQR in Salmonella isolated from food animals or agricultural environments in the United States. © 2016 Blackwell Verlag GmbH.
Farrell, John J; Doyle, Laura J; Addison, Rachel M; Reller, L Barth; Hall, Geraldine S; Procop, Gary W
2005-03-01
We describe broad-range salmonellae (ie, Salmonella) and Salmonella serotype Typhi-specific LightCycler (Roche Diagnostics, Indianapolis, IN) real-time polymerase chain reaction assays. We validated these with a battery of 280 bacteria, 108 of which were salmonellae representing 20 serotypes. In addition, 298 isolates from 170 clinical specimens that were suspected to possibly represent Salmonella were tested with the pan- Salmonella assay. Finally, the pan-Salmonella assay also was used to test DNA extracts from 101 archived, frozen stool specimens, 55 of which were culture-positive for salmonellae. Both assays were 100% sensitive and specific when cultured isolates of the battery were tested. The pan- Salmonella assay also characterized correctly all salmonellae on the primary isolation agar and was 96% sensitive (53/55) and 96% specific (49/51) when nucleic acid extracts from direct stool specimens were tested. These assays represent potential tools the clinical microbiologist could use to screen suspect isolates or stool specimens for Salmonella.
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.
Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed
2017-12-18
The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this
Draft Genome Sequences of 37 Salmonella enterica Strains Isolated from Poultry Sources in Nigeria.
Useh, Nicodemus M; Ngbede, Emmanuel O; Akange, Nguavese; Thomas, Milton; Foley, Andrew; Keena, Mitchel Chan; Nelson, Eric; Christopher-Hennings, Jane; Tomita, Masaru; Suzuki, Haruo; Scaria, Joy
2016-05-05
Here, we report the availability of draft genomes of several Salmonella serotypes, isolated from poultry sources from Nigeria. These genomes will help to further understand the biological diversity of S. enterica and will serve as references in microbial trace-back studies to improve food safety. Copyright © 2016 Useh et al.
Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2004-09-22
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl
One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001
Energy Technology Data Exchange (ETDEWEB)
Shaw, B. R.
2004-04-16
We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified
Murgia, Manuela; Bouchrif, Brahim; Timinouni, Mohammed; Al-Qahtani, Ahmed; Al-Ahdal, Mohammed N; Cappuccinelli, Pietro; Rubino, Salvatore; Paglietti, Bianca
2015-12-23
Antimicrobial-resistant non-typhoidal Salmonella (NTS) are an important cause of infection in Africa, but there is a lack of information on their molecular mechanisms of resistance and epidemiology. This study contributes to fill this gap through the characterization by pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), plasmid profiling and analysis of antibiotic-resistance determinants of 94 Salmonella enterica strains isolated from food in Morocco. PFGE revealed considerable heterogeneity among the strains, showing 32 pulsotypes. MLST of strains representative of the different serovars evidenced 13 sequence types (STs), three of which were newly identified (ST1694, ST1768 and ST1818) and nine not previously reported in Morocco. Thirty-four strains harbored from one to four plasmids, of IncI1 group in S. Mbandaka, IncFIIA in S. Typhimurium, IncL/M in S. Hadar and S. Blockley. For the first time in Morocco an intact Salmonella Genomic Island 1 (SGI1) carrying the resistance genes aadA2, floR, tetG, blaPSE-1 and sul1 was detected in S. Typhimurium DT104. In serovar Hadar resistance to ampicillin, tetracycline and streptomycin was associated to blaTEM-1, tetA and strA genes respectively, whereas one mutation in gyrA (Asp87Asn) and one in parC (Thr54Ser) genes conferred resistance to nalidixic acid. These findings improve the information on foodborne Salmonella in Morocco, evidencing the presence of MDR strains potentially dangerous to humans, and provide useful data for future studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Salmonella Yoruba infection in white-tufted-ear marmoset (Callithrix jacchus
Directory of Open Access Journals (Sweden)
Terezinha Knöbl
2011-08-01
Full Text Available The aim of this study was to describe a fatal salmonellosis case in a non-human female primate (Callithrix jacchus, found in the illegal pet trade in Brazil. The marmoset was sent to the quarantine section of the Guarulhos City Zoo and died in the sequence of an episode of profuse diarrhea. Necropsy findings included mucous enteritis, and liver enlargement and necrosis. Feces and liver fragments were collected for bacteriological tests, which indicated the presence of Salmonella sp.; it was subsequently characterized as pertaining to the Yoruba serotype. The susceptibility profile demonstrated resistance to tetracycline only. The strain was positive for genes that encoded the virulence factors investigated (invA, sefC, pefA and spvC. The results indicated the risk of introduction of Salmonella pathogenic serotypes in primates in captivity.
Expressed sequence tags (ESTs) and single nucleotide ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.
Retrieval and Representation of Nucleotide Sequence of ...
African Journals Online (AJOL)
Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...
Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J
1995-05-01
The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.
Zhao, Xiaonan; Gao, Yanxia; Ye, Chaoqun; Yang, Lingling; Wang, Tao; Chang, Weishan
2016-01-01
Compared with chickens raised in intensively managed breeding farms, free-range chickens in China are quite popular due to lower breeding density and less antibiotics usage. However, investigations about Salmonella enterica from free-range chickens are quite rare. The aim of the present study was to investigate prevalence and characteristics of Salmonella in free-range chickens in Shandong province, China. During the period of August and November 2015, 300 fresh fecal swabs from different broilers in three free-range chicken farms (100 samples per farm) were collected to isolate Salmonella , and then these isolates were subjected to serotyping, antibiotic sensitivity testing, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR), and multilocus sequence typing (ST). A total of 38 Salmonella isolates (38/300, 12.7%) were recovered. The most common serotype was Enteritidis (81.6%), followed by Indiana (13.2%) and Typhimurium (5.3%). Twenty-two out of 38 isolates (57.9%) were resistant to ampicillin, the highest resistance rate, but resistance rates to cefazolin, cefotaxime, and ceftazidime were only 7.9%. The multidrug resistance (MDR) rate was 26.3%. Additionally, the Salmonella isolates could be classified into 25 genotypes by ERIC-PCR and were divided into three ST types (ST11, ST17, and ST19), with ST11 the highest isolation rate (81.6%). In summary, as with other poultry, free-ranging chickens may also serve as potential reservoir for antibiotic resistant Salmonella , thereby posing a threat to public health.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
International Nuclear Information System (INIS)
Hurley, L.H.; Needham-VanDevanter, D.R.
1986-01-01
DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs
Oh, Jun-Hyun; Park, Mi-Kyung
2017-12-28
Salmonella is one of the principal causes of foodborne outbreaks. As traditional control methods have shown less efficacy against emerging Salmonella serotypes or antimicrobialresistant Salmonella , new approaches have been attempted. The use of lytic phages for the biocontrol of Salmonella in the food industry has become an attractive method owing to the many advantages offered by the use of phages as biocontrol agents. Phages are natural alternatives to traditional antimicrobial agents; they have proven effective in the control of bacterial pathogens in the food industry, which has led to the development of different phage products. The treatment with specific phages in the food industry can prevent the decay of products and the spread of bacterial diseases, and ultimately promotes safe environments for animal and plant food production, processing, and handling. After an extensive investigation of the current literature, this review focuses predominantly on the efficacy of phages for the successful control of Salmonella spp. in foods. This review also addresses the current knowledge on the pathogenic characteristics of Salmonella , the prevalence of emerging Salmonella outbreaks, the isolation and characterization of Salmonella -specific phages, the effectiveness of Salmonella -specific phages as biocontrol agents, and the prospective use of Salmonella -specific phages in the food industry.
Applications of High-Throughput Nucleotide Sequencing (PhD)
DEFF Research Database (Denmark)
Waage, Johannes
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
van Dijl, J M; Jong, de Anne; Smith, H; Bron, Sierd; Venema, G
1991-01-01
This paper describes an attempt to clone the Bacillus licheniformis lep gene, encoding signal peptidase, using the Salmonella typhimurium lep gene as a hybridization probe. Although a hybridizing fragment was obtained, DNA sequence analysis indicated that it did not contain the lep gene. Instead,
Directory of Open Access Journals (Sweden)
Shima Shaigan nia
2014-06-01
Conclusions: To our best knowledge the present study is the first prevalence report of Salmonella spp., Salmonella enteritidis and Salmonella typhimurium in raw sheep and goat samples in Iran. Consumption of pasteurized milk and dairy products can reduce the risk of salmonellosis.
PREVALENCE OF SALMONELLA IN CAPTIVE REPTILES FROM CROATIA.
Lukac, Maja; Pedersen, Karl; Prukner-Radovcic, Estella
2015-06-01
Salmonellosis transmitted by pet reptiles is an increasing public health issue worldwide. The aim of this study was to investigate the prevalence of Salmonella strains from captive reptiles in Croatia. From November 2009 to November 2011 a total of 292 skin, pharyngeal, cloacal, and fecal samples from 200 apparently healthy reptiles were tested for Salmonella excretions by bacteriologic culture and serotyping. These 200 individual reptiles included 31 lizards, 79 chelonians, and 90 snakes belonging to private owners or housed at the Zagreb Zoo, Croatia. Salmonella was detected in a total of 13% of the animals, among them 48.4% lizards, 8.9% snakes, and 3.8% turtles. Representatives of five of the six Salmonella enterica subspecies were identified with the following proportions in the total number of isolates: Salmonella enterica enterica 34.6%, Salmonella enterica houtenae 23.1%, Salmonella enterica arizonae 23.1%, Salmonella enterica diarizonae 15.4%, and Salmonella enterica salamae 3.8%. The 14 different serovars isolated included several rarely occurring serovars such as Salmonella Apapa, Salmonella Halle, Salmonella Kisarawe, and Salmonella Potengi. These findings confirm that the prevalence of Salmonella is considerable in captive reptiles in Croatia, indicating that these animals may harbor serovars not commonly seen in veterinary or human microbiologic practice. This should be addressed in the prevention and diagnostics of human reptile-transmitted infections.
DEFF Research Database (Denmark)
Hasman, Henrik; Mevius, D.; Veldman, K.
2005-01-01
Objectives: The purpose of this work was to study the genetic determinants responsible for extended-spectrum beta-lactamase (ESBL) resistance of Salmonella isolated from Dutch poultry, poultry meat and hospitalized humans. Methods: Thirty-four ESBL-resistant Salmonella isolates from The Netherlands...... were tested towards 21 antimicrobial agents. PCR and sequencing were used to determine the underlying genetic determinants responsible for the ESBL phenotypes. The transferability of the ESBL phenotypes was tested by conjugation to a susceptible Salmonella enterica serovar Dublin and plasmid....... Finally, the bla(ACC-1) gene was cloned from a S. Bareilly isolate and was found to be present on indistinguishable plasmids in all S. Bareilly isolates examined as well as in a S. Braenderup isolate and a S. Infantis isolate. Conclusions: Our data underscore the diversity of ESBL genes in Salmonella...
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
9 CFR 113.122 - Salmonella Choleraesuis Bacterin.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Salmonella Choleraesuis Bacterin. 113... REQUIREMENTS Inactivated Bacterial Products § 113.122 Salmonella Choleraesuis Bacterin. Salmonella Choleraesuis Bacterin shall be prepared from a culture of Salmonella choleraesuis which has been inactivated and is...
9 CFR 113.120 - Salmonella Typhimurium Bacterin.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Salmonella Typhimurium Bacterin. 113... REQUIREMENTS Inactivated Bacterial Products § 113.120 Salmonella Typhimurium Bacterin. Salmonella Typhimurium Bacterin shall be prepared from a culture of Salmonella typhimurium which has been inactivated and is...
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Czech Academy of Sciences Publication Activity Database
Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor
2012-01-01
Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012
Directory of Open Access Journals (Sweden)
Aldemir Reginato Ribeiro
2007-06-01
Full Text Available The present study was carried out to evaluate the occurrence of Salmonellae in raw broiler parts and to determine the antimicrobial resistance profile of the isolated strains. Twenty-four (39.3% broiler parts samples were positive for Salmonella and twenty-five Salmonella strains were isolated, since two different serovars were detected in one single positive sample. Salmonella Enteritidis was the most prevalent serovar. Among Salmonella Enteritidis isolates, 95.2% belonged to Phage Type 4 (PT4 (20/21 and 4.8% to PT7 (1/21. Twenty-two (88% strains of Salmonella were resistant to at least one antimicrobial agent, generating eight different resistance patterns. The S. Typhimurium (n: 1 and S. Hadar (n: 3 isolates presented multiple resistance. Three S. Enteritidis isolates were susceptible to all antimicrobials tested, two were resistant only to tetracycline. The high prevalence of Salmonella in the broiler parts strenghtens the importance of the use of good manufacturing practices (GMP, and HACCP. The results also emphasize the need for the responsible use of antimicrobials in animal production.Este trabalho foi conduzido para avaliar a ocorrência de Salmonella em cortes de frango e para determinar o perfil de resistência antimicrobiana das cepas isoladas. Vinte e quatro (39,3% cortes de frango foram positivas para Salmonella, tendo sido isoladas vinte e cinco cepas de Salmonella, uma vez que em uma amostra isolaram-se dois sorovares. Salmonella Enteritidis foi o sorovar prevalente. Entre as Salmonella Enteritidis isoladas, 95,2% pertencem ao Fagotipo 4 (PT4 (20/21 e 4,8% ao PT7 (1/21. Vinte e duas (88% cepas de Salmonella foram resistentes a pelo menos um agente antimicrobiano e oito diferentes padrões de resistência foram observados. S. Typhimurium (n:1 e S. Hadar (n: 3, apresentaram múltipla resistência. Três cepas de S. Enteritidis foram sensíveis a todos os antimicrobianos e duas resistentes somente a tetraciclina. A elevada ocorr
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis
Directory of Open Access Journals (Sweden)
Suravajhala P
2017-06-01
Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS
Salmonella Infections - Multiple Languages
... Are Here: Home → Multiple Languages → All Health Topics → Salmonella Infections URL of this page: https://medlineplus.gov/ ... V W XYZ List of All Topics All Salmonella Infections - Multiple Languages To use the sharing features ...
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Reduction of Salmonella Shedding by Sows during Gestation in Relation to Its Fecal Microbiome
Directory of Open Access Journals (Sweden)
Guillaume Larivière-Gauthier
2017-11-01
Full Text Available Pork meat is estimated to be responsible for 10–20% of human salmonellosis cases in Europe. Control strategies at the farm could reduce contamination at the slaughterhouse. One of the targeted sectors of production is maternity, where sows could be Salmonella reservoirs. The aim of this study was to assess the dynamics of shedding of Salmonella in terms of variation in both shedding prevalence and strains excreted during gestation in Quebec’s maternity sector. The evolution of the fecal microbiota of these sows during gestation was also assessed to detect bacterial populations associated with these variations. A total of 73 sows both at the beginning and the end of the gestation were randomly selected and their fecal matter was analyzed. Salmonella detection was conducted using a method that includes two selective enrichment media (MSRV and TBG. Nine isolates per positive samples were collected. Among the 73 sows tested, 27 were shedding Salmonella. Sows in the first third of their gestation shed Salmonella significantly more frequently (21/27 than those in the last third (6/46 (χ2P < 0.05. The shedding status of 19 of the sows that were previously sampled in the first third of their gestation was followed, this time in the last third of their gestation, which confirmed reduction of shedding. Using 16S rRNA gene sequencing and qPCR, significant differences between the fecal flora of sows at the beginning and the end of the gestation, shedding Salmonella or not and with different parity number were detected. Using MaAsLin, multiple OTUs were found to be associated with the time of gestation, the status of Salmonella excretion and parity number. Some of the identified taxa could be linked to the reduction of the shedding of Salmonella at the end of gestation. In this study, we showed that the level of Salmonella shedding was variable during gestation with significantly higher shedding at the beginning rather than at the end of gestation. We
The Role of the st313-td Gene in Virulence of Salmonella Typhimurium ST313
DEFF Research Database (Denmark)
Herrero-Fresno, Ana; Wallrodt, Inke; Leekitcharoenphon, Pimlapas
2014-01-01
Multidrug-resistant Salmonella enterica serovar Typhimurium ST313 has emerged in sub-Saharan Africa causing severe infections in humans. Therefore, it has been speculated that this specific sequence type, ST313, carries factors associated with increased pathogenicity. We assessed the role in viru...
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of
9 CFR 113.123 - Salmonella Dublin Bacterin.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Salmonella Dublin Bacterin. 113.123... Inactivated Bacterial Products § 113.123 Salmonella Dublin Bacterin. Salmonella Dublin Bacterin shall be prepared from a culture of Salmonella dublin which has been inactivated and is nontoxic. Each serial of...
Li, Baisheng; Yang, Xingfen; Tan, Hailing; Ke, Bixia; He, Dongmei; Wang, Haiyan; Chen, Qiuxia; Ke, Changwen; Zhang, Yonghui
2018-02-02
Salmonella enterica serovar Weltevreden is the most common non-typhoid Salmonella found in South and Southeast Asia. It causes zoonoses worldwide through the consumption of contaminated foods and seafood, and is considered as an important food-borne pathogen in China, especially in the Southern coastal area. We compared the whole genomes of 44 S. Weltevreden strains isolated from human stool and contaminated food samples from Southern Coastal China, in order to investigate their phylogenetic relationships and establish their genetic relatedness to known international strains. ResFinder analysis of the draft genomes of isolated strains detected antimicrobial resistance (AMR) genes in only eight isolates, equivalent to minimum inhibitory concentration assay, and only a few isolates showed resistance to tetracycline, ciprofloxacin or ampicillin. In silico MLST analysis revealed that 43 out of 44 S. Weltevreden strains belonged to sequence type 365 (CC205), the most common sequence type of the serovars. Phylogenetic analysis of the 44 domestic and 26 international isolates suggested that the population of S. Weltevreden could be segregated into six phylogenetic clusters. Cluster I included two strains from food and strains of the "Island Cluster", indicating potential inter-transmission between different countries and regions through foods. The predominant S. Weltevreden isolates obtained from the samples from Southern coastal China were found to be phylogenetically related to strains from Southern East Asia, and formed clusters II-VI. The study has demonstrated that WGS-based analysis may be used to improve our understanding of the epidemiology of this bacterium as part of a food-borne disease surveillance program. The methods used are also more widely applicable to other geographical regions and areas and could therefore be useful for improving our understanding of the international spread of S. Weltevreden on a global scale. Copyright © 2017. Published by Elsevier
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Saingam, Prakit; Li, Bo; Yan, Tao
2018-06-01
DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Korver H; Raes M; Maas HME; Ward LR; Wannet WJB; Henken AM; MGB; LIS
2002-01-01
Test resultaten van Salmonella sero- en faagtypering en antimicrobiele gevoeligheidsbepalingen door de Nationale Referentie Laboratoria voor Salmonella in de Lidstaten van de Europese Unie en EnterNet Laboratoria: Ringonderzoek VI (2001) voor Salmonella. Een zesde ringonderzoek betreffende de
Directory of Open Access Journals (Sweden)
Bingjun eDang
2016-02-01
Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.
Survival of Salmonella Newport in oysters.
Morrison, Christopher M; Armstrong, Alexandra E; Evans, Sanford; Mild, Rita M; Langdon, Christopher J; Joens, Lynn A
2011-08-02
Salmonella enterica is the leading cause of laboratory-confirmed foodborne illness in the United States and raw shellfish consumption is a commonly implicated source of gastrointestinal pathogens. A 2005 epidemiological study done in our laboratory by Brands et al., showed that oysters in the United States are contaminated with Salmonella, and in particular, a specific strain of the Newport serovar. This work sought to further investigate the host-microbe interactions between Salmonella Newport and oysters. A procedure was developed to reliably and repeatedly expose oysters to enteric bacteria and quantify the subsequent levels of bacterial survival. The results show that 10 days after an exposure to Salmonella Newport, an average concentration of 3.7 × 10(3)CFU/g remains within the oyster meat, and even after 60 days there still can be more than 10(2)CFU/g remaining. However, the strain of Newport that predominated in the market survey done by Brands et al. does not survive within oysters or the estuarine environment better than any other strains of Salmonella we tested. Using this same methodology, we compared Salmonella Newport's ability to survive within oysters to a non-pathogenic strain of E. coli and found that after 10 days the concentration of Salmonella was 200-times greater than that of E. coli. We also compared those same strains of Salmonella and E. coli in a depuration process to determine if a constant 120 L/h flux of clean seawater could significantly reduce the concentration of bacteria within oysters and found that after 3 days the oysters retained over 10(4)CFU/g of Salmonella while the oysters exposed to the non-pathogenic strain of E. coli contained 100-times less bacteria. Overall, the results of this study demonstrate that any of the clinically relevant serovars of Salmonella can survive within oysters for significant periods of time after just one exposure event. Based on the drastic differences in survivability between Salmonella and a non
Nostoc PCC7524, a cyanobacterium which contains five sequence-specific deoxyribonucleases
Reaston, J.; Duybesteyn, M.G.C.; Waard, Adrian de
1982-01-01
Five nucleotide sequence-specific deoxyribonucleases present in cell-free extracts of the filamentous cyanobacterium Nostoc PCC7524 have been purified and characterized. One of these enzymes, designated Nsp(7524)I cleaves at a new kind of nucleotide sequence i.e. 5'-PuCATG λ Py-3'. The other four
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
Guo, D; Maiss, E; Adam, G; Casper, R
1995-05-01
The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.
DEFF Research Database (Denmark)
Nauta, Maarten; Barfod, Kristen; Hald, Tine
2013-01-01
Salmonella concentrations. It is concluded that the faecal carriage of Salmonella together with the faecal contamination of carcasses, as predicted from E. coli data in the animal faeces and hygiene performance of the slaughterhouse, is not sufficient to explain carcass contamination with Salmonella. Our...... extensive data set showed that other factors than the observed faecal carriage of Salmonella by the individual animals brought to slaughter, play a more important role in the Salmonella carcass contamination of pork.......Faecal contamination of carcasses in the slaughterhouse is generally considered to be the source of Salmonella on pork. In this study the hygiene indicator Escherichia coli is used to quantify faecal contamination of carcasses and it is hypothesized that it can be used to predict the quantitative...
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
Four new single nucleotide polymorphisms (SNPs) of toll-like ...
African Journals Online (AJOL)
In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...
Korver H; Raes M; Maas HME; Ward LR; Wannet WJB; Henken AM; PHLS-Colindale/London; MGB; LIS
2002-01-01
Test results of Salmonella sero- and phage typing and antimicrobial susceptibility testing by the National Reference Laboratories for Salmonella in the Member States of the European Union and the EnterNet Laboratories: Collaborative study VI (2001) for Salmonella. The sixth collaborative typing
DEFF Research Database (Denmark)
Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.
1998-01-01
on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...
Vaccines against invasive Salmonella disease
MacLennan, Calman A; Martin, Laura B; Micoli, Francesca
2014-01-01
Though primarily enteric pathogens, Salmonellae are responsible for a considerable yet under-appreciated global burden of invasive disease. In South and South-East Asia, this manifests as enteric fever caused by serovars Typhi and Paratyphi A. In sub-Saharan Africa, a similar disease burden results from invasive nontyphoidal Salmonellae, principally serovars Typhimurium and Enteritidis. The existing Ty21a live-attenuated and Vi capsular polysaccharide vaccines target S. Typhi and are not effective in young children where the burden of invasive Salmonella disease is highest. After years of lack of investment in new Salmonella vaccines, recent times have seen increased interest in the area led by emerging-market manufacturers, global health vaccine institutes and academic partners. New glycoconjugate vaccines against S. Typhi are becoming available with similar vaccines against other invasive serovars in development. With other new vaccines under investigation, including live-attenuated, protein-based and GMMA vaccines, now is an exciting time for the Salmonella vaccine field. PMID:24804797
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Thermal inactivation of eight Salmonella serotypes on dry corn flour.
VanCauwenberge, J E; Bothast, R J; Kwolek, W F
1981-01-01
Dry heat was used to inactivate Salmonella newington, Salmonella typhimurium, Salmonella anatum, Salmonella kentucky, Salmonella cubana, Salmonella seftenberg, Salmonella thompson, and Salmonella tennessee in corn flour at 10 and 15% moisture. The flour was spray inoculated at 10(5) Salmonella cells per g and then stored at 49 degrees C (120 degrees F); viable Salmonella cells were counted on Trypticase (BBL Microbiology Systems) soy agar plates every 30 min for the first 4 h and then at 4-h ...
Liu, Fenyun; Kariyawasam, Subhashinie; Jayarao, Bhushan M; Barrangou, Rodolphe; Gerner-Smidt, Peter; Ribot, Efrain M; Knabel, Stephen J; Dudley, Edward G
2011-07-01
Salmonella enterica subsp. enterica serovar Enteritidis is a major cause of food-borne salmonellosis in the United States. Two major food vehicles for S. Enteritidis are contaminated eggs and chicken meat. Improved subtyping methods are needed to accurately track specific strains of S. Enteritidis related to human salmonellosis throughout the chicken and egg food system. A sequence typing scheme based on virulence genes (fimH and sseL) and clustered regularly interspaced short palindromic repeats (CRISPRs)-CRISPR-including multi-virulence-locus sequence typing (designated CRISPR-MVLST)-was used to characterize 35 human clinical isolates, 46 chicken isolates, 24 egg isolates, and 63 hen house environment isolates of S. Enteritidis. A total of 27 sequence types (STs) were identified among the 167 isolates. CRISPR-MVLST identified three persistent and predominate STs circulating among U.S. human clinical isolates and chicken, egg, and hen house environmental isolates in Pennsylvania, and an ST that was found only in eggs and humans. It also identified a potential environment-specific sequence type. Moreover, cluster analysis based on fimH and sseL identified a number of clusters, of which several were found in more than one outbreak, as well as 11 singletons. Further research is needed to determine if CRISPR-MVLST might help identify the ecological origins of S. Enteritidis strains that contaminate chickens and eggs.
Pearce, Madison E; Alikhan, Nabil-Fareed; Dallman, Timothy J; Zhou, Zhemin; Grant, Kathie; Maiden, Martin C J
2018-06-02
Multi-country outbreaks of foodborne bacterial disease present challenges in their detection, tracking, and notification. As food is increasingly distributed across borders, such outbreaks are becoming more common. This increases the need for high-resolution, accessible, and replicable isolate typing schemes. Here we evaluate a core genome multilocus typing (cgMLST) scheme for the high-resolution reproducible typing of Salmonella enterica (S. enterica) isolates, by its application to a large European outbreak of S. enterica serovar Enteritidis. This outbreak had been extensively characterised using single nucleotide polymorphism (SNP)-based approaches. The cgMLST analysis was congruent with the original SNP-based analysis, the epidemiological data, and whole genome MLST (wgMLST) analysis. Combination of the cgMLST and epidemiological data confirmed that the genetic diversity among the isolates predated the outbreak, and was likely present at the infection source. There was consequently no link between country of isolation and genetic diversity, but the cgMLST clusters were congruent with date of isolation. Furthermore, comparison with publicly available Enteritidis isolate data demonstrated that the cgMLST scheme presented is highly scalable, enabling outbreaks to be contextualised within the Salmonella genus. The cgMLST scheme is therefore shown to be a standardised and scalable typing method, which allows Salmonella outbreaks to be analysed and compared across laboratories and jurisdictions. Copyright © 2018. Published by Elsevier B.V.
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.
Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.
Directory of Open Access Journals (Sweden)
Simon Reed
2012-09-01
Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.
Global impact of Salmonella type III secretion effector SteA on host cells
International Nuclear Information System (INIS)
Cardenal-Muñoz, Elena; Gutiérrez, Gabriel; Ramos-Morales, Francisco
2014-01-01
Highlights: • We analyzed HeLa cells transcriptome in response to Salmonella SteA. • Significant differential expression was detected for 58 human genes. • They are involved in ECM organization and regulation of some signaling pathways. • Cell death, cell adhesion and cell migration were decreased in SteA-expressing cells. • These results contribute to understand the role of SteA during infections. - Abstract: Salmonella enterica is a Gram-negative bacterium that causes gastroenteritis, bacteremia and typhoid fever in several animal species including humans. Its virulence is greatly dependent on two type III secretion systems, encoded in pathogenicity islands 1 and 2. These systems translocate proteins called effectors into eukaryotic host cell. Effectors interfere with host signal transduction pathways to allow the internalization of pathogens and their survival and proliferation inside vacuoles. SteA is one of the few Salmonella effectors that are substrates of both type III secretion systems. Here, we used gene arrays and bioinformatics analysis to study the genetic response of human epithelial cells to SteA. We found that constitutive synthesis of SteA in HeLa cells leads to induction of genes related to extracellular matrix organization and regulation of cell proliferation and serine/threonine kinase signaling pathways. SteA also causes repression of genes related to immune processes and regulation of purine nucleotide synthesis and pathway-restricted SMAD protein phosphorylation. In addition, a cell biology approach revealed that epithelial cells expressing steA show altered cell morphology, and decreased cytotoxicity, cell–cell adhesion and migration
Global impact of Salmonella type III secretion effector SteA on host cells
Energy Technology Data Exchange (ETDEWEB)
Cardenal-Muñoz, Elena; Gutiérrez, Gabriel; Ramos-Morales, Francisco
2014-07-11
Highlights: • We analyzed HeLa cells transcriptome in response to Salmonella SteA. • Significant differential expression was detected for 58 human genes. • They are involved in ECM organization and regulation of some signaling pathways. • Cell death, cell adhesion and cell migration were decreased in SteA-expressing cells. • These results contribute to understand the role of SteA during infections. - Abstract: Salmonella enterica is a Gram-negative bacterium that causes gastroenteritis, bacteremia and typhoid fever in several animal species including humans. Its virulence is greatly dependent on two type III secretion systems, encoded in pathogenicity islands 1 and 2. These systems translocate proteins called effectors into eukaryotic host cell. Effectors interfere with host signal transduction pathways to allow the internalization of pathogens and their survival and proliferation inside vacuoles. SteA is one of the few Salmonella effectors that are substrates of both type III secretion systems. Here, we used gene arrays and bioinformatics analysis to study the genetic response of human epithelial cells to SteA. We found that constitutive synthesis of SteA in HeLa cells leads to induction of genes related to extracellular matrix organization and regulation of cell proliferation and serine/threonine kinase signaling pathways. SteA also causes repression of genes related to immune processes and regulation of purine nucleotide synthesis and pathway-restricted SMAD protein phosphorylation. In addition, a cell biology approach revealed that epithelial cells expressing steA show altered cell morphology, and decreased cytotoxicity, cell–cell adhesion and migration.
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Patchanee, Prapas; Eiamsam-Ang, Thanaporn; Vanaseang, Juntakarn; Boonkhot, Phacharaporn; Tadee, Pakpoom
2017-08-02
Salmonella is recognized as a significant zoonotic foodborne pathogen, and pork products are involved in one-fifth of infections. Whole genome sequencing data of Salmonella isolated from retail's pork circulating in the Chiang Mai Municipality area between April 2013 and September 2014, were used to focus on genetic diversity and proven in pig-human transmission based on Multilocus Sequence Typing (MLST). Additionally, WGS data were used to investigate virulence genes, to assess the hazard or pathogenic potential transferred into the food production chain. In this study, all 32 Salmonella strains were classified into 11 Sequence Types (STs). ST469 accounted for the majority (41%). The sequence types of two other strains, 6% of the total, could not be identified. All tested strains carried at least 15 virulence genes. The most frequent gene profile was "sfm-fim-sop-inv.-org-sip-spa-sif-fli-flg-hil-spr-ssa-sse-pag-bss" (47%). Salmonella circulating in the study area demonstrated competence in biofilm production, host cell adhesion, host cell invasion, and host cell survival. Based on the phenotypic and genotypic findings, as well as pathogen source, it appears possible that a common supply chain or common infection source might be presented in the retail pork system in the study area. In addition, an epidemiological comparison of the Salmonella genotypes from the current study with those from other areas such as People's Republic of China (PR China) and the Lao People's Democratic Republic (Lao PDR) was generated by Minimum spanning tree (MST). Identical strains originating from humans, animals and food were found. The findings indicate that contamination can be occured at all levels including pre-harvest, the farm-slaughterhouse-retail chain and consumers over different geographical areas. Acquiring information about infection sources and transmission routes will hopefully motivate all sectors to enforce strict sanitation controls at all production stages including
Kuo, C.; Hsu, B.; Shen, T.; Tseng, S.; Tsai, J.; Huang, K.; Kao, P.; Chen, J.
2013-12-01
Salmonella spp. is a common water-borne pathogens and its genus comprises more than 2,500 serotypes. Major pathogenic genotypes which cause typhoid fever, enteritis and other intestinal-type diseases are S. Typhimurium, S. Enteritidis, S. Stanley, S. Agona, S.Albany, S. Schwarzengrund, S. Newport, S. Choleraesuis, and S. Derby. Hence, the identification of the serotypes of Salmonella spp. is important. In the present study, the analytical procedures include direct concentration method, non-selective pre-enrichment method and selective enrichment method of Salmonella spp.. Both selective enrichment method and cultured bacteria were detected with specific primers of Salmonella spp. by polymerase chain reaction (PCR). At last, the serotypes of Salmonella were confirmed by using MLST (multilocus sequence typing) with aroC, dnaN, hemD, hisD, purE, sucA, thrA housekeeping genes to identify the strains of positive samples. This study contains 121 samples from three different types of water sources including the drinking water (51), streams (45), and swine wastewater (25). Thirteen samples with positive invA gene are separated from culture method. The strains of these positive samples which identified from MLST method are S. Albany, S. Typhimurium, S. Newport, S. Bareilly, and S. Derby. Some of the serotypes, S. Albany, S. Typhimurium and S. Newport, are highly pathogenic which correlated to human diarrhea. In our results, MLST is a useful method to identify the strains of Salmonella spp.. Keywords: Salmonella, PCR, MLST.
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
DEFF Research Database (Denmark)
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology
DEFF Research Database (Denmark)
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr
2017-01-01
Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...
Gwida, Mayada M; Al-Ashmawy, Maha A M
2014-01-01
A total of 200 samples of milk and dairy products as well as 120 samples of dairy handlers were randomly collected from different dairy farms and supermarkets in Dakahlia Governorate, Egypt. The conventional cultural and serotyping methods for detection of Salmonella in dairy products were applied and the results were compared with those obtained by molecular screening assay using (ttr sequence). The obtained results revealed that 21% of milk and dairy products (42/200) were positive for Salmonella species using enrichment culture-based PCR method, while 12% of different dairy samples (24/200) were found to be positive for Salmonella species by using the conventional culture methods. Two stool specimens out of 40 apparently healthy dairy handlers were positive by the PCR method. Serotyping of Salmonella isolates revealed that 58.3% (14/24) from different dairy products were contaminated with Salmonella Typhimurium. We conclude that the enrichment culture-based PCR assay has high sensitivity and specificity for detection of Salmonella species in dairy products and handlers. High incidence of Salmonella Typhimurium in the examined dairy samples highlights the important role played by milk and dairy products as a vehicle in disease prevalence. Great effort should be applied for reducing foodborne risk for consumers.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Assessment of Salmonella survival in dry-cured Italian salami.
Bonardi, S; Bruini, I; Bolzoni, L; Cozzolino, P; Pierantoni, M; Brindani, F; Bellotti, P; Renzi, M; Pongolini, S
2017-12-04
The inactivation of Salmonella during curing of Italian traditional pork salami was investigated. A total of 150 batches of ground raw meat (GRM) used for salami manufacturing by four producers were tested for Salmonella by real-time PCR followed by ISO 6579 cultural confirmation and MPN enumeration. Salami produced with Salmonella positive GRMs were re-tested at the end of their curing period. Aw, pH and NaCl content were also measured. Detection of Salmonella was performed testing both 25 and 50g of the samples. By Real-Time PCR 37% of the GRMs resulted positive, but cultural detection of Salmonella was obtained in 14% of the samples only. Salmonella enumeration ranged from 31 MPN/g to Salmonella in 100% of all positive samples, vs. 62% of ISO-25g. Salami made of the contaminated GRMs were 29% Salmonella-positive, as most batches of salami produced with Salmonella-positive GRMs resulted negative after regular curing (20-48days). Overall, 13% of salami produced with Salmonella-contaminated GRMs were positive. They belonged to six batches, which turned out negative after prolonged curing ranging between 49 and 86days. Salmonella enumeration in salami ranged from 8.7 MPN/g to Salmonella in cured salami (p value: >0.05). The most common Salmonella serovars in GRMs were Derby (52%), Typhimurium monophasic variant 4, (Barbuti et al., 1993), 12:i:- (19%) and Stanley (10%). Salmonella Derby (56%), London, Branderup, Panama (13%, respectively) and Goldcoast (6%) were most frequent in cured salami. The study showed negative correlation between real-time CT values and cultural confirmation of Salmonella, as well as the importance of sample size for Salmonella detection. Among considered factors with possible effect on the occurrence of Salmonella in salami, statistical analysis revealed a role for aw in salami and for Salmonella load in GRMs, while pH and NaCl content did not significantly affect the probability of finding Salmonella in dry-cured salami in the context of
Autophagy Facilitates Salmonella Replication in HeLa Cells
Yu, Hong B.; Croxen, Matthew A.; Marchiando, Amanda M.; Ferreira, Rosana B. R.; Cadwell, Ken; Foster, Leonard J.; Finlay, B. Brett
2014-01-01
ABSTRACT Autophagy is a process whereby a double-membrane structure (autophagosome) engulfs unnecessary cytosolic proteins, organelles, and invading pathogens and delivers them to the lysosome for degradation. We examined the fate of cytosolic Salmonella targeted by autophagy and found that autophagy-targeted Salmonella present in the cytosol of HeLa cells correlates with intracellular bacterial replication. Real-time analyses revealed that a subset of cytosolic Salmonella extensively associates with autophagy components p62 and/or LC3 and replicates quickly, whereas intravacuolar Salmonella shows no or very limited association with p62 or LC3 and replicates much more slowly. Replication of cytosolic Salmonella in HeLa cells is significantly decreased when autophagy components are depleted. Eventually, hyperreplication of cytosolic Salmonella potentiates cell detachment, facilitating the dissemination of Salmonella to neighboring cells. We propose that Salmonella benefits from autophagy for its cytosolic replication in HeLa cells. PMID:24618251
Usongo, Valentine; Berry, Chrystal; Yousfi, Khadidja; Doualla-Bell, Florence; Labbé, Genevieve; Johnson, Roger; Fournier, Eric; Nadon, Celine; Goodridge, Lawrence; Bekal, Sadjia
2018-01-01
Salmonella enterica serovar Heidelberg (S. Heidelberg) is one of the top serovars causing human salmonellosis. The core genome single nucleotide variant pipeline (cgSNV) is one of several whole genome based sequence typing methods used for the laboratory investigation of foodborne pathogens. SNV detection using this method requires a reference genome. The purpose of this study was to investigate the impact of the choice of the reference genome on the cgSNV-informed phylogenetic clustering and inferred isolate relationships. We found that using a draft or closed genome of S. Heidelberg as reference did not impact the ability of the cgSNV methodology to differentiate among 145 S. Heidelberg isolates involved in foodborne outbreaks. We also found that using a distantly related genome such as S. Dublin as choice of reference led to a loss in resolution since some sporadic isolates were found to cluster together with outbreak isolates. In addition, the genetic distances between outbreak isolates as well as between outbreak and sporadic isolates were overall reduced when S. Dublin was used as the reference genome as opposed to S. Heidelberg.
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Shahada, F; Chuma, T; Kosugi, G; Kusumoto, M; Iwata, T; Akiba, M
2013-06-01
This study was conducted to investigate the distribution and diversity of extended-spectrum cephalosporin (ESC) resistance determinants in Salmonella enterica and Escherichia coli obtained from the same cecal samples and to provide evidence of transmission of the resistance determinants among these bacteria in broiler farms in southern Japan. Salmonella enterica and E. coli were characterized by serotyping and multilocus sequence typing, respectively. An antimicrobial susceptibility test, plasmid analysis, and identification and localization of resistance genes were performed to determine the relatedness of ESC resistance determinants among the isolates. Of 48 flocks examined, 14 had S. enterica. In total, 57 S. enterica isolates were obtained, 45 of which showed ESC resistance. Extended-spectrum cephalosporin-resistant E. coli were also obtained from all of these ESC-resistant Salmonella-positive samples. β-Lactamase genes, blaTEM-52 (38 isolates), blaCTX-M-14 (1 isolate), and blaCMY-2 (6 isolates), were carried by conjugative untypable or IncP plasmids detected in the S. enterica serovars Infantis and Manhattan. The β-lactamase genes blaCTX-M-14 (3 isolates), blaCTX-M-15 (3 isolates), blaSHV-2 (1 isolate), blaSHV-12 (2 isolates), and blaCMY-2 (32 isolates) associated with IncI1-Iγ, IncFIB, IncFIC, IncK, IncB/O, and IncY plasmids were detected in E. coli co-isolates. Restriction mapping revealed similar plasmids in Salmonella Infantis and Salmonella Manhattan and in different sequence types of E. coli. Intraspecies transmission of plasmids was suggested within S. enterica and E. coli populations, whereas interspecies transmission was not observed. This study highlights the importance of plasmids as carriers of ESC resistance determinants.
Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna
Directory of Open Access Journals (Sweden)
Souche Erika L
2011-06-01
Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.
Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S
2011-05-25
Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
BlockLogo: Visualization of peptide and sequence motif conservation
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian
2013-01-01
BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
Study of Salmonella Typhimurium infection in laying hens
Directory of Open Access Journals (Sweden)
Kapil eChousalkar
2016-02-01
Full Text Available Members of Salmonella enterica are frequently involved in egg and egg product related human food poisoning outbreaks worldwide. In Australia, Salmonella Typhimurium is frequently involved in egg and egg product related foodborne illness and Salmonella Mbandaka has also been found to be a contaminant of the layer farm environment. The ability possessed by Salmonella Enteritidis to colonise reproductive organs and contaminate developing eggs has been well described. However, there are few studies investigating this ability for Salmonella Typhimurium. The hypothesis of this study was that the Salmonella Typhimurium can colonise the gut for a prolonged period of time and that horizontal infection through feces is the main route of egg contamination. At 14 weeks of age hens were orally infected with either S. Typhimurium PT 9 or S. Typhimurium PT 9 and Salmonella Mbandaka. Salmonella shedding in feces and eggs was monitored for 15 weeks post infection. Egg shell surface and internal contents of eggs laid by infected hens were cultured independently for detection of Salmonella spp. The mean Salmonella load in feces ranged from 1.54 to 63.35 and 0.31 to 98.38 most probable number/g (MPN/g in the S. Typhimurium and S. Typhimurium + S. Mbandaka group respectively. No correlation was found between mean fecal Salmonella load and frequency of egg shell contamination. Egg shell contamination was higher in S. Typhimurium + S. Mbandaka infected group (7.2% Typhimurium, 14.1% Mbandaka compared to birds infected with S. Typhimurium (5.66% however, co-infection had no significant impact on egg contamination by S. Typhimurium. Throughout the study Salmonella was not recovered from internal contents of eggs laid by hens. Salmonella was isolated from different segments of oviduct of hens from both the groups, however pathology was not observed on microscopic examination. This study investigated Salmonella shedding for up to 15 weeks p.i which is a longer period of
International Nuclear Information System (INIS)
Xiong Gang; Wang, X.R.
2005-01-01
The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor
Directory of Open Access Journals (Sweden)
Berendonk Thomas U
2011-05-01
Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino
Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
Rösler, Uwe; Szabo, Istvan; Matthies, Claudia; Albrecht, Kerstin; Leffler, Kerstin; Scherer, Kathrin; Nöckler, Karsten; Lehmann, Jörg; Methner, Ulrich; Hensel, Andreas
2018-01-01
The objective of this study was the comparative evaluation of four indirect Salmonella ELISA tests at study time approved in Germany to detect Salmonella infection in pigs. Three tests are based on a LPS-antigen mix and directed against specific IgG antibodies. The fourth test is based on a purified S. Typhimurium whole-cell lysate antigen and discriminates between Salmonella-specific IgM-, IgA-, and IgG- antibodies. In a longitudinal study, two groups of six weeks old hybrid piglets were ...
Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S
2016-08-01
Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.
Virulence of invasive Salmonella Typhimurium ST313 in animal models of infection.
Directory of Open Access Journals (Sweden)
Girish Ramachandran
2017-08-01
Full Text Available Salmonella Typhimurium sequence type (ST 313 produces septicemia in infants in sub-Saharan Africa. Although there are known genetic and phenotypic differences between ST313 strains and gastroenteritis-associated ST19 strains, conflicting data about the in vivo virulence of ST313 strains have been reported. To resolve these differences, we tested clinical Salmonella Typhimurium ST313 and ST19 strains in murine and rhesus macaque infection models. The 50% lethal dose (LD50 was determined for three Salmonella Typhimurium ST19 and ST313 strains in mice. For dissemination studies, bacterial burden in organs was determined at various time-points post-challenge. Indian rhesus macaques were infected with one ST19 and one ST313 strain. Animals were monitored for clinical signs and bacterial burden and pathology were determined. The LD50 values for ST19 and ST313 infected mice were not significantly different. However, ST313-infected BALB/c mice had significantly higher bacterial numbers in blood at 24 h than ST19-infected mice. ST19-infected rhesus macaques exhibited moderate-to-severe diarrhea while ST313-infected monkeys showed no-to-mild diarrhea. ST19-infected monkeys had higher bacterial burden and increased inflammation in tissues. Our data suggest that Salmonella Typhimurium ST313 invasiveness may be investigated using mice. The non-human primate results are consistent with clinical data, suggesting that ST313 strains do not cause diarrhea.
Virulence of invasive Salmonella Typhimurium ST313 in animal models of infection.
Ramachandran, Girish; Panda, Aruna; Higginson, Ellen E; Ateh, Eugene; Lipsky, Michael M; Sen, Sunil; Matson, Courtney A; Permala-Booth, Jasnehta; DeTolla, Louis J; Tennant, Sharon M
2017-08-01
Salmonella Typhimurium sequence type (ST) 313 produces septicemia in infants in sub-Saharan Africa. Although there are known genetic and phenotypic differences between ST313 strains and gastroenteritis-associated ST19 strains, conflicting data about the in vivo virulence of ST313 strains have been reported. To resolve these differences, we tested clinical Salmonella Typhimurium ST313 and ST19 strains in murine and rhesus macaque infection models. The 50% lethal dose (LD50) was determined for three Salmonella Typhimurium ST19 and ST313 strains in mice. For dissemination studies, bacterial burden in organs was determined at various time-points post-challenge. Indian rhesus macaques were infected with one ST19 and one ST313 strain. Animals were monitored for clinical signs and bacterial burden and pathology were determined. The LD50 values for ST19 and ST313 infected mice were not significantly different. However, ST313-infected BALB/c mice had significantly higher bacterial numbers in blood at 24 h than ST19-infected mice. ST19-infected rhesus macaques exhibited moderate-to-severe diarrhea while ST313-infected monkeys showed no-to-mild diarrhea. ST19-infected monkeys had higher bacterial burden and increased inflammation in tissues. Our data suggest that Salmonella Typhimurium ST313 invasiveness may be investigated using mice. The non-human primate results are consistent with clinical data, suggesting that ST313 strains do not cause diarrhea.
Berghaus, R D; Thayer, S G; Maurer, J J; Hofacre, C L
2011-05-01
The objective of this study was to evaluate the effect of vaccination of breeder chickens on Salmonella prevalences and loads in breeder and broiler chicken flocks. Chickens housed on six commercial breeder farms were vaccinated with a killed Salmonella vaccine containing Salmonella Typhimurium, Salmonella Enteritidis, and Salmonella Kentucky. Unvaccinated breeders placed on six additional farms served as controls. Eggs from vaccinated and unvaccinated breeder flocks were kept separately in the hatchery, and the resulting chicks were used to populate 58 commercial broiler flock houses by using a pair-matched design. Vaccinated breeder flocks had significantly higher Salmonella-specific antibody titers than did the unvaccinated breeder flocks, although they did not differ significantly with respect to environmental Salmonella prevalences or loads. Broiler flocks that were the progeny of vaccinated breeders had significantly lower Salmonella prevalences and loads than broiler flocks that were the progeny of unvaccinated breeders. After adjusting for sample type and clustering at the farm level, the odds of detecting Salmonella in samples collected from broiler flocks originating from vaccinated breeders were 62% lower (odds ratio [95% confidence interval] = 0.38 [0.21, 0.68]) than in flocks from unvaccinated breeders. In addition, the mean load of culture-positive samples was lower in broilers from vaccinated breeders by 0.30 log most probable number per sample (95% confidence interval of -0.51, -0.09; P = 0.004), corresponding to a 50% decrease in Salmonella loads. In summary, vaccination of broiler breeder pullets increased humoral immunity in the breeders and reduced Salmonella prevalences and loads in their broiler progeny, but did not significantly decrease Salmonella in the breeder farm environment.
Salmonella-secreted Virulence Factors
Energy Technology Data Exchange (ETDEWEB)
Heffron, Fred; Niemann, George; Yoon, Hyunjin; Kidwai, Afshan S.; Brown, Roslyn N.; McDermott, Jason E.; Smith, Richard D.; Adkins, Joshua N.
2011-05-01
In this short review we discuss secreted virulence factors of Salmonella, which directly affect Salmonella interaction with its host. Salmonella secretes protein to subvert host defenses but also, as discussed, to reduce virulence thereby permitting the bacteria to persist longer and more successfully disperse. The type III secretion system (TTSS) is the best known and well studied of the mechanisms that enable secretion from the bacterial cytoplasm to the host cell cytoplasm. Other secretion systems include outer membrane vesicles, which are present in all Gram-negative bacteria examined to date, two-partner secretion, and type VI secretion will also be addressed. Excellent reviews of Salmonella secreted effectors have focused on themes such as actin rearrangements, vesicular trafficking, ubiquitination, and the activities of the virulence factors themselves. This short review is based on S. Typhimurium infection of mice because it is a model of typhoid like disease in humans. We have organized effectors in terms of events that happen during the infection cycle and how secreted effectors may be involved.
Non-Typhoidal Salmonella Aortitis in a transplant patient
International Nuclear Information System (INIS)
Tarif, N.; Azam, M.N.; Mitwalli, Ahmad H.; Al-Wakeel, Jamal S.; El-Kheder, A. Al-Aboud
2002-01-01
Non-typhoidal salmonella bacteremia may result in extra gastrointestinallocalization of infection. Aortitis due to non-typhoidal salmonella wasreported to be the cause of 38-42% of all infected abdominal aortitis.Underlying atherosclerosis is a frequent site for salmonella aortitis. Wedescribe here a case of possible salmonella aortitis in a renal transplantpatient. (author)
Korver H; Maas HME; Ward LR; Wannet WJB; Henken AM; MGB; LIS
2003-01-01
Het Communautair Referentie Laboratorium voor Salmonella (CRL-Salmonella, Bilthoven, Nederland) organiseerde in samenwerking met Public Health Laboratory Services (PHLS), London, Verenigd Koninkrijk een zevende ringonderzoek aangaande de typering van Salmonella. Zeventien Nationale Referentie
A carbon nanotube immunosensor for Salmonella
Lerner, Mitchell B.; Goldsmith, Brett R.; McMillon, Ronald; Dailey, Jennifer; Pillai, Shreekumar; Singh, Shree R.; Johnson, A. T. Charlie
2011-12-01
Antibody-functionalized carbon nanotube devices have been suggested for use as bacterial detectors for monitoring of food purity in transit from the farm to the kitchen. Here we report progress towards that goal by demonstrating specific detection of Salmonella in complex nutrient broth solutions using nanotube transistors functionalized with covalently-bound anti-Salmonella antibodies. The small size of the active device region makes them compatible with integration in large-scale arrays. We find that the on-state current of the transistor is sensitive specifically to the Salmonella concentration and saturates at low concentration (Salmonella and other bacteria types, with no sign of saturation even at much larger concentrations (108 cfu/ml).
Salmonella Control Programs in Denmark
DEFF Research Database (Denmark)
Wegener, Henrik Caspar; Hald, Tine; Wong, Danilo Lo Fo
2003-01-01
We describe Salmonella control programs of broiler chickens, layer hens, and pigs in Denmark. Major reductions in the incidence of foodborne human salmonellosis have occurred by integrated control of farms and food processing plants. Disease control has been achieved by monitoring the herds...... and flocks, eliminating infected animals, and diversifying animals (animals and products are processed differently depending on Salmonella status) and animal food products according to the determined risk. In 2001, the Danish society saved U.S.$25.5 million by controlling Salmonella. The total annual...... Salmonella control costs in year 2001 were U.S.$14.1 million (U.S.$0.075/kg of pork and U.S.$0.02/kg of broiler or egg). These costs are paid almost exclusively by the industry. The control principles described are applicable to most industrialized countries with modern intensive farming systems....
Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M
2015-12-29
Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.
Optimization of sequence alignment for simple sequence repeat regions
Directory of Open Access Journals (Sweden)
Ogbonnaya Francis C
2011-07-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic
Phenotypic and molecular characterization of Salmonella serotypes ...
African Journals Online (AJOL)
The presence of Salmonella and human pathogens in unpasteurized milk remains a public health hazard. The study reported the phenotypic and molecular characterization of Salmonella serotypes in cow raw milk, cheese and traditional yoghurt marketed for man's consumption in Nigeria. Isolation of Salmonella was done ...
Sequence-specific bias correction for RNA-seq data using recurrent neural networks.
Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru
2017-01-25
The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
Statistical properties of nucleotides in human chromosomes 21 and 22
International Nuclear Information System (INIS)
Zhang Linxi; Sun Tingting
2005-01-01
In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence
To assess diversity of Salmonella enterica serotypes present in poultry and their environment from Southern Brazil, the Kauffman-White-LeMinor (KWL) scheme was used to serotype a total of 155 isolates. Isolates were then re-examined with nested PCR and sequencing of the dkgB-linked Intergenic Sequ...
Shigemura, Hiroaki; Matsui, Mari; Sekizuka, Tsuyoshi; Onozuka, Daisuke; Noda, Tamie; Yamashita, Akifumi; Kuroda, Makoto; Suzuki, Satowa; Kimura, Hirokazu; Fujimoto, Shuji; Oishi, Kazunori; Sera, Nobuyuki; Inoshima, Yasuo; Murakami, Koichi
2018-06-02
Extended-spectrum cephalosporin (ESC)-resistant Salmonella in chicken meat is a significant food safety concern. We previously reported that the prevalence of ESC-resistant Salmonella in chicken meat, giblets, and processed chicken (chicken meat products) increased in Japan between 2005 and 2010, with 27.9% (17/61) of Salmonella isolated from chicken meat products in 2010 showing resistance to ESC. The aims of the present study were to clarify trends in the prevalence of ESC-resistant Salmonella in chicken meat products in Japan between 2011 and 2015, and to determine the genetic profiles of bla-harboring plasmids, including replicon types, using next-generation sequencing. Our results showed that the prevalence of ESC-resistant Salmonella, mainly consisting of AmpC β-lactamase CMY-2-producing isolates, in chicken meat products had increased to 45.5% (10/22) by 2011. However, following the voluntary cessation of ceftiofur use by the Japanese poultry industry in 2012, the prevalence of ESC-resistant Salmonella steadily decreased each year, to 29.2% (7/24), 18.2% (4/22), 10.5% (2/19), and 10.5% (2/19) in 2012, 2013, 2014, and 2015, respectively. Furthermore, no AmpC β-lactamase CMY-2-producing isolates were identified in 2014 and 2015. However, the prevalence of Salmonella enterica subspecies enterica serovar Manhattan isolates harboring a bla TEM-52 -carrying IncX1 plasmid remained steady even after the cessation of ceftiofur use. Therefore, continuous monitoring of ESC resistance amongst Salmonella isolates from chicken meat products is required for food safety. Copyright © 2018. Published by Elsevier B.V.
Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S
2016-08-01
Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
Simulating efficiently the evolution of DNA sequences.
Schöniger, M; von Haeseler, A
1995-02-01
Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
A single-tube screen for Salmonella and Shigella.
Procop, Gary W; Wallace, Jacqueline D; Tuohy, Marion J; Lasalvia, Margret M; Addison, Rachel M; Reller, L Barth
2008-08-01
Salmonella and Shigella species are routinely sought in stool specimens submitted for culture. It is a common practice to screen lactose-negative colonies by using triple sugar iron agar, lysine iron agar, and Christensen urea agar to determine if further identification is necessary. We designed and evaluated a novel combination of media, which are layered in a single tube, for screening isolates suspected to possibly represent Salmonella or Shigella. We tested this media combination with 106 Salmonella, 56 Shigella, and 56 other gram-negative bacilli. All Salmonella and Shigella isolates tested were appropriately characterized as possible Salmonella or Shigella by using an algorithm developed for use with this media combination. Similarly, 53 (95%) of 56 other gram-negative bacilli were appropriately screened as non -Salmonella and non -Shigella isolates. This unique media combination provides the most important biochemical reactions needed to screen for Salmonella and Shigella in a single-tube format, which decreases labor by two thirds (ie, 1 tube is inoculated vs 3).
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Salmonella serotype distribution in the Dutch broiler supply chain.
van Asselt, E D; Thissen, J T N M; van der Fels-Klerx, H J
2009-12-01
Salmonella serotype distribution can give insight in contamination routes and persistence along a production chain. Therefore, it is important to determine not only Salmonella prevalence but also to specify the serotypes involved at the different stages of the supply chain. For this purpose, data from a national monitoring program in the Netherlands were used to estimate the serotype distribution and to determine whether this distribution differs for the available sampling points in the broiler supply chain. Data covered the period from 2002 to 2005, all slaughterhouses (n = 22), and the following 6 sampling points: departure from hatchery, arrival at the farm, departure from the farm, arrival at the slaughterhouse, departure from the slaughterhouse, and end of processing. Furthermore, retail data for 2005 were used for comparison with slaughterhouse data. The following serotypes were followed throughout the chain: Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Paratyphi B var. Java (Salmonella Java), Salmonella Infantis, Salmonella Virchow, and Salmonella Mbandaka. Results showed that serotype distribution varied significantly throughout the supply chain (P supply chain up to the retail phase.
DEFF Research Database (Denmark)
Hartman, Hassan B.; Fell, David A.; Rossell, Sergio
2014-01-01
Salmonella enterica sv. Typhimurium is an established model organism for Gram-negative, intracellular pathogens. Owing to the rapid spread of resistance to antibiotics among this group of pathogens, new approaches to identify suitable target proteins are required. Based on the genome sequence of ...
Directory of Open Access Journals (Sweden)
Lefranc Marie-Paule
2008-10-01
Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By
Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard
2008-10-02
Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we
Reduction of Salmonella in ground chicken using a bacteriophage.
Grant, Ar'Quette; Parveen, Salina; Schwarz, Jurgen; Hashem, Fawzy; Vimini, Bob
2017-08-01
This study's goal was to ascertain the effectiveness of a commercially available Salmonella bacteriophage during ground chicken production focusing on: water source, different Salmonella serovars, and time. Salmonella-free boneless, skinless chicken meat was inoculated with 4.0 Log CFU/cm2 of either a cocktail of 3 Salmonella isolates derived from ground chicken (GC) or a cocktail of 3 Salmonella strains not isolated from ground chicken (non-GC). Bacteriophages were spread onto the chicken using sterile tap or filtered water for 30 min or 8 h. Salmonella was recovered using standard plating method. Greater Salmonella reduction was observed when the bacteriophage was diluted in sterile tap water than in sterile filtered water: 0.39 Log CFU/cm2 and 0.23 Log CFU/cm2 reduction after 30 min, respectively (P Salmonella's susceptibility to the bacteriophage, and treatment time. © 2017 Poultry Science Association Inc.
Bai, Jaewoo; Kim, Seul I; Ryu, Sangryeol
2014-01-01
Salmonella enterica serovar Typhimurium is a primary cause of enteric diseases and has acquired a variety of virulence factors during its evolution into a pathogen. Secreted virulence factors interact with commensal flora and host cells and enable Salmonella to survive and thrive in hostile environments. Outer membrane vesicles (OMVs) released from many Gram-negative bacteria function as a mechanism for the secretion of complex mixtures, including virulence factors. We performed a proteomic analysis of OMVs that were isolated under standard laboratory and acidic minimal medium conditions and identified 14 OMV-associated proteins that were observed in the OMV fraction isolated only under the acidic minimal medium conditions, which reproduced the nutrient-deficient intracellular milieu. The inferred roles of these 14 proteins were diverse, including transporter, enzyme, and transcriptional regulator. The absence of these proteins influenced Salmonella survival inside murine macrophages. Eleven of these proteins were predicted to possess secretion signal sequences at their N termini, and three (HupA, GlnH, and PhoN) of the proteins were found to be translocated into the cytoplasm of host cells. The comparative proteomic profiling of OMVs performed in this study revealed different protein compositions in the OMVs isolated under the two different conditions, which indicates that the OMV cargo depends on the growth conditions and provides a deeper insight into how Salmonella utilizes OMVs to adapt to environmental changes. PMID:24935973
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Directory of Open Access Journals (Sweden)
Rachid Elgroud
2015-01-01
Full Text Available An epidemiological investigation was carried out on one hundred Salmonella isolates from broiler farms, slaughterhouses, and human patients in the Constantine region of Algeria, in order to explore the contribution of avian strains to human salmonellosis cases in this region over the same period of time. The isolates were characterized by phenotypic as well as genotypic methods. A large variety of antimicrobial resistance profiles was found among human isolates, while only seven profiles were found among avian isolates. Enterobacterial Repetitive Intergenic Consensus-PCR (ERIC-PCR, Insertion Sequence 200-PCR (IS200-PCR, and Pulsed Field Gel Electrophoresis (PFGE resulted in the allocation of the isolates to 16, 20, and 34 different profiles, respectively. The 3 genotyping methods led to complementary results by underlining the clonality of some serovars with the diffusion and persistence of a single clone in the Constantine area as well as stressing the polymorphism present in isolates belonging to other serovars, indicating the diversity of potential reservoirs of nontyphoidal Salmonella. Altogether, our results seem to indicate that nontyphoidal avian Salmonella may play an important role in human salmonellosis in the Constantine region.
Directory of Open Access Journals (Sweden)
Zafer Ata
2014-01-01
Full Text Available Quinolones have been extensively used for treatment of a variety of invasive and systemic infections of salmonellosis. Widespread use of these agents has been associated with the emergence and dissemination of quinolone-resistant pathogens. The quinolone resistance and plasmid-mediated quinolone resistance determinants (qnrA, qnrB, qnrS and aac(6’-Ib-cr of 85 Salmonella isolates from chicken carcasses were investigated in this study. Isolates were serotyped according to the Kauffman-White-Le Minor scheme, and broth microdilution method was used to determine quinolone resistance. Plasmid-mediated quinolone resistance genes were investigated by real-time PCR and positive results were confirmed by sequencing. Among the Salmonella isolates, 30/85 (35% and 18/85 (21% were found to be resistant to enrofloxacin (MIC ≥ 2 mg/ml, and danofloxacin (MIC ≥ 2 mg/ml, respectively. All the isolates were negative for qnrA, qnrB and aac(6’-Ib-cr genes, nevertheless 2% (S. Brandenburg and S. Dabou were positive for qnrS (qnrS1 determinant. This study is the first and unique investigating the plasmid- mediated quinolone resistance determinants of Salmonella isolated from chicken carcasses in Turkey.
Directory of Open Access Journals (Sweden)
Oliveiro Caetano de Freitas Neto
2008-06-01
Full Text Available Salmonella Enteritidis is one of the agents that is responsible for outbreaks of human foodborne salmonellosis caused by Salmonella Enteritidis and is generally associated with the consumption of poultry products. Inactivated Salmonella Enteritidis cell vaccine is one of the available methods to control Salmonella Enteritidis in breeders and laying hens, however results in terms of efficacy vary. This vaccine has never been tested in Brazil, therefore, the present work was carried out to assess three commercial inactivated Salmonella Enteritidis vaccines allowed in Brazil. Four hundred white light variety commercial laying hens were obtained at one-day-of age. At eight weeks old, the birds were divided into four groups with one hundred animals each. Birds from three groups (V1, V2 and V3 received different intramuscular vaccines, followed by a booster dose at 16 weeks of age. Birds from another group (CG were not vaccinated. When the laying hens were 20, 25 and 31 weeks old, 13 from each group were transferred to another room and were challenged by inoculating 2 mL neat culture of Salmonella Enteritidis. On the second day after each challenge, the caecal contents, spleen, liver and ovary of three birds from each group were analyzed for the presence of Salmonella Enteritidis. Twice a week a cloacal swab of each bird was taken and all eggs laid were examined for the presence of Salmonella Enteritidis. After four consecutive negative cloacal swabs in all the groups, the birds were sacrificed so as to examine the liver, caecal contents and ovaries. Overall, the inactivated vaccine used in group V3 reduced Salmonella Enteritidis in the feces and eggs. A very small amount of Salmonella was found in the spleen, liver, ovary and caeca of the birds in the four groups during the whole experiment. In general, inactivated Salmonella Enteritidis vaccines was able to decrease the presence of Salmonella Enteritidis in the birds and in the eggs as well
Cellulitis Due to Salmonella infantis.
Directory of Open Access Journals (Sweden)
Satish R Patil
2013-01-01
Full Text Available Bacteria of the genus Salmonella are highly adapted for the growth in both humans and animals and cause a wide spectrum of disease. The growth of Serotypes S. typhi and S. paratyphi is restricted to human hosts, in whom these organisms cause enteric (typhoid fever. The remaining Serotypes (non typhoidal Salmonella or NTS can colonize the gastrointestinal tracts of the broad range of animals, including mammals, reptiles, birds and insects. The usual clinical presentation of non-typhoidal salmonellae (NTS infection is self limited gastroenteritis; however bacteremia and focal extra intestinal infection may occur. However salmonella localization to the skin presenting as cutaneous ulceration is regarded as a rare event. Rates of morbidity and mortality associated with NTS are highest among the elderly, infants, and immunocompromised individuals, including those with hemoglobinopathies, HIV infection, or infections that cause blockade of the reticuloendothelial system. We isolated S.infantis in 50 years old man with left leg cellulitis. The serotype was confirmed at Central Research Institute, Kasauli.
Noda, Tamie; Murakami, Koichi; Etoh, Yoshiki; Okamoto, Fuyuki; Yatsuyanagi, Jun; Sera, Nobuyuki; Furuta, Munenori; Onozuka, Daisuke; Oda, Takahiro; Asai, Tetsuo; Fujimoto, Shuji
2015-01-01
Extended-spectrum β-lactamase (ESBL)-producing Salmonella are one of the most important public health problems in developed countries. ESBL-producing Salmonella strains have been isolated from humans in Asian countries neighboring Japan, along with strains harboring the plasmid-mediated extended-spectrum cephalosporin (ESC)-resistance gene, ampC (pAmpC). However, only a few studies have investigated the prevalence of ESC-resistant Salmonella in chicken products in Japan, which are the main vehicle of Salmonella transmission. The aim of this study was to investigate the prevalence of ESBL-producing, pAmpC-harboring, or carbapenem-resistant Salmonella in chicken products in Japan. In total, 355 out of 779 (45.6%) chicken product samples collected from 1996-2010 contained Salmonella, resulting in 378 distinct isolates. Of these isolates, 373 were tested for resistance to ESCs, cephamycins, or carbapenems. Isolates that showed resistance to one or more of these antimicrobials were then examined by PCR and DNA sequence analysis for the presence of the bla(CMY), bla(CTX-M), bla(TEM), and bla(SHV) resistance genes. Thirty-five resistant isolates were detected, including 26 isolates that contained pAmpC (bla(CMY-2)), and nine ESBL-producing isolates harboring bla(CTX-M) (n = 4, consisting of two bla(CTX-M-2) and two bla(CTX-M-15 genes)), bla(TEM) (n = 4, consisting of one bla(TEM-20) and three bla(TEM-52) genes), and bla(SHV) (n = 1, bla(SHV-12)). All pAmpC-harboring and ESBL-producing Salmonella isolates were obtained from samples collected after 2005, and the percentage of resistant isolates increased significantly from 0% in 2004 to 27.9% in 2010 (P for trend = 0.006). This increase was caused in part by an increase in the number of Salmonella enterica subsp. enterica serovar Infantis strains harboring an approximately 280-kb plasmid containing bla(CMY-2) in proximity to ISEcp1. The dissemination of ESC-resistant Salmonella containing plasmid-mediated bla(CMY-2) in
Directory of Open Access Journals (Sweden)
Tamie Noda
Full Text Available Extended-spectrum β-lactamase (ESBL-producing Salmonella are one of the most important public health problems in developed countries. ESBL-producing Salmonella strains have been isolated from humans in Asian countries neighboring Japan, along with strains harboring the plasmid-mediated extended-spectrum cephalosporin (ESC-resistance gene, ampC (pAmpC. However, only a few studies have investigated the prevalence of ESC-resistant Salmonella in chicken products in Japan, which are the main vehicle of Salmonella transmission. The aim of this study was to investigate the prevalence of ESBL-producing, pAmpC-harboring, or carbapenem-resistant Salmonella in chicken products in Japan. In total, 355 out of 779 (45.6% chicken product samples collected from 1996-2010 contained Salmonella, resulting in 378 distinct isolates. Of these isolates, 373 were tested for resistance to ESCs, cephamycins, or carbapenems. Isolates that showed resistance to one or more of these antimicrobials were then examined by PCR and DNA sequence analysis for the presence of the bla(CMY, bla(CTX-M, bla(TEM, and bla(SHV resistance genes. Thirty-five resistant isolates were detected, including 26 isolates that contained pAmpC (bla(CMY-2, and nine ESBL-producing isolates harboring bla(CTX-M (n = 4, consisting of two bla(CTX-M-2 and two bla(CTX-M-15 genes, bla(TEM (n = 4, consisting of one bla(TEM-20 and three bla(TEM-52 genes, and bla(SHV (n = 1, bla(SHV-12. All pAmpC-harboring and ESBL-producing Salmonella isolates were obtained from samples collected after 2005, and the percentage of resistant isolates increased significantly from 0% in 2004 to 27.9% in 2010 (P for trend = 0.006. This increase was caused in part by an increase in the number of Salmonella enterica subsp. enterica serovar Infantis strains harboring an approximately 280-kb plasmid containing bla(CMY-2 in proximity to ISEcp1. The dissemination of ESC-resistant Salmonella containing plasmid-mediated bla(CMY-2 in chicken
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.
2009-08-01
The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
An extended sequence specificity for UV-induced DNA damage.
Chung, Long H; Murray, Vincent
2018-01-01
The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Rapid radiometric method for detection of Salmonella in foods
International Nuclear Information System (INIS)
Stewart, B.J.; Eyles, M.J.; Murrell, W.G.
1980-01-01
A radiometric method for the detection of Salmonella in foods has been developed which is based on Salmonella poly H agglutinating serum preventing Salmonella from producing 14CO2 from [14C] dulcitol. The method will detect the presence or absence of Salmonella in a product within 30 h compared to 4 to 5 days by routine culture methods. The method has been evaluated against a routine culture method using 58 samples of food. The overall agreement was 91%. Five samples negative for Salmonella by the routine method were positive by the radiometric method. These may have been false positives. However, the routine method may have failed to detect Salmonella due to the presence of large numbers of lactose-fermenting bacteria which hindered isolation of Salmonella colonies on the selective agar plates
Salmonella capture using orbiting magnetic microbeads
Owen, Drew; Ballard, Matthew; Mills, Zachary; Hanasoge, Srinivas; Hesketh, Peter; Alexeev, Alexander
2014-11-01
Using three-dimensional simulations and experiments, we examine capture of salmonella from a complex fluid sample flowing through a microfluidic channel. Capture is performed using orbiting magnetic microbeads, which can easily be extracted from the system for analysis after salmonella capture. Numerical simulations are used to model the dynamics of the system, which consists of a microchannel filled with a viscous fluid, model salmonella, magnetic microbeads and a series of angled parallel ridges lining the top of the microchannel. Simulations provide a statistical measure of the ability of the system to capture target salmonella. Our modeling findings guide the design of a lab-on-a-chip experimental device to be used for the detection of salmonella from complex food samples, allowing for the detection of the bacteria at the food source and preventing the consumption of contaminated food. Such a device can be used as a generic platform for the detection of a variety of biomaterials from complex fluids. This work is supported by a grant from the United States Department of Agriculture.
Moon, Jihea; Kim, Giyoung; Lee, Sangdae; Park, Saetbyeol
2013-11-01
Conventional methods for detection of infective organisms, such as Salmonella, are complicated and require multiple steps, and the need for rapid detection has increased. Biosensors show great potential for rapid detection of pathogens. In turn, aptamers have great potential for biosensor assay development, given their small size, ease of synthesis and labeling, lack of immunogenicity, a lower cost of production than antibodies, and high target specificity. In this study, ssDNA aptamers specific to Salmonella Typhimurium were obtained by a whole bacterium-based systematic evolution of ligands by exponential enrichment (SELEX) procedure and applied to probing S. Typhimurium. After 10 rounds of selection with S. Typhimurium as the target and Salmonella Enteritidis, Escherichia coli and Staphylococcus aureus as counter targets, the highly enriched oligonucleic acid pool was sorted using flow cytometry. In total, 12 aptamer candidates from different families were sequenced and grouped. Fluorescent analysis demonstrated that aptamer C4 had particularly high binding affinity and selectivity; this aptamer was then further characterized. © 2013 Elsevier B.V. All rights reserved.
Voogt N; Veld PH in ' t; Nagelkerke N; Henken AM; MGB
1997-01-01
Het Communautair Referentie Laboratorium voor Salmonella heeft een tweede bacteriologisch ringonderzoek georganiseerd met deelname van de Nationale Referentie Laboratoria voor Salmonella. Het belangrijkste doel van dit onderzoek was verschillen tussen de NRLs in de resultaten van Salmonella
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Sources of salmonellae in an uninfected commercially-processed broiler flock.
Rigby, C E; Pettit, J R; Baker, M F; Bentley, A H; Salomons, M O; Lior, H
1980-07-01
Cultural monitoring was used to study the incidence and sources of salmonellae in a 4160 bird broiler flock during the growing period, transport and processing in a commercial plant. No salmonellae were isolated from any of 132 litter samples of 189 chickens cultured during the seven-week growing period, even though nest litter samples from four of the eight parent flocks yielded salmonellae and Salmonella worthington was isolated from the meat meal component of the grower ration. On arrival at the plant, 2/23 birds sampled carried S. infantis on their feathers, although intestinal cultures failed to yield salmonellae. Three of 18 processed carcasses samples yielded salmonellae (S. infantis, S. heidelberg, S. typhimurium var copenhagen). The most likely source of these salmonellae was the plastic transport crates, since 15/107 sampled before the birds were loaded yielded salmonellae (S. infantis, S. typhimurium). The crate washer at the plant did not reduce the incidence of Salmonella-contaminated crates, since 16/116 sampled after washing yielded salmonellae (S. infantis, S. typhimurium, S. heidelberg, S. schwarzengrund, S. albany).
Preparation of protected nucleotides usable in oligonucleotide synthesis
International Nuclear Information System (INIS)
Debiard, Jean-Pascal
1983-01-01
After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr
Son, Manki; Kim, Daesan; Kang, Jinkyung; Lim, Jong Hyun; Lee, Seung Hwan; Ko, Hwi Jin; Hong, Seunghun; Park, Tai Hyun
2016-12-06
Salmonella infection is the one of the major causes of food borne illnesses including fever, abdominal pain, diarrhea, and nausea. Thus, early detection of Salmonella contamination is important for our healthy life. Conventional detection methods for the food contamination have limitations in sensitivity and rapidity; thus, the early detection has been difficult. Herein, we developed a bioelectronic nose using a carbon nanotube (CNT) field-effect transistor (FET) functionalized with Drosophila odorant binding protein (OBP)-derived peptide for easy and rapid detection of Salmonella contamination in ham. 3-Methyl-1-butanol is known as a specific volatile organic compound, generated from the ham contaminated with Salmonella. We designed and synthesized the peptide based on the sequence of the Drosophila OBP, LUSH, which specifically binds to alcohols. The C-terminus of the synthetic peptide was modified with three phenylalanine residues and directly immobilized onto CNT channels using the π-π interaction. The p-type properties of FET were clearly maintained after the functionalization using the peptide. The biosensor detected 1 fM of 3-methyl-1-butanol with high selectivity and successfully assessed Salmonella contamination in ham. These results indicate that the bioelectronic nose can be used for the rapid detection of Salmonella contamination in food.
Survival of Salmonella during baking of peanut butter cookies.
Lathrop, Amanda A; Taylor, Tiffany; Schnepf, James
2014-04-01
Peanuts and peanut-based products have been the source of recent Salmonella outbreaks worldwide. Because peanut butter is commonly used as an ingredient in baked goods, such as cookies, the potential risk of Salmonella remaining in these products after baking needs to be assessed. This research examines the potential hazard of Salmonella in peanut butter cookies when it is introduced via the peanut-derived ingredient. The survival of Salmonella during the baking of peanut butter cookies was determined. Commercial, creamy-style peanut butter was artificially inoculated with a five-strain Salmonella cocktail at a target concentration of 10(8) CFU/g. The inoculated peanut butter was then used to prepare peanut butter cookie dough following a standard recipe. Cookies were baked at 350 °F (177 °C) and were sampled after 10, 11, 12, 13, 14, and 15 min. Temperature profiles of the oven and cookies were monitored during baking. The water activity and pH of the inoculated and uninoculated peanut butter, raw dough, and baked cookies were measured. Immediately after baking, cookies were cooled, and the survival of Salmonella was determined by direct plating or enrichment. After baking cookies for 10 min, the minimum reduction of Salmonella observed was 4.8 log. In cookies baked for 13 and 14 min, Salmonella was only detectable by enrichment reflecting a Salmonella reduction in the range of 5.2 to 6.2 log. Cookies baked for 15 min had no detectable Salmonella. Results of this study showed that proper baking will reduce Salmonella in peanut butter cookies by 5 log or more.
Conservation of Salmonella infection mechanisms in plants and animals.
Directory of Open Access Journals (Sweden)
Adam Schikora
Full Text Available Salmonella virulence in animals depends on effectors injected by Type III Secretion Systems (T3SSs. In this report we demonstrate that Salmonella mutants that are unable to deliver effectors are also compromised in infection of Arabidopsis thaliana plants. Transcriptome analysis revealed that in contrast to wild type bacteria, T3SS mutants of Salmonella are compromised in suppressing highly conserved Arabidopsis genes that play a prominent role during Salmonella infection of animals. We also found that Salmonella originating from infected plants are equally virulent for human cells and mice. These results indicate a high degree of conservation in the defense and infection mechanism of animal and plant hosts during Salmonella infection.
Directory of Open Access Journals (Sweden)
Kien-Pong eYap
2016-03-01
Full Text Available Typhoid fever, caused by Salmonella enterica serovar Typhi, remains an important public health burden in Southeast Asia and other endemic countries. Various genotyping methods have been applied to study the genetic variations of this human-restricted pathogen. Multilocus Sequence Typing (MLST is one of the widely accepted methods, and recently, there is a growing interest in the re-application of MLST in the post-genomic era. In this study, we provide the global MLST distribution of S. Typhi utilizing both publicly available 1,826 S. Typhi genome sequences in addition to performing conventional MLST on S. Typhi strains isolated from various endemic regions spanning over a century. Our global MLST analysis confirms the predominance of two sequence types (ST1 and ST2 co-existing in the endemic regions. Interestingly, S. Typhi strains with ST8 are currently confined within the African continent. Comparative genomic analyses of ST8 and other rare STs with genomes of ST1/ST2 revealed unique mutations in important virulence genes such as flhB, sipC and tviD that may explain the variations that differentiate between seemingly successful (widespread and unsuccessful (poor dissemination S. Typhi populations. Large scale whole-genome phylogeny demonstrated evidence of phylogeographical structuring and showed that ST8 may have diverged from the earlier ancestral population of ST1 and ST2, which later lost some of its fitness advantages, leading to poor worldwide dissemination. In response to the unprecedented increase in genomic data, this study demonstrates and highlights the utility of large-scale genome-based MLST as a quick and effective approach to narrow the scope of in-depth comparative genomic analysis and consequently provide new insights into the fine scale of pathogen evolution and population structure.
Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.
Directory of Open Access Journals (Sweden)
Enying Zhang
Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.
Foster, J W; Kinney, D M; Moat, A G
1979-03-01
Mutants of Salmonella typhimurium LT-2 deficient in nicotinamidase activity (pncA) or nicotinic acid phosphoribosyltransferase activity (pncB) were isolated as resistant to analogs of nicotinic acid and nicotinamide. Information obtained from interrupted mating experiments placed the pncA gene at 27 units and the pncB gene at 25 units on the S. typhimurium LT-2 linkage map. A major difference in the location of the pncA gene was found between the S. typhimurium and Escherichia coli linkage maps. The pncA gene is located in a region in which there is a major inversion of the gene order in S. typhimurium as compared to that in E. coli. Growth experiments using double mutants blocked in the de novo pathway to nicotinamide adenine dinucleotide (NAD) (nad) and in the pyridine nucleotide cycle (pnc) at either the pncA or pncB locus, or both, have provided evidence for the existence of an alternate recycling pathway in this organism. Mutants lacking this alternate cycle, pncC, have been isolated and mapped via cotransduction at 0 units. Utilization of exogenous NAD was examined through the use of [14C]carbonyl-labeled NAD and [14C]adenine-labeled NAD. The results of these experiments suggest that NAD is degraded to nicotinamide mononucleotide at the cell surface. A portion of this extracellular nicotinamide mononucleotide is then transported across the cell membrane by nicotinamide mononucleotide glycohydrolase and degraded to nicotinamide in the process. The remaining nicotinamide mononucleotide accumulates extracellularly and will support the growth of nadA pncB mutants which cannot utilize the nicotinamide resulting from the major pathway of NAD degradation. A model is presented for the utilization of exogenous NAD by S. typhimurium LT-2.
Vo, An T T; Duijkeren, Engeline van; Fluit, Ad C; Wannet, Wim J B; Verbruggen, Anjo J; Maas, Henny M E; Gaastra, Wim
2006-01-01
The objective of this study was to investigate the antimicrobial resistance patterns, integron characteristics and gene cassettes as well as the presence of Salmonella genomic island 1 (SGI1) in non-typhoidal Salmonella (NTS) isolates from human and animal origin. Epidemiologically unrelated Dutch
LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E
DEFF Research Database (Denmark)
Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael
2002-01-01
Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....
Directory of Open Access Journals (Sweden)
P.N. Agbedanu
2013-07-01
Full Text Available In an effort to investigate the molecular basis of protozoa engulfment-mediated hypervirulence of Salmonella in cattle, we evaluated protozoan G protein-coupled receptors (GPCRs as transducers of Salmonella engulfment by the model protozoan Tetrahymena. Our laboratory previously demonstrated that non-pathogenic protozoa (including Tetrahymena engulf Salmonella and then exacerbate its virulence in cattle, but the mechanistic details of the phenomenon are not fully understood. GPCRs were investigated since these receptors facilitate phagocytosis of particulates by Tetrahymena, and a GPCR apparently modulates bacterial engulfment for the pathogenic protozoan Entamoeba histolytica. A database search identified three putative Tetrahymena GPCRs, based on sequence homologies and predicted transmembrane domains, that were the focus of this study. Salmonella engulfment by Tetrahymena was assessed in the presence of suramin, a non-specific GPCR inhibitor. Salmonella engulfment was also assessed in Tetrahymena in which expression of putative GPCRs was knocked-down using RNAi. A candidate GPCR was then expressed in a heterologous yeast expression system for further characterization. Our results revealed that Tetrahymena were less efficient at engulfing Salmonella in the presence of suramin. Engulfment was reduced concordantly with a reduction in the density of protozoa. RNAi-based studies revealed that knock-down of one the Tetrahymena GPCRs caused diminished engulfment of Salmonella. Tetrahymena lysates activated this receptor in the heterologous expression system. These data demonstrate that the Tetrahymena receptor is a putative GPCR that facilitates bacterial engulfment by Tetrahymena. Activation of the putative GPCR seemed to be related to protozoan cell density, suggesting that its cognate ligand is an intercellular signaling molecule.
Incidence of Salmonella contamination in broiler chickens in Saskatchewan.
Bhargava, K K; O'Neil, J B; Prior, M G; Dunkelgod, K E
1983-01-01
The incidence of Salmonella contamination in ten Saskatchewan broiler flocks varying in size from 6 200 to 14 000 was investigated from February, 1977 to April, 1979. Prior to the initial chick placement, brooding equipment, feed, water and fresh litter samples were found to be free of Salmonellae. Samples obtained from the clean and disinfected processing plant equipment before the commencement of daily operation were negative except the isolation for Salmonella anatum from the fingers of the defeathering machine in flock 4. There was no evidence of Salmonella contamination in flocks 5, 6, 8 and 10. The incidence of Salmonella was lower when cloacal swabs were taken from day old chicks fasted for 48 hours than for the same groups of chicks when carcasses were blended in nutrient broth (flocks 7 and 9). The blending of such chicks appears to be a more critical test. The serotypes isolated from eviscerated birds were the same as those isolated from used litter samples. Salmonella saintpaul was isolated from a water sample at 53 days in flock 1 and the same serotype was recovered from the intestinal contents and skin of eviscerated birds. Salmonella typhimurium was recovered from the eviscerated birds and neck samples in flock 3. In flock 4, S. saintpaul and S. anatum were isolated from 13% of the eviscerated birds sampled. Salmonella thompson, Salmonella agona and Salmonella heidelberg were recovered from 61%, 5% and 1%, respectively, of the processed carcasses sampled in flock 7.
Salmonella serovar spectrum associated with reptiles in Poland
Directory of Open Access Journals (Sweden)
Tomasz Piasecki
2014-01-01
Full Text Available This study aimed to evaluate the incidence of Salmonella isolates from a wide variety of reptiles in Poland. A total of 374 faecal samples from chelonians, lizards and snakes were collected between 2009 and 2012. The nested, two-step PCR and multiplex PCR were performed to access the incidence and to characterize Salmonella isolates. Salmonella strains were found in 122 of 374 samples (32.6%. Among the different reptilian species, Salmonella strains were found in 58 samples from lizards (38.9%, 31 samples from snakes (28.7% and 33 samples from chelonians (28.2%. Of the total of 122 strains, 72 belonged to the species Salmonella enterica subsp. enterica, 20 to the species S. enterica subs. salamae or S. enterica subs. houtanae. The incidence of S. enterica subs. diarizonae and S. enterica subs. indica was low, constituting less than 3.5% of the examined population. The findings show that reptiles can be considered as a reservoir for Salmonella and hence could pose a zoonotic hazard. In addition, multiplex PCR assay is a rapid, specific and easy-to-perform method and might be applied for rapid screening of large numbers of Salmonella samples.
Salmonella Typhimurium infection in the porcine intestine
DEFF Research Database (Denmark)
Schauser, Kirsten; Olsen, John Elmerdahl; Larsson, Lars-Inge
2005-01-01
The normal intestinal epithelium is renewed with a turnover rate of 3-5 days. During Salmonella infection increased cell loss is observed, possibly as a result of programmed cell death (PCD). We have, therefore, studied the effects of Salmonella Typhimurium infection on three elements involved...... in scattered epithelial cells and the number of positive cells increased with increasing times of exposure to Salmonella (P
DEFF Research Database (Denmark)
Kjeldsen, Marianne Kirstine; Torpdahl, Mia; Pedersen, Karl
2015-01-01
serovars can be typed. We developed a MLVA scheme for high discriminatory typing of Salmonella. Methods and Results Sixty-six unique VNTRs were investigated and the polymorphisms of seven promising VNTRs were evaluated with a panel 163 diverse isolates of 14 serotypes of significance for human health. Five......-related strains. Conclusions The technique showed a high discriminatory power within most serotypes comparable with or better than that of PFGE. Significance and impact of the Study This MLVA assay makes it possible to use a single typing method for Salmonella surveillance and outbreak investigations. This allows...... inexpensive and fast surveillance for laboratories without resources for both serotyping and molecular typing, e.g. PFGE or sequence-based methods, and thereby improve the effectiveness of epidemiological investigations of Salmonella infections globally....
Mather, Alison E; Vaughan, Timothy G; French, Nigel P
2015-11-01
Nontyphoidal Salmonella (NTS) is a frequent cause of diarrhea around the world, yet in many African countries it is more commonly associated with invasive bacterial disease. Various source attribution models have been developed that utilize microbial subtyping data to assign cases of human NTS infection to different animal populations and foods of animal origin. Advances in molecular microbial subtyping approaches, in particular whole-genome sequencing, provide higher resolution data with which to investigate these sources. In this review, we provide updates on the source attribution models developed for Salmonella, and examine the application of whole-genome sequencing data combined with evolutionary modeling to investigate the putative sources and transmission pathways of NTS, with a focus on the epidemiology of NTS in Africa. This is essential information to decide where, what, and how control strategies might be applied most effectively. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Directory of Open Access Journals (Sweden)
Xiaolin Ji
Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.
Krieger, Viktoria; Liebl, David; Zhang, Yuying; Rajashekar, Roopa; Chlanda, Petr; Giesker, Katrin; Chikkaballi, Deepak; Hensel, Michael
2014-01-01
During the intracellular life of Salmonella enterica, a unique membrane-bound compartment termed Salmonella-containing vacuole, or SCV, is formed. By means of translocated effector proteins, intracellular Salmonella also induce the formation of extensive, highly dynamic membrane tubules termed Salmonella-induced filaments or SIF. Here we report the first detailed ultrastructural analyses of the SCV and SIF by electron microscopy (EM), EM tomography and live cell correlative light and electron microscopy (CLEM). We found that a subset of SIF is composed of double membranes that enclose portions of host cell cytosol and cytoskeletal filaments within its inner lumen. Despite some morphological similarities, we found that the formation of SIF double membranes is independent from autophagy and requires the function of the effector proteins SseF and SseG. The lumen of SIF network is accessible to various types of endocytosed material and our CLEM analysis of double membrane SIF demonstrated that fluid phase markers accumulate only between the inner and outer membrane of these structures, a space continual with endosomal lumen. Our work reveals how manipulation of the endosomal membrane system by an intracellular pathogen results in a unique tubular membrane compartmentalization of the host cell, generating a shielded niche permissive for intracellular proliferation of Salmonella. PMID:25254663
Salmonella spp. on chicken carcasses in processing plants in Poland.
Mikołajczyk, Anita; Radkowski, Mieczysław
2002-09-01
Chickens at selected points in the slaughter process and after slaughter on the dressing line in poultry plants were sampled and analyzed for Salmonella. These chickens came from the northeast part of Poland. The examinations were carried out in quarters I, II, III, and IV of 1999. All the birds were determined to be healthy by a veterinary inspection. Swab samples were taken from the cloaca after stunning and from the skin surface and body cavity of the whole bird after evisceration, after rinsing at the final rinse station but before chilling in the spin-chiller, and after cooling in the continuous cooling plant at the end of the production day. In 1999, 400 whole chickens were examined. The percentage of these 400 chickens from which Salmonella spp. were isolated was relatively high (23.75%; Salmonella-positive results were observed in 95 cases). Salmonella spp. were found after stunning in 6% of the chickens (6 of 100 samples), after evisceration in 24% (24 of 100), before cooling in 52% (52 of 100), and after cooling in 13% (13 of 100). These results show that Salmonella spp. were found more often at some processing points than at others. The lowest Salmonella spp. contamination rate (6%) for slaughter birds was found after stunning, and the highest contamination rate was found before chilling (52%). The serological types of Salmonella spp. isolated from whole chickens were Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Saintpaul, Salmonella Agona, and Salmonella Infantis. The results of these investigations indicate that Salmonella Enteritidis is the dominant serological type in infections of slaughter chickens, as it is in many countries.
Djeffal, Samia; Bakour, Sofiane; Mamache, Bakir; Elgroud, Rachid; Agabou, Amir; Chabou, Selma; Hireche, Sana; Bouaziz, Omar; Rahal, Kheira; Rolain, Jean-Marc
2017-05-15
The aims of this study were to investigate Salmonella contamination in broiler chicken farms and slaughterhouses, to assess the antibiotic resistance profile in avian and human Salmonella isolates, and to evaluate the relationship between avian and human Extended Spectrum β-Lactamase (ESBL)-producing isolates. Salmonella was screened in different sample matrices collected at thirty-two chicken farms and five slaughterhouses. The human isolates were recovered from clinical specimens at the University Teaching Hospital of Constantine (UTH). All suspected colonies were confirmed by MALDI-TOF (Matrix Assisted Laser Desorption Ionization Time OF light) and serotyped. Susceptibility testing against 13 antibiotics including, amoxicillin/clavulanic acid, ticarcillin, cefoxitin, cefotaxime, aztreonam, imipenem, ertapenem, gentamicin, amikacin, ciprofloxacin, colistin, trimethoprim/sulfamethoxazole and fosfomycin, was performed using the disk diffusion method on Mueller-Hinton agar. ESBL-production was screened by the double-disk synergy test and confirmed by molecular characterization using PCR (polymerase chain reaction) amplification and sequencing of ESBL encoding genes. Clonality of the avian and human strains was performed using the Multi Locus Sequencing Typing method (MLST). Forty-five isolated avian Salmonella strains and 37 human collected ones were studied. Five S. enterica serotypes were found in avian isolates (mainly Kentucky) and 9 from human ones (essentially Infantis). 51.11% and 26.6% of the avian isolates were resistant to ciprofloxacin and cefotaxime, respectively, whereas human isolates were less resistant to these antibiotics (13.5% to ciprofloxacin and 16.2% to cefotaxime). Eighteen (12 avian and 6 human) strains were found to produce ESBLs, which were identified as bla CTX-M-1 (n = 12), bla CTX-M-15 (n = 5) and bla TEM group (n = 8). Interestingly, seven of the ESBL-producing strains (5 avian and 2 human) were of the same ST (ST15) and
9 CFR 113.30 - Detection of Salmonella contamination.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of Salmonella contamination... REQUIREMENTS Standard Procedures § 113.30 Detection of Salmonella contamination. The test for detection of Salmonella contamination provided in this section shall be conducted when such a test is prescribed in an...
Characterization of a multidrug resistant Salmonella enterica give ...
African Journals Online (AJOL)
Salmonella enterica Give is one of the serotypes that have been incriminated in Salmonella infections; sometimes associated with hospitalization and mortalities in humans and animals in some parts of the world. In this work, we characterized one Salmonella Give isolated from cloaca swab of an Agama agama lizard ...
Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John
2013-01-01
The 3M Molecular Detection Assay (MDA) Salmonella is used with the 3M Molecular Detection System for the detection of Salmonella spp. in food, food-related, and environmental samples after enrichment. The assay utilizes loop-mediated isothermal amplification to rapidly amplify Salmonella target DNA with high specificity and sensitivity, combined with bioluminescence to detect the amplification. The 3M MDA Salmonella method was compared using an unpaired study design in a multilaboratory collaborative study to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG 4.05), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg and Catfish Products for raw ground beef and the U.S. Food and Drug Administration/Bacteriological Analytical Manual (FDA/BAM) Chapter 5 Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the POD of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were obtained: -0.04 (-0.16, +0.09). No significant differences were observed in the number of positive
Interactions of Salmonella with animals and plants.
Wiedemann, Agnès; Virlogeux-Payant, Isabelle; Chaussé, Anne-Marie; Schikora, Adam; Velge, Philippe
2014-01-01
Salmonella enterica species are Gram-negative bacteria, which are responsible for a wide range of food- and water-borne diseases in both humans and animals, thereby posing a major threat to public health. Recently, there has been an increasing number of reports, linking Salmonella contaminated raw vegetables and fruits with food poisoning. Many studies have shown that an essential feature of the pathogenicity of Salmonella is its capacity to cross a number of barriers requiring invasion of a large variety of cells and that the extent of internalization may be influenced by numerous factors. However, it is poorly understood how Salmonella successfully infects hosts as diversified as animals or plants. The aim of this review is to describe the different stages required for Salmonella interaction with its hosts: (i) attachment to host surfaces; (ii) entry processes; (iii) multiplication; (iv) suppression of host defense mechanisms; and to point out similarities and differences between animal and plant infections.
Interactions of Salmonella with animals and plants
Directory of Open Access Journals (Sweden)
Agnès eWiedemann
2015-01-01
Full Text Available Salmonella enterica species is a Gram negative bacterium, which is responsible for a wide range of food- and water-borne diseases in both humans and animals, thereby posing a major threat to public health. Recently, there has been an increasing number of reports, linking Salmonella contaminated raw vegetables and fruit with food poisoning. Many studies have shown that an essential feature of the pathogenicity of Salmonella is its capacity to cross a number of barriers requiring invasion of a large variety of cells and that the extent of internalization may be influenced by numerous factors. However, it is poorly understood how Salmonella successfully infects hosts as diversified as animals or plants. The aim of this review is to describe the different stages required for Salmonella interaction with its hosts: (i attachment to host surfaces; (ii entry processes; (iii, multiplication; (iv suppression of host defence mechanisms ; and to point out similarities and differences between animal and plant infections.
Interactions of Salmonella with animals and plants
Wiedemann, Agnès; Virlogeux-Payant, Isabelle; Chaussé, Anne-Marie; Schikora, Adam; Velge, Philippe
2015-01-01
Salmonella enterica species are Gram-negative bacteria, which are responsible for a wide range of food- and water-borne diseases in both humans and animals, thereby posing a major threat to public health. Recently, there has been an increasing number of reports, linking Salmonella contaminated raw vegetables and fruits with food poisoning. Many studies have shown that an essential feature of the pathogenicity of Salmonella is its capacity to cross a number of barriers requiring invasion of a large variety of cells and that the extent of internalization may be influenced by numerous factors. However, it is poorly understood how Salmonella successfully infects hosts as diversified as animals or plants. The aim of this review is to describe the different stages required for Salmonella interaction with its hosts: (i) attachment to host surfaces; (ii) entry processes; (iii) multiplication; (iv) suppression of host defense mechanisms; and to point out similarities and differences between animal and plant infections. PMID:25653644
Salmonella in beef and produce from honduras.
Maradiaga, Martha; Miller, Mark F; Thompson, Leslie; Pond, Ansen; Gragg, Sara E; Echeverry, Alejandro; Garcia, Lyda G; Loneragan, Guy H; Brashears, Mindy M
2015-03-01
Salmonella continues to cause a considerable number of foodborne illnesses worldwide. The sources of outbreaks include contaminated meat and produce. The purpose of this study was to establish an initial investigation of the burden of Salmonella in produce and beef from Honduras by sampling retail markets and abattoirs. Retail produce samples (cantaloupes, cilantro, cucumbers, leafy greens, peppers, and tomatoes; n = 573) were purchased in three major cities of Honduras, and retail whole-muscle beef (n = 555) samples were also purchased in four major cities. Additionally, both hide and beef carcass (n = 141) samples were collected from two Honduran abattoirs. Whole-muscle beef samples were obtained using a sponge hydrated with buffered peptone water, and 10 ml of the buffered peptone water rinsate of each produce sample was collected with a dry sponge and placed in a bag to be transported back to the United States. Salmonella was detected using a commercially available, closeplatform PCR system, and positive samples were subjected to culture on selective media to obtain isolates. Overall, the prevalence of Salmonella-positive samples, based on PCR detection in Honduras (n = 555) retail beef was 10.1% (95% confidence interval = 7.8, 12.9), whereas 7.8% (n = 141) of beef carcass and hides samples were positive in both beef plants. The overall Salmonella prevalence for all produce samples (n = 573) collected was 2.1% (95% confidence interval = 1.2, 3.6). The most common serotypes identified in Honduras were Salmonella Typhimurium followed by Derby. These results provide an indication of Salmonella contamination of beef and produce in Honduras. Developing a Salmonella baseline for Latin America through an initial investigation like the one presented here contributes to a broader global understanding of the potential exposure through food, thus providing insight into the needs for control strategies.
Directory of Open Access Journals (Sweden)
Rodrigues IBBE
2017-10-01
Full Text Available This study investigated the resistance of various Salmonella strains to beta-lactam antibiotics. Salmonella Minnesota (36 strains and Salmonella Heidelberg (24 strains were isolated from broiler chickens and carcasses by the Disk Diffusion Test and resistance genes blaCTX-M-8, blaACC-1 and blaCMY-2 were detected by PCR. Of the 60 strains tested, 80% were resistant to at least one antibiotic. Specifically, 66.7% were resistant to amoxicillin/clavulanic acid and 75% were resistant to cefotaxime. Among the amoxicillin/clavulanic acid resistant strains, the blaCMY-2 gene was detected in 40%, blaACC-1 in 37.5% and blaCTX-M-8 in 7.5%. Among the cefotaxime resistant strains, we detected the genes blaCTX-M-8 in 13.3%, blaACC-1 in 33.3%, and blaCMY-2 in 31.1%. The presence of cefotaxime- and amoxicillin/clavulanic acid-resistant Salmonella in poultry, and the prevalence of extended spectrum betalactamases and AmpC-betalactamases in these strains are of huge concern to public health and economy.
Salmonella enterica Induces And Subverts The Plant Immune System
Directory of Open Access Journals (Sweden)
Ana Victoria Garcia
2014-04-01
Full Text Available Infections with Salmonella enterica belong to the most prominent causes of food poisoning and infected fruits and vegetables represent important vectors for salmonellosis. Whereas it was shown that plants raise defense responses against Salmonella, these bacteria persist and proliferate in various plant tissues. Recent reports shed light into the molecular interaction between plants and Salmonella, highlighting the defense pathways induced and the means used by the bacteria to escape the plant immune system and accomplish colonization. It was recently shown that plants detect Salmonella pathogen-associated molecular patterns (PAMPs, such as the flagellin peptide flg22, and activate hallmarks of the defense program known as PAMP-triggered immunity (PTI. Interestingly, certain Salmonella strains carry mutations in the flg22 domain triggering PTI, suggesting that a strategy of Salmonella is to escape plant detection by mutating PAMP motifs. Another strategy may rely on the type III secretion system (T3SS as T3SS mutants were found to induce stronger plant defense responses than wild type bacteria. Although Salmonella effector delivery into plant cells has not been shown, expression of Salmonella effectors in plant tissues shows that these bacteria also possess powerful means to manipulate the plant immune system. Altogether, the data gathered suggest that Salmonella triggers PTI in plants and evolved strategies to avoid or subvert plant immunity.
Salmonella enterica induces and subverts the plant immune system
García, Ana V.
2014-04-04
Infections with Salmonella enterica belong to the most prominent causes of food poisoning and infected fruits and vegetables represent important vectors for salmonellosis. Although it was shown that plants raise defense responses against Salmonella, these bacteria persist and proliferate in various plant tissues. Recent reports shed light into the molecular interaction between plants and Salmonella, highlighting the defense pathways induced and the means used by the bacteria to escape the plant immune system and accomplish colonization. It was recently shown that plants detect Salmonella pathogen-associated molecular patterns (PAMPs), such as the flagellin peptide flg22, and activate hallmarks of the defense program known as PAMP-triggered immunity (PTI). Interestingly, certain Salmonella strains carry mutations in the flg22 domain triggering PTI, suggesting that a strategy of Salmonella is to escape plant detection by mutating PAMP motifs. Another strategy may rely on the type III secretion system (T3SS) as T3SS mutants were found to induce stronger plant defense responses than wild type bacteria. Although Salmonella effector delivery into plant cells has not been shown, expression of Salmonella effectors in plant tissues shows that these bacteria also possess powerful means to manipulate the plant immune system. Altogether, these data suggest that Salmonella triggers PTI in plants and evolved strategies to avoid or subvert plant immunity. 2014 Garca and Hirt.
Multiple antimicrobial resistance of Escherichia coli and Salmonella ...
African Journals Online (AJOL)
Presumptive isolates were subjected to antimicrobial susceptibility testing using 13 panels of antibiotics for both E. coli and Salmonella spp. Results showed that the overall isolation rate of Salmonella spp. was 12 (11.4%), broiler chickens had higher isolation rate 9 (12.0%) of Salmonella than local chickens. However, the ...
Diversity of Salmonella isolates from central Florida surface waters.
McEgan, Rachel; Chandler, Jeffrey C; Goodridge, Lawrence D; Danyluk, Michelle D
2014-11-01
Identification of Salmonella serotypes is important for understanding the environmental diversity of the genus Salmonella. This study evaluates the diversity of Salmonella isolates recovered from 165 of 202 Central Florida surface water samples and investigates whether the serotype of the environmental Salmonella isolates can be predicted by a previously published multiplex PCR assay (S. Kim, J. G. Frye, J. Hu, P. J. Fedorka-Cray, R. Gautom, and D. S. Boyle, J. Clin. Microbiol. 44:3608-3615, 2006, http://dx.doi.org/10.1128/JCM.00701-06). Multiplex PCR was performed on 562 Salmonella isolates (as many as 36 isolates per water sample) to predict serotypes. Kauffmann-White serogrouping was used to confirm multiplex PCR pattern groupings before isolates were serotyped, analyzed by pulsed-field gel electrophoresis, and assayed for antimicrobial susceptibility. In 41.2% of the Salmonella-positive water samples, all Salmonella isolates had identical multiplex PCR patterns; in the remaining 58.8%, two or more multiplex PCR patterns were identified. Within each sample, isolates with matching multiplex PCR patterns had matching serogroups. The multiplex patterns of 495 isolates (88.1%) did not match any previously reported pattern. The remaining 68 isolates matched reported patterns but did not match the serotypes for those patterns. The use of the multiplex PCR allowed the number of isolates requiring further analysis to be reduced to 223. Thirty-three Salmonella enterica serotypes were identified; the most frequent included serotypes Muenchen, Rubislaw, Anatum, Gaminara, and IV_50:z4,z23:-. A majority (141/223) of Salmonella isolates clustered into one genotypic group. Salmonella isolates in Central Florida surface waters are serotypically, genotypically, and phenotypically (in terms of antimicrobial susceptibility) diverse. While isolates could be grouped as different or potentially the same using multiplex PCR, the multiplex PCR pattern did not predict the Salmonella
DEFF Research Database (Denmark)
Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk
2013-01-01
to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...
Web-based surveillance and global Salmonella distribution, 2000-2002
DEFF Research Database (Denmark)
Galanis, E.; Wong, Danilo Lo Fo; Patrick, M.E.
2006-01-01
Salmonellae are a common cause of foodborne disease worldwide. The World Health Organization (WHO) supports international foodborne disease surveillance through WHO Global Salm-Surv and other activities. WHO Global Salm-Surv members annually report the 15 most frequently isolated Salmonella...... serotypes to a Web-based country databank. We describe the global distribution of reported Salmonella serotypes from human and nonhuman sources from 2000 to 2002. Among human isolates, Salmonella enterica serovar Enteritidis was the most common serotype, accounting for 65% of all isolates. Among nonhuman...... professionals to explore hypotheses related to the sources and distribution of salmonellae worldwide....
Inactivation of Salmonellae in Frozen Catfish by Gamma Irradiation
International Nuclear Information System (INIS)
Nouchpramoon, Kovit; Amsiri, Jarurat
2003-06-01
The effect of gamma irradiation on salmonellae viability in frozen catfish was investigated using fresh cut of catfish artificially contaminated with stationary phase cells of salmonellae, frozen at-18 οC and irradiated with does ranging from 0.0 to 2.4 kGy. The D 10 values for ten serovars of salmonellae ranged from 0.47 to 0.77 kGy. Salmonella Enteritidis was the most resistant serovars found in frozen catfish. Dosage at 2.5 kGy would be sufficient to kill 10 3 . 2 Salmonella Enteritidis that may occasionally present in frozen catfish
Directory of Open Access Journals (Sweden)
Thomas R. Connor
2016-08-01
Full Text Available For 100 years, it has been obvious that Salmonella enterica strains sharing the serotype with the formula 1,4,[5],12:b:1,2—now known as Paratyphi B—can cause diseases ranging from serious systemic infections to self-limiting gastroenteritis. Despite considerable predicted diversity between strains carrying the common Paratyphi B serotype, there remain few methods that subdivide the group into groups that are congruent with their disease phenotypes. Paratyphi B therefore represents one of the canonical examples in Salmonella where serotyping combined with classical microbiological tests fails to provide clinically informative information. Here, we use genomics to provide the first high-resolution view of this serotype, placing it into a wider genomic context of the Salmonella enterica species. These analyses reveal why it has been impossible to subdivide this serotype based upon phenotypic and limited molecular approaches. By examining the genomic data in detail, we are able to identify common features that correlate with strains of clinical importance. The results presented here provide new diagnostic targets, as well as posing important new questions about the basis for the invasive disease phenotype observed in a subset of strains.
RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants.
Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong
2017-07-01
Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.
Sequence variations in the FAD2 gene in seeded pumpkins.
Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P
2015-12-21
Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.
Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays
DEFF Research Database (Denmark)
Dobrowolska, G; Boldyreff, B; Issinger, O G
1991-01-01
The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....
Diaz Serrano, Madeline
Waterborne and foodborne diseases are one of the principal public health problems worldwide. Microorganisms are the major agents of foodborne illness: pathogens such as Salmonella, Campylobacter jejuni and Escherichia coli, and parasites such as cryptosporidium. The most popular methods to detect Salmonella are based on culture and colony counting methods, ELISA, Gel electrophoresis and the polymerase chain reaction. Conventional detection methods are laborious and time-consuming, allowing for portions of the food to be distributed, marketed, sold and eaten before the analysis is done and the problem even detected. By these reasons, the rapid, easy and portable detection of foodborne organisms will facilitate the disease treatment. Our particular interest is to develop a nucleic acid biosensor (NAB) for the detection of pathogenic microorganisms in food and water samples. In this research, we report on the development of a NAB prototype using a polymer modified electrode surface together with sequences of different lengths for the OmpC gene from Salmonella as probes and Ferrocene-labeled target (Fc-ssDNA), Ferrocene-labeled tri(ethylene glycol) (Fc-PEG) and Ruthenium-Ferrocene (Ru-Fe) bimetallic complex as an electrochemical labels. We have optimized several PS films and anchored nucleic acid sequences with different lengths at gold and carbon surfaces. Non contact mode AFM and XPS were used to monitor each step of the NAB preparation, from polymer modification to oligos hybridization (conventional design). The hybridization reaction was followed electrochemically using a Fc-ssDNA and Fc-PEG in solution taking advantage of the morphological changes generated upon hybridization. We observed a small current at the potential for the Fe oxidation without signal amplification at +296 mV vs. Ag/AgCl for the Fc-ssDNA strategy and a small current at +524 mV for the Fc-PEG strategy. The immobilization, hybridization and signal amplification of Biotin- OmpC Salmonella genes
Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi
2015-01-01
The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
Transcriptomic analysis of Salmonella desiccation resistance.
Li, Haiping; Bhaskara, Anuhya; Megalis, Christina; Tortorello, Mary Lou
2012-12-01
The survival of Salmonella in low moisture foods and processing environments remains a great challenge for the food industry and public health. To explore the mechanisms of Salmonella desiccation resistance, we studied the transcriptomic responses in Salmonella Tennessee (Tennessee), using Salmonella Typhimurium LT2 (LT2), a strain weakly resistant to desiccation, as a reference strain. In response to 2 h of air-drying at 11% equilibrated relative humidity, approximately one-fourth of the open reading frames (ORFs) in the Tennessee genome and one-fifth in LT2 were differentially expressed (>2-fold). Among all differentially expressed functional groups (>5-fold) in both strains, the expression fold change associated with fatty acid metabolism was the highest, and constituted 51% and 35% of the total expression fold change in Tennessee and LT2, respectively. Tennessee showed greater changes in expression of genes associated with stress response and envelope modification than LT2, while showing lesser changes in protein biosynthesis expression. Expression of flagella genes was significantly more inhibited in stationary phase cells of Tennessee than LT2 both before and after desiccation. The accumulation of the osmolyte trehalose was significantly induced by desiccation in Tennessee, but no increase was detectable in LT2, which is consistent with the expression patterns of the entire trehalose biosynthesis and degradation pathways in both strains. Results from this study present a global view of the dynamic desiccation responses in Salmonella, which will guide future research efforts to control Salmonella in low moisture environments.
Salmonella Typhimurium transcription profiles in space flight
National Aeronautics and Space Administration — Salmonella transcription profiles were obtained from samples flown on space shuttle mission STS-115 and compared to profiles from Salmonella grown under identical...
antimicrobial susceptibility pattern of Salmonella species
African Journals Online (AJOL)
user
ABSTRACT. Treatment of enteric fever is increasingly becoming very challenging due to the increasing wave of antibiotic resistance. This study is a review of the contemporary antimicrobial susceptibility pattern of. Salmonella species. The antimicrobial susceptibility pattern of Salmonella species to a wide range of.
Kuijpers AFA; Mooijman KA; VDL; Z&O
2018-01-01
In 2016, it was shown that all 34 National Reference Laboratories (NRLs), 30 of which are located in the European Union, were able to detect high and low levels of Salmonella in minced chicken meat. Three NRLs reported Salmonella in one 'blank' minced meat sample. This was probably caused by the
PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates
Directory of Open Access Journals (Sweden)
Zohreh Ebrahimvandi
2014-07-01
Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Adaptation and Preadaptation of Salmonella enterica to Bile
Hernández, Sara B.; Cota, Ignacio; Ducret, Adrien; Aussel, Laurent; Casadesús, Josep
2012-01-01
Bile possesses antibacterial activity because bile salts disrupt membranes, denature proteins, and damage DNA. This study describes mechanisms employed by the bacterium Salmonella enterica to survive bile. Sublethal concentrations of the bile salt sodium deoxycholate (DOC) adapt Salmonella to survive lethal concentrations of bile. Adaptation seems to be associated to multiple changes in gene expression, which include upregulation of the RpoS-dependent general stress response and other stress responses. The crucial role of the general stress response in adaptation to bile is supported by the observation that RpoS− mutants are bile-sensitive. While adaptation to bile involves a response by the bacterial population, individual cells can become bile-resistant without adaptation: plating of a non-adapted S. enterica culture on medium containing a lethal concentration of bile yields bile-resistant colonies at frequencies between 10−6 and 10−7 per cell and generation. Fluctuation analysis indicates that such colonies derive from bile-resistant cells present in the previous culture. A fraction of such isolates are stable, indicating that bile resistance can be acquired by mutation. Full genome sequencing of bile-resistant mutants shows that alteration of the lipopolysaccharide transport machinery is a frequent cause of mutational bile resistance. However, selection on lethal concentrations of bile also provides bile-resistant isolates that are not mutants. We propose that such isolates derive from rare cells whose physiological state permitted survival upon encountering bile. This view is supported by single cell analysis of gene expression using a microscope fluidic system: batch cultures of Salmonella contain cells that activate stress response genes in the absence of DOC. This phenomenon underscores the existence of phenotypic heterogeneity in clonal populations of bacteria and may illustrate the adaptive value of gene expression fluctuations. PMID:22275872
Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.
Directory of Open Access Journals (Sweden)
Carine Makendi
2016-02-01
Full Text Available Salmonella enterica serovar Weltevreden (S. Weltevreden is an emerging cause of diarrheal and invasive disease in humans residing in tropical regions. Despite the regional and international emergence of this Salmonella serovar, relatively little is known about its genetic diversity, genomics or virulence potential in model systems. Here we used whole genome sequencing and bioinformatics analyses to define the phylogenetic structure of a diverse global selection of S. Weltevreden. Phylogenetic analysis of more than 100 isolates demonstrated that the population of S. Weltevreden can be segregated into two main phylogenetic clusters, one associated predominantly with continental Southeast Asia and the other more internationally dispersed. Subcluster analysis suggested the local evolution of S. Weltevreden within specific geographical regions. Four of the isolates were sequenced using long read sequencing to produce high quality reference genomes. Phenotypic analysis in Hep-2 cells and in a murine infection model indicated that S. Weltevreden were significantly attenuated in these models compared to the classical S. Typhimurium reference strain SL1344. Our work outlines novel insights into this important emerging pathogen and provides a baseline understanding for future research studies.
Directory of Open Access Journals (Sweden)
Manju Soman
2018-04-01
Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.
Stably Integrated luxCDABE for Assessment of Salmonella Invasion Kinetics
Directory of Open Access Journals (Sweden)
Kelly N. Flentie
2008-09-01
Full Text Available Salmonella Typhimurium is a common cause of gastroenteritis in humans and also localizes to neoplastic tumors in animals. Invasion of specific eukaryotic cells is a key mechanism of Salmonella interactions with host tissues. Early stages of gastrointestinal cell invasion are mediated by a Salmonella type III secretion system, powered by the adenosine triphosphatase invC. The aim of this work was to characterize the invC dependence of invasion kinetics into disparate eukaryotic cells traditionally used as models of gut epithelium or neoplasms. Thus, a nondestructive real-time assay was developed to report eukaryotic cell invasion kinetics using lux+ Salmonella that contain chromosomally integrated luxCDABE genes. Bioluminescence-based invasion assays using lux+ Salmonella exhibited inoculum dose-response correlation, distinguished invasion-competent from invasion-incompetent Salmonella, and discriminated relative Salmonella invasiveness in accordance with environmental conditions that induce invasion gene expression. In standard gentamicin protection assays, bioluminescence from lux+ Salmonella correlated with recovery of colony-forming units of internalized bacteria and could be visualized by bioluminescence microscopy. Furthermore, this assay distinguished invasion-competent from invasion-incompetent bacteria independent of gentamicin treatment in real time. Bioluminescence reported Salmonella invasion of disparate eukaryotic cell lines, including neoplastic melanoma, colon adenocarcinoma, and glioma cell lines used in animal models of malignancy. In each case, Salmonella invasion of eukaryotic cells was invC dependent.
Septic arthritis of the ankle due to Salmonella enteritidis.
LENUS (Irish Health Repository)
Dineen, Patrick F
2011-06-01
Salmonella septic arthritis in healthy, immunocompetent patients is extremely rare. We present the case of a 70-year-old man who presented with a one-day history of painful swelling of his ankle from which was aspirated pus which subsequently grew Salmonella enteritidis. There was no history of trauma or symptoms consistent with Salmonella enterocolitis. Our patient recovered fully after two weeks on intravenous ceftriaxone and six weeks on oral ciprofloxacin. Salmonella is a notifiable disease in the European Union and the United States of America, and is associated with outbreaks as a result of food contamination. The nature of Salmonella arthritis and its appropriate management are outlined.
MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2016-03-01
Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.
African Journals Online (AJOL)
DR. AMINU
... of Salmonella species serotypes in relation to age and sex among children, ..... However, most antimicrobials show sufficient selective toxicity to be of value in ... salmonellosis should be given good attention (Barrow et al., 2007). To reduce ...
Fernandes, Sueli Aparecida; Camargo, Carlos Henrique; Francisco, Gabriela Rodrigues; Bueno, Maria Fernanda Campagnari; Garcia, Doroti Oliveira; Doi, Yohei; Casas, Monique Ribeiro Tiba
2017-07-01
We characterized extended-spectrum β-lactamases (ESBL) enzymes among Salmonella strains isolated in Brazil from 2009 to 2014. Salmonella recovered from both clinical and nonhuman (food, poultry, and environment) sources were subjected to antimicrobial susceptibility testing. β-lactamases genes were detected by polymerase chain reaction/sequencing; plasmid profiles and transferability were assessed by S1-pulsed field gel electrophoresis (PFGE). Genetic diversity was evaluated by XbaI-PFGE. Out of 630 Salmonella strains screened, 46 displayed ESBL phenotype, distributed across 11 different serotypes. bla CTX-M-8 and bla CTX-M-2 genes were detected at frequencies of 47% and 41%, respectively. bla SHV-5 and bla SHV-2 were also detected but in lower frequencies (4%, 2%). bla TEM-1 gene was detected in 22% of the strains. Most of the ESBL genes were transferable by conjugation, and the respective bla ESBL gene was detected in the recipient strain, indicating the location of ESBL determinants on transferable plasmids. XbaI-PFGE revealed genomic diversity of Salmonella Typhimurium bearing bla CTX-M-2 , bla CTX-M-8 , bla TEM-1 , and bla SHV-2 genes. Salmonella Muenchen (harboring bla CTX-M-2 ) and Salmonella Corvallis (bla CTX-M-8 and bla SHV-5 ) showed clonal relatedness within respective serotypes. Our findings underscore the occurrence of diverse ESBL genes in several Salmonella serotypes, reinforcing the need for continuous surveillance of resistance genes circulating in human and nonhuman sources.
Anaerobiosis induced virulence of Salmonella typhi
DEFF Research Database (Denmark)
Kapoor, Sarika; Singh, R D; Sharma, P C
2002-01-01
, we examined the effect of anaerobiosis on the virulence of Salmonella Typhi, a Gram negative bacteria which invades through the gut mucosa and is responsible for typhoid fever. METHODS: Salmonella Typhi (ty2) was cultured in aerobic and anaerobic conditions to compare its virulence by rabbit ileal...